#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AAK1	22848	genome.wustl.edu	37	2	69732700	69732700	+	Splice_Site	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:69732700C>T	ENST00000409085.4	-	16	2646		c.e16+1		AAK1_ENST00000409068.1_Intron|AAK1_ENST00000406297.3_Splice_Site	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1						endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						GCCATACTAACCAGTTCCAGC	0.463																																																	0													75.0	73.0	74.0					2																	69732700		1899	4127	6026	SO:0001630	splice_region_variant	0			AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.2269+1G>A	2.37:g.69732700C>T			Q4ZFZ3|Q53RX6|Q9UPV4	Splice_Site	SNP	-	e15+1	ENST00000409085.4	37	c.2269+1	CCDS1893.2	2	.	.	.	.	.	.	.	.	.	.	C	19.87	3.907465	0.72868	.	.	ENSG00000115977	ENST00000409085;ENST00000406297	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.3583	0.90365	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	AAK1	69586204	1.000000	0.71417	0.999000	0.59377	0.808000	0.45660	5.089000	0.64492	2.675000	0.91044	0.655000	0.94253	.	AAK1	-	-	ENSG00000115977		0.463	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAK1	HGNC	protein_coding	OTTHUMT00000251847.4		0.00	31	0	C	NM_014911	Intron	69732700	-1			no_errors	ENST00000409085	ensembl	human	known	74_37	splice_site	14.29	18	3	SNP	1.000	T
ABCA12	26154	genome.wustl.edu	37	2	215940284	215940284	+	Intron	DEL	A	A	-			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:215940284delA	ENST00000272895.7	-	3	383				ABCA12_ENST00000412081.1_Frame_Shift_Del_p.S74fs	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12						cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		tttatGCAGGAAAAAAAAAAA	0.373																																					Ovarian(66;664 1488 5121 34295)												0																																										SO:0001627	intron_variant	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.164-11342T>-	2.37:g.215940284delA			Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Frame_Shift_Del	DEL	NULL	p.S74fs	ENST00000272895.7	37	c.220	CCDS33372.1	2																																																																																			ABCA12	-	NULL	ENSG00000144452		0.373	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1		0.00	16	0	A	NM_173076		215940284	-1	tier1		no_errors	ENST00000412081	ensembl	human	novel	74_37	frame_shift_del	20.59	27	7	DEL	0.082	-
ABCA12	26154	genome.wustl.edu	37	2	215802332	215802332	+	Silent	SNP	G	G	T	rs199503269		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:215802332G>T	ENST00000272895.7	-	51	7663	c.7444C>A	c.(7444-7446)Cga>Aga	p.R2482R	AC072062.1_ENST00000607412.1_RNA|ABCA12_ENST00000389661.4_Silent_p.R2164R	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2482	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		GTAAATCCTCGTCCAAACCTA	0.368																																					Ovarian(66;664 1488 5121 34295)												0			GRCh37	CM073950	ABCA12	M							116.0	105.0	109.0					2																	215802332		2203	4300	6503	SO:0001819	synonymous_variant	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.7444C>A	2.37:g.215802332G>T			Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R2482	ENST00000272895.7	37	c.7444	CCDS33372.1	2																																																																																			ABCA12	-	pfscan_ABC_transporter-like	ENSG00000144452		0.368	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1		0.00	16	0	G	NM_173076		215802332	-1			no_errors	ENST00000272895	ensembl	human	known	74_37	silent	7.69	24	2	SNP	1.000	T
ABCF2	10061	genome.wustl.edu	37	7	150915852	150915852	+	Silent	SNP	G	G	T	rs139539137	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:150915852G>T	ENST00000287844.2	-	9	1234	c.1125C>A	c.(1123-1125)gtC>gtA	p.V375V	ABCF2_ENST00000473874.1_5'UTR|ABCF2_ENST00000222388.2_Silent_p.V375V	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	375					transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TATCGCTCACGACCCTCTCTG	0.557																																																	0													134.0	116.0	122.0					7																	150915852		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1125C>A	7.37:g.150915852G>T			O60864|Q75MJ0|Q75MJ1|Q96TE8	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.V375	ENST00000287844.2	37	c.1125	CCDS5923.1	7																																																																																			ABCF2	-	NULL	ENSG00000033050		0.557	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	HGNC	protein_coding	OTTHUMT00000336086.1		0.00	59	0	G	NM_005692		150915852	-1			no_errors	ENST00000222388	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.741	T
ACCS	84680	genome.wustl.edu	37	11	44095008	44095008	+	Silent	SNP	C	C	T	rs373648157		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:44095008C>T	ENST00000263776.8	+	4	794	c.360C>T	c.(358-360)cgC>cgT	p.R120R	ACCS_ENST00000533208.1_3'UTR|ACCS_ENST00000432284.2_Intron|CTD-2609K8.3_ENST00000531268.1_RNA	NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	120					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						TGAGTCAGCGCGACATGCAGA	0.582													C|||	1	0.000199681	0.0	0.0	5008	,	,		19205	0.0		0.0	False		,,,				2504	0.001				Esophageal Squamous(158;148 1889 8077 23160 41213)												0								C	,	0,4406		0,0,2203	94.0	66.0	76.0		360,360	-10.9	0.4	11		76	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous	ACCS	NM_001127219.1,NM_032592.3	,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,	120/502,120/502	44095008	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.360C>T	11.37:g.44095008C>T			B4E219|Q8WUL4|Q96LX5	Silent	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.R120	ENST00000263776.8	37	c.360	CCDS7907.1	11																																																																																			ACCS	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	ENSG00000110455		0.582	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCS	HGNC	protein_coding	OTTHUMT00000389721.1	-	0.00	42	0	C	NM_032592		44095008	+1	tier1	-	no_errors	ENST00000263776	ensembl	human	known	74_37	silent	41.46	24	17	SNP	0.038	T
ACSF2	80221	genome.wustl.edu	37	17	48551099	48551099	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:48551099G>T	ENST00000300441.4	+	13	1653	c.1549G>T	c.(1549-1551)Ggt>Tgt	p.G517C	ACSF2_ENST00000427954.2_Missense_Mutation_p.G542C|ACSF2_ENST00000504392.1_Missense_Mutation_p.G474C|ACSF2_ENST00000502667.1_Missense_Mutation_p.G504C|ACSF2_ENST00000506085.1_3'UTR|ACSF2_ENST00000541920.1_Missense_Mutation_p.G357C	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2	517					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)	p.G517S(1)		endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CATCCGGGGTGGTGAGAACAT	0.567																																																	1	Substitution - Missense(1)	endometrium(1)											120.0	110.0	113.0					17																	48551099		2203	4300	6503	SO:0001583	missense	0			AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.1549G>T	17.37:g.48551099G>T	ENSP00000300441:p.Gly517Cys		B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.G517C	ENST00000300441.4	37	c.1549	CCDS11567.1	17	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735665	0.89482	.	.	ENSG00000167107	ENST00000300441;ENST00000541920;ENST00000504392;ENST00000427954;ENST00000502667	D;D;D;D;D	0.90261	-2.64;-2.64;-2.64;-2.64;-2.64	5.1	5.1	0.69264	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.97742	0.9259	H	0.99391	4.545	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99843	1.1063	10	0.87932	D	0	-11.5077	18.1117	0.89538	0.0:0.0:1.0:0.0	.	504;542;474;517	B4DHT5;B4DFQ6;E9PF16;Q96CM8	.;.;.;ACSF2_HUMAN	C	517;357;474;542;504	ENSP00000300441:G517C;ENSP00000437987:G357C;ENSP00000425964:G474C;ENSP00000401831:G542C;ENSP00000421884:G504C	ENSP00000300441:G517C	G	+	1	0	ACSF2	45906098	1.000000	0.71417	0.747000	0.31113	0.964000	0.63967	6.394000	0.73223	2.368000	0.80403	0.491000	0.48974	GGT	ACSF2	-	pfam_AMP-dep_Synth/Lig	ENSG00000167107		0.567	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF2	HGNC	protein_coding	OTTHUMT00000367423.3		0.00	25	0	G	NM_025149		48551099	+1			no_errors	ENST00000300441	ensembl	human	known	74_37	missense	10.00	18	2	SNP	1.000	T
ADAMTSL2	9719	genome.wustl.edu	37	9	136405772	136405772	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:136405772G>T	ENST00000354484.4	+	6	1022	c.465G>T	c.(463-465)gtG>gtT	p.V155V	ADAMTSL2_ENST00000393060.1_Silent_p.V155V|ADAMTSL2_ENST00000393061.3_Silent_p.V264V	NM_001145320.1	NP_001138792.1	Q86TH1	ATL2_HUMAN	ADAMTS-like 2	155					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(145;9.31e-08)|Epithelial(140;6.62e-07)|all cancers(34;7.74e-06)		GTACCACCGTGGACGGCCAGC	0.582																																																	0													55.0	44.0	48.0					9																	136405772		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011177	CCDS6976.1	9q34.3	2005-01-12			ENSG00000197859	ENSG00000197859			14631	protein-coding gene	gene with protein product		612277				9628581, 14667842	Standard	NM_014694		Approved	KIAA0605	uc004cei.3	Q86TH1	OTTHUMG00000131706	ENST00000354484.4:c.465G>T	9.37:g.136405772G>T			B1B0D5|O60345	Silent	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS	p.V264	ENST00000354484.4	37	c.792	CCDS6976.1	9																																																																																			ADAMTSL2	-	NULL	ENSG00000197859		0.582	ADAMTSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL2	HGNC	protein_coding	OTTHUMT00000254619.1	-	0.00	39	0	G	NM_014694		136405772	+1	tier1	-	no_errors	ENST00000393061	ensembl	human	known	74_37	silent	7.69	48	4	SNP	0.980	T
ADPRHL2	54936	genome.wustl.edu	37	1	36557343	36557343	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:36557343G>T	ENST00000373178.4	+	3	463	c.433G>T	c.(433-435)Ggg>Tgg	p.G145W		NM_017825.2	NP_060295.1	Q9NX46	ARHL2_HUMAN	ADP-ribosylhydrolase like 2	145						mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(ADP-ribose) glycohydrolase activity (GO:0004649)			cervix(1)|endometrium(2)|large_intestine(1)|lung(3)|pancreas(1)	8		Myeloproliferative disorder(586;0.0393)				CCAGTTTAACGGGAAAGGCTC	0.582																																																	0													74.0	76.0	75.0					1																	36557343		2203	4300	6503	SO:0001583	missense	0			AJ427295	CCDS402.1	1p34.3	2008-02-05			ENSG00000116863	ENSG00000116863			21304	protein-coding gene	gene with protein product		610624				12070318, 16278211	Standard	NM_017825		Approved	ARH3, FLJ20446	uc001bzt.3	Q9NX46	OTTHUMG00000007628	ENST00000373178.4:c.433G>T	1.37:g.36557343G>T	ENSP00000362273:p.Gly145Trp		Q53G94|Q6IAB8|Q9BY47	Missense_Mutation	SNP	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1	p.G145W	ENST00000373178.4	37	c.433	CCDS402.1	1	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841302	0.91197	.	.	ENSG00000116863	ENST00000373178;ENST00000540867	T	0.36878	1.23	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.69886	0.3161	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77726	-0.2480	10	0.87932	D	0	-16.5774	19.064	0.93103	0.0:0.0:1.0:0.0	.	145	Q9NX46	ARHL2_HUMAN	W	145;65	ENSP00000362273:G145W	ENSP00000362273:G145W	G	+	1	0	ADPRHL2	36329930	1.000000	0.71417	0.969000	0.41365	0.974000	0.67602	9.845000	0.99498	2.477000	0.83638	0.563000	0.77884	GGG	ADPRHL2	-	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1	ENSG00000116863		0.582	ADPRHL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRHL2	HGNC	protein_coding	OTTHUMT00000020199.1		0.00	27	0	G	NM_017825		36557343	+1			no_errors	ENST00000373178	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
AEBP1	165	genome.wustl.edu	37	7	44149591	44149591	+	Intron	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:44149591C>T	ENST00000223357.3	+	10	1455				AEBP1_ENST00000450684.2_5'Flank|MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000454218.1_3'UTR	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1						cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						AGTGAGCCACCATTCTGGGGT	0.627																																																	0													39.0	31.0	34.0					7																	44149591		2203	4298	6501	SO:0001627	intron_variant	0			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.1151-23C>T	7.37:g.44149591C>T			Q14113|Q59ER7|Q6ZSC7|Q7KZ79	RNA	SNP	-	NULL	ENST00000223357.3	37	NULL	CCDS5476.1	7																																																																																			AEBP1	-	-	ENSG00000106624		0.627	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2	-	0.00	9	0	C	NM_001129		44149591	+1	tier1	-	no_errors	ENST00000454218	ensembl	human	known	74_37	rna	50.00	6	6	SNP	0.001	T
AFTPH	54812	genome.wustl.edu	37	2	64794826	64794826	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:64794826G>T	ENST00000422803.1	+	3	2380	c.2066G>T	c.(2065-2067)aGa>aTa	p.R689I	AFTPH_ENST00000238856.4_Missense_Mutation_p.R689I|AFTPH_ENST00000409933.1_Missense_Mutation_p.R689I|AFTPH_ENST00000238855.7_Missense_Mutation_p.R689I|AFTPH_ENST00000487769.1_Intron|AFTPH_ENST00000409183.1_Missense_Mutation_p.R320I			Q6ULP2	AFTIN_HUMAN	aftiphilin	689					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						ATAAAAACGAGAGAGGCCTTA	0.368																																																	0													88.0	86.0	86.0					2																	64794826		2203	4300	6503	SO:0001583	missense	0			AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.2066G>T	2.37:g.64794826G>T	ENSP00000397726:p.Arg689Ile		D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Missense_Mutation	SNP	NULL	p.R689I	ENST00000422803.1	37	c.2066		2	.	.	.	.	.	.	.	.	.	.	G	20.8	4.043272	0.75732	.	.	ENSG00000119844	ENST00000238856;ENST00000422803;ENST00000238855;ENST00000409933;ENST00000409183	T;T;T;T;T	0.47869	1.81;1.82;1.82;1.82;0.83	5.42	5.42	0.78866	.	0.326036	0.34828	N	0.003649	T	0.53384	0.1793	L	0.59436	1.845	0.51767	D	0.999934	P;P;P;P	0.50617	0.755;0.874;0.467;0.937	B;B;B;P	0.51385	0.295;0.387;0.154;0.668	T	0.55642	-0.8109	10	0.62326	D	0.03	-5.4979	10.7532	0.46221	0.1167:0.0:0.8833:0.0	.	689;689;689;689	Q6ULP2;Q6ULP2-2;Q6ULP2-5;Q6ULP2-4	AFTIN_HUMAN;.;.;.	I	689;689;689;689;320	ENSP00000238856:R689I;ENSP00000397726:R689I;ENSP00000238855:R689I;ENSP00000387071:R689I;ENSP00000386913:R320I	ENSP00000238855:R689I	R	+	2	0	AFTPH	64648330	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	1.099000	0.31013	2.703000	0.92315	0.655000	0.94253	AGA	AFTPH	-	NULL	ENSG00000119844		0.368	AFTPH-202	KNOWN	basic	protein_coding	AFTPH	HGNC	protein_coding			0.00	18	0	G	NM_017657		64794826	+1			no_errors	ENST00000422803	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	T
AIF1	199	genome.wustl.edu	37	6	31583913	31583913	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:31583913G>T	ENST00000376059.3	+	4	333	c.187G>T	c.(187-189)Ggc>Tgc	p.G63C	AIF1_ENST00000376049.4_Missense_Mutation_p.G9C	NM_001623.3	NP_001614.3	P55008	AIF1_HUMAN	allograft inflammatory factor 1	63	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cellular response to interferon-gamma (GO:0071346)|inflammatory response (GO:0006954)|microglial cell activation (GO:0001774)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell proliferation (GO:0048662)|phagocytosis, engulfment (GO:0006911)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of smooth muscle cell chemotaxis (GO:0071673)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell migration (GO:2000406)|positive regulation of T cell proliferation (GO:0042102)|Rac protein signal transduction (GO:0016601)|ruffle assembly (GO:0097178)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|phagocytic cup (GO:0001891)|ruffle membrane (GO:0032587)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)			lung(2)|ovary(1)	3						TAATGGAAATGGCGATATTGG	0.522																																					Ovarian(23;358 734 36938 38933 52312)												0													171.0	166.0	167.0					6																	31583913		1510	2707	4217	SO:0001583	missense	0			U19713	CCDS4706.1, CCDS34398.1	6p21.3	2013-01-10			ENSG00000204472	ENSG00000204472		"""EF-hand domain containing"""	352	protein-coding gene	gene with protein product	"""interferon gamma responsive transcript"", ""ionized calcium-binding adapter molecule 1"""	601833				8912632	Standard	NM_032955		Approved	IRT-1, AIF-1, Em:AF129756.17, IBA1	uc003nuy.3	P55008	OTTHUMG00000031246	ENST00000376059.3:c.187G>T	6.37:g.31583913G>T	ENSP00000365227:p.Gly63Cys		A8K406|O43904|Q9UIV4|Q9UKS9	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.G63C	ENST00000376059.3	37	c.187	CCDS4706.1	6	.	.	.	.	.	.	.	.	.	.	G	18.43	3.621836	0.66787	.	.	ENSG00000204472	ENST00000376059;ENST00000337917;ENST00000376049	T;T;T	0.66995	-0.24;-0.24;-0.24	4.42	4.42	0.53409	EF-hand-like domain (1);	2.361970	0.02467	N	0.087177	D	0.86564	0.5963	M	0.94142	3.5	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.76198	-0.3047	10	0.87932	D	0	-3.6605	14.9259	0.70878	0.0:0.0:1.0:0.0	.	9;63	O43904;P55008	.;AIF1_HUMAN	C	63;77;9	ENSP00000365227:G63C;ENSP00000338776:G77C;ENSP00000365217:G9C	ENSP00000338776:G77C	G	+	1	0	AIF1	31691892	1.000000	0.71417	0.962000	0.40283	0.480000	0.33159	8.433000	0.90291	2.461000	0.83175	0.557000	0.71058	GGC	AIF1	-	pfscan_EF_hand_dom	ENSG00000204472		0.522	AIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIF1	HGNC	protein_coding	OTTHUMT00000076512.3	-	0.00	53	0	G			31583913	+1	tier1	-	no_errors	ENST00000376059	ensembl	human	known	74_37	missense	8.93	51	5	SNP	0.999	T
ALDH8A1	64577	genome.wustl.edu	37	6	135239827	135239827	+	Missense_Mutation	SNP	G	G	A	rs150799987		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:135239827G>A	ENST00000265605.2	-	7	1258	c.1190C>T	c.(1189-1191)aCg>aTg	p.T397M	ALDH8A1_ENST00000367845.2_Missense_Mutation_p.T343M|ALDH8A1_ENST00000367847.2_Missense_Mutation_p.T347M	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	397					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		GACGACACACGTCACTGGACC	0.522																																																	0								G	MET/THR,MET/THR,MET/THR	0,4406		0,0,2203	160.0	120.0	134.0		1040,1190,1028	5.7	1.0	6	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	ALDH8A1	NM_001193480.1,NM_022568.3,NM_170771.2	81,81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	347/438,397/488,343/434	135239827	1,13005	2203	4300	6503	SO:0001583	missense	0			AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.1190C>T	6.37:g.135239827G>A	ENSP00000265605:p.Thr397Met		B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.T397M	ENST00000265605.2	37	c.1190	CCDS5171.1	6	.	.	.	.	.	.	.	.	.	.	G	23.9	4.473088	0.84640	0.0	1.16E-4	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847;ENST00000460753	T;T;T;T	0.75821	-0.97;1.58;-0.97;-0.97	5.72	5.72	0.89469	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.042392	0.85682	D	0.000000	T	0.67767	0.2928	N	0.17345	0.48	0.80722	D	1	D;D;D	0.58970	0.984;0.965;0.972	P;P;P	0.57425	0.82;0.725;0.82	T	0.67998	-0.5525	10	0.33940	T	0.23	.	19.8673	0.96808	0.0:0.0:1.0:0.0	.	347;343;397	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	M	397;343;347;82	ENSP00000265605:T397M;ENSP00000356819:T343M;ENSP00000356821:T347M;ENSP00000437161:T82M	ENSP00000265605:T397M	T	-	2	0	ALDH8A1	135281520	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	6.641000	0.74324	2.698000	0.92095	0.655000	0.94253	ACG	ALDH8A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000118514		0.522	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH8A1	HGNC	protein_coding	OTTHUMT00000042334.2	-	0.00	17	0	G			135239827	-1	tier1	rs150799987	no_errors	ENST00000265605	ensembl	human	known	74_37	missense	45.45	12	10	SNP	1.000	A
ALPK2	115701	genome.wustl.edu	37	18	56203296	56203296	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:56203296C>G	ENST00000361673.3	-	5	4336	c.4123G>C	c.(4123-4125)Gac>Cac	p.D1375H	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1375						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TCCTCCTGGTCTTGACTCACA	0.433																																																	0													103.0	102.0	103.0					18																	56203296		2203	4300	6503	SO:0001583	missense	0			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.4123G>C	18.37:g.56203296C>G	ENSP00000354991:p.Asp1375His		Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like_dom	p.D1375H	ENST00000361673.3	37	c.4123	CCDS11966.2	18	.	.	.	.	.	.	.	.	.	.	c	11.14	1.549679	0.27652	.	.	ENSG00000198796	ENST00000361673	T	0.44083	0.93	5.62	-2.01	0.07410	.	2.121730	0.01773	N	0.031291	T	0.31575	0.0801	N	0.22421	0.69	0.09310	N	1	P;P	0.43094	0.799;0.553	P;B	0.44946	0.465;0.103	T	0.19712	-1.0297	10	0.56958	D	0.05	-1.9872	1.8008	0.03071	0.1448:0.3933:0.145:0.3168	.	1370;1375	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	H	1375	ENSP00000354991:D1375H	ENSP00000354991:D1375H	D	-	1	0	ALPK2	54354276	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.136000	0.10405	-0.040000	0.13580	-0.258000	0.10820	GAC	ALPK2	-	NULL	ENSG00000198796		0.433	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	HGNC	protein_coding	OTTHUMT00000256126.1	-	0.00	18	0	C	NM_052947		56203296	-1	tier1	-	no_errors	ENST00000361673	ensembl	human	known	74_37	missense	35.29	11	6	SNP	0.000	G
ANAPC1	64682	genome.wustl.edu	37	2	112605344	112605344	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:112605344G>T	ENST00000341068.3	-	15	2521	c.1749C>A	c.(1747-1749)taC>taA	p.Y583*		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	583					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						TAGAATGAATGTAAGTTCCAA	0.403																																																	0													86.0	70.0	75.0					2																	112605344		2203	4300	6503	SO:0001587	stop_gained	0			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.1749C>A	2.37:g.112605344G>T	ENSP00000339109:p.Tyr583*		Q2M3H8|Q9BSE6|Q9H8D0	Nonsense_Mutation	SNP	NULL	p.Y583*	ENST00000341068.3	37	c.1749	CCDS2093.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	45|45	11.700809|11.700809	0.99592|0.99592	.|.	.|.	ENSG00000153107|ENSG00000153107	ENST00000427997|ENST00000341068	.|.	.|.	.|.	4.77|4.77	-4.0|-4.0	0.04057|0.04057	.|.	.|0.000000	.|0.41605	.|U	.|0.000846	T|.	0.23210|.	0.0561|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.41716|.	-0.9493|.	3|.	.|0.02654	.|T	.|1	-15.25|-15.25	13.2668|13.2668	0.60139|0.60139	0.6192:0.0:0.3808:0.0|0.6192:0.0:0.3808:0.0	.|.	.|.	.|.	.|.	N|X	118|583	.|.	.|ENSP00000339109:Y583X	H|Y	-|-	1|3	0|2	ANAPC1|ANAPC1	112321815|112321815	0.880000|0.880000	0.30214|0.30214	0.766000|0.766000	0.31476|0.31476	0.951000|0.951000	0.60555|0.60555	-0.048000|-0.048000	0.11944|0.11944	-1.244000|-1.244000	0.02516|0.02516	-0.455000|-0.455000	0.05494|0.05494	CAT|TAC	ANAPC1	-	NULL	ENSG00000153107		0.403	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC1	HGNC	protein_coding	OTTHUMT00000254045.2	-	0.00	74	0	G	NM_022662		112605344	-1	tier1	-	no_errors	ENST00000341068	ensembl	human	known	74_37	nonsense	40.21	58	39	SNP	0.959	T
ANKRD12	23253	genome.wustl.edu	37	18	9258860	9258860	+	Silent	SNP	C	C	T	rs149491789	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:9258860C>T	ENST00000262126.4	+	9	5835	c.5595C>T	c.(5593-5595)gaC>gaT	p.D1865D	ANKRD12_ENST00000400020.3_Silent_p.D1842D|ANKRD12_ENST00000383440.2_Silent_p.D1842D|RP11-888D10.4_ENST00000609701.1_RNA	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1865						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AGTACTATGACGAATATGTAA	0.363																																																	0								C	,,	2,4404	4.2+/-10.8	0,2,2201	95.0	92.0	93.0		5526,5526,5595	4.2	1.0	18	dbSNP_134	93	4,8596	3.7+/-12.6	0,4,4296	no	coding-synonymous,coding-synonymous,coding-synonymous	ANKRD12	NM_001083625.2,NM_001204056.1,NM_015208.4	,,	0,6,6497	TT,TC,CC		0.0465,0.0454,0.0461	,,	1842/2040,1842/2040,1865/2063	9258860	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.5595C>T	18.37:g.9258860C>T			O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D1865	ENST00000262126.4	37	c.5595	CCDS11843.1	18																																																																																			ANKRD12	-	NULL	ENSG00000101745		0.363	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	-	0.00	23	0	C	NM_015208		9258860	+1	tier1	rs149491789	no_errors	ENST00000262126	ensembl	human	known	74_37	silent	66.67	5	10	SNP	1.000	T
ANKRD30BP2	149992	genome.wustl.edu	37	21	14417520	14417520	+	RNA	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr21:14417520A>G	ENST00000507941.1	+	0	132				RNU6-614P_ENST00000384369.1_RNA					ankyrin repeat domain 30B pseudogene 2																		CATAAGGAAAAGAAGTGAGCA	0.294																																																	0																																												0			AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14417520A>G				RNA	SNP	-	NULL	ENST00000507941.1	37	NULL		21																																																																																			ANKRD30BP2	-	-	ENSG00000224309		0.294	ANKRD30BP2-004	KNOWN	basic	processed_transcript	ANKRD30BP2	HGNC	pseudogene	OTTHUMT00000372094.1	-	0.00	92	0	A	NR_026916		14417520	+1	tier1	-	no_errors	ENST00000471407	ensembl	human	known	74_37	rna	23.13	103	31	SNP	0.003	G
ANKRD44	91526	genome.wustl.edu	37	2	197986194	197986194	+	Silent	SNP	G	G	A	rs560770318		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:197986194G>A	ENST00000328737.2	-	8	769	c.693C>T	c.(691-693)aaC>aaT	p.N231N	ANKRD44_ENST00000409919.1_Silent_p.N256N|ANKRD44_ENST00000337207.5_Silent_p.N231N|ANKRD44_ENST00000539527.1_Silent_p.N184N|ANKRD44_ENST00000282272.8_Silent_p.N248N|ANKRD44_ENST00000409153.1_Silent_p.N256N|ANKRD44_ENST00000450567.1_Silent_p.N231N			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	256										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CAATCAACTCGTTAACCACAG	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		21796	0.0		0.001	False		,,,				2504	0.0																0													202.0	148.0	166.0					2																	197986194		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.693C>T	2.37:g.197986194G>A			Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.N231	ENST00000328737.2	37	c.693		2																																																																																			ANKRD44	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000065413		0.463	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	ANKRD44	HGNC	protein_coding	OTTHUMT00000335113.1	-	0.00	18	0	G	NM_153697		197986194	-1	tier1	-	no_errors	ENST00000328737	ensembl	human	known	74_37	silent	53.57	13	15	SNP	0.039	A
AOC1	26	genome.wustl.edu	37	7	150556093	150556093	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:150556093C>T	ENST00000493429.1	+	5	2397	c.1813C>T	c.(1813-1815)Ctg>Ttg	p.L605L	AOC1_ENST00000360937.4_Silent_p.L605L|AOC1_ENST00000416793.2_Silent_p.L605L|AOC1_ENST00000467291.1_Silent_p.L605L|AOC1_ENST00000480582.1_3'UTR			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	605					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)	p.L605M(2)								Amiloride(DB00594)	CGACCAGGTGCTGCCCCCAGG	0.652																																																	2	Substitution - Missense(2)	lung(2)											11.0	12.0	12.0					7																	150556093		1924	4115	6039	SO:0001819	synonymous_variant	0			AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.1813C>T	7.37:g.150556093C>T			C9J690|Q16683|Q16684|Q56II4|Q6GU42	Silent	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N2,pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.L605	ENST00000493429.1	37	c.1813	CCDS43679.1	7																																																																																			AOC1	-	pfam_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_C	ENSG00000002726		0.652	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AOC1	HGNC	protein_coding	OTTHUMT00000350628.1		0.00	41	0	C	NM_001091		150556093	+1			no_errors	ENST00000416793	ensembl	human	known	74_37	silent	6.00	47	3	SNP	1.000	T
AP5S1	55317	genome.wustl.edu	37	20	3804698	3804698	+	Silent	SNP	G	G	T	rs545414217		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr20:3804698G>T	ENST00000246041.2	+	3	576	c.357G>T	c.(355-357)tcG>tcT	p.S119S	AP5S1_ENST00000379573.2_3'UTR|AP5S1_ENST00000379567.2_Silent_p.S119S			Q9NUS5	AP5S1_HUMAN	adaptor-related protein complex 5, sigma 1 subunit	119					double-strand break repair via homologous recombination (GO:0000724)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)											GCGTGCTCTCGTTAGGCTTTG	0.662																																																	0													99.0	69.0	80.0					20																	3804698		2203	4300	6503	SO:0001819	synonymous_variant	0			AK002030	CCDS13070.1	20p13	2012-02-27	2012-02-27	2012-02-27	ENSG00000125843	ENSG00000125843			15875	protein-coding gene	gene with protein product		614824	"""chromosome 20 open reading frame 29"""	C20orf29		11780052, 22022230	Standard	NM_001204446		Approved	FLJ11168	uc002wjs.2	Q9NUS5	OTTHUMG00000031760	ENST00000246041.2:c.357G>T	20.37:g.3804698G>T			B3KSD0|D3DVY7	Silent	SNP	NULL	p.S119	ENST00000246041.2	37	c.357	CCDS13070.1	20																																																																																			AP5S1	-	NULL	ENSG00000125843		0.662	AP5S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5S1	HGNC	protein_coding	OTTHUMT00000077768.2	-	0.00	57	0	G	NM_018347		3804698	+1	tier1	-	no_errors	ENST00000246041	ensembl	human	known	74_37	silent	32.73	37	18	SNP	0.001	T
APBA3	9546	genome.wustl.edu	37	19	3752887	3752887	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:3752887C>T	ENST00000316757.3	-	7	1313	c.1113G>A	c.(1111-1113)ccG>ccA	p.P371P	AC005954.4_ENST00000586503.1_RNA|AC005954.3_ENST00000591962.1_RNA	NM_004886.3	NP_004877.1	O96018	APBA3_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 3	371	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				in utero embryonic development (GO:0001701)|negative regulation of catalytic activity (GO:0043086)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	perinuclear region of cytoplasm (GO:0048471)	beta-amyloid binding (GO:0001540)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)			endometrium(1)|large_intestine(1)|skin(1)	3		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00467)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCCTGGGCTCGGGTGCACGC	0.667																																																	0													38.0	43.0	41.0					19																	3752887		2202	4299	6501	SO:0001819	synonymous_variant	0			AB021638	CCDS12110.1	19p13.3	2008-07-18	2008-07-18			ENSG00000011132			580	protein-coding gene	gene with protein product	"""X11-like 2"""	604262				10049767	Standard	NM_004886		Approved	X11L2, mint3	uc002lyp.1	O96018		ENST00000316757.3:c.1113G>A	19.37:g.3752887C>T			O60483|Q9UPZ2	Silent	SNP	pfam_PTB/PI_dom,pfam_PDZ,superfamily_PDZ,smart_PTB/PI_dom,smart_PDZ,pfscan_PDZ,pfscan_PTB/PI_dom	p.P371	ENST00000316757.3	37	c.1113	CCDS12110.1	19																																																																																			APBA3	-	NULL	ENSG00000011132		0.667	APBA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA3	HGNC	protein_coding	OTTHUMT00000453634.2	-	0.00	40	0	C			3752887	-1	tier1	-	no_errors	ENST00000316757	ensembl	human	known	74_37	silent	34.09	29	15	SNP	0.009	T
APLNR	187	genome.wustl.edu	37	11	57003456	57003456	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:57003456C>A	ENST00000606794.1	-	1	1219	c.1023G>T	c.(1021-1023)gaG>gaT	p.E341D		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	341					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						TGGCTGACTTCTCCCCACTGC	0.637																																																	0													54.0	45.0	48.0					11																	57003456		2201	4296	6497	SO:0001583	missense	0			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.1023G>T	11.37:g.57003456C>A	ENSP00000475344:p.Glu341Asp			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM,prints_APJ_rcpt,prints_GPCR_Rhodpsn,prints_ATII_rcpt	p.E341D	ENST00000606794.1	37	c.1023	CCDS7950.1	11	.	.	.	.	.	.	.	.	.	.	C	8.340	0.828547	0.16749	.	.	ENSG00000134817	ENST00000257254;ENST00000326830;ENST00000444275	T	0.37584	1.19	5.46	1.22	0.21188	Apelin receptor, C-terminal (1);	0.527072	0.18001	N	0.154912	T	0.20007	0.0481	N	0.08118	0	0.30331	N	0.786663	B	0.02656	0.0	B	0.04013	0.001	T	0.09228	-1.0684	10	0.14252	T	0.57	-14.1665	18.1304	0.89599	0.0:0.4129:0.5871:0.0	.	341	P35414	APJ_HUMAN	D	341;222;260	ENSP00000257254:E341D	ENSP00000257254:E341D	E	-	3	2	APLNR	56760032	0.997000	0.39634	0.998000	0.56505	0.994000	0.84299	0.366000	0.20365	-0.026000	0.13895	0.655000	0.94253	GAG	APLNR	-	NULL	ENSG00000134817		0.637	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	APLNR	HGNC	protein_coding	OTTHUMT00000470575.1	-	0.00	45	0	C	NM_005161		57003456	-1	tier1	-	no_errors	ENST00000257254	ensembl	human	known	74_37	missense	27.50	29	11	SNP	0.999	A
ARAF	369	genome.wustl.edu	37	X	47426460	47426460	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:47426460A>C	ENST00000377045.4	+	9	997	c.803A>C	c.(802-804)aAg>aCg	p.K268T	ARAF_ENST00000290277.6_3'UTR	NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	268					cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	TCGGGGAGGAAGTCCCCACAT	0.612																																																	0													34.0	32.0	33.0					X																	47426460		2203	4300	6503	SO:0001583	missense	0			X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.803A>C	X.37:g.47426460A>C	ENSP00000366244:p.Lys268Thr		P07557|Q5H9B2|Q5H9B3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd	p.K268T	ENST00000377045.4	37	c.803	CCDS35232.1	X	.	.	.	.	.	.	.	.	.	.	a	13.85	2.359393	0.41801	.	.	ENSG00000078061	ENST00000377045	T	0.74737	-0.87	5.64	5.64	0.86602	.	0.527843	0.21734	N	0.069935	T	0.63414	0.2509	L	0.48362	1.52	0.80722	D	1	P;B	0.37864	0.61;0.029	B;B	0.29353	0.101;0.017	T	0.63812	-0.6552	10	0.35671	T	0.21	.	11.0737	0.48019	1.0:0.0:0.0:0.0	.	268;134	P10398;B4DV85	ARAF_HUMAN;.	T	268	ENSP00000366244:K268T	ENSP00000366244:K268T	K	+	2	0	ARAF	47311404	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.197000	0.42696	1.886000	0.54624	0.341000	0.21757	AAG	ARAF	-	NULL	ENSG00000078061		0.612	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ARAF	HGNC	protein_coding	OTTHUMT00000056418.1	-	0.00	33	0	A			47426460	+1	tier1	-	no_errors	ENST00000377045	ensembl	human	known	74_37	missense	53.12	15	17	SNP	1.000	C
ARAP1	116985	genome.wustl.edu	37	11	72422123	72422123	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:72422123G>T	ENST00000393609.3	-	9	1358	c.1156C>A	c.(1156-1158)Cag>Aag	p.Q386K	ARAP1_ENST00000426523.1_Missense_Mutation_p.Q141K|ARAP1_ENST00000455638.2_Missense_Mutation_p.Q386K|ARAP1_ENST00000334211.8_Missense_Mutation_p.Q141K|ARAP1_ENST00000429686.1_Missense_Mutation_p.Q141K|ARAP1_ENST00000393605.3_Missense_Mutation_p.Q146K|ARAP1_ENST00000359373.5_Missense_Mutation_p.Q386K	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	386	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						TCAAACTTCTGGTCCCCGATG	0.542																																					Ovarian(102;1198 1520 13195 17913 37529)												0													128.0	106.0	113.0					11																	72422123		2200	4293	6493	SO:0001583	missense	0			AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.1156C>A	11.37:g.72422123G>T	ENSP00000377233:p.Gln386Lys		A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_Ras-assoc,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.Q386K	ENST00000393609.3	37	c.1156	CCDS41687.1	11	.	.	.	.	.	.	.	.	.	.	G	23.9	4.473752	0.84640	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000340247	T;T;T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88	5.52	5.52	0.82312	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.283649	0.30020	N	0.010601	T	0.71187	0.3310	N	0.17312	0.475	0.29990	N	0.816945	P;D;D;P;P	0.63880	0.89;0.993;0.984;0.89;0.866	P;P;P;P;P	0.52881	0.707;0.675;0.712;0.707;0.583	T	0.72283	-0.4339	10	0.62326	D	0.03	.	16.9389	0.86210	0.0:0.0:1.0:0.0	.	141;141;386;386;146	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	K	386;386;146;141;386;141;141;175	ENSP00000352332:Q386K;ENSP00000390461:Q386K;ENSP00000377230:Q146K;ENSP00000335506:Q141K;ENSP00000377233:Q386K;ENSP00000392264:Q141K;ENSP00000403127:Q141K	ENSP00000335506:Q141K	Q	-	1	0	ARAP1	72099771	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.870000	0.56070	2.612000	0.88384	0.655000	0.94253	CAG	ARAP1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000186635		0.542	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARAP1	HGNC	protein_coding	OTTHUMT00000347428.1		0.00	26	0	G	NM_001040118		72422123	-1			no_errors	ENST00000393609	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	T
ARHGAP21	57584	genome.wustl.edu	37	10	24874962	24874962	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:24874962C>T	ENST00000396432.2	-	26	4742	c.4256G>A	c.(4255-4257)cGc>cAc	p.R1419H	ARHGAP21_ENST00000320481.6_3'UTR	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	1418					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						CTTCCTCTTGCGACTAGCAGC	0.448																																																	0													65.0	60.0	62.0					10																	24874962		2203	4300	6503	SO:0001583	missense	0			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.4256G>A	10.37:g.24874962C>T	ENSP00000379709:p.Arg1419His		Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.R1419H	ENST00000396432.2	37	c.4256	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	C	34	5.391567	0.95988	.	.	ENSG00000107863	ENST00000396432;ENST00000447364	T	0.15952	2.38	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.45935	0.1367	M	0.78637	2.42	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.50013	-0.8877	10	0.87932	D	0	.	18.6261	0.91340	0.0:1.0:0.0:0.0	.	1418	Q5T5U3	RHG21_HUMAN	H	1419;868	ENSP00000379709:R1419H	ENSP00000379709:R1419H	R	-	2	0	ARHGAP21	24914968	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.770000	0.85390	2.446000	0.82766	0.655000	0.94253	CGC	ARHGAP21	-	NULL	ENSG00000107863		0.448	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4	-	0.00	32	0	C	NM_020824		24874962	-1	tier1	-	no_errors	ENST00000396432	ensembl	human	known	74_37	missense	34.55	36	19	SNP	1.000	T
ARHGAP28	79822	genome.wustl.edu	37	18	6898517	6898517	+	Intron	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:6898517A>G	ENST00000383472.4	+	16	2134				ARHGAP28_ENST00000400091.2_Missense_Mutation_p.N705D|ARHGAP28_ENST00000314319.3_Intron|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.N653D|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.N528D|ARHGAP28_ENST00000531294.1_Intron|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.N546D|ARHGAP28_ENST00000419673.2_Intron			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				GACAGAGACCAACAGGAGCCC	0.433																																																	0													142.0	146.0	145.0					18																	6898517		2203	4300	6503	SO:0001627	intron_variant	0			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.2030+1892A>G	18.37:g.6898517A>G			A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.N705D	ENST00000383472.4	37	c.2113		18	.	.	.	.	.	.	.	.	.	.	A	13.88	2.369655	0.42003	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T	0.58652	3.0;2.96;2.73;0.32	2.93	2.93	0.34026	.	0.000000	0.85682	N	0.000000	T	0.42404	0.1201	.	.	.	0.09310	N	1	B;B;B	0.26002	0.139;0.135;0.135	B;B;B	0.24848	0.025;0.04;0.056	T	0.36768	-0.9734	9	0.51188	T	0.08	.	7.6767	0.28490	1.0:0.0:0.0:0.0	.	537;546;653	E9PRP2;F6VKJ9;Q9P2N2-2	.;.;.	D	705;653;546;537;528	ENSP00000382963:N705D;ENSP00000262227:N653D;ENSP00000406907:N546D;ENSP00000372964:N528D	ENSP00000262227:N653D	N	+	1	0	ARHGAP28	6888517	0.001000	0.12720	0.009000	0.14445	0.014000	0.08584	0.986000	0.29590	1.601000	0.50113	0.454000	0.30748	AAC	ARHGAP28	-	NULL	ENSG00000088756		0.433	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	ARHGAP28	HGNC	protein_coding	OTTHUMT00000442123.3	-	0.00	38	0	A	XM_371108		6898517	+1	tier1	-	no_errors	ENST00000400091	ensembl	human	known	74_37	missense	33.33	18	9	SNP	0.011	G
ARHGAP29	9411	genome.wustl.edu	37	1	94650552	94650552	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:94650552A>C	ENST00000260526.6	-	18	2167	c.1985T>G	c.(1984-1986)cTt>cGt	p.L662R	ARHGAP29_ENST00000482481.1_5'UTR	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	662					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TTTTCCTGGAAGTTTCTGATG	0.343																																																	0													68.0	71.0	70.0					1																	94650552		2203	4299	6502	SO:0001583	missense	0				CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.1985T>G	1.37:g.94650552A>C	ENSP00000260526:p.Leu662Arg		O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.L662R	ENST00000260526.6	37	c.1985	CCDS748.1	1	.	.	.	.	.	.	.	.	.	.	A	19.77	3.888671	0.72524	.	.	ENSG00000137962	ENST00000260526	T	0.30981	1.51	5.39	5.39	0.77823	Rho GTPase-activating protein domain (1);	0.000000	0.33057	N	0.005329	T	0.51805	0.1696	M	0.83852	2.665	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.61078	-0.7135	10	0.87932	D	0	-18.0477	15.4205	0.75006	1.0:0.0:0.0:0.0	.	662;662	F8VWZ8;Q52LW3	.;RHG29_HUMAN	R	662	ENSP00000260526:L662R	ENSP00000260526:L662R	L	-	2	0	ARHGAP29	94423140	1.000000	0.71417	0.912000	0.35992	0.778000	0.44026	6.528000	0.73807	2.032000	0.59987	0.455000	0.32223	CTT	ARHGAP29	-	NULL	ENSG00000137962		0.343	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	HGNC	protein_coding	OTTHUMT00000029376.2	-	0.00	23	0	A	NM_004815		94650552	-1	tier1	-	no_errors	ENST00000260526	ensembl	human	known	74_37	missense	50.00	12	13	SNP	0.997	C
ARHGAP40	343578	genome.wustl.edu	37	20	37267439	37267439	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr20:37267439G>A	ENST00000373345.4	+	8	1086	c.918G>A	c.(916-918)atG>atA	p.M306I		NM_001164431.1	NP_001157903.1	Q5TG30	RHG40_HUMAN	Rho GTPase activating protein 40	306	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)	1						GACTGGACATGGAAGGCATTC	0.517																																																	0													121.0	117.0	118.0					20																	37267439		692	1591	2283	SO:0001583	missense	0			AL035419		20q11.23	2011-06-29	2010-04-14	2010-04-14	ENSG00000124143	ENSG00000124143		"""Rho GTPase activating proteins"""	16226	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 95"""	C20orf95			Standard	NM_001164431		Approved	dJ1100H13.4	uc021wdn.1	Q5TG30	OTTHUMG00000032453	ENST00000373345.4:c.918G>A	20.37:g.37267439G>A	ENSP00000362442:p.Met306Ile			Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.M306I	ENST00000373345.4	37	c.918		20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.111|9.111	1.006584|1.006584	0.19199|0.19199	.|.	.|.	ENSG00000124143|ENSG00000124143	ENST00000243967|ENST00000373345	.|T	.|0.18016	.|2.24	4.82|4.82	-9.64|-9.64	0.00541|0.00541	.|.	.|0.588277	.|0.18161	.|N	.|0.149774	T|T	0.03348|0.03348	0.0097|0.0097	N|N	0.02120|0.02120	-0.675|-0.675	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.18304|0.18304	-1.0341|-1.0341	5|8	.|0.37606	.|T	.|0.19	.|.	3.1554|3.1554	0.06503|0.06503	0.539:0.1541:0.1407:0.1662|0.539:0.1541:0.1407:0.1662	.|.	.|.	.|.	.|.	R|I	247|306	.|ENSP00000362442:M306I	.|ENSP00000362442:M306I	G|M	+|+	1|3	0|0	ARHGAP40|ARHGAP40	36700853|36700853	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.392000|0.392000	0.30506|0.30506	-3.613000|-3.613000	0.00414|0.00414	-1.906000|-1.906000	0.01089|0.01089	-0.219000|-0.219000	0.12488|0.12488	GGA|ATG	ARHGAP40	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000124143		0.517	ARHGAP40-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP40	HGNC	protein_coding		-	0.00	66	0	G	XM_293123		37267439	+1	tier1	-	no_errors	ENST00000373345	ensembl	human	known	74_37	missense	37.04	51	30	SNP	0.000	A
ARHGEF12	23365	genome.wustl.edu	37	11	120328447	120328447	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:120328447C>T	ENST00000397843.2	+	24	2373	c.2207C>T	c.(2206-2208)aCa>aTa	p.T736I	ARHGEF12_ENST00000532993.1_Missense_Mutation_p.T633I|ARHGEF12_ENST00000356641.3_Missense_Mutation_p.T717I	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	736					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		GAACATGGGACACCAAAGCCC	0.333			T	MLL	AML																																			Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0													71.0	62.0	64.0					11																	120328447		1843	4076	5919	SO:0001583	missense	0			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.2207C>T	11.37:g.120328447C>T	ENSP00000380942:p.Thr736Ile		O15086|Q6P526	Missense_Mutation	SNP	pfam_RGS-like_dom,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.T717I	ENST00000397843.2	37	c.2150	CCDS41727.1	11	.	.	.	.	.	.	.	.	.	.	C	27.7	4.857164	0.91433	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	T;T;T	0.70399	-0.37;-0.48;-0.36	5.66	5.66	0.87406	.	0.000000	0.50627	D	0.000106	T	0.81725	0.4883	M	0.69823	2.125	0.53005	D	0.999966	D;D;D	0.65815	0.983;0.995;0.991	P;D;P	0.65010	0.78;0.931;0.854	T	0.75365	-0.3343	10	0.13470	T	0.59	-14.3149	19.7147	0.96110	0.0:1.0:0.0:0.0	.	633;717;736	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	I	736;717;633	ENSP00000380942:T736I;ENSP00000349056:T717I;ENSP00000432984:T633I	ENSP00000349056:T717I	T	+	2	0	ARHGEF12	119833657	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.847000	0.62867	2.838000	0.97847	0.591000	0.81541	ACA	ARHGEF12	-	NULL	ENSG00000196914		0.333	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	HGNC	protein_coding	OTTHUMT00000388052.1	-	0.00	37	0	C	NM_015313		120328447	+1	tier1	-	no_errors	ENST00000356641	ensembl	human	known	74_37	missense	12.50	35	5	SNP	1.000	T
ARHGEF38	54848	genome.wustl.edu	37	4	106580493	106580493	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:106580493G>T	ENST00000420470.2	+	10	1660	c.1516G>T	c.(1516-1518)Gca>Tca	p.A506S	ARHGEF38_ENST00000508036.2_3'UTR	NM_001242729.1	NP_001229658.1	Q9NXL2	ARH38_HUMAN	Rho guanine nucleotide exchange factor (GEF) 38	506	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(3)	11						GATGCTCGTGGCACAGCAGGC	0.532																																																	0																																										SO:0001583	missense	0			AK000191	CCDS3670.1, CCDS56338.1	4q24	2012-07-24			ENSG00000236699	ENSG00000236699		"""Rho guanine nucleotide exchange factors"""	25968	protein-coding gene	gene with protein product							Standard	NM_001242729		Approved	FLJ20184	uc003hxv.2	Q9NXL2	OTTHUMG00000154752	ENST00000420470.2:c.1516G>T	4.37:g.106580493G>T	ENSP00000416125:p.Ala506Ser		C9JIB4	Missense_Mutation	SNP	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.A506S	ENST00000420470.2	37	c.1516	CCDS56338.1	4	.	.	.	.	.	.	.	.	.	.	G	14.01	2.408760	0.42715	.	.	ENSG00000236699	ENST00000420470	T	0.63580	-0.05	5.66	1.84	0.25277	.	.	.	.	.	T	0.57388	0.2050	M	0.78637	2.42	0.09310	N	1	B	0.33940	0.433	B	0.34536	0.185	T	0.51857	-0.8652	9	0.40728	T	0.16	-7.241	3.4231	0.07401	0.1988:0.1158:0.5662:0.1193	.	506	C9JIB4	.	S	506	ENSP00000416125:A506S	ENSP00000416125:A506S	A	+	1	0	ARHGEF38	106799942	0.214000	0.23563	0.000000	0.03702	0.130000	0.20726	2.376000	0.44292	0.437000	0.26423	-0.154000	0.13518	GCA	ARHGEF38	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000236699		0.532	ARHGEF38-001	PUTATIVE	basic|appris_principal|readthrough_transcript|exp_conf|CCDS	protein_coding	ARHGEF38	HGNC	protein_coding	OTTHUMT00000336934.3	-	0.00	25	0	G	NM_017700		106580493	+1	tier1	-	no_errors	ENST00000420470	ensembl	human	putative	74_37	missense	12.12	29	4	SNP	0.000	T
ARHGEF40	55701	genome.wustl.edu	37	14	21550545	21550545	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:21550545A>G	ENST00000298694.4	+	15	3521	c.3394A>G	c.(3394-3396)Agg>Ggg	p.R1132G	ARHGEF40_ENST00000298693.3_Missense_Mutation_p.R1132G			Q8TER5	ARH40_HUMAN	Rho guanine nucleotide exchange factor (GEF) 40	1132	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.					cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(4)|ovary(3)|upper_aerodigestive_tract(2)	9						TGCCCGGGAAAGGCTTCGCAG	0.652																																																	0													32.0	35.0	34.0					14																	21550545		2203	4300	6503	SO:0001583	missense	0				CCDS32041.1	14q11.2	2012-07-24			ENSG00000165801	ENSG00000165801		"""Rho guanine nucleotide exchange factors"""	25516	protein-coding gene	gene with protein product		610018				16143467	Standard	NM_001278529		Approved	solo, FLJ10357	uc001vzp.3	Q8TER5		ENST00000298694.4:c.3394A>G	14.37:g.21550545A>G	ENSP00000298694:p.Arg1132Gly		A5PL07|Q9BWP5|Q9H7L6|Q9NTF9|Q9NW24	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R1132G	ENST00000298694.4	37	c.3394	CCDS32041.1	14	.	.	.	.	.	.	.	.	.	.	A	20.3	3.962863	0.74016	.	.	ENSG00000165801	ENST00000298694;ENST00000298693	T;T	0.29917	1.55;1.55	5.91	4.81	0.61882	Dbl homology (DH) domain (4);	0.353262	0.23646	N	0.045963	T	0.46268	0.1384	L	0.53249	1.67	0.30585	N	0.762127	D;D;P	0.56746	0.971;0.977;0.493	P;D;B	0.66602	0.908;0.945;0.109	T	0.50206	-0.8855	10	0.72032	D	0.01	.	9.9089	0.41392	0.6975:0.3025:0.0:0.0	.	1132;1132;418	Q8TER5-4;Q8TER5;Q8TER5-2	.;ARH40_HUMAN;.	G	1132	ENSP00000298694:R1132G;ENSP00000298693:R1132G	ENSP00000298693:R1132G	R	+	1	2	ARHGEF40	20620385	1.000000	0.71417	0.997000	0.53966	0.952000	0.60782	4.178000	0.58284	2.266000	0.75297	0.533000	0.62120	AGG	ARHGEF40	-	pfam_DH-domain,superfamily_DH-domain,pfscan_DH-domain	ENSG00000165801		0.652	ARHGEF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF40	HGNC	protein_coding	OTTHUMT00000413122.1	-	0.00	11	0	A			21550545	+1	tier1	-	no_errors	ENST00000298694	ensembl	human	known	74_37	missense	52.94	8	9	SNP	1.000	G
ARID1A	8289	genome.wustl.edu	37	1	27101252	27101252	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:27101252C>T	ENST00000324856.7	+	18	4905	c.4534C>T	c.(4534-4536)Cag>Tag	p.Q1512*	ARID1A_ENST00000540690.1_Intron|ARID1A_ENST00000457599.2_Intron|ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q1129*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1512					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TGCCAACAGGCAGAGCACGGG	0.577			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													65.0	70.0	68.0					1																	27101252		2203	4300	6503	SO:0001587	stop_gained	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.4534C>T	1.37:g.27101252C>T	ENSP00000320485:p.Gln1512*		D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q1512*	ENST00000324856.7	37	c.4534	CCDS285.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	44|44	11.208754|11.208754	0.99531|0.99531	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000430799|ENST00000324856;ENST00000374152	.|.	.|.	.|.	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.112351	.|0.64402	.|D	.|0.000005	T|.	0.75199|.	0.3817|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.71427|.	-0.4596|.	4|.	.|0.37606	.|T	.|0.19	-6.2947|-6.2947	19.6787|19.6787	0.95950|0.95950	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	V|X	408|1512;1129	.|.	.|ENSP00000320485:Q1512X	A|Q	+|+	2|1	0|0	ARID1A|ARID1A	26973839|26973839	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.228000|7.228000	0.78079|0.78079	2.890000|2.890000	0.99128|0.99128	0.650000|0.650000	0.86243|0.86243	GCA|CAG	ARID1A	-	NULL	ENSG00000117713		0.577	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	-	0.00	34	0	C	NM_139135		27101252	+1	tier1	-	no_errors	ENST00000324856	ensembl	human	known	74_37	nonsense	39.53	26	17	SNP	1.000	T
ARMC2	84071	genome.wustl.edu	37	6	109286189	109286189	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:109286189G>T	ENST00000392644.4	+	17	2460	c.2292G>T	c.(2290-2292)gtG>gtT	p.V764V	ARMC2_ENST00000368972.3_Silent_p.V599V|ARMC2_ENST00000481850.1_3'UTR	NM_032131.4	NP_115507.4	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2	764										endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)	24		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		TCAGGTTAGTGGACTGTTTAA	0.338																																																	0													164.0	168.0	167.0					6																	109286189		2203	4300	6503	SO:0001819	synonymous_variant	0			BC030603	CCDS5069.2, CCDS69168.1	6q21	2013-02-14			ENSG00000118690	ENSG00000118690		"""Armadillo repeat containing"""	23045	protein-coding gene	gene with protein product							Standard	XM_005267154		Approved	DKFZp434P0714, bA787I22.1	uc003pss.4	Q8NEN0	OTTHUMG00000015335	ENST00000392644.4:c.2292G>T	6.37:g.109286189G>T			A8K8Y4|B4DGF5|G5E993|Q5VVY8|Q9H0K9	Silent	SNP	superfamily_ARM-type_fold,smart_Armadillo	p.V764	ENST00000392644.4	37	c.2292	CCDS5069.2	6																																																																																			ARMC2	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000118690		0.338	ARMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC2	HGNC	protein_coding	OTTHUMT00000041732.2	-	0.00	41	0	G	NM_032131		109286189	+1	tier1	-	no_errors	ENST00000392644	ensembl	human	known	74_37	silent	7.14	52	4	SNP	1.000	T
ARMC4	55130	genome.wustl.edu	37	10	28250550	28250550	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:28250550C>A	ENST00000305242.5	-	10	1425	c.1333G>T	c.(1333-1335)Gca>Tca	p.A445S	ARMC4_ENST00000537576.1_Missense_Mutation_p.A137S|ARMC4_ENST00000239715.3_Missense_Mutation_p.A302S|ARMC4_ENST00000545014.1_5'UTR|ARMC4_ENST00000480504.1_5'UTR	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	445					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						GGCAAATCTGCACTTGCTTCC	0.388																																																	0													66.0	65.0	65.0					10																	28250550		2203	4297	6500	SO:0001583	missense	0			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.1333G>T	10.37:g.28250550C>A	ENSP00000306410:p.Ala445Ser		A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_GSKIP_dom,smart_Armadillo,pfscan_Armadillo	p.A445S	ENST00000305242.5	37	c.1333	CCDS7157.1	10	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491149	0.44249	.	.	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000537573;ENST00000434029;ENST00000239715	T;T;T;T	0.46819	1.1;1.53;0.86;0.88	5.4	4.27	0.50696	Armadillo-like helical (1);Armadillo-type fold (1);	0.334105	0.33419	N	0.004930	T	0.36468	0.0968	L	0.49350	1.555	0.35523	D	0.80161	B	0.17268	0.021	B	0.21708	0.036	T	0.39292	-0.9621	10	0.26408	T	0.33	-13.8082	4.8242	0.13408	0.0:0.7153:0.0:0.2847	.	445	Q5T2S8	ARMC4_HUMAN	S	137;445;137;339;302	ENSP00000443208:A137S;ENSP00000306410:A445S;ENSP00000398155:A339S;ENSP00000239715:A302S	ENSP00000239715:A302S	A	-	1	0	ARMC4	28290556	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.129000	0.57957	2.677000	0.91161	0.650000	0.86243	GCA	ARMC4	-	superfamily_ARM-type_fold	ENSG00000169126		0.388	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	HGNC	protein_coding	OTTHUMT00000047339.1		0.00	30	0	C	NM_018076		28250550	-1			no_errors	ENST00000305242	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	A
ASF1A	25842	genome.wustl.edu	37	6	119226836	119226836	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:119226836G>T	ENST00000229595.5	+	3	439	c.245G>T	c.(244-246)gGa>gTa	p.G82V	MCM9_ENST00000316316.6_Intron	NM_014034.2	NP_054753.1	Q9Y294	ASF1A_HUMAN	anti-silencing function 1A histone chaperone	82	Interaction with histone H3, CHAF1B, and HIRA.				chromatin modification (GO:0016568)|DNA repair (GO:0006281)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|muscle cell differentiation (GO:0042692)|negative regulation of chromatin silencing (GO:0031936)|nucleosome assembly (GO:0006334)|osteoblast differentiation (GO:0001649)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|histone binding (GO:0042393)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0633)|OV - Ovarian serous cystadenocarcinoma(136;0.188)		CCTAATCCAGGACTCATTCCA	0.383																																																	0													192.0	193.0	193.0					6																	119226836		1904	4130	6034	SO:0001583	missense	0			AF279306	CCDS47469.1	6q22.31	2013-05-01	2013-05-01		ENSG00000111875	ENSG00000111875			20995	protein-coding gene	gene with protein product		609189	"""ASF1 anti-silencing function 1 homolog A (S. cerevisiae)"""			10810093, 11042152	Standard	NM_014034		Approved	DKFZP547E2110, CIA	uc011ebn.2	Q9Y294	OTTHUMG00000015470	ENST00000229595.5:c.245G>T	6.37:g.119226836G>T	ENSP00000229595:p.Gly82Val		Q6IA08|Q9P014	Missense_Mutation	SNP	pfam_Histone_chaperone_ASF1-like,superfamily_Histone_chaperone_ASF1-like	p.G82V	ENST00000229595.5	37	c.245	CCDS47469.1	6	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958041	0.53400	.	.	ENSG00000111875	ENST00000229595	.	.	.	6.17	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.42653	0.1212	L	0.34521	1.04	0.80722	D	1	P	0.38551	0.636	P	0.46172	0.506	T	0.51803	-0.8659	9	0.62326	D	0.03	-20.3978	11.9011	0.52685	0.0654:0.1224:0.8122:0.0	.	82	Q9Y294	ASF1A_HUMAN	V	82	.	ENSP00000229595:G82V	G	+	2	0	ASF1A	119268535	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.734000	0.62043	1.630000	0.50440	0.655000	0.94253	GGA	ASF1A	-	pfam_Histone_chaperone_ASF1-like,superfamily_Histone_chaperone_ASF1-like	ENSG00000111875		0.383	ASF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASF1A	HGNC	protein_coding	OTTHUMT00000361910.1		0.00	30	0	G	NM_014034		119226836	+1			no_errors	ENST00000229595	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
ASTN1	460	genome.wustl.edu	37	1	176845742	176845742	+	Missense_Mutation	SNP	G	G	A	rs373152514		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:176845742G>A	ENST00000367654.3	-	21	3629	c.3418C>T	c.(3418-3420)Cgg>Tgg	p.R1140W	ASTN1_ENST00000361833.2_Missense_Mutation_p.R1132W|ASTN1_ENST00000367657.3_Missense_Mutation_p.R1132W|ASTN1_ENST00000424564.2_Missense_Mutation_p.R1132W	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	1140	Fibronectin type-III 1.				locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)		p.R1132W(1)		NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CTGGAGCGCCGTCCTGTGTTG	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18580	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	prostate(1)						G	TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	114.0	88.0	97.0		3394,3394	4.2	1.0	1		97	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ASTN1	NM_004319.1,NM_207108.1	101,101	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,probably-damaging	1132/1295,1132/1217	176845742	2,13004	2203	4300	6503	SO:0001583	missense	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.3418C>T	1.37:g.176845742G>A	ENSP00000356626:p.Arg1140Trp		A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.R1140W	ENST00000367654.3	37	c.3418		1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.441505	0.83993	2.27E-4	1.16E-4	ENSG00000152092	ENST00000367657;ENST00000361833;ENST00000367654;ENST00000424564;ENST00000541808	T;T;T;T	0.17213	2.29;2.71;2.71;2.29	5.19	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.34366	0.0895	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	T	0.04017	-1.0984	10	0.87932	D	0	-17.3769	11.0346	0.47793	0.0:0.0:0.6384:0.3616	.	1132;1132	O14525-2;B1AJS1	.;.	W	1132;1132;1140;1132;1132	ENSP00000356629:R1132W;ENSP00000354536:R1132W;ENSP00000356626:R1140W;ENSP00000395041:R1132W	ENSP00000354536:R1132W	R	-	1	2	ASTN1	175112365	1.000000	0.71417	0.995000	0.50966	0.957000	0.61999	5.493000	0.66899	2.400000	0.81607	0.655000	0.94253	CGG	ASTN1	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000152092		0.577	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		-	0.00	25	0	G	NM_004319		176845742	-1	tier1	-	no_errors	ENST00000367654	ensembl	human	known	74_37	missense	58.33	15	21	SNP	0.995	A
ATAD1	84896	genome.wustl.edu	37	10	89530710	89530710	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:89530710G>T	ENST00000308448.7	-	7	1157	c.779C>A	c.(778-780)cCt>cAt	p.P260H	ATAD1_ENST00000328142.3_Splice_Site_p.P260H|ATAD1_ENST00000541004.1_Splice_Site_p.P260H|ATAD1_ENST00000400215.3_Intron	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	260					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		ACCACCTACAGGCTGGTTGAT	0.368																																																	0													108.0	99.0	102.0					10																	89530710		2203	4300	6503	SO:0001630	splice_region_variant	0			AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.780+1C>A	10.37:g.89530710G>T			D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P260H	ENST00000308448.7	37	c.779	CCDS7386.1	10	.	.	.	.	.	.	.	.	.	.	G	22.4	4.287999	0.80803	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000541004	D;D;D	0.99060	-5.03;-5.03;-5.38	5.03	5.03	0.67393	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.99486	0.9817	H	0.94964	3.605	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98292	1.0514	9	.	.	.	-17.2736	16.6727	0.85271	0.0:0.0:1.0:0.0	.	260	Q8NBU5	ATAD1_HUMAN	H	260	ENSP00000339017:P260H;ENSP00000339016:P260H;ENSP00000445500:P260H	.	P	-	2	0	ATAD1	89520690	1.000000	0.71417	0.992000	0.48379	0.858000	0.48976	9.011000	0.93618	2.706000	0.92434	0.650000	0.86243	CCT	ATAD1	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000138138		0.368	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD1	HGNC	protein_coding	OTTHUMT00000049235.1	-	0.00	20	0	G	NM_032810	Missense_Mutation	89530710	-1	tier1	-	no_errors	ENST00000308448	ensembl	human	known	74_37	missense	30.00	7	3	SNP	1.000	T
ATG9B	285973	genome.wustl.edu	37	7	150716292	150716292	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:150716292G>A	ENST00000377974.2	-	6	1208	c.1133C>T	c.(1132-1134)cCg>cTg	p.P378L	ATG9B_ENST00000605938.1_Missense_Mutation_p.P378L|ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000444312.1_Intron			Q674R7	ATG9B_HUMAN	autophagy related 9B	378					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCAGCGGGCCGGCAGCAGGCC	0.697																																																	0													6.0	8.0	7.0					7																	150716292		1876	3954	5830	SO:0001583	missense	0			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.1133C>T	7.37:g.150716292G>A	ENSP00000475005:p.Pro378Leu		A1A5D3|Q6JRW5|Q8N8I8	Missense_Mutation	SNP	pfam_Autophagy-rel_prot_9	p.P378L	ENST00000377974.2	37	c.1133		7	.	.	.	.	.	.	.	.	.	.	G	16.31	3.087010	0.55861	.	.	ENSG00000248602	ENST00000377974;ENST00000397266	.	.	.	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.79639	0.4480	.	.	.	.	.	.	D	0.89917	1.0	D	0.81914	0.995	T	0.81881	-0.0729	7	0.62326	D	0.03	-14.2306	16.665	0.85250	0.0:0.0:1.0:0.0	.	378	Q674R7	ATG9B_HUMAN	L	378	.	ENSP00000444232:P378L	P	-	2	0	AC010973.1	150347225	1.000000	0.71417	0.986000	0.45419	0.989000	0.77384	7.895000	0.87343	2.527000	0.85204	0.462000	0.41574	CCG	ATG9B	-	pfam_Autophagy-rel_prot_9	ENSG00000181652		0.697	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	ATG9B	HGNC	protein_coding		-	0.00	18	0	G	NM_173681		150716292	-1	tier1	-	no_errors	ENST00000377974	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	A
ATP1A2	477	genome.wustl.edu	37	1	160098836	160098836	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:160098836G>A	ENST00000361216.3	+	10	1372	c.1283G>A	c.(1282-1284)cGc>cAc	p.R428H	ATP1A2_ENST00000392233.3_Missense_Mutation_p.R428H	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	428					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CTCTGCAACCGCGCCGTCTTC	0.582																																																	0													44.0	37.0	39.0					1																	160098836		2203	4300	6503	SO:0001583	missense	0			AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1283G>A	1.37:g.160098836G>A	ENSP00000354490:p.Arg428His		D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.R428H	ENST00000361216.3	37	c.1283	CCDS1196.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.092935|4.092935	0.76756|0.76756	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000447527|ENST00000361216;ENST00000392233;ENST00000435866	.|T;T	.|0.79749	.|-1.3;-1.3	4.13|4.13	4.13|4.13	0.48395|0.48395	.|ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	.|0.105463	.|0.64402	.|D	.|0.000007	T|T	0.80581|0.80581	0.4650|0.4650	L|L	0.28556|0.28556	0.865|0.865	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.78314	.|0.991;0.984;0.991	D|D	0.83637|0.83637	0.0148|0.0148	5|10	.|0.66056	.|D	.|0.02	.|.	15.6667|15.6667	0.77236|0.77236	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|428;328;428	.|B1AKY9;F5GXJ7;P50993	.|.;.;AT1A2_HUMAN	T|H	139|428;428;131	.|ENSP00000354490:R428H;ENSP00000376066:R428H	.|ENSP00000354490:R428H	A|R	+|+	1|2	0|0	ATP1A2|ATP1A2	158365460|158365460	1.000000|1.000000	0.71417|0.71417	0.939000|0.939000	0.37840|0.37840	0.959000|0.959000	0.62525|0.62525	7.808000|7.808000	0.86044|0.86044	2.306000|2.306000	0.77630|0.77630	0.561000|0.561000	0.74099|0.74099	GCG|CGC	ATP1A2	-	pfam_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Na/K_IIC	ENSG00000018625		0.582	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A2	HGNC	protein_coding	OTTHUMT00000060642.2	-	0.00	31	0	G	NM_000702		160098836	+1	tier1	-	no_errors	ENST00000361216	ensembl	human	known	74_37	missense	23.91	35	11	SNP	1.000	A
AVPR1A	552	genome.wustl.edu	37	12	63541337	63541337	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:63541337G>T	ENST00000299178.2	-	2	1164	c.1059C>A	c.(1057-1059)ggC>ggA	p.G353G		NM_000706.4	NP_000697.1	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	353					activation of phospholipase C activity (GO:0007202)|blood circulation (GO:0008015)|calcium-mediated signaling (GO:0019722)|cellular response to water deprivation (GO:0042631)|G-protein coupled receptor signaling pathway (GO:0007186)|generation of precursor metabolites and energy (GO:0006091)|grooming behavior (GO:0007625)|maternal aggressive behavior (GO:0002125)|maternal behavior (GO:0042711)|myotube differentiation (GO:0014902)|negative regulation of female receptivity (GO:0007621)|negative regulation of transmission of nerve impulse (GO:0051970)|penile erection (GO:0043084)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular pH reduction (GO:0032849)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of glutamate secretion (GO:0014049)|positive regulation of heart rate (GO:0010460)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of vasoconstriction (GO:0045907)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to corticosterone (GO:0051412)|social behavior (GO:0035176)|sperm ejaculation (GO:0042713)|telencephalon development (GO:0021537)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein kinase C binding (GO:0005080)|vasopressin receptor activity (GO:0005000)	p.G353G(1)		central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(12)|prostate(2)|skin(1)	26			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	GAAGGAGATGGCCACTAAAAA	0.408																																																	1	Substitution - coding silent(1)	large_intestine(1)											161.0	153.0	156.0					12																	63541337		2203	4300	6503	SO:0001819	synonymous_variant	0			L25615	CCDS8965.1	12q14-q15	2012-08-08				ENSG00000166148		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	895	protein-coding gene	gene with protein product		600821		AVPR1		8106369	Standard	NM_000706		Approved		uc001sro.2	P37288		ENST00000299178.2:c.1059C>A	12.37:g.63541337G>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_DUF1856,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Vprs_V1A_rcpt,prints_Vasoprsn_rcpt,prints_GPCR_Rhodpsn	p.G353	ENST00000299178.2	37	c.1059	CCDS8965.1	12																																																																																			AVPR1A	-	pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_GPCR_Rhodpsn	ENSG00000166148		0.408	AVPR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVPR1A	HGNC	protein_coding	OTTHUMT00000406734.1		0.00	46	0	G			63541337	-1			no_errors	ENST00000299178	ensembl	human	known	74_37	silent	5.45	52	3	SNP	0.862	T
BAI1	575	genome.wustl.edu	37	8	143561135	143561135	+	Missense_Mutation	SNP	G	G	A	rs555744616		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:143561135G>A	ENST00000517894.1	+	9	2702	c.1808G>A	c.(1807-1809)cGg>cAg	p.R603Q	BAI1_ENST00000323289.5_Missense_Mutation_p.R603Q			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	603					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GCTGCTGTCCGGTGTCCCCGC	0.642																																																	0													71.0	84.0	80.0					8																	143561135		2125	4223	6348	SO:0001583	missense	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.1808G>A	8.37:g.143561135G>A	ENSP00000430945:p.Arg603Gln			Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.R603Q	ENST00000517894.1	37	c.1808		8	.	.	.	.	.	.	.	.	.	.	g	15.05	2.717657	0.48622	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.26810	1.71;1.71	4.67	4.67	0.58626	.	0.165145	0.40385	U	0.001112	T	0.36413	0.0966	L	0.48362	1.52	0.32267	N	0.569402	D	0.60160	0.987	P	0.55545	0.778	T	0.36286	-0.9754	10	0.23891	T	0.37	.	16.5456	0.84444	0.0:0.0:1.0:0.0	.	603	E9PBK0	.	Q	603	ENSP00000430945:R603Q;ENSP00000313046:R603Q	ENSP00000313046:R603Q	R	+	2	0	BAI1	143558137	1.000000	0.71417	1.000000	0.80357	0.124000	0.20399	2.893000	0.48633	2.162000	0.67917	0.306000	0.20318	CGG	BAI1	-	smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom	ENSG00000181790		0.642	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	-	0.00	44	0	G	NM_001702		143561135	+1	tier1	-	no_errors	ENST00000323289	ensembl	human	known	74_37	missense	70.27	11	26	SNP	0.999	A
BBOX1	8424	genome.wustl.edu	37	11	27147227	27147227	+	Missense_Mutation	SNP	G	G	A	rs202026071		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:27147227G>A	ENST00000529202.1	+	7	1202	c.863G>A	c.(862-864)cGc>cAc	p.R288H	RP11-1L12.3_ENST00000530430.1_RNA|RP11-1L12.3_ENST00000526061.1_RNA|BBOX1_ENST00000263182.3_Missense_Mutation_p.R288H|BBOX1_ENST00000525090.1_Missense_Mutation_p.R288H|BBOX1_ENST00000528583.1_Missense_Mutation_p.R288H|RP11-1L12.3_ENST00000525302.1_RNA			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	288					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)	p.R288H(1)		breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	caagtggttcgcatcaacttc	0.338																																																	1	Substitution - Missense(1)	ovary(1)											88.0	73.0	78.0					11																	27147227		2198	4298	6496	SO:0001583	missense	0			AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.863G>A	11.37:g.27147227G>A	ENSP00000435781:p.Arg288His		B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	pfam_Taurine_dOase,pfam_DUF971,tigrfam_2-oxoglut_dOase	p.R288H	ENST00000529202.1	37	c.863	CCDS7862.1	11	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428881	0.83667	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7	6.03	5.13	0.70059	.	0.102971	0.64402	D	0.000003	D	0.88614	0.6484	L	0.59967	1.855	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.87848	0.2656	10	0.39692	T	0.17	.	14.0118	0.64503	0.0726:0.0:0.9274:0.0	.	288	O75936	BODG_HUMAN	H	288	ENSP00000435781:R288H;ENSP00000263182:R288H;ENSP00000434918:R288H;ENSP00000433772:R288H	ENSP00000263182:R288H	R	+	2	0	BBOX1	27103803	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.829000	0.69316	1.560000	0.49568	0.655000	0.94253	CGC	BBOX1	-	pfam_Taurine_dOase,tigrfam_2-oxoglut_dOase	ENSG00000129151		0.338	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBOX1	HGNC	protein_coding	OTTHUMT00000387946.1		0.00	27	0	G	NM_003986		27147227	+1			no_errors	ENST00000263182	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	A
BCAR1	9564	genome.wustl.edu	37	16	75263637	75263637	+	Silent	SNP	G	G	A	rs141865631		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:75263637G>A	ENST00000162330.5	-	7	2511	c.2385C>T	c.(2383-2385)atC>atT	p.I795I	BCAR1_ENST00000538440.2_Silent_p.I795I|BCAR1_ENST00000420641.3_Silent_p.I813I|BCAR1_ENST00000566982.1_5'UTR|RP11-331F4.4_ENST00000489723.1_RNA|BCAR1_ENST00000535626.2_Silent_p.I647I|BCAR1_ENST00000393422.2_Silent_p.I813I|BCAR1_ENST00000393420.6_Silent_p.I813I|BCAR1_ENST00000418647.3_Silent_p.I841I|BCAR1_ENST00000542031.2_Silent_p.I793I|BCAR1_ENST00000546196.1_Silent_p.I766I	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	795	Divergent helix-loop-helix motif.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)	p.I795I(1)		breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		GTGTGTCCCCGATGAACACCA	0.632																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)						G	,,,,,,,,	1,4395	2.1+/-5.4	0,1,2197	82.0	63.0	70.0		2523,2439,2439,2439,2385,2379,1941,1755,2385	-10.1	0.1	16	dbSNP_134	70	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	BCAR1	NM_001170714.1,NM_001170715.1,NM_001170716.1,NM_001170717.1,NM_001170718.1,NM_001170719.1,NM_001170720.1,NM_001170721.1,NM_014567.3	,,,,,,,,	0,1,6497	AA,AG,GG		0.0,0.0227,0.0077	,,,,,,,,	841/917,813/889,813/889,813/889,795/871,793/869,647/723,585/661,795/871	75263637	1,12995	2198	4300	6498	SO:0001819	synonymous_variant	0			AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.2385C>T	16.37:g.75263637G>A			B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Silent	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.I841	ENST00000162330.5	37	c.2523	CCDS10915.1	16																																																																																			BCAR1	-	pfam_CAS_DUF3513	ENSG00000050820		0.632	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAR1	HGNC	protein_coding	OTTHUMT00000269017.1	-	0.00	48	0	G	NM_014567		75263637	-1	tier1	rs141865631	no_errors	ENST00000418647	ensembl	human	known	74_37	silent	75.68	9	28	SNP	0.351	A
BCL9L	283149	genome.wustl.edu	37	11	118768466	118768467	+	3'UTR	INS	-	-	TT	rs529976724|rs35636302|rs398115882	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:118768466_118768467insTT	ENST00000334801.3	-	0	6121_6122				CXCR5_ENST00000292174.4_3'UTR|BCL9L_ENST00000526143.1_5'UTR	NM_182557.2	NP_872363.1	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like						canonical Wnt signaling pathway (GO:0060070)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell morphogenesis (GO:0022604)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|transcription coactivator activity (GO:0003713)			NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	56	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		TTCTTTTATCCTTTTTTTTTTG	0.5																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB094091	CCDS8403.1	11q23.3	2012-06-06				ENSG00000186174			23688	protein-coding gene	gene with protein product		609004				12964048	Standard	NM_182557		Approved	DLNB11	uc001pug.3	Q86UU0		ENST00000334801.3:c.*658->AA	11.37:g.118768475_118768476dupTT			A1A4C1|Q67FY1|Q6ZWJ0|Q6ZWK2	RNA	INS	-	NULL	ENST00000334801.3	37	NULL	CCDS8403.1	11																																																																																			BCL9L	-	-	ENSG00000186174		0.500	BCL9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL9L	HGNC	protein_coding	OTTHUMT00000389653.1		0.00	16	0	-	NM_182557		118768467	-1	tier1		no_errors	ENST00000526143	ensembl	human	known	74_37	rna	11.11	24	3	INS	0.859:0.885	TT
BDP1	55814	genome.wustl.edu	37	5	70766232	70766233	+	Frame_Shift_Ins	INS	-	-	T	rs567681041		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:70766232_70766233insT	ENST00000358731.4	+	7	1193_1194	c.930_931insT	c.(931-933)tttfs	p.F311fs	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	311	Myb-like.				gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		AAACAGATATGTTTTTTTTAGC	0.292																																																	0																																										SO:0001589	frameshift_variant	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.938dupT	5.37:g.70766240_70766240dupT	ENSP00000351575:p.Phe311fs		Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Frame_Shift_Ins	INS	superfamily_Homeodomain-like,smart_SANT/Myb	p.L312fs	ENST00000358731.4	37	c.930_931	CCDS43328.1	5																																																																																			BDP1	-	superfamily_Homeodomain-like,smart_SANT/Myb	ENSG00000145734		0.292	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2		0.00	20	0	-	NM_018429		70766233	+1	tier1		no_errors	ENST00000358731	ensembl	human	known	74_37	frame_shift_ins	8.70	21	2	INS	1.000:1.000	T
BICD2	23299	genome.wustl.edu	37	9	95482726	95482726	+	Silent	SNP	G	G	A	rs540280844		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:95482726G>A	ENST00000375512.3	-	4	985	c.918C>T	c.(916-918)ggC>ggT	p.G306G	BICD2_ENST00000356884.6_Silent_p.G306G	NM_015250.3	NP_056065.1	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 (Drosophila)	306					cell death (GO:0008219)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase binding (GO:0017137)			cervix(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23						TGGCCAGGCCGCCGTGCTCAA	0.642													G|||	1	0.000199681	0.0	0.0	5008	,	,		17772	0.0		0.0	False		,,,				2504	0.001																0													84.0	87.0	86.0					9																	95482726		2203	4300	6503	SO:0001819	synonymous_variant	0			AB014599	CCDS6700.1, CCDS35064.1	9q22.32	2008-02-05			ENSG00000185963	ENSG00000185963			17208	protein-coding gene	gene with protein product		609797				9734811	Standard	NM_001003800		Approved	KIAA0699	uc004asp.1	Q8TD16	OTTHUMG00000021036	ENST00000375512.3:c.918C>T	9.37:g.95482726G>A			O75181|Q5TBQ2|Q5TBQ3|Q96LH2|Q9BT84|Q9H561	Silent	SNP	pfam_Bicaudal-D_microtubule-assoc	p.G306	ENST00000375512.3	37	c.918	CCDS6700.1	9																																																																																			BICD2	-	pfam_Bicaudal-D_microtubule-assoc	ENSG00000185963		0.642	BICD2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BICD2	HGNC	protein_coding	OTTHUMT00000055508.1	-	0.00	46	0	G	NM_015250		95482726	-1	tier1	-	no_errors	ENST00000356884	ensembl	human	known	74_37	silent	43.59	44	34	SNP	0.001	A
BNIP3P1	319138	genome.wustl.edu	37	14	28734247	28734247	+	RNA	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:28734247A>G	ENST00000550043.1	+	0	652									BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene 1																		AATTTCTGAAAGTTTTCTTTC	0.493																																																	0																																												0					14q12	2014-02-04	2011-03-18	2011-03-18	ENSG00000197358	ENSG00000197358			19922	pseudogene	pseudogene			"""BCL2/adenovirus E1B 19kDa interacting protein 3 pseudogene"""	BNIP3P			Standard	NG_002516		Approved				OTTHUMG00000170378		14.37:g.28734247A>G				RNA	SNP	-	NULL	ENST00000550043.1	37	NULL		14																																																																																			BNIP3P1	-	-	ENSG00000197358		0.493	BNIP3P1-002	KNOWN	basic	processed_transcript	BNIP3P1	HGNC	pseudogene	OTTHUMT00000408770.1	-	0.00	57	0	A			28734247	+1	tier1	-	no_errors	ENST00000550043	ensembl	human	known	74_37	rna	39.53	26	17	SNP	0.964	G
BRINP1	1620	genome.wustl.edu	37	9	121929731	121929731	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:121929731G>T	ENST00000265922.3	-	8	2378	c.1917C>A	c.(1915-1917)gaC>gaA	p.D639E	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	639					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											GATCCGACAGGTCCACGGGGC	0.557																																																	0													141.0	137.0	139.0					9																	121929731		2203	4300	6503	SO:0001583	missense	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1917C>A	9.37:g.121929731G>T	ENSP00000265922:p.Asp639Glu		Q6IPV6|Q6P1A0|Q8WU22	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.D639E	ENST00000265922.3	37	c.1917	CCDS6822.1	9	.	.	.	.	.	.	.	.	.	.	G	5.820	0.335501	0.11013	.	.	ENSG00000078725	ENST00000373969;ENST00000265922	T	0.12672	2.66	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.06508	0.0167	N	0.12182	0.205	0.58432	D	0.999991	B	0.19073	0.033	B	0.17098	0.017	T	0.16988	-1.0384	10	0.02654	T	1	-28.2149	10.2622	0.43434	0.1467:0.0:0.8533:0.0	.	639	O60477	DBC1_HUMAN	E	639	ENSP00000265922:D639E	ENSP00000265922:D639E	D	-	3	2	DBC1	120969552	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.992000	0.29667	2.756000	0.94617	0.655000	0.94253	GAC	BRINP1	-	NULL	ENSG00000078725		0.557	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRINP1	HGNC	protein_coding	OTTHUMT00000055440.2	-	0.00	29	0	G	NM_014618		121929731	-1	tier1	-	no_errors	ENST00000265922	ensembl	human	known	74_37	missense	15.79	16	3	SNP	1.000	T
BRWD3	254065	genome.wustl.edu	37	X	79939516	79939516	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:79939516T>C	ENST00000373275.4	-	37	4442	c.4226A>G	c.(4225-4227)aAg>aGg	p.K1409R	BRWD3_ENST00000473691.1_Intron	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1409	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						TACCCTTGACTTTTTATTAGA	0.338																																																	0													81.0	78.0	79.0					X																	79939516		2202	4299	6501	SO:0001583	missense	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.4226A>G	X.37:g.79939516T>C	ENSP00000362372:p.Lys1409Arg		C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.K1409R	ENST00000373275.4	37	c.4226	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	T	6.850	0.526146	0.13066	.	.	ENSG00000165288	ENST00000373275	T	0.18657	2.2	4.66	4.66	0.58398	Bromodomain (6);	0.046313	0.85682	D	0.000000	T	0.10723	0.0262	N	0.05280	-0.08	0.46011	D	0.998818	B	0.16603	0.018	B	0.20184	0.028	T	0.16041	-1.0416	9	.	.	.	-6.3035	13.347	0.60580	0.0:0.0:0.0:1.0	.	1409	Q6RI45	BRWD3_HUMAN	R	1409	ENSP00000362372:K1409R	.	K	-	2	0	BRWD3	79826172	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.525000	0.81892	1.722000	0.51474	0.408000	0.27601	AAG	BRWD3	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000165288		0.338	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	-	0.00	75	0	T	NM_153252		79939516	-1	tier1	-	no_errors	ENST00000373275	ensembl	human	known	74_37	missense	37.04	51	30	SNP	1.000	C
BRWD3	254065	genome.wustl.edu	37	X	79947627	79947627	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:79947627T>A	ENST00000373275.4	-	29	3502	c.3286A>T	c.(3286-3288)Aag>Tag	p.K1096*	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1096					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						GGGCTCATCTTTTCTCTCTCA	0.289																																																	0													62.0	60.0	61.0					X																	79947627		2203	4294	6497	SO:0001587	stop_gained	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.3286A>T	X.37:g.79947627T>A	ENSP00000362372:p.Lys1096*		C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.K1096*	ENST00000373275.4	37	c.3286	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	T	44	10.733105	0.99458	.	.	ENSG00000165288	ENST00000373275	.	.	.	4.71	4.71	0.59529	.	0.047819	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.9674	13.3937	0.60838	0.0:0.0:0.0:1.0	.	.	.	.	X	1096	.	.	K	-	1	0	BRWD3	79834283	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.678000	0.68153	1.734000	0.51633	0.481000	0.45027	AAG	BRWD3	-	NULL	ENSG00000165288		0.289	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	-	0.00	29	0	T	NM_153252		79947627	-1	tier1	-	no_errors	ENST00000373275	ensembl	human	known	74_37	nonsense	45.45	24	20	SNP	1.000	A
BRWD3	254065	genome.wustl.edu	37	X	79999527	79999527	+	Intron	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:79999527T>C	ENST00000373275.4	-	8	1030					NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3						cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						ATCACTTTTCTTACCTGTATG	0.373																																																	0													66.0	60.0	62.0					X																	79999527		2203	4299	6502	SO:0001627	intron_variant	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.813+3A>G	X.37:g.79999527T>C			C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	RNA	SNP	-	NULL	ENST00000373275.4	37	NULL	CCDS14447.1	X																																																																																			BRWD3	-	-	ENSG00000165288		0.373	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	-	0.00	35	0	T	NM_153252		79999527	-1	tier1	-	no_errors	ENST00000478415	ensembl	human	known	74_37	rna	36.67	38	22	SNP	1.000	C
BTAF1	9044	genome.wustl.edu	37	10	93719738	93719738	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:93719738G>T	ENST00000265990.6	+	11	1398	c.1090G>T	c.(1090-1092)Gtg>Ttg	p.V364L	BTAF1_ENST00000471217.1_3'UTR	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	364					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TCTGTAGGTTGTGGCACCAGT	0.363																																																	0													104.0	100.0	101.0					10																	93719738		2203	4300	6503	SO:0001583	missense	0			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.1090G>T	10.37:g.93719738G>T	ENSP00000265990:p.Val364Leu		B4E0W6|O43578	Missense_Mutation	SNP	pfam_DUF3535,pfam_SNF2_N,pfam_HEAT,pfam_Helicase_C,superfamily_ARM-type_fold,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V364L	ENST00000265990.6	37	c.1090	CCDS7419.1	10	.	.	.	.	.	.	.	.	.	.	G	28.5	4.925635	0.92319	.	.	ENSG00000095564	ENST00000265990	T	0.64618	-0.11	5.37	5.37	0.77165	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82683	0.5090	M	0.90198	3.095	0.80722	D	1	D	0.71674	0.998	D	0.65010	0.931	D	0.86287	0.1671	10	0.72032	D	0.01	-13.474	19.0981	0.93263	0.0:0.0:1.0:0.0	.	364	O14981	BTAF1_HUMAN	L	364	ENSP00000265990:V364L	ENSP00000265990:V364L	V	+	1	0	BTAF1	93709718	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.835000	0.99442	2.520000	0.84964	0.585000	0.79938	GTG	BTAF1	-	superfamily_ARM-type_fold	ENSG00000095564		0.363	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTAF1	HGNC	protein_coding	OTTHUMT00000049380.4	-	0.00	64	0	G	NM_003972		93719738	+1	tier1	-	no_errors	ENST00000265990	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
BTBD7	55727	genome.wustl.edu	37	14	93760733	93760733	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:93760733G>T	ENST00000334746.5	-	3	940	c.633C>A	c.(631-633)gaC>gaA	p.D211E	BTBD7_ENST00000555525.1_Missense_Mutation_p.D211E|BTBD7_ENST00000554565.1_Intron|BTBD7_ENST00000298896.3_Missense_Mutation_p.D211E|BTBD7_ENST00000393170.2_5'Flank	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	211	BTB 1. {ECO:0000255|PROSITE- ProRule:PRU00037}.				multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GAAACCTTGAGTCCTCCATTC	0.388																																																	0													66.0	63.0	64.0					14																	93760733		2203	4300	6503	SO:0001583	missense	0			AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.633C>A	14.37:g.93760733G>T	ENSP00000335615:p.Asp211Glu		A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.D211E	ENST00000334746.5	37	c.633	CCDS32146.1	14	.	.	.	.	.	.	.	.	.	.	G	15.91	2.971722	0.53614	.	.	ENSG00000011114	ENST00000334746;ENST00000298896;ENST00000555525	T;T;T	0.70399	-0.48;-0.48;-0.48	5.57	3.39	0.38822	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.61850	0.2380	L	0.39245	1.2	0.80722	D	1	B;P;B	0.35872	0.373;0.525;0.426	B;B;B	0.39503	0.099;0.188;0.301	T	0.62604	-0.6819	10	0.49607	T	0.09	.	9.2401	0.37491	0.295:0.0:0.705:0.0	.	211;211;211	Q9P203-3;G3V3T2;Q9P203	.;.;BTBD7_HUMAN	E	211	ENSP00000335615:D211E;ENSP00000298896:D211E;ENSP00000451408:D211E	ENSP00000298896:D211E	D	-	3	2	BTBD7	92830486	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.672000	0.25187	1.348000	0.45733	0.650000	0.86243	GAC	BTBD7	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000011114		0.388	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD7	HGNC	protein_coding	OTTHUMT00000412701.1	-	0.00	31	0	G	NM_001002860		93760733	-1	tier1	-	no_errors	ENST00000334746	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.999	T
C10orf76	79591	genome.wustl.edu	37	10	103771512	103771512	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:103771512G>T	ENST00000370033.4	-	11	918	c.799C>A	c.(799-801)Caa>Aaa	p.Q267K		NM_024541.2	NP_078817.2	Q5T2E6	CJ076_HUMAN	chromosome 10 open reading frame 76	267						integral component of membrane (GO:0016021)		p.Q267K(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(7)|prostate(2)|upper_aerodigestive_tract(2)	24		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		AAACCACTTTGGTGTTCTTCT	0.343																																																	1	Substitution - Missense(1)	endometrium(1)											125.0	124.0	124.0					10																	103771512		1823	4079	5902	SO:0001583	missense	0			AK023176	CCDS41563.1	10q24.32	2008-10-21			ENSG00000120029	ENSG00000120029			25788	protein-coding gene	gene with protein product						14702039	Standard	NM_024541		Approved	FLJ13114	uc009xwy.1	Q5T2E6	OTTHUMG00000018943	ENST00000370033.4:c.799C>A	10.37:g.103771512G>T	ENSP00000359050:p.Gln267Lys		Q2TB87|Q9H8Z9	Missense_Mutation	SNP	pfam_DUF1741,superfamily_ARM-type_fold	p.Q267K	ENST00000370033.4	37	c.799	CCDS41563.1	10	.	.	.	.	.	.	.	.	.	.	G	16.93	3.258640	0.59321	.	.	ENSG00000120029	ENST00000370033	T	0.65364	-0.15	6.17	6.17	0.99709	.	0.051755	0.85682	D	0.000000	T	0.56202	0.1969	L	0.46157	1.445	0.80722	D	1	B	0.26258	0.145	B	0.24974	0.057	T	0.54456	-0.8291	10	0.06494	T	0.89	-12.8406	20.8794	0.99867	0.0:0.0:1.0:0.0	.	267	Q5T2E6	CJ076_HUMAN	K	267	ENSP00000359050:Q267K	ENSP00000359050:Q267K	Q	-	1	0	C10orf76	103761502	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.097000	0.89539	2.941000	0.99782	0.655000	0.94253	CAA	C10orf76	-	superfamily_ARM-type_fold	ENSG00000120029		0.343	C10orf76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf76	HGNC	protein_coding	OTTHUMT00000050007.1	-	0.00	20	0	G	NM_024541		103771512	-1	tier1	-	no_errors	ENST00000370033	ensembl	human	known	74_37	missense	17.39	19	4	SNP	1.000	T
C11orf54	28970	genome.wustl.edu	37	11	93488460	93488460	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:93488460G>T	ENST00000331239.4	+	6	594	c.415G>T	c.(415-417)Ggg>Tgg	p.G139W	C11orf54_ENST00000540113.1_Missense_Mutation_p.G120W|C11orf54_ENST00000354421.3_Missense_Mutation_p.G139W|C11orf54_ENST00000528288.1_Missense_Mutation_p.G139W|C11orf54_ENST00000528099.1_Missense_Mutation_p.G139W			Q9H0W9	CK054_HUMAN	chromosome 11 open reading frame 54	139					metabolic process (GO:0008152)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)	8		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TGCAGATGGAGGGTGCCTACT	0.433																																																	0													105.0	98.0	101.0					11																	93488460		2201	4298	6499	SO:0001583	missense	0			AF092133	CCDS8294.1, CCDS66204.1, CCDS73365.1, CCDS73366.1	11q21	2012-08-09			ENSG00000182919	ENSG00000182919			30204	protein-coding gene	gene with protein product		615810				16522806	Standard	NM_014039		Approved	PTD012	uc001pef.3	Q9H0W9	OTTHUMG00000167452	ENST00000331239.4:c.415G>T	11.37:g.93488460G>T	ENSP00000331209:p.Gly139Trp		A8K850|Q6FI88|Q6XYB0|Q96EI3|Q96IX1|Q9Y6B4	Missense_Mutation	SNP	pfam_DUF1907	p.G139W	ENST00000331239.4	37	c.415		11	.	.	.	.	.	.	.	.	.	.	G	19.43	3.826809	0.71143	.	.	ENSG00000182919	ENST00000528288;ENST00000331239;ENST00000528099;ENST00000354421;ENST00000540113;ENST00000530620;ENST00000524485;ENST00000527363;ENST00000526335;ENST00000533154	.	.	.	5.94	5.02	0.67125	Domain of unknown function DUF1907 (1);	0.356623	0.36703	N	0.002455	T	0.62332	0.2419	L	0.53249	1.67	0.35076	D	0.762985	D;P	0.67145	0.996;0.956	P;P	0.58873	0.847;0.694	T	0.74156	-0.3756	9	0.72032	D	0.01	-3.5873	11.5545	0.50739	0.1382:0.0:0.8618:0.0	.	139;139	Q9H0W9;Q9H0W9-3	CK054_HUMAN;.	W	139;139;139;139;120;120;120;139;139;28	.	ENSP00000331209:G139W	G	+	1	0	C11orf54	93128108	1.000000	0.71417	0.995000	0.50966	0.964000	0.63967	2.833000	0.48159	1.483000	0.48342	0.591000	0.81541	GGG	C11orf54	-	pfam_DUF1907	ENSG00000182919		0.433	C11orf54-002	KNOWN	basic|appris_principal	protein_coding	C11orf54	HGNC	protein_coding	OTTHUMT00000394671.1		0.00	70	0	G	NM_014039		93488460	+1			no_errors	ENST00000331239	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
CFAP54	144535	genome.wustl.edu	37	12	97038026	97038026	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:97038026A>C	ENST00000524981.4	+	33	4410	c.4387A>C	c.(4387-4389)Agt>Cgt	p.S1463R				Q96N23	CL055_HUMAN		0																	TCTAATATTAAGTTATGTTAA	0.403																																																	0																																										SO:0001583	missense	0																														ENST00000524981.4:c.4387A>C	12.37:g.97038026A>C	ENSP00000431759:p.Ser1463Arg			Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.S1463R	ENST00000524981.4	37	c.4387		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.84|10.84	1.464137|1.464137	0.26335|0.26335	.|.	.|.	ENSG00000188596|ENSG00000188596	ENST00000550977|ENST00000524981	.|.	.|.	.|.	5.68|5.68	1.58|1.58	0.23477|0.23477	.|.	.|.	.|.	.|.	.|.	T|T	0.17916|0.17916	0.0430|0.0430	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	1|1	.|B	.|0.10296	.|0.003	.|B	.|0.10450	.|0.005	T|T	0.31696|0.31696	-0.9934|-0.9934	5|8	.|0.15499	.|T	.|0.54	.|.	5.6166|5.6166	0.17434|0.17434	0.7018:0.1194:0.0731:0.1057|0.7018:0.1194:0.0731:0.1057	.|.	.|1463	.|E9PJL5	.|.	T|R	209|1463	.|.	.|ENSP00000431759:S1463R	K|S	+|+	2|1	0|0	C12orf63|C12orf63	95562157|95562157	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.453000|0.453000	0.21811|0.21811	0.070000|0.070000	0.16634|0.16634	-1.139000|-1.139000	0.01908|0.01908	AAG|AGT	C12orf55	-	NULL	ENSG00000188596		0.403	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	-	0.00	28	0	A			97038026	+1	tier1	-	no_errors	ENST00000524981	ensembl	human	putative	74_37	missense	76.00	6	19	SNP	0.000	C
C16orf96	342346	genome.wustl.edu	37	16	4626216	4626216	+	Missense_Mutation	SNP	G	G	A	rs368874235	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:4626216G>A	ENST00000444310.4	+	5	1735	c.1735G>A	c.(1735-1737)Gcc>Acc	p.A579T		NM_001145011.1	NP_001138483.1			chromosome 16 open reading frame 96											NS(1)|breast(1)|endometrium(6)|kidney(1)|skin(3)	12						cgcagcctacgccgctgccAC	0.652													G|||	9	0.00179712	0.0008	0.0	5008	,	,		14314	0.0069		0.001	False		,,,				2504	0.0																0													7.0	17.0	14.0					16																	4626216		673	1550	2223	SO:0001583	missense	0				CCDS53986.1	16p13.3	2012-10-10			ENSG00000205832	ENSG00000205832			40031	protein-coding gene	gene with protein product							Standard	NM_001145011		Approved		uc010uxn.2	A6NNT2	OTTHUMG00000176519	ENST00000444310.4:c.1735G>A	16.37:g.4626216G>A	ENSP00000415027:p.Ala579Thr			Missense_Mutation	SNP	NULL	p.A579T	ENST00000444310.4	37	c.1735	CCDS53986.1	16	.	.	.	.	.	.	.	.	.	.	G	17.10	3.301958	0.60195	.	.	ENSG00000205832	ENST00000444310	.	.	.	3.92	1.91	0.25777	.	.	.	.	.	T	0.11452	0.0279	N	0.14661	0.345	0.09310	N	1	P	0.39964	0.697	B	0.28784	0.094	T	0.13442	-1.0509	8	0.10902	T	0.67	.	5.9773	0.19387	0.2474:0.0:0.7526:0.0	.	579	A6NNT2	CP096_HUMAN	T	579	.	ENSP00000415027:A579T	A	+	1	0	C16orf96	4566217	0.232000	0.23762	0.002000	0.10522	0.003000	0.03518	2.096000	0.41738	0.594000	0.29761	0.313000	0.20887	GCC	C16orf96	-	NULL	ENSG00000205832		0.652	C16orf96-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C16orf96	HGNC	protein_coding	OTTHUMT00000432384.1	-	0.00	18	0	G	NM_001145011		4626216	+1	tier1	-	no_errors	ENST00000444310	ensembl	human	known	74_37	missense	40.00	12	8	SNP	0.003	A
C19orf44	84167	genome.wustl.edu	37	19	16620485	16620485	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:16620485C>T	ENST00000221671.3	+	5	1481	c.1325C>T	c.(1324-1326)tCt>tTt	p.S442F	C19orf44_ENST00000594035.1_Missense_Mutation_p.S442F|CTD-3222D19.2_ENST00000409035.1_Intron	NM_032207.2	NP_115583.1	Q9H6X5	CS044_HUMAN	chromosome 19 open reading frame 44	442										endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	16						AGCTCGGCTTCTGCCATCCAG	0.592																																																	0													66.0	64.0	65.0					19																	16620485		2203	4300	6503	SO:0001583	missense	0			AK025395	CCDS12345.1, CCDS74306.1	19p13.11	2011-11-24			ENSG00000105072	ENSG00000105072			26141	protein-coding gene	gene with protein product						12477932	Standard	NM_032207		Approved	FLJ21742	uc002neh.1	Q9H6X5		ENST00000221671.3:c.1325C>T	19.37:g.16620485C>T	ENSP00000221671:p.Ser442Phe		Q8N6Y7	Missense_Mutation	SNP	NULL	p.S442F	ENST00000221671.3	37	c.1325	CCDS12345.1	19	.	.	.	.	.	.	.	.	.	.	C	11.80	1.747707	0.30955	.	.	ENSG00000105072	ENST00000221671	.	.	.	4.25	3.21	0.36854	.	1.265960	0.05486	N	0.555675	T	0.33089	0.0851	L	0.36672	1.1	0.09310	N	1	B;P;P	0.43094	0.372;0.514;0.799	B;B;B	0.41764	0.221;0.264;0.366	T	0.21930	-1.0231	9	0.39692	T	0.17	0.157	8.4389	0.32803	0.0:0.8893:0.0:0.1107	.	442;115;442	Q9H6X5;B4DN63;Q9H6X5-2	CS044_HUMAN;.;.	F	442	.	ENSP00000221671:S442F	S	+	2	0	C19orf44	16481485	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.046000	0.11983	0.933000	0.37291	0.555000	0.69702	TCT	C19orf44	-	NULL	ENSG00000105072		0.592	C19orf44-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C19orf44	HGNC	protein_coding	OTTHUMT00000461218.1	-	0.00	11	0	C	NM_032207		16620485	+1	tier1	-	no_errors	ENST00000221671	ensembl	human	known	74_37	missense	38.89	11	7	SNP	0.002	T
C2orf80	389073	genome.wustl.edu	37	2	209045468	209045468	+	Splice_Site	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:209045468C>T	ENST00000341287.4	-	6	562		c.e6+1		C2orf80_ENST00000451346.1_Splice_Site|C2orf80_ENST00000453017.1_Splice_Site	NM_001099334.2	NP_001092804	Q0P641	CB080_HUMAN	chromosome 2 open reading frame 80											endometrium(2)|large_intestine(3)|lung(6)|skin(2)	13						GTCACCCTTACCTTGATGGTA	0.333																																																	0													105.0	98.0	100.0					2																	209045468		1806	4078	5884	SO:0001630	splice_region_variant	0			AC016697, AW136505, BC035737	CCDS42809.1	2q33.3	2013-10-31			ENSG00000188674	ENSG00000188674			34352	protein-coding gene	gene with protein product	"""gonad development associated 1"""	615536				22080834, 24055526	Standard	NM_001099334		Approved	LOC389073, GONDA1	uc002vcr.3	Q0P641	OTTHUMG00000154751	ENST00000341287.4:c.366+1G>A	2.37:g.209045468C>T			A6NKZ3	Splice_Site	SNP	-	e5+1	ENST00000341287.4	37	c.366+1	CCDS42809.1	2	.	.	.	.	.	.	.	.	.	.	C	12.16	1.853936	0.32791	.	.	ENSG00000188674	ENST00000451342;ENST00000341287;ENST00000451346;ENST00000428015;ENST00000453017;ENST00000423952	.	.	.	4.12	4.12	0.48240	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1501	0.54046	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C2orf80	208753713	1.000000	0.71417	0.998000	0.56505	0.496000	0.33645	3.303000	0.51858	2.584000	0.87258	0.563000	0.77884	.	C2orf80	-	-	ENSG00000188674		0.333	C2orf80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf80	HGNC	protein_coding	OTTHUMT00000336931.1	-	0.00	16	0	C	NM_001099334	Intron	209045468	-1	tier1	-	no_errors	ENST00000341287	ensembl	human	known	74_37	splice_site	40.00	15	10	SNP	0.999	T
SUGCT	79783	genome.wustl.edu	37	7	40498755	40498755	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:40498755G>T	ENST00000335693.4	+	11	988	c.965G>T	c.(964-966)cGg>cTg	p.R322L	C7orf10_ENST00000309930.5_Missense_Mutation_p.R322L|C7orf10_ENST00000401647.2_Missense_Mutation_p.R274L	NM_001193313.1	NP_001180242.1	Q9HAC7	SUCHY_HUMAN		322					metabolic process (GO:0008152)	mitochondrion (GO:0005739)	succinate-hydroxymethylglutarate CoA-transferase activity (GO:0047369)			endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)	18						AACCACCTTCGGGTACACAAT	0.284																																																	0													49.0	50.0	50.0					7																	40498755		1790	4061	5851	SO:0001583	missense	0																														ENST00000335693.4:c.965G>T	7.37:g.40498755G>T	ENSP00000338475:p.Arg322Leu		A4D1W5|B4DR73|Q4KMW4|Q4KMW8|Q4KMZ0|Q8TE00|Q8TEY1	Missense_Mutation	SNP	pfam_CoA-Trfase_fam_III,superfamily_CoA-Trfase_III_dom	p.R322L	ENST00000335693.4	37	c.965	CCDS55105.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.8|22.8	4.331749|4.331749	0.81801|0.81801	.|.	.|.	ENSG00000175600|ENSG00000175600	ENST00000416370|ENST00000309930;ENST00000401647;ENST00000335693	.|D;D;D	.|0.82984	.|-1.67;-1.67;-1.67	5.37|5.37	5.37|5.37	0.77165|0.77165	.|CoA-transferase family III domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92404|0.92404	0.7589|0.7589	M|M	0.90309|0.90309	3.105|3.105	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;1.0;1.0	D|D	0.93505|0.93505	0.6848|0.6848	5|10	.|0.87932	.|D	.|0	-14.3559|-14.3559	14.9906|14.9906	0.71384|0.71384	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|274;322;285	.|Q4KMW8;Q9HAC7;Q9HAC7-2	.|.;CG010_HUMAN;.	W|L	317|322;274;322	.|ENSP00000312054:R322L;ENSP00000385222:R274L;ENSP00000338475:R322L	.|ENSP00000312054:R322L	G|R	+|+	1|2	0|0	C7orf10|C7orf10	40465280|40465280	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.460000|5.460000	0.66691|0.66691	2.685000|2.685000	0.91497|0.91497	0.655000|0.655000	0.94253|0.94253	GGG|CGG	C7orf10	-	superfamily_CoA-Trfase_III_dom	ENSG00000175600		0.284	C7orf10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C7orf10	HGNC	protein_coding	OTTHUMT00000338388.1	-	0.00	49	0	G			40498755	+1	tier1	-	no_errors	ENST00000309930	ensembl	human	known	74_37	missense	7.69	60	5	SNP	1.000	T
CACHD1	57685	genome.wustl.edu	37	1	65145405	65145405	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:65145405G>T	ENST00000371073.2	+	24	3372	c.3372G>T	c.(3370-3372)cgG>cgT	p.R1124R	CACHD1_ENST00000495994.1_3'UTR|CACHD1_ENST00000290039.5_Silent_p.R1073R			Q5VU97	CAHD1_HUMAN	cache domain containing 1	1124					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						TTCATCGCCGGAGCCATCAGC	0.582																																																	0													73.0	67.0	69.0					1																	65145405		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.3372G>T	1.37:g.65145405G>T			Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Silent	SNP	pfam_VWA_N,pfam_Cache_domain,pfscan_VWF_A	p.R1124	ENST00000371073.2	37	c.3372		1																																																																																			CACHD1	-	NULL	ENSG00000158966		0.582	CACHD1-201	KNOWN	basic	protein_coding	CACHD1	HGNC	protein_coding			0.00	44	0	G	NM_020925		65145405	+1			no_errors	ENST00000371073	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.244	T
CACNB1	782	genome.wustl.edu	37	17	37342801	37342801	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:37342801G>T	ENST00000394303.3	-	6	783	c.576C>A	c.(574-576)tcC>tcA	p.S192S	CACNB1_ENST00000394310.3_Silent_p.S192S|CACNB1_ENST00000344140.5_Silent_p.S192S|CACNB1_ENST00000582877.1_5'UTR	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	192					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	CTCCCAGACTGGAACTGGAGT	0.617																																					Esophageal Squamous(5;100 366 38393 41452 45827)												0													45.0	46.0	45.0					17																	37342801		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.576C>A	17.37:g.37342801G>T			A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Silent	SNP	pfam_GK/Ca_channel_bsu,pfam_VDCC_L_bsu,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b1su	p.S192	ENST00000394303.3	37	c.576	CCDS42311.1	17																																																																																			CACNB1	-	superfamily_SH3_domain	ENSG00000067191		0.617	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACNB1	HGNC	protein_coding	OTTHUMT00000256945.3	-	0.00	72	0	G			37342801	-1	tier1	-	no_errors	ENST00000394303	ensembl	human	known	74_37	silent	6.90	81	6	SNP	1.000	T
CAMTA1	23261	genome.wustl.edu	37	1	7792537	7792537	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:7792537C>T	ENST00000303635.7	+	12	3151	c.2944C>T	c.(2944-2946)Cga>Tga	p.R982*	CAMTA1_ENST00000439411.2_Nonsense_Mutation_p.R982*	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	982					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		CATCCTGGAACGACTGGAGCA	0.612			T	WWTR1	epitheliod hemangioendothelioma																																			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0													61.0	64.0	63.0					1																	7792537		2203	4300	6503	SO:0001587	stop_gained	0			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.2944C>T	1.37:g.7792537C>T	ENSP00000306522:p.Arg982*		A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Nonsense_Mutation	SNP	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.R982*	ENST00000303635.7	37	c.2944	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	C	42	9.771968	0.99260	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738	.	.	.	5.52	3.43	0.39272	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.4188	15.9496	0.79823	0.2569:0.7431:0.0:0.0	.	.	.	.	X	982;982;69	.	ENSP00000306522:R982X	R	+	1	2	CAMTA1	7715124	1.000000	0.71417	0.551000	0.28230	0.985000	0.73830	6.018000	0.70811	1.305000	0.44909	0.557000	0.71058	CGA	CAMTA1	-	NULL	ENSG00000171735		0.612	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	HGNC	protein_coding	OTTHUMT00000003588.3		0.00	14	0	C	NM_015215		7792537	+1			no_errors	ENST00000303635	ensembl	human	known	74_37	nonsense	20.00	20	5	SNP	1.000	T
CAND2	23066	genome.wustl.edu	37	3	12858855	12858855	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:12858855G>A	ENST00000456430.2	+	10	2465	c.2424G>A	c.(2422-2424)gtG>gtA	p.V808V	CAND2_ENST00000295989.5_Silent_p.V715V	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	808					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CCCGGTGTGTGGCAGCCCTCT	0.642																																					GBM(43;676 868 1633 6395 37496)												0													51.0	58.0	56.0					3																	12858855		2083	4212	6295	SO:0001819	synonymous_variant	0				CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.2424G>A	3.37:g.12858855G>A			B9EGM9|E9KL24	Silent	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.V808	ENST00000456430.2	37	c.2424	CCDS54554.1	3																																																																																			CAND2	-	superfamily_ARM-type_fold	ENSG00000144712		0.642	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND2	HGNC	protein_coding	OTTHUMT00000339856.4	-	0.00	44	0	G	XM_371617		12858855	+1	tier1	-	no_errors	ENST00000456430	ensembl	human	known	74_37	silent	30.95	29	13	SNP	1.000	A
CANX	821	genome.wustl.edu	37	5	179147423	179147423	+	Silent	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:179147423A>G	ENST00000247461.4	+	10	1244	c.1044A>G	c.(1042-1044)ggA>ggG	p.G348G	CANX_ENST00000512607.2_Silent_p.G240G|CANX_ENST00000504734.1_Silent_p.G348G|CANX_ENST00000415618.2_Silent_p.G383G|CANX_ENST00000452673.2_Silent_p.G348G	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	348	4 X approximate repeats.|Interaction with PPIB. {ECO:0000250}.|P domain (Extended arm). {ECO:0000250}.				aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	ACATGGATGGAGAATGGGAGG	0.502																																																	0													125.0	120.0	122.0					5																	179147423		2203	4300	6503	SO:0001819	synonymous_variant	0			L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.1044A>G	5.37:g.179147423A>G			B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Silent	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl_sf,superfamily_Calreticulin/calnexin_P_dom,prints_Calret/calnex	p.G383	ENST00000247461.4	37	c.1149	CCDS4447.1	5																																																																																			CANX	-	pfam_Calret/calnex,superfamily_Calreticulin/calnexin_P_dom,prints_Calret/calnex	ENSG00000127022		0.502	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CANX	HGNC	protein_coding	OTTHUMT00000253500.2	-	0.00	65	0	A	NM_001024649		179147423	+1	tier1	-	no_errors	ENST00000415618	ensembl	human	known	74_37	silent	7.41	50	4	SNP	0.970	G
CBLC	23624	genome.wustl.edu	37	19	45296802	45296802	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:45296802G>T	ENST00000270279.3	+	8	1272	c.1209G>T	c.(1207-1209)caG>caT	p.Q403H	CBLC_ENST00000341505.4_Missense_Mutation_p.Q357H	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	403	Interaction with RET.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				GTATCTACCAGTTCCACGGTC	0.652			M		AML																																			Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	0													49.0	42.0	44.0					19																	45296802		2203	4300	6503	SO:0001583	missense	0			AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	ENST00000270279.3:c.1209G>T	19.37:g.45296802G>T	ENSP00000270279:p.Gln403His		Q8N1E5|Q9Y5Z2|Q9Y5Z3	Missense_Mutation	SNP	pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Adaptor_Cbl_N_hlx,pfam_Znf_C3HC4_RING-type,superfamily_Adaptor_Cbl_N_hlx,smart_Znf_RING,pfscan_Znf_RING	p.Q403H	ENST00000270279.3	37	c.1209	CCDS12643.1	19	.	.	.	.	.	.	.	.	.	.	.	13.00	2.107439	0.37145	.	.	ENSG00000142273	ENST00000270279;ENST00000341505	D;D	0.94828	-3.53;-3.53	4.25	-8.5	0.00927	.	0.976842	0.08346	N	0.960014	D	0.85986	0.5825	L	0.34521	1.04	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.12156	0.007;0.003	T	0.72107	-0.4390	10	0.72032	D	0.01	-6.2097	1.2085	0.01899	0.3818:0.2874:0.1376:0.1932	.	357;403	Q9ULV8-2;Q9ULV8	.;CBLC_HUMAN	H	403;357	ENSP00000270279:Q403H;ENSP00000340250:Q357H	ENSP00000270279:Q403H	Q	+	3	2	CBLC	49988642	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.552000	0.02176	-1.731000	0.01360	-1.721000	0.00707	CAG	CBLC	-	NULL	ENSG00000142273		0.652	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLC	HGNC	protein_coding	OTTHUMT00000319732.2	-	0.00	42	0	G	NM_012116		45296802	+1	tier1	-	no_errors	ENST00000270279	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.000	T
CBX6	23466	genome.wustl.edu	37	22	39262762	39262762	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr22:39262762C>T	ENST00000407418.3	-	5	814	c.691G>A	c.(691-693)Gcc>Acc	p.A231T	CBX6_ENST00000216083.6_Missense_Mutation_p.A213T			O95503	CBX6_HUMAN	chromobox homolog 6	231					chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)	single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	6	Melanoma(58;0.04)					AGCGCAAAGGCGCCGAACTTC	0.682																																																	0													43.0	40.0	41.0					22																	39262762		2203	4300	6503	SO:0001583	missense	0				CCDS13980.1	22q13.1	2013-04-23			ENSG00000183741	ENSG00000183741			1556	protein-coding gene	gene with protein product							Standard	NM_014292		Approved		uc003awl.3	O95503	OTTHUMG00000150456	ENST00000407418.3:c.691G>A	22.37:g.39262762C>T	ENSP00000384490:p.Ala231Thr		A8KAH0|Q96EM5	Missense_Mutation	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow,prints_Chromo_dom_subgr	p.A231T	ENST00000407418.3	37	c.691	CCDS13980.1	22	.	.	.	.	.	.	.	.	.	.	C	10.48	1.362718	0.24684	.	.	ENSG00000183741	ENST00000407418;ENST00000216083	.	.	.	4.69	-0.512	0.11966	.	13.495900	0.00649	N	0.000554	T	0.21509	0.0518	N	0.04508	-0.205	0.25601	N	0.986595	B	0.06786	0.001	B	0.04013	0.001	T	0.23868	-1.0176	9	0.08599	T	0.76	.	9.5196	0.39126	0.0:0.5626:0.0:0.4374	.	231	O95503	CBX6_HUMAN	T	231;213	.	ENSP00000216083:A213T	A	-	1	0	CBX6	37592708	0.000000	0.05858	0.915000	0.36163	0.928000	0.56348	-1.282000	0.02799	-0.336000	0.08438	-0.481000	0.04817	GCC	CBX6	-	NULL	ENSG00000183741		0.682	CBX6-001	KNOWN	basic|CCDS	protein_coding	CBX6	HGNC	protein_coding	OTTHUMT00000318190.1	-	0.00	31	0	C	NM_014292		39262762	-1	tier1	-	no_errors	ENST00000407418	ensembl	human	known	74_37	missense	47.06	18	16	SNP	0.912	T
CCDC141	285025	genome.wustl.edu	37	2	179825996	179825996	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:179825996T>G	ENST00000409284.1	-	5	858	c.741A>C	c.(739-741)caA>caC	p.Q247H	CCDC141_ENST00000420890.2_Missense_Mutation_p.Q247H			Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141	247										NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(37)|ovary(8)|pancreas(2)|skin(4)|upper_aerodigestive_tract(1)	78			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			TCTGCAGAACTTGACTCAATT	0.438																																																	0																																										SO:0001583	missense	0			AK096821		2q31.2	2013-01-14			ENSG00000163492	ENSG00000163492		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26821	protein-coding gene	gene with protein product	"""coiled-coil protein associated with myosin II and DISC1"""					20956536	Standard	NM_173648		Approved	FLJ39502, CAMDI	uc002une.2	Q6ZP82	OTTHUMG00000132578	ENST00000409284.1:c.741A>C	2.37:g.179825996T>G	ENSP00000386503:p.Gln247His		H7C0P1|J3KNW6|Q8N8H3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Spectrin_repeat,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.Q247H	ENST00000409284.1	37	c.741		2	.	.	.	.	.	.	.	.	.	.	T	13.27	2.186146	0.38609	.	.	ENSG00000163492	ENST00000420890;ENST00000443758;ENST00000446116;ENST00000409284	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.85	2.05	0.26809	.	.	.	.	.	T	0.31949	0.0813	M	0.65975	2.015	0.80722	D	1	B	0.21905	0.062	B	0.17433	0.018	T	0.05818	-1.0862	8	.	.	.	.	7.3418	0.26641	0.1195:0.6891:0.0:0.1914	.	247	B8ZZB3	.	H	247	ENSP00000395995:Q247H;ENSP00000390190:Q247H;ENSP00000388745:Q247H;ENSP00000386503:Q247H	.	Q	-	3	2	CCDC141	179534241	0.998000	0.40836	0.992000	0.48379	0.967000	0.64934	0.473000	0.22132	0.094000	0.17404	-0.146000	0.13790	CAA	CCDC141	-	NULL	ENSG00000163492		0.438	CCDC141-003	PUTATIVE	basic	protein_coding	CCDC141	HGNC	protein_coding	OTTHUMT00000335873.1	-	0.00	50	0	T	NM_173648		179825996	-1	tier1	-	no_errors	ENST00000420890	ensembl	human	known	74_37	missense	37.10	39	23	SNP	1.000	G
CCDC170	80129	genome.wustl.edu	37	6	151857458	151857458	+	Silent	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:151857458T>G	ENST00000239374.7	+	2	162	c.63T>G	c.(61-63)acT>acG	p.T21T	CCDC170_ENST00000544131.1_3'UTR|CCDC170_ENST00000367290.5_Silent_p.T21T	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	21																	ACCAGGAAACTTACGATCATC	0.438																																																	0													92.0	87.0	88.0					6																	151857458		1835	4090	5925	SO:0001819	synonymous_variant	0			AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.63T>G	6.37:g.151857458T>G			Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Silent	SNP	superfamily_Prefoldin,superfamily_Smac_DIABLO-like	p.T21	ENST00000239374.7	37	c.63	CCDS43515.1	6																																																																																			CCDC170	-	NULL	ENSG00000120262		0.438	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC170	HGNC	protein_coding	OTTHUMT00000042727.2	-	0.00	21	0	T	NM_025059		151857458	+1	tier1	-	no_errors	ENST00000367290	ensembl	human	known	74_37	silent	30.00	21	9	SNP	0.000	G
CCNK	8812	genome.wustl.edu	37	14	99959174	99959174	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:99959174G>A	ENST00000389879.5	+	2	283	c.160G>A	c.(160-162)Gct>Act	p.A54T	CCNK_ENST00000555049.1_Missense_Mutation_p.A54T|CCNK_ENST00000557165.1_3'UTR	NM_001099402.1	NP_001092872.1	O75909	CCNK_HUMAN	cyclin K	54					cellular response to DNA damage stimulus (GO:0006974)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of cell cycle arrest (GO:0071157)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cyclin K-CDK12 complex (GO:0002944)|cyclin K-CDK13 complex (GO:0002945)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase binding (GO:0019901)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(1)|endometrium(2)|lung(3)	6		all_cancers(154;0.224)|all_epithelial(191;0.0643)|Melanoma(154;0.0866)				CCGAGAGGGCGCTCGGTTCAT	0.517																																																	0													39.0	40.0	39.0					14																	99959174		1920	4117	6037	SO:0001583	missense	0			AF060515	CCDS45160.1	14q32.2	2014-07-03			ENSG00000090061	ENSG00000090061			1596	protein-coding gene	gene with protein product		603544				9632813, 10574912	Standard	NM_001099402		Approved	CPR4	uc001ygi.4	O75909	OTTHUMG00000171495	ENST00000389879.5:c.160G>A	14.37:g.99959174G>A	ENSP00000374529:p.Ala54Thr		Q59FT6|Q86U16|Q96B63|Q9NNY9	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.A54T	ENST00000389879.5	37	c.160	CCDS45160.1	14	.	.	.	.	.	.	.	.	.	.	G	33	5.250149	0.95305	.	.	ENSG00000090061	ENST00000437596;ENST00000216279;ENST00000380246;ENST00000389879;ENST00000557441;ENST00000555049;ENST00000555842	T;T;T;T	0.11712	2.75;2.75;2.75;2.75	6.06	6.06	0.98353	Cyclin, N-terminal (1);Cyclin-like (2);	0.000000	0.85682	D	0.000000	T	0.33556	0.0867	M	0.68317	2.08	0.80722	D	1	D;D	0.71674	0.998;0.998	D;P	0.66084	0.941;0.785	T	0.00225	-1.1901	10	0.56958	D	0.05	-16.6648	20.6397	0.99537	0.0:0.0:1.0:0.0	.	54;54	O75909;O75909-2	CCNK_HUMAN;.	T	54	ENSP00000374529:A54T;ENSP00000450792:A54T;ENSP00000452307:A54T;ENSP00000450440:A54T	ENSP00000216279:A54T	A	+	1	0	CCNK	99028927	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.675000	0.98638	2.880000	0.98712	0.650000	0.86243	GCT	CCNK	-	pfam_Cyclin_N,superfamily_Cyclin-like	ENSG00000090061		0.517	CCNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNK	HGNC	protein_coding	OTTHUMT00000413721.1	-	0.00	14	0	G			99959174	+1	tier1	-	no_errors	ENST00000389879	ensembl	human	known	74_37	missense	33.33	10	5	SNP	1.000	A
CD163L1	283316	genome.wustl.edu	37	12	7527243	7527243	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:7527243G>A	ENST00000313599.3	-	13	3261	c.3204C>T	c.(3202-3204)agC>agT	p.S1068S	CD163L1_ENST00000396630.1_Silent_p.S1068S|CD163L1_ENST00000416109.2_Silent_p.S1078S|CD163L1_ENST00000544331.1_5'Flank			Q9NR16	C163B_HUMAN	CD163 molecule-like 1	1068	SRCR 10. {ECO:0000255|PROSITE- ProRule:PRU00196}.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)	p.D1069fs*27(1)|p.S1068S(1)		breast(5)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(18)|lung(37)|ovary(8)|prostate(3)|skin(6)|stomach(1)|urinary_tract(4)	96						CGTGGGCATCGCTCAGGTCCC	0.622											OREG0021653	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					2	Deletion - Frameshift(1)|Substitution - coding silent(1)	ovary(1)|large_intestine(1)											72.0	64.0	67.0					12																	7527243		2203	4300	6503	SO:0001819	synonymous_variant	0			AF264014	CCDS8577.1, CCDS73434.1	12p13.31	2006-03-28	2006-03-28			ENSG00000177675			30375	protein-coding gene	gene with protein product		606079	"""CD163 antigen-like 1"""			11124526, 11086079	Standard	XM_005253348		Approved	M160, CD163B	uc001qsy.3	Q9NR16		ENST00000313599.3:c.3204C>T	12.37:g.7527243G>A		642	B4E0G7|C9JHR7|E7EVK4|Q2M3B7|Q6UWC2	Silent	SNP	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	p.S1068	ENST00000313599.3	37	c.3204	CCDS8577.1	12																																																																																			CD163L1	-	pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000177675		0.622	CD163L1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD163L1	HGNC	protein_coding	OTTHUMT00000399329.1		0.00	19	0	G	NM_174941		7527243	-1			no_errors	ENST00000313599	ensembl	human	known	74_37	silent	11.11	16	2	SNP	0.099	A
CD1E	913	genome.wustl.edu	37	1	158325803	158325803	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:158325803C>A	ENST00000368167.3	+	4	1051	c.812C>A	c.(811-813)gCa>gAa	p.A271E	CD1E_ENST00000368156.1_Missense_Mutation_p.A181E|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000434258.1_Missense_Mutation_p.A269E|CD1E_ENST00000368161.3_Intron|CD1E_ENST00000444681.2_Missense_Mutation_p.A172E|CD1E_ENST00000368165.3_Missense_Mutation_p.A181E|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000368163.3_Intron|CD1E_ENST00000368160.3_Missense_Mutation_p.A271E|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000452291.2_Missense_Mutation_p.A82E|CD1E_ENST00000368166.3_Missense_Mutation_p.A82E	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	271	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					TATCTCCGAGCAACCCTGGAT	0.607																																																	0													99.0	99.0	99.0					1																	158325803		2203	4300	6503	SO:0001583	missense	0			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.812C>A	1.37:g.158325803C>A	ENSP00000357149:p.Ala271Glu		B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.A271E	ENST00000368167.3	37	c.812	CCDS41417.1	1	.	.	.	.	.	.	.	.	.	.	C	13.79	2.341388	0.41498	.	.	ENSG00000158488	ENST00000434258;ENST00000444681;ENST00000368167;ENST00000452291;ENST00000368165;ENST00000368166;ENST00000368160;ENST00000368156	T;T;T;T;T;T;T;T	0.02812	4.15;4.15;4.15;4.15;4.15;4.15;4.15;4.15	4.28	0.596	0.17496	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);	0.588914	0.14197	N	0.334970	T	0.04497	0.0123	M	0.72576	2.205	0.09310	N	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.998;0.998;1.0;0.99;0.996;0.998;0.989;0.999	D;D;D;D;D;D;P;D;D;D;D	0.81914	0.994;0.993;0.993;0.981;0.986;0.995;0.858;0.976;0.986;0.951;0.975	T	0.25187	-1.0139	10	0.87932	D	0	-5.0189	6.0469	0.19766	0.0:0.4103:0.0:0.5897	.	82;172;269;271;172;181;82;271;271;82;181	B4E057;B4E042;E7ET31;A2RRL5;E7EP01;P15812-5;P15812-9;P15812-2;P15812;P15812-8;P15812-6	.;.;.;.;.;.;.;.;CD1E_HUMAN;.;.	E	269;172;271;82;181;82;271;181	ENSP00000401957:A269E;ENSP00000402906:A172E;ENSP00000357149:A271E;ENSP00000416228:A82E;ENSP00000357147:A181E;ENSP00000357148:A82E;ENSP00000357142:A271E;ENSP00000357138:A181E	ENSP00000357138:A181E	A	+	2	0	CD1E	156592427	0.012000	0.17670	0.002000	0.10522	0.572000	0.35998	0.231000	0.17872	-0.060000	0.13132	0.563000	0.77884	GCA	CD1E	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000158488		0.607	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	-	0.00	50	0	C	NM_030893		158325803	+1	tier1	-	no_errors	ENST00000368167	ensembl	human	known	74_37	missense	44.07	33	26	SNP	0.002	A
CD93	22918	genome.wustl.edu	37	20	23066708	23066708	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr20:23066708G>A	ENST00000246006.4	-	1	269	c.122C>T	c.(121-123)tCg>tTg	p.S41L		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	41	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CAGCTTGCCCGAGTGGGCCGT	0.697																																																	0													26.0	23.0	24.0					20																	23066708		2200	4296	6496	SO:0001583	missense	0			U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.122C>T	20.37:g.23066708G>A	ENSP00000246006:p.Ser41Leu		O00274	Missense_Mutation	SNP	pirsf_CD93/CD141,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_MFS_dom_general_subst_transpt,smart_C-type_lectin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_C-type_lectin	p.S41L	ENST00000246006.4	37	c.122	CCDS13149.1	20	.	.	.	.	.	.	.	.	.	.	G	6.520	0.464154	0.12402	.	.	ENSG00000125810	ENST00000246006;ENST00000413585	T	0.80738	-1.41	5.88	3.96	0.45880	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.558192	0.16514	N	0.211139	T	0.63319	0.2501	N	0.13235	0.315	0.25795	N	0.984576	B	0.06786	0.001	B	0.01281	0.0	T	0.43589	-0.9382	10	0.11485	T	0.65	-11.1266	11.0412	0.47831	0.1357:0.5987:0.2657:0.0	.	41	Q9NPY3	C1QR1_HUMAN	L	41	ENSP00000246006:S41L	ENSP00000246006:S41L	S	-	2	0	CD93	23014708	0.975000	0.34042	0.998000	0.56505	0.961000	0.63080	1.617000	0.36943	0.817000	0.34445	-0.133000	0.14855	TCG	CD93	-	pirsf_CD93/CD141,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000125810		0.697	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD93	HGNC	protein_coding	OTTHUMT00000078312.2	-	0.00	15	0	G	NM_012072		23066708	-1	tier1	-	no_errors	ENST00000246006	ensembl	human	known	74_37	missense	34.62	17	9	SNP	1.000	A
CDC42BPA	8476	genome.wustl.edu	37	1	227288919	227288919	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:227288919G>T	ENST00000366769.3	-	15	3314	c.2023C>A	c.(2023-2025)Cca>Aca	p.P675T	CDC42BPA_ENST00000366764.2_Missense_Mutation_p.P675T|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.P675T|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.P675T|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.P594T|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.P675T|CDC42BPA_ENST00000334218.5_Missense_Mutation_p.P675T	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)									p.P675T(2)|p.P594T(1)		NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CATACTCCTGGTGAGTAACTA	0.259																																																	3	Substitution - Missense(3)	endometrium(3)											66.0	67.0	66.0					1																	227288919		2199	4293	6492	SO:0001583	missense	0			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.2023C>A	1.37:g.227288919G>T	ENSP00000355731:p.Pro675Thr			Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Pkinase_C,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_CRIB_dom,pfscan_CRIB_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.P675T	ENST00000366769.3	37	c.2023	CCDS1558.1	1	.	.	.	.	.	.	.	.	.	.	g	10.09	1.254280	0.22965	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000535525;ENST00000366765	T;T;T;T;T;T;T	0.64803	-0.1;-0.1;-0.1;-0.11;-0.12;-0.09;-0.08	5.57	5.57	0.84162	.	0.211271	0.49916	D	0.000132	T	0.59321	0.2185	L	0.55481	1.735	0.42055	D	0.991132	B;B;B;B	0.15473	0.01;0.001;0.004;0.013	B;B;B;B	0.15484	0.007;0.003;0.013;0.008	T	0.55464	-0.8137	10	0.16896	T	0.51	.	19.5667	0.95397	0.0:0.0:1.0:0.0	.	675;675;594;675	F5H5N0;Q5VT25-4;Q5VT25-3;Q5VT25-5	.;.;.;.	T	675;594;675;675;675;675;675	ENSP00000355731:P675T;ENSP00000355729:P594T;ENSP00000335341:P675T;ENSP00000355728:P675T;ENSP00000355726:P675T;ENSP00000443275:P675T;ENSP00000355727:P675T	ENSP00000335341:P675T	P	-	1	0	CDC42BPA	225355542	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	2.439000	0.44846	2.604000	0.88044	0.645000	0.84053	CCA	CDC42BPA	-	NULL	ENSG00000143776		0.259	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPA	HGNC	protein_coding	OTTHUMT00000091696.1		0.00	31	0	G	NM_014826		227288919	-1			no_errors	ENST00000334218	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	T
CDCA7L	55536	genome.wustl.edu	37	7	21946041	21946041	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:21946041C>G	ENST00000406877.3	-	6	1066	c.787G>C	c.(787-789)Gga>Cga	p.G263R	CDCA7L_ENST00000373934.4_Missense_Mutation_p.G217R|CDCA7L_ENST00000465490.1_5'UTR|CDCA7L_ENST00000356195.5_Missense_Mutation_p.G229R	NM_018719.4	NP_061189.2	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like	263					positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(1)|urinary_tract(1)	29						GTGATCTGTCCCTCCGAGAAG	0.542																																																	0													85.0	97.0	93.0					7																	21946041		2203	4300	6503	SO:0001583	missense	0				CCDS5374.1, CCDS47558.1, CCDS47559.1	7p15.3	2007-04-27			ENSG00000164649	ENSG00000164649			30777	protein-coding gene	gene with protein product		609685				16829576	Standard	NM_018719		Approved	RAM2, R1, JPO2	uc010kuk.3	Q96GN5	OTTHUMG00000128429	ENST00000406877.3:c.787G>C	7.37:g.21946041C>G	ENSP00000383986:p.Gly263Arg		A4D141|A6NF50|B3KTR5|B4DUT3|C9K0Y1|Q6PIL4|Q86YT0|Q8IXN5|Q96C70|Q9H9A2|Q9NPV2	Missense_Mutation	SNP	pfam_Znf-4CXXC_R1	p.G263R	ENST00000406877.3	37	c.787	CCDS5374.1	7	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418764	0.83559	.	.	ENSG00000164649	ENST00000356195;ENST00000406877;ENST00000373934	T;T;T	0.46451	0.87;0.87;0.89	5.82	5.82	0.92795	.	0.111999	0.64402	D	0.000009	T	0.60418	0.2267	M	0.72118	2.19	0.58432	D	0.999999	P;D;D	0.61080	0.484;0.981;0.989	B;P;P	0.55011	0.142;0.566;0.766	T	0.60969	-0.7157	10	0.56958	D	0.05	-0.7767	20.0953	0.97838	0.0:1.0:0.0:0.0	.	217;263;262	C9K0Y1;Q96GN5;Q96GN5-2	.;CDA7L_HUMAN;.	R	229;263;217	ENSP00000348523:G229R;ENSP00000383986:G263R;ENSP00000363045:G217R	ENSP00000348523:G229R	G	-	1	0	CDCA7L	21912566	1.000000	0.71417	0.994000	0.49952	0.735000	0.41995	6.070000	0.71220	2.767000	0.95098	0.655000	0.94253	GGA	CDCA7L	-	NULL	ENSG00000164649		0.542	CDCA7L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA7L	HGNC	protein_coding	OTTHUMT00000250218.4		0.00	47	0	C	NM_018719		21946041	-1			no_errors	ENST00000406877	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	G
CDH11	1009	genome.wustl.edu	37	16	65016132	65016132	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:65016132A>C	ENST00000268603.4	-	8	1687	c.1072T>G	c.(1072-1074)Ttt>Gtt	p.F358V	CDH11_ENST00000394156.3_Missense_Mutation_p.F358V|CDH11_ENST00000566827.1_Missense_Mutation_p.F232V	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	358	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TTGCTGATAAACTTCGGGTCG	0.473			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													147.0	117.0	127.0					16																	65016132		2203	4300	6503	SO:0001583	missense	0			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1072T>G	16.37:g.65016132A>C	ENSP00000268603:p.Phe358Val		A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F358V	ENST00000268603.4	37	c.1072	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	A	25.7	4.665117	0.88251	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.57273	0.41;0.44	5.61	5.61	0.85477	Cadherin (4);Cadherin-like (1);	0.044072	0.85682	D	0.000000	T	0.71728	0.3374	M	0.81497	2.545	0.58432	D	0.999998	P;P	0.43392	0.805;0.747	P;P	0.58172	0.559;0.834	T	0.75218	-0.3395	10	0.72032	D	0.01	.	15.2783	0.73760	1.0:0.0:0.0:0.0	.	358;358	P55287-2;P55287	.;CAD11_HUMAN	V	358;358;341	ENSP00000268603:F358V;ENSP00000377711:F358V	ENSP00000268603:F358V	F	-	1	0	CDH11	63573633	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	8.818000	0.91991	2.269000	0.75478	0.533000	0.62120	TTT	CDH11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000140937		0.473	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	-	0.00	67	0	A	NM_033664		65016132	-1	tier1	-	no_errors	ENST00000268603	ensembl	human	known	74_37	missense	60.61	13	20	SNP	1.000	C
CDH20	28316	genome.wustl.edu	37	18	59206286	59206286	+	Missense_Mutation	SNP	G	G	T	rs568329311		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:59206286G>T	ENST00000262717.4	+	9	1836	c.1438G>T	c.(1438-1440)Gtc>Ttc	p.V480F	CDH20_ENST00000536675.2_Missense_Mutation_p.V480F|CDH20_ENST00000538374.1_Missense_Mutation_p.V480F			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	480	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				AAGTGTTCCTGTCACAATCAA	0.418																																																	0													174.0	160.0	165.0					18																	59206286		2203	4300	6503	SO:0001583	missense	0			AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.1438G>T	18.37:g.59206286G>T	ENSP00000262717:p.Val480Phe		Q495S3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V480F	ENST00000262717.4	37	c.1438	CCDS11977.1	18	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901222	0.92035	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.61510	0.1;0.1;0.1	6.04	6.04	0.98038	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.79287	0.4420	M	0.86502	2.82	0.80722	D	1	D	0.57571	0.98	P	0.61070	0.883	T	0.81366	-0.0965	10	0.87932	D	0	.	20.5801	0.99389	0.0:0.0:1.0:0.0	.	480	Q9HBT6	CAD20_HUMAN	F	480	ENSP00000444767:V480F;ENSP00000442226:V480F;ENSP00000262717:V480F	ENSP00000262717:V480F	V	+	1	0	CDH20	57357266	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.359000	0.73060	2.873000	0.98535	0.643000	0.83706	GTC	CDH20	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000101542		0.418	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH20	HGNC	protein_coding	OTTHUMT00000256141.2	-	0.00	53	0	G	NM_031891		59206286	+1	tier1	-	no_errors	ENST00000262717	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
CDH6	1004	genome.wustl.edu	37	5	31267714	31267714	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:31267714A>C	ENST00000265071.2	+	2	399	c.134A>C	c.(133-135)aAa>aCa	p.K45T	RP11-152K4.2_ENST00000523584.1_RNA|CDH6_ENST00000514738.1_5'UTR	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	45					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GGAAACAGCAAAAATGAGCTG	0.493																																																	0													107.0	114.0	112.0					5																	31267714		2203	4300	6503	SO:0001583	missense	0			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.134A>C	5.37:g.31267714A>C	ENSP00000265071:p.Lys45Thr		A8K5H5|Q9BWS0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K45T	ENST00000265071.2	37	c.134	CCDS3894.1	5	.	.	.	.	.	.	.	.	.	.	A	12.82	2.053047	0.36181	.	.	ENSG00000113361	ENST00000265071	T	0.57752	0.38	5.8	2.18	0.27775	.	0.580093	0.20847	N	0.084585	T	0.37517	0.1006	L	0.29908	0.895	0.20926	N	0.999825	B;B	0.31485	0.325;0.27	B;B	0.37015	0.224;0.239	T	0.27020	-1.0086	10	0.11485	T	0.65	.	8.6542	0.34053	0.6257:0.0:0.3743:0.0	.	45;45	P55285;P55285-2	CADH6_HUMAN;.	T	45	ENSP00000265071:K45T	ENSP00000265071:K45T	K	+	2	0	CDH6	31303471	0.725000	0.28048	0.775000	0.31657	0.994000	0.84299	0.718000	0.25866	0.148000	0.19059	0.533000	0.62120	AAA	CDH6	-	NULL	ENSG00000113361		0.493	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	HGNC	protein_coding	OTTHUMT00000207355.2	-	0.00	56	0	A	NM_004932		31267714	+1	tier1	-	no_errors	ENST00000265071	ensembl	human	known	74_37	missense	40.62	38	26	SNP	0.414	C
CDH6	1004	genome.wustl.edu	37	5	31318069	31318069	+	Intron	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:31318069G>T	ENST00000265071.2	+	11	2147				CDH6_ENST00000514738.1_Silent_p.V585V	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)						adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TCCCCATGGTGAGGGGCTCAC	0.527																																																	0													60.0	62.0	61.0					5																	31318069		2201	4291	6492	SO:0001627	intron_variant	0			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1882+38G>T	5.37:g.31318069G>T			A8K5H5|Q9BWS0	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V585	ENST00000265071.2	37	c.1755	CCDS3894.1	5																																																																																			CDH6	-	NULL	ENSG00000113361		0.527	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	HGNC	protein_coding	OTTHUMT00000207355.2	-	0.00	24	0	G	NM_004932		31318069	+1	tier1	-	no_errors	ENST00000514738	ensembl	human	putative	74_37	silent	32.14	19	9	SNP	1.000	T
CDK2AP1	8099	genome.wustl.edu	37	12	123746286	123746286	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:123746286G>T	ENST00000261692.2	-	4	866	c.345C>A	c.(343-345)tcC>tcA	p.S115S	CDK2AP1_ENST00000544658.1_Silent_p.S87S|RP11-282O18.3_ENST00000543217.2_RNA|CDK2AP1_ENST00000535979.1_Silent_p.S87S|CDK2AP1_ENST00000542174.1_Silent_p.S87S|RP11-282O18.3_ENST00000541002.3_RNA|RP11-282O18.3_ENST00000542427.2_RNA|CDK2AP1_ENST00000538446.1_Silent_p.S87S|RP11-282O18.3_ENST00000544890.1_RNA|RP11-282O18.7_ENST00000602352.1_RNA	NM_001270433.1|NM_001270434.1|NM_004642.3	NP_001257362.1|NP_001257363.1|NP_004633.1	O14519	CDKA1_HUMAN	cyclin-dependent kinase 2 associated protein 1	115					cell cycle (GO:0007049)|DNA-dependent DNA replication (GO:0006261)|positive regulation of protein phosphorylation (GO:0001934)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA polymerase binding (GO:0070182)			lung(2)|stomach(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000554)|Epithelial(86;0.00178)		AAGGCAGCTAGGATCTGGCAT	0.468																																																	0													155.0	139.0	145.0					12																	123746286		2203	4300	6503	SO:0001819	synonymous_variant	0			AB006077	CCDS9245.1, CCDS58289.1	12q24	2008-11-04	2008-11-04		ENSG00000111328	ENSG00000111328			14002	protein-coding gene	gene with protein product		602198	"""CDK2-associated protein 1"""			9331572, 9506968	Standard	NM_004642		Approved	DORC1, doc-1, DOC1, ST19, p12DOC-1	uc001ueq.4	O14519	OTTHUMG00000168854	ENST00000261692.2:c.345C>A	12.37:g.123746286G>T			F5GYA4	Silent	SNP	pfam_Cyclin-dep_kinase2-assoc_pr,pirsf_CDK2-associated_2	p.S115	ENST00000261692.2	37	c.345	CCDS9245.1	12																																																																																			CDK2AP1	-	pirsf_CDK2-associated_2	ENSG00000111328		0.468	CDK2AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK2AP1	HGNC	protein_coding	OTTHUMT00000401387.1	-	0.00	18	0	G	NM_004642		123746286	-1	tier1	-	no_errors	ENST00000261692	ensembl	human	known	74_37	silent	22.22	14	4	SNP	1.000	T
CDR1	1038	genome.wustl.edu	37	X	139865773	139865773	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:139865773G>T	ENST00000370532.2	-	1	950	c.759C>A	c.(757-759)ttC>ttA	p.F253L		NM_004065.2	NP_004056.2	P51861	CDR1_HUMAN	cerebellar degeneration-related protein 1, 34kDa	253										breast(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(2)|skin(4)|urinary_tract(1)	25	Acute lymphoblastic leukemia(192;7.65e-05)	Lung SC(4;0.051)				GTGTCTTCCAGAAAGAAATCC	0.413																																																	0													92.0	91.0	91.0					X																	139865773		2203	4299	6502	SO:0001583	missense	0				CCDS14670.1	Xq27.1	2013-06-13	2002-08-29		ENSG00000184258	ENSG00000184258			1798	protein-coding gene	gene with protein product	"""Cerebellar degeneration-related protein-1 (34kD)"""	302650	"""cerebellar degeneration-related protein (34kD)"""	CDR		2326268	Standard	NM_004065		Approved	CDR62A, CDR34	uc004fbg.1	P51861	OTTHUMG00000137398	ENST00000370532.2:c.759C>A	X.37:g.139865773G>T	ENSP00000359563:p.Phe253Leu		Q5JXH6	Missense_Mutation	SNP	NULL	p.F253L	ENST00000370532.2	37	c.759	CCDS14670.1	X	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603050	0.28534	.	.	ENSG00000184258	ENST00000370532	.	.	.	2.87	0.917	0.19380	.	.	.	.	.	T	0.15349	0.0370	N	0.08118	0	0.09310	N	1	B	0.20671	0.047	B	0.12156	0.007	T	0.28618	-1.0038	7	.	.	.	.	5.0232	0.14372	0.1313:0.0:0.6635:0.2051	.	253	P51861	CDR1_HUMAN	L	253	.	.	F	-	3	2	CDR1	139693439	0.000000	0.05858	0.015000	0.15790	0.012000	0.07955	0.456000	0.21859	-0.016000	0.14127	-0.567000	0.04161	TTC	CDR1	-	NULL	ENSG00000184258		0.413	CDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDR1	HGNC	protein_coding	OTTHUMT00000058583.1		0.00	70	0	G	NM_004065		139865773	-1			no_errors	ENST00000370532	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.026	T
CECR2	27443	genome.wustl.edu	37	22	17983960	17983960	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr22:17983960G>A	ENST00000400585.2	+	7	731	c.293G>A	c.(292-294)cGc>cAc	p.R98H	CECR2_ENST00000400573.5_Missense_Mutation_p.R239H|CECR2_ENST00000262608.8_Missense_Mutation_p.R220H|CECR2_ENST00000342247.5_Missense_Mutation_p.R219H			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	261					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)		p.R239H(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		GAGAGTTTTCGCGAGAGGACC	0.562																																																	1	Substitution - Missense(1)	central_nervous_system(1)											81.0	88.0	86.0					22																	17983960		1964	4145	6109	SO:0001583	missense	0			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.293G>A	22.37:g.17983960G>A	ENSP00000383428:p.Arg98His		A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R239H	ENST00000400585.2	37	c.716		22	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458572	0.84317	.	.	ENSG00000099954	ENST00000342247;ENST00000400585;ENST00000400573;ENST00000262608	T;T;T;T	0.51574	0.7;0.7;0.7;0.7	5.35	5.35	0.76521	.	0.000000	0.47852	D	0.000214	T	0.67468	0.2896	L	0.56769	1.78	0.40122	D	0.976617	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.993;0.966;0.987	T	0.69807	-0.5045	10	0.72032	D	0.01	-14.7554	19.4213	0.94723	0.0:0.0:1.0:0.0	.	261;98;261;239	Q9BXF3;B7WPH3;Q9BXF3-2;E2QRE6	CECR2_HUMAN;.;.;.	H	219;98;239;220	ENSP00000341219:R219H;ENSP00000383428:R98H;ENSP00000383417:R239H;ENSP00000262608:R220H	ENSP00000262608:R220H	R	+	2	0	CECR2	16363960	1.000000	0.71417	1.000000	0.80357	0.708000	0.40852	7.337000	0.79256	2.664000	0.90586	0.655000	0.94253	CGC	CECR2	-	NULL	ENSG00000099954		0.562	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	-	0.00	28	0	G	NM_031413		17983960	+1	tier1	-	no_errors	ENST00000400573	ensembl	human	novel	74_37	missense	40.62	19	13	SNP	1.000	A
CELA2B	51032	genome.wustl.edu	37	1	15813780	15813780	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:15813780G>T	ENST00000375910.3	+	7	665	c.640G>T	c.(640-642)Gga>Tga	p.G214*		NM_015849.2	NP_056933	P08218	CEL2B_HUMAN	chymotrypsin-like elastase family, member 2B	214	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8						CCTTCCTCAGGGAGACTCCGG	0.562																																																	0													72.0	72.0	72.0					1																	15813780		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS30605.1	1p36.21	2009-07-09			ENSG00000215704	ENSG00000215704			29995	protein-coding gene	gene with protein product	"""pancreatic elastase IIB"""	609444				3646943, 16327289	Standard	NM_015849		Approved	RP11-265F14.2, ELA2B	uc001awl.3	P08218	OTTHUMG00000002259	ENST00000375910.3:c.640-1G>T	1.37:g.15813780G>T			Q14D16|Q6ISM5|Q96QV5	Nonsense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.G214*	ENST00000375910.3	37	c.640	CCDS30605.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.283974	0.95489	.	.	ENSG00000215704	ENST00000375910	.	.	.	4.73	4.73	0.59995	.	0.000000	0.56097	U	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6055	0.76668	0.0:0.0:1.0:0.0	.	.	.	.	X	214	.	.	G	+	1	0	CELA2B	15686367	1.000000	0.71417	0.987000	0.45799	0.763000	0.43281	9.475000	0.97721	2.315000	0.78130	0.597000	0.82753	GGA	CELA2B	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	ENSG00000215704		0.562	CELA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA2B	HGNC	protein_coding	OTTHUMT00000006448.1	-	0.00	63	0	G	NM_015849	Nonsense_Mutation	15813780	+1	tier1	-	no_errors	ENST00000375910	ensembl	human	known	74_37	nonsense	7.84	47	4	SNP	1.000	T
CEP57L1	285753	genome.wustl.edu	37	6	109481828	109481828	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:109481828G>T	ENST00000517392.1	+	10	1496	c.1070G>T	c.(1069-1071)tGt>tTt	p.C357F	CEP57L1_ENST00000368968.2_Missense_Mutation_p.C357F|CEP57L1_ENST00000368970.2_Missense_Mutation_p.C374F|CEP57L1_ENST00000407272.1_Missense_Mutation_p.C357F|CEP57L1_ENST00000336977.4_Missense_Mutation_p.C257F|CEP57L1_ENST00000521522.1_Missense_Mutation_p.C304F|CEP57L1_ENST00000520883.1_Missense_Mutation_p.C257F|CEP57L1_ENST00000359793.3_Missense_Mutation_p.C357F|CEP57L1_ENST00000523787.1_Missense_Mutation_p.C360F	NM_001271852.1|NM_001271853.1	NP_001258781.1|NP_001258782.1	Q8IYX8	CE57L_HUMAN	centrosomal protein 57kDa-like 1	357					microtubule anchoring (GO:0034453)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)	11						CATTCAGTCTGTGACGACATA	0.343																																																	0													83.0	81.0	82.0					6																	109481828		2203	4298	6501	SO:0001583	missense	0			AK092723	CCDS5071.1, CCDS64491.1	6q21	2014-01-28	2010-09-30	2010-09-30	ENSG00000183137	ENSG00000183137			21561	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 182"""	C6orf182			Standard	NM_001083535		Approved	bA487F23.2, MGC21731	uc003psy.4	Q8IYX8	OTTHUMG00000015336	ENST00000517392.1:c.1070G>T	6.37:g.109481828G>T	ENSP00000427844:p.Cys357Phe		G5E992	Missense_Mutation	SNP	pfam_Cep57_MT-bd_dom	p.C357F	ENST00000517392.1	37	c.1070	CCDS5071.1	6	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.765646	0.00651	.	.	ENSG00000183137	ENST00000517392;ENST00000407272;ENST00000336977;ENST00000521522;ENST00000368968;ENST00000368970;ENST00000520883;ENST00000523787;ENST00000359793;ENST00000523174	T;T;T;T;T;T;T;T;T	0.42131	0.99;0.99;0.98;0.98;0.99;0.99;0.98;0.99;0.99	5.19	-2.46	0.06461	.	0.869304	0.10614	N	0.654175	T	0.07007	0.0178	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.32079	-0.9920	10	0.23302	T	0.38	0.9889	1.0775	0.01635	0.3981:0.1143:0.268:0.2195	.	357;357	Q8IYX8;G5E992	CE57L_HUMAN;.	F	357;357;257;304;357;374;257;360;357;138	ENSP00000427844:C357F;ENSP00000383936:C357F;ENSP00000337392:C257F;ENSP00000428344:C304F;ENSP00000357964:C357F;ENSP00000357966:C374F;ENSP00000430011:C257F;ENSP00000430529:C360F;ENSP00000352841:C357F	ENSP00000337392:C257F	C	+	2	0	CEP57L1	109588521	0.166000	0.22962	0.098000	0.21074	0.100000	0.18952	0.107000	0.15375	-0.363000	0.08101	-0.158000	0.13435	TGT	CEP57L1	-	pfam_Cep57_MT-bd_dom	ENSG00000183137		0.343	CEP57L1-001	KNOWN	basic|CCDS	protein_coding	CEP57L1	HGNC	protein_coding	OTTHUMT00000041734.4	-	0.00	23	0	G	NM_173830		109481828	+1	tier1	-	no_errors	ENST00000359793	ensembl	human	known	74_37	missense	17.39	19	4	SNP	0.016	T
CFHR5	81494	genome.wustl.edu	37	1	196952103	196952103	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:196952103A>C	ENST00000256785.4	+	2	256	c.147A>C	c.(145-147)gaA>gaC	p.E49D	CFHR5_ENST00000367414.5_Missense_Mutation_p.E73D			Q9BXR6	FHR5_HUMAN	complement factor H-related 5	49	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, alternative pathway (GO:0006957)	extracellular region (GO:0005576)				NS(2)|breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(23)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)	49						CTACAGGGGAAGTTTTCTATT	0.373																																																	0													110.0	108.0	109.0					1																	196952103		2203	4300	6503	SO:0001583	missense	0			AF295327	CCDS1387.1	1q31.3	2014-09-17		2006-02-28	ENSG00000134389	ENSG00000134389		"""Complement system"""	24668	protein-coding gene	gene with protein product	"""factor H related protein 5"""	608593		CFHL5		11058592, 12041828	Standard	NM_030787		Approved	FHR5, FHR-5	uc001gts.4	Q9BXR6	OTTHUMG00000036517	ENST00000256785.4:c.147A>C	1.37:g.196952103A>C	ENSP00000256785:p.Glu49Asp		Q2NKK2	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.E73D	ENST00000256785.4	37	c.219	CCDS1387.1	1	.	.	.	.	.	.	.	.	.	.	.	15.30	2.793073	0.50102	.	.	ENSG00000134389	ENST00000367414;ENST00000256785	T;T	0.65364	-0.15;-0.15	2.22	-0.138	0.13464	Complement control module (2);Sushi/SCR/CCP (2);	.	.	.	.	T	0.48607	0.1509	L	0.40543	1.245	0.09310	N	1	B	0.33345	0.409	B	0.41135	0.348	T	0.39761	-0.9598	9	0.08837	T	0.75	.	4.146	0.10215	0.6094:0.0:0.3906:0.0	.	49	Q9BXR6	FHR5_HUMAN	D	73;49	ENSP00000356384:E73D;ENSP00000256785:E49D	ENSP00000256785:E49D	E	+	3	2	CFHR5	195218726	0.000000	0.05858	0.000000	0.03702	0.662000	0.39071	-0.068000	0.11561	-0.042000	0.13535	0.254000	0.18369	GAA	CFHR5	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP	ENSG00000134389		0.373	CFHR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR5	HGNC	protein_coding	OTTHUMT00000088814.2	-	0.00	47	0	A	NM_030787		196952103	+1	tier1	-	no_errors	ENST00000367414	ensembl	human	known	74_37	missense	70.83	7	17	SNP	0.000	C
CHAMP1	283489	genome.wustl.edu	37	13	115089492	115089492	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr13:115089492G>T	ENST00000361283.1	+	3	484	c.175G>T	c.(175-177)Gca>Tca	p.A59S		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	59					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.A59>?(1)									CCAGAAAAGTGCAAAGTTATT	0.378																																																	1	Complex(1)	large_intestine(1)											100.0	93.0	96.0					13																	115089492		2203	4300	6503	SO:0001583	missense	0			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.175G>T	13.37:g.115089492G>T	ENSP00000354730:p.Ala59Ser		B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A59S	ENST00000361283.1	37	c.175	CCDS9545.1	13	.	.	.	.	.	.	.	.	.	.	G	29.1	4.976648	0.92982	.	.	ENSG00000198824	ENST00000361283	T	0.02890	4.12	5.96	5.96	0.96718	.	0.000000	0.56097	D	0.000028	T	0.10766	0.0263	L	0.36672	1.1	0.45427	D	0.998409	D	0.89917	1.0	D	0.87578	0.998	T	0.18871	-1.0323	9	.	.	.	-14.0419	20.3928	0.98949	0.0:0.0:1.0:0.0	.	59	Q96JM3	ZN828_HUMAN	S	59	ENSP00000354730:A59S	.	A	+	1	0	ZNF828	114107594	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.134000	0.71689	2.813000	0.96785	0.655000	0.94253	GCA	CHAMP1	-	NULL	ENSG00000198824		0.378	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAMP1	HGNC	protein_coding	OTTHUMT00000045977.2		0.00	16	0	G	NM_032436		115089492	+1			no_errors	ENST00000361283	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	T
CHIA	27159	genome.wustl.edu	37	1	111861192	111861192	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:111861192C>A	ENST00000369740.1	+	9	910	c.807C>A	c.(805-807)caC>caA	p.H269Q	RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000343320.6_Missense_Mutation_p.H269Q|CHIA_ENST00000451398.2_Missense_Mutation_p.H108Q|CHIA_ENST00000483391.1_Missense_Mutation_p.H108Q|CHIA_ENST00000430615.1_Missense_Mutation_p.H161Q|CHIA_ENST00000353665.6_Missense_Mutation_p.H108Q	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	269					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		CCTATGGACACAACTTCATCC	0.527																																																	0													162.0	149.0	154.0					1																	111861192		2203	4300	6503	SO:0001583	missense	0			AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.807C>A	1.37:g.111861192C>A	ENSP00000358755:p.His269Gln		Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,pfam_Chitin-bd_dom,superfamily_Glycoside_hydrolase_SF,superfamily_Chitin-bd_dom,smart_Chitinase_II,smart_Chitin-bd_dom,pfscan_Chitin-bd_dom	p.H269Q	ENST00000369740.1	37	c.807	CCDS41368.1	1	.	.	.	.	.	.	.	.	.	.	C	6.988	0.552398	0.13374	.	.	ENSG00000134216	ENST00000422815;ENST00000483391;ENST00000369740;ENST00000343320;ENST00000451398;ENST00000353665;ENST00000489524;ENST00000430615	T;T;T;T;T;T;T;T	0.41400	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	4.84	2.9	0.33743	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.252134	0.29737	U	0.011324	T	0.16896	0.0406	L	0.31578	0.945	0.20403	N	0.999904	B	0.27765	0.188	B	0.37650	0.255	T	0.19095	-1.0316	10	0.56958	D	0.05	-17.2046	7.5741	0.27926	0.1694:0.7407:0.0:0.0899	.	269	Q9BZP6	CHIA_HUMAN	Q	213;108;269;269;108;108;108;161	ENSP00000387671:H213Q;ENSP00000436946:H108Q;ENSP00000358755:H269Q;ENSP00000341828:H269Q;ENSP00000390476:H108Q;ENSP00000338970:H108Q;ENSP00000433309:H108Q;ENSP00000391132:H161Q	ENSP00000341828:H269Q	H	+	3	2	CHIA	111662715	0.000000	0.05858	0.141000	0.22245	0.117000	0.20001	-1.273000	0.02823	0.523000	0.28482	0.563000	0.77884	CAC	CHIA	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000134216		0.527	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIA	HGNC	protein_coding	OTTHUMT00000030710.1	-	0.00	38	0	C			111861192	+1	tier1	-	no_errors	ENST00000343320	ensembl	human	known	74_37	missense	46.51	23	20	SNP	0.172	A
CMYA5	202333	genome.wustl.edu	37	5	79027139	79027140	+	Frame_Shift_Ins	INS	-	-	CATC			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:79027139_79027140insCATC	ENST00000446378.2	+	2	2582_2583	c.2551_2552insCATC	c.(2551-2553)gcafs	p.-852fs		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5						negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		TTTGGTTGTTGCATCTGAACAC	0.48																																																	0																																										SO:0001589	frameshift_variant	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.2552_2555dupCATC	5.37:g.79027140_79027143dupCATC	ENSP00000394770:p.Ser852fs		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Frame_Shift_Ins	INS	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.E853fs	ENST00000446378.2	37	c.2551_2552	CCDS47238.1	5																																																																																			CMYA5	-	NULL	ENSG00000164309		0.480	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1		0.00	68	0	-	NM_153610		79027140	+1	tier1		no_errors	ENST00000446378	ensembl	human	known	74_37	frame_shift_ins	58.33	10	14	INS	0.000:0.000	CATC
CNN1	1264	genome.wustl.edu	37	19	11649767	11649767	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:11649767G>T	ENST00000252456.2	+	1	236	c.25G>T	c.(25-27)Ggc>Tgc	p.G9C	CNN1_ENST00000592923.1_5'UTR|CNN1_ENST00000544952.1_5'Flank|CNN1_ENST00000535659.2_5'UTR|CNN1_ENST00000588468.1_3'UTR	NM_001299.4	NP_001290.2	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle	9					actomyosin structure organization (GO:0031032)|regulation of smooth muscle contraction (GO:0006940)	cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				breast(1)|endometrium(2)|large_intestine(4)|lung(2)	9						CTTCAACCGAGGCCCTGCCTA	0.662																																																	0													29.0	28.0	28.0					19																	11649767		2203	4299	6502	SO:0001583	missense	0			U37019	CCDS12263.1	19p13.2-p13.1	2008-07-16				ENSG00000130176			2155	protein-coding gene	gene with protein product		600806				8526917, 9332369	Standard	XM_005259741		Approved	SMCC, Sm-Calp	uc002msc.1	P51911		ENST00000252456.2:c.25G>T	19.37:g.11649767G>T	ENSP00000252456:p.Gly9Cys		B2R868|B4DUX6|O00638|Q15416|Q8IY93|Q99438	Missense_Mutation	SNP	pfam_Calponin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain,pfscan_Calponin_repeat,prints_SM22_calponin,prints_Calponin	p.G9C	ENST00000252456.2	37	c.25	CCDS12263.1	19	.	.	.	.	.	.	.	.	.	.	G	27.8	4.865995	0.91511	.	.	ENSG00000130176	ENST00000252456	T	0.61980	0.06	4.53	4.53	0.55603	Calponin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.81503	0.4836	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.68192	0.956	D	0.86111	0.1562	10	0.87932	D	0	-31.4134	16.0271	0.80551	0.0:0.0:1.0:0.0	.	9	P51911	CNN1_HUMAN	C	9	ENSP00000252456:G9C	ENSP00000252456:G9C	G	+	1	0	CNN1	11510767	1.000000	0.71417	0.996000	0.52242	0.978000	0.69477	7.453000	0.80700	2.053000	0.61076	0.448000	0.29417	GGC	CNN1	-	superfamily_CH-domain,prints_SM22_calponin	ENSG00000130176		0.662	CNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNN1	HGNC	protein_coding	OTTHUMT00000458854.1		0.00	47	0	G	NM_001299		11649767	+1			no_errors	ENST00000252456	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
CNTLN	54875	genome.wustl.edu	37	9	17135344	17135345	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:17135344_17135345insA	ENST00000380647.3	+	1	365_366	c.281_282insA	c.(280-285)gtagagfs	p.E95fs	CNTLN_ENST00000380641.4_Frame_Shift_Ins_p.E95fs|CNTLN_ENST00000425824.1_Frame_Shift_Ins_p.E95fs|CNTLN_ENST00000484374.1_3'UTR|CNTLN_ENST00000262360.5_Frame_Shift_Ins_p.E95fs			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	95					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		GGCATCTCGGTAGAGGAGGCGA	0.673																																																	0																																										SO:0001589	frameshift_variant	0			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.282dupA	9.37:g.17135345_17135345dupA	ENSP00000370021:p.Glu95fs		A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Frame_Shift_Ins	INS	superfamily_Prefoldin	p.E95fs	ENST00000380647.3	37	c.281_282	CCDS43789.1	9																																																																																			CNTLN	-	NULL	ENSG00000044459		0.673	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTLN	HGNC	protein_coding	OTTHUMT00000051793.3		0.00	27	0	-	NM_017738		17135345	+1	tier1		no_errors	ENST00000380647	ensembl	human	known	74_37	frame_shift_ins	22.58	24	7	INS	0.947:0.972	A
CNTN5	53942	genome.wustl.edu	37	11	100061924	100061924	+	Silent	SNP	C	C	T	rs201116802		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:100061924C>T	ENST00000524871.1	+	14	1937	c.1647C>T	c.(1645-1647)taC>taT	p.Y549Y	CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000279463.3_Silent_p.Y549Y|CNTN5_ENST00000418526.2_Silent_p.Y475Y|CNTN5_ENST00000527185.1_Silent_p.Y549Y|CNTN5_ENST00000528682.1_Silent_p.Y549Y	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	549	Ig-like C2-type 5.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AGGGAAAGTACGTTTGCCGAG	0.388													C|||	1	0.000199681	0.0	0.0	5008	,	,		16165	0.0		0.0	False		,,,				2504	0.001																0													70.0	73.0	72.0					11																	100061924		1836	4081	5917	SO:0001819	synonymous_variant	0			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1647C>T	11.37:g.100061924C>T			A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Y549	ENST00000524871.1	37	c.1647	CCDS53696.1	11																																																																																			CNTN5	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000149972		0.388	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTN5	HGNC	protein_coding	OTTHUMT00000395148.2	-	0.00	38	0	C	NM_014361		100061924	+1	tier1	-	no_errors	ENST00000279463	ensembl	human	known	74_37	silent	53.19	22	25	SNP	0.288	T
CNTRL	11064	genome.wustl.edu	37	9	123888117	123888117	+	Missense_Mutation	SNP	G	G	A	rs368951469		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:123888117G>A	ENST00000373855.1	+	14	2188	c.1928G>A	c.(1927-1929)cGg>cAg	p.R643Q	CNTRL_ENST00000373847.1_Missense_Mutation_p.R91Q|CNTRL_ENST00000238341.5_Missense_Mutation_p.R643Q|CNTRL_ENST00000373850.1_Missense_Mutation_p.R91Q			Q7Z7A1	CNTRL_HUMAN	centriolin	643					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AGGAAGCTGCGGGATGAGAAA	0.478																																																	0													112.0	117.0	115.0					9																	123888117		2203	4300	6503	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.1928G>A	9.37:g.123888117G>A	ENSP00000362962:p.Arg643Gln		A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.R643Q	ENST00000373855.1	37	c.1928	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	G	2.144	-0.396065	0.04899	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000373851;ENST00000373850;ENST00000373847	T;T;T;T	0.25250	2.15;2.15;1.85;1.81	5.7	2.13	0.27403	.	.	.	.	.	T	0.07279	0.0184	N	0.01168	-0.975	0.21184	N	0.999765	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.36065	-0.9763	9	0.02654	T	1	.	8.9276	0.35650	0.7867:0.0:0.2133:0.0	.	643;643;643	B2RP65;F5GZN0;Q7Z7A1	.;.;CNTRL_HUMAN	Q	643;643;643;125;91;91	ENSP00000362962:R643Q;ENSP00000238341:R643Q;ENSP00000362956:R91Q;ENSP00000362953:R91Q	ENSP00000238341:R643Q	R	+	2	0	CNTRL	122927938	0.998000	0.40836	0.988000	0.46212	0.446000	0.32137	1.506000	0.35747	0.424000	0.26061	-1.148000	0.01847	CGG	CNTRL	-	NULL	ENSG00000119397		0.478	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	-	0.00	48	0	G	NM_007018		123888117	+1	tier1	-	no_errors	ENST00000238341	ensembl	human	known	74_37	missense	38.89	22	14	SNP	0.970	A
COL24A1	255631	genome.wustl.edu	37	1	86430729	86430729	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:86430729T>C	ENST00000370571.2	-	23	2846	c.2480A>G	c.(2479-2481)aAg>aGg	p.K827R	COL24A1_ENST00000436319.1_Missense_Mutation_p.K827R	NM_152890.5	NP_690850.2	Q17RW2	COOA1_HUMAN	collagen, type XXIV, alpha 1	827	Collagen-like 5.				extracellular matrix organization (GO:0030198)|hematopoietic progenitor cell differentiation (GO:0002244)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			NS(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(9)|liver(1)|lung(56)|ovary(4)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	101				all cancers(265;0.0627)|Epithelial(280;0.0689)		TGCATACCCCTTTTGACCTGG	0.303																																																	0													111.0	104.0	106.0					1																	86430729		1830	4071	5901	SO:0001583	missense	0			AF410793	CCDS41353.1	1p22.3-p22.2	2013-01-16			ENSG00000171502	ENSG00000171502		"""Collagens"""	20821	protein-coding gene	gene with protein product		610025					Standard	NM_152890		Approved		uc001dlj.3	Q17RW2	OTTHUMG00000010629	ENST00000370571.2:c.2480A>G	1.37:g.86430729T>C	ENSP00000359603:p.Lys827Arg		C9J1X6|Q14BD7|Q59EX5|Q5VY50|Q7Z5L5	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.K827R	ENST00000370571.2	37	c.2480	CCDS41353.1	1	.	.	.	.	.	.	.	.	.	.	T	16.09	3.025198	0.54683	.	.	ENSG00000171502	ENST00000370571;ENST00000436319	D;D	0.92965	-3.14;-3.14	5.55	5.55	0.83447	.	0.000000	0.38605	N	0.001627	D	0.89684	0.6786	N	0.25201	0.72	0.47905	D	0.999548	D	0.69078	0.997	D	0.76575	0.988	D	0.88691	0.3209	10	0.23302	T	0.38	.	13.6548	0.62330	0.0:0.0:0.0:1.0	.	827	Q17RW2	COOA1_HUMAN	R	827	ENSP00000359603:K827R;ENSP00000392531:K827R	ENSP00000359603:K827R	K	-	2	0	COL24A1	86203317	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.947000	0.63583	2.118000	0.64928	0.459000	0.35465	AAG	COL24A1	-	pfam_Collagen	ENSG00000171502		0.303	COL24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL24A1	HGNC	protein_coding	OTTHUMT00000029335.4		0.00	22	0	T	NM_152890		86430729	-1			no_errors	ENST00000370571	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	C
COL11A1	1301	genome.wustl.edu	37	1	103471658	103471658	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:103471658C>G	ENST00000370096.3	-	17	2069	c.1757G>C	c.(1756-1758)gGa>gCa	p.G586A	COL11A1_ENST00000461720.1_5'UTR|COL11A1_ENST00000353414.4_Missense_Mutation_p.G547A|COL11A1_ENST00000358392.2_Missense_Mutation_p.G598A|COL11A1_ENST00000512756.1_Missense_Mutation_p.G470A	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	586	Collagen-like 2.|Collagen-like 3.|Triple-helical region.				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TCCTCTTCCTCCATCTGCACC	0.363																																																	0													64.0	62.0	63.0					1																	103471658		2203	4300	6503	SO:0001583	missense	0			J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1757G>C	1.37:g.103471658C>G	ENSP00000359114:p.Gly586Ala		B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.G598A	ENST00000370096.3	37	c.1793	CCDS778.1	1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202658	0.79127	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000512756	D;D;D;D	0.99607	-6.27;-6.27;-6.27;-6.27	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.99736	0.9896	M	0.90198	3.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.998;0.998;0.999	D	0.97747	1.0212	10	0.87932	D	0	.	19.6772	0.95941	0.0:1.0:0.0:0.0	.	470;547;598;586	E9PCU0;P12107-3;P12107-2;P12107	.;.;.;COBA1_HUMAN	A	586;598;547;470	ENSP00000359114:G586A;ENSP00000351163:G598A;ENSP00000302551:G547A;ENSP00000426533:G470A	ENSP00000302551:G547A	G	-	2	0	COL11A1	103244246	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.336000	0.79245	2.656000	0.90262	0.655000	0.94253	GGA	COL11A1	-	pfam_Collagen	ENSG00000060718		0.363	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COL11A1	HGNC	protein_coding	OTTHUMT00000029997.1	-	0.00	25	0	C	NM_080630		103471658	-1	tier1	-	no_errors	ENST00000358392	ensembl	human	known	74_37	missense	39.13	12	9	SNP	1.000	G
COL6A6	131873	genome.wustl.edu	37	3	130394219	130394219	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:130394219G>T	ENST00000358511.6	+	36	6801	c.6770G>T	c.(6769-6771)aGt>aTt	p.S2257I	COL6A6_ENST00000453409.2_Missense_Mutation_p.S2257I	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	2257	Nonhelical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						ATGATAGAAAGTGCTCCCAAA	0.363																																																	0													47.0	44.0	45.0					3																	130394219		1905	4104	6009	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.6770G>T	3.37:g.130394219G>T	ENSP00000351310:p.Ser2257Ile		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.S2257I	ENST00000358511.6	37	c.6770	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	G	9.890	1.204011	0.22205	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.89270	-2.47;-2.49	4.97	1.54	0.23209	.	.	.	.	.	T	0.75228	0.3821	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.65207	-0.6224	9	0.66056	D	0.02	.	5.3633	0.16099	0.0:0.4589:0.4062:0.1349	.	2257;2257	A6NMZ7;F8W6Y7	CO6A6_HUMAN;.	I	2257	ENSP00000351310:S2257I;ENSP00000399236:S2257I	ENSP00000351310:S2257I	S	+	2	0	COL6A6	131876909	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.415000	0.21181	0.577000	0.29470	-0.540000	0.04249	AGT	COL6A6	-	NULL	ENSG00000206384		0.363	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	-	0.00	21	0	G	NM_001102608		130394219	+1	tier1	-	no_errors	ENST00000358511	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.000	T
COL9A2	1298	genome.wustl.edu	37	1	40779928	40779928	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:40779928G>T	ENST00000372748.3	-	4	294	c.198C>A	c.(196-198)ggC>ggA	p.G66G		NM_001852.3	NP_001843.1	Q14055	CO9A2_HUMAN	collagen, type IX, alpha 2	66	Triple-helical region 4 (COL4).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(4)|stomach(2)|urinary_tract(2)	22	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			TGCCAGGCTCGCCCTTGGGTC	0.582																																																	0													106.0	113.0	111.0					1																	40779928		2203	4300	6503	SO:0001819	synonymous_variant	0			M95610	CCDS450.1	1p33-p32	2013-01-16			ENSG00000049089	ENSG00000049089		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2218	protein-coding gene	gene with protein product		120260		EDM2		8454052, 8528240, 1429648	Standard	NM_001852		Approved	MED	uc001cfh.1	Q14055	OTTHUMG00000005761	ENST00000372748.3:c.198C>A	1.37:g.40779928G>T			B2RMP9	Silent	SNP	pfam_Collagen	p.G66	ENST00000372748.3	37	c.198	CCDS450.1	1																																																																																			COL9A2	-	pfam_Collagen	ENSG00000049089		0.582	COL9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A2	HGNC	protein_coding	OTTHUMT00000015764.3		0.00	24	0	G	NM_001852		40779928	-1			no_errors	ENST00000372748	ensembl	human	known	74_37	silent	10.00	27	3	SNP	0.994	T
COPA	1314	genome.wustl.edu	37	1	160283886	160283886	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:160283886G>T	ENST00000241704.7	-	9	965	c.736C>A	c.(736-738)Cgg>Agg	p.R246R	COPA_ENST00000368069.3_Silent_p.R246R	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	246					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TAATGGCCCCGGCAGGTATCA	0.438																																																	0													83.0	77.0	79.0					1																	160283886		2203	4300	6503	SO:0001819	synonymous_variant	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.736C>A	1.37:g.160283886G>T			Q5T201|Q8IXZ9	Silent	SNP	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R246	ENST00000241704.7	37	c.736	CCDS1202.1	1																																																																																			COPA	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000122218		0.438	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1		0.00	8	0	G	NM_004371		160283886	-1			no_errors	ENST00000368069	ensembl	human	known	74_37	silent	11.54	23	3	SNP	1.000	T
CPB1	1360	genome.wustl.edu	37	3	148562486	148562486	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:148562486G>T	ENST00000491148.1	+	9	1044	c.710G>T	c.(709-711)cGc>cTc	p.R237L	CPB1_ENST00000282957.4_Missense_Mutation_p.R237L			P15086	CBPB1_HUMAN	carboxypeptidase B1 (tissue)	237						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)	p.R237H(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	38			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			AGAAAGACTCGCTCCACCCAT	0.433																																																	1	Substitution - Missense(1)	large_intestine(1)											115.0	114.0	114.0					3																	148562486		2203	4300	6503	SO:0001583	missense	0			AJ224866	CCDS33874.1	3q24	2012-02-10			ENSG00000153002	ENSG00000153002	3.4.17.2		2299	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase B"", ""tissue carboxypeptidase B"", ""protaminase"""	114852					Standard	XM_005247124		Approved		uc003ewl.3	P15086	OTTHUMG00000159520	ENST00000491148.1:c.710G>T	3.37:g.148562486G>T	ENSP00000417222:p.Arg237Leu		O60834|Q53XJ0|Q96BQ8	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.R237L	ENST00000491148.1	37	c.710	CCDS33874.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.181085	0.94846	.	.	ENSG00000153002	ENST00000491148;ENST00000282957;ENST00000468341	T;T;T	0.25085	1.82;1.82;1.82	5.78	5.78	0.91487	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.62974	0.2472	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70407	-0.4880	10	0.87932	D	0	.	20.0124	0.97464	0.0:0.0:1.0:0.0	.	237	P15086	CBPB1_HUMAN	L	237;237;203	ENSP00000417222:R237L;ENSP00000282957:R237L;ENSP00000419427:R203L	ENSP00000282957:R237L	R	+	2	0	CPB1	150045176	1.000000	0.71417	1.000000	0.80357	0.867000	0.49689	9.476000	0.97823	2.749000	0.94314	0.655000	0.94253	CGC	CPB1	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000153002		0.433	CPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPB1	HGNC	protein_coding	OTTHUMT00000355928.1		0.00	40	0	G	NM_001871		148562486	+1			no_errors	ENST00000282957	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
CPED1	79974	genome.wustl.edu	37	7	120655798	120655798	+	Missense_Mutation	SNP	C	C	A	rs564333233	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:120655798C>A	ENST00000310396.5	+	3	796	c.329C>A	c.(328-330)aCa>aAa	p.T110K	CPED1_ENST00000450913.2_Missense_Mutation_p.T110K|CPED1_ENST00000340646.5_Missense_Mutation_p.T110K|CPED1_ENST00000495036.1_3'UTR	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	110						endoplasmic reticulum (GO:0005783)											TACAGCAAAACAGAGCTTCAG	0.488													C|||	2	0.000399361	0.0015	0.0	5008	,	,		17639	0.0		0.0	False		,,,				2504	0.0																0													83.0	69.0	74.0					7																	120655798		2203	4300	6503	SO:0001583	missense	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.329C>A	7.37:g.120655798C>A	ENSP00000309772:p.Thr110Lys		A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	NULL	p.T110K	ENST00000310396.5	37	c.329	CCDS34739.1	7	.	.	.	.	.	.	.	.	.	.	C	4.410	0.075794	0.08485	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000340646	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.84	-11.7	0.00046	.	1.928690	0.02357	N	0.076480	T	0.13072	0.0317	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.17868	-1.0355	10	0.02654	T	1	.	2.2236	0.03979	0.2307:0.0998:0.1615:0.5079	.	110;110	A4D0V7-2;A4D0V7	.;CG058_HUMAN	K	110	ENSP00000309772:T110K;ENSP00000398082:T110K;ENSP00000406122:T110K;ENSP00000345235:T110K	ENSP00000309772:T110K	T	+	2	0	C7orf58	120443034	0.000000	0.05858	0.000000	0.03702	0.179000	0.23085	-4.298000	0.00257	-2.420000	0.00564	0.591000	0.81541	ACA	CPED1	-	NULL	ENSG00000106034		0.488	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	-	0.00	27	0	C	NM_024913		120655798	+1	tier1	-	no_errors	ENST00000310396	ensembl	human	known	74_37	missense	36.00	16	9	SNP	0.000	A
CRB1	23418	genome.wustl.edu	37	1	197297562	197297562	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:197297562C>T	ENST00000367400.3	+	2	216	c.81C>T	c.(79-81)tgC>tgT	p.C27C	CRB1_ENST00000535699.1_5'UTR|CRB1_ENST00000538660.1_Silent_p.C27C|CRB1_ENST00000367399.2_Silent_p.C27C	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	27			C -> F (in RP12). {ECO:0000269|PubMed:19956407}.		cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						ATTCCTTTTGCAATAAAAACA	0.328																																																	0													39.0	40.0	40.0					1																	197297562		2198	4299	6497	SO:0001819	synonymous_variant	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.81C>T	1.37:g.197297562C>T			A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Silent	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.C27	ENST00000367400.3	37	c.81	CCDS1390.1	1																																																																																			CRB1	-	NULL	ENSG00000134376		0.328	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	-	0.00	22	0	C	NM_201253		197297562	+1	tier1	-	no_errors	ENST00000367400	ensembl	human	known	74_37	silent	20.00	12	3	SNP	0.930	T
CREBBP	1387	genome.wustl.edu	37	16	3789596	3789596	+	Nonsense_Mutation	SNP	G	G	T	rs61731413	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:3789596G>T	ENST00000262367.5	-	25	5072	c.4263C>A	c.(4261-4263)tgC>tgA	p.C1421*	CREBBP_ENST00000382070.3_Nonsense_Mutation_p.C1383*	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1421	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.|Cys/His-rich.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TTGGAGGGGGGCAATCAGAGC	0.507			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													74.0	69.0	70.0					16																	3789596		2197	4300	6497	SO:0001587	stop_gained	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.4263C>A	16.37:g.3789596G>T	ENSP00000262367:p.Cys1421*		D3DUC9|O00147|Q16376|Q4LE28	Nonsense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX_dom,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX_dom,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX_dom,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.C1421*	ENST00000262367.5	37	c.4263	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	g	16.05	3.012573	0.54468	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	.	.	.	5.36	1.22	0.21188	.	0.128977	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-14.7453	11.1501	0.48453	0.2507:0.0:0.7493:0.0	.	.	.	.	X	1421;1451;1383;10	.	ENSP00000262367:C1421X	C	-	3	2	CREBBP	3729597	0.996000	0.38824	1.000000	0.80357	0.949000	0.60115	0.349000	0.20055	0.496000	0.27904	0.561000	0.74099	TGC	CREBBP	-	pfam_Histone_H3-K56_AcTrfase_RTT109	ENSG00000005339		0.507	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	-	0.00	23	0	G	NM_004380		3789596	-1	tier1	-	no_errors	ENST00000262367	ensembl	human	known	74_37	nonsense	15.38	22	4	SNP	0.998	T
CREBRF	153222	genome.wustl.edu	37	5	172539365	172539365	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:172539365G>T	ENST00000296953.2	+	7	1983	c.1664G>T	c.(1663-1665)gGc>gTc	p.G555V	CREBRF_ENST00000540014.1_Missense_Mutation_p.G557V	NM_153607.2	NP_705835.2	Q8IUR6	CRERF_HUMAN	CREB3 regulatory factor	555	bZIP.				negative regulation of endoplasmic reticulum unfolded protein response (GO:1900102)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular transport (GO:0032388)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein transport (GO:0051222)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										AAATTATGGGGCCTCAACACA	0.358																																																	0													75.0	78.0	77.0					5																	172539365		2203	4300	6503	SO:0001583	missense	0			AY139008	CCDS34293.1, CCDS54948.1	5q35.2	2012-03-06	2012-03-06	2012-03-06	ENSG00000164463	ENSG00000164463			24050	protein-coding gene	gene with protein product	"""luman/CREB3 recruitment factor"""		"""chromosome 5 open reading frame 41"""	C5orf41		18391022	Standard	NM_153607		Approved	LRF	uc003mch.3	Q8IUR6	OTTHUMG00000163322	ENST00000296953.2:c.1664G>T	5.37:g.172539365G>T	ENSP00000296953:p.Gly555Val		B3DFH2|B3KW49|D3DQM2|F5GXN3|Q5HYG4|Q5HYK0|Q86YR3|Q8IZG1	Missense_Mutation	SNP	NULL	p.G557V	ENST00000296953.2	37	c.1670	CCDS34293.1	5	.	.	.	.	.	.	.	.	.	.	G	26.0	4.695815	0.88830	.	.	ENSG00000164463	ENST00000296953;ENST00000540014;ENST00000538538;ENST00000393776	T;T	0.21031	2.03;2.03	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.37100	0.0991	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.17349	-1.0372	10	0.72032	D	0.01	.	19.5275	0.95212	0.0:0.0:1.0:0.0	.	555	Q8IUR6	CE041_HUMAN	V	555;557;555;555	ENSP00000296953:G555V;ENSP00000440075:G557V	ENSP00000296953:G555V	G	+	2	0	C5orf41	172471971	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.334000	0.96470	2.621000	0.88768	0.591000	0.81541	GGC	CREBRF	-	NULL	ENSG00000164463		0.358	CREBRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBRF	HGNC	protein_coding	OTTHUMT00000372667.1	-	0.00	59	0	G	NM_153607		172539365	+1	tier1	-	no_errors	ENST00000540014	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
CRMP1	1400	genome.wustl.edu	37	4	5830297	5830297	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:5830297G>T	ENST00000397890.2	-	12	1594	c.1380C>A	c.(1378-1380)aaC>aaA	p.N460K	CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000512574.1_Missense_Mutation_p.N458K|EVC_ENST00000382674.2_3'UTR|CRMP1_ENST00000324989.7_Missense_Mutation_p.N574K	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	460					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.N574N(1)		NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		CCTTGTTGACGTTGATGTTTC	0.567																																																	1	Substitution - coding silent(1)	large_intestine(1)											165.0	113.0	131.0					4																	5830297		2203	4300	6503	SO:0001583	missense	0			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1380C>A	4.37:g.5830297G>T	ENSP00000380987:p.Asn460Lys		A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.N574K	ENST00000397890.2	37	c.1722	CCDS43207.1	4	.	.	.	.	.	.	.	.	.	.	g	2.587	-0.296093	0.05532	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	T;T;T	0.72835	-0.69;-0.69;-0.69	4.33	-5.32	0.02722	Metal-dependent hydrolase, composite domain (1);	0.418879	0.28057	N	0.016764	T	0.34366	0.0895	N	0.05031	-0.125	0.09310	N	0.999999	B;B;B;B	0.31174	0.001;0.004;0.004;0.311	B;B;B;B	0.30401	0.008;0.002;0.005;0.115	T	0.49283	-0.8956	10	0.11182	T	0.66	-8.262	3.922	0.09248	0.4986:0.1025:0.2954:0.1036	.	574;458;460;397	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	K	574;460;460;458	ENSP00000321606:N574K;ENSP00000380987:N460K;ENSP00000425742:N458K	ENSP00000321606:N574K	N	-	3	2	CRMP1	5881198	0.004000	0.15560	0.000000	0.03702	0.039000	0.13416	-1.133000	0.03232	-1.230000	0.02561	-0.215000	0.12644	AAC	CRMP1	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000072832		0.567	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1		0.00	50	0	G	NM_001313		5830297	-1			no_errors	ENST00000324989	ensembl	human	known	74_37	missense	7.89	35	3	SNP	0.002	T
CSRNP3	80034	genome.wustl.edu	37	2	166535293	166535293	+	Missense_Mutation	SNP	G	G	A	rs538593922		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:166535293G>A	ENST00000342316.4	+	5	1060	c.788G>A	c.(787-789)cGt>cAt	p.R263H	CSRNP3_ENST00000409420.1_Missense_Mutation_p.R295H|CSRNP3_ENST00000314499.7_Missense_Mutation_p.R263H	NM_024969.3	NP_079245.2	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	263					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(3)|skin(2)	33						AATCCTATCCGTGTTCGGACT	0.443													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18529	0.0		0.0	False		,,,				2504	0.0																0													102.0	97.0	99.0					2																	166535293		2203	4300	6503	SO:0001583	missense	0			AB063300	CCDS2225.1	2q24.3	2012-04-17	2009-01-07	2009-01-07	ENSG00000178662	ENSG00000178662		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30729	protein-coding gene	gene with protein product	"""TGF beta induced apotosis protein 2"", ""protein phosphatase 1, regulatory subunit 73"""		"""family with sequence similarity 130, member A2"""	FAM130A2		17726538	Standard	NM_024969		Approved	FLJ32093, TAIP-2, PPP1R73	uc002udg.3	Q8WYN3	OTTHUMG00000132145	ENST00000342316.4:c.788G>A	2.37:g.166535293G>A	ENSP00000344042:p.Arg263His		B3KPR4|Q53SG0|Q6ZTX3|Q9HAF9	Missense_Mutation	SNP	prints_Cys/Ser-rich_nuc_prot	p.R263H	ENST00000342316.4	37	c.788	CCDS2225.1	2	.	.	.	.	.	.	.	.	.	.	G	21.3	4.124612	0.77436	.	.	ENSG00000178662	ENST00000421875;ENST00000431452;ENST00000314499;ENST00000342316;ENST00000409420	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.59	5.59	0.84812	.	0.050173	0.85682	D	0.000000	T	0.67692	0.2920	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.70949	-0.4733	10	0.87932	D	0	-15.1003	18.5751	0.91151	0.0:0.0:1.0:0.0	.	263	Q8WYN3	CSRN3_HUMAN	H	263;270;263;263;295	ENSP00000412081:R263H;ENSP00000318258:R263H;ENSP00000344042:R263H;ENSP00000387195:R295H	ENSP00000318258:R263H	R	+	2	0	CSRNP3	166243539	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.824000	0.99380	2.624000	0.88883	0.650000	0.86243	CGT	CSRNP3	-	NULL	ENSG00000178662		0.443	CSRNP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP3	HGNC	protein_coding	OTTHUMT00000255191.2	-	0.00	59	0	G	NM_024969		166535293	+1	tier1	-	no_errors	ENST00000314499	ensembl	human	known	74_37	missense	32.79	41	20	SNP	1.000	A
CTNNB1	1499	genome.wustl.edu	37	3	41266610	41266610	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:41266610T>C	ENST00000349496.5	+	4	687	c.407T>C	c.(406-408)gTt>gCt	p.V136A	CTNNB1_ENST00000453024.1_Missense_Mutation_p.V129A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.V136A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.V136A|CTNNB1_ENST00000396185.3_Missense_Mutation_p.V136A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	136					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_Q143del(7)|p.W25_I140del(3)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.M5_N141>D(2)|p.M1_V173del(1)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.I35_K170del(1)|p.E15_I140>V(1)|p.A20_N141del(1)|p.D11_Y142>H(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		AAACATGCAGTTGTAAACTTG	0.448		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)			Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	23	Deletion - In frame(16)|Complex - deletion inframe(7)	liver(22)|skin(1)											147.0	128.0	134.0					3																	41266610		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.407T>C	3.37:g.41266610T>C	ENSP00000344456:p.Val136Ala		A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.V136A	ENST00000349496.5	37	c.407	CCDS2694.1	3	.	.	.	.	.	.	.	.	.	.	T	19.12	3.766195	0.69878	.	.	ENSG00000168036	ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T;T	0.66638	-0.22;0.96;-0.22;-0.22;-0.22;-0.22	5.4	5.4	0.78164	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70919	0.3279	L	0.58810	1.83	0.80722	D	1	B;B	0.32425	0.171;0.371	B;P	0.44447	0.202;0.45	T	0.67086	-0.5759	10	0.24483	T	0.36	-2.7182	15.7251	0.77751	0.0:0.0:0.0:1.0	.	64;136	B4DSW9;P35222	.;CTNB1_HUMAN	A	136;136;136;136;129;136	ENSP00000385604:V136A;ENSP00000412219:V136A;ENSP00000379486:V136A;ENSP00000344456:V136A;ENSP00000411226:V129A;ENSP00000379488:V136A	ENSP00000344456:V136A	V	+	2	0	CTNNB1	41241614	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	2.175000	0.68902	0.533000	0.62120	GTT	CTNNB1	-	superfamily_ARM-type_fold	ENSG00000168036		0.448	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNB1	HGNC	protein_coding	OTTHUMT00000254182.2	-	0.00	25	0	T	NM_001098210		41266610	+1	tier1	-	no_errors	ENST00000349496	ensembl	human	known	74_37	missense	72.22	5	13	SNP	1.000	C
CTNND2	1501	genome.wustl.edu	37	5	11364954	11364954	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:11364954T>C	ENST00000304623.8	-	8	1415	c.1226A>G	c.(1225-1227)gAg>gGg	p.E409G	CTNND2_ENST00000503622.1_Missense_Mutation_p.E72G|CTNND2_ENST00000511377.1_Missense_Mutation_p.E318G|CTNND2_ENST00000458100.2_5'UTR|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Missense_Mutation_p.E409G	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	409					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGCCCGCAACTCTGGGCCCAG	0.567																																																	0													49.0	54.0	52.0					5																	11364954		2203	4300	6503	SO:0001583	missense	0			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.1226A>G	5.37:g.11364954T>C	ENSP00000307134:p.Glu409Gly		B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.E409G	ENST00000304623.8	37	c.1226	CCDS3881.1	5	.	.	.	.	.	.	.	.	.	.	T	22.2	4.253278	0.80135	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000503622;ENST00000502551	T;T;T;D	0.81659	-1.31;-1.41;-1.3;-1.52	5.47	5.47	0.80525	.	0.000000	0.64402	D	0.000005	T	0.76335	0.3973	L	0.52573	1.65	0.80722	D	1	P;P	0.38922	0.608;0.651	B;B	0.35931	0.202;0.214	T	0.78605	-0.2139	10	0.54805	T	0.06	-20.337	15.5559	0.76192	0.0:0.0:0.0:1.0	.	72;409	B4DRK2;Q9UQB3	.;CTND2_HUMAN	G	409;409;318;72;149	ENSP00000307134:E409G;ENSP00000352661:E409G;ENSP00000426510:E318G;ENSP00000426887:E72G	ENSP00000307134:E409G	E	-	2	0	CTNND2	11417954	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	7.665000	0.83852	2.087000	0.62958	0.533000	0.62120	GAG	CTNND2	-	NULL	ENSG00000169862		0.567	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	HGNC	protein_coding	OTTHUMT00000206999.1		0.00	16	0	T	NM_001332		11364954	-1			no_errors	ENST00000304623	ensembl	human	known	74_37	missense	25.00	9	3	SNP	1.000	C
CWF19L2	143884	genome.wustl.edu	37	11	107300162	107300162	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:107300162G>A	ENST00000282251.5	-	8	823	c.796C>T	c.(796-798)Cag>Tag	p.Q266*	CWF19L2_ENST00000433523.1_Nonsense_Mutation_p.Q266*	NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	266							catalytic activity (GO:0003824)			endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		AATTTTGACTGAAATATTTCC	0.378																																																	0													28.0	26.0	27.0					11																	107300162		2195	4285	6480	SO:0001587	stop_gained	0			AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.796C>T	11.37:g.107300162G>A	ENSP00000282251:p.Gln266*		A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Nonsense_Mutation	SNP	pfam_Cwf19-like_C_dom-1,pfam_Cwf19-like_C_dom-2,superfamily_HIT-like	p.Q266*	ENST00000282251.5	37	c.796	CCDS8336.2	11	.	.	.	.	.	.	.	.	.	.	G	33	5.268131	0.95429	.	.	ENSG00000152404	ENST00000282251;ENST00000433523	.	.	.	5.45	4.54	0.55810	.	0.055713	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	-13.3561	11.7826	0.52023	0.0816:0.0:0.9184:0.0	.	.	.	.	X	266	.	ENSP00000282251:Q266X	Q	-	1	0	CWF19L2	106805372	1.000000	0.71417	0.997000	0.53966	0.863000	0.49368	5.032000	0.64140	1.429000	0.47314	0.591000	0.81541	CAG	CWF19L2	-	NULL	ENSG00000152404		0.378	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWF19L2	HGNC	protein_coding	OTTHUMT00000328825.2	-	0.00	27	0	G	NM_152434		107300162	-1	tier1	-	no_errors	ENST00000282251	ensembl	human	known	74_37	nonsense	47.83	12	11	SNP	1.000	A
CYP1A1	1543	genome.wustl.edu	37	15	75014808	75014808	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:75014808G>T	ENST00000379727.3	-	2	829	c.631C>A	c.(631-633)Cac>Aac	p.H211N	CYP1A1_ENST00000395048.2_Missense_Mutation_p.H211N|CYP1A1_ENST00000567032.1_Missense_Mutation_p.H211N|CYP1A1_ENST00000564596.1_5'UTR|CYP1A1_ENST00000395049.4_Missense_Mutation_p.H211N			P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 1	211					9-cis-retinoic acid biosynthetic process (GO:0042904)|aging (GO:0007568)|amine metabolic process (GO:0009308)|arachidonic acid metabolic process (GO:0019369)|camera-type eye development (GO:0043010)|cell proliferation (GO:0008283)|cellular lipid metabolic process (GO:0044255)|cellular response to organic cyclic compound (GO:0071407)|coumarin metabolic process (GO:0009804)|dibenzo-p-dioxin catabolic process (GO:0019341)|digestive tract development (GO:0048565)|drug metabolic process (GO:0017144)|embryo development ending in birth or egg hatching (GO:0009792)|epoxygenase P450 pathway (GO:0019373)|flavonoid metabolic process (GO:0009812)|hepatocyte differentiation (GO:0070365)|hydrogen peroxide biosynthetic process (GO:0050665)|insecticide metabolic process (GO:0017143)|maternal process involved in parturition (GO:0060137)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|response to antibiotic (GO:0046677)|response to arsenic-containing substance (GO:0046685)|response to drug (GO:0042493)|response to food (GO:0032094)|response to herbicide (GO:0009635)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to iron(III) ion (GO:0010041)|response to lipopolysaccharide (GO:0032496)|response to nematode (GO:0009624)|response to virus (GO:0009615)|response to vitamin A (GO:0033189)|response to wounding (GO:0009611)|small molecule metabolic process (GO:0044281)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|mitochondrion (GO:0005739)	aromatase activity (GO:0070330)|demethylase activity (GO:0032451)|flavonoid 3'-monooxygenase activity (GO:0016711)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on diphenols and related substances as donors (GO:0016679)|oxygen binding (GO:0019825)|steroid hydroxylase activity (GO:0008395)|vitamin D 24-hydroxylase activity (GO:0070576)			autonomic_ganglia(1)|breast(2)|endometrium(1)|large_intestine(7)|lung(13)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Acetaminophen(DB00316)|Albendazole(DB00518)|Amiodarone(DB01118)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Arsenic trioxide(DB01169)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Caffeine(DB00201)|Carvedilol(DB01136)|Chloroquine(DB00608)|Chlorzoxazone(DB00356)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Clenbuterol(DB01407)|Clobetasol propionate(DB01013)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonidine(DB00575)|Clozapine(DB00363)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Dexamethasone(DB01234)|Dexmedetomidine(DB00633)|Diclofenac(DB00586)|Dicyclomine(DB00804)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Ethanol(DB00898)|Flunarizine(DB04841)|Fluorescein(DB00693)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Granisetron(DB00889)|Haloperidol(DB00502)|Isoprenaline(DB01064)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lorcaserin(DB04871)|Mebendazole(DB00643)|Melatonin(DB01065)|Menadione(DB00170)|Methoxsalen(DB00553)|Nicotine(DB00184)|Nifedipine(DB01115)|Nitroprusside(DB00325)|Norfloxacin(DB01059)|Omeprazole(DB00338)|Ouabain(DB01092)|Oxaliplatin(DB00526)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Prazosin(DB00457)|Primaquine(DB01087)|Progesterone(DB00396)|Propofol(DB00818)|Propranolol(DB00571)|Pyridoxine(DB00165)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Riluzole(DB00740)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Testosterone(DB00624)|Thalidomide(DB01041)|Theophylline(DB00277)|Thiabendazole(DB00730)|Ticlopidine(DB00208)|Toremifene(DB00539)|Tretinoin(DB00755)|Vitamin A(DB00162)|Warfarin(DB00682)	AGTTCTTGGTGGTTGTGGTCA	0.512									Endometrial Cancer, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																																								0													98.0	99.0	99.0					15																	75014808		2197	4296	6493	SO:0001583	missense	0	Familial Cancer Database	;AIMAH, Cushing disease, Adrenal, Familial	BC023019	CCDS10268.1	15q24.1	2007-12-14	2003-01-14		ENSG00000140465	ENSG00000140465	1.14.14.1	"""Cytochrome P450s"""	2595	protein-coding gene	gene with protein product		108330	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 1"""	CYP1		15128046	Standard	NM_000499		Approved	P450DX, P1-450, P450-C, CP11	uc002ayp.4	P04798	OTTHUMG00000142812	ENST00000379727.3:c.631C>A	15.37:g.75014808G>T	ENSP00000369050:p.His211Asn		A4F3V9|A4F3W0|Q53G18	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP1,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.H211N	ENST00000379727.3	37	c.631	CCDS10268.1	15	.	.	.	.	.	.	.	.	.	.	G	10.82	1.457206	0.26161	.	.	ENSG00000140465	ENST00000379727;ENST00000395048;ENST00000395049;ENST00000268062	T;T;T	0.77750	-1.12;-1.12;-1.12	5.0	-7.25	0.01470	.	0.276188	0.44902	N	0.000413	T	0.35335	0.0928	N	0.00315	-1.66	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.004	T	0.46176	-0.9210	10	0.36615	T	0.2	.	9.9346	0.41543	0.0:0.6241:0.1292:0.2467	.	211;211	E7EMT5;P04798	.;CP1A1_HUMAN	N	211	ENSP00000369050:H211N;ENSP00000378488:H211N;ENSP00000378489:H211N	ENSP00000268062:H211N	H	-	1	0	CYP1A1	72801861	0.000000	0.05858	0.001000	0.08648	0.777000	0.43975	-0.271000	0.08572	-1.609000	0.01585	-0.410000	0.06199	CAC	CYP1A1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000140465		0.512	CYP1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP1A1	HGNC	protein_coding	OTTHUMT00000286396.1		0.00	35	0	G	NM_000499		75014808	-1			no_errors	ENST00000379727	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.134	T
CYP2F1	1572	genome.wustl.edu	37	19	41631428	41631428	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:41631428G>A	ENST00000331105.2	+	9	1255	c.1183G>A	c.(1183-1185)Gtc>Atc	p.V395I		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	395					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						CCTTAACACCGTCCACTACGA	0.557																																																	0													12.0	14.0	13.0					19																	41631428		2167	4243	6410	SO:0001583	missense	0			J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.1183G>A	19.37:g.41631428G>A	ENSP00000333534:p.Val395Ile		A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_CYP2_fam,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.V395I	ENST00000331105.2	37	c.1183	CCDS12572.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	13.47|13.47	2.245606|2.245606	0.39697|0.39697	.|.	.|.	ENSG00000197446|ENSG00000197446	ENST00000439903|ENST00000331105	.|T	.|0.68025	.|-0.3	3.19|3.19	3.19|3.19	0.36642|0.36642	.|.	.|0.000000	.|0.64402	.|U	.|0.000001	T|T	0.63815|0.63815	0.2543|0.2543	L|L	0.41356|0.41356	1.27|1.27	0.43734|0.43734	D|D	0.996226|0.996226	.|P	.|0.45126	.|0.851	.|P	.|0.48425	.|0.577	T|T	0.67597|0.67597	-0.5630|-0.5630	5|10	.|0.59425	.|D	.|0.04	.|.	12.0027|12.0027	0.53240|0.53240	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|395	.|P24903	.|CP2F1_HUMAN	H|I	28|395	.|ENSP00000333534:V395I	.|ENSP00000333534:V395I	R|V	+|+	2|1	0|0	CYP2F1|CYP2F1	46323268|46323268	1.000000|1.000000	0.71417|0.71417	0.021000|0.021000	0.16686|0.16686	0.370000|0.370000	0.29829|0.29829	5.943000|5.943000	0.70211|0.70211	1.649000|1.649000	0.50652|0.50652	0.089000|0.089000	0.15464|0.15464	CGT|GTC	CYP2F1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_B	ENSG00000197446		0.557	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2F1	HGNC	protein_coding	OTTHUMT00000394527.2	-	0.00	28	0	G			41631428	+1	tier1	-	no_errors	ENST00000331105	ensembl	human	known	74_37	missense	15.62	27	5	SNP	0.986	A
CYP46A1	10858	genome.wustl.edu	37	14	100191745	100191745	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:100191745G>T	ENST00000261835.3	+	13	1298	c.1194G>T	c.(1192-1194)atG>atT	p.M398I	CYP46A1_ENST00000554176.1_Missense_Mutation_p.M235I|CYP46A1_ENST00000423126.2_Missense_Mutation_p.M301I	NM_006668.1	NP_006659.1	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46, subfamily A, polypeptide 1	398					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|nervous system development (GO:0007399)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol 24-hydroxylase activity (GO:0033781)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)			breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)	25		Melanoma(154;0.0866)|all_epithelial(191;0.179)				CCTATGTCATGGGGCGGATGG	0.602																																																	0													116.0	100.0	105.0					14																	100191745		2203	4300	6503	SO:0001583	missense	0			AF094480	CCDS9954.1	14q32.2	2013-05-03	2003-02-14	2003-02-28	ENSG00000036530	ENSG00000036530		"""Cytochrome P450s"""	2641	protein-coding gene	gene with protein product		604087	"""cytochrome P450, subfamily 46 (cholesterol 24-hydroxylase)"""	CYP46		10377398	Standard	NM_006668		Approved		uc001ygo.3	Q9Y6A2	OTTHUMG00000171510	ENST00000261835.3:c.1194G>T	14.37:g.100191745G>T	ENSP00000261835:p.Met398Ile		B4DHP8|E7EQG9|Q8N2B0	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.M398I	ENST00000261835.3	37	c.1194	CCDS9954.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.37|19.37	3.815496|3.815496	0.70912|0.70912	.|.	.|.	ENSG00000036530|ENSG00000036530	ENST00000380228|ENST00000261835;ENST00000423126;ENST00000554176	.|T;T;T	.|0.66460	.|-0.21;-0.21;-0.21	4.48|4.48	4.48|4.48	0.54585|0.54585	.|.	.|0.345770	.|0.29021	.|N	.|0.013397	T|T	0.58163|0.58163	0.2103|0.2103	N|N	0.03268|0.03268	-0.37|-0.37	0.51482|0.51482	D|D	0.999925|0.999925	.|B;D	.|0.54964	.|0.365;0.969	.|B;D	.|0.63283	.|0.311;0.913	T|T	0.59825|0.59825	-0.7381|-0.7381	5|10	.|0.23891	.|T	.|0.37	.|.	13.0411|13.0411	0.58899|0.58899	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|235;398	.|Q8N2B0;Q9Y6A2	.|.;CP46A_HUMAN	W|I	385|398;301;235	.|ENSP00000261835:M398I;ENSP00000405779:M301I;ENSP00000450553:M235I	.|ENSP00000261835:M398I	G|M	+|+	1|3	0|0	CYP46A1|CYP46A1	99261498|99261498	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.656000|2.656000	0.46716|0.46716	2.218000|2.218000	0.71995|0.71995	0.563000|0.563000	0.77884|0.77884	GGG|ATG	CYP46A1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000036530		0.602	CYP46A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP46A1	HGNC	protein_coding	OTTHUMT00000413814.1	-	0.00	47	0	G			100191745	+1	tier1	-	no_errors	ENST00000261835	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
CYP51A1	1595	genome.wustl.edu	37	7	91743071	91743071	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:91743071G>T	ENST00000003100.8	-	10	1603	c.1438C>A	c.(1438-1440)Ctc>Atc	p.L480I	LRRD1_ENST00000422722.1_5'UTR|CYP51A1_ENST00000450723.1_Missense_Mutation_p.L375I	NM_000786.3	NP_000777.1	Q16850	CP51A_HUMAN	cytochrome P450, family 51, subfamily A, polypeptide 1	474					cholesterol biosynthetic process (GO:0006695)|cholesterol biosynthetic process via 24,25-dihydrolanosterol (GO:0033488)|demethylation (GO:0070988)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|sterol 14-demethylase activity (GO:0008398)	p.L480F(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|skin(1)	10	all_cancers(62;2.16e-09)|all_epithelial(64;3.86e-08)|Breast(17;0.00206)|all_lung(186;0.169)|all_hematologic(106;0.215)|Lung NSC(181;0.227)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)		Itraconazole(DB01167)|Ketoconazole(DB01026)|Sertaconazole(DB01153)|Tioconazole(DB01007)	CCATCAATGAGATCAAATTCA	0.343																																					GBM(70;1100 1190 11592 25836 51397)												1	Substitution - Missense(1)	skin(1)											110.0	108.0	108.0					7																	91743071		2203	4300	6503	SO:0001583	missense	0			U51685	CCDS5623.1, CCDS55123.1	7q21.2	2012-10-10	2003-02-14	2003-02-28	ENSG00000001630	ENSG00000001630		"""Cytochrome P450s"""	2649	protein-coding gene	gene with protein product		601637	"""cytochrome P450, 51 (lanosterol 14-alpha-demethylase)"""	CYP51		8975714	Standard	NM_000786		Approved	CP51, CYPL1, P450L1, LDM, P450-14DM	uc003ulm.4	Q16850	OTTHUMG00000131131	ENST00000003100.8:c.1438C>A	7.37:g.91743071G>T	ENSP00000003100:p.Leu480Ile		A4D1F8|B2RAI4|B4DJ55|O00770|O00772|Q16784|Q8N1A8|Q99868	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_B	p.L480I	ENST00000003100.8	37	c.1438	CCDS5623.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.8|21.8	4.198121|4.198121	0.79015|0.79015	.|.	.|.	ENSG00000001630|ENSG00000001630	ENST00000003100;ENST00000496998;ENST00000450723|ENST00000422867	T;T|.	0.69561|.	-0.41;-0.41|.	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76463|0.76463	0.3991|0.3991	M|M	0.83852|0.83852	2.665|2.665	0.80722|0.80722	D|D	1|1	D;D|.	0.62365|.	0.988;0.991|.	D;D|.	0.71870|.	0.966;0.975|.	T|T	0.78214|0.78214	-0.2291|-0.2291	10|5	0.54805|.	T|.	0.06|.	.|.	13.0486|13.0486	0.58942|0.58942	0.077:0.0:0.923:0.0|0.077:0.0:0.923:0.0	.|.	420;474|.	B3KRC6;Q16850|.	.;CP51A_HUMAN|.	I|Y	480;420;375|192	ENSP00000003100:L480I;ENSP00000406757:L375I|.	ENSP00000003100:L480I|.	L|S	-|-	1|2	0|0	CYP51A1|CYP51A1	91581007|91581007	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.527000|6.527000	0.73803|0.73803	2.648000|2.648000	0.89879|0.89879	0.591000|0.591000	0.81541|0.81541	CTC|TCT	CYP51A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000001630		0.343	CYP51A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP51A1	HGNC	protein_coding	OTTHUMT00000253812.4		0.00	22	0	G			91743071	-1			no_errors	ENST00000003100	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
DCLK1	9201	genome.wustl.edu	37	13	36382456	36382456	+	Splice_Site	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr13:36382456T>G	ENST00000360631.3	-	14	1979	c.1768A>C	c.(1768-1770)Agt>Cgt	p.S590R	DCLK1_ENST00000255448.4_Splice_Site_p.S590R|DCLK1_ENST00000379893.1_Splice_Site_p.S283R			O15075	DCLK1_HUMAN	doublecortin-like kinase 1	590	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TCATCACCACTTCTGTTTAGG	0.453																																																	0													179.0	169.0	172.0					13																	36382456		2203	4300	6503	SO:0001630	splice_region_variant	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1767-1A>C	13.37:g.36382456T>G			B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_dom	p.S590R	ENST00000360631.3	37	c.1768		13	.	.	.	.	.	.	.	.	.	.	T	16.07	3.019379	0.54576	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	T;T;T	0.65364	-0.15;-0.15;-0.15	5.51	4.33	0.51752	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.040051	0.85682	D	0.000000	T	0.55673	0.1935	L	0.28556	0.865	0.80722	D	1	B;P;P;B	0.41188	0.142;0.741;0.696;0.142	B;P;B;B	0.45712	0.092;0.491;0.358;0.092	T	0.56836	-0.7913	10	0.56958	D	0.05	.	11.1706	0.48569	0.0:0.072:0.0:0.928	.	283;590;590;283	O15075-4;O15075;O15075-2;O15075-3	.;DCLK1_HUMAN;.;.	R	282;590;590;283;572	ENSP00000255448:S590R;ENSP00000353846:S590R;ENSP00000369223:S283R	ENSP00000255448:S590R	S	-	1	0	DCLK1	35280456	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	4.161000	0.58170	0.934000	0.37316	0.460000	0.39030	AGT	DCLK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000133083		0.453	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	HGNC	protein_coding	OTTHUMT00000044487.1	-	0.00	17	0	T	NM_004734	Missense_Mutation	36382456	-1	tier1	-	no_errors	ENST00000360631	ensembl	human	known	74_37	missense	66.67	6	12	SNP	1.000	G
DCST2	127579	genome.wustl.edu	37	1	155002614	155002614	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:155002614G>T	ENST00000368424.3	-	7	1181	c.1123C>A	c.(1123-1125)Ctg>Atg	p.L375M	DCST2_ENST00000295536.5_Missense_Mutation_p.L375M	NM_144622.2	NP_653223.2	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	375						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|prostate(1)|skin(1)	38	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ACTGTGGGCAGCCCTGCCGTG	0.602																																																	0													86.0	85.0	86.0					1																	155002614		2203	4300	6503	SO:0001583	missense	0			AK057496	CCDS1082.2	1q22	2008-02-05		2005-08-09	ENSG00000163354	ENSG00000163354			26562	protein-coding gene	gene with protein product							Standard	NM_144622		Approved	FLJ32934	uc001fgm.3	Q5T1A1	OTTHUMG00000037371	ENST00000368424.3:c.1123C>A	1.37:g.155002614G>T	ENSP00000357409:p.Leu375Met		Q2M2R2|Q8N810|Q96M03	Missense_Mutation	SNP	pfam_DC_STAMP-like	p.L375M	ENST00000368424.3	37	c.1123	CCDS1082.2	1	.	.	.	.	.	.	.	.	.	.	G	7.656	0.683942	0.14907	.	.	ENSG00000163354	ENST00000368424;ENST00000295536	T;T	0.30182	1.54;1.54	4.68	1.73	0.24493	Dendritic cell-specific transmembrane protein-like (1);	0.614183	0.15050	N	0.283396	T	0.11196	0.0273	M	0.68317	2.08	0.09310	N	0.999997	P	0.40144	0.704	B	0.35182	0.197	T	0.13548	-1.0505	10	0.46703	T	0.11	-18.5333	4.143	0.10203	0.1764:0.0:0.5078:0.3158	.	375	Q5T1A1	DCST2_HUMAN	M	375	ENSP00000357409:L375M;ENSP00000295536:L375M	ENSP00000295536:L375M	L	-	1	2	DCST2	153269238	0.982000	0.34865	0.558000	0.28319	0.479000	0.33129	1.422000	0.34826	0.195000	0.20347	0.655000	0.94253	CTG	DCST2	-	pfam_DC_STAMP-like	ENSG00000163354		0.602	DCST2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST2	HGNC	protein_coding	OTTHUMT00000090953.3	-	0.00	42	0	G	NM_144622		155002614	-1	tier1	-	no_errors	ENST00000368424	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.280	T
DDX17	10521	genome.wustl.edu	37	22	38894461	38894461	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr22:38894461G>C	ENST00000396821.3	-	4	755	c.656C>G	c.(655-657)tCt>tGt	p.S219C	DDX17_ENST00000381633.3_Missense_Mutation_p.S140C|DDX17_ENST00000432525.1_5'UTR	NM_001098504.1|NM_006386.4	NP_001091974|NP_006377.2	Q92841	DDX17_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 17	219	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of skeletal muscle cell differentiation (GO:2001014)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA helicase activity (GO:0003724)|RNA-dependent ATPase activity (GO:0008186)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(6)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	25	Melanoma(58;0.0286)					CGTCTTCCCAGAGCCAGTCTG	0.458																																					Ovarian(55;1085 1454 6392 21425)												0													125.0	104.0	111.0					22																	38894461		2203	4300	6503	SO:0001583	missense	0			U59321	CCDS33646.1, CCDS46706.1	22q13.1	2012-02-23	2012-02-23		ENSG00000100201	ENSG00000100201		"""DEAD-boxes"""	2740	protein-coding gene	gene with protein product		608469	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 17 (72kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 17"""			8871553, 17226766	Standard	NM_006386		Approved	P72	uc003avy.4	Q92841	OTTHUMG00000151136	ENST00000396821.3:c.656C>G	22.37:g.38894461G>C	ENSP00000380033:p.Ser219Cys		B1AHM0|Q69YT1|Q6ICD6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.S219C	ENST00000396821.3	37	c.656	CCDS46706.1	22	.	.	.	.	.	.	.	.	.	.	G	26.9	4.785173	0.90282	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000403230;ENST00000404499	T;T;T	0.22945	1.93;1.93;1.93	5.39	5.39	0.77823	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70133	0.3189	H	0.98559	4.265	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.82837	-0.0260	10	0.87932	D	0	-16.515	19.5163	0.95167	0.0:0.0:1.0:0.0	.	140;221;219	Q92841;Q59F66;Q92841-4	DDX17_HUMAN;.;.	C	219;140;219;221	ENSP00000380033:S219C;ENSP00000371046:S140C;ENSP00000385536:S219C	ENSP00000371046:S140C	S	-	2	0	DDX17	37224407	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.459000	0.97638	2.683000	0.91414	0.591000	0.81541	TCT	DDX17	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000100201		0.458	DDX17-001	KNOWN	basic|CCDS	protein_coding	DDX17	HGNC	protein_coding	OTTHUMT00000321476.2	-	0.00	27	0	G	NM_030881		38894461	-1	tier1	-	no_errors	ENST00000396821	ensembl	human	known	74_37	missense	40.00	15	10	SNP	1.000	C
DEF8	54849	genome.wustl.edu	37	16	90027487	90027487	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:90027487G>T	ENST00000268676.7	+	7	935	c.846G>T	c.(844-846)cgG>cgT	p.R282R	DEF8_ENST00000563848.1_3'UTR|DEF8_ENST00000563795.1_Silent_p.R221R|DEF8_ENST00000570182.1_Silent_p.R211R|DEF8_ENST00000567874.1_Silent_p.R161R|DEF8_ENST00000569453.1_Silent_p.R221R|DEF8_ENST00000563594.1_Silent_p.R221R	NM_207514.2	NP_997397.1	Q6ZN54	DEFI8_HUMAN	differentially expressed in FDCP 8 homolog (mouse)	282					intracellular signal transduction (GO:0035556)		zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		all_cancers(9;7.59e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.0019)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0274)		CCGAGTGCCGGGCGCCCATCT	0.612																																																	0													75.0	78.0	77.0					16																	90027487		2198	4300	6498	SO:0001819	synonymous_variant	0			AK131370	CCDS10989.1, CCDS45555.1, CCDS58493.1, CCDS58494.1, CCDS58495.1, CCDS58496.1	16q24.3	2011-01-31			ENSG00000140995	ENSG00000140995			25969	protein-coding gene	gene with protein product						12477932	Standard	NM_207514		Approved	FLJ20186	uc002fpn.2	Q6ZN54	OTTHUMG00000138989	ENST00000268676.7:c.846G>T	16.37:g.90027487G>T			B3KT65|B4DK62|B4E0S9|B7Z3H6|H3BUG7|Q8N8N3|Q9NXL0	Silent	SNP	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.R282	ENST00000268676.7	37	c.846	CCDS10989.1	16																																																																																			DEF8	-	NULL	ENSG00000140995		0.612	DEF8-001	KNOWN	basic|CCDS	protein_coding	DEF8	HGNC	protein_coding	OTTHUMT00000272878.1	-	0.00	18	0	G	NM_207514		90027487	+1	tier1	-	no_errors	ENST00000268676	ensembl	human	known	74_37	silent	23.08	10	3	SNP	0.941	T
DENND4A	10260	genome.wustl.edu	37	15	65957686	65957686	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:65957686G>T	ENST00000431932.2	-	29	5432	c.5224C>A	c.(5224-5226)Cac>Aac	p.H1742N	DENND4A_ENST00000443035.3_Missense_Mutation_p.H1785N	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1742					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						CACTTACTGTGTGCATTCCAG	0.343																																																	0													137.0	135.0	136.0					15																	65957686		1906	4119	6025	SO:0001583	missense	0			AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.5224C>A	15.37:g.65957686G>T	ENSP00000396830:p.His1742Asn		E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,tigrfam_Pentatricopeptide_repeat	p.H1785N	ENST00000431932.2	37	c.5353	CCDS45285.1	15	.	.	.	.	.	.	.	.	.	.	G	10.92	1.486835	0.26686	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	T;T	0.04502	3.61;3.61	5.7	5.7	0.88788	.	0.284657	0.41194	D	0.000924	T	0.03739	0.0106	N	0.20483	0.58	0.28604	N	0.908996	B;B	0.33413	0.242;0.411	B;B	0.26969	0.054;0.075	T	0.40869	-0.9540	10	0.26408	T	0.33	.	14.6472	0.68769	0.0:0.0:0.8545:0.1454	.	1785;1742	E7EPL3;Q7Z401	.;MYCPP_HUMAN	N	1785;1742	ENSP00000391167:H1785N;ENSP00000396830:H1742N	ENSP00000396830:H1742N	H	-	1	0	DENND4A	63744740	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	6.224000	0.72265	2.684000	0.91462	0.650000	0.86243	CAC	DENND4A	-	NULL	ENSG00000174485		0.343	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4A	HGNC	protein_coding	OTTHUMT00000419611.1	-	0.00	41	0	G	NM_005848		65957686	-1	tier1	-	no_errors	ENST00000443035	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
DHX8	1659	genome.wustl.edu	37	17	41576241	41576241	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:41576241G>A	ENST00000262415.3	+	10	1384	c.1312G>A	c.(1312-1314)Gag>Aag	p.E438K	DHX8_ENST00000540306.1_Missense_Mutation_p.E438K	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	438					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		TGAGGACCTTGAGATTGAATT	0.393																																					NSCLC(56;1548 1661 49258 49987)												0													70.0	66.0	68.0					17																	41576241		2203	4300	6503	SO:0001583	missense	0			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.1312G>A	17.37:g.41576241G>A	ENSP00000262415:p.Glu438Lys			Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E438K	ENST00000262415.3	37	c.1312	CCDS11464.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.148836	0.94603	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.03386	3.95;3.96	5.19	5.19	0.71726	.	0.059306	0.64402	D	0.000003	T	0.26085	0.0636	M	0.92459	3.31	0.80722	D	1	D;D	0.89917	1.0;0.987	D;P	0.75020	0.985;0.87	T	0.17806	-1.0357	10	0.72032	D	0.01	.	17.3272	0.87252	0.0:0.0:1.0:0.0	.	438;438	F5H658;Q14562	.;DHX8_HUMAN	K	438	ENSP00000437886:E438K;ENSP00000262415:E438K	ENSP00000262415:E438K	E	+	1	0	DHX8	38931767	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.450000	0.97607	2.421000	0.82119	0.561000	0.74099	GAG	DHX8	-	NULL	ENSG00000067596		0.393	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX8	HGNC	protein_coding	OTTHUMT00000453485.1	-	0.00	31	0	G			41576241	+1	tier1	-	no_errors	ENST00000262415	ensembl	human	known	74_37	missense	45.16	17	14	SNP	1.000	A
DNAH10	196385	genome.wustl.edu	37	12	124298415	124298415	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:124298415G>T	ENST00000409039.3	+	20	3407	c.3382G>T	c.(3382-3384)Gac>Tac	p.D1128Y		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1128	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CAGATATAGGGACGTCCAGGA	0.393																																																	0													77.0	74.0	75.0					12																	124298415		1979	4187	6166	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.3382G>T	12.37:g.124298415G>T	ENSP00000386770:p.Asp1128Tyr		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.D1128Y	ENST00000409039.3	37	c.3382	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945009	0.73672	.	.	ENSG00000197653	ENST00000409039	T	0.22539	1.95	5.72	5.72	0.89469	.	.	.	.	.	T	0.50411	0.1614	M	0.83483	2.645	0.80722	D	1	D	0.67145	0.996	P	0.61940	0.896	T	0.54214	-0.8327	9	0.72032	D	0.01	.	19.8751	0.96867	0.0:0.0:1.0:0.0	.	1128	Q8IVF4	DYH10_HUMAN	Y	1128	ENSP00000386770:D1128Y	ENSP00000386770:D1128Y	D	+	1	0	DNAH10	122864368	1.000000	0.71417	0.980000	0.43619	0.320000	0.28249	9.609000	0.98334	2.695000	0.91970	0.655000	0.94253	GAC	DNAH10	-	NULL	ENSG00000197653		0.393	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	45	0	G			124298415	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	15.56	38	7	SNP	1.000	T
DNAH10	196385	genome.wustl.edu	37	12	124330608	124330608	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:124330608G>T	ENST00000409039.3	+	31	5392	c.5367G>T	c.(5365-5367)acG>acT	p.T1789T		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1789	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.T1789T(1)|p.T381T(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GCCAGTGCACGGGAACCTTTG	0.592																																																	2	Substitution - coding silent(2)	large_intestine(2)											75.0	80.0	78.0					12																	124330608		1993	4159	6152	SO:0001819	synonymous_variant	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.5367G>T	12.37:g.124330608G>T			C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.T1789	ENST00000409039.3	37	c.5367	CCDS9255.2	12																																																																																			DNAH10	-	NULL	ENSG00000197653		0.592	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3		0.00	35	0	G			124330608	+1			no_errors	ENST00000409039	ensembl	human	known	74_37	silent	5.56	34	2	SNP	0.077	T
DNAH11	8701	genome.wustl.edu	37	7	21857862	21857862	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:21857862G>T	ENST00000409508.3	+	65	10627	c.10596G>T	c.(10594-10596)ttG>ttT	p.L3532F	DNAH11_ENST00000328843.6_Missense_Mutation_p.L3539F	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3539	AAA 5. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						AAACTGCTTTGGCCTTTGGTG	0.333									Kartagener syndrome																																								0													95.0	86.0	89.0					7																	21857862		1832	4080	5912	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.10596G>T	7.37:g.21857862G>T	ENSP00000475939:p.Leu3532Phe		Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L3539F	ENST00000409508.3	37	c.10617		7	.	.	.	.	.	.	.	.	.	.	G	14.35	2.508601	0.44660	.	.	ENSG00000105877	ENST00000328843	T	0.27256	1.68	5.48	4.61	0.57282	.	0.427890	0.23135	N	0.051530	T	0.24661	0.0598	.	.	.	0.37766	D	0.926507	B	0.12630	0.006	B	0.20384	0.029	T	0.09997	-1.0649	9	0.87932	D	0	.	12.3178	0.54966	0.1406:0.0:0.8594:0.0	.	3539	Q96DT5	DYH11_HUMAN	F	3539	ENSP00000330671:L3539F	ENSP00000330671:L3539F	L	+	3	2	DNAH11	21824387	1.000000	0.71417	0.996000	0.52242	0.960000	0.62799	0.762000	0.26503	1.334000	0.45468	0.644000	0.83932	TTG	DNAH11	-	NULL	ENSG00000105877		0.333	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6		0.00	46	0	G	NM_003777		21857862	+1			no_errors	ENST00000328843	ensembl	human	known	74_37	missense	13.51	32	5	SNP	1.000	T
DNAH5	1767	genome.wustl.edu	37	5	13736028	13736028	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:13736028G>T	ENST00000265104.4	-	67	11573	c.11469C>A	c.(11467-11469)ggC>ggA	p.G3823G		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3823					cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AGAGGATGCTGCCCCGCGTAG	0.453									Kartagener syndrome																																								0													75.0	72.0	73.0					5																	13736028		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.11469C>A	5.37:g.13736028G>T			Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G3823	ENST00000265104.4	37	c.11469	CCDS3882.1	5																																																																																			DNAH5	-	NULL	ENSG00000039139		0.453	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2		0.00	13	0	G	NM_001369		13736028	-1			no_errors	ENST00000265104	ensembl	human	known	74_37	silent	26.32	14	5	SNP	0.998	T
DNAH5	1767	genome.wustl.edu	37	5	13793813	13793813	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:13793813G>T	ENST00000265104.4	-	49	8139	c.8035C>A	c.(8035-8037)Ctg>Atg	p.L2679M		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2679	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TGTTCCATCAGCTGTCGCACT	0.448									Kartagener syndrome																																								0													79.0	82.0	81.0					5																	13793813		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.8035C>A	5.37:g.13793813G>T	ENSP00000265104:p.Leu2679Met		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L2679M	ENST00000265104.4	37	c.8035	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	G	14.06	2.422848	0.43020	.	.	ENSG00000039139	ENST00000265104	T	0.35973	1.28	5.64	4.78	0.61160	ATPase, AAA+ type, core (1);	0.000000	0.64402	D	0.000001	T	0.47581	0.1453	L	0.52206	1.635	0.80722	D	1	P	0.52061	0.95	P	0.57283	0.817	T	0.32107	-0.9919	10	0.24483	T	0.36	.	14.7893	0.69827	0.0696:0.0:0.9304:0.0	.	2679	Q8TE73	DYH5_HUMAN	M	2679	ENSP00000265104:L2679M	ENSP00000265104:L2679M	L	-	1	2	DNAH5	13846813	1.000000	0.71417	1.000000	0.80357	0.585000	0.36419	4.654000	0.61469	1.400000	0.46741	-0.459000	0.05422	CTG	DNAH5	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000039139		0.448	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2		0.00	18	0	G	NM_001369		13793813	-1			no_errors	ENST00000265104	ensembl	human	known	74_37	missense	50.00	8	8	SNP	1.000	T
DNAH7	56171	genome.wustl.edu	37	2	196863913	196863913	+	Intron	SNP	G	G	A	rs547185809	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:196863913G>A	ENST00000312428.6	-	12	1454				DNAH7_ENST00000410072.1_Silent_p.V469V	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						gctgaaaggtgacagaccttt	0.373																																																	0																																										SO:0001627	intron_variant	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.1353+1514C>T	2.37:g.196863913G>A			B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	NULL	p.V469	ENST00000312428.6	37	c.1407	CCDS42794.1	2																																																																																			DNAH7	-	NULL	ENSG00000118997		0.373	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	-	0.00	14	0	G	NM_018897		196863913	-1	tier1	-	no_errors	ENST00000410072	ensembl	human	known	74_37	silent	57.14	6	8	SNP	0.000	A
DNAJC13	23317	genome.wustl.edu	37	3	132175410	132175410	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:132175410G>T	ENST00000260818.6	+	11	1413	c.1165G>T	c.(1165-1167)Gca>Tca	p.A389S	DNAJC13_ENST00000486798.1_3'UTR	NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	389					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						AGTCCTACATGCAGTAACACA	0.338																																																	0													135.0	136.0	135.0					3																	132175410		2203	4300	6503	SO:0001583	missense	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.1165G>T	3.37:g.132175410G>T	ENSP00000260818:p.Ala389Ser		Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	pfam_DnaJ_domain,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_domain,pfscan_DnaJ_domain	p.A389S	ENST00000260818.6	37	c.1165	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	G	12.36	1.914428	0.33815	.	.	ENSG00000138246	ENST00000260818	T	0.39787	1.06	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.53850	0.1822	L	0.39898	1.24	0.80722	D	1	B;P;D	0.58970	0.342;0.946;0.984	B;P;D	0.68192	0.114;0.619;0.956	T	0.33317	-0.9873	10	0.08381	T	0.77	.	20.032	0.97543	0.0:0.0:1.0:0.0	.	389;56;389	A7E2Y5;Q8N7A5;O75165	.;.;DJC13_HUMAN	S	389	ENSP00000260818:A389S	ENSP00000260818:A389S	A	+	1	0	DNAJC13	133658100	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	9.345000	0.97053	2.743000	0.94032	0.655000	0.94253	GCA	DNAJC13	-	NULL	ENSG00000138246		0.338	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2	-	0.00	28	0	G	NM_015268		132175410	+1	tier1	-	no_errors	ENST00000260818	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	T
DNALI1	7802	genome.wustl.edu	37	1	38027197	38027197	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:38027197G>T	ENST00000296218.7	+	4	513	c.503G>T	c.(502-504)aGg>aTg	p.R168M	DNALI1_ENST00000497858.1_3'UTR|DNALI1_ENST00000541606.1_Missense_Mutation_p.R20M	NM_003462.3	NP_003453.2	O14645	IDLC_HUMAN	dynein, axonemal, light intermediate chain 1	146					cellular component movement (GO:0006928)|metabolic process (GO:0008152)|single fertilization (GO:0007338)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|filopodium (GO:0030175)	microtubule motor activity (GO:0003777)			breast(1)|kidney(1)|large_intestine(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TGTGCGGAGAGGGGGCTGCTG	0.602											OREG0013380	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													89.0	78.0	82.0					1																	38027197		2203	4300	6503	SO:0001583	missense	0			AF006386	CCDS420.1	1p35.1	2008-07-18	2006-09-04		ENSG00000163879	ENSG00000163879		"""Axonemal dyneins"""	14353	protein-coding gene	gene with protein product	"""inner dynein arm, homolog of clamydomonas"", ""dJ423B22.5 (axonemal dynein light chain (hp28))"""	602135	"""dynein, axonemal, light intermediate polypeptide 1"""			9284741	Standard	NM_003462		Approved	P28, hp28, dJ423B22.5	uc001cbj.3	O14645	OTTHUMG00000004222	ENST00000296218.7:c.503G>T	1.37:g.38027197G>T	ENSP00000296218:p.Arg168Met	875	A8K387|B4DHN6|Q05BL9|Q5HYE2|Q5TGH0|Q7L0I5	Missense_Mutation	SNP	pfam_Axonemal_dynein_light_chain	p.R168M	ENST00000296218.7	37	c.503	CCDS420.1	1	.	.	.	.	.	.	.	.	.	.	G	25.8	4.675926	0.88445	.	.	ENSG00000163879	ENST00000296218;ENST00000541606	T	0.65364	-0.15	5.2	5.2	0.72013	.	0.043972	0.85682	D	0.000000	D	0.83667	0.5304	H	0.96996	3.92	0.80722	D	1	P	0.51791	0.948	P	0.54499	0.754	D	0.89518	0.3776	10	0.87932	D	0	-17.2668	19.1061	0.93296	0.0:0.0:1.0:0.0	.	146	O14645	IDLC_HUMAN	M	168;20	ENSP00000296218:R168M	ENSP00000296218:R168M	R	+	2	0	DNALI1	37799784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.875000	0.87205	2.574000	0.86865	0.655000	0.94253	AGG	DNALI1	-	pfam_Axonemal_dynein_light_chain	ENSG00000163879		0.602	DNALI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNALI1	HGNC	protein_coding	OTTHUMT00000012159.1		0.00	40	0	G	NM_003462		38027197	+1			no_errors	ENST00000296218	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
DNAJC6	9829	genome.wustl.edu	37	1	65855049	65855049	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:65855049G>T	ENST00000395325.3	+	10	1290	c.1133G>T	c.(1132-1134)tGg>tTg	p.W378L	DNAJC6_ENST00000371069.4_Missense_Mutation_p.W435L|DNAJC6_ENST00000263441.7_Missense_Mutation_p.W365L	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	378					cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						ACTCCACCATGGGAACATTAC	0.443																																																	0													138.0	123.0	128.0					1																	65855049		2203	4300	6503	SO:0001583	missense	0			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.1133G>T	1.37:g.65855049G>T	ENSP00000378735:p.Trp378Leu		B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_C2_dom,smart_DnaJ_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.W435L	ENST00000395325.3	37	c.1304	CCDS30739.1	1	.	.	.	.	.	.	.	.	.	.	G	19.65	3.867754	0.72065	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	D;D;D	0.94793	-3.51;-3.44;-3.52	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.96636	0.8902	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94507	0.7715	10	0.28530	T	0.3	.	19.5125	0.95148	0.0:0.0:1.0:0.0	.	435;378;365	O75061-2;O75061;D3DQ66	.;AUXI_HUMAN;.	L	365;378;435	ENSP00000263441:W365L;ENSP00000378735:W378L;ENSP00000360108:W435L	ENSP00000263441:W365L	W	+	2	0	DNAJC6	65627637	1.000000	0.71417	0.998000	0.56505	0.260000	0.26232	9.249000	0.95470	2.840000	0.97914	0.655000	0.94253	TGG	DNAJC6	-	NULL	ENSG00000116675		0.443	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DNAJC6	HGNC	protein_coding	OTTHUMT00000025134.1		0.00	42	0	G			65855049	+1			no_errors	ENST00000371069	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
DNER	92737	genome.wustl.edu	37	2	230456533	230456535	+	In_Frame_Del	DEL	GCT	GCT	-	rs376000556	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	GCT	GCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:230456533_230456535delGCT	ENST00000341772.4	-	2	480_482	c.346_348delAGC	c.(346-348)agcdel	p.S116del		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	116	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Interaction with NOTCH1. {ECO:0000250}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		GGTAGCCATCgctgctgctgctg	0.532																																																	0																																										SO:0001651	inframe_deletion	0			AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.346_348delAGC	2.37:g.230456542_230456544delGCT	ENSP00000345229:p.Ser116del		A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	In_Frame_Del	DEL	pfam_EG-like_dom,pfam_EGF_extracell,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.S116in_frame_del	ENST00000341772.4	37	c.348_346	CCDS33390.1	2																																																																																			DNER	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000187957		0.532	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNER	HGNC	protein_coding	OTTHUMT00000331902.1		0.00	16	0	GCT	NM_139072		230456535	-1	tier1		no_errors	ENST00000341772	ensembl	human	known	74_37	in_frame_del	12.12	29	4	DEL	0.003:0.004:0.006	-
DNM1L	10059	genome.wustl.edu	37	12	32896340	32896340	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:32896340G>T	ENST00000549701.1	+	20	2281	c.2207G>T	c.(2206-2208)tGg>tTg	p.W736L	DNM1L_ENST00000358214.5_Missense_Mutation_p.W712L|DNM1L_ENST00000452533.2_Missense_Mutation_p.W710L|DNM1L_ENST00000414834.2_Missense_Mutation_p.W533L|DNM1L_ENST00000266481.6_Missense_Mutation_p.W699L|YARS2_ENST00000551673.1_Intron|DNM1L_ENST00000547312.1_Missense_Mutation_p.W725L|DNM1L_ENST00000381000.4_Missense_Mutation_p.W738L|DNM1L_ENST00000553257.1_Missense_Mutation_p.W749L			O00429	DNM1L_HUMAN	dynamin 1-like	736					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dynamin polymerization involved in mitochondrial fission (GO:0003374)|endocytosis (GO:0006897)|GTP catabolic process (GO:0006184)|membrane fission involved in mitochondrial fission (GO:0090149)|membrane fusion (GO:0061025)|mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion morphogenesis (GO:0070584)|necroptotic process (GO:0070266)|peroxisome fission (GO:0016559)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein secretion (GO:0050714)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homotetramerization (GO:0051289)|protein localization to mitochondrion (GO:0070585)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|regulation of protein oligomerization (GO:0032459)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|protein complex (GO:0043234)|synapse (GO:0045202)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	23	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					ACTCATCTTTGGTGAAGAGAA	0.338																																																	0													93.0	94.0	94.0					12																	32896340		2203	4300	6503	SO:0001583	missense	0			AF000430	CCDS8728.1, CCDS8729.1, CCDS8730.1, CCDS61095.1, CCDS61096.1, CCDS61098.1, CCDS61099.1	12p11.21	2012-10-02			ENSG00000087470	ENSG00000087470			2973	protein-coding gene	gene with protein product		603850				9348079, 9731200	Standard	NM_012062		Approved	DRP1, DVLP, HDYNIV, DYMPLE, VPS1	uc001rld.2	O00429	OTTHUMG00000169451	ENST00000549701.1:c.2207G>T	12.37:g.32896340G>T	ENSP00000450399:p.Trp736Leu		A8K4X9|B4DGC9|B4DSU8|J3KPI2|O14541|O60709|Q59GN9|Q7L6B3|Q8TBT7|Q9BWM1|Q9Y5J2	Missense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,smart_GED,prints_Dynamin_SF	p.W749L	ENST00000549701.1	37	c.2246	CCDS8729.1	12	.	.	.	.	.	.	.	.	.	.	G	26.9	4.785278	0.90282	.	.	ENSG00000087470	ENST00000452533;ENST00000411996;ENST00000553257;ENST00000549701;ENST00000358214;ENST00000266481;ENST00000547312;ENST00000414834;ENST00000381000	D;D;D;D;D;D;D;D	0.91996	-2.95;-2.82;-2.87;-2.86;-2.83;-2.92;-1.7;-2.94	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.95752	0.8618	M	0.66939	2.045	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;0.997;1.0;1.0;0.997;1.0	D;P;D;D;P;D	0.91635	0.996;0.87;0.999;0.999;0.902;0.999	D	0.95831	0.8858	10	0.87932	D	0	.	19.5745	0.95436	0.0:0.0:1.0:0.0	.	533;763;789;791;752;736	B4DGC9;D3DUW6;D3DUW5;F8W8D1;D3DUW7;O00429	.;.;.;.;.;DNM1L_HUMAN	L	710;791;749;736;712;699;725;533;738	ENSP00000415131:W710L;ENSP00000449089:W749L;ENSP00000450399:W736L;ENSP00000350948:W712L;ENSP00000266481:W699L;ENSP00000448610:W725L;ENSP00000404160:W533L;ENSP00000370388:W738L	ENSP00000266481:W699L	W	+	2	0	DNM1L	32787607	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.162000	0.94745	2.689000	0.91719	0.591000	0.81541	TGG	DNM1L	-	NULL	ENSG00000087470		0.338	DNM1L-003	KNOWN	basic|CCDS	protein_coding	DNM1L	HGNC	protein_coding	OTTHUMT00000404124.1		0.00	21	0	G	NM_012062		32896340	+1			no_errors	ENST00000553257	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
DNMBP	23268	genome.wustl.edu	37	10	101637038	101637038	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:101637038G>T	ENST00000324109.4	-	17	4695	c.4604C>A	c.(4603-4605)tCa>tAa	p.S1535*	DNMBP_ENST00000540316.1_Nonsense_Mutation_p.S471*|DNMBP_ENST00000342239.3_Nonsense_Mutation_p.S1559*|DNMBP_ENST00000543621.1_Nonsense_Mutation_p.S781*	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	1535	SH3 6. {ECO:0000255|PROSITE- ProRule:PRU00192}.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.S1535*(1)		central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CTGATTGGCTGACACGCTCAG	0.473																																																	1	Substitution - Nonsense(1)	endometrium(1)											204.0	190.0	195.0					10																	101637038		2203	4300	6503	SO:0001587	stop_gained	0			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.4604C>A	10.37:g.101637038G>T	ENSP00000315659:p.Ser1535*		Q8IVY3|Q9Y2L3	Nonsense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_BAR_dom,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain,prints_p67phox,prints_Spectrin_alpha_SH3	p.S1559*	ENST00000324109.4	37	c.4676	CCDS7485.1	10	.	.	.	.	.	.	.	.	.	.	G	39	7.901302	0.98551	.	.	ENSG00000107554	ENST00000342239;ENST00000324109;ENST00000393570;ENST00000543621;ENST00000540316	.	.	.	5.38	3.48	0.39840	.	0.179826	0.27202	N	0.020456	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.0212	11.3289	0.49465	0.1512:0.0:0.8488:0.0	.	.	.	.	X	1559;1535;781;781;471	.	ENSP00000315659:S1535X	S	-	2	0	DNMBP	101627028	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	3.620000	0.54203	1.237000	0.43756	0.561000	0.74099	TCA	DNMBP	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000107554		0.473	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	HGNC	protein_coding	OTTHUMT00000049832.2		0.00	64	0	G	NM_015221		101637038	-1			no_errors	ENST00000342239	ensembl	human	known	74_37	nonsense	6.00	47	3	SNP	1.000	T
DRD4	1815	genome.wustl.edu	37	11	640565	640565	+	Missense_Mutation	SNP	C	C	T	rs377281442		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:640565C>T	ENST00000176183.5	+	4	1234	c.1222C>T	c.(1222-1224)Cgc>Tgc	p.R408C		NM_000797.3	NP_000788.2	P21917	DRD4_HUMAN	dopamine receptor D4	456					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult locomotory behavior (GO:0008344)|arachidonic acid secretion (GO:0050482)|behavioral fear response (GO:0001662)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|cellular calcium ion homeostasis (GO:0006874)|circadian rhythm (GO:0007623)|dopamine metabolic process (GO:0042417)|dopamine receptor signaling pathway (GO:0007212)|fear response (GO:0042596)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein secretion (GO:0050709)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|olfactory learning (GO:0008355)|photoperiodism (GO:0009648)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of kinase activity (GO:0033674)|positive regulation of penile erection (GO:0060406)|positive regulation of sodium:proton antiporter activity (GO:0032417)|regulation of calcium-mediated signaling (GO:0050848)|regulation of circadian rhythm (GO:0042752)|regulation of dopamine metabolic process (GO:0042053)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of neurotransmitter secretion (GO:0046928)|response to amphetamine (GO:0001975)|response to histamine (GO:0034776)|response to steroid hormone (GO:0048545)|retina development in camera-type eye (GO:0060041)|short-term memory (GO:0007614)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)	cell cortex (GO:0005938)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)|vesicle membrane (GO:0012506)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)|SH3 domain binding (GO:0017124)			NS(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;4.36e-28)|Epithelial(43;2.59e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0234)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Dopamine(DB00988)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pramipexole(DB00413)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Ziprasidone(DB00246)	CGCCGAGTTCCGCAACGTCTT	0.697																																																	0									CYS/ARG	0,4406		0,0,2203	93.0	79.0	84.0		1222	2.0	1.0	11		84	1,8595	1.2+/-3.3	0,1,4297	no	missense	DRD4	NM_000797.3	180	0,1,6500	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	408/420	640565	1,13001	2203	4298	6501	SO:0001583	missense	0			L12398	CCDS7710.1	11p15.5	2012-08-08			ENSG00000069696	ENSG00000069696		"""GPCR / Class A : Dopamine receptors"""	3025	protein-coding gene	gene with protein product		126452					Standard	NM_000797		Approved		uc001lqp.2	P21917	OTTHUMG00000133312	ENST00000176183.5:c.1222C>T	11.37:g.640565C>T	ENSP00000176183:p.Arg408Cys		B0M0J7|Q7Z7Q5|Q8NGM5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Dopamine_D4_rcpt,prints_Dopamine_rcpt	p.R408C	ENST00000176183.5	37	c.1222	CCDS7710.1	11	.	.	.	.	.	.	.	.	.	.	c	20.1	3.933167	0.73442	0.0	1.16E-4	ENSG00000069696	ENST00000176183	T	0.58358	0.34	3.02	1.98	0.26296	.	0.071537	0.51477	D	0.000097	T	0.66356	0.2781	.	.	.	0.51767	D	0.999931	D	0.89917	1.0	D	0.77557	0.99	T	0.68550	-0.5379	9	0.87932	D	0	.	7.67	0.28453	0.4648:0.5351:0.0:0.0	.	456	P21917	DRD4_HUMAN	C	408	ENSP00000176183:R408C	ENSP00000176183:R408C	R	+	1	0	DRD4	630565	1.000000	0.71417	0.967000	0.41034	0.954000	0.61252	2.088000	0.41663	1.709000	0.51313	0.457000	0.33378	CGC	DRD4	-	prints_GPCR_Rhodpsn,prints_Dopamine_rcpt	ENSG00000069696		0.697	DRD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD4	HGNC	protein_coding	OTTHUMT00000257109.1	-	0.00	38	0	C	NM_000797		640565	+1	tier1	-	no_errors	ENST00000176183	ensembl	human	known	74_37	missense	34.69	32	17	SNP	1.000	T
DSG4	147409	genome.wustl.edu	37	18	28993361	28993361	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:28993361G>T	ENST00000308128.4	+	16	3061	c.2926G>T	c.(2926-2928)Gac>Tac	p.D976Y	RP11-534N16.1_ENST00000581856.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.D995Y|RP11-534N16.1_ENST00000578477.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	976					anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TGGTGTGCCTGACATGAGCAA	0.433																																																	0													171.0	157.0	162.0					18																	28993361		2203	4300	6503	SO:0001583	missense	0			AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.2926G>T	18.37:g.28993361G>T	ENSP00000311859:p.Asp976Tyr		A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmosomal_cadherin	p.D995Y	ENST00000308128.4	37	c.2983	CCDS11897.1	18	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628287	0.46944	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.60171	0.27;0.21	5.56	5.56	0.83823	.	0.218640	0.23191	N	0.050905	T	0.71178	0.3309	M	0.65498	2.005	0.27007	N	0.96477	D;P	0.55172	0.97;0.829	P;B	0.56823	0.807;0.332	T	0.67677	-0.5609	10	0.87932	D	0	.	17.3007	0.87182	0.0:0.0:1.0:0.0	.	995;976	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	Y	976;995	ENSP00000311859:D976Y;ENSP00000352785:D995Y	ENSP00000311859:D976Y	D	+	1	0	DSG4	27247359	0.234000	0.23783	0.168000	0.22838	0.954000	0.61252	2.884000	0.48562	2.603000	0.88011	0.591000	0.81541	GAC	DSG4	-	NULL	ENSG00000175065		0.433	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG4	HGNC	protein_coding	OTTHUMT00000254941.1	-	0.00	46	0	G	NM_177986		28993361	+1	tier1	-	no_errors	ENST00000359747	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.399	T
DYRK1A	1859	genome.wustl.edu	37	21	38853058	38853059	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr21:38853058_38853059insA	ENST00000398960.2	+	4	521_522	c.446_447insA	c.(445-450)gtaaaafs	p.VK149fs	DYRK1A_ENST00000338785.3_Frame_Shift_Ins_p.VK149fs|DYRK1A_ENST00000398956.2_Frame_Shift_Ins_p.VK149fs|DYRK1A_ENST00000321219.8_Frame_Shift_Ins_p.VK149fs|DYRK1A_ENST00000462274.1_3'UTR|DYRK1A_ENST00000451934.1_Frame_Shift_Ins_p.VK149fs|DYRK1A_ENST00000339659.4_Frame_Shift_Ins_p.VK140fs	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	149					circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GATTATATTGTAAAAAACGGAG	0.376																																					Melanoma(114;464 1602 31203 43785 45765)												0																																										SO:0001589	frameshift_variant	0			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.452dupA	21.37:g.38853064_38853064dupA	ENSP00000381932:p.Val149fs		O60769|Q92582|Q92810|Q9UNM5	Frame_Shift_Ins	INS	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.N151fs	ENST00000398960.2	37	c.446_447	CCDS42925.1	21																																																																																			DYRK1A	-	superfamily_Kinase-like_dom	ENSG00000157540		0.376	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK1A	HGNC	protein_coding	OTTHUMT00000194804.1		0.00	26	0	-	NM_001396		38853059	+1	tier1		no_errors	ENST00000398960	ensembl	human	known	74_37	frame_shift_ins	24.00	19	6	INS	1.000:0.984	A
EEF1A2	1917	genome.wustl.edu	37	20	62127339	62127339	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr20:62127339G>A	ENST00000298049.7	-	2	264	c.194C>T	c.(193-195)gCg>gTg	p.A65V	EEF1A2_ENST00000217182.3_Missense_Mutation_p.A65V			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	65	tr-type G.				positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			CTCACGCTCCGCCTTCAGCTT	0.627											OREG0026129	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													214.0	169.0	184.0					20																	62127339		2203	4299	6502	SO:0001583	missense	0			AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.194C>T	20.37:g.62127339G>A	ENSP00000298049:p.Ala65Val	1058	B5BUF3|E1P5J1|P54266|Q0VGC7	Missense_Mutation	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_P-loop_NTPase,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_B-barrel,prints_EF_GTP-bd_dom,tigrfam_Transl_elong_EF1A_euk/arc	p.A65V	ENST00000298049.7	37	c.194	CCDS13522.1	20	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266952	0.80469	.	.	ENSG00000101210	ENST00000298049;ENST00000217182	T;T	0.71579	-0.58;-0.58	4.01	4.01	0.46588	Protein synthesis factor, GTP-binding (2);	0.000000	0.85682	D	0.000000	D	0.85031	0.5604	M	0.85197	2.74	0.80722	D	1	D;P	0.89917	1.0;0.71	D;B	0.72338	0.977;0.2	D	0.88263	0.2924	10	0.66056	D	0.02	15.4109	16.4593	0.84031	0.0:0.0:1.0:0.0	.	41;65	Q59GP5;Q05639	.;EF1A2_HUMAN	V	65	ENSP00000298049:A65V;ENSP00000217182:A65V	ENSP00000217182:A65V	A	-	2	0	EEF1A2	61597783	1.000000	0.71417	0.971000	0.41717	0.874000	0.50279	9.664000	0.98607	1.954000	0.56735	0.313000	0.20887	GCG	EEF1A2	-	pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,tigrfam_Transl_elong_EF1A_euk/arc	ENSG00000101210		0.627	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1A2	HGNC	protein_coding	OTTHUMT00000080495.1	-	0.00	37	0	G	NM_001958		62127339	-1	tier1	-	no_errors	ENST00000217182	ensembl	human	known	74_37	missense	29.51	43	18	SNP	1.000	A
EFCAB5	374786	genome.wustl.edu	37	17	28295948	28295948	+	Silent	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:28295948A>G	ENST00000394835.3	+	4	522	c.330A>G	c.(328-330)ccA>ccG	p.P110P	EFCAB5_ENST00000378738.3_Silent_p.P110P|EFCAB5_ENST00000534836.2_Intron|EFCAB5_ENST00000320856.5_Silent_p.P110P|EFCAB5_ENST00000536908.2_Silent_p.P54P|EFCAB5_ENST00000541045.1_Intron|EFCAB5_ENST00000394832.2_Silent_p.P110P	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	110							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						AATCAAAGCCAGAGCACACAT	0.358																																																	0													28.0	25.0	26.0					17																	28295948		1829	4092	5921	SO:0001819	synonymous_variant	0			AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.330A>G	17.37:g.28295948A>G			B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Silent	SNP	pfscan_EF_hand_dom	p.P110	ENST00000394835.3	37	c.330	CCDS11254.2	17																																																																																			EFCAB5	-	NULL	ENSG00000176927		0.358	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB5	HGNC	protein_coding	OTTHUMT00000256120.4	-	0.00	14	0	A	NM_198529		28295948	+1	tier1	-	no_errors	ENST00000394835	ensembl	human	known	74_37	silent	63.64	4	7	SNP	0.000	G
EGLN2	112398	genome.wustl.edu	37	19	41306597	41306597	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:41306597G>T	ENST00000593726.1	+	1	1148	c.120G>T	c.(118-120)ctG>ctT	p.L40L	RAB4B-EGLN2_ENST00000594136.1_3'UTR|EGLN2_ENST00000303961.4_Silent_p.L40L|EGLN2_ENST00000406058.2_Silent_p.L40L|EGLN2_ENST00000594140.1_5'Flank|CTC-490E21.12_ENST00000601627.1_5'Flank			Q96KS0	EGLN2_HUMAN	egl-9 family hypoxia-inducible factor 2	40					cell redox homeostasis (GO:0045454)|cellular response to hypoxia (GO:0071456)|intracellular estrogen receptor signaling pathway (GO:0030520)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)|positive regulation of protein catabolic process (GO:0045732)|regulation of cell growth (GO:0001558)|regulation of neuron apoptotic process (GO:0043523)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to hypoxia (GO:0001666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|oxygen sensor activity (GO:0019826)|peptidyl-proline 4-dioxygenase activity (GO:0031545)			breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	AGAGTTACCTGCCCTGTCCCC	0.652																																																	0													55.0	47.0	49.0					19																	41306597		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ310544	CCDS12567.1	19q13.2	2013-08-21	2013-08-21		ENSG00000269858	ENSG00000269858			14660	protein-coding gene	gene with protein product	"""HIF prolyl hydroxylase 1"""	606424	"""EGL nine (C.elegans) homolog 2"", ""egl nine homolog 2 (C. elegans)"""				Standard	NM_080732		Approved	PHD1, HIFPH1	uc002oph.3	Q96KS0		ENST00000593726.1:c.120G>T	19.37:g.41306597G>T			A8K5S0|Q8WWY4|Q9BV14	Silent	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.L40	ENST00000593726.1	37	c.120	CCDS12567.1	19																																																																																			EGLN2	-	NULL	ENSG00000269858		0.652	EGLN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EGLN2	HGNC	protein_coding	OTTHUMT00000463218.1	-	0.00	42	0	G			41306597	+1	tier1	-	no_errors	ENST00000303961	ensembl	human	known	74_37	silent	10.20	44	5	SNP	1.000	T
EHBP1	23301	genome.wustl.edu	37	2	63176034	63176034	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:63176034G>T	ENST00000263991.5	+	14	2640	c.2158G>T	c.(2158-2160)Gaa>Taa	p.E720*	EHBP1_ENST00000405289.1_Nonsense_Mutation_p.E685*|EHBP1_ENST00000431489.1_Nonsense_Mutation_p.E685*|EHBP1_ENST00000405015.3_Nonsense_Mutation_p.E685*|EHBP1_ENST00000354487.3_Nonsense_Mutation_p.E685*	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	720						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			GGAGACAGATGAACAAAAGCT	0.358																																																	0													70.0	76.0	74.0					2																	63176034		2203	4300	6503	SO:0001587	stop_gained	0			AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.2158G>T	2.37:g.63176034G>T	ENSP00000263991:p.Glu720*		O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Nonsense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.E720*	ENST00000263991.5	37	c.2158	CCDS1872.1	2	.	.	.	.	.	.	.	.	.	.	G	43	10.041509	0.99324	.	.	ENSG00000115504	ENST00000405015;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	.	.	.	5.66	0.954	0.19595	.	0.614363	0.16352	N	0.218154	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	4.7123	0.12879	0.3653:0.4084:0.2263:0.0	.	.	.	.	X	685;685;720;685;685	.	ENSP00000263991:E720X	E	+	1	0	EHBP1	63029538	0.929000	0.31497	0.018000	0.16275	0.887000	0.51463	1.642000	0.37207	0.241000	0.21283	0.655000	0.94253	GAA	EHBP1	-	NULL	ENSG00000115504		0.358	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1	HGNC	protein_coding	OTTHUMT00000251616.1		0.00	30	0	G	NM_015252		63176034	+1			no_errors	ENST00000263991	ensembl	human	known	74_37	nonsense	6.45	29	2	SNP	0.002	T
EIF3F	8665	genome.wustl.edu	37	11	8015982	8015982	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:8015982G>T	ENST00000533626.1	+	7	1289	c.663G>T	c.(661-663)atG>atT	p.M221I	EIF3F_ENST00000309828.4_Missense_Mutation_p.M221I|EIF3F_ENST00000537635.1_Missense_Mutation_p.M236I|EIF3F_ENST00000449102.2_Missense_Mutation_p.M72I					eukaryotic translation initiation factor 3, subunit F											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|skin(1)	13				Epithelial(150;1.44e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GCACTTTAATGGGAGTCCCTG	0.498																																																	0													95.0	78.0	84.0					11																	8015982		2201	4296	6497	SO:0001583	missense	0			U94855, AK093511	CCDS7785.1	11p15.4	2010-03-10	2007-07-27	2007-07-27	ENSG00000175390	ENSG00000175390			3275	protein-coding gene	gene with protein product		603914	"""eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa"""	EIF3S5		9341143	Standard	NM_003754		Approved	eIF3-epsilon, eIF3-p47, eIF3f	uc001mfw.3	O00303		ENST00000533626.1:c.663G>T	11.37:g.8015982G>T	ENSP00000431800:p.Met221Ile			Missense_Mutation	SNP	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.M236I	ENST00000533626.1	37	c.708	CCDS7785.1	11	.	.	.	.	.	.	.	.	.	.	G	15.39	2.818112	0.50633	.	.	ENSG00000175390	ENST00000533626;ENST00000537635;ENST00000309828;ENST00000538607;ENST00000449102	T;T;T;T	0.38560	1.67;1.67;1.67;1.13	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.33206	0.0855	L	0.31065	0.9	0.80722	D	1	B	0.22003	0.063	B	0.17433	0.018	T	0.06162	-1.0842	10	0.32370	T	0.25	1.845	16.5077	0.84277	0.0:0.0:1.0:0.0	.	221	O00303	EIF3F_HUMAN	I	221;236;221;171;72	ENSP00000431800:M221I;ENSP00000442283:M236I;ENSP00000310040:M221I;ENSP00000396929:M72I	ENSP00000310040:M221I	M	+	3	0	EIF3F	7972558	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	9.144000	0.94629	2.689000	0.91719	0.655000	0.94253	ATG	EIF3F	-	smart_JAB_MPN_dom	ENSG00000175390		0.498	EIF3F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EIF3F	HGNC	protein_coding	OTTHUMT00000385713.2	-	0.00	41	0	G	NM_003754		8015982	+1	tier1	-	no_errors	ENST00000537635	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
ELFN1	392617	genome.wustl.edu	37	7	1785372	1785372	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:1785372C>T	ENST00000424383.2	+	3	1627	c.1140C>T	c.(1138-1140)tgC>tgT	p.C380C	ELFN1_ENST00000561626.1_Silent_p.C380C|ELFN1_ENST00000541472.1_Silent_p.C380C			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	380	Fibronectin type-III.				negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						ACACCTACTGCGTGGTGTCCA	0.647																																																	0													68.0	65.0	66.0					7																	1785372		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.1140C>T	7.37:g.1785372C>T			H3BS57	Silent	SNP	superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.C380	ENST00000424383.2	37	c.1140	CCDS59046.1	7																																																																																			ELFN1	-	superfamily_Fibronectin_type3	ENSG00000225968		0.647	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ELFN1	HGNC	protein_coding	OTTHUMT00000322893.2	-	0.00	48	0	C	NM_001128636		1785372	+1	tier1	-	no_errors	ENST00000424383	ensembl	human	known	74_37	silent	31.25	22	10	SNP	0.489	T
EMID1	129080	genome.wustl.edu	37	22	29651284	29651284	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr22:29651284C>T	ENST00000404820.3	+	14	1271	c.1144C>T	c.(1144-1146)Cag>Tag	p.Q382*	EMID1_ENST00000404755.3_Intron|EMID1_ENST00000334018.6_Intron			Q96A84	EMID1_HUMAN	EMI domain containing 1	377						collagen trimer (GO:0005581)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)|skin(3)	12						GAGCTTCCTGCAGCAGCAGGC	0.662																																																	0													9.0	12.0	11.0					22																	29651284		690	1582	2272	SO:0001587	stop_gained	0			AJ416090	CCDS33630.1	22q12.2	2009-08-04			ENSG00000186998	ENSG00000186998		"""EMI domain containing"""	18036	protein-coding gene	gene with protein product	"""emilin and multimerin-domain containing protein 1"", ""putative emu1"""	608926				12221002	Standard	NM_001267895		Approved	EMU1, hEmu1, EMI5	uc003aem.4	Q96A84	OTTHUMG00000151013	ENST00000404820.3:c.1144C>T	22.37:g.29651284C>T	ENSP00000384452:p.Gln382*		B0QYK6|Q6ICG1|Q86SS7	Nonsense_Mutation	SNP	pfam_Collagen,pfam_EMI_domain,pfscan_EMI_domain	p.Q382*	ENST00000404820.3	37	c.1144		22	.	.	.	.	.	.	.	.	.	.	C	36	5.731404	0.96856	.	.	ENSG00000186998	ENST00000404820	.	.	.	5.54	4.52	0.55395	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-10.9443	12.1057	0.53811	0.0:0.9178:0.0:0.0822	.	.	.	.	X	382	.	ENSP00000384452:Q382X	Q	+	1	0	EMID1	27981284	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.688000	0.46984	1.571000	0.49722	0.655000	0.94253	CAG	EMID1	-	NULL	ENSG00000186998		0.662	EMID1-002	NOVEL	basic|appris_principal	protein_coding	EMID1	HGNC	protein_coding	OTTHUMT00000321075.1	-	0.00	32	0	C	NM_133455		29651284	+1	tier1	-	no_errors	ENST00000404820	ensembl	human	novel	74_37	nonsense	10.26	35	4	SNP	1.000	T
EMR1	2015	genome.wustl.edu	37	19	6935064	6935064	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:6935064G>A	ENST00000312053.4	+	18	2393	c.2356G>A	c.(2356-2358)Gaa>Aaa	p.E786K	EMR1_ENST00000250572.8_Missense_Mutation_p.E721K|EMR1_ENST00000450315.3_Missense_Mutation_p.E609K|EMR1_ENST00000381404.4_Missense_Mutation_p.E767K|EMR1_ENST00000381407.5_Missense_Mutation_p.E645K	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	786					cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					TGTTAATGCCGAAGTCTCAAC	0.483																																																	0													176.0	156.0	162.0					19																	6935064		2203	4300	6503	SO:0001583	missense	0			X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.2356G>A	19.37:g.6935064G>A	ENSP00000311545:p.Glu786Lys		A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like	p.E786K	ENST00000312053.4	37	c.2356	CCDS12175.1	19	.	.	.	.	.	.	.	.	.	.	g	16.44	3.123880	0.56613	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.09	4.05	0.47172	GPCR, family 2-like (1);	.	.	.	.	T	0.48277	0.1491	L	0.41027	1.25	0.33032	D	0.530296	D;D;D;D;D	0.69078	0.996;0.997;0.986;0.997;0.98	P;P;P;D;P	0.62955	0.878;0.878;0.63;0.909;0.663	T	0.58509	-0.7624	9	0.72032	D	0.01	.	6.8511	0.24014	0.1931:0.0:0.8069:0.0	.	609;645;721;767;786	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	K	721;786;767;721;645;609	ENSP00000311545:E786K;ENSP00000370811:E767K;ENSP00000250572:E721K;ENSP00000370814:E645K;ENSP00000405974:E609K	ENSP00000250572:E721K	E	+	1	0	EMR1	6886064	0.991000	0.36638	0.905000	0.35620	0.297000	0.27493	2.230000	0.42999	2.371000	0.80710	0.655000	0.94253	GAA	EMR1	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt	ENSG00000174837		0.483	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR1	HGNC	protein_coding	OTTHUMT00000458485.1	-	0.00	60	0	G			6935064	+1	tier1	-	no_errors	ENST00000312053	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.910	A
SMG1P4	100507526	genome.wustl.edu	37	16	21893326	21893326	+	RNA	DEL	A	A	-			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:21893326delA	ENST00000540706.1	-	0	1710																											TGGAACCATTAAAAAAAACAA	0.358																																																	0																																												0																															16.37:g.21893326delA				RNA	DEL	-	NULL	ENST00000540706.1	37	NULL		16																																																																																			RP11-645C24.2	-	-	ENSG00000185710		0.358	RP11-645C24.2-003	KNOWN	basic	processed_transcript	ENSG00000185710	Clone_based_vega_gene	pseudogene	OTTHUMT00000402428.1		0.00	48	0	A			21893326	-1			no_errors	ENST00000543702	ensembl	human	known	74_37	rna	37.50	35	21	DEL	0.002	0
LRRC37BP1	147172	genome.wustl.edu	37	17	28960350	28960351	+	RNA	INS	-	-	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:28960350_28960351insA	ENST00000417404.1	+	0	1211_1212									leucine rich repeat containing 37B pseudogene 1																		CAACAAAAAACAAATTATATTA	0.446																																																	0																																												0			BC118647		17q11.2	2012-10-05	2010-08-16	2010-08-16	ENSG00000250462	ENSG00000250462			25390	pseudogene	pseudogene			"""leucine rich repeat containing 37, member B2"""	LRRC37B2			Standard	NR_015341		Approved	DKFZp667M2411	uc010csj.3		OTTHUMG00000132795		17.37:g.28960353_28960353dupA				RNA	INS	-	NULL	ENST00000417404.1	37	NULL		17																																																																																			AC005562.1	-	-	ENSG00000214719		0.446	LRRC37BP1-003	KNOWN	basic	processed_transcript	ENSG00000214719	Clone_based_vega_gene	pseudogene	OTTHUMT00000256203.1		0.00	69	0	-	NR_015341		28960351	+1	tier1		no_errors	ENST00000398849	ensembl	human	known	74_37	rna	32.61	62	30	INS	0.000:0.001	A
AL445258.1	0	genome.wustl.edu	37	X	145072451	145072451	+	RNA	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:145072451A>C	ENST00000401213.1	-	0	4				hsa-mir-892c_ENST00000516410.1_RNA																							TGAGTAGGGAACTTCCCACAG	0.488																																																	0																																												0																															X.37:g.145072451A>C				RNA	SNP	-	NULL	ENST00000401213.1	37	NULL		X																																																																																			AL445258.1	-	-	ENSG00000216032		0.488	AL445258.1-201	NOVEL	basic	miRNA	ENSG00000216032	Clone_based_ensembl_gene	miRNA		-	0.00	30	0	A			145072451	-1	tier1	-	no_errors	ENST00000401213	ensembl	human	novel	74_37	rna	30.77	18	8	SNP	0.000	C
PHF20L1	51105	genome.wustl.edu	37	8	133854714	133854715	+	Intron	INS	-	-	T	rs71276510|rs398038307		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:133854714_133854715insT	ENST00000395386.2	+	19	2686				AF230666.2_ENST00000429151.1_RNA|AF230666.2_ENST00000608375.1_RNA|PHF20L1_ENST00000220847.7_Intron|PHF20L1_ENST00000395390.2_Intron	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1								zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TTGTTAATAGATTTTTTTTTTT	0.356																																																	0																																										SO:0001627	intron_variant	0			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2388-45->T	8.37:g.133854725_133854725dupT			A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	RNA	INS	-	NULL	ENST00000395386.2	37	NULL	CCDS6367.2	8																																																																																			AF230666.2	-	-	ENSG00000223697		0.356	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ENSG00000223697	Clone_based_vega_gene	protein_coding	OTTHUMT00000308949.3		0.00	10	0	-	NM_016018		133854715	-1	tier1		no_errors	ENST00000608375	ensembl	human	known	74_37	rna	33.33	4	2	INS	0.014:0.003	T
CUBNP1	728064	genome.wustl.edu	37	10	43197597	43197597	+	lincRNA	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:43197597G>A	ENST00000439913.1	+	0	825																											AGATGTTCCAGCAGAGCCCTG	0.493																																																	0																																												0																															10.37:g.43197597G>A				RNA	SNP	-	NULL	ENST00000439913.1	37	NULL		10																																																																																			AL022344.5	-	-	ENSG00000234864		0.493	AL022344.5-001	KNOWN	basic	lincRNA	ENSG00000234864	Clone_based_vega_gene	lincRNA	OTTHUMT00000047688.1	-	0.00	43	0	G			43197597	+1	tier1	-	no_errors	ENST00000439913	ensembl	human	known	74_37	rna	7.69	48	4	SNP	0.995	A
ACSL6	23305	genome.wustl.edu	37	5	131214704	131214704	+	IGR	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:131214704A>C								FNIP1 (81994 upstream) : AC034228.4 (65396 downstream)																							TTGAAGGGCAAGTTTTCTCAG	0.274																																																	0																																										SO:0001628	intergenic_variant	0																															5.37:g.131214704A>C				RNA	SNP	-	NULL		37	NULL		5																																																																																			AC034228.7	-	-	ENSG00000239642	0	0.274					ENSG00000239642	Clone_based_vega_gene			-	0.00	16	0	A			131214704	-1	tier1	-	no_errors	ENST00000439905	ensembl	human	known	74_37	rna	50.00	11	11	SNP	0.206	C
PRKAG2	51422	genome.wustl.edu	37	7	151504031	151504031	+	Intron	DEL	A	A	-			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:151504031delA	ENST00000287878.4	-	2	619				PRKAG2_ENST00000392801.2_Intron|RP13-452N2.1_ENST00000462083.2_RNA	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit						ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	cagcctgggGAAAAAAAAAAG	0.498																																																	0																																										SO:0001627	intron_variant	0			AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.115-20404T>-	7.37:g.151504031delA			Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	RNA	DEL	-	NULL	ENST00000287878.4	37	NULL	CCDS5928.1	7																																																																																			RP13-452N2.1	-	-	ENSG00000242048		0.498	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000242048	Clone_based_vega_gene	protein_coding	OTTHUMT00000348440.2		0.00	10	0	A	NM_016203		151504031	+1	tier1		no_errors	ENST00000462083	ensembl	human	known	74_37	rna	18.18	18	4	DEL	0.004	-
LOC101926941	101926941	genome.wustl.edu	37	5	141913840	141913840	+	RNA	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:141913840G>T	ENST00000443800.1	+	0	243				AC005215.1_ENST00000517022.1_RNA																							agattcctgggctccacacca	0.453																																																	0																																												0																															5.37:g.141913840G>T				RNA	SNP	-	NULL	ENST00000443800.1	37	NULL		5																																																																																			AC005215.1	-	-	ENSG00000252831		0.453	AC005592.2-001	KNOWN	basic	antisense	ENSG00000252831	Clone_based_ensembl_gene	antisense	OTTHUMT00000257944.1	-	0.00	14	0	G			141913840	-1	tier1	-	no_errors	ENST00000517022	ensembl	human	novel	74_37	rna	36.36	7	4	SNP	0.030	T
RP11-554D14.1	0	genome.wustl.edu	37	12	108305201	108305201	+	RNA	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:108305201T>G	ENST00000547829.1	-	0	1196																											TGAGCTGTGCTTCCTCCCAGA	0.607																																																	0																																												0																															12.37:g.108305201T>G				RNA	SNP	-	NULL	ENST00000547829.1	37	NULL		12																																																																																			RP11-554D14.1	-	-	ENSG00000257129		0.607	RP11-554D14.1-002	KNOWN	basic	processed_transcript	ENSG00000257129	Clone_based_vega_gene	pseudogene	OTTHUMT00000405547.1	-	0.00	9	0	T			108305201	-1	tier1	-	no_errors	ENST00000547829	ensembl	human	known	74_37	rna	40.00	6	4	SNP	0.000	G
EPB41L3	23136	genome.wustl.edu	37	18	5397308	5397308	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:5397308C>T	ENST00000341928.2	-	18	2930	c.2590G>A	c.(2590-2592)Gtg>Atg	p.V864M	EPB41L3_ENST00000342933.3_Missense_Mutation_p.V864M|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000427684.2_Missense_Mutation_p.V161M|EPB41L3_ENST00000542146.1_Missense_Mutation_p.V169M|EPB41L3_ENST00000544123.1_Missense_Mutation_p.V695M|EPB41L3_ENST00000400111.3_Missense_Mutation_p.V642M|EPB41L3_ENST00000540638.2_Missense_Mutation_p.V642M	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	864	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CTCGCGTGCACCACACGCCGC	0.612																																																	0													66.0	63.0	64.0					18																	5397308		2203	4300	6503	SO:0001583	missense	0			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2590G>A	18.37:g.5397308C>T	ENSP00000343158:p.Val864Met		B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.V864M	ENST00000341928.2	37	c.2590	CCDS11838.1	18	.	.	.	.	.	.	.	.	.	.	C	14.34	2.506538	0.44558	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;T;T;T;T;T	0.53423	0.62;0.62;0.62;0.62;0.62;0.62	5.73	4.87	0.63330	.	0.341929	0.39146	N	0.001454	T	0.57858	0.2082	M	0.62723	1.935	0.47308	D	0.999386	B;B;B;B;P;P;B;D	0.62365	0.031;0.011;0.089;0.068;0.857;0.724;0.126;0.991	B;B;B;B;P;P;B;P	0.53593	0.039;0.024;0.275;0.126;0.58;0.573;0.094;0.73	T	0.60010	-0.7346	10	0.45353	T	0.12	.	14.9586	0.71138	0.0:0.9314:0.0:0.0686	.	695;161;169;256;533;642;864;99	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	M	864;533;695;533;161;169;864;642	ENSP00000343158:V864M;ENSP00000441174:V695M;ENSP00000392195:V161M;ENSP00000442233:V169M;ENSP00000341138:V864M;ENSP00000382981:V642M	ENSP00000343158:V864M	V	-	1	0	EPB41L3	5387308	0.958000	0.32768	0.778000	0.31720	0.006000	0.05464	2.092000	0.41700	1.424000	0.47217	-0.216000	0.12614	GTG	EPB41L3	-	pirsf_Band_41_protein	ENSG00000082397		0.612	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	HGNC	protein_coding	OTTHUMT00000254424.1	-	0.00	14	0	C	NM_012307		5397308	-1	tier1	-	no_errors	ENST00000341928	ensembl	human	known	74_37	missense	25.00	12	4	SNP	0.988	T
ERAP2	64167	genome.wustl.edu	37	5	96253165	96253165	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:96253165G>T	ENST00000437043.3	+	19	3450		c.e19-1		CTD-2260A17.2_ENST00000501338.1_Intron|ERAP2_ENST00000379904.4_Splice_Site	NM_001130140.1|NM_022350.3	NP_001123612.1|NP_071745.1	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2						antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|regulation of blood pressure (GO:0008217)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.?(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		ATATTTTACAGGTGAAACTAT	0.398																																																	1	Unknown(1)	skin(1)											59.0	64.0	62.0					5																	96253165		2203	4300	6503	SO:0001630	splice_region_variant	0			AF191545	CCDS4086.1	5q15	2007-11-21			ENSG00000164308	ENSG00000164308			29499	protein-coding gene	gene with protein product	"""leukocyte-derived arginine aminopeptidase"""	609497				12799365, 15908954	Standard	NM_022350		Approved	L-RAP, LRAP	uc003kmt.3	Q6P179	OTTHUMG00000128718	ENST00000437043.3:c.2740-1G>T	5.37:g.96253165G>T			Q7Z5K1|Q8TD32|Q8WVJ4|Q9HBX2	Splice_Site	SNP	-	e18-1	ENST00000437043.3	37	c.2740-1	CCDS4086.1	5	.	.	.	.	.	.	.	.	.	.	G	19.18	3.777339	0.70107	.	.	ENSG00000164308	ENST00000437043;ENST00000379904	.	.	.	4.6	4.6	0.57074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.269	0.60150	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ERAP2	96278921	1.000000	0.71417	0.997000	0.53966	0.956000	0.61745	6.324000	0.72896	2.280000	0.76307	0.557000	0.71058	.	ERAP2	-	-	ENSG00000164308		0.398	ERAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAP2	HGNC	protein_coding	OTTHUMT00000250623.2		0.00	38	0	G	NM_022350	Intron	96253165	+1			no_errors	ENST00000437043	ensembl	human	known	74_37	splice_site	11.11	16	2	SNP	1.000	T
ERBB3	2065	genome.wustl.edu	37	12	56495099	56495099	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:56495099G>T	ENST00000267101.3	+	27	3896	c.3456G>T	c.(3454-3456)gaG>gaT	p.E1152D	ERBB3_ENST00000553131.1_Missense_Mutation_p.E393D|RP11-603J24.9_ENST00000548861.1_5'Flank|ERBB3_ENST00000549832.1_Missense_Mutation_p.E272D|ERBB3_ENST00000450146.2_Missense_Mutation_p.E509D|ERBB3_ENST00000415288.2_Missense_Mutation_p.E1093D	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	1152					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CCGGGTTAGAGGAAGAGGATG	0.572																																																	0													57.0	57.0	57.0					12																	56495099		2203	4300	6503	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.3456G>T	12.37:g.56495099G>T	ENSP00000267101:p.Glu1152Asp		A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E1152D	ENST00000267101.3	37	c.3456	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936917	0.73557	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000550070;ENST00000553131;ENST00000549832	T;T;T;T;T	0.79247	-1.04;-1.01;-1.03;-1.25;-1.02	6.17	1.06	0.20224	.	0.180183	0.39985	N	0.001215	T	0.56140	0.1965	L	0.27053	0.805	0.41381	D	0.987555	P;B;B	0.35155	0.487;0.114;0.067	B;B;B	0.30943	0.122;0.034;0.012	T	0.38824	-0.9643	10	0.22706	T	0.39	.	5.1133	0.14821	0.3813:0.1393:0.4793:0.0	.	1093;272;1152	P21860-4;B3KWG5;P21860	.;.;ERBB3_HUMAN	D	1152;509;1093;275;393;272	ENSP00000267101:E1152D;ENSP00000399178:E509D;ENSP00000408340:E1093D;ENSP00000449129:E393D;ENSP00000448729:E272D	ENSP00000267101:E1152D	E	+	3	2	ERBB3	54781366	0.996000	0.38824	0.999000	0.59377	0.981000	0.71138	0.153000	0.16323	0.184000	0.20083	-0.136000	0.14681	GAG	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt	ENSG00000065361		0.572	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	-	0.00	22	0	G			56495099	+1	tier1	-	no_errors	ENST00000267101	ensembl	human	known	74_37	missense	14.29	18	3	SNP	0.998	T
ERBB4	2066	genome.wustl.edu	37	2	212251633	212251633	+	Silent	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:212251633T>C	ENST00000342788.4	-	27	3736	c.3426A>G	c.(3424-3426)cgA>cgG	p.R1142R	ERBB4_ENST00000436443.1_Silent_p.R1126R|ERBB4_ENST00000402597.1_Silent_p.R1132R	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1142					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CCAGCTCTCCTCGTGGGCTCC	0.532										TSP Lung(8;0.080)																																							0													159.0	147.0	151.0					2																	212251633		2203	4300	6503	SO:0001819	synonymous_variant	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3426A>G	2.37:g.212251633T>C			B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R1142	ENST00000342788.4	37	c.3426	CCDS2394.1	2																																																																																			ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt	ENSG00000178568		0.532	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	-	0.00	101	0	T	NM_001042599		212251633	-1	tier1	-	no_errors	ENST00000342788	ensembl	human	known	74_37	silent	43.75	63	49	SNP	1.000	C
ERC2	26059	genome.wustl.edu	37	3	55544641	55544641	+	3'UTR	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:55544641G>T	ENST00000288221.6	-	0	3832				ERC2_ENST00000486496.1_5'UTR	NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2							cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TTAAAAAATTGATTTCTTTTC	0.403																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.*703C>A	3.37:g.55544641G>T			Q2T9F6|Q86TK4	RNA	SNP	-	NULL	ENST00000288221.6	37	NULL	CCDS46851.1	3																																																																																			ERC2	-	-	ENSG00000187672		0.403	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	-	0.00	29	0	G	NM_015576		55544641	-1	tier1	-	no_errors	ENST00000469720	ensembl	human	known	74_37	rna	26.67	11	4	SNP	1.000	T
EVC2	132884	genome.wustl.edu	37	4	5544884	5544884	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:5544884A>C	ENST00000344938.1	-	22	3768	c.3715T>G	c.(3715-3717)Tta>Gta	p.L1239V				Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	0					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CACTCAATTAACCCAATCTCT	0.483																																																	0																																										SO:0001583	missense	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344938.1:c.3715T>G	4.37:g.5544884A>C	ENSP00000339954:p.Leu1239Val		Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_Limbin	p.L1239V	ENST00000344938.1	37	c.3715		4	.	.	.	.	.	.	.	.	.	.	A	0.378	-0.930215	0.02359	.	.	ENSG00000173040	ENST00000344938	T	0.75050	-0.9	1.47	-1.31	0.09230	.	.	.	.	.	T	0.66703	0.2816	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.59241	-0.7491	6	0.87932	D	0	.	3.5945	0.08001	0.6045:0.2267:0.1689:0.0	.	.	.	.	V	1239	ENSP00000339954:L1239V	ENSP00000339954:L1239V	L	-	1	2	EVC2	5595785	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-1.060000	0.03475	-1.019000	0.03358	-2.381000	0.00232	TTA	EVC2	-	NULL	ENSG00000173040		0.483	EVC2-201	KNOWN	basic	protein_coding	EVC2	HGNC	protein_coding		-	0.00	27	0	A	NM_147127		5544884	-1	tier1	-	no_errors	ENST00000344938	ensembl	human	known	74_37	missense	24.14	22	7	SNP	0.001	C
EZR	7430	genome.wustl.edu	37	6	159190425	159190425	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:159190425G>T	ENST00000367075.3	-	12	1445	c.1277C>A	c.(1276-1278)gCc>gAc	p.A426D	EZR_ENST00000337147.7_Missense_Mutation_p.A426D|EZR_ENST00000392177.4_Missense_Mutation_p.A394D	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	426	Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)	p.A426V(1)	EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		GGCAATCTTGGCAGTGTATTC	0.572			T	ROS1	NSCLC																																			Dom	yes		6	6q25.3	7430	ezrin		E	1	Substitution - Missense(1)	endometrium(1)											78.0	68.0	72.0					6																	159190425		2203	4300	6503	SO:0001583	missense	0			AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.1277C>A	6.37:g.159190425G>T	ENSP00000356042:p.Ala426Asp		E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	p.A426D	ENST00000367075.3	37	c.1277	CCDS5258.1	6	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061645	0.76187	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	D;D;D	0.83914	-1.78;-1.78;-1.78	5.25	4.32	0.51571	Ezrin/radixin/moesin, C-terminal (1);	0.159132	0.56097	D	0.000032	T	0.75620	0.3874	M	0.74881	2.28	0.80722	D	1	B;B	0.20887	0.003;0.049	B;B	0.30105	0.02;0.111	T	0.72874	-0.4160	10	0.18276	T	0.48	.	15.3032	0.73972	0.0:0.1402:0.8598:0.0	.	394;426	E7EQR4;P15311	.;EZRI_HUMAN	D	426;426;394	ENSP00000338934:A426D;ENSP00000356042:A426D;ENSP00000376016:A394D	ENSP00000338934:A426D	A	-	2	0	EZR	159110413	1.000000	0.71417	0.971000	0.41717	0.996000	0.88848	6.439000	0.73430	2.455000	0.83008	0.561000	0.74099	GCC	EZR	-	pirsf_ERM,pfam_ERM_C_dom	ENSG00000092820		0.572	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EZR	HGNC	protein_coding	OTTHUMT00000042878.1		0.00	21	0	G	NM_003379		159190425	-1			no_errors	ENST00000337147	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.979	T
FAM107B	83641	genome.wustl.edu	37	10	14709635	14709635	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:14709635G>T	ENST00000181796.2	-	2	700	c.467C>A	c.(466-468)tCa>tAa	p.S156*		NM_031453.2	NP_113641.2	Q9H098	F107B_HUMAN	family with sequence similarity 107, member B	0					sensory perception of sound (GO:0007605)					breast(7)|kidney(1)|large_intestine(4)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TACTCTACCTGATGTCATTTT	0.448																																																	0													143.0	132.0	136.0					10																	14709635		2203	4300	6503	SO:0001587	stop_gained	0			AK127413	CCDS7102.1, CCDS60486.1	10p14	2006-01-17	2006-01-17	2005-11-20	ENSG00000065809	ENSG00000065809			23726	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 45"""	C10orf45		11230166	Standard	XM_005252616		Approved	FLJ45505, MGC11034	uc001ina.1	Q9H098	OTTHUMG00000017709	ENST00000181796.2:c.467C>A	10.37:g.14709635G>T	ENSP00000181796:p.Ser156*		A8K1P4|D3DRT2|Q5T9K7|Q5T9K8|Q6ZSI4	Nonsense_Mutation	SNP	pfam_DUF1151	p.S156*	ENST00000181796.2	37	c.467	CCDS7102.1	10	.	.	.	.	.	.	.	.	.	.	G	16.18	3.050434	0.55218	.	.	ENSG00000065809	ENST00000181796	.	.	.	4.52	4.52	0.55395	.	0.844843	0.09943	N	0.735709	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9327	0.58296	0.0:0.0:1.0:0.0	.	.	.	.	X	156	.	ENSP00000181796:S156X	S	-	2	0	FAM107B	14749641	1.000000	0.71417	0.953000	0.39169	0.087000	0.18053	2.746000	0.47467	2.518000	0.84900	0.555000	0.69702	TCA	FAM107B	-	NULL	ENSG00000065809		0.448	FAM107B-001	KNOWN	basic|CCDS	protein_coding	FAM107B	HGNC	protein_coding	OTTHUMT00000356966.1	-	0.00	40	0	G	NM_031453		14709635	-1	tier1	-	no_errors	ENST00000181796	ensembl	human	known	74_37	nonsense	6.15	61	4	SNP	0.968	T
FAM122A	116224	genome.wustl.edu	37	9	71395941	71395941	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:71395941G>T	ENST00000394264.3	+	1	978	c.861G>T	c.(859-861)aaG>aaT	p.K287N	PIP5K1B_ENST00000541509.1_Intron|PIP5K1B_ENST00000265382.3_Intron	NM_138333.3	NP_612206.3	Q96E09	F122A_HUMAN	family with sequence similarity 122A	287										endometrium(1)|lung(2)	3						TTTCGTCTAAGTGATTCACTC	0.438																																																	0													157.0	166.0	163.0					9																	71395941		2202	4300	6502	SO:0001583	missense	0			AK126379	CCDS6623.1	9q21.13	2011-02-10	2006-07-11	2006-07-11	ENSG00000187866	ENSG00000187866			23490	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 42"""	C9orf42		12477932	Standard	NM_138333		Approved	MGC17347	uc004agw.1	Q96E09	OTTHUMG00000019971	ENST00000394264.3:c.861G>T	9.37:g.71395941G>T	ENSP00000377807:p.Lys287Asn			Missense_Mutation	SNP	NULL	p.K287N	ENST00000394264.3	37	c.861	CCDS6623.1	9	.	.	.	.	.	.	.	.	.	.	G	16.07	3.019215	0.54576	.	.	ENSG00000187866	ENST00000394264;ENST00000377279	.	.	.	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.62563	0.2438	M	0.66939	2.045	0.28324	N	0.922116	D	0.54772	0.968	P	0.61874	0.895	T	0.58797	-0.7573	9	0.87932	D	0	-29.3956	12.8382	0.57786	0.0:0.0:1.0:0.0	.	287	Q96E09	F122A_HUMAN	N	287;271	.	ENSP00000366492:K271N	K	+	3	2	FAM122A	70585761	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.095000	0.41729	2.758000	0.94735	0.563000	0.77884	AAG	FAM122A	-	NULL	ENSG00000187866		0.438	FAM122A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM122A	HGNC	protein_coding	OTTHUMT00000052556.1		0.00	40	0	G	NM_138333		71395941	+1			no_errors	ENST00000394264	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
FAM122B	159090	genome.wustl.edu	37	X	133906176	133906176	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:133906176G>T	ENST00000370790.1	-	9	1665	c.737C>A	c.(736-738)cCc>cAc	p.P246H	FAM122B_ENST00000343004.5_Missense_Mutation_p.P265H|FAM122B_ENST00000298090.6_Intron|FAM122B_ENST00000486347.1_Missense_Mutation_p.P247H|FAM122B_ENST00000493333.1_5'UTR	NM_001166599.2|NM_145284.5	NP_001160071.1|NP_660327.2	Q7Z309	F122B_HUMAN	family with sequence similarity 122B	246										breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|skin(1)	6	Acute lymphoblastic leukemia(192;0.000127)					AAGTCACTTGGGTGAGAGATC	0.438																																																	0													120.0	94.0	103.0					X																	133906176		2203	4300	6503	SO:0001583	missense	0			BX538218	CCDS14643.1, CCDS55497.1, CCDS55498.1	Xq26.3	2008-02-05			ENSG00000156504	ENSG00000156504			30490	protein-coding gene	gene with protein product						12477932	Standard	NM_145284		Approved	DKFZp686L20116, RP11-308B5.5	uc004exq.3	Q7Z309	OTTHUMG00000022461	ENST00000370790.1:c.737C>A	X.37:g.133906176G>T	ENSP00000359826:p.Pro246His		A8K902|Q6PIM2|Q6ZU47|Q6ZV64|Q6ZVE4|Q8TB75	Missense_Mutation	SNP	NULL	p.P265H	ENST00000370790.1	37	c.794	CCDS55497.1	X	.	.	.	.	.	.	.	.	.	.	G	22.3	4.277320	0.80580	.	.	ENSG00000156504	ENST00000370790;ENST00000343004;ENST00000486347	.	.	.	5.65	5.65	0.86999	.	0.104028	0.43416	D	0.000564	T	0.77039	0.4072	L	0.59436	1.845	0.58432	D	0.999999	D;D;P	0.89917	1.0;1.0;0.879	D;D;P	0.76575	0.988;0.988;0.459	T	0.79017	-0.1975	9	0.87932	D	0	.	17.633	0.88114	0.0:0.0:1.0:0.0	.	247;246;265	Q7Z309-2;Q7Z309;Q7Z309-3	.;F122B_HUMAN;.	H	246;265;247	.	ENSP00000339207:P265H	P	-	2	0	FAM122B	133733842	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.300000	0.65721	2.381000	0.81170	0.600000	0.82982	CCC	FAM122B	-	NULL	ENSG00000156504		0.438	FAM122B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM122B	HGNC	protein_coding	OTTHUMT00000058382.1		0.00	23	0	G	NM_145284		133906176	-1			no_errors	ENST00000343004	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
FAM157C	100996541	genome.wustl.edu	37	16	90229187	90229187	+	RNA	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:90229187G>A	ENST00000570230.1	+	0	1162				RP11-356C4.5_ENST00000565965.1_lincRNA			P0CG43	F157C_HUMAN	family with sequence similarity 157, member C																		TCCAGGCCCCGAACTTTCTCT	0.488																																																	0																																												0					16q24.3	2013-01-24	2013-01-18	2013-01-18	ENSG00000260528	ENSG00000260528			34081	other	unknown							Standard	XR_429804		Approved			P0CG43	OTTHUMG00000172848		16.37:g.90229187G>A				RNA	SNP	-	NULL	ENST00000570230.1	37	NULL		16																																																																																			FAM157C	-	-	ENSG00000260528		0.488	FAM157C-004	KNOWN	basic	processed_transcript	FAM157C	HGNC	processed_transcript	OTTHUMT00000420872.1	-	0.00	32	0	G			90229187	+1	tier1	-	no_errors	ENST00000570230	ensembl	human	known	74_37	rna	40.00	24	16	SNP	0.000	A
FAM163A	148753	genome.wustl.edu	37	1	179783228	179783228	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:179783228C>T	ENST00000341785.4	+	5	804	c.408C>T	c.(406-408)tcC>tcT	p.S136S	RP11-12M5.3_ENST00000415218.1_RNA|RP11-12M5.3_ENST00000453051.1_RNA	NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	136						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						GACCCCCATCCCTCAAATTGG	0.582																																																	0													64.0	70.0	68.0					1																	179783228		2203	4300	6503	SO:0001819	synonymous_variant	0			BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.408C>T	1.37:g.179783228C>T			A8K8R7	Silent	SNP	NULL	p.S136	ENST00000341785.4	37	c.408	CCDS1333.1	1																																																																																			FAM163A	-	NULL	ENSG00000143340		0.582	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM163A	HGNC	protein_coding	OTTHUMT00000085300.1	-	0.00	25	0	C	NM_173509		179783228	+1	tier1	-	no_errors	ENST00000341785	ensembl	human	known	74_37	silent	24.44	34	11	SNP	0.280	T
FAM179B	23116	genome.wustl.edu	37	14	45542540	45542540	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:45542540G>C	ENST00000361577.3	+	19	5153	c.4939G>C	c.(4939-4941)Gag>Cag	p.E1647Q	FAM179B_ENST00000382233.2_3'UTR|FAM179B_ENST00000361462.2_Missense_Mutation_p.E1700Q	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	1647										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						GCATGCCACAGAGCAGAAAGT	0.388																																																	0													98.0	102.0	101.0					14																	45542540		2203	4300	6503	SO:0001583	missense	0			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.4939G>C	14.37:g.45542540G>C	ENSP00000355045:p.Glu1647Gln		Q68D66|Q6PG27	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E1647Q	ENST00000361577.3	37	c.4939	CCDS9681.1	14	.	.	.	.	.	.	.	.	.	.	G	21.7	4.188834	0.78789	.	.	ENSG00000198718	ENST00000361577;ENST00000361462;ENST00000556823	T;T;T	0.17854	2.25;2.25;2.25	5.42	5.42	0.78866	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.39911	0.1096	M	0.61703	1.905	0.80722	D	1	P;D	0.76494	0.821;0.999	P;D	0.79108	0.758;0.992	T	0.03739	-1.1008	10	0.40728	T	0.16	-18.8707	17.0072	0.86396	0.0:0.0:1.0:0.0	.	1700;1647	G3XAE9;Q9Y4F4	.;F179B_HUMAN	Q	1647;1700;82	ENSP00000355045:E1647Q;ENSP00000354917:E1700Q;ENSP00000450465:E82Q	ENSP00000354917:E1700Q	E	+	1	0	FAM179B	44612290	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.404000	0.90210	2.556000	0.86216	0.563000	0.77884	GAG	FAM179B	-	superfamily_ARM-type_fold	ENSG00000198718		0.388	FAM179B-001	KNOWN	basic|CCDS	protein_coding	FAM179B	HGNC	protein_coding	OTTHUMT00000276791.1	-	0.00	40	0	G	XM_113781		45542540	+1	tier1	-	no_errors	ENST00000361577	ensembl	human	known	74_37	missense	30.00	14	6	SNP	1.000	C
FAM186B	84070	genome.wustl.edu	37	12	49993827	49993827	+	Silent	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:49993827C>A	ENST00000257894.2	-	4	1757	c.1596G>T	c.(1594-1596)cgG>cgT	p.R532R	PRPF40B_ENST00000508736.1_3'UTR|FAM186B_ENST00000551047.1_Intron|FAM186B_ENST00000544141.1_Silent_p.R442R	NM_032130.2	NP_115506.1	Q8IYM0	F186B_HUMAN	family with sequence similarity 186, member B	532						protein complex (GO:0043234)				breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GGACCCATCTCCGCTGTTGCT	0.607																																																	0													70.0	69.0	69.0					12																	49993827		2203	4300	6503	SO:0001819	synonymous_variant	0			AL136748	CCDS8788.1	12q13.12	2008-09-17	2008-09-17	2008-09-17	ENSG00000135436	ENSG00000135436			25296	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 25"""	C12orf25		11230166	Standard	NM_032130		Approved	DKFZP434J0113	uc001ruo.3	Q8IYM0	OTTHUMG00000167427	ENST00000257894.2:c.1596G>T	12.37:g.49993827C>A			B4DZ15|Q8TCP7|Q9H0L3	Silent	SNP	NULL	p.R532	ENST00000257894.2	37	c.1596	CCDS8788.1	12																																																																																			FAM186B	-	NULL	ENSG00000135436		0.607	FAM186B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM186B	HGNC	protein_coding	OTTHUMT00000394583.2	-	0.00	37	0	C	NM_032130		49993827	-1	tier1	-	no_errors	ENST00000257894	ensembl	human	known	74_37	silent	32.08	36	17	SNP	0.004	A
FAM230B	642633	genome.wustl.edu	37	22	21538079	21538079	+	RNA	SNP	A	A	G	rs62240903		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr22:21538079A>G	ENST00000451257.1	+	0	1065									family with sequence similarity 230, member B (non-protein coding)																		GGCATCGCCAACGAGGACGCC	0.746																																																	0																																												0			BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21538079A>G				RNA	SNP	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			FAM230B	-	-	ENSG00000215498		0.746	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1		0.00	25	0	A	NR_108107		21538079	+1			no_errors	ENST00000451257	ensembl	human	known	74_37	rna	8.14	79	7	SNP	0.000	G
FAM47C	442444	genome.wustl.edu	37	X	37028366	37028366	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:37028366C>T	ENST00000358047.3	+	1	1935	c.1883C>T	c.(1882-1884)tCc>tTc	p.S628F		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	628										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						ACTGGAGTGTCCCATCTCCGC	0.642																																																	0													29.0	33.0	32.0					X																	37028366		2195	4285	6480	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1883C>T	X.37:g.37028366C>T	ENSP00000367913:p.Ser628Phe		Q6ZU46	Missense_Mutation	SNP	NULL	p.S628F	ENST00000358047.3	37	c.1883	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	-	13.00	2.105227	0.37145	.	.	ENSG00000198173	ENST00000358047	T	0.20200	2.09	1.67	-1.65	0.08291	.	.	.	.	.	T	0.40171	0.1106	M	0.81341	2.54	0.09310	N	1	D	0.76494	0.999	D	0.91635	0.999	T	0.20672	-1.0268	9	0.52906	T	0.07	.	4.2479	0.10680	0.0:0.5847:0.233:0.1823	.	628	Q5HY64	FA47C_HUMAN	F	628	ENSP00000367913:S628F	ENSP00000367913:S628F	S	+	2	0	FAM47C	36938287	0.000000	0.05858	0.002000	0.10522	0.165000	0.22458	0.162000	0.16501	-0.706000	0.05028	0.414000	0.27820	TCC	FAM47C	-	NULL	ENSG00000198173		0.642	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	-	0.00	115	0	C	NM_001013736		37028366	+1	tier1	-	no_errors	ENST00000358047	ensembl	human	known	74_37	missense	44.21	53	42	SNP	0.008	T
FARSB	10056	genome.wustl.edu	37	2	223478626	223478626	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:223478626G>T	ENST00000281828.6	-	15	1629	c.1366C>A	c.(1366-1368)Cct>Act	p.P456T	FARSB_ENST00000536361.1_Missense_Mutation_p.P357T	NM_005687.3	NP_005678.3	Q9NSD9	SYFB_HUMAN	phenylalanyl-tRNA synthetase, beta subunit	456					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|RNA binding (GO:0003723)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	24		Renal(207;0.0183)		Epithelial(121;3.47e-10)|all cancers(144;1.86e-07)|LUSC - Lung squamous cell carcinoma(224;0.00871)|Lung(261;0.011)	L-Phenylalanine(DB00120)	AGGAGGCCAGGAAGAAGGGTA	0.423																																																	0													109.0	101.0	104.0					2																	223478626		2203	4300	6503	SO:0001583	missense	0			AF042346	CCDS2454.1	2q36.2	2011-07-01	2007-02-23	2007-02-23	ENSG00000116120	ENSG00000116120	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	17800	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, beta, cytoplasmic"""	609690	"""phenylalanyl-tRNA synthetase-like, beta subunit"""	FARSLB		10049785	Standard	NM_005687		Approved	PheHB, FRSB	uc002vne.1	Q9NSD9	OTTHUMG00000133155	ENST00000281828.6:c.1366C>A	2.37:g.223478626G>T	ENSP00000281828:p.Pro456Thr		B4DFM0|O95708|Q4ZFX1|Q57ZJ5|Q9NZZ6	Missense_Mutation	SNP	pfam_B3/B4_tRNA-bd,pfam_tRNA_synthase_B5-dom,superfamily_DNA-bd_dom_put,superfamily_Phe-tRNA_synthase_B3/B4,smart_B3/B4_tRNA-bd,smart_tRNA_synthase_B5-dom,tigrfam_Phe-tRNA-synth_IIc_bsu_arc	p.P456T	ENST00000281828.6	37	c.1366	CCDS2454.1	2	.	.	.	.	.	.	.	.	.	.	G	24.1	4.492495	0.84962	.	.	ENSG00000116120	ENST00000281828;ENST00000536361	.	.	.	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	D	0.89931	0.6858	H	0.97265	3.97	0.80722	D	1	D;D	0.69078	0.997;0.995	D;D	0.66084	0.941;0.914	D	0.93204	0.6594	9	0.87932	D	0	-16.9766	19.5226	0.95192	0.0:0.0:1.0:0.0	.	456;456	A8K666;Q9NSD9	.;SYFB_HUMAN	T	456;357	.	ENSP00000281828:P456T	P	-	1	0	FARSB	223186870	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.426000	0.80270	2.617000	0.88574	0.585000	0.79938	CCT	FARSB	-	tigrfam_Phe-tRNA-synth_IIc_bsu_arc	ENSG00000116120		0.423	FARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARSB	HGNC	protein_coding	OTTHUMT00000256855.2	-	0.00	29	0	G	NM_005687		223478626	-1	tier1	-	no_errors	ENST00000281828	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
FAT1	2195	genome.wustl.edu	37	4	187629119	187629119	+	Silent	SNP	C	C	T	rs551785621		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:187629119C>T	ENST00000441802.2	-	2	2072	c.1863G>A	c.(1861-1863)tcG>tcA	p.S621S		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	621	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						ACAATACCCCCGAGTTGGGGT	0.413										HNSCC(5;0.00058)			A|||	1	0.000199681	0.0	0.0	5008	,	,		20487	0.0		0.001	False		,,,				2504	0.0				Colon(197;1040 2055 4143 4984 49344)												0													69.0	64.0	66.0					4																	187629119		1859	4087	5946	SO:0001819	synonymous_variant	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.1863G>A	4.37:g.187629119C>T				Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.S621	ENST00000441802.2	37	c.1863	CCDS47177.1	4																																																																																			FAT1	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000083857		0.413	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	-	0.00	26	0	C	NM_005245		187629119	-1	tier1	-	no_errors	ENST00000441802	ensembl	human	known	74_37	silent	17.24	24	5	SNP	0.908	T
FAT3	120114	genome.wustl.edu	37	11	92533265	92533265	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:92533265G>T	ENST00000298047.6	+	9	7103	c.7086G>T	c.(7084-7086)ttG>ttT	p.L2362F	FAT3_ENST00000525166.1_Missense_Mutation_p.L2212F|FAT3_ENST00000409404.2_Missense_Mutation_p.L2362F			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2362	Cadherin 21. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACTGCACTTTGAAAGTCAGAT	0.403										TCGA Ovarian(4;0.039)																																							0													115.0	111.0	112.0					11																	92533265		1949	4149	6098	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7086G>T	11.37:g.92533265G>T	ENSP00000298047:p.Leu2362Phe		B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.L2362F	ENST00000298047.6	37	c.7086		11	.	.	.	.	.	.	.	.	.	.	G	4.998	0.185280	0.09495	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.69926	-0.44;-0.44;-0.44	5.95	2.84	0.33178	.	.	.	.	.	T	0.50769	0.1635	L	0.33668	1.02	0.80722	D	1	B	0.14805	0.011	B	0.16722	0.016	T	0.41270	-0.9518	9	0.21540	T	0.41	.	8.6758	0.34179	0.1238:0.2375:0.6387:0.0	.	2362	Q8TDW7-3	.	F	2362;2362;2212	ENSP00000298047:L2362F;ENSP00000387040:L2362F;ENSP00000432586:L2212F	ENSP00000298047:L2362F	L	+	3	2	FAT3	92172913	0.995000	0.38212	1.000000	0.80357	0.986000	0.74619	0.381000	0.20619	1.509000	0.48786	-0.175000	0.13238	TTG	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.403	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	30	0	G	NM_001008781		92533265	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.997	T
FAT4	79633	genome.wustl.edu	37	4	126372688	126372688	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:126372688A>C	ENST00000394329.3	+	9	10530	c.10517A>C	c.(10516-10518)aAc>aCc	p.N3506T	FAT4_ENST00000335110.5_Missense_Mutation_p.N1804T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3506	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						ATAAATGATAACGGGCCCATG	0.488																																																	0													104.0	104.0	104.0					4																	126372688		2203	4300	6503	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.10517A>C	4.37:g.126372688A>C	ENSP00000377862:p.Asn3506Thr		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.N3506T	ENST00000394329.3	37	c.10517	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	A	19.68	3.873082	0.72180	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.52983	0.64;0.64	5.77	5.77	0.91146	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.36234	U	0.002704	T	0.77811	0.4186	H	0.94306	3.52	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.998	D;D;D	0.87578	0.998;0.966;0.991	D	0.84556	0.0647	10	0.87932	D	0	.	16.1024	0.81184	1.0:0.0:0.0:0.0	.	1804;3506;3506	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	T	3506;1804	ENSP00000377862:N3506T;ENSP00000335169:N1804T	ENSP00000335169:N1804T	N	+	2	0	FAT4	126592138	1.000000	0.71417	0.969000	0.41365	0.944000	0.59088	9.149000	0.94659	2.200000	0.70718	0.459000	0.35465	AAC	FAT4	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.488	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	29	0	A	NM_024582		126372688	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	28.00	18	7	SNP	1.000	C
FATE1	89885	genome.wustl.edu	37	X	150884596	150884596	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:150884596C>A	ENST00000370350.3	+	1	90	c.5C>A	c.(4-6)gCa>gAa	p.A2E		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	2						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					GTTGTGATGGCAGGAGGCCCT	0.527																																																	0													59.0	45.0	50.0					X																	150884596		2017	3704	5721	SO:0001583	missense	0			AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.5C>A	X.37:g.150884596C>A	ENSP00000359375:p.Ala2Glu			Missense_Mutation	SNP	pfam_FATE/Miff/Tango-11	p.A2E	ENST00000370350.3	37	c.5	CCDS14700.1	X	.	.	.	.	.	.	.	.	.	.	C	14.65	2.600236	0.46423	.	.	ENSG00000147378	ENST00000370350	T	0.59502	0.26	4.18	3.3	0.37823	.	0.429234	0.20041	N	0.100503	T	0.45155	0.1328	L	0.29908	0.895	0.19775	N	0.999955	P	0.47841	0.901	B	0.43052	0.406	T	0.37753	-0.9692	10	0.87932	D	0	.	8.5063	0.33190	0.2284:0.7716:0.0:0.0	.	2	Q969F0	FATE1_HUMAN	E	2	ENSP00000359375:A2E	ENSP00000359375:A2E	A	+	2	0	FATE1	150635252	0.273000	0.24181	0.103000	0.21229	0.699000	0.40488	1.645000	0.37238	1.094000	0.41399	0.600000	0.82982	GCA	FATE1	-	NULL	ENSG00000147378		0.527	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FATE1	HGNC	protein_coding	OTTHUMT00000060885.1	-	0.00	16	0	C	NM_033085		150884596	+1	tier1	-	no_errors	ENST00000370350	ensembl	human	known	74_37	missense	30.00	14	6	SNP	0.090	A
FBN2	2201	genome.wustl.edu	37	5	127645012	127645012	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:127645012C>A	ENST00000508053.1	-	47	6254	c.5280G>T	c.(5278-5280)agG>agT	p.R1760S	FBN2_ENST00000262464.4_Missense_Mutation_p.R1760S			P35556	FBN2_HUMAN	fibrillin 2	1760	TB 7.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AGCAGCACATCCTTTTTGTCA	0.433																																																	0													167.0	136.0	147.0					5																	127645012		2203	4300	6503	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5280G>T	5.37:g.127645012C>A	ENSP00000424571:p.Arg1760Ser		B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.R1760S	ENST00000508053.1	37	c.5280	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	c	14.66	2.601707	0.46423	.	.	ENSG00000138829	ENST00000262464;ENST00000508053	D;D	0.91407	-2.84;-2.84	4.85	1.8	0.24995	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.64402	D	0.000006	T	0.78966	0.4367	N	0.08118	0	0.33316	D	0.56675	B	0.25772	0.134	B	0.29077	0.098	T	0.74244	-0.3728	10	0.38643	T	0.18	.	8.7546	0.34637	0.0:0.7227:0.0:0.2773	.	1760	P35556	FBN2_HUMAN	S	1760	ENSP00000262464:R1760S;ENSP00000424571:R1760S	ENSP00000262464:R1760S	R	-	3	2	FBN2	127672911	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.596000	0.36718	0.238000	0.21222	-1.112000	0.02068	AGG	FBN2	-	pirsf_FBN,pfam_TB_dom,superfamily_TB_dom	ENSG00000138829		0.433	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	-	0.00	34	0	C	NM_001999		127645012	-1	tier1	-	no_errors	ENST00000262464	ensembl	human	known	74_37	missense	76.00	5	19	SNP	1.000	A
FBN3	84467	genome.wustl.edu	37	19	8145962	8145962	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:8145962G>T	ENST00000600128.1	-	59	7792	c.7378C>A	c.(7378-7380)Ctc>Atc	p.L2460I	FBN3_ENST00000270509.2_Missense_Mutation_p.L2460I|FBN3_ENST00000601739.1_Missense_Mutation_p.L2460I			Q75N90	FBN3_HUMAN	fibrillin 3	2460	EGF-like 40; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						TTGACACAGAGGAACTGACAG	0.657																																																	0													93.0	81.0	85.0					19																	8145962		2203	4300	6503	SO:0001583	missense	0				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.7378C>A	19.37:g.8145962G>T	ENSP00000470498:p.Leu2460Ile		Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.L2460I	ENST00000600128.1	37	c.7378	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337818	0.60963	.	.	ENSG00000142449	ENST00000270509;ENST00000341066	D	0.91945	-2.94	4.12	0.329	0.15924	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.381336	0.22947	U	0.053717	T	0.79405	0.4440	N	0.03324	-0.35	0.35471	D	0.79734	P;B	0.39376	0.67;0.011	P;B	0.46796	0.527;0.021	T	0.72023	-0.4415	10	0.17832	T	0.49	.	0.7714	0.01024	0.2386:0.1845:0.3889:0.1881	.	2460;566	Q75N90;Q6ZNB8	FBN3_HUMAN;.	I	2460;566	ENSP00000270509:L2460I	ENSP00000270509:L2460I	L	-	1	0	FBN3	8051962	1.000000	0.71417	0.976000	0.42696	0.821000	0.46438	2.605000	0.46283	-0.121000	0.11787	0.297000	0.19635	CTC	FBN3	-	pfam_EGF-like_Ca-bd_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom	ENSG00000142449		0.657	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	-	0.00	75	0	G	NM_032447		8145962	-1	tier1	-	no_errors	ENST00000270509	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
FBP2	8789	genome.wustl.edu	37	9	97355869	97355869	+	Nonsense_Mutation	SNP	G	G	T	rs200620421		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:97355869G>T	ENST00000375337.3	-	1	206	c.140C>A	c.(139-141)tCg>tAg	p.S47*		NM_003837.2	NP_003828.2	O00757	F16P2_HUMAN	fructose-1,6-bisphosphatase 2	47					carbohydrate metabolic process (GO:0005975)|fructose metabolic process (GO:0006000)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	fructose 1,6-bisphosphate 1-phosphatase activity (GO:0042132)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(3)|lung(5)	9		Acute lymphoblastic leukemia(62;0.136)				GCGCACAGCCGAGGAGATGGC	0.647																																																	0													93.0	76.0	82.0					9																	97355869		2203	4300	6503	SO:0001587	stop_gained	0			Y10812	CCDS6711.1	9q22.3	2012-08-13			ENSG00000130957	ENSG00000130957	3.1.3.11		3607	protein-coding gene	gene with protein product		603027				9678974	Standard	NM_003837		Approved		uc004auv.3	O00757	OTTHUMG00000020269	ENST00000375337.3:c.140C>A	9.37:g.97355869G>T	ENSP00000364486:p.Ser47*		Q17R39|Q6FI53	Nonsense_Mutation	SNP	pfam_FBPase_class-1/SBPase,pfam_Inositol_monophosphatase,prints_FBPtase,prints_SBPase	p.S47*	ENST00000375337.3	37	c.140	CCDS6711.1	9	.	.	.	.	.	.	.	.	.	.	G	38	7.155488	0.98099	.	.	ENSG00000130957	ENST00000375337	.	.	.	5.7	4.81	0.61882	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	3.6052	14.7836	0.69784	0.0694:0.0:0.9306:0.0	.	.	.	.	X	47	.	ENSP00000364486:S47X	S	-	2	0	FBP2	96395690	1.000000	0.71417	0.888000	0.34837	0.989000	0.77384	7.771000	0.85420	1.412000	0.46977	0.655000	0.94253	TCG	FBP2	-	pfam_FBPase_class-1/SBPase,prints_FBPtase	ENSG00000130957		0.647	FBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBP2	HGNC	protein_coding	OTTHUMT00000053189.1		0.00	53	0	G	NM_003837		97355869	-1			no_errors	ENST00000375337	ensembl	human	known	74_37	nonsense	6.98	40	3	SNP	1.000	T
FBXW2	26190	genome.wustl.edu	37	9	123527004	123527004	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:123527004G>T	ENST00000608872.1	-	8	1385	c.1198C>A	c.(1198-1200)Cgc>Agc	p.R400S	FBXW2_ENST00000493559.1_Intron|FBXW2_ENST00000340778.5_Missense_Mutation_p.R335S	NM_012164.3	NP_036296.2	Q9UKT8	FBXW2_HUMAN	F-box and WD repeat domain containing 2	400					cellular protein modification process (GO:0006464)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	ubiquitin-protein transferase activity (GO:0004842)			ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	4						AGAGGCCAGCGACTAATCAGG	0.532																																																	0													118.0	119.0	119.0					9																	123527004		1968	4160	6128	SO:0001583	missense	0			AF129531	CCDS43872.1	9q34	2013-01-09	2007-02-08		ENSG00000119402	ENSG00000119402		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	13608	protein-coding gene	gene with protein product		609071	"""F-box and WD-40 domain protein 2"""			10531035, 10828603	Standard	NM_012164		Approved	FBW2, Md6, Fwd2	uc004bkm.1	Q9UKT8	OTTHUMG00000020576	ENST00000608872.1:c.1198C>A	9.37:g.123527004G>T	ENSP00000476369:p.Arg400Ser		B3KRL8|Q4VXH2|Q7Z4V6|Q8WV51|Q9HA09|Q9UKA3	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R400S	ENST00000608872.1	37	c.1198	CCDS43872.1	9	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083163	0.76642	.	.	ENSG00000119402	ENST00000373926;ENST00000340778;ENST00000444833	T;T	0.16743	2.32;2.32	4.95	4.95	0.65309	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.049056	0.85682	D	0.000000	T	0.28532	0.0706	L	0.34521	1.04	0.58432	D	0.999999	D;P;B	0.67145	0.996;0.495;0.25	D;B;B	0.76575	0.988;0.141;0.141	T	0.02313	-1.1178	10	0.13853	T	0.58	-3.1256	16.037	0.80638	0.0:0.0:1.0:0.0	.	335;400;400	Q9UKT8-2;B2RAW3;Q9UKT8	.;.;FBXW2_HUMAN	S	400;335;400	ENSP00000363036:R400S;ENSP00000341161:R335S	ENSP00000341161:R335S	R	-	1	0	FBXW2	122566825	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.785000	0.85724	2.447000	0.82792	0.563000	0.77884	CGC	FBXW2	-	superfamily_WD40_repeat_dom	ENSG00000119402		0.532	FBXW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW2	HGNC	protein_coding	OTTHUMT00000053834.2		0.00	20	0	G			123527004	-1			no_errors	ENST00000608872	ensembl	human	known	74_37	missense	10.00	18	2	SNP	1.000	T
FFAR3	2865	genome.wustl.edu	37	19	35850546	35850546	+	Missense_Mutation	SNP	G	G	A	rs540255880	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:35850546G>A	ENST00000327809.4	+	2	955	c.754G>A	c.(754-756)Ggt>Agt	p.G252S	FFAR3_ENST00000594310.1_Missense_Mutation_p.G252S	NM_005304.3	NP_005295.1	O14843	FFAR3_HUMAN	free fatty acid receptor 3	252					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to fatty acid (GO:0071398)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|mucosal immune response (GO:0002385)|negative regulation of blood pressure (GO:0045776)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|regulation of hormone biosynthetic process (GO:0046885)|regulation of norepinephrine secretion (GO:0014061)|regulation of peptide hormone secretion (GO:0090276)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|stomach(1)	17	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			CTATATCTGCGGTGAAAGCCC	0.607													G|||	2	0.000399361	0.0008	0.0	5008	,	,		32780	0.001		0.0	False		,,,				2504	0.0				Esophageal Squamous(185;1742 2042 21963 24215 27871)												0													281.0	203.0	230.0					19																	35850546		2201	4298	6499	SO:0001583	missense	0			AF024688	CCDS12459.1	19q13.1	2012-08-08	2006-02-15	2006-02-15	ENSG00000185897	ENSG00000185897		"""GPCR / Class A : Fatty acid receptors"""	4499	protein-coding gene	gene with protein product		603821	"""G protein-coupled receptor 41"""	GPR41		9344866, 22493486	Standard	NM_005304		Approved	FFA3R	uc002nzd.3	O14843	OTTHUMG00000172514	ENST00000327809.4:c.754G>A	19.37:g.35850546G>A	ENSP00000328230:p.Gly252Ser		B2RWM8|Q14CM7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_GPR40-rel_orph	p.G252S	ENST00000327809.4	37	c.754	CCDS12459.1	19	.	.	.	.	.	.	.	.	.	.	G	0.706	-0.788939	0.02884	.	.	ENSG00000185897	ENST00000327809	T	0.70869	-0.52	5.13	-1.86	0.07760	GPCR, rhodopsin-like superfamily (1);	0.664365	0.15132	U	0.278803	T	0.42607	0.1210	L	0.32530	0.975	0.09310	N	1	P	0.35242	0.492	B	0.26969	0.075	T	0.42749	-0.9433	10	0.06099	T	0.92	-5.2777	3.9057	0.09182	0.0781:0.2482:0.4202:0.2536	.	252	O14843	FFAR3_HUMAN	S	252	ENSP00000328230:G252S	ENSP00000328230:G252S	G	+	1	0	FFAR3	40542386	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.544000	0.02192	0.120000	0.18254	0.455000	0.32223	GGT	FFAR3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000185897		0.607	FFAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FFAR3	HGNC	protein_coding	OTTHUMT00000418873.2	-	0.00	227	0	G	NM_005304		35850546	+1	tier1	-	no_errors	ENST00000327809	ensembl	human	known	74_37	missense	26.45	202	73	SNP	0.000	A
FCGBP	8857	genome.wustl.edu	37	19	40364341	40364341	+	Silent	SNP	C	C	T	rs143346927		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:40364341C>T	ENST00000221347.6	-	31	14308	c.14301G>A	c.(14299-14301)tcG>tcA	p.S4767S		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4767	TIL 11.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CACGGCAGGCCGACTCACAGC	0.647																																																	0								C		1,4403		0,1,2201	54.0	50.0	52.0		14301	-10.3	0.0	19	dbSNP_134	52	0,8596		0,0,4298	no	coding-synonymous	FCGBP	NM_003890.2		0,1,6499	TT,TC,CC		0.0,0.0227,0.0077		4767/5406	40364341	1,12999	2202	4298	6500	SO:0001819	synonymous_variant	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14301G>A	19.37:g.40364341C>T			O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.S4767	ENST00000221347.6	37	c.14301	CCDS12546.1	19																																																																																			FCGBP	-	pfam_TIL_dom,superfamily_TIL_dom,smart_EG-like_dom	ENSG00000090920		0.647	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	-	0.00	72	0	C	NM_003890		40364341	-1	tier1	rs143346927	no_errors	ENST00000221347	ensembl	human	known	74_37	silent	34.85	43	23	SNP	0.000	T
FGF13	2258	genome.wustl.edu	37	X	137715091	137715091	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:137715091T>G	ENST00000315930.6	-	5	1319	c.658A>C	c.(658-660)Agc>Cgc	p.S220R	FGF13_ENST00000541469.1_Missense_Mutation_p.S174R|FGF13_ENST00000305414.4_Missense_Mutation_p.S167R|FGF13_ENST00000370603.3_Missense_Mutation_p.S230R|FGF13_ENST00000441825.2_Missense_Mutation_p.S201R	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	220					cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					GGGGTCCCGCTTCCAGATCGG	0.522																																																	0													161.0	126.0	138.0					X																	137715091		2203	4300	6503	SO:0001583	missense	0			BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.658A>C	X.37:g.137715091T>G	ENSP00000322390:p.Ser220Arg		B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam,prints_Fibroblast_GF_fam	p.S230R	ENST00000315930.6	37	c.688	CCDS14665.1	X	.	.	.	.	.	.	.	.	.	.	T	14.96	2.692361	0.48202	.	.	ENSG00000129682	ENST00000315930;ENST00000305414;ENST00000441825;ENST00000370603;ENST00000541469	T;T;T;T;T	0.80393	-1.16;-1.3;-1.33;-1.37;-1.31	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.75774	0.3895	L	0.46157	1.445	0.80722	D	1	B;B;B;B	0.15141	0.004;0.012;0.003;0.009	B;B;B;B	0.16289	0.005;0.015;0.007;0.013	T	0.71052	-0.4704	10	0.41790	T	0.15	.	14.1997	0.65693	0.0:0.0:0.0:1.0	.	174;230;167;220	B7Z8N0;B7Z4M7;Q92913-2;Q92913	.;.;.;FGF13_HUMAN	R	220;167;201;230;174	ENSP00000322390:S220R;ENSP00000303391:S167R;ENSP00000409276:S201R;ENSP00000359635:S230R;ENSP00000437903:S174R	ENSP00000303391:S167R	S	-	1	0	FGF13	137542757	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.698000	0.84413	1.952000	0.56665	0.441000	0.28932	AGC	FGF13	-	NULL	ENSG00000129682		0.522	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF13	HGNC	protein_coding	OTTHUMT00000058534.2	-	0.00	38	0	T	NM_004114		137715091	-1	tier1	-	no_errors	ENST00000370603	ensembl	human	known	74_37	missense	23.26	33	10	SNP	1.000	G
FILIP1	27145	genome.wustl.edu	37	6	76023490	76023490	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:76023490G>T	ENST00000237172.7	-	5	2388	c.2058C>A	c.(2056-2058)caC>caA	p.H686Q	FILIP1_ENST00000393004.2_Missense_Mutation_p.H686Q|FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Missense_Mutation_p.H587Q	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	686										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						TGGCAATTTGGTGCTTGATCT	0.428																																																	0													221.0	220.0	220.0					6																	76023490		2203	4300	6503	SO:0001583	missense	0			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.2058C>A	6.37:g.76023490G>T	ENSP00000237172:p.His686Gln		B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,prints_Tropomyosin	p.H686Q	ENST00000237172.7	37	c.2058	CCDS4984.1	6	.	.	.	.	.	.	.	.	.	.	G	2.646	-0.282946	0.05642	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.16457	2.34;2.34;2.34	5.66	2.93	0.34026	.	0.269175	0.43110	D	0.000613	T	0.02380	0.0073	N	0.08118	0	0.34420	D	0.69737	B;B;B	0.28971	0.229;0.084;0.137	B;B;B	0.30251	0.019;0.053;0.113	T	0.42258	-0.9462	10	0.13470	T	0.59	-20.4553	8.5125	0.33226	0.2902:0.0:0.7098:0.0	.	686;686;686	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	Q	686;686;587	ENSP00000376728:H686Q;ENSP00000237172:H686Q;ENSP00000359037:H587Q	ENSP00000237172:H686Q	H	-	3	2	FILIP1	76080210	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.164000	0.42387	0.759000	0.33084	0.563000	0.77884	CAC	FILIP1	-	NULL	ENSG00000118407		0.428	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FILIP1	HGNC	protein_coding	OTTHUMT00000041263.1	-	0.00	56	0	G	XM_029179		76023490	-1	tier1	-	no_errors	ENST00000237172	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
FHL5	9457	genome.wustl.edu	37	6	97058632	97058632	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:97058632G>T	ENST00000326771.2	+	6	1069	c.689G>T	c.(688-690)aGt>aTt	p.S230I	FHL5_ENST00000541107.1_Missense_Mutation_p.S230I	NM_020482.4	NP_065228.4	Q5TD97	FHL5_HUMAN	four and a half LIM domains 5	230	LIM zinc-binding 4. {ECO:0000255|PROSITE- ProRule:PRU00125}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|ovary(2)|urinary_tract(1)	27		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		AAACCCATTAGTGGTGAGTTC	0.388																																																	0													135.0	131.0	133.0					6																	97058632		2203	4300	6503	SO:0001583	missense	0			AF278541	CCDS5035.1	6q16.1-q16.3	2008-02-05			ENSG00000112214	ENSG00000112214			17371	protein-coding gene	gene with protein product		605126					Standard	NM_020482		Approved	FLJ33049, ACT, dJ393D12.2	uc003pot.2	Q5TD97	OTTHUMG00000015239	ENST00000326771.2:c.689G>T	6.37:g.97058632G>T	ENSP00000326022:p.Ser230Ile		B2RBD1|E1P526|Q5TD98|Q8WW21|Q9NQU2	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.S230I	ENST00000326771.2	37	c.689	CCDS5035.1	6	.	.	.	.	.	.	.	.	.	.	G	13.40	2.226249	0.39300	.	.	ENSG00000112214	ENST00000541107;ENST00000326771	D;D	0.87256	-2.23;-2.23	5.98	3.24	0.37175	Zinc finger, LIM-type (5);	0.145914	0.32081	N	0.006608	T	0.65217	0.2670	N	0.20685	0.6	0.26476	N	0.975192	B	0.18610	0.029	B	0.25614	0.062	T	0.61987	-0.6949	10	0.87932	D	0	.	10.0727	0.42343	0.0:0.7591:0.1144:0.1264	.	230	Q5TD97	FHL5_HUMAN	I	230	ENSP00000442357:S230I;ENSP00000326022:S230I	ENSP00000326022:S230I	S	+	2	0	FHL5	97165353	0.701000	0.27806	0.989000	0.46669	0.674000	0.39518	0.806000	0.27126	0.879000	0.35944	-0.153000	0.13522	AGT	FHL5	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000112214		0.388	FHL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHL5	HGNC	protein_coding	OTTHUMT00000041559.1		0.00	26	0	G	NM_020482		97058632	+1			no_errors	ENST00000326771	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.921	T
FMNL1	752	genome.wustl.edu	37	17	43314658	43314658	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:43314658G>T	ENST00000331495.3	+	8	1070	c.734G>T	c.(733-735)aGc>aTc	p.S245I	FMNL1_ENST00000328118.3_Missense_Mutation_p.S245I|CTD-2020K17.3_ENST00000587534.1_RNA|FMNL1_ENST00000592006.1_3'UTR	NM_005892.3	NP_005883	O95466	FMNL_HUMAN	formin-like 1	245	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament severing (GO:0051014)|cortical actin cytoskeleton organization (GO:0030866)|regulation of cell shape (GO:0008360)|substrate-dependent cell migration (GO:0006929)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|GTPase activating protein binding (GO:0032794)|Rac GTPase binding (GO:0048365)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(12)|pancreas(1)|skin(1)|urinary_tract(2)	33						TCTGGCTTCAGCCTTGTCATG	0.572																																					GBM(164;1247 1997 8702 11086 51972)												0													108.0	97.0	101.0					17																	43314658		2203	4300	6503	SO:0001583	missense	0			AJ008112	CCDS11497.1	17q21.31	2008-05-14	2003-12-02	2003-12-03		ENSG00000184922			1212	protein-coding gene	gene with protein product		604656	"""formin-like"""	C17orf1B, FMNL		9799091	Standard	NM_005892		Approved	C17orf1	uc002iin.3	O95466		ENST00000331495.3:c.734G>T	17.37:g.43314658G>T	ENSP00000329219:p.Ser245Ile		D2DGW2|Q6DKG5|Q6IBP3|Q86UH1|Q8N671|Q8TDH1|Q96H10	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.S245I	ENST00000331495.3	37	c.734	CCDS11497.1	17	.	.	.	.	.	.	.	.	.	.	G	15.76	2.928499	0.52759	.	.	ENSG00000184922	ENST00000328118;ENST00000331495	D;D	0.87571	-2.27;-2.27	3.83	3.83	0.44106	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.153463	0.56097	D	0.000025	D	0.90577	0.7046	L	0.52573	1.65	0.47994	D	0.999568	D	0.71674	0.998	D	0.66351	0.943	D	0.91296	0.5063	10	0.59425	D	0.04	.	16.0229	0.80512	0.0:0.0:1.0:0.0	.	245	O95466	FMNL_HUMAN	I	245	ENSP00000327442:S245I;ENSP00000329219:S245I	ENSP00000327442:S245I	S	+	2	0	FMNL1	40670441	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.975000	0.63777	2.433000	0.82419	0.462000	0.41574	AGC	FMNL1	-	pfam_GTPase-bd,superfamily_ARM-type_fold	ENSG00000184922		0.572	FMNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMNL1	HGNC	protein_coding	OTTHUMT00000450198.1	-	0.00	34	0	G	NM_005892		43314658	+1	tier1	-	no_errors	ENST00000328118	ensembl	human	known	74_37	missense	8.51	42	4	SNP	1.000	T
FMNL3	91010	genome.wustl.edu	37	12	50043574	50043574	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:50043574C>T	ENST00000293590.5	-	18	2368	c.2135G>A	c.(2134-2136)cGc>cAc	p.R712H	FMNL3_ENST00000352151.5_Missense_Mutation_p.R661H|FMNL3_ENST00000550488.1_Missense_Mutation_p.R712H|FMNL3_ENST00000335154.5_Missense_Mutation_p.R712H			Q8IVF7	FMNL3_HUMAN	formin-like 3	712	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)	GTPase activating protein binding (GO:0032794)			breast(4)|endometrium(7)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|stomach(1)	39						CAGCATGAAGCGGTCCTCAGC	0.607																																																	0													66.0	73.0	71.0					12																	50043574		2119	4234	6353	SO:0001583	missense	0			AK128195	CCDS41780.1, CCDS44874.1	12q13.12	2006-04-10							23698	protein-coding gene	gene with protein product						12684686	Standard	NM_198900		Approved	DKFZp762B245, MGC45819, WBP3	uc001ruv.1	Q8IVF7	OTTHUMG00000169651	ENST00000293590.5:c.2135G>A	12.37:g.50043574C>T	ENSP00000293590:p.Arg712His		B0JZA7|Q6ZRJ1	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.R712H	ENST00000293590.5	37	c.2135		12	.	.	.	.	.	.	.	.	.	.	C	35	5.431057	0.96150	.	.	ENSG00000161791	ENST00000335154;ENST00000550488;ENST00000352151;ENST00000293590	T;T;T;T	0.18960	2.18;2.18;2.18;2.18	5.44	5.44	0.79542	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.57227	0.2039	M	0.91612	3.225	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.983;0.994;0.998	T	0.65598	-0.6129	10	0.62326	D	0.03	.	18.4218	0.90594	0.0:1.0:0.0:0.0	.	661;712;712	Q8IVF7-2;Q8IVF7-3;Q8IVF7	.;.;FMNL3_HUMAN	H	712;712;661;712	ENSP00000335655:R712H;ENSP00000447479:R712H;ENSP00000344311:R661H;ENSP00000293590:R712H	ENSP00000293590:R712H	R	-	2	0	FMNL3	48329841	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.066000	0.57520	2.723000	0.93209	0.655000	0.94253	CGC	FMNL3	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000161791		0.607	FMNL3-201	KNOWN	basic	protein_coding	FMNL3	HGNC	protein_coding		-	0.00	18	0	C	NM_175736		50043574	-1	tier1	-	no_errors	ENST00000293590	ensembl	human	known	74_37	missense	40.91	13	9	SNP	1.000	T
FOXK1	221937	genome.wustl.edu	37	7	4799119	4799119	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:4799119C>T	ENST00000328914.4	+	7	1589	c.1589C>T	c.(1588-1590)aCa>aTa	p.T530I	FOXK1_ENST00000446823.1_Missense_Mutation_p.T367I	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		GTGGTCACCACATCTGCCAAC	0.692																																																	0													37.0	29.0	32.0					7																	4799119		2191	4295	6486	SO:0001583	missense	0			BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.1589C>T	7.37:g.4799119C>T	ENSP00000328720:p.Thr530Ile			Missense_Mutation	SNP	pfam_TF_fork_head,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_TF_fork_head,pfscan_FHA_dom,pfscan_TF_fork_head,prints_TF_fork_head	p.T530I	ENST00000328914.4	37	c.1589	CCDS34591.1	7	.	.	.	.	.	.	.	.	.	.	C	14.19	2.462366	0.43736	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.95788	-3.45;-3.81	5.65	2.71	0.32032	.	0.500214	0.22262	N	0.062388	D	0.91925	0.7443	L	0.46157	1.445	0.28393	N	0.919	P;P	0.49961	0.93;0.664	B;B	0.39068	0.289;0.277	D	0.84001	0.0343	10	0.19147	T	0.46	.	16.4709	0.84112	0.0:0.481:0.519:0.0	.	530;367	P85037;P85037-2	FOXK1_HUMAN;.	I	367;286;530;413	ENSP00000394442:T367I;ENSP00000328720:T530I	ENSP00000328720:T530I	T	+	2	0	FOXK1	4765645	0.570000	0.26651	0.331000	0.25455	0.714000	0.41099	1.154000	0.31688	0.355000	0.24131	0.655000	0.94253	ACA	FOXK1	-	NULL	ENSG00000164916		0.692	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXK1	HGNC	protein_coding	OTTHUMT00000323729.2	-	0.00	61	0	C			4799119	+1	tier1	-	no_errors	ENST00000328914	ensembl	human	known	74_37	missense	33.78	49	25	SNP	0.366	T
FRMD1	79981	genome.wustl.edu	37	6	168475955	168475955	+	Missense_Mutation	SNP	C	C	T	rs528646808		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:168475955C>T	ENST00000283309.6	-	2	338	c.274G>A	c.(274-276)Gcg>Acg	p.A92T	FRMD1_ENST00000440994.2_Missense_Mutation_p.A24T	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	92	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		AAGAACTGCGCGTCTCTGATG	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		22937	0.001		0.0	False		,,,				2504	0.0				GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)												0													98.0	91.0	93.0					6																	168475955		2203	4300	6503	SO:0001583	missense	0				CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.274G>A	6.37:g.168475955C>T	ENSP00000283309:p.Ala92Thr		B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.A92T	ENST00000283309.6	37	c.274	CCDS5306.1	6	.	.	.	.	.	.	.	.	.	.	C	0.381	-0.928711	0.02359	.	.	ENSG00000153303	ENST00000283309;ENST00000440994;ENST00000511714	T;T;T	0.75050	-0.9;-0.9;-0.9	2.16	-1.45	0.08828	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.277119	0.23815	U	0.044291	T	0.31071	0.0785	N	0.17082	0.46	0.54753	D	0.999989	B;B	0.18166	0.026;0.021	B;B	0.19391	0.025;0.014	T	0.03139	-1.1068	10	0.23302	T	0.38	.	5.3078	0.15813	0.0:0.5514:0.2866:0.162	.	92;24	Q8N878;Q8N878-2	FRMD1_HUMAN;.	T	92;24;134	ENSP00000283309:A92T;ENSP00000414115:A24T;ENSP00000424439:A134T	ENSP00000283309:A92T	A	-	1	0	FRMD1	168218804	0.002000	0.14202	0.463000	0.27130	0.061000	0.15899	-0.969000	0.03813	-0.116000	0.11893	-0.752000	0.03492	GCG	FRMD1	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000153303		0.622	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD1	HGNC	protein_coding	OTTHUMT00000362513.2	-	0.00	10	0	C	NM_024919		168475955	-1	tier1	-	no_errors	ENST00000283309	ensembl	human	known	74_37	missense	36.36	7	4	SNP	0.758	T
FRMD3	257019	genome.wustl.edu	37	9	85862863	85862863	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:85862863G>T	ENST00000304195.3	-	14	1970	c.1764C>A	c.(1762-1764)caC>caA	p.H588Q	FRMD3_ENST00000328788.1_Intron|FRMD3_ENST00000376438.1_Intron|FRMD3_ENST00000376434.1_Intron|FRMD3_ENST00000465485.1_5'Flank	NM_001244960.1|NM_174938.5	NP_001231889.1|NP_777598.3	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3	588						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(15)|ovary(1)|upper_aerodigestive_tract(1)	30						AGAGGATGAGGTGGACTTTCC	0.453																																																	0													167.0	167.0	167.0					9																	85862863		1922	4139	6061	SO:0001583	missense	0			AK094281	CCDS43840.1, CCDS59131.1, CCDS59132.1, CCDS59133.1, CCDS75852.1	9q21.33	2008-02-05			ENSG00000172159	ENSG00000172159			24125	protein-coding gene	gene with protein product		607619				12601556	Standard	NM_174938		Approved	EPB41L4O, MGC20553	uc004ams.2	A2A2Y4	OTTHUMG00000020103	ENST00000304195.3:c.1764C>A	9.37:g.85862863G>T	ENSP00000303508:p.His588Gln		A8MQB0|B4DN14|Q53EP2|Q5JV59|Q5VZA1|Q86WP8|Q8IZ44|Q8N3Y5|Q8N9L2	Missense_Mutation	SNP	pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.H588Q	ENST00000304195.3	37	c.1764	CCDS43840.1	9	.	.	.	.	.	.	.	.	.	.	G	8.715	0.913070	0.17907	.	.	ENSG00000172159	ENST00000304195	D	0.81659	-1.52	5.52	2.66	0.31614	.	0.468437	0.26265	N	0.025373	T	0.60379	0.2264	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.51826	-0.8656	10	0.41790	T	0.15	.	8.8186	0.35011	0.2878:0.0:0.7122:0.0	.	588	A2A2Y4	FRMD3_HUMAN	Q	588	ENSP00000303508:H588Q	ENSP00000303508:H588Q	H	-	3	2	FRMD3	85052683	1.000000	0.71417	0.179000	0.23059	0.996000	0.88848	1.271000	0.33098	0.679000	0.31345	0.655000	0.94253	CAC	FRMD3	-	NULL	ENSG00000172159		0.453	FRMD3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD3	HGNC	protein_coding	OTTHUMT00000157355.1	-	0.00	36	0	G	NM_174938		85862863	-1	tier1	-	no_errors	ENST00000304195	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.519	T
FSHR	2492	genome.wustl.edu	37	2	49195944	49195944	+	Silent	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:49195944A>C	ENST00000406846.2	-	9	866	c.747T>G	c.(745-747)acT>acG	p.T249T	FSHR_ENST00000469138.1_5'UTR|FSHR_ENST00000541117.1_5'UTR|FSHR_ENST00000346173.3_Intron|FSHR_ENST00000304421.4_Silent_p.T223T	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	249					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	TTAAGTTGTAAGTCGACCTGG	0.448									Gonadal Dysgenesis, 46 XX																																								0													100.0	95.0	97.0					2																	49195944		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.747T>G	2.37:g.49195944A>C			A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_7TM,prints_FSH_rcpt,prints_Gphrmn_rcpt_fam,prints_GPCR_Rhodpsn,prints_TSH_rcpt	p.T249	ENST00000406846.2	37	c.747	CCDS1843.1	2																																																																																			FSHR	-	NULL	ENSG00000170820		0.448	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2	-	0.00	19	0	A			49195944	-1	tier1	-	no_errors	ENST00000406846	ensembl	human	known	74_37	silent	43.75	9	7	SNP	0.908	C
FSTL5	56884	genome.wustl.edu	37	4	162697220	162697220	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:162697220T>C	ENST00000306100.5	-	5	852	c.416A>G	c.(415-417)aAg>aGg	p.K139R	FSTL5_ENST00000536695.1_Missense_Mutation_p.K138R|FSTL5_ENST00000427802.2_Missense_Mutation_p.K138R|FSTL5_ENST00000379164.4_Missense_Mutation_p.K138R	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	139						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		AGTCTTGCACTTATCTCCTGT	0.254																																																	0													36.0	35.0	35.0					4																	162697220		2200	4290	6490	SO:0001583	missense	0			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.416A>G	4.37:g.162697220T>C	ENSP00000305334:p.Lys139Arg		E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Kazal_dom,pfam_Ig_V-set,smart_Kazal_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_hand_dom,pfscan_Ig-like_dom	p.K139R	ENST00000306100.5	37	c.416	CCDS3802.1	4	.	.	.	.	.	.	.	.	.	.	T	9.644	1.139799	0.21205	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.74209	-0.79;-0.78;-0.82;-0.78	5.3	4.11	0.48088	.	0.346250	0.36303	N	0.002665	T	0.54775	0.1879	N	0.16478	0.41	0.24597	N	0.993798	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.0	T	0.38672	-0.9650	10	0.25106	T	0.35	.	8.1937	0.31383	0.0:0.1567:0.0:0.8433	.	138;138;139	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	R	139;138;138;138	ENSP00000305334:K139R;ENSP00000368462:K138R;ENSP00000389270:K138R;ENSP00000440409:K138R	ENSP00000305334:K139R	K	-	2	0	FSTL5	162916670	1.000000	0.71417	0.998000	0.56505	0.966000	0.64601	3.509000	0.53386	0.935000	0.37341	0.528000	0.53228	AAG	FSTL5	-	NULL	ENSG00000168843		0.254	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FSTL5	HGNC	protein_coding	OTTHUMT00000364773.2	-	0.00	17	0	T	NM_020116		162697220	-1	tier1	-	no_errors	ENST00000306100	ensembl	human	known	74_37	missense	29.41	12	5	SNP	1.000	C
FUK	197258	genome.wustl.edu	37	16	70501299	70501299	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:70501299G>T	ENST00000288078.6	+	7	739	c.507G>T	c.(505-507)cgG>cgT	p.R169R	FUK_ENST00000571514.1_Intron|FUK_ENST00000378912.2_Silent_p.R201R	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	169						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				ACAGCTTCCGGGGAGCCAGAG	0.652																																																	0													20.0	24.0	22.0					16																	70501299		1915	4131	6046	SO:0001819	synonymous_variant	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.507G>T	16.37:g.70501299G>T			Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Silent	SNP	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.R201	ENST00000288078.6	37	c.603	CCDS10891.2	16																																																																																			FUK	-	pfam_Fucokinase	ENSG00000157353		0.652	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2	-	0.00	30	0	G	NM_145059		70501299	+1	tier1	-	no_errors	ENST00000378912	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.997	T
FZD9	8326	genome.wustl.edu	37	7	72849881	72849881	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:72849881T>C	ENST00000344575.3	+	1	1773	c.1544T>C	c.(1543-1545)tTc>tCc	p.F515S		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	515					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTCAAAATTTTCATGTCACTG	0.657																																					Pancreas(144;909 1878 36867 38226 39554)												0													40.0	43.0	42.0					7																	72849881		2203	4300	6503	SO:0001583	missense	0			U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.1544T>C	7.37:g.72849881T>C	ENSP00000345785:p.Phe515Ser			Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.F515S	ENST00000344575.3	37	c.1544	CCDS5548.1	7	.	.	.	.	.	.	.	.	.	.	T	19.76	3.888394	0.72524	.	.	ENSG00000188763	ENST00000344575	D	0.84442	-1.85	5.12	5.12	0.69794	GPCR, family 2-like (1);	0.000000	0.85682	U	0.000000	D	0.91178	0.7221	M	0.80422	2.495	0.80722	D	1	P	0.50156	0.932	P	0.59546	0.859	D	0.92221	0.5784	10	0.66056	D	0.02	.	14.0952	0.65016	0.0:0.0:0.0:1.0	.	515	O00144	FZD9_HUMAN	S	515	ENSP00000345785:F515S	ENSP00000345785:F515S	F	+	2	0	FZD9	72487817	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.040000	0.89188	1.927000	0.55829	0.460000	0.39030	TTC	FZD9	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled	ENSG00000188763		0.657	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD9	HGNC	protein_coding	OTTHUMT00000252120.1	-	0.00	15	0	T			72849881	+1	tier1	-	no_errors	ENST00000344575	ensembl	human	known	74_37	missense	35.00	13	7	SNP	1.000	C
GABRA2	2555	genome.wustl.edu	37	4	46252548	46252548	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:46252548A>G	ENST00000510861.1	-	10	1306	c.1133T>C	c.(1132-1134)cTt>cCt	p.L378P	GABRA2_ENST00000507069.1_Missense_Mutation_p.L438P|GABRA2_ENST00000514090.1_Missense_Mutation_p.L378P|GABRA2_ENST00000540012.1_Missense_Mutation_p.L383P|GABRA2_ENST00000381620.4_Missense_Mutation_p.L378P|GABRA2_ENST00000356504.1_Missense_Mutation_p.L378P			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	378					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	ATCTTTTGAAAGATTCGGGGC	0.408																																																	0													136.0	136.0	136.0					4																	46252548		2203	4299	6502	SO:0001583	missense	0				CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.1133T>C	4.37:g.46252548A>G	ENSP00000421828:p.Leu378Pro		A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa2_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.L383P	ENST00000510861.1	37	c.1148	CCDS3471.1	4	.	.	.	.	.	.	.	.	.	.	A	13.31	2.200280	0.38905	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069	D;D;D;D;D;D	0.85955	-1.86;-1.86;-1.86;-1.86;-2.05;-2.05	5.96	5.96	0.96718	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.047553	0.85682	D	0.000000	D	0.85796	0.5780	N	0.19112	0.55	0.40882	D	0.984	D;B	0.67145	0.996;0.0	D;B	0.66196	0.942;0.002	D	0.85879	0.1421	10	0.33940	T	0.23	.	15.6192	0.76793	1.0:0.0:0.0:0.0	.	383;378	B7Z1H8;P47869	.;GBRA2_HUMAN	P	378;378;378;378;383;438	ENSP00000421828:L378P;ENSP00000421300:L378P;ENSP00000371033:L378P;ENSP00000348897:L378P;ENSP00000444409:L383P;ENSP00000427603:L438P	ENSP00000348897:L378P	L	-	2	0	GABRA2	45947305	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.383000	0.79741	2.280000	0.76307	0.533000	0.62120	CTT	GABRA2	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABBAa2_rcpt,tigrfam_Neur_channel	ENSG00000151834		0.408	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GABRA2	HGNC	protein_coding	OTTHUMT00000360848.2	-	0.00	31	0	A			46252548	-1	tier1	-	no_errors	ENST00000540012	ensembl	human	known	74_37	missense	41.67	14	10	SNP	1.000	G
GABRA5	2558	genome.wustl.edu	37	15	27193133	27193133	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:27193133A>G	ENST00000335625.5	+	11	2030	c.1142A>G	c.(1141-1143)aAg>aGg	p.K381R	GABRA5_ENST00000355395.5_Missense_Mutation_p.K381R|GABRA5_ENST00000400081.3_Missense_Mutation_p.K381R	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	381					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	ACAACTGGGAAGATGTCTCAC	0.438																																																	0													40.0	39.0	39.0					15																	27193133		1873	4106	5979	SO:0001583	missense	0				CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.1142A>G	15.37:g.27193133A>G	ENSP00000335592:p.Lys381Arg		A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa5_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.K381R	ENST00000335625.5	37	c.1142	CCDS45194.1	15	.	.	.	.	.	.	.	.	.	.	A	1.504	-0.551277	0.03996	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000400081	D;D;D	0.85556	-2.0;-2.0;-2.0	4.66	2.32	0.28847	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.887740	0.09994	N	0.729321	T	0.75339	0.3836	L	0.29908	0.895	0.35559	D	0.804555	B	0.02656	0.0	B	0.10450	0.005	T	0.65734	-0.6096	10	0.28530	T	0.3	.	7.0303	0.24962	0.7372:0.0:0.2628:0.0	.	381	P31644	GBRA5_HUMAN	R	381	ENSP00000335592:K381R;ENSP00000347557:K381R;ENSP00000382953:K381R	ENSP00000335592:K381R	K	+	2	0	GABRA5	24775879	0.998000	0.40836	0.778000	0.31720	0.063000	0.16089	0.779000	0.26746	0.262000	0.21774	0.482000	0.46254	AAG	GABRA5	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABBAa5_rcpt,tigrfam_Neur_channel	ENSG00000186297		0.438	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA5	HGNC	protein_coding	OTTHUMT00000415234.1	-	0.00	21	0	A			27193133	+1	tier1	-	no_errors	ENST00000335625	ensembl	human	known	74_37	missense	31.25	11	5	SNP	0.987	G
GABRA5	2558	genome.wustl.edu	37	15	27193248	27193248	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:27193248C>A	ENST00000335625.5	+	11	2145	c.1257C>A	c.(1255-1257)taC>taA	p.Y419*	GABRA5_ENST00000355395.5_Nonsense_Mutation_p.Y419*|GABRA5_ENST00000400081.3_Nonsense_Mutation_p.Y419*	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	419					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	AAAAGACTTACAACAGTATCA	0.433																																																	0													48.0	46.0	46.0					15																	27193248		1843	4102	5945	SO:0001587	stop_gained	0				CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.1257C>A	15.37:g.27193248C>A	ENSP00000335592:p.Tyr419*		A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Nonsense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa5_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.Y419*	ENST00000335625.5	37	c.1257	CCDS45194.1	15	.	.	.	.	.	.	.	.	.	.	C	38	6.811044	0.97857	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000400081	.	.	.	4.97	4.03	0.46877	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8392	0.40989	0.0:0.8367:0.0:0.1633	.	.	.	.	X	419	.	ENSP00000335592:Y419X	Y	+	3	2	GABRA5	24775994	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.605000	0.36815	2.456000	0.83038	0.591000	0.81541	TAC	GABRA5	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000186297		0.433	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA5	HGNC	protein_coding	OTTHUMT00000415234.1	-	0.00	22	0	C			27193248	+1	tier1	-	no_errors	ENST00000335625	ensembl	human	known	74_37	nonsense	61.90	8	13	SNP	1.000	A
GABRE	2564	genome.wustl.edu	37	X	151143045	151143045	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:151143045G>T	ENST00000370328.3	-	1	106	c.53C>A	c.(52-54)tCg>tAg	p.S18*	GABRE_ENST00000370325.1_Nonsense_Mutation_p.S18*|GABRE_ENST00000393914.3_5'UTR	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	18					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GACTCACCTCGACTGGAGGAT	0.687																																																	0													60.0	39.0	46.0					X																	151143045		2190	4282	6472	SO:0001587	stop_gained	0			Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.53C>A	X.37:g.151143045G>T	ENSP00000359353:p.Ser18*		E7ET93|O15345|O15346|Q6PCD2|Q99520	Nonsense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAe_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.S18*	ENST00000370328.3	37	c.53	CCDS14703.1	X	.	.	.	.	.	.	.	.	.	.	g	21.3	4.130186	0.77549	.	.	ENSG00000102287	ENST00000370328;ENST00000370325	.	.	.	3.29	-0.88	0.10610	.	9.065020	0.00166	N	0.000002	.	.	.	.	.	.	0.27545	N	0.950673	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.346	0.07136	0.4373:0.2232:0.3395:0.0	.	.	.	.	X	18	.	ENSP00000359350:S18X	S	-	2	0	GABRE	150893701	0.000000	0.05858	0.023000	0.16930	0.270000	0.26580	0.013000	0.13310	-0.205000	0.10219	-0.351000	0.07748	TCG	GABRE	-	NULL	ENSG00000102287		0.687	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRE	HGNC	protein_coding	OTTHUMT00000060903.1		0.00	40	0	G	NM_004961, NM_021990, NM_021984		151143045	-1			no_errors	ENST00000370328	ensembl	human	known	74_37	nonsense	14.81	23	4	SNP	0.003	T
GALNT15	117248	genome.wustl.edu	37	3	16237412	16237412	+	Missense_Mutation	SNP	G	G	T	rs367893487		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:16237412G>T	ENST00000339732.5	+	2	1188	c.685G>T	c.(685-687)Gtg>Ttg	p.V229L	GALNT15_ENST00000437509.1_Missense_Mutation_p.V229L	NM_054110.4	NP_473451.3	Q8N3T1	GLT15_HUMAN	polypeptide N-acetylgalactosaminyltransferase 15	229	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|transport vesicle (GO:0030133)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										GATCATCCTCGTGGACGACCT	0.582																																																	0													66.0	51.0	56.0					3																	16237412		2203	4300	6503	SO:0001583	missense	0			AY358443	CCDS33711.1	3p25.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000131386	ENSG00000131386	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	21531	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 15"""	615131	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 2"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"""	GALNTL2		12975309, 14702039, 15147861	Standard	NM_054110		Approved	GALNT7, pp-GalNAc-T15	uc003car.4	Q8N3T1	OTTHUMG00000156893	ENST00000339732.5:c.685G>T	3.37:g.16237412G>T	ENSP00000344260:p.Val229Leu		A6NMN1|B2R638|F1LIP6|Q86T60|Q96C46|Q96DJ5	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.V229L	ENST00000339732.5	37	c.685	CCDS33711.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.190304	0.94923	.	.	ENSG00000131386	ENST00000339732;ENST00000437509	T;T	0.69685	-0.42;-0.42	4.88	4.88	0.63580	Glycosyl transferase, family 2 (1);	0.000000	0.64402	D	0.000001	D	0.85208	0.5644	M	0.92649	3.33	0.58432	D	0.999999	D	0.67145	0.996	D	0.64042	0.921	D	0.89518	0.3776	10	0.87932	D	0	.	18.0575	0.89367	0.0:0.0:1.0:0.0	.	229	Q8N3T1	GLTL2_HUMAN	L	229	ENSP00000344260:V229L;ENSP00000395873:V229L	ENSP00000344260:V229L	V	+	1	0	GALNTL2	16212416	1.000000	0.71417	0.948000	0.38648	0.891000	0.51852	7.948000	0.87774	2.256000	0.74724	0.555000	0.69702	GTG	GALNT15	-	pfam_Glyco_trans_2	ENSG00000131386		0.582	GALNT15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT15	HGNC	protein_coding	OTTHUMT00000346483.2		0.00	45	0	G	NM_054110		16237412	+1			no_errors	ENST00000339732	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
GBP4	115361	genome.wustl.edu	37	1	89659042	89659042	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:89659042G>T	ENST00000355754.6	-	4	514	c.417C>A	c.(415-417)agC>agA	p.S139R		NM_052941.4	NP_443173.2	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	139	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(19)|skin(1)|stomach(2)|urinary_tract(1)	33				all cancers(265;0.00723)|Epithelial(280;0.0291)		AGACAAAGCTGCTGCTTAGAA	0.468																																																	0													131.0	126.0	127.0					1																	89659042		2203	4300	6503	SO:0001583	missense	0			AF288814	CCDS721.1	1p22.2	2008-02-05			ENSG00000162654	ENSG00000162654			20480	protein-coding gene	gene with protein product		612466				16689661	Standard	NM_052941		Approved	Mpa2	uc001dnb.3	Q96PP9	OTTHUMG00000010663	ENST00000355754.6:c.417C>A	1.37:g.89659042G>T	ENSP00000359490:p.Ser139Arg		B2R630|Q05D63|Q6NSL0|Q86T99	Missense_Mutation	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.S139R	ENST00000355754.6	37	c.417	CCDS721.1	1	.	.	.	.	.	.	.	.	.	.	G	17.33	3.361587	0.61403	.	.	ENSG00000162654	ENST00000355754	D	0.83419	-1.72	4.93	3.04	0.35103	Guanylate-binding protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92192	0.7524	H	0.98802	4.335	0.30430	N	0.777301	D	0.89917	1.0	D	0.97110	1.0	D	0.88397	0.3012	10	0.87932	D	0	.	9.3674	0.38232	0.1765:0.0:0.8235:0.0	.	139	Q96PP9	GBP4_HUMAN	R	139	ENSP00000359490:S139R	ENSP00000359490:S139R	S	-	3	2	GBP4	89431630	1.000000	0.71417	0.677000	0.29947	0.685000	0.39939	1.800000	0.38833	0.774000	0.33427	0.655000	0.94253	AGC	GBP4	-	pfam_Guanylate-bd_N,superfamily_P-loop_NTPase	ENSG00000162654		0.468	GBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP4	HGNC	protein_coding	OTTHUMT00000029409.1	-	0.00	40	0	G	NM_052941		89659042	-1	tier1	-	no_errors	ENST00000355754	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.988	T
GLI1	2735	genome.wustl.edu	37	12	57863271	57863271	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:57863271G>T	ENST00000228682.2	+	11	1457	c.1366G>T	c.(1366-1368)Ggg>Tgg	p.G456W	GLI1_ENST00000546141.1_Missense_Mutation_p.G415W|GLI1_ENST00000543426.1_Missense_Mutation_p.G328W	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	456					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CTCCCCGGCAGGGAGTGCAGC	0.602																																					Pancreas(157;841 1936 10503 41495 50368)												0													79.0	67.0	71.0					12																	57863271		2203	4300	6503	SO:0001583	missense	0				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1366G>T	12.37:g.57863271G>T	ENSP00000228682:p.Gly456Trp		D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G456W	ENST00000228682.2	37	c.1366	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	G	19.37	3.814413	0.70912	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467	T;T;T;T	0.17213	2.39;2.29;2.39;2.39	4.49	4.49	0.54785	.	0.000000	0.51477	D	0.000081	T	0.39989	0.1099	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.26430	-1.0103	10	0.87932	D	0	.	15.0811	0.72117	0.0:0.0:1.0:0.0	.	456	P08151	GLI1_HUMAN	W	328;456;415;415	ENSP00000437607:G328W;ENSP00000228682:G456W;ENSP00000441006:G415W;ENSP00000434408:G415W	ENSP00000228682:G456W	G	+	1	0	GLI1	56149538	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	9.462000	0.97649	2.484000	0.83849	0.563000	0.77884	GGG	GLI1	-	NULL	ENSG00000111087		0.602	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	HGNC	protein_coding	OTTHUMT00000394197.1		0.00	40	0	G	NM_005269		57863271	+1			no_errors	ENST00000228682	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	T
GNGT1	2792	genome.wustl.edu	37	7	93536047	93536047	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:93536047G>T	ENST00000248572.5	+	2	137		c.e2-1		GNGT1_ENST00000430875.1_5'UTR|GNGT1_ENST00000429473.1_5'UTR|GNGT1_ENST00000428834.1_Splice_Site|GNGT1_ENST00000455502.1_Splice_Site	NM_021955.3	NP_068774.1	P63211	GBG1_HUMAN	guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 1						cardiac muscle cell apoptotic process (GO:0010659)|cellular response to hypoxia (GO:0071456)|eye photoreceptor cell development (GO:0042462)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	heterotrimeric G-protein complex (GO:0005834)|photoreceptor disc membrane (GO:0097381)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	GTPase activity (GO:0003924)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(1)|lung(3)|prostate(1)	6	all_cancers(62;2.39e-10)|all_epithelial(64;1.54e-09)|Lung NSC(181;0.218)		STAD - Stomach adenocarcinoma(171;0.000967)			TACATCTTCAGCAGGCAAAAA	0.398																																																	0													99.0	98.0	98.0					7																	93536047		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS5633.1	7q21.3	2008-07-18			ENSG00000127928	ENSG00000127928			4411	protein-coding gene	gene with protein product		189970				8661128	Standard	NM_021955		Approved	GNG1	uc003unc.1	P63211	OTTHUMG00000022908	ENST00000248572.5:c.-11-1G>T	7.37:g.93536047G>T			A4D1H2|O43835|Q08447|Q16026|Q6LCP6	Splice_Site	SNP	-	e1-1	ENST00000248572.5	37	c.1-1	CCDS5633.1	7																																																																																			GNGT1	-	-	ENSG00000127928		0.398	GNGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNGT1	HGNC	protein_coding	OTTHUMT00000254718.2	-	0.00	28	0	G	NM_021955	Intron	93536047	+1	tier1	-	no_errors	ENST00000248572	ensembl	human	known	74_37	splice_site	13.04	20	3	SNP	0.000	T
GOLGA6L7P	728310	genome.wustl.edu	37	15	29093679	29093679	+	RNA	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:29093679G>T	ENST00000569815.1	-	0	142					NR_047567.1				golgin A6 family-like 7, pseudogene																		TCTTTGTTGGGTTTTTTCGGA	0.557																																																	0																																												0			AK302238		15q13.1	2012-10-05	2011-04-15	2010-04-20	ENSG00000261649	ENSG00000261649			37442	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 6-like 7 (pseudogene)"""	GOLGA6L7			Standard	NR_047567		Approved		uc010uar.2		OTTHUMG00000176345		15.37:g.29093679G>T				RNA	SNP	-	NULL	ENST00000569815.1	37	NULL		15																																																																																			GOLGA6L7P	-	-	ENSG00000261649		0.557	GOLGA6L7P-002	PUTATIVE	basic	processed_transcript	GOLGA6L7P	HGNC	pseudogene	OTTHUMT00000431796.1	-	0.00	27	0	G	XR_078490		29093679	-1	tier1	-	no_errors	ENST00000569815	ensembl	human	putative	74_37	rna	40.91	13	9	SNP	0.008	T
GPR107	57720	genome.wustl.edu	37	9	132854566	132854566	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:132854566G>T	ENST00000372406.1	+	9	1276	c.769G>T	c.(769-771)Gca>Tca	p.A257S	GPR107_ENST00000372410.3_Missense_Mutation_p.A257S|GPR107_ENST00000347136.6_Missense_Mutation_p.A257S	NM_001136557.1	NP_001130029.1	Q5VW38	GP107_HUMAN	G protein-coupled receptor 107	257						integral component of membrane (GO:0016021)				endometrium(2)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	11		Ovarian(14;0.000531)				CTACCTCTCAGCAGGAGAAAT	0.383																																																	0													147.0	143.0	144.0					9																	132854566		2203	4300	6503	SO:0001583	missense	0			AF376725	CCDS35162.1, CCDS48041.1, CCDS48042.1	9q34.2	2014-01-30			ENSG00000148358	ENSG00000148358		"""GPCR / Unclassified : 7TM orphan receptors"""	17830	protein-coding gene	gene with protein product							Standard	NM_020960		Approved	KIAA1624, RP11-88G17, FLJ20998, LUSTR1	uc004bzd.2	Q5VW38	OTTHUMG00000020804	ENST00000372406.1:c.769G>T	9.37:g.132854566G>T	ENSP00000361483:p.Ala257Ser		A6NJ53|Q2TB81|Q5JPA3|Q5VW39|Q96T26|Q9H658|Q9HCE8	Missense_Mutation	SNP	pfam_TM_rcpt_euk,pfam_Intimal_thickness-rel_rcpt	p.A257S	ENST00000372406.1	37	c.769	CCDS48041.1	9	.	.	.	.	.	.	.	.	.	.	G	28.9	4.962562	0.92791	.	.	ENSG00000148358	ENST00000372406;ENST00000347136;ENST00000372410;ENST00000455412	T;T;T	0.32023	1.54;1.47;1.53	5.56	5.56	0.83823	.	0.154096	0.44688	D	0.000428	T	0.56543	0.1992	M	0.82056	2.57	0.80722	D	1	P;D;P	0.55800	0.649;0.973;0.649	B;P;B	0.60117	0.321;0.869;0.321	T	0.60016	-0.7345	10	0.62326	D	0.03	-6.8946	18.183	0.89785	0.0:0.0:1.0:0.0	.	257;257;257	G5E994;Q5VW38;Q5VW38-2	.;GP107_HUMAN;.	S	257	ENSP00000361483:A257S;ENSP00000336988:A257S;ENSP00000361487:A257S	ENSP00000336988:A257S	A	+	1	0	GPR107	131894387	1.000000	0.71417	0.967000	0.41034	0.999000	0.98932	8.384000	0.90160	2.638000	0.89438	0.603000	0.83216	GCA	GPR107	-	pfam_TM_rcpt_euk,pfam_Intimal_thickness-rel_rcpt	ENSG00000148358		0.383	GPR107-003	NOVEL	basic|CCDS	protein_coding	GPR107	HGNC	protein_coding	OTTHUMT00000054643.2	-	0.00	30	0	G			132854566	+1	tier1	-	no_errors	ENST00000372410	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.996	T
GPR155	151556	genome.wustl.edu	37	2	175333663	175333663	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:175333663T>G	ENST00000392552.2	-	5	1397	c.1159A>C	c.(1159-1161)Agt>Cgt	p.S387R	GPR155_ENST00000392551.2_Missense_Mutation_p.S387R|GPR155_ENST00000295500.4_Missense_Mutation_p.S387R	NM_001267051.1|NM_152529.6	NP_001253980.1|NP_689742.4	Q7Z3F1	GP155_HUMAN	G protein-coupled receptor 155	387					cognition (GO:0050890)|intracellular signal transduction (GO:0035556)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	26						CTGACAATACTTATATCAAAA	0.418																																																	0													188.0	175.0	179.0					2																	175333663		2203	4300	6503	SO:0001583	missense	0			AY255528	CCDS2259.1, CCDS74605.1	2q31.1	2012-04-10			ENSG00000163328	ENSG00000163328			22951	protein-coding gene	gene with protein product						12679517	Standard	NM_001033045		Approved	DEPDC3, DEP.7, FLJ31819, PGR22	uc002uiu.4	Q7Z3F1	OTTHUMG00000132336	ENST00000392552.2:c.1159A>C	2.37:g.175333663T>G	ENSP00000376335:p.Ser387Arg		B2RCI2|D3DPE2|Q4G0Y6|Q53SJ3|Q53TA8|Q69YG8|Q86SP9|Q8N261|Q8N639|Q8N8K3|Q96MV6	Missense_Mutation	SNP	pfam_Auxin_eff,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.S387R	ENST00000392552.2	37	c.1159	CCDS2259.1	2	.	.	.	.	.	.	.	.	.	.	T	28.5	4.921807	0.92319	.	.	ENSG00000163328	ENST00000392552;ENST00000392551;ENST00000295500	T;T;T	0.69040	-0.37;-0.37;-0.37	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.81569	0.4850	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83339	-0.0009	10	0.87932	D	0	-16.2721	16.6277	0.84984	0.0:0.0:0.0:1.0	.	387	Q7Z3F1	GP155_HUMAN	R	387	ENSP00000376335:S387R;ENSP00000376334:S387R;ENSP00000295500:S387R	ENSP00000295500:S387R	S	-	1	0	GPR155	175041909	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.330000	0.79161	0.528000	0.53228	AGT	GPR155	-	NULL	ENSG00000163328		0.418	GPR155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR155	HGNC	protein_coding	OTTHUMT00000255455.1	-	0.00	18	0	T	NM_152529		175333663	-1	tier1	-	no_errors	ENST00000295500	ensembl	human	known	74_37	missense	35.71	9	5	SNP	1.000	G
GPR4	2828	genome.wustl.edu	37	19	46094360	46094360	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:46094360G>T	ENST00000323040.4	-	2	1709	c.765C>A	c.(763-765)ccC>ccA	p.P255P	OPA3_ENST00000544371.1_Intron|GPR4_ENST00000591614.1_5'Flank	NM_005282.2	NP_005273.1	P46093	GPR4_HUMAN	G protein-coupled receptor 4	255				P -> L (in Ref. 5; BAF83387). {ECO:0000305}.	G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;0.0071)|GBM - Glioblastoma multiforme(486;0.128)|Epithelial(262;0.223)		CGCAGTCCCAGGGGCGGCCCA	0.632																																					Esophageal Squamous(117;181 1612 1673 14956 42937)												0													37.0	41.0	40.0					19																	46094360		2202	4300	6502	SO:0001819	synonymous_variant	0			BC067536	CCDS12669.1	19q13.3	2012-08-21				ENSG00000177464		"""GPCR / Class A : Orphans"""	4497	protein-coding gene	gene with protein product		600551				8595909	Standard	NM_005282		Approved		uc002pcm.3	P46093		ENST00000323040.4:c.765C>A	19.37:g.46094360G>T			A8K3T3|B0M0K1|Q6NWM4	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPR4_orph,prints_GPCR_Rhodpsn,prints_Psych_rcpt	p.P255	ENST00000323040.4	37	c.765	CCDS12669.1	19																																																																																			GPR4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR4_orph	ENSG00000177464		0.632	GPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR4	HGNC	protein_coding	OTTHUMT00000459603.1	-	0.00	28	0	G	NM_005282		46094360	-1	tier1	-	no_errors	ENST00000323040	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.994	T
GPRC6A	222545	genome.wustl.edu	37	6	117114295	117114295	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:117114295G>T	ENST00000310357.3	-	6	1812	c.1791C>A	c.(1789-1791)ctC>ctA	p.L597L	GPRC6A_ENST00000530250.1_Silent_p.L422L|GPRC6A_ENST00000368549.3_Silent_p.L526L	NM_148963.2	NP_683766.2	Q5T6X5	GPC6A_HUMAN	G protein-coupled receptor, class C, group 6, member A	597					calcium-mediated signaling (GO:0019722)|response to amino acid (GO:0043200)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|liver(1)|lung(24)|ovary(5)|pancreas(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)	65		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0265)|all cancers(137;0.0554)|OV - Ovarian serous cystadenocarcinoma(136;0.07)		AGAGAATCAGGAGTAGGATGG	0.428																																																	0													106.0	102.0	104.0					6																	117114295		2203	4300	6503	SO:0001819	synonymous_variant	0			AF502962	CCDS5112.1, CCDS69184.1, CCDS69185.1	6q22.31	2014-01-30	2014-01-30		ENSG00000173612	ENSG00000173612		"""GPCR / Class C : Calcium-sensing receptors"""	18510	protein-coding gene	gene with protein product			"""G protein-coupled receptor, family C, group 6, member A"""				Standard	NM_001286354		Approved	bA86F4.3	uc003pxj.1	Q5T6X5	OTTHUMG00000015447	ENST00000310357.3:c.1791C>A	6.37:g.117114295G>T			Q6JK43|Q6JK44|Q8NGU8|Q8NHZ9|Q8TDT6	Silent	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_vmron_rcpt_2	p.L597	ENST00000310357.3	37	c.1791	CCDS5112.1	6																																																																																			GPRC6A	-	pfscan_GPCR_3_C	ENSG00000173612		0.428	GPRC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC6A	HGNC	protein_coding	OTTHUMT00000041966.2	-	0.00	20	0	G			117114295	-1	tier1	-	no_errors	ENST00000310357	ensembl	human	known	74_37	silent	15.38	22	4	SNP	0.015	T
GRIK5	2901	genome.wustl.edu	37	19	42525545	42525545	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:42525545G>T	ENST00000262895.3	-	14	1778	c.1779C>A	c.(1777-1779)ggC>ggA	p.G593G	GRIK5_ENST00000593562.1_Silent_p.G593G|GRIK5_ENST00000301218.4_Silent_p.G593G	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	593					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				ACAGGCTGTTGCCCAGCGTGT	0.642																																																	0													32.0	30.0	31.0					19																	42525545		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.1779C>A	19.37:g.42525545G>T			Q8WWG8	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G593	ENST00000262895.3	37	c.1779	CCDS12595.1	19																																																																																			GRIK5	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000105737		0.642	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	HGNC	protein_coding	OTTHUMT00000463453.1	-	0.00	35	0	G			42525545	-1	tier1	-	no_errors	ENST00000301218	ensembl	human	known	74_37	silent	31.43	24	11	SNP	0.998	T
GRIPAP1	56850	genome.wustl.edu	37	X	48847591	48847591	+	Intron	SNP	G	G	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:48847591G>C	ENST00000376441.1	-	7	492				GRIPAP1_ENST00000376425.3_Intron|GRIPAP1_ENST00000376444.3_Intron|GRIPAP1_ENST00000376423.4_Intron|GRIPAP1_ENST00000473581.1_5'UTR	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1							blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						GCCTCGAATAGAGGGAGAACT	0.532																																																	0																																										SO:0001627	intron_variant	0			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.458-69C>G	X.37:g.48847591G>C			A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	RNA	SNP	-	NULL	ENST00000376441.1	37	NULL	CCDS35248.1	X																																																																																			GRIPAP1	-	-	ENSG00000068400		0.532	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIPAP1	HGNC	protein_coding	OTTHUMT00000080970.2	-	0.00	9	0	G	NM_207672		48847591	-1	tier1	-	no_errors	ENST00000473581	ensembl	human	known	74_37	rna	35.00	13	7	SNP	0.001	C
GRM6	2916	genome.wustl.edu	37	5	178410025	178410025	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:178410025G>T	ENST00000517717.1	-	10	2360	c.2322C>A	c.(2320-2322)ggC>ggA	p.G774G	GRM6_ENST00000231188.5_Silent_p.G774G|RP11-281O15.4_ENST00000519491.1_RNA			O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6	774					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|detection of light stimulus involved in visual perception (GO:0050908)|detection of visible light (GO:0009584)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|locomotory behavior (GO:0007626)|positive regulation of calcium ion import (GO:0090280)|regulation of synaptic transmission, glutamatergic (GO:0051966)|retina development in camera-type eye (GO:0060041)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|new growing cell tip (GO:0035841)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|protein homodimerization activity (GO:0042803)			NS(2)|breast(4)|endometrium(9)|large_intestine(12)|lung(21)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	55	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		TCTCGGGCACGCCACGGGCCT	0.597																																																	0													130.0	107.0	115.0					5																	178410025		2203	4300	6503	SO:0001819	synonymous_variant	0			U82083	CCDS4442.1	5q35	2014-01-28						"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4598	protein-coding gene	gene with protein product		604096				9215706	Standard	NM_000843		Approved	GPRC1F, mGlu6, MGLUR6, CSNB1B	uc003mjr.3	O15303	OTTHUMG00000130889	ENST00000517717.1:c.2322C>A	5.37:g.178410025G>T				Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_6,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.G774	ENST00000517717.1	37	c.2322	CCDS4442.1	5																																																																																			GRM6	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3	ENSG00000113262		0.597	GRM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM6	HGNC	protein_coding	OTTHUMT00000253474.2		0.00	44	0	G			178410025	-1			no_errors	ENST00000231188	ensembl	human	known	74_37	silent	6.90	27	2	SNP	0.001	T
GVINP1	387751	genome.wustl.edu	37	11	6736736	6736736	+	RNA	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:6736736G>A	ENST00000526769.3	-	0	6468					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										GTTTCTCCAGGTTAGTCCTGT	0.423																																																	0																																												0			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6736736G>A			A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-	ENSG00000254838		0.423	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	-	0.00	30	0	G	NR_003945		6736736	-1	tier1	-	no_errors	ENST00000526769	ensembl	human	known	74_37	rna	32.35	23	11	SNP	0.991	A
HACL1	26061	genome.wustl.edu	37	3	15609465	15609465	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:15609465A>C	ENST00000321169.5	-	14	1662	c.1295T>G	c.(1294-1296)tTt>tGt	p.F432C	HACL1_ENST00000435217.2_Missense_Mutation_p.F191C|HACL1_ENST00000451445.2_Missense_Mutation_p.F350C|HACL1_ENST00000457447.2_Missense_Mutation_p.F372C|HACL1_ENST00000456194.2_Missense_Mutation_p.F405C	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1	432	Thiamine pyrophosphate binding.				cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)			NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						TGCAATAGCAAATCCCAAACC	0.483																																																	0													141.0	144.0	143.0					3																	15609465		2203	4300	6503	SO:0001583	missense	0			AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.1295T>G	3.37:g.15609465A>C	ENSP00000323811:p.Phe432Cys		B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Missense_Mutation	SNP	pfam_Thiamin_PyroP_enz_TPP-bd_dom,pfam_Thiamin_PyroP_enz_cen_dom,pfam_TPP_enzyme-bd_C,pfam_CO_DH_CoA_synth	p.F432C	ENST00000321169.5	37	c.1295	CCDS2627.1	3	.	.	.	.	.	.	.	.	.	.	A	21.4	4.138399	0.77775	.	.	ENSG00000131373	ENST00000321169;ENST00000435217;ENST00000451445;ENST00000456194;ENST00000457447	T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92	5.5	5.5	0.81552	Thiamine pyrophosphate enzyme, C-terminal TPP-binding (1);	0.106929	0.64402	D	0.000001	T	0.71160	0.3307	M	0.90595	3.13	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.993;0.994;0.998;0.999;0.999	T	0.78420	-0.2211	10	0.87932	D	0	.	15.6106	0.76713	1.0:0.0:0.0:0.0	.	350;372;405;191;432	B4DXI5;E9PEN4;B4DWI1;B3KPX4;Q9UJ83	.;.;.;.;HACL1_HUMAN	C	432;191;350;405;372	ENSP00000323811:F432C;ENSP00000395278:F191C;ENSP00000403656:F350C;ENSP00000390699:F405C;ENSP00000404883:F372C	ENSP00000323811:F432C	F	-	2	0	HACL1	15584469	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.031000	0.76491	2.093000	0.63338	0.459000	0.35465	TTT	HACL1	-	pfam_TPP_enzyme-bd_C	ENSG00000131373		0.483	HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HACL1	HGNC	protein_coding	OTTHUMT00000252104.3	-	0.00	30	0	A	NM_012260		15609465	-1	tier1	-	no_errors	ENST00000321169	ensembl	human	known	74_37	missense	41.94	18	13	SNP	1.000	C
HIP1	3092	genome.wustl.edu	37	7	75174482	75174482	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:75174482G>T	ENST00000336926.6	-	26	2590	c.2564C>A	c.(2563-2565)aCa>aAa	p.T855K	HIP1_ENST00000434438.2_Missense_Mutation_p.T804K	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	855	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						AGGGGATGCTGTACCCTAGGG	0.423			T	PDGFRB	CMML																																			Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0													100.0	105.0	103.0					7																	75174482		2203	4300	6503	SO:0001583	missense	0			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2564C>A	7.37:g.75174482G>T	ENSP00000336747:p.Thr855Lys		B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	pfam_ANTH_dom,pfam_ILWEQ_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Epsin-like_N,smart_ILWEQ_dom,pfscan_Epsin-like_N,pfscan_ILWEQ_dom	p.T855K	ENST00000336926.6	37	c.2564	CCDS34669.1	7	.	.	.	.	.	.	.	.	.	.	g	26.9	4.779736	0.90195	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.29397	1.57;1.57	5.6	5.6	0.85130	I/LWEQ (4);	0.045918	0.85682	D	0.000000	T	0.39655	0.1086	L	0.39397	1.21	0.49687	D	0.999811	B;B	0.34399	0.452;0.105	P;B	0.45913	0.497;0.149	T	0.10753	-1.0616	10	0.41790	T	0.15	-17.2273	18.1668	0.89731	0.0:0.0:1.0:0.0	.	804;855	E7ES17;O00291	.;HIP1_HUMAN	K	855;804	ENSP00000336747:T855K;ENSP00000410300:T804K	ENSP00000336747:T855K	T	-	2	0	HIP1	75012418	1.000000	0.71417	0.967000	0.41034	0.996000	0.88848	9.432000	0.97498	2.644000	0.89710	0.655000	0.94253	ACA	HIP1	-	pfam_ILWEQ_dom,smart_ILWEQ_dom,pfscan_ILWEQ_dom	ENSG00000127946		0.423	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	HGNC	protein_coding	OTTHUMT00000342863.2		0.00	33	0	G	NM_005338		75174482	-1			no_errors	ENST00000336926	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186056742	186056742	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:186056742G>T	ENST00000271588.4	+	60	9557	c.9328G>T	c.(9328-9330)Gct>Tct	p.A3110S	HMCN1_ENST00000367492.2_Missense_Mutation_p.A3110S	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3110	Ig-like C2-type 29.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GGAGATTTTAGCTGATGGACA	0.448																																																	0													119.0	118.0	118.0					1																	186056742		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.9328G>T	1.37:g.186056742G>T	ENSP00000271588:p.Ala3110Ser		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.A3110S	ENST00000271588.4	37	c.9328	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	5.552	0.286657	0.10513	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.67345	-0.26;-0.26	5.29	-1.71	0.08133	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.924765	0.09285	N	0.823208	T	0.46367	0.1389	N	0.12920	0.275	0.09310	N	1	B	0.28584	0.216	B	0.39706	0.307	T	0.43956	-0.9359	10	0.07990	T	0.79	.	5.0283	0.14396	0.1904:0.0:0.4491:0.3605	.	3110	Q96RW7	HMCN1_HUMAN	S	3110	ENSP00000271588:A3110S;ENSP00000356462:A3110S	ENSP00000271588:A3110S	A	+	1	0	HMCN1	184323365	0.296000	0.24398	0.011000	0.14972	0.932000	0.56968	0.832000	0.27490	-0.254000	0.09500	0.655000	0.94253	GCT	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143341		0.448	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	46	0	G	NM_031935		186056742	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	6.45	58	4	SNP	0.130	T
HMCN1	83872	genome.wustl.edu	37	1	186094842	186094843	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:186094842_186094843insA	ENST00000271588.4	+	82	12835_12836	c.12606_12607insA	c.(12607-12609)aaafs	p.K4203fs	HMCN1_ENST00000367492.2_Frame_Shift_Ins_p.K4203fs	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4203	Ig-like C2-type 41.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAATTAACTGGAAAAAAGACAA	0.396																																																	0																																										SO:0001589	frameshift_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.12612dupA	1.37:g.186094848_186094848dupA	ENSP00000271588:p.Lys4203fs		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Frame_Shift_Ins	INS	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.D4204fs	ENST00000271588.4	37	c.12606_12607	CCDS30956.1	1																																																																																			HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143341		0.396	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1		0.00	31	0	-	NM_031935		186094843	+1	tier1		no_errors	ENST00000271588	ensembl	human	known	74_37	frame_shift_ins	59.09	18	26	INS	1.000:1.000	A
HSD17B12	51144	genome.wustl.edu	37	11	43772501	43772501	+	Silent	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:43772501A>G	ENST00000278353.4	+	2	320	c.201A>G	c.(199-201)gcA>gcG	p.A67A	HSD17B12_ENST00000529261.1_3'UTR|HSD17B12_ENST00000395700.4_Silent_p.A67A	NM_016142.2	NP_057226.1	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12	67					cellular lipid metabolic process (GO:0044255)|estrogen biosynthetic process (GO:0006703)|extracellular matrix organization (GO:0030198)|fatty acid biosynthetic process (GO:0006633)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cell-substrate adhesion (GO:0010811)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|integral component of membrane (GO:0016021)	estradiol 17-beta-dehydrogenase activity (GO:0004303)|heparin binding (GO:0008201)			endometrium(2)|large_intestine(4)|lung(4)	10						AATCATATGCAGAAGAGGTAG	0.294																																					Ovarian(58;548 1143 13948 16572 34258)												0													114.0	105.0	108.0					11																	43772501		2203	4300	6503	SO:0001819	synonymous_variant	0			AF078850	CCDS7905.1	11q11	2011-09-20				ENSG00000149084	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	18646	protein-coding gene	gene with protein product	"""3-ketoacyl-CoA reductase"", ""short chain dehydrogenase/reductase family 12C, member 1"""	609574				12482854, 19027726	Standard	NM_016142		Approved	KAR, SDR12C1	uc001mxq.4	Q53GQ0		ENST00000278353.4:c.201A>G	11.37:g.43772501A>G			A8K9B0|D3DR23|Q96EA9|Q96JU2|Q9Y6G8	Silent	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.A67	ENST00000278353.4	37	c.201	CCDS7905.1	11																																																																																			HSD17B12	-	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH	ENSG00000149084		0.294	HSD17B12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B12	HGNC	protein_coding	OTTHUMT00000389594.1	-	0.00	38	0	A			43772501	+1	tier1	-	no_errors	ENST00000278353	ensembl	human	known	74_37	silent	24.49	37	12	SNP	1.000	G
HSPG2	3339	genome.wustl.edu	37	1	22172708	22172708	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:22172708G>T	ENST00000374695.3	-	64	8436	c.8357C>A	c.(8356-8358)gCc>gAc	p.A2786D		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2786	Ig-like C2-type 13.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	ACCCGAGTCGGCCGGGGACAC	0.637																																																	0													19.0	22.0	21.0					1																	22172708		2200	4297	6497	SO:0001583	missense	0			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.8357C>A	1.37:g.22172708G>T	ENSP00000363827:p.Ala2786Asp		Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA_dom,pfscan_Ig-like_dom,prints_LDrepeatLR_classA_rpt	p.A2786D	ENST00000374695.3	37	c.8357	CCDS30625.1	1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.763453	0.49574	.	.	ENSG00000142798	ENST00000374695;ENST00000453796	T;T	0.13901	2.55;2.82	5.22	4.31	0.51392	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.39615	N	0.001303	T	0.22551	0.0544	L	0.41415	1.275	0.34826	D	0.739228	P;P	0.44478	0.836;0.593	P;P	0.56216	0.794;0.7	T	0.20940	-1.0260	10	0.49607	T	0.09	.	11.5345	0.50628	0.0875:0.0:0.9125:0.0	.	726;2786	Q59EG0;P98160	.;PGBM_HUMAN	D	2786;201	ENSP00000363827:A2786D;ENSP00000396310:A201D	ENSP00000363827:A2786D	A	-	2	0	HSPG2	22045295	0.960000	0.32886	0.302000	0.25058	0.662000	0.39071	2.548000	0.45794	1.204000	0.43247	0.561000	0.74099	GCC	HSPG2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000142798		0.637	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1		0.00	51	0	G	NM_005529		22172708	-1			no_errors	ENST00000374695	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.680	T
HUWE1	10075	genome.wustl.edu	37	X	53575167	53575167	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:53575167C>T	ENST00000342160.3	-	67	10560	c.10103G>A	c.(10102-10104)gGc>gAc	p.G3368D	HUWE1_ENST00000262854.6_Missense_Mutation_p.G3368D|HUWE1_ENST00000474288.1_5'Flank			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3368					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GGCCTTATTGCCCCTTTCCCG	0.512																																																	0													76.0	48.0	58.0					X																	53575167		2203	4300	6503	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.10103G>A	X.37:g.53575167C>T	ENSP00000340648:p.Gly3368Asp		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.G3368D	ENST00000342160.3	37	c.10103	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	C	10.68	1.417116	0.25552	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.37915	1.17;1.17	5.75	5.75	0.90469	.	0.632453	0.16022	N	0.233253	T	0.30510	0.0767	L	0.29908	0.895	0.32753	N	0.506155	B;B	0.22414	0.041;0.069	B;B	0.24006	0.037;0.05	T	0.27468	-1.0073	10	0.17832	T	0.49	.	17.639	0.88130	0.0:1.0:0.0:0.0	.	3368;3352	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	D	3368	ENSP00000340648:G3368D;ENSP00000262854:G3368D	ENSP00000262854:G3368D	G	-	2	0	HUWE1	53591892	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	3.884000	0.56175	2.437000	0.82529	0.529000	0.55759	GGC	HUWE1	-	NULL	ENSG00000086758		0.512	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	36	0	C	XM_497119		53575167	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	51.52	16	17	SNP	1.000	T
HUWE1	10075	genome.wustl.edu	37	X	53596600	53596600	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:53596600G>T	ENST00000342160.3	-	47	6957	c.6500C>A	c.(6499-6501)gCt>gAt	p.A2167D	HUWE1_ENST00000262854.6_Missense_Mutation_p.A2167D			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2167					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TGTACTCTCAGCCATAGCCAG	0.522																																																	0													123.0	114.0	117.0					X																	53596600		2203	4300	6503	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.6500C>A	X.37:g.53596600G>T	ENSP00000340648:p.Ala2167Asp		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.A2167D	ENST00000342160.3	37	c.6500	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	G	17.90	3.502980	0.64298	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.37235	1.21;1.21	5.24	5.24	0.73138	Armadillo-like helical (1);	0.224065	0.38381	N	0.001716	T	0.20088	0.0483	N	0.03608	-0.345	0.51233	D	0.999911	B;B	0.25609	0.079;0.13	B;B	0.29598	0.029;0.104	T	0.11275	-1.0594	10	0.20046	T	0.44	.	16.6657	0.85253	0.0:0.0:1.0:0.0	.	2167;2167	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	D	2167	ENSP00000340648:A2167D;ENSP00000262854:A2167D	ENSP00000262854:A2167D	A	-	2	0	HUWE1	53613325	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.395000	0.97266	2.194000	0.70268	0.513000	0.50165	GCT	HUWE1	-	NULL	ENSG00000086758		0.522	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	29	0	G	XM_497119		53596600	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
HUWE1	10075	genome.wustl.edu	37	X	53658551	53658551	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:53658551G>T	ENST00000342160.3	-	9	1118	c.661C>A	c.(661-663)Cta>Ata	p.L221I	HUWE1_ENST00000218328.8_Missense_Mutation_p.L221I|HUWE1_ENST00000262854.6_Missense_Mutation_p.L221I			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	221					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						ATATAATGTAGTGTGTTACTA	0.383																																																	0													87.0	85.0	86.0					X																	53658551		2201	4300	6501	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.661C>A	X.37:g.53658551G>T	ENSP00000340648:p.Leu221Ile		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.L221I	ENST00000342160.3	37	c.661	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	G	12.23	1.876276	0.33162	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.47869	1.1;1.1;0.83	4.86	4.86	0.63082	E3 ubiquitin ligase, domain of unknown function DUF908 (1);Armadillo-type fold (1);	0.093245	0.44688	D	0.000425	T	0.33440	0.0863	L	0.28400	0.85	0.53005	D	0.999969	B	0.33777	0.425	B	0.28385	0.089	T	0.12451	-1.0547	10	0.14656	T	0.56	.	15.8226	0.78667	0.0:0.0:1.0:0.0	.	221	Q7Z6Z7	HUWE1_HUMAN	I	221	ENSP00000340648:L221I;ENSP00000262854:L221I;ENSP00000218328:L221I	ENSP00000218328:L221I	L	-	1	2	HUWE1	53675276	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.064000	0.93933	2.247000	0.74100	0.600000	0.82982	CTA	HUWE1	-	pfam_E3_Ub_ligase_DUF908,superfamily_ARM-type_fold	ENSG00000086758		0.383	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	30	0	G	XM_497119		53658551	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	32.50	27	13	SNP	1.000	T
HYDIN	54768	genome.wustl.edu	37	16	71098610	71098610	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:71098610G>T	ENST00000393567.2	-	16	2359	c.2209C>A	c.(2209-2211)Cag>Aag	p.Q737K	HYDIN_ENST00000541601.1_Missense_Mutation_p.Q754K|HYDIN_ENST00000321489.5_Missense_Mutation_p.Q737K|HYDIN_ENST00000448089.2_Missense_Mutation_p.Q737K|HYDIN_ENST00000538248.1_Missense_Mutation_p.Q764K|HYDIN_ENST00000448691.1_Missense_Mutation_p.Q737K	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	737					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.Q737*(3)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				GAACTCACCTGAGGCTGGACC	0.458																																																	3	Substitution - Nonsense(3)	lung(3)											43.0	41.0	42.0					16																	71098610		2197	4299	6496	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.2209C>A	16.37:g.71098610G>T	ENSP00000377197:p.Gln737Lys		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.Q737K	ENST00000393567.2	37	c.2209	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	G	15.55	2.867028	0.51588	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089;ENST00000448691;ENST00000321489;ENST00000538248;ENST00000541601	T;T;T;T;T;T	0.11277	2.79;2.79;2.79;2.79;2.79;2.79	4.8	4.8	0.61643	.	0.000000	0.31872	U	0.006930	T	0.29061	0.0722	M	0.85630	2.765	0.80722	D	1	P;D;D;P	0.61697	0.952;0.99;0.99;0.827	P;P;P;B	0.59825	0.705;0.864;0.864;0.442	T	0.39078	-0.9631	10	0.06099	T	0.92	.	16.6973	0.85339	0.0:0.0:1.0:0.0	.	764;754;737;737	B4DRN4;F5H6V3;Q4G0P3-5;F8WD23	.;.;.;.	K	737;737;737;737;737;764;754	ENSP00000377197:Q737K;ENSP00000398544:Q737K;ENSP00000394826:Q737K;ENSP00000314736:Q737K;ENSP00000444970:Q764K;ENSP00000437341:Q754K	ENSP00000313052:Q737K	Q	-	1	0	HYDIN	69656111	1.000000	0.71417	1.000000	0.80357	0.770000	0.43624	7.490000	0.81461	2.219000	0.72066	0.505000	0.49811	CAG	HYDIN	-	NULL	ENSG00000157423		0.458	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3		0.00	33	0	G			71098610	-1			no_errors	ENST00000448089	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	T
ICA1L	130026	genome.wustl.edu	37	2	203693680	203693680	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:203693680C>T	ENST00000392237.2	-	3	210	c.53G>A	c.(52-54)aGa>aAa	p.R18K	ICA1L_ENST00000425178.1_Missense_Mutation_p.R18K|ICA1L_ENST00000358299.2_Missense_Mutation_p.R18K|ICA1L_ENST00000418208.1_Missense_Mutation_p.R18K	NM_138468.4	NP_612477.3	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like	18								p.R18I(1)		breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTTTTGCATTCTTCTGACTAC	0.383																																																	1	Substitution - Missense(1)	large_intestine(1)											165.0	148.0	154.0					2																	203693680		2203	4300	6503	SO:0001583	missense	0			AB053317	CCDS2354.1, CCDS74632.1	2q33	2008-02-05	2006-05-26	2006-05-26	ENSG00000163596	ENSG00000163596			14442	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14"""	ALS2CR15, ALS2CR14		11586298	Standard	NM_138468		Approved		uc002uzh.1	Q8NDH6	OTTHUMG00000132856	ENST00000392237.2:c.53G>A	2.37:g.203693680C>T	ENSP00000376070:p.Arg18Lys		B3KRW6|Q53P45|Q53QZ4|Q53T97|Q96N47|Q96Q32|Q9BVQ2	Missense_Mutation	SNP	pfam_Islet_autoAg_Ica1_C,pfam_AH_dom,pfscan_AH_dom	p.R18K	ENST00000392237.2	37	c.53	CCDS2354.1	2	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657535	0.47467	.	.	ENSG00000163596	ENST00000392237;ENST00000358299;ENST00000420558;ENST00000425178;ENST00000418208;ENST00000450143;ENST00000435143;ENST00000419460;ENST00000441547;ENST00000412210;ENST00000457524;ENST00000432273;ENST00000416760;ENST00000454326;ENST00000411681;ENST00000421334	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54;-0.54	5.91	5.91	0.95273	Arfaptin-like (1);	0.000000	0.85682	D	0.000000	T	0.42720	0.1215	N	0.03891	-0.335	0.38318	D	0.943432	B;B	0.09022	0.001;0.002	B;B	0.17722	0.006;0.019	T	0.47249	-0.9132	10	0.02654	T	1	.	11.1129	0.48243	0.0:0.9168:0.0:0.0832	.	18;18	Q96Q33;Q8NDH6	.;ICA1L_HUMAN	K	18	ENSP00000376070:R18K;ENSP00000351047:R18K;ENSP00000400249:R18K;ENSP00000404189:R18K;ENSP00000412158:R18K;ENSP00000410747:R18K;ENSP00000405592:R18K;ENSP00000410135:R18K;ENSP00000404618:R18K;ENSP00000387382:R18K;ENSP00000404707:R18K;ENSP00000397827:R18K;ENSP00000392609:R18K;ENSP00000416726:R18K;ENSP00000409741:R18K	ENSP00000351047:R18K	R	-	2	0	ICA1L	203401925	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.133000	0.42093	2.799000	0.96334	0.650000	0.86243	AGA	ICA1L	-	pfam_AH_dom	ENSG00000163596		0.383	ICA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICA1L	HGNC	protein_coding	OTTHUMT00000256330.1	-	0.00	46	0	C	NM_138468		203693680	-1	tier1	-	no_errors	ENST00000358299	ensembl	human	known	74_37	missense	30.00	27	12	SNP	1.000	T
ICAM2	3384	genome.wustl.edu	37	17	62082507	62082507	+	Silent	SNP	G	G	T	rs138843858		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:62082507G>T	ENST00000412356.1	-	4	642	c.288C>A	c.(286-288)tcC>tcA	p.S96S	ICAM2_ENST00000579687.1_Silent_p.S96S|ICAM2_ENST00000449662.2_Silent_p.S96S|ICAM2_ENST00000418105.1_Silent_p.S96S|ICAM2_ENST00000578892.1_Silent_p.S72S|ICAM2_ENST00000581417.1_5'UTR|ICAM2_ENST00000579788.1_Silent_p.S96S|ICAM2_ENST00000578379.1_5'UTR	NM_001099786.1	NP_001093256.1	P13598	ICAM2_HUMAN	intercellular adhesion molecule 2	96	Ig-like C2-type 1.				extracellular matrix organization (GO:0030198)|regulation of immune response (GO:0050776)|single organismal cell-cell adhesion (GO:0016337)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|uropod (GO:0001931)	integrin binding (GO:0005178)			large_intestine(1)|lung(2)|ovary(1)|skin(2)	6						CCTGCTTCCCGGAGCAGGTGA	0.542																																																	0													114.0	81.0	93.0					17																	62082507		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11657.1	17q23.3	2014-01-30			ENSG00000108622	ENSG00000108622		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5345	protein-coding gene	gene with protein product		146630				1769660	Standard	NM_001099786		Approved	CD102	uc002jdx.4	P13598		ENST00000412356.1:c.288C>A	17.37:g.62082507G>T			Q14600	Silent	SNP	pfam_ICAM_N,prints_ICAM_VCAM_N,prints_ICAM	p.S96	ENST00000412356.1	37	c.288	CCDS11657.1	17																																																																																			ICAM2	-	pfam_ICAM_N	ENSG00000108622		0.542	ICAM2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM2	HGNC	protein_coding	OTTHUMT00000443687.1	-	0.00	54	0	G			62082507	-1	tier1	-	no_errors	ENST00000412356	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.000	T
IFNA16	3449	genome.wustl.edu	37	9	21217165	21217165	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:21217165A>C	ENST00000380216.1	-	1	145	c.140T>G	c.(139-141)aTc>aGc	p.I47S		NM_002173.2	NP_002164.1	P05015	IFN16_HUMAN	interferon, alpha 16	47					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	13				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		GAAATGAGAGATTCTTCCCAT	0.507																																																	0													101.0	102.0	102.0					9																	21217165		2203	4300	6503	SO:0001583	missense	0				CCDS34996.1	9p22	2010-12-10			ENSG00000147885	ENSG00000147885		"""Interferons"""	5421	protein-coding gene	gene with protein product		147580				1385305	Standard	NM_002173		Approved	IFN-alphaO	uc003zor.1	P05015	OTTHUMG00000019663	ENST00000380216.1:c.140T>G	9.37:g.21217165A>C	ENSP00000369564:p.Ile47Ser		Q5VV12	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.I47S	ENST00000380216.1	37	c.140	CCDS34996.1	9	.	.	.	.	.	.	.	.	.	.	-	9.422	1.083185	0.20309	.	.	ENSG00000147885	ENST00000380216	T	0.03496	3.91	2.62	0.0963	0.14489	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	1.302160	0.05087	N	0.484575	T	0.09730	0.0239	L	0.56396	1.775	0.09310	N	1	P	0.47350	0.894	P	0.56474	0.799	T	0.25433	-1.0132	10	0.87932	D	0	.	1.6317	0.02734	0.4672:0.0:0.2533:0.2795	.	47	P05015	IFN16_HUMAN	S	47	ENSP00000369564:I47S	ENSP00000369564:I47S	I	-	2	0	IFNA16	21207165	0.000000	0.05858	0.040000	0.18447	0.042000	0.13812	0.033000	0.13754	0.210000	0.20664	0.155000	0.16302	ATC	IFNA16	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core	ENSG00000147885		0.507	IFNA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA16	HGNC	protein_coding	OTTHUMT00000051892.1	-	0.00	70	0	A	NM_002173		21217165	-1	tier1	-	no_errors	ENST00000380216	ensembl	human	known	74_37	missense	38.30	58	36	SNP	0.006	C
IGDCC3	9543	genome.wustl.edu	37	15	65667684	65667684	+	Missense_Mutation	SNP	C	C	T	rs534017016		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:65667684C>T	ENST00000327987.4	-	2	411	c.160G>A	c.(160-162)Gtc>Atc	p.V54I		NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	54	Ig-like C2-type 1.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGCCCGGGGACGGCAACATCA	0.572																																																	0													39.0	32.0	34.0					15																	65667684		2201	4299	6500	SO:0001583	missense	0			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.160G>A	15.37:g.65667684C>T	ENSP00000332773:p.Val54Ile		O95215	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V54I	ENST00000327987.4	37	c.160	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	C	10.59	1.393000	0.25118	.	.	ENSG00000174498	ENST00000327987	T	0.66638	-0.22	5.63	2.75	0.32379	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.450401	0.21035	N	0.081262	T	0.54711	0.1875	L	0.32530	0.975	0.09310	N	0.999999	P	0.52463	0.953	B	0.43990	0.438	T	0.44421	-0.9329	10	0.32370	T	0.25	-18.4398	10.405	0.44252	0.0:0.7883:0.0:0.2117	.	54	Q8IVU1	IGDC3_HUMAN	I	54	ENSP00000332773:V54I	ENSP00000332773:V54I	V	-	1	0	IGDCC3	63454737	0.998000	0.40836	0.000000	0.03702	0.000000	0.00434	3.940000	0.56599	0.330000	0.23485	-0.742000	0.03525	GTC	IGDCC3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000174498		0.572	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	-	0.00	28	0	C	NM_004884		65667684	-1	tier1	-	no_errors	ENST00000327987	ensembl	human	known	74_37	missense	47.06	9	8	SNP	0.131	T
IGSF22	283284	genome.wustl.edu	37	11	18739479	18739479	+	Splice_Site	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:18739479C>T	ENST00000513874.1	-	9	1111	c.972G>A	c.(970-972)ctG>ctA	p.L324L	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	324										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						CACTCATACCCAGCACTGTGA	0.537																																																	0													123.0	125.0	124.0					11																	18739479		2114	4223	6337	SO:0001630	splice_region_variant	0			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.973+1G>A	11.37:g.18739479C>T			A6NNA0|D6RGV7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L324	ENST00000513874.1	37	c.972	CCDS41625.2	11																																																																																			IGSF22	-	smart_Ig_sub	ENSG00000179057		0.537	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000360850.2	-	0.00	55	0	C	NM_173588	Silent	18739479	-1	tier1	-	no_errors	ENST00000513874	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.866	T
IL13RA2	3598	genome.wustl.edu	37	X	114242551	114242551	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:114242551A>C	ENST00000371936.1	-	9	1190	c.941T>G	c.(940-942)aTt>aGt	p.I314S	IL13RA2_ENST00000243213.1_Missense_Mutation_p.I314S			Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2	314	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	23						TGAGCAATAAATATTCACTTT	0.368																																																	0													241.0	203.0	216.0					X																	114242551		2203	4300	6503	SO:0001583	missense	0			X95302	CCDS14565.1	Xq23	2014-01-21			ENSG00000123496	ENSG00000123496		"""Interleukins and interleukin receptors"", ""CD molecules"""	5975	protein-coding gene	gene with protein product	"""cancer/testis antigen 19"""	300130				8663118, 9083087	Standard	NM_000640		Approved	IL-13R, IL13BP, CD213a2, CT19	uc004epx.3	Q14627	OTTHUMG00000022229	ENST00000371936.1:c.941T>G	X.37:g.114242551A>C	ENSP00000361004:p.Ile314Ser		A8K7E2|O00667	Missense_Mutation	SNP	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3	p.I314S	ENST00000371936.1	37	c.941	CCDS14565.1	X	.	.	.	.	.	.	.	.	.	.	a	5.872	0.344996	0.11126	.	.	ENSG00000123496	ENST00000371936;ENST00000243213	T;T	0.68624	-0.34;-0.34	4.1	4.1	0.47936	Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.511199	0.21884	N	0.067697	T	0.48589	0.1508	L	0.35487	1.065	0.37765	D	0.926453	B	0.14438	0.01	B	0.09377	0.004	T	0.40905	-0.9538	10	0.08381	T	0.77	-10.3879	8.5978	0.33725	1.0:0.0:0.0:0.0	.	314	Q14627	I13R2_HUMAN	S	314	ENSP00000361004:I314S;ENSP00000243213:I314S	ENSP00000243213:I314S	I	-	2	0	IL13RA2	114148807	0.987000	0.35691	0.998000	0.56505	0.970000	0.65996	2.446000	0.44908	1.624000	0.50355	0.438000	0.28831	ATT	IL13RA2	-	superfamily_Fibronectin_type3	ENSG00000123496		0.368	IL13RA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL13RA2	HGNC	protein_coding	OTTHUMT00000057966.1	-	0.00	80	0	A	NM_000640		114242551	-1	tier1	-	no_errors	ENST00000243213	ensembl	human	known	74_37	missense	36.90	53	31	SNP	1.000	C
IL27	246778	genome.wustl.edu	37	16	28515212	28515212	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:28515212T>C	ENST00000356897.1	-	2	213	c.191A>G	c.(190-192)cAg>cGg	p.Q64R		NM_145659.3	NP_663634.2	Q8TAD2	IL17D_HUMAN	interleukin 27	0					inflammatory response (GO:0006954)	extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	10						GCGGTGGGCCTGGCCCCGAAC	0.667																																																	0													36.0	39.0	38.0					16																	28515212		2197	4300	6497	SO:0001583	missense	0			AY099296	CCDS10633.1	16p11	2011-07-21	2003-12-17	2003-12-19	ENSG00000197272	ENSG00000197272		"""Interleukins and interleukin receptors"""	19157	protein-coding gene	gene with protein product		608273	"""interleukin 30"""	IL30		12121660	Standard	NM_145659		Approved	IL-27, p28, IL27p28, IL-27A, IL27A, MGC71873	uc002dqc.3	Q8NEV9	OTTHUMG00000097023	ENST00000356897.1:c.191A>G	16.37:g.28515212T>C	ENSP00000349365:p.Gln64Arg		B1AM69	Missense_Mutation	SNP	superfamily_4_helix_cytokine-like_core	p.Q64R	ENST00000356897.1	37	c.191	CCDS10633.1	16	.	.	.	.	.	.	.	.	.	.	T	9.942	1.217821	0.22373	.	.	ENSG00000197272	ENST00000356897	T	0.35236	1.32	4.37	1.93	0.25924	.	1.108720	0.06968	N	0.817512	T	0.29850	0.0746	L	0.42245	1.32	0.09310	N	1	B	0.32160	0.358	B	0.29785	0.107	T	0.27571	-1.0070	10	0.48119	T	0.1	-0.0307	6.559	0.22476	0.5247:0.0:0.0:0.4753	.	64	Q8NEV9	IL27A_HUMAN	R	64	ENSP00000349365:Q64R	ENSP00000349365:Q64R	Q	-	2	0	IL27	28422713	0.850000	0.29656	0.044000	0.18714	0.700000	0.40528	1.433000	0.34947	0.514000	0.28300	0.449000	0.29647	CAG	IL27	-	superfamily_4_helix_cytokine-like_core	ENSG00000197272		0.667	IL27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL27	HGNC	protein_coding	OTTHUMT00000214114.1	-	0.00	16	0	T	NM_145659		28515212	-1	tier1	-	no_errors	ENST00000356897	ensembl	human	known	74_37	missense	31.58	13	6	SNP	0.027	C
ILDR2	387597	genome.wustl.edu	37	1	166892005	166892005	+	Missense_Mutation	SNP	C	C	A	rs141206348		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:166892005C>A	ENST00000271417.3	-	8	1091	c.1036G>T	c.(1036-1038)Gac>Tac	p.D346Y	ILDR2_ENST00000529071.1_Missense_Mutation_p.D327Y|ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000469934.2_Missense_Mutation_p.D346Y|ILDR2_ENST00000528703.1_Missense_Mutation_p.D287Y|ILDR2_ENST00000526687.1_Missense_Mutation_p.D238Y|ILDR2_ENST00000525740.1_Missense_Mutation_p.D219Y	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	346					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						AAATTGCTGTCCTCCTCATGT	0.473																																																	0													147.0	137.0	141.0					1																	166892005		2203	4300	6503	SO:0001583	missense	0			AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1036G>T	1.37:g.166892005C>A	ENSP00000271417:p.Asp346Tyr			Missense_Mutation	SNP	pfam_LISCH7,smart_Ig_sub	p.D346Y	ENST00000271417.3	37	c.1036	CCDS1256.1	1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613709	0.46631	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000469934;ENST00000529071;ENST00000526687;ENST00000528703	T;T;T;T;T;T	0.80480	0.4;-1.38;0.36;0.39;-1.3;-0.28	5.24	4.12	0.48240	.	0.369256	0.30464	N	0.009578	T	0.81370	0.4808	M	0.61703	1.905	0.26208	N	0.979342	D	0.64830	0.994	P	0.60173	0.87	T	0.74266	-0.3721	10	0.87932	D	0	.	12.9686	0.58499	0.0:0.9106:0.0:0.0894	.	346	Q71H61	ILDR2_HUMAN	Y	346;219;346;327;238;287	ENSP00000271417:D346Y;ENSP00000436120:D219Y;ENSP00000437008:D346Y;ENSP00000436882:D327Y;ENSP00000434273:D238Y;ENSP00000432750:D287Y	ENSP00000271417:D346Y	D	-	1	0	ILDR2	165158629	0.993000	0.37304	0.905000	0.35620	0.980000	0.70556	3.896000	0.56266	2.427000	0.82271	0.561000	0.74099	GAC	ILDR2	-	NULL	ENSG00000143195		0.473	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILDR2	HGNC	protein_coding	OTTHUMT00000082880.2	-	0.00	32	0	C	NM_199351		166892005	-1	tier1	-	no_errors	ENST00000271417	ensembl	human	known	74_37	missense	51.85	26	28	SNP	0.364	A
ING5	84289	genome.wustl.edu	37	2	242659480	242659480	+	Intron	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:242659480G>T	ENST00000313552.6	+	6	508				ING5_ENST00000482774.1_3'UTR|ING5_ENST00000406941.1_Intron	NM_032329.4	NP_115705.2	Q8WYH8	ING5_HUMAN	inhibitor of growth family, member 5						chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|skin(1)	3		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.16e-33)|all cancers(36;4.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		AAGGCGCCAAGGAGGCCCCTT	0.652																																																	0																																										SO:0001627	intron_variant	0			AF189286	CCDS33425.1	2q37.3	2013-01-28			ENSG00000168395	ENSG00000168395		"""Zinc fingers, PHD-type"""	19421	protein-coding gene	gene with protein product		608525				12750254	Standard	NM_032329		Approved	FLJ23842, p28ING5	uc002wcd.3	Q8WYH8	OTTHUMG00000151501	ENST00000313552.6:c.483-2874G>T	2.37:g.242659480G>T			A8K1P3|Q53NU6|Q57Z54|Q9BS30	RNA	SNP	-	NULL	ENST00000313552.6	37	NULL	CCDS33425.1	2																																																																																			ING5	-	-	ENSG00000168395		0.652	ING5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ING5	HGNC	protein_coding	OTTHUMT00000322901.3	-	0.00	45	0	G	NM_032329		242659480	+1	tier1	-	no_errors	ENST00000482774	ensembl	human	known	74_37	rna	8.51	43	4	SNP	0.001	T
INPP5B	3633	genome.wustl.edu	37	1	38406367	38406367	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:38406367G>T	ENST00000373026.1	-	5	384	c.384C>A	c.(382-384)gcC>gcA	p.A128A	INPP5B_ENST00000373024.3_Silent_p.A128A|INPP5B_ENST00000373021.1_Silent_p.A128A|INPP5B_ENST00000373023.2_Silent_p.A128A			P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	128	PH.				in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol dephosphorylation (GO:0046856)|regulation of protein processing (GO:0070613)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	inositol-1,4,5-trisphosphate 5-phosphatase activity (GO:0052658)|metal ion binding (GO:0046872)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)			breast(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(9)|urinary_tract(1)	15	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TACCTGGACAGGCCCTGGCAA	0.577																																																	0													90.0	88.0	88.0					1																	38406367		1939	4138	6077	SO:0001819	synonymous_variant	0			M74161	CCDS41306.1, CCDS72760.1	1p34	2008-02-05	2002-08-29		ENSG00000204084	ENSG00000204084	3.1.3.56		6077	protein-coding gene	gene with protein product		147264	"""inositol polyphosphate-5-phosphatase, 75kD"""			1718960	Standard	NM_005540		Approved		uc001ccg.1	P32019	OTTHUMG00000004436	ENST00000373026.1:c.384C>A	1.37:g.38406367G>T			C9J6U5|Q5VSG9|Q5VSH0|Q5VSH1|Q658Q5|Q6P6D4|Q6PD53|Q86YE1	Silent	SNP	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.A128	ENST00000373026.1	37	c.384		1																																																																																			INPP5B	-	NULL	ENSG00000204084		0.577	INPP5B-003	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	INPP5B	HGNC	protein_coding	OTTHUMT00000012968.1	-	0.00	38	0	G	NM_005540		38406367	-1	tier1	-	no_errors	ENST00000373023	ensembl	human	known	74_37	silent	8.16	45	4	SNP	0.996	T
INPP5F	22876	genome.wustl.edu	37	10	121580378	121580378	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:121580378G>T	ENST00000361976.2	+	16	2073	c.1907G>T	c.(1906-1908)aGa>aTa	p.R636I	INPP5F_ENST00000490818.1_3'UTR|INPP5F_ENST00000369080.3_Missense_Mutation_p.R26I	NM_014937.3	NP_055752.1	Q01968	OCRL_HUMAN	inositol polyphosphate-5-phosphatase F	0	ASH.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(9)|lung(5)|ovary(5)|pancreas(1)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.00205)|BRCA - Breast invasive adenocarcinoma(275;0.158)		GCTACTCACAGAGACGTGGAT	0.363																																																	0													229.0	207.0	214.0					10																	121580378		2203	4300	6503	SO:0001583	missense	0			AB023183	CCDS7616.1, CCDS58098.1	10q26.13	2009-02-03			ENSG00000198825	ENSG00000198825			17054	protein-coding gene	gene with protein product		609389				10231032, 11274189	Standard	NM_014937		Approved	SAC2, KIAA0966, hSac2	uc001leo.3	Q9Y2H2	OTTHUMG00000019158	ENST00000361976.2:c.1907G>T	10.37:g.121580378G>T	ENSP00000354519:p.Arg636Ile		A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	pfam_Syja_N,pfam_Inositol_phosphatase,pfscan_Syja_N	p.R636I	ENST00000361976.2	37	c.1907	CCDS7616.1	10	.	.	.	.	.	.	.	.	.	.	G	16.30	3.085310	0.55861	.	.	ENSG00000198825	ENST00000361976;ENST00000369080	T;T	0.45668	1.14;0.89	5.68	4.67	0.58626	.	0.050241	0.85682	D	0.000000	T	0.34890	0.0913	N	0.22421	0.69	0.80722	D	1	P;P	0.51147	0.942;0.523	P;B	0.51516	0.672;0.141	T	0.03807	-1.1002	10	0.37606	T	0.19	-15.5468	6.8387	0.23951	0.1992:0.0:0.8008:0.0	.	26;636	Q5W135;Q9Y2H2	.;SAC2_HUMAN	I	636;26	ENSP00000354519:R636I;ENSP00000358076:R26I	ENSP00000354519:R636I	R	+	2	0	INPP5F	121570368	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.819000	0.55686	2.675000	0.91044	0.467000	0.42956	AGA	INPP5F	-	pfam_Inositol_phosphatase	ENSG00000198825		0.363	INPP5F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPP5F	HGNC	protein_coding	OTTHUMT00000050679.1	-	0.00	40	0	G	NM_014937		121580378	+1	tier1	-	no_errors	ENST00000361976	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
INTS6	26512	genome.wustl.edu	37	13	51963521	51963521	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr13:51963521G>T	ENST00000311234.4	-	6	1145	c.673C>A	c.(673-675)Cag>Aag	p.Q225K	INTS6_ENST00000463928.1_Missense_Mutation_p.Q225K|INTS6_ENST00000398119.2_Missense_Mutation_p.Q212K|INTS6_ENST00000497989.1_Missense_Mutation_p.Q47K|INTS6_ENST00000420668.2_Nonsense_Mutation_p.C163*|INTS6_ENST00000425000.1_5'UTR	NM_012141.2	NP_036273.1	Q9UL03	INT6_HUMAN	integrator complex subunit 6	225	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				signal transduction (GO:0007165)|snRNA processing (GO:0016180)	actin cytoskeleton (GO:0015629)|integrator complex (GO:0032039)|nucleus (GO:0005634)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Breast(56;0.000286)|Lung NSC(96;0.00145)|Prostate(109;0.00403)|Hepatocellular(98;0.065)|Myeloproliferative disorder(33;0.163)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;7.7e-08)		TGTACTTTCTGCACCAAGGAC	0.373																																																	0													157.0	156.0	157.0					13																	51963521		2203	4300	6503	SO:0001583	missense	0			AF097645	CCDS9428.1, CCDS41890.1, CCDS45048.1	13q14.3	2010-08-20	2006-03-15	2006-03-15	ENSG00000102786	ENSG00000102786		"""DEAD-boxes"""	14879	protein-coding gene	gene with protein product		604331	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26"""	DDX26		10467397, 16239144	Standard	XM_005266340		Approved	DICE1, HDB, Notchl2, DBI-1, DDX26A, INT6	uc001vfk.3	Q9UL03	OTTHUMG00000016945	ENST00000311234.4:c.673C>A	13.37:g.51963521G>T	ENSP00000310260:p.Gln225Lys		Q0P664|Q6PJP4|Q9UFK0|Q9Y5M9	Nonsense_Mutation	SNP	pfam_VWF_A,pfscan_VWF_A	p.C163*	ENST00000311234.4	37	c.489	CCDS9428.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	33|33	5.277000|5.277000	0.95459|0.95459	.|.	.|.	ENSG00000102786|ENSG00000102786	ENST00000420668|ENST00000311234;ENST00000398119;ENST00000497989	.|.	.|.	.|.	5.33|5.33	5.33|5.33	0.75918|0.75918	.|von Willebrand factor, type A (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.82779	.|0.5111	M|M	0.85630|0.85630	2.765|2.765	0.80722|0.80722	D|D	1|1	.|D	.|0.63880	.|0.993	.|D	.|0.64506	.|0.926	.|T	.|0.83111	.|-0.0123	.|9	0.46703|0.41790	T|T	0.11|0.15	-8.0824|-8.0824	18.3667|18.3667	0.90392|0.90392	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|225	.|Q9UL03	.|INT6_HUMAN	X|K	163|225;212;47	.|.	ENSP00000388585:C163X|ENSP00000310260:Q225K	C|Q	-|-	3|1	2|0	INTS6|INTS6	50861522|50861522	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.779000|9.779000	0.99018|0.99018	2.652000|2.652000	0.90054|0.90054	0.563000|0.563000	0.77884|0.77884	TGC|CAG	INTS6	-	NULL	ENSG00000102786		0.373	INTS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS6	HGNC	protein_coding	OTTHUMT00000045023.1	-	0.00	36	0	G	NM_012141		51963521	-1	tier1	-	no_errors	ENST00000420668	ensembl	human	known	74_37	nonsense	7.84	47	4	SNP	1.000	T
IPO8	10526	genome.wustl.edu	37	12	30787065	30787065	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:30787065G>T	ENST00000256079.4	-	23	3189	c.2851C>A	c.(2851-2853)Ctt>Att	p.L951I	IPO8_ENST00000544829.1_Missense_Mutation_p.L746I	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	951					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CTATTGTCAAGGTCAAGTGGA	0.388																																																	0													200.0	158.0	172.0					12																	30787065		2203	4300	6503	SO:0001583	missense	0			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.2851C>A	12.37:g.30787065G>T	ENSP00000256079:p.Leu951Ile		B7Z7M3	Missense_Mutation	SNP	pfam_Importin-beta_N,pfam_Cse1,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.L951I	ENST00000256079.4	37	c.2851	CCDS8719.1	12	.	.	.	.	.	.	.	.	.	.	G	11.70	1.718030	0.30503	.	.	ENSG00000133704	ENST00000256079;ENST00000545286;ENST00000544829	T;T	0.65549	-0.16;-0.16	5.22	4.32	0.51571	Armadillo-type fold (1);	0.274624	0.37136	N	0.002226	T	0.42832	0.1220	N	0.22421	0.69	0.29232	N	0.873201	B;B;B	0.29716	0.243;0.255;0.243	B;B;B	0.25987	0.065;0.057;0.065	T	0.34079	-0.9843	10	0.25106	T	0.35	-18.0004	8.4321	0.32764	0.2345:0.0:0.7655:0.0	.	746;427;951	B7Z7M3;Q59F59;O15397	.;.;IPO8_HUMAN	I	951;427;746	ENSP00000256079:L951I;ENSP00000444520:L746I	ENSP00000256079:L951I	L	-	1	0	IPO8	30678332	1.000000	0.71417	0.994000	0.49952	0.687000	0.40016	4.409000	0.59768	1.315000	0.45114	0.655000	0.94253	CTT	IPO8	-	superfamily_ARM-type_fold	ENSG00000133704		0.388	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO8	HGNC	protein_coding	OTTHUMT00000402700.2		0.00	47	0	G	NM_006390		30787065	-1			no_errors	ENST00000256079	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.998	T
IQSEC2	23096	genome.wustl.edu	37	X	53263497	53263497	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:53263497G>A	ENST00000375368.5	-	14	4541	c.4341C>T	c.(4339-4341)ccC>ccT	p.P1447P	IQSEC2_ENST00000396435.3_Silent_p.P1457P|IQSEC2_ENST00000375365.2_3'UTR			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1447	Pro-rich.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						GCGGGCCATggggggaggtgg	0.677																																																	0													1.0	1.0	1.0					X																	53263497		226	486	712	SO:0001819	synonymous_variant	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.4341C>T	X.37:g.53263497G>A			B3KT97|C7SDG1|O60275|Q5JUX1	Silent	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_P-loop_NTPase,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7_dom	p.P1457	ENST00000375368.5	37	c.4371		X																																																																																			IQSEC2	-	NULL	ENSG00000124313		0.677	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		-	0.00	8	0	G	XM_291345		53263497	-1	tier1	-	no_errors	ENST00000396435	ensembl	human	known	74_37	silent	57.14	6	8	SNP	0.993	A
ITGA10	8515	genome.wustl.edu	37	1	145539689	145539689	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:145539689A>G	ENST00000369304.3	+	27	3296	c.3121A>G	c.(3121-3123)Agc>Ggc	p.S1041G	RP11-315I20.3_ENST00000415065.2_RNA|ITGA10_ENST00000538811.1_Missense_Mutation_p.S910G|ITGA10_ENST00000539363.1_Missense_Mutation_p.S898G	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	1041					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTAGAATGGGAGCAATACTCA	0.502																																																	0													83.0	82.0	82.0					1																	145539689		2203	4300	6503	SO:0001583	missense	0			AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.3121A>G	1.37:g.145539689A>G	ENSP00000358310:p.Ser1041Gly		B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.S1041G	ENST00000369304.3	37	c.3121	CCDS918.1	1	.	.	.	.	.	.	.	.	.	.	A	19.57	3.852034	0.71719	.	.	ENSG00000143127	ENST00000369304;ENST00000539363;ENST00000538811	T;T;T	0.46451	0.87;0.87;0.87	5.06	5.06	0.68205	.	0.103686	0.64402	D	0.000005	T	0.39911	0.1096	M	0.62723	1.935	0.48762	D	0.999701	P;B;P	0.49447	0.778;0.389;0.924	B;B;P	0.50109	0.399;0.25;0.631	T	0.43015	-0.9417	10	0.66056	D	0.02	.	12.8233	0.57707	1.0:0.0:0.0:0.0	.	910;898;1041	F5GY13;B2RTV5;O75578	.;.;ITA10_HUMAN	G	1041;898;910	ENSP00000358310:S1041G;ENSP00000439894:S898G;ENSP00000440011:S910G	ENSP00000358310:S1041G	S	+	1	0	ITGA10	144251046	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	5.475000	0.66787	2.130000	0.65690	0.460000	0.39030	AGC	ITGA10	-	NULL	ENSG00000143127		0.502	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA10	HGNC	protein_coding	OTTHUMT00000038537.2	-	0.00	25	0	A	NM_003637		145539689	+1	tier1	-	no_errors	ENST00000369304	ensembl	human	known	74_37	missense	54.84	14	17	SNP	1.000	G
ITGB4	3691	genome.wustl.edu	37	17	73736505	73736505	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:73736505G>A	ENST00000200181.3	+	21	2700	c.2513G>A	c.(2512-2514)cGg>cAg	p.R838Q	ITGB4_ENST00000449880.2_Missense_Mutation_p.R838Q|ITGB4_ENST00000339591.3_Missense_Mutation_p.R838Q|ITGB4_ENST00000450894.3_Missense_Mutation_p.R838Q|ITGB4_ENST00000579662.1_Missense_Mutation_p.R838Q|ITGB4_ENST00000584558.1_3'UTR	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	838					amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCTGACACTCGGGAGTGCGCC	0.657																																																	0													52.0	50.0	50.0					17																	73736505		2203	4300	6503	SO:0001583	missense	0				CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.2513G>A	17.37:g.73736505G>A	ENSP00000200181:p.Arg838Gln		A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Missense_Mutation	SNP	pirsf_Integrin_bsu-4,pfam_Integrin_bsu_N,pfam_Fibronectin_type3,pfam_Calx_beta,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Fibronectin_type3,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,smart_Calx_beta,smart_Fibronectin_type3,prints_Integrin_bsu,pfscan_Fibronectin_type3	p.R838Q	ENST00000200181.3	37	c.2513	CCDS11727.1	17	.	.	.	.	.	.	.	.	.	.	G	10.82	1.457608	0.26161	.	.	ENSG00000132470	ENST00000200181;ENST00000339591;ENST00000449880	T;T;T	0.77358	-1.09;-1.02;-1.02	4.95	4.95	0.65309	.	0.243929	0.32372	N	0.006182	D	0.83161	0.5194	L	0.32530	0.975	0.48632	D	0.999682	D;P;D;B	0.89917	1.0;0.925;1.0;0.369	D;P;D;B	0.87578	0.998;0.517;0.951;0.042	D	0.84998	0.0898	10	0.59425	D	0.04	.	18.1801	0.89775	0.0:0.0:1.0:0.0	.	838;838;838;838	P16144-5;P16144-3;A0AVL6;P16144	.;.;.;ITB4_HUMAN	Q	838	ENSP00000200181:R838Q;ENSP00000344079:R838Q;ENSP00000400217:R838Q	ENSP00000200181:R838Q	R	+	2	0	ITGB4	71248100	0.962000	0.33011	0.899000	0.35326	0.064000	0.16182	3.017000	0.49615	2.293000	0.77203	0.448000	0.29417	CGG	ITGB4	-	pirsf_Integrin_bsu-4	ENSG00000132470		0.657	ITGB4-001	KNOWN	basic|CCDS	protein_coding	ITGB4	HGNC	protein_coding	OTTHUMT00000448334.1	-	0.00	32	0	G			73736505	+1	tier1	-	no_errors	ENST00000200181	ensembl	human	known	74_37	missense	62.07	11	18	SNP	0.997	A
ITSN2	50618	genome.wustl.edu	37	2	24432863	24432863	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:24432863G>T	ENST00000355123.4	-	35	4740	c.4297C>A	c.(4297-4299)Cgg>Agg	p.R1433R	ITSN2_ENST00000361999.3_Silent_p.R1406R	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	1433					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAGAGCTTCCGGGGCCCCAGG	0.448																																																	0													131.0	129.0	130.0					2																	24432863		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.4297C>A	2.37:g.24432863G>T			O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_dom,superfamily_DH-domain,superfamily_C2_dom,superfamily_SH3_domain,smart_EPS15_homology,smart_EF_hand_dom,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_dom,pfscan_EF_hand_dom,pfscan_EPS15_homology,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.R1433	ENST00000355123.4	37	c.4297	CCDS1710.2	2																																																																																			ITSN2	-	NULL	ENSG00000198399		0.448	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	HGNC	protein_coding	OTTHUMT00000207620.2		0.00	49	0	G	NM_006277		24432863	-1			no_errors	ENST00000355123	ensembl	human	known	74_37	silent	5.56	50	3	SNP	1.000	T
IZUMO3	100129669	genome.wustl.edu	37	9	24543261	24543261	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:24543261T>C	ENST00000543880.2	-	7	917	c.686A>G	c.(685-687)gAg>gGg	p.E229G	RP11-20A20.2_ENST00000602851.1_lincRNA|IZUMO3_ENST00000604921.1_Missense_Mutation_p.E223G			Q5VZ72	IZUM3_HUMAN	IZUMO family member 3	229						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)										CTCCTCCTTCTCATCTATCTT	0.368																																																	0																																										SO:0001583	missense	0				CCDS65020.1	9p21.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000205442	ENSG00000205442		"""-"""	31421	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 134"""	C9orf134		19658160, 22957301	Standard	NM_001271706		Approved	bA20A20.1	uc031tdg.1	Q5VZ72	OTTHUMG00000019704	ENST00000543880.2:c.686A>G	9.37:g.24543261T>C	ENSP00000438895:p.Glu229Gly			Missense_Mutation	SNP	NULL	p.E229G	ENST00000543880.2	37	c.686		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.03|11.03	1.520398|1.520398	0.27211|0.27211	.|.	.|.	ENSG00000205442|ENSG00000205442	ENST00000543880|ENST00000412335	T|.	0.12361|.	2.69|.	4.61|4.61	0.987|0.987	0.19790|0.19790	.|.	1.136700|.	0.06681|.	N|.	0.767909|.	T|.	0.39200|.	0.1069|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.44742|.	-0.9308|.	6|.	0.59425|.	D|.	0.04|.	-27.5141|-27.5141	6.2705|6.2705	0.20951|0.20951	0.0:0.3078:0.0:0.6922|0.0:0.3078:0.0:0.6922	.|.	.|.	.|.	.|.	G|W	229|161	ENSP00000438895:E229G|.	ENSP00000438895:E229G|.	E|X	-|-	2|3	0|0	IZUMO3|IZUMO3	24533261|24533261	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	0.114000|0.114000	0.15520|0.15520	0.068000|0.068000	0.16574|0.16574	-0.256000|-0.256000	0.11100|0.11100	GAG|TGA	IZUMO3	-	NULL	ENSG00000205442		0.368	IZUMO3-001	NOVEL	not_organism_supported|basic	protein_coding	IZUMO3	HGNC	protein_coding	OTTHUMT00000467652.1	-	0.00	26	0	T	NM_001271706		24543261	-1	tier1	-	no_errors	ENST00000543880	ensembl	human	novel	74_37	missense	37.04	34	20	SNP	0.000	C
JAG2	3714	genome.wustl.edu	37	14	105622219	105622219	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:105622219G>A	ENST00000331782.3	-	4	986	c.583C>T	c.(583-585)Cgc>Tgc	p.R195C	RP11-44N21.4_ENST00000548203.1_RNA|JAG2_ENST00000347004.2_Missense_Mutation_p.R195C	NM_002226.4	NP_002217.3	Q9Y219	JAG2_HUMAN	jagged 2	195					auditory receptor cell fate commitment (GO:0009912)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|epithelial cell apoptotic process involved in palatal shelf morphogenesis (GO:1990134)|gamma-delta T cell differentiation (GO:0042492)|in utero embryonic development (GO:0001701)|morphogenesis of embryonic epithelium (GO:0016331)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|respiratory system process (GO:0003016)|skeletal system development (GO:0001501)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|thymic T cell selection (GO:0045061)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|growth factor activity (GO:0008083)|Notch binding (GO:0005112)			breast(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(7)|prostate(2)|skin(5)	22		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CAGCGCACGCGGATCTGCAGC	0.627																																																	0													61.0	44.0	50.0					14																	105622219		2196	4298	6494	SO:0001583	missense	0			AF020201	CCDS9998.1, CCDS9999.1	14q32	2008-08-01			ENSG00000184916	ENSG00000184916			6189	protein-coding gene	gene with protein product		602570				9315665, 10662552	Standard	NM_002226		Approved		uc001yqg.4	Q9Y219	OTTHUMG00000140172	ENST00000331782.3:c.583C>T	14.37:g.105622219G>A	ENSP00000328169:p.Arg195Cys		Q9UE17|Q9UE99|Q9UNK8|Q9Y6P9|Q9Y6Q0	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Notch_ligand_N,pfam_DSL,pfam_EGF_extracell,pfam_EGF-like_Ca-bd_dom,smart_DSL,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_VWC_out,smart_VWF_C,pfscan_DSL,pfscan_EG-like_dom,pfscan_VWF_C	p.R195C	ENST00000331782.3	37	c.583	CCDS9998.1	14	.	.	.	.	.	.	.	.	.	.	G	19.69	3.875022	0.72180	.	.	ENSG00000184916	ENST00000331782;ENST00000347004	D;D	0.97016	-4.21;-4.21	4.18	4.18	0.49190	Delta/Serrate/lag-2 (DSL) protein (2);	0.000000	0.64402	U	0.000001	D	0.98419	0.9474	H	0.95402	3.665	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98771	1.0728	10	0.87932	D	0	.	9.8707	0.41172	0.0:0.0:0.6632:0.3368	.	195;195	Q9Y219-2;Q9Y219	.;JAG2_HUMAN	C	195	ENSP00000328169:R195C;ENSP00000328566:R195C	ENSP00000328169:R195C	R	-	1	0	JAG2	104693264	0.286000	0.24305	0.963000	0.40424	0.897000	0.52465	0.496000	0.22499	1.864000	0.54056	0.563000	0.77884	CGC	JAG2	-	pfam_DSL,smart_DSL	ENSG00000184916		0.627	JAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAG2	HGNC	protein_coding	OTTHUMT00000276506.2	-	0.00	32	0	G			105622219	-1	tier1	-	no_errors	ENST00000331782	ensembl	human	known	74_37	missense	50.00	10	10	SNP	0.998	A
JSRP1	126306	genome.wustl.edu	37	19	2255274	2255274	+	Missense_Mutation	SNP	C	C	T	rs150323105		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:2255274C>T	ENST00000300961.6	-	2	104	c.40G>A	c.(40-42)Ggc>Agc	p.G14S	JSRP1_ENST00000586471.2_Missense_Mutation_p.G14S	NM_144616.3	NP_653217.1	Q96MG2	JSPR1_HUMAN	junctional sarcoplasmic reticulum protein 1	14	Mediates interaction with CACNA1S. {ECO:0000250}.				protein localization to membrane (GO:0072657)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|skeletal muscle contraction (GO:0003009)	membrane (GO:0016020)|sarcoplasmic reticulum (GO:0016529)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|pancreas(1)|urinary_tract(1)	6				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCCCAGGCCGCCATCCAGC	0.672													C|||	1	0.000199681	0.0	0.0	5008	,	,		14833	0.001		0.0	False		,,,				2504	0.0																0								C	SER/GLY	0,4400		0,0,2200	29.0	35.0	33.0		40	4.0	0.9	19	dbSNP_134	33	1,8595	1.2+/-3.3	0,1,4297	no	missense	JSRP1	NM_144616.3	56	0,1,6497	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	14/332	2255274	1,12995	2200	4298	6498	SO:0001583	missense	0			AK056978	CCDS12086.1	19p13.3	2010-03-23			ENSG00000167476	ENSG00000167476			24963	protein-coding gene	gene with protein product	"""homolog of mouse skeletal muscle sarcoplasmic reticulum protein JP-45"""	608743				12871958	Standard	NM_144616		Approved	JP-45, FLJ32416	uc002lvj.2	Q96MG2		ENST00000300961.6:c.40G>A	19.37:g.2255274C>T	ENSP00000300961:p.Gly14Ser			Missense_Mutation	SNP	NULL	p.G14S	ENST00000300961.6	37	c.40	CCDS12086.1	19	.	.	.	.	.	.	.	.	.	.	C	17.22	3.333667	0.60853	0.0	1.16E-4	ENSG00000167476	ENST00000300961	T	0.43688	0.94	4.0	4.0	0.46444	.	0.000000	0.36002	N	0.002842	T	0.50616	0.1626	L	0.32530	0.975	0.28752	N	0.901388	D	0.89917	1.0	D	0.91635	0.999	T	0.41840	-0.9486	10	0.51188	T	0.08	-8.3628	11.7902	0.52065	0.0:1.0:0.0:0.0	.	14	Q96MG2	JSPR1_HUMAN	S	14	ENSP00000300961:G14S	ENSP00000300961:G14S	G	-	1	0	JSRP1	2206274	0.848000	0.29623	0.926000	0.36857	0.301000	0.27625	1.584000	0.36589	2.218000	0.71995	0.561000	0.74099	GGC	JSRP1	-	NULL	ENSG00000167476		0.672	JSRP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	JSRP1	HGNC	protein_coding	OTTHUMT00000451266.2	-	0.00	56	0	C	NM_144616		2255274	-1	tier1	rs150323105	no_errors	ENST00000300961	ensembl	human	known	74_37	missense	29.73	52	22	SNP	0.947	T
KBTBD3	143879	genome.wustl.edu	37	11	105923578	105923578	+	Nonstop_Mutation	SNP	C	C	G	rs371541115		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:105923578C>G	ENST00000526793.1	-	3	1997	c.1838G>C	c.(1837-1839)tGa>tCa	p.*613S	KBTBD3_ENST00000531837.1_Nonstop_Mutation_p.*613S|KBTBD3_ENST00000534815.1_Nonstop_Mutation_p.*534S	NM_152433.3	NP_689646.2	Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	0										NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		TTAGAATGTTCAAGCACATAG	0.323																																																	0								C	SER/stop,SER/stop	1,4401	2.1+/-5.4	0,1,2200	64.0	67.0	66.0		1838,1838	2.2	0.0	11		66	0,8596		0,0,4298	no	stop-lost,stop-lost	KBTBD3	NM_152433.3,NM_198439.2	,	0,1,6498	GG,GC,CC		0.0,0.0227,0.0077	,	613/613,613/613	105923578	1,12997	2201	4298	6499	SO:0001578	stop_lost	0			AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000526793.1:c.1838G>C	11.37:g.105923578C>G			Q6N066|Q86X38|Q96NK5	Nonstop_Mutation	SNP	pfam_BACK,pfam_BTB_POZ,pfam_Kelch_1,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.*613S	ENST00000526793.1	37	c.1838	CCDS8334.1	11	.	.	.	.	.	.	.	.	.	.	C	1.326	-0.598121	0.03744	2.27E-4	0.0	ENSG00000182359	ENST00000534815;ENST00000526793;ENST00000531837	.	.	.	5.34	2.16	0.27623	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.5643	0.22503	0.0:0.6197:0.0:0.3803	.	.	.	.	S	534;613;613	.	.	X	-	2	2	KBTBD3	105428788	0.036000	0.19791	0.003000	0.11579	0.342000	0.28953	0.930000	0.28858	0.249000	0.21456	0.586000	0.80456	TGA	KBTBD3	-	NULL	ENSG00000182359		0.323	KBTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD3	HGNC	protein_coding	OTTHUMT00000388705.2	-	0.00	23	0	C	NM_152433		105923578	-1	tier1	-	no_errors	ENST00000526793	ensembl	human	known	74_37	nonstop	38.71	19	12	SNP	0.005	G
KCNJ12	3768	genome.wustl.edu	37	17	21319673	21319673	+	Missense_Mutation	SNP	T	T	G	rs373244146		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:21319673T>G	ENST00000583088.1	+	3	1914	c.1019T>G	c.(1018-1020)aTt>aGt	p.I340S	KCNJ12_ENST00000331718.5_Missense_Mutation_p.I340S	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	340					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	CAGTACAAGATTGACTACTCG	0.587										Prostate(3;0.18)																																							0													159.0	158.0	158.0					17																	21319673		2203	4300	6503	SO:0001583	missense	0			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.1019T>G	17.37:g.21319673T>G	ENSP00000463778:p.Ile340Ser		O43401|Q15756|Q8NG63	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	p.I340S	ENST00000583088.1	37	c.1019	CCDS11219.1	17	.	.	.	.	.	.	.	.	.	.	T	21.0	4.078933	0.76528	.	.	ENSG00000184185	ENST00000331718	D	0.93019	-3.15	5.76	5.76	0.90799	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.060724	0.64402	D	0.000005	D	0.94162	0.8127	M	0.64170	1.965	0.51482	D	0.999927	P	0.39131	0.661	P	0.46975	0.533	D	0.94581	0.7779	10	0.87932	D	0	.	16.0796	0.80995	0.0:0.0:0.0:1.0	.	340	Q14500	IRK12_HUMAN	S	340	ENSP00000328150:I340S	ENSP00000328150:I340S	I	+	2	0	KCNJ12	21260266	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	7.905000	0.87416	2.206000	0.71126	0.533000	0.62120	ATT	KCNJ12	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	ENSG00000184185		0.587	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	HGNC	protein_coding	OTTHUMT00000255060.2	-	0.00	66	0	T	NM_021012		21319673	+1	tier1	-	no_errors	ENST00000331718	ensembl	human	known	74_37	missense	8.64	74	7	SNP	1.000	G
KCNJ9	3765	genome.wustl.edu	37	1	160054260	160054260	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:160054260C>T	ENST00000368088.3	+	2	682	c.440C>T	c.(439-441)tCc>tTc	p.S147F		NM_004983.2	NP_004974.2	Q92806	KCNJ9_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 9	147					synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein activated inward rectifier potassium channel activity (GO:0015467)			biliary_tract(1)|endometrium(3)|large_intestine(3)|liver(1)|lung(5)|ovary(1)|skin(2)	16	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ATCCTGGGCTCCATGGTGAAC	0.647																																																	0													46.0	42.0	43.0					1																	160054260		2203	4300	6503	SO:0001583	missense	0			U52152	CCDS1194.1	1q23.2	2011-07-05			ENSG00000162728	ENSG00000162728		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6270	protein-coding gene	gene with protein product		600932				8575783, 16382105	Standard	NM_004983		Approved	Kir3.3, GIRK3	uc001fuy.1	Q92806	OTTHUMG00000024072	ENST00000368088.3:c.440C>T	1.37:g.160054260C>T	ENSP00000357067:p.Ser147Phe		Q5JW75	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir3.3	p.S147F	ENST00000368088.3	37	c.440	CCDS1194.1	1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648001	0.67358	.	.	ENSG00000162728	ENST00000368088	D	0.95788	-3.81	4.6	3.61	0.41365	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.144439	0.47455	D	0.000222	D	0.96809	0.8958	M	0.78456	2.415	0.58432	D	0.99999	D	0.76494	0.999	D	0.73380	0.98	D	0.97039	0.9756	10	0.72032	D	0.01	.	12.9955	0.58644	0.0:0.8362:0.1638:0.0	.	147	Q92806	IRK9_HUMAN	F	147	ENSP00000357067:S147F	ENSP00000357067:S147F	S	+	2	0	KCNJ9	158320884	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.915000	0.69973	2.103000	0.63969	0.555000	0.69702	TCC	KCNJ9	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000162728		0.647	KCNJ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ9	HGNC	protein_coding	OTTHUMT00000060628.1	-	0.00	46	0	C	NM_004983		160054260	+1	tier1	-	no_errors	ENST00000368088	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
KIAA0319	9856	genome.wustl.edu	37	6	24547478	24547478	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:24547478T>A	ENST00000378214.3	-	21	3658	c.3134A>T	c.(3133-3135)aAg>aTg	p.K1045M	KIAA0319_ENST00000430948.2_Missense_Mutation_p.K1000M|KIAA0319_ENST00000535378.1_Missense_Mutation_p.K1036M|KIAA0319_ENST00000537886.1_Missense_Mutation_p.K984M|KIAA0319_ENST00000543707.1_Missense_Mutation_p.K1045M	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	1045					negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						TCTCTCCATCTTTTCTCGGCT	0.468																																																	0													191.0	178.0	183.0					6																	24547478		2203	4300	6503	SO:0001583	missense	0			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.3134A>T	6.37:g.24547478T>A	ENSP00000367459:p.Lys1045Met		A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_MANSC_N,smart_Fibronectin_type3,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.K1045M	ENST00000378214.3	37	c.3134	CCDS34348.1	6	.	.	.	.	.	.	.	.	.	.	T	13.39	2.221930	0.39300	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.08807	3.12;3.05;3.06;3.05;3.05	3.9	1.9	0.25705	.	0.330140	0.24539	N	0.037649	T	0.02929	0.0087	N	0.08118	0	0.09310	N	1	D;P;P	0.60575	0.988;0.955;0.924	P;P;P	0.56514	0.708;0.8;0.514	T	0.36578	-0.9742	10	0.59425	D	0.04	-9.6765	7.0762	0.25205	0.0:0.4872:0.0:0.5128	.	984;1036;1045	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	M	984;1036;1000;1045;1045	ENSP00000439700:K984M;ENSP00000442403:K1036M;ENSP00000401086:K1000M;ENSP00000367459:K1045M;ENSP00000437656:K1045M	ENSP00000367459:K1045M	K	-	2	0	KIAA0319	24655457	0.373000	0.25073	0.105000	0.21289	0.956000	0.61745	0.834000	0.27518	0.473000	0.27368	-0.242000	0.12053	AAG	KIAA0319	-	NULL	ENSG00000137261		0.468	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	HGNC	protein_coding	OTTHUMT00000040009.1	-	0.00	40	0	T	NM_014809		24547478	-1	tier1	-	no_errors	ENST00000378214	ensembl	human	known	74_37	missense	33.90	38	20	SNP	0.192	A
KIAA1033	23325	genome.wustl.edu	37	12	105512234	105512234	+	Missense_Mutation	SNP	G	G	T	rs371615453		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:105512234G>T	ENST00000332180.5	+	7	533	c.446G>T	c.(445-447)tGc>tTc	p.C149F		NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						GAACTGTCTTGCTTTGTTACG	0.343																																																	0													129.0	120.0	123.0					12																	105512234		1844	4089	5933	SO:0001583	missense	0			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.446G>T	12.37:g.105512234G>T	ENSP00000328062:p.Cys149Phe			Missense_Mutation	SNP	NULL	p.C149F	ENST00000332180.5	37	c.446	CCDS41826.1	12	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040248	0.93630	.	.	ENSG00000136051	ENST00000548195;ENST00000332180	T;T	0.28069	1.63;1.63	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.46658	0.1404	L	0.56769	1.78	0.80722	D	1	D;D	0.53745	0.962;0.962	P;P	0.54590	0.756;0.756	T	0.07195	-1.0785	10	0.21014	T	0.42	.	20.3593	0.98849	0.0:0.0:1.0:0.0	.	149;149	B7ZKT9;Q2M389	.;WASH7_HUMAN	F	22;149	ENSP00000450243:C22F;ENSP00000328062:C149F	ENSP00000328062:C149F	C	+	2	0	KIAA1033	104036364	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.605000	0.98321	2.807000	0.96579	0.591000	0.81541	TGC	KIAA1033	-	NULL	ENSG00000136051		0.343	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1033	HGNC	protein_coding	OTTHUMT00000406138.4		0.00	36	0	G	NM_015275		105512234	+1			no_errors	ENST00000332180	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
CEMIP	57214	genome.wustl.edu	37	15	81221497	81221497	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:81221497G>T	ENST00000394685.3	+	21	3013	c.2594G>T	c.(2593-2595)aGg>aTg	p.R865M	RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000356249.5_Missense_Mutation_p.R865M|KIAA1199_ENST00000220244.3_Missense_Mutation_p.R865M			Q8WUJ3	CEMIP_HUMAN		865					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CATAGCGGAAGGACCCTCCCT	0.507																																																	0													116.0	112.0	113.0					15																	81221497		2203	4300	6503	SO:0001583	missense	0																														ENST00000394685.3:c.2594G>T	15.37:g.81221497G>T	ENSP00000378177:p.Arg865Met		Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.R865M	ENST00000394685.3	37	c.2594	CCDS10315.1	15	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339878	0.60963	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249;ENST00000394683	T;T;T	0.61274	0.12;0.12;0.12	4.87	4.87	0.63330	Pectin lyase fold/virulence factor (1);	0.000000	0.85682	D	0.000000	T	0.78444	0.4284	M	0.83223	2.63	0.50313	D	0.999861	D	0.89917	1.0	D	0.83275	0.996	T	0.80544	-0.1335	10	0.51188	T	0.08	-38.0867	18.2156	0.89884	0.0:0.0:1.0:0.0	.	865	Q8WUJ3	K1199_HUMAN	M	865	ENSP00000220244:R865M;ENSP00000378177:R865M;ENSP00000348583:R865M	ENSP00000220244:R865M	R	+	2	0	KIAA1199	79008552	1.000000	0.71417	1.000000	0.80357	0.155000	0.21991	8.701000	0.91331	2.518000	0.84900	0.655000	0.94253	AGG	KIAA1199	-	superfamily_Pectin_lyase_fold/virulence	ENSG00000103888		0.507	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1		0.00	37	0	G			81221497	+1			no_errors	ENST00000220244	ensembl	human	known	74_37	missense	10.71	25	3	SNP	1.000	T
KIAA1429	25962	genome.wustl.edu	37	8	95539448	95539448	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:95539448C>A	ENST00000297591.5	-	8	1099	c.1024G>T	c.(1024-1026)Gac>Tac	p.D342Y	KIAA1429_ENST00000437199.1_Missense_Mutation_p.D342Y|KIAA1429_ENST00000421249.2_Missense_Mutation_p.D342Y	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	342					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			AGCTCCCTGTCATATGGATCA	0.368																																																	0													100.0	99.0	100.0					8																	95539448		2203	4300	6503	SO:0001583	missense	0			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.1024G>T	8.37:g.95539448C>A	ENSP00000297591:p.Asp342Tyr		Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D342Y	ENST00000297591.5	37	c.1024	CCDS34923.1	8	.	.	.	.	.	.	.	.	.	.	C	19.22	3.786422	0.70337	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	T;T;T	0.46819	0.86;0.86;0.86	5.7	5.7	0.88788	.	0.171148	0.51477	D	0.000093	T	0.55130	0.1901	L	0.36672	1.1	0.58432	D	0.999999	P;P	0.51537	0.946;0.946	P;P	0.53809	0.735;0.735	T	0.56366	-0.7991	10	0.72032	D	0.01	-14.5418	19.8292	0.96628	0.0:1.0:0.0:0.0	.	342;342	Q69YN4-4;Q69YN4	.;VIR_HUMAN	Y	342	ENSP00000297591:D342Y;ENSP00000395600:D342Y;ENSP00000398390:D342Y	ENSP00000297591:D342Y	D	-	1	0	KIAA1429	95608624	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.689000	0.91719	0.491000	0.48974	GAC	KIAA1429	-	NULL	ENSG00000164944		0.368	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	HGNC	protein_coding	OTTHUMT00000378720.2		0.00	28	0	C	NM_015496		95539448	-1			no_errors	ENST00000297591	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	A
KIAA1524	57650	genome.wustl.edu	37	3	108287026	108287026	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:108287026C>A	ENST00000295746.8	-	10	1325	c.1249G>T	c.(1249-1251)Gcc>Tcc	p.A417S	KIAA1524_ENST00000487834.1_5'UTR|KIAA1524_ENST00000491772.1_Missense_Mutation_p.A258S	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	417					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						ATGGCCTTGGCAATCCTTTCA	0.343																																																	0													150.0	149.0	149.0					3																	108287026		2203	4300	6503	SO:0001583	missense	0			AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.1249G>T	3.37:g.108287026C>A	ENSP00000295746:p.Ala417Ser		A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A417S	ENST00000295746.8	37	c.1249	CCDS33812.1	3	.	.	.	.	.	.	.	.	.	.	C	2.519	-0.311172	0.05458	.	.	ENSG00000163507	ENST00000491772;ENST00000295746	T;T	0.09445	2.98;3.15	5.91	1.15	0.20763	Armadillo-type fold (1);	0.536007	0.21830	N	0.068483	T	0.07143	0.0181	L	0.29908	0.895	0.28470	N	0.915445	B	0.13594	0.008	B	0.14023	0.01	T	0.39231	-0.9624	10	0.15499	T	0.54	0.0011	9.9607	0.41695	0.0:0.6064:0.0:0.3936	.	417	Q8TCG1	CIP2A_HUMAN	S	258;417	ENSP00000419487:A258S;ENSP00000295746:A417S	ENSP00000295746:A417S	A	-	1	0	KIAA1524	109769716	1.000000	0.71417	0.988000	0.46212	0.662000	0.39071	1.487000	0.35540	-0.066000	0.12998	-0.136000	0.14681	GCC	KIAA1524	-	superfamily_ARM-type_fold	ENSG00000163507		0.343	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1524	HGNC	protein_coding	OTTHUMT00000353975.2	-	0.00	36	0	C	NM_020890		108287026	-1	tier1	-	no_errors	ENST00000295746	ensembl	human	known	74_37	missense	25.71	25	9	SNP	0.975	A
KIAA1804	84451	genome.wustl.edu	37	1	233511698	233511699	+	Frame_Shift_Del	DEL	AC	AC	-			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:233511698_233511699delAC	ENST00000366624.3	+	7	1973_1974	c.1712_1713delAC	c.(1711-1713)aacfs	p.N571fs	MLK4_ENST00000366622.1_Frame_Shift_Del_p.N17fs	NM_032435.2	NP_115811.2																					TGGGGAAGGAACACAGTCTTTC	0.322																																																	0																																										SO:0001589	frameshift_variant	0																														ENST00000366624.3:c.1712_1713delAC	1.37:g.233511700_233511701delAC	ENSP00000355583:p.Asn571fs			Frame_Shift_Del	DEL	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.T572fs	ENST00000366624.3	37	c.1712_1713	CCDS1598.1	1																																																																																			MLK4	-	pirsf_MAPKKK9/10/11	ENSG00000143674		0.322	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1804	Uniprot_gn	protein_coding	OTTHUMT00000092495.1		0.00	32	0	AC			233511699	+1	tier1		no_errors	ENST00000366624	ensembl	human	known	74_37	frame_shift_del	72.41	8	21	DEL	1.000:0.997	-
KIAA1841	84542	genome.wustl.edu	37	2	61331022	61331022	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:61331022G>T	ENST00000402291.1	+	13	1641	c.1400G>T	c.(1399-1401)cGt>cTt	p.R467L	KIAA1841_ENST00000295031.5_Missense_Mutation_p.R467L|KIAA1841_ENST00000356719.2_Missense_Mutation_p.R467L|KIAA1841_ENST00000453873.1_Missense_Mutation_p.R467L	NM_001129993.1	NP_001123465.1	Q6NSI8	K1841_HUMAN	KIAA1841	467										breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			GTTACACTTCGTGATCAAGGT	0.418																																																	0													185.0	143.0	157.0					2																	61331022		2203	4300	6503	SO:0001583	missense	0			BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000402291.1:c.1400G>T	2.37:g.61331022G>T	ENSP00000385579:p.Arg467Leu		Q49AF0|Q6ZND0|Q96JI6	Missense_Mutation	SNP	pfam_DUF3342,superfamily_BTB/POZ_fold,superfamily_Homeodomain-like	p.R467L	ENST00000402291.1	37	c.1400	CCDS46296.1	2	.	.	.	.	.	.	.	.	.	.	G	8.286	0.816646	0.16607	.	.	ENSG00000162929	ENST00000402291;ENST00000295031;ENST00000356719;ENST00000453873	.	.	.	5.57	-1.98	0.07480	.	0.839728	0.10898	N	0.621882	T	0.08891	0.0220	N	0.02011	-0.69	0.09310	N	0.999993	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.26608	-1.0098	9	0.27082	T	0.32	0.082	2.5585	0.04766	0.4553:0.1678:0.2753:0.1016	.	467;467	Q6NSI8-2;Q6NSI8	.;K1841_HUMAN	L	467	.	ENSP00000295031:R467L	R	+	2	0	KIAA1841	61184526	0.006000	0.16342	0.263000	0.24496	0.270000	0.26580	0.116000	0.15561	-0.371000	0.08004	0.555000	0.69702	CGT	KIAA1841	-	NULL	ENSG00000162929		0.418	KIAA1841-003	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1841	HGNC	protein_coding	OTTHUMT00000325477.1		0.00	57	0	G	NM_032506		61331022	+1			no_errors	ENST00000356719	ensembl	human	known	74_37	missense	5.45	52	3	SNP	0.471	T
KIAA2018	205717	genome.wustl.edu	37	3	113377481	113377482	+	Frame_Shift_Ins	INS	-	-	T	rs78597857		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:113377481_113377482insT	ENST00000478658.1	-	5	3064_3065	c.3047_3048insA	c.(3046-3048)aacfs	p.N1016fs	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Frame_Shift_Ins_p.N1016fs			Q68DE3	K2018_HUMAN	KIAA2018	1016						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.N1016fs*8(1)|p.N1016fs*9(1)|p.N1016fs*23(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						ATTTCTGAGGGTTTTTTTTTTT	0.366																																																	3	Deletion - Frameshift(2)|Insertion - Frameshift(1)	ovary(3)																																								SO:0001589	frameshift_variant	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3048dupA	3.37:g.113377492_113377492dupT	ENSP00000420721:p.Asn1016fs		Q7Z3L9|Q8IVF3|Q9H8T4	Frame_Shift_Ins	INS	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.N1016fs	ENST00000478658.1	37	c.3048_3047	CCDS43133.1	3																																																																																			KIAA2018	-	NULL	ENSG00000176542		0.366	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1		0.00	18	0	-	NM_001009899		113377482	-1	tier1		no_errors	ENST00000316407	ensembl	human	known	74_37	frame_shift_ins	13.64	19	3	INS	0.174:0.827	T
KIR3DL1	3811	genome.wustl.edu	37	19	55315144	55315144	+	Intron	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:55315144T>C	ENST00000538269.1	+	2	61				KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000357494.4_Missense_Mutation_p.L13P|KIR2DL4_ENST00000463062.1_3'UTR|KIR2DL4_ENST00000346587.4_Missense_Mutation_p.L13P|KIR2DL4_ENST00000396293.1_Missense_Mutation_p.L13P|KIR2DL4_ENST00000396284.2_Intron|KIR2DL4_ENST00000359085.4_Missense_Mutation_p.L13P|KIR2DL4_ENST00000345540.5_Missense_Mutation_p.L13P|KIR3DL1_ENST00000541392.1_Intron			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)	p.L13H(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		CTGGCATGTCTTGGTGAGTCC	0.577											OREG0003678	type=REGULATORY REGION|Gene=KIR2DL4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					1	Substitution - Missense(1)	ovary(1)											7.0	7.0	7.0					19																	55315144		1663	3606	5269	SO:0001627	intron_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-13845T>C	19.37:g.55315144T>C		1007	O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.L13P	ENST00000538269.1	37	c.38		19	.	.	.	.	.	.	.	.	.	.	T	11.09	1.536211	0.27475	.	.	ENSG00000189013	ENST00000359085;ENST00000345540;ENST00000357494;ENST00000396293;ENST00000346587;ENST00000396289	T;T;T;T;T;T	0.00569	6.56;6.58;6.52;6.63;6.75;6.59	1.07	-0.0402	0.13872	.	.	.	.	.	T	0.01800	0.0057	M	0.88105	2.93	0.23933	N	0.996425	D;P;D;D;B;D;B	0.62365	0.991;0.932;0.991;0.991;0.162;0.991;0.219	P;P;D;D;B;D;B	0.67548	0.713;0.616;0.952;0.926;0.002;0.921;0.007	T	0.42224	-0.9464	9	0.87932	D	0	.	2.9547	0.05872	0.0:0.3071:0.0:0.6929	.	13;13;13;13;13;13;13	Q99706;Q8N741;Q99706-4;Q99706-2;Q8N736;Q99706-3;Q8N738	KI2L4_HUMAN;.;.;.;.;.;.	P	13;13;13;13;13;11	ENSP00000351988:L13P;ENSP00000339634:L13P;ENSP00000350088:L13P;ENSP00000379588:L13P;ENSP00000345331:L13P;ENSP00000379584:L11P	ENSP00000339634:L13P	L	+	2	0	KIR2DL4	60006956	0.990000	0.36364	0.386000	0.26170	0.133000	0.20885	0.443000	0.21644	-0.045000	0.13468	0.113000	0.15668	CTT	KIR2DL4	-	NULL	ENSG00000189013		0.577	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL4	HGNC	protein_coding		-	0.00	9	0	T	NM_013289		55315144	+1	tier1	-	no_errors	ENST00000345540	ensembl	human	known	74_37	missense	50.00	3	3	SNP	0.494	C
KITLG	4254	genome.wustl.edu	37	12	88887102	88887102	+	5'UTR	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:88887102A>G	ENST00000378535.4	-	0	4658							P21583	SCF_HUMAN	KIT ligand						cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|male gonad development (GO:0008584)|negative regulation of mast cell apoptotic process (GO:0033026)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of myeloid leukocyte differentiation (GO:0002763)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Ras protein signal transduction (GO:0046579)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	stem cell factor receptor binding (GO:0005173)			kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|stomach(1)	9						TGCTTAGTAAACATTTCAGGA	0.244									Testicular Cancer, Familial Clustering of																																								0																																										SO:0001623	5_prime_UTR_variant	0	Familial Cancer Database		M59964	CCDS31867.1, CCDS31868.1	12q22	2010-11-23			ENSG00000049130	ENSG00000049130			6343	protein-coding gene	gene with protein product	"""mast cell growth factor"", ""stem cell factor"", ""steel factor"", ""familial progressive hyperpigmentation 2"""	184745		MGF		2208279, 1707188, 19375057	Standard	NM_003994		Approved	SCF, SF, Kitl, KL-1, FPH2	uc001tav.3	P21583	OTTHUMG00000169888	ENST00000378535.4:c.-533T>C	12.37:g.88887102A>G			A0AV09|A8K2Q4|B7ZLM4|Q16487|Q68DZ2|Q7M4N8|Q9UQK7	RNA	SNP	-	NULL	ENST00000378535.4	37	NULL		12																																																																																			KITLG	-	-	ENSG00000049130		0.244	KITLG-003	KNOWN	basic	processed_transcript	KITLG	HGNC	protein_coding	OTTHUMT00000406423.2	-	0.00	61	0	A	NM_003994		88887102	-1	tier1	-	no_errors	ENST00000378535	ensembl	human	known	74_37	rna	50.00	15	15	SNP	0.997	G
KPNA5	3841	genome.wustl.edu	37	6	117023196	117023196	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:117023196G>T	ENST00000368564.1	+	6	598	c.450G>T	c.(448-450)tgG>tgT	p.W150C	KPNA5_ENST00000356348.1_Missense_Mutation_p.W150C			O15131	IMA6_HUMAN	karyopherin alpha 5 (importin alpha 6)	147	NLS binding site (major). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(6)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)		AAGCTGCATGGGCATTAACAA	0.358																																																	0													91.0	90.0	90.0					6																	117023196		2203	4300	6503	SO:0001583	missense	0			AF005361	CCDS5111.1	6q22.2	2013-02-14			ENSG00000196911	ENSG00000196911		"""Importins"", ""Armadillo repeat containing"""	6398	protein-coding gene	gene with protein product		604545				9395085	Standard	NM_002269		Approved	SRP6, IPOA6	uc003pxh.3	O15131	OTTHUMG00000015448	ENST00000368564.1:c.450G>T	6.37:g.117023196G>T	ENSP00000357552:p.Trp150Cys		B2RAI5|Q86X23	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.W150C	ENST00000368564.1	37	c.450	CCDS5111.1	6	.	.	.	.	.	.	.	.	.	.	G	17.86	3.492025	0.64074	.	.	ENSG00000196911	ENST00000368564;ENST00000356348	T;T	0.74842	-0.88;-0.88	5.51	4.63	0.57726	Armadillo-like helical (1);Armadillo-type fold (1);	0.075335	0.56097	N	0.000023	D	0.88381	0.6421	H	0.95712	3.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92198	0.5765	10	0.87932	D	0	.	15.5714	0.76341	0.0:0.0:0.8608:0.1392	.	147	O15131	IMA5_HUMAN	C	150	ENSP00000357552:W150C;ENSP00000348704:W150C	ENSP00000348704:W150C	W	+	3	0	KPNA5	117129889	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.066000	0.93949	1.303000	0.44873	-0.293000	0.09583	TGG	KPNA5	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000196911		0.358	KPNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA5	HGNC	protein_coding	OTTHUMT00000041967.1		0.00	27	0	G	NM_002269		117023196	+1			no_errors	ENST00000356348	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
KRT32	3882	genome.wustl.edu	37	17	39616470	39616470	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:39616470G>T	ENST00000225899.3	-	7	1342	c.1239C>A	c.(1237-1239)tcC>tcA	p.S413S		NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	413	Tail.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				AGGAAGGAGTGGAGCATGGGT	0.622																																																	0													83.0	56.0	65.0					17																	39616470		2194	4296	6490	SO:0001819	synonymous_variant	0			X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.1239C>A	17.37:g.39616470G>T				Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.S413	ENST00000225899.3	37	c.1239	CCDS11393.1	17																																																																																			KRT32	-	NULL	ENSG00000108759		0.622	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT32	HGNC	protein_coding	OTTHUMT00000257293.1	-	0.00	73	0	G	NM_002278		39616470	-1	tier1	-	no_errors	ENST00000225899	ensembl	human	known	74_37	silent	7.94	58	5	SNP	0.019	T
KRTAP10-7	386675	genome.wustl.edu	37	21	46021305	46021305	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr21:46021305A>C	ENST00000380102.2	+	1	809	c.784A>C	c.(784-786)Acc>Ccc	p.T262P	TSPEAR_ENST00000323084.4_Intron	NM_198689.2	NP_941962.1	P60409	KR107_HUMAN	keratin associated protein 10-7	262	30 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				breast(1)|large_intestine(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8						AGCTTGCTGCACCTCCTCCCA	0.627																																																	0													134.0	135.0	135.0					21																	46021305		2203	4300	6503	SO:0001583	missense	0			AJ566385	CCDS74803.1	21q22.3	2014-04-10			ENSG00000205441	ENSG00000272804		"""Keratin associated proteins"""	22970	protein-coding gene	gene with protein product				KRTAP18-7			Standard	NM_198689		Approved	KAP10.7, KAP18.7	uc002zfn.4	P60409	OTTHUMG00000188307	ENST00000380102.2:c.784A>C	21.37:g.46021305A>C	ENSP00000369445:p.Thr262Pro		Q0VDJ8|Q70LJ2	Missense_Mutation	SNP	NULL	p.T262P	ENST00000380102.2	37	c.784		21	.	.	.	.	.	.	.	.	.	.	a	3.029	-0.200092	0.06219	.	.	ENSG00000205441	ENST00000380102	T	0.00664	5.92	2.93	-1.4	0.08968	.	.	.	.	.	T	0.01695	0.0054	M	0.89095	3.005	0.09310	N	1	P	0.52316	0.952	P	0.46850	0.529	T	0.36335	-0.9752	9	0.30078	T	0.28	.	3.0327	0.06111	0.4762:0.2326:0.2912:0.0	.	257	P60409-2	.	P	262	ENSP00000369445:T262P	ENSP00000369445:T262P	T	+	1	0	KRTAP10-7	44845733	0.000000	0.05858	0.000000	0.03702	0.360000	0.29518	-0.258000	0.08733	-0.206000	0.10203	0.163000	0.16589	ACC	KRTAP10-7	-	NULL	ENSG00000205441		0.627	KRTAP10-7-001	KNOWN	basic|appris_principal	protein_coding	KRTAP10-7	HGNC	protein_coding	OTTHUMT00000128038.1	-	0.00	74	0	A	NM_198689		46021305	+1	tier1	-	no_errors	ENST00000380102	ensembl	human	known	74_37	missense	43.14	58	44	SNP	0.000	C
KRTAP12-3	386683	genome.wustl.edu	37	21	46078017	46078017	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr21:46078017A>G	ENST00000397907.1	+	1	169	c.121A>G	c.(121-123)Acg>Gcg	p.T41A	TSPEAR_ENST00000323084.4_Intron	NM_198697.2	NP_941970.2	P60328	KR123_HUMAN	keratin associated protein 12-3	41	14 X 5 AA approximate repeats.					keratin filament (GO:0045095)				central_nervous_system(1)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						CGTGAGCTGCACGCGCATTGT	0.642																																																	0													97.0	111.0	106.0					21																	46078017		2188	4270	6458	SO:0001583	missense	0			AB076361	CCDS42964.1	21q22.3	2006-03-13			ENSG00000205439	ENSG00000205439		"""Keratin associated proteins"""	20531	protein-coding gene	gene with protein product							Standard	NM_198697		Approved	KRTAP12.3	uc002zft.3	P60328	OTTHUMG00000057630	ENST00000397907.1:c.121A>G	21.37:g.46078017A>G	ENSP00000381005:p.Thr41Ala			Missense_Mutation	SNP	NULL	p.T41A	ENST00000397907.1	37	c.121	CCDS42964.1	21	.	.	.	.	.	.	.	.	.	.	N	11.67	1.707924	0.30322	.	.	ENSG00000205439	ENST00000397907	T	0.01388	4.95	4.31	-8.62	0.00881	.	.	.	.	.	T	0.01222	0.0040	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.45745	-0.9240	8	0.62326	D	0.03	.	9.9947	0.41891	0.2149:0.6296:0.1555:0.0	.	41	P60328	KR123_HUMAN	A	41	ENSP00000381005:T41A	ENSP00000381005:T41A	T	+	1	0	KRTAP12-3	44902445	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.931000	0.01556	-1.819000	0.01216	-0.621000	0.04028	ACG	KRTAP12-3	-	NULL	ENSG00000205439		0.642	KRTAP12-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP12-3	HGNC	protein_coding	OTTHUMT00000128033.1	-	0.00	39	0	A			46078017	+1	tier1	-	no_errors	ENST00000397907	ensembl	human	known	74_37	missense	30.23	30	13	SNP	0.000	G
LAMA1	284217	genome.wustl.edu	37	18	6959467	6959467	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:6959467C>T	ENST00000389658.3	-	54	7744	c.7651G>A	c.(7651-7653)Gga>Aga	p.G2551R	RP11-781P6.1_ENST00000584722.1_RNA	NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2551	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ATGTTGCCTCCGATCAGCATG	0.478																																																	0													94.0	77.0	83.0					18																	6959467		2203	4300	6503	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.7651G>A	18.37:g.6959467C>T	ENSP00000374309:p.Gly2551Arg			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G2551R	ENST00000389658.3	37	c.7651	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	6.490	0.458639	0.12342	.	.	ENSG00000101680	ENST00000389658;ENST00000344342	T	0.79653	-1.29	5.72	5.72	0.89469	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 1 (1);	0.883820	0.10003	N	0.728169	T	0.55194	0.1905	N	0.02247	-0.625	0.24991	N	0.991536	P	0.38767	0.646	B	0.31495	0.131	T	0.40850	-0.9541	10	0.19147	T	0.46	.	10.3151	0.43732	0.0:0.8544:0.0:0.1456	.	2551	P25391	LAMA1_HUMAN	R	2551;4	ENSP00000374309:G2551R	ENSP00000341000:G4R	G	-	1	0	LAMA1	6949467	0.873000	0.30073	0.575000	0.28536	0.004000	0.04260	1.386000	0.34419	2.684000	0.91462	0.563000	0.77884	GGA	LAMA1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000101680		0.478	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	17	0	C	NM_005559		6959467	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	19.35	25	6	SNP	0.981	T
LAMC1	3915	genome.wustl.edu	37	1	183095293	183095293	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:183095293G>T	ENST00000258341.4	+	16	3097	c.2840G>T	c.(2839-2841)tGt>tTt	p.C947F	LAMC1_ENST00000466964.1_3'UTR	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	947	Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						AATGGGCAGTGTGACATCCGC	0.527																																																	0													64.0	55.0	58.0					1																	183095293		2203	4300	6503	SO:0001583	missense	0			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2840G>T	1.37:g.183095293G>T	ENSP00000258341:p.Cys947Phe		Q5VYE7	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.C947F	ENST00000258341.4	37	c.2840	CCDS1351.1	1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.982841	0.93044	.	.	ENSG00000135862	ENST00000258341	D	0.94330	-3.4	5.64	5.64	0.86602	EGF-like, laminin (3);	0.000000	0.85682	D	0.000000	D	0.98457	0.9486	H	0.99273	4.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99501	1.0953	10	0.87932	D	0	.	19.6934	0.96010	0.0:0.0:1.0:0.0	.	947	P11047	LAMC1_HUMAN	F	947	ENSP00000258341:C947F	ENSP00000258341:C947F	C	+	2	0	LAMC1	181361916	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.135000	0.94478	2.651000	0.90000	0.655000	0.94253	TGT	LAMC1	-	pfam_EGF_laminin,smart_EG-like_dom,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000135862		0.527	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2		0.00	70	0	G	NM_002293		183095293	+1			no_errors	ENST00000258341	ensembl	human	known	74_37	missense	5.05	94	5	SNP	1.000	T
LBX1	10660	genome.wustl.edu	37	10	102988555	102988555	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:102988555G>A	ENST00000370193.2	-	1	996	c.18C>T	c.(16-18)gaC>gaT	p.D6D	LBX1-AS1_ENST00000546988.1_RNA|LBX1-AS1_ENST00000547077.1_RNA	NM_006562.4	NP_006553.2	P52954	LBX1_HUMAN	ladybird homeobox 1	6					anatomical structure morphogenesis (GO:0009653)|heart looping (GO:0001947)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|neuron fate determination (GO:0048664)|regulation of transcription from RNA polymerase II promoter involved in spinal cord association neuron specification (GO:0021920)|spinal cord motor neuron differentiation (GO:0021522)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|lung(4)|ovary(1)	7		Colorectal(252;0.234)		Epithelial(162;3.22e-09)|all cancers(201;1.79e-07)		CCGCCTTGCCGTCCTCCTTGG	0.761																																																	0													15.0	17.0	17.0					10																	102988555		2198	4292	6490	SO:0001819	synonymous_variant	0			X90828	CCDS31270.1	10q24.32	2011-06-20	2007-02-15		ENSG00000138136	ENSG00000138136		"""Homeoboxes / ANTP class : NKL subclass"""	16960	protein-coding gene	gene with protein product		604255	"""ladybird homeobox homolog 1 (Drosophila)"""			8645601	Standard	XM_005269443		Approved	LBX1H, HPX6	uc001ksx.3	P52954	OTTHUMG00000018927	ENST00000370193.2:c.18C>T	10.37:g.102988555G>A			B9EGA2|Q05BB2	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.D6	ENST00000370193.2	37	c.18	CCDS31270.1	10																																																																																			LBX1	-	NULL	ENSG00000138136		0.761	LBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LBX1	HGNC	protein_coding	OTTHUMT00000049928.3	-	0.00	23	0	G	NM_006562		102988555	-1	tier1	-	no_errors	ENST00000370193	ensembl	human	known	74_37	silent	46.67	16	14	SNP	0.998	A
LCNL1	401562	genome.wustl.edu	37	9	139878960	139878960	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:139878960G>T	ENST00000408973.2	+	2	735	c.141G>T	c.(139-141)caG>caT	p.Q47H	LCNL1_ENST00000432827.1_3'UTR	NM_207510.3	NP_997393.3	Q6ZST4	LCNL1_HUMAN	lipocalin-like 1	47																	GCGGGTGCCAGAAAATGGACA	0.672																																																	0													17.0	20.0	19.0					9																	139878960		1912	4108	6020	SO:0001583	missense	0				CCDS43908.1	9q34.3	2014-01-22			ENSG00000214402	ENSG00000214402		"""Lipocalins"""	34436	protein-coding gene	gene with protein product							Standard	NM_207510		Approved	FLJ45224	uc004ckh.1	Q6ZST4	OTTHUMG00000159546	ENST00000408973.2:c.141G>T	9.37:g.139878960G>T	ENSP00000386162:p.Gln47His			Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like	p.Q47H	ENST00000408973.2	37	c.141	CCDS43908.1	9	.	.	.	.	.	.	.	.	.	.	g	12.10	1.838056	0.32513	.	.	ENSG00000214402	ENST00000408973	T	0.08458	3.09	4.63	3.72	0.42706	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	.	.	.	.	T	0.17238	0.0414	L	0.36672	1.1	0.23669	N	0.997151	D	0.89917	1.0	D	0.91635	0.999	T	0.08743	-1.0707	9	0.41790	T	0.15	.	8.5046	0.33179	0.1106:0.0:0.8894:0.0	.	47	Q6ZST4	LCNL1_HUMAN	H	47	ENSP00000386162:Q47H	ENSP00000386162:Q47H	Q	+	3	2	LCNL1	138998781	0.670000	0.27512	0.160000	0.22671	0.040000	0.13550	1.039000	0.30266	0.941000	0.37499	0.479000	0.44913	CAG	LCNL1	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like	ENSG00000214402		0.672	LCNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCNL1	HGNC	protein_coding	OTTHUMT00000356128.1	-	0.00	34	0	G	NM_207510		139878960	+1	tier1	-	no_errors	ENST00000408973	ensembl	human	known	74_37	missense	10.87	41	5	SNP	0.937	T
LCOR	84458	genome.wustl.edu	37	10	98715549	98715549	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:98715549G>T	ENST00000371097.4	+	8	1718	c.1172G>T	c.(1171-1173)gGc>gTc	p.G391V	LCOR_ENST00000498444.1_Intron|LCOR_ENST00000356016.3_Missense_Mutation_p.G391V|LCOR_ENST00000540664.1_Missense_Mutation_p.G391V|LCOR_ENST00000371103.3_Missense_Mutation_p.G391V			Q96JN0	LCOR_HUMAN	ligand dependent nuclear receptor corepressor	391	HTH psq-type. {ECO:0000255|PROSITE- ProRule:PRU00320}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|ovary(3)|prostate(1)|urinary_tract(1)	13		Colorectal(252;0.162)		Epithelial(162;4.43e-09)|all cancers(201;2.96e-07)		GAGAGGCTGGGCACTTTGAAA	0.433																																																	0													55.0	58.0	57.0					10																	98715549		2203	4300	6503	SO:0001583	missense	0				CCDS7451.1, CCDS53561.1	10q24	2006-06-28			ENSG00000196233	ENSG00000196233			29503	protein-coding gene	gene with protein product		607698				12535528, 15193453	Standard	NM_001170765		Approved	MLR2, FLJ38026, KIAA1795		Q96JN0	OTTHUMG00000018841	ENST00000371097.4:c.1172G>T	10.37:g.98715549G>T	ENSP00000360138:p.Gly391Val		D3DR47|Q5VW16|Q7Z723|Q86T32|Q86T33|Q8N3L6	Missense_Mutation	SNP	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq	p.G391V	ENST00000371097.4	37	c.1172	CCDS7451.1	10	.	.	.	.	.	.	.	.	.	.	G	17.05	3.289380	0.59976	.	.	ENSG00000196233	ENST00000540664;ENST00000371103;ENST00000371097;ENST00000356016	.	.	.	5.52	5.52	0.82312	Homeodomain-like (1);Helix-turn-helix, Psq-like (1);Helix-turn-helix, Psq (1);	0.000000	0.85682	D	0.000000	T	0.66025	0.2748	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.70088	-0.4968	9	0.72032	D	0.01	-3.4209	19.8055	0.96531	0.0:0.0:1.0:0.0	.	391;391	Q96JN0;Q96JN0-2	LCOR_HUMAN;.	V	391	.	ENSP00000348298:G391V	G	+	2	0	LCOR	98705539	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.759000	0.94783	0.555000	0.69702	GGC	LCOR	-	pfam_HTH_Psq,superfamily_Homeodomain-like,pfscan_HTH_Psq	ENSG00000196233		0.433	LCOR-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	LCOR	HGNC	protein_coding	OTTHUMT00000049628.2		0.00	18	0	G			98715549	+1			no_errors	ENST00000356016	ensembl	human	known	74_37	missense	20.00	12	3	SNP	1.000	T
LETM2	137994	genome.wustl.edu	37	8	38260109	38260109	+	Missense_Mutation	SNP	G	G	T	rs140730377	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:38260109G>T	ENST00000379957.4	+	7	1178	c.1051G>T	c.(1051-1053)Ggg>Tgg	p.G351W	RP11-350N15.3_ENST00000533301.1_RNA|LETM2_ENST00000528827.1_3'UTR|LETM2_ENST00000523983.2_Missense_Mutation_p.G304W|LETM2_ENST00000527710.1_Missense_Mutation_p.G137W|LETM2_ENST00000524874.1_Missense_Mutation_p.G303W|LETM2_ENST00000297720.5_Missense_Mutation_p.G256W	NM_001199659.1	NP_001186588.1	Q2VYF4	LETM2_HUMAN	leucine zipper-EF-hand containing transmembrane protein 2	351	LETM1.					integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)		p.G256W(1)|p.G351W(1)		NS(1)|large_intestine(1)|lung(3)|prostate(2)	7	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)			TAGGGCCCGAGGGATGAGATC	0.532																																																	2	Substitution - Missense(2)	lung(2)											96.0	82.0	87.0					8																	38260109		2203	4300	6503	SO:0001583	missense	0			AK058138	CCDS6106.1, CCDS56534.1, CCDS69466.1, CCDS75731.1	8p12	2013-01-11						"""EF-hand domain containing"""	14648	protein-coding gene	gene with protein product						11549311	Standard	NM_001286821		Approved	FLJ25409	uc003xlm.2	Q2VYF4		ENST00000379957.4:c.1051G>T	8.37:g.38260109G>T	ENSP00000369291:p.Gly351Trp		A6NMG3|Q8NCR2|Q96LL1	Missense_Mutation	SNP	pfam_LETM1	p.G351W	ENST00000379957.4	37	c.1051		8	.	.	.	.	.	.	.	.	.	.	G	30	5.056857	0.93793	.	.	ENSG00000165046	ENST00000297720;ENST00000524874;ENST00000379957;ENST00000523983;ENST00000527710	T;T;T;T;T	0.79845	-1.31;-1.31;-1.31;-1.31;-1.31	5.63	5.63	0.86233	LETM1-like (1);	0.000000	0.85682	D	0.000000	D	0.93288	0.7861	H	0.95079	3.62	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94763	0.7938	10	0.87932	D	0	-14.1134	19.6699	0.95907	0.0:0.0:1.0:0.0	.	148;351;303	B7Z7T4;Q2VYF4;E9PMA4	.;LETM2_HUMAN;.	W	256;303;351;304;137	ENSP00000297720:G256W;ENSP00000431211:G303W;ENSP00000369291:G351W;ENSP00000428765:G304W;ENSP00000434867:G137W	ENSP00000297720:G256W	G	+	1	0	LETM2	38379266	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.641000	0.89580	0.655000	0.94253	GGG	LETM2	-	pfam_LETM1	ENSG00000165046		0.532	LETM2-013	KNOWN	basic|appris_candidate_longest	protein_coding	LETM2	HGNC	protein_coding	OTTHUMT00000381816.1		0.00	27	0	G	NM_144652		38260109	+1			no_errors	ENST00000379957	ensembl	human	known	74_37	missense	7.89	35	3	SNP	1.000	T
LHPP	64077	genome.wustl.edu	37	10	126185530	126185530	+	Splice_Site	SNP	G	G	T	rs146652970	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:126185530G>T	ENST00000368842.5	+	4	496	c.468G>T	c.(466-468)ggG>ggT	p.G156G	LHPP_ENST00000392757.4_Splice_Site_p.G156G|LHPP_ENST00000368839.1_Splice_Site_p.G156G	NM_022126.3	NP_071409.3	Q9H008	LHPP_HUMAN	phospholysine phosphohistidine inorganic pyrophosphate phosphatase	156					phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)|phosphohistidine phosphatase activity (GO:0008969)|protein homodimerization activity (GO:0042803)			large_intestine(2)|lung(2)	4		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.163)|Colorectal(40;0.187)		TCTCTCCTAGGCGTTACTACA	0.602																																					GBM(165;1980 2715 15999 18454)												0								G	,	0,4406		0,0,2203	234.0	204.0	214.0		468,468	-5.7	0.3	10	dbSNP_134	214	4,8596	3.7+/-12.6	0,4,4296	yes	coding-synonymous-near-splice,coding-synonymous-near-splice	LHPP	NM_001167880.1,NM_022126.3	,	0,4,6499	TT,TG,GG		0.0465,0.0,0.0308	,	156/211,156/271	126185530	4,13002	2203	4300	6503	SO:0001630	splice_region_variant	0			AB049629	CCDS7640.1, CCDS53587.1	10q26.2	2010-02-17			ENSG00000107902	ENSG00000107902	3.6.1.1		30042	protein-coding gene	gene with protein product						12801912, 16430861	Standard	NM_022126		Approved	HDHD2B	uc001lhs.2	Q9H008	OTTHUMG00000019214	ENST00000368842.5:c.468-1G>T	10.37:g.126185530G>T			B3KP20|Q2TBE9|Q5VUV9|Q5VUW0	Silent	SNP	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_hyp2,tigrfam_HAD-SF_hydro_IIA	p.G156	ENST00000368842.5	37	c.468	CCDS7640.1	10																																																																																			LHPP	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIA_hyp2,tigrfam_HAD-SF_hydro_IIA	ENSG00000107902		0.602	LHPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHPP	HGNC	protein_coding	OTTHUMT00000050870.1	-	0.00	26	0	G	NM_022126	Silent	126185530	+1	tier1	rs146652970	no_errors	ENST00000368842	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.886	T
LILRB5	10990	genome.wustl.edu	37	19	54756400	54756400	+	Missense_Mutation	SNP	C	C	T	rs367690586		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:54756400C>T	ENST00000316219.5	-	10	1591	c.1484G>A	c.(1483-1485)cGt>cAt	p.R495H	LILRB5_ENST00000345866.6_Missense_Mutation_p.R396H|CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000450632.1_Missense_Mutation_p.R487H|LILRB5_ENST00000449561.2_Missense_Mutation_p.R496H	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	495					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.R495H(2)|p.R487H(2)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCCTGCAGGACGGTAGAAATG	0.597																																																	4	Substitution - Missense(4)	large_intestine(2)|prostate(2)						C	HIS/ARG,HIS/ARG,HIS/ARG	0,4406		0,0,2203	83.0	80.0	81.0		1487,1187,1484	-3.1	0.0	19		81	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense,missense	LILRB5	NM_001081442.1,NM_001081443.1,NM_006840.3	29,29,29	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	benign,benign,benign	496/592,396/492,495/591	54756400	2,13004	2203	4300	6503	SO:0001583	missense	0			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1484G>A	19.37:g.54756400C>T	ENSP00000320390:p.Arg495His		Q8N760	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R487H	ENST00000316219.5	37	c.1460	CCDS12885.1	19	.	.	.	.	.	.	.	.	.	.	C	4.006	-0.001534	0.07819	0.0	2.33E-4	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00479	7.12;7.13;7.12;7.16	1.57	-3.14	0.05250	.	.	.	.	.	T	0.00178	0.0005	N	0.16790	0.44	0.09310	N	1	B;B;B;P	0.46784	0.032;0.013;0.099;0.884	B;B;B;B	0.38056	0.013;0.013;0.015;0.264	T	0.40346	-0.9568	9	0.07644	T	0.81	.	0.9829	0.01440	0.2361:0.3953:0.1794:0.1893	.	487;396;496;495	C9JMK7;O75023-2;O75023-3;O75023	.;.;.;LIRB5_HUMAN	H	495;487;496;396	ENSP00000320390:R495H;ENSP00000414225:R487H;ENSP00000406478:R496H;ENSP00000263430:R396H	ENSP00000320390:R495H	R	-	2	0	LILRB5	59448212	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.670000	0.05256	-2.029000	0.00930	-0.745000	0.03516	CGT	LILRB5	-	NULL	ENSG00000105609		0.597	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	-	0.00	18	0	C			54756400	-1	tier1	-	no_errors	ENST00000450632	ensembl	human	known	74_37	missense	50.00	21	21	SNP	0.000	T
LINC00221	338005	genome.wustl.edu	37	14	106950223	106950223	+	lincRNA	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:106950223T>C	ENST00000334298.3	+	0	418					NR_027457.2				long intergenic non-protein coding RNA 221																		GTCAAAATTGTTTCTTGGATG	0.463																																																	0																																												0			AK058096		14q32.33	2013-05-31	2011-08-11	2011-08-11	ENSG00000187156	ENSG00000270816		"""Long non-coding RNAs"""	20169	non-coding RNA	RNA, long non-coding			"""chromosome 14 open reading frame 98"", ""non-protein coding RNA 221"""	C14orf98, NCRNA00221			Standard	NR_027457		Approved		uc001ysy.2		OTTHUMG00000152084		14.37:g.106950223T>C				RNA	SNP	-	NULL	ENST00000334298.3	37	NULL		14																																																																																			LINC00221	-	-	ENSG00000187156		0.463	LINC00221-002	KNOWN	basic	lincRNA	LINC00221	HGNC	lincRNA	OTTHUMT00000325180.1	-	0.00	65	0	T	NR_027457		106950223	+1	tier1	-	no_errors	ENST00000334298	ensembl	human	known	74_37	rna	32.73	37	18	SNP	0.022	C
LINC00469	283982	genome.wustl.edu	37	17	71819917	71819917	+	lincRNA	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:71819917G>A	ENST00000321800.7	-	0	120							Q8N7U9	CQ054_HUMAN	long intergenic non-protein coding RNA 469																		ggatatgtctggacacatttc	0.552																																																	0																																												0			AK097638		17q25.1	2012-10-12	2011-08-31	2011-08-31	ENSG00000177338	ENSG00000177338		"""Long non-coding RNAs"""	26863	non-coding RNA	RNA, long non-coding			"""chromosome 17 open reading frame 54"""	C17orf54			Standard	NR_027146		Approved	FLJ40319	uc010dfo.2	Q8N7U9	OTTHUMG00000167833		17.37:g.71819917G>A			Q495E4	RNA	SNP	-	NULL	ENST00000321800.7	37	NULL		17																																																																																			LINC00469	-	-	ENSG00000177338		0.552	LINC00469-001	KNOWN	basic	lincRNA	LINC00469	HGNC	lincRNA	OTTHUMT00000396490.1	-	0.00	39	0	G	NM_182564		71819917	-1	tier1	-	no_errors	ENST00000321800	ensembl	human	known	74_37	rna	64.52	11	20	SNP	0.038	A
LIPG	9388	genome.wustl.edu	37	18	47107823	47107823	+	Missense_Mutation	SNP	G	G	T	rs138921240		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:47107823G>T	ENST00000261292.4	+	6	1110	c.832G>T	c.(832-834)Gtc>Ttc	p.V278F	LIPG_ENST00000427224.2_Missense_Mutation_p.V204F|LIPG_ENST00000577628.1_Missense_Mutation_p.V314F|LIPG_ENST00000580036.1_Missense_Mutation_p.V278F	NM_006033.2	NP_006024.1	Q9Y5X9	LIPE_HUMAN	lipase, endothelial	278					cell proliferation (GO:0008283)|cholesterol homeostasis (GO:0042632)|high-density lipoprotein particle remodeling (GO:0034375)|lipid metabolic process (GO:0006629)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of high-density lipoprotein particle clearance (GO:0010983)|regulation of lipoprotein metabolic process (GO:0050746)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)	extracellular space (GO:0005615)	heparin binding (GO:0008201)|lipoprotein lipase activity (GO:0004465)|phosphatidylcholine 1-acylhydrolase activity (GO:0008970)|phospholipase activity (GO:0004620)	p.V278I(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(2)	18						TGAGCGAGCCGTCCACCTCTT	0.493																																					Pancreas(126;280 1778 12814 26243 34948)												1	Substitution - Missense(1)	prostate(1)											102.0	98.0	99.0					18																	47107823		2203	4300	6503	SO:0001583	missense	0			AF118767	CCDS11938.1	18q21.1	2006-04-22				ENSG00000101670			6623	protein-coding gene	gene with protein product		603684				10318835, 10192396	Standard	XM_005258390		Approved	EDL	uc002ldv.3	Q9Y5X9		ENST00000261292.4:c.832G>T	18.37:g.47107823G>T	ENSP00000261292:p.Val278Phe		B0LPG6|Q6P9C8|Q6UW82	Missense_Mutation	SNP	pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pirsf_Lipoprotein_lipase_LIPH,pfscan_PLAT/LH2_dom,prints_Lipase,prints_Lipo_Lipase,prints_Lipase_hep	p.V278F	ENST00000261292.4	37	c.832	CCDS11938.1	18	.	.	.	.	.	.	.	.	.	.	G	17.55	3.416684	0.62511	.	.	ENSG00000101670	ENST00000261292;ENST00000427224	D;D	0.92149	-2.98;-2.98	5.79	3.08	0.35506	Lipase, N-terminal (1);	0.165697	0.52532	D	0.000063	D	0.94735	0.8301	M	0.70842	2.15	0.58432	D	0.999991	P;D;D	0.67145	0.951;0.994;0.996	P;D;D	0.72338	0.847;0.977;0.926	D	0.93795	0.7096	10	0.87932	D	0	-22.4129	11.1305	0.48343	0.1987:0.0:0.8013:0.0	.	204;278;278	B4DTR8;Q9Y5X9;Q9Y5X9-2	.;LIPE_HUMAN;.	F	278;204	ENSP00000261292:V278F;ENSP00000387978:V204F	ENSP00000261292:V278F	V	+	1	0	LIPG	45361821	1.000000	0.71417	0.008000	0.14137	0.614000	0.37383	3.599000	0.54045	0.390000	0.25115	-0.224000	0.12420	GTC	LIPG	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase	ENSG00000101670		0.493	LIPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPG	HGNC	protein_coding	OTTHUMT00000447546.1		0.00	35	0	G	NM_006033		47107823	+1			no_errors	ENST00000261292	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.924	T
LMX1B	4010	genome.wustl.edu	37	9	129455488	129455488	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:129455488C>T	ENST00000373474.4	+	4	634	c.627C>T	c.(625-627)agC>agT	p.S209S	LMX1B_ENST00000561065.1_Silent_p.S186S|LMX1B_ENST00000526117.1_Silent_p.S209S|LMX1B_ENST00000425646.2_Silent_p.S186S|LMX1B_ENST00000355497.5_Silent_p.S209S			O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	209					cell proliferation (GO:0008283)|central nervous system neuron development (GO:0021954)|cerebellum morphogenesis (GO:0021587)|collagen fibril organization (GO:0030199)|dopaminergic neuron differentiation (GO:0071542)|dorsal/ventral pattern formation (GO:0009953)|in utero embryonic development (GO:0001701)|limb morphogenesis (GO:0035108)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|organ growth (GO:0035265)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|trabecular meshwork development (GO:0002930)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	15						GCAAGGGCAGCGGGGATGACG	0.647									Nail-Patella Syndrome																												Pancreas(110;1796 2278 18357 20466)												0													36.0	35.0	36.0					9																	129455488		2197	4297	6494	SO:0001819	synonymous_variant	0	Familial Cancer Database	Osteo-Onychodysplasia, Turner-Kieser syndrome, Fong disease	U77457	CCDS6866.1, CCDS6866.2, CCDS55342.1, CCDS55343.1	9q33.3	2011-06-20			ENSG00000136944	ENSG00000136944		"""Homeoboxes / LIM class"""	6654	protein-coding gene	gene with protein product		602575		NPS1		9441763, 9590287	Standard	NM_002316		Approved		uc004bqj.3	O60663	OTTHUMG00000020692	ENST00000373474.4:c.627C>T	9.37:g.129455488C>T			F8W7W6|O75463|Q5JU95|Q6ISC9	Silent	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.S209	ENST00000373474.4	37	c.627	CCDS55342.1	9																																																																																			LMX1B	-	superfamily_Homeodomain-like	ENSG00000136944		0.647	LMX1B-002	KNOWN	basic|CCDS	protein_coding	LMX1B	HGNC	protein_coding	OTTHUMT00000054123.2	-	0.00	50	0	C			129455488	+1	tier1	-	no_errors	ENST00000355497	ensembl	human	known	74_37	silent	55.81	19	24	SNP	0.989	T
AL592284.1	0	genome.wustl.edu	37	1	144520978	144520978	+	3'UTR	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:144520978G>T	ENST00000538264.1	+	0	993				RP11-640M9.1_ENST00000442509.1_RNA|RP11-640M9.1_ENST00000414344.1_RNA|RP11-640M9.1_ENST00000437785.1_RNA|RP11-640M9.1_ENST00000430014.1_RNA|RP11-640M9.1_ENST00000435404.1_RNA|RP11-640M9.1_ENST00000426786.1_RNA|RP11-640M9.1_ENST00000458262.1_RNA|RP11-640M9.1_ENST00000411760.1_RNA|RP11-640M9.1_ENST00000411941.1_RNA																							AGGGGCTGAAGGCCAACTGGT	0.542																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000538264.1:c.*146G>T	1.37:g.144520978G>T				RNA	SNP	-	NULL	ENST00000538264.1	37	NULL		1																																																																																			RP11-640M9.1	-	-	ENSG00000236943		0.542	AL592284.1-201	NOVEL	basic|appris_principal	protein_coding	LOC101929438	Clone_based_vega_gene	protein_coding		-	0.00	63	0	G			144520978	-1	tier1	-	no_errors	ENST00000411941	ensembl	human	known	74_37	rna	51.14	43	45	SNP	1.000	T
LOXHD1	125336	genome.wustl.edu	37	18	44127006	44127006	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:44127006G>A	ENST00000398722.4	-	15	2531	c.2532C>T	c.(2530-2532)tgC>tgT	p.C844C	LOXHD1_ENST00000536736.1_Silent_p.C1122C|LOXHD1_ENST00000441551.2_Silent_p.C916C|LOXHD1_ENST00000579038.1_5'UTR|LOXHD1_ENST00000300591.6_Silent_p.C11C|LOXHD1_ENST00000582408.1_Silent_p.C11C|LOXHD1_ENST00000441893.2_Silent_p.C55C			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	844	PLAT 6. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GCCAACGTTGGCATGGAAAGT	0.562																																																	0													54.0	54.0	54.0					18																	44127006		692	1591	2283	SO:0001819	synonymous_variant	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2532C>T	18.37:g.44127006G>A			B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.C1122	ENST00000398722.4	37	c.3366		18	.	.	.	.	.	.	.	.	.	.	G	8.921	0.961055	0.18583	.	.	ENSG00000167210	ENST00000441551	.	.	.	5.05	2.29	0.28610	.	.	.	.	.	T	0.58524	0.2128	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52888	-0.8515	4	.	.	.	.	9.7005	0.40184	0.2249:0.0:0.7751:0.0	.	.	.	.	S	1103	.	.	P	-	1	0	LOXHD1	42381004	1.000000	0.71417	0.969000	0.41365	0.943000	0.58893	1.669000	0.37492	0.535000	0.28714	0.563000	0.77884	CCA	LOXHD1	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	ENSG00000167210		0.562	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding			0.00	30	0	G	NM_144612		44127006	-1			no_errors	ENST00000536736	ensembl	human	known	74_37	silent	8.82	31	3	SNP	1.000	A
LPAR1	1902	genome.wustl.edu	37	9	113704324	113704324	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:113704324A>T	ENST00000374431.3	-	4	553	c.170T>A	c.(169-171)aTc>aAc	p.I57N	LPAR1_ENST00000374430.2_Missense_Mutation_p.I57N|LPAR1_ENST00000538760.1_Missense_Mutation_p.I58N|LPAR1_ENST00000541779.1_Missense_Mutation_p.I58N|LPAR1_ENST00000358883.4_Missense_Mutation_p.I57N	NM_057159.2	NP_476500.1	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1	57					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|bleb assembly (GO:0032060)|cellular response to oxygen levels (GO:0071453)|G-protein coupled receptor signaling pathway (GO:0007186)|myelination (GO:0042552)|negative regulation of neuron projection development (GO:0010977)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell chemotaxis (GO:0071673)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(6)|skin(1)	21						ACAAACAGTGATTCCAAGTCC	0.433																																					NSCLC(115;661 2323 9836 34256)												0													116.0	104.0	108.0					9																	113704324		2203	4300	6503	SO:0001583	missense	0			U80811	CCDS6777.1	9q	2012-08-08	2008-04-11	2008-04-11	ENSG00000198121	ENSG00000198121		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3166	protein-coding gene	gene with protein product		602282	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2"""	EDG2		8922387, 9070858	Standard	NM_001401		Approved	edg-2, rec.1.3, vzg-1, Gpcr26, Mrec1.3, LPA1, GPR26	uc004bfc.3	Q92633	OTTHUMG00000020486	ENST00000374431.3:c.170T>A	9.37:g.113704324A>T	ENSP00000363553:p.Ile57Asn		B4DK36|O00656|O00722|P78351	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_LPA_rcpt_EDG2,prints_LPA_rcpt,prints_GPCR_Rhodpsn	p.I58N	ENST00000374431.3	37	c.173	CCDS6777.1	9	.	.	.	.	.	.	.	.	.	.	A	19.42	3.824309	0.71143	.	.	ENSG00000198121	ENST00000374431;ENST00000541779;ENST00000374430;ENST00000358883;ENST00000449490;ENST00000538760;ENST00000441240	T;T;T;T;T;T	0.39056	1.1;1.1;1.1;1.1;1.1;1.1	5.36	5.36	0.76844	.	0.088725	0.64402	D	0.000001	T	0.39009	0.1062	L	0.40543	1.245	0.80722	D	1	P;P;P	0.47841	0.901;0.901;0.901	B;B;B	0.42916	0.402;0.402;0.402	T	0.38394	-0.9663	10	0.87932	D	0	.	14.5418	0.67999	1.0:0.0:0.0:0.0	.	58;58;57	B4DQ18;B4DK36;Q92633	.;.;LPAR1_HUMAN	N	57;58;57;57;39;58;57	ENSP00000363553:I57N;ENSP00000445697:I58N;ENSP00000363552:I57N;ENSP00000351755:I57N;ENSP00000440201:I58N;ENSP00000401810:I57N	ENSP00000351755:I57N	I	-	2	0	LPAR1	112744145	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.049000	0.60858	0.533000	0.62120	ATC	LPAR1	-	prints_GPCR_Rhodpsn	ENSG00000198121		0.433	LPAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR1	HGNC	protein_coding	OTTHUMT00000053631.1	-	0.00	14	0	A	NM_057159		113704324	-1	tier1	-	no_errors	ENST00000538760	ensembl	human	known	74_37	missense	35.71	18	10	SNP	1.000	T
LRFN1	57622	genome.wustl.edu	37	19	39799033	39799033	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:39799033C>T	ENST00000248668.4	-	2	1555	c.1556G>A	c.(1555-1557)gGg>gAg	p.G519E		NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	519	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.					cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CGCCGGATCCCCAGCGGTGGT	0.682																																																	0													12.0	16.0	15.0					19																	39799033		2095	4209	6304	SO:0001583	missense	0			BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1556G>A	19.37:g.39799033C>T	ENSP00000248668:p.Gly519Glu		Q8TBS9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G519E	ENST00000248668.4	37	c.1556	CCDS46071.1	19	.	.	.	.	.	.	.	.	.	.	C	0.361	-0.939603	0.02322	.	.	ENSG00000128011	ENST00000248668	T	0.60548	0.18	4.17	4.17	0.49024	Fibronectin, type III (1);	0.000000	0.39083	N	0.001475	T	0.24084	0.0583	N	0.02247	-0.625	0.09310	N	0.999999	B	0.15141	0.012	B	0.15870	0.014	T	0.27468	-1.0073	10	0.02654	T	1	.	7.7631	0.28963	0.0:0.8885:0.0:0.1115	.	519	Q9P244	LRFN1_HUMAN	E	519	ENSP00000248668:G519E	ENSP00000248668:G519E	G	-	2	0	LRFN1	44490873	0.000000	0.05858	0.670000	0.29842	0.734000	0.41952	0.163000	0.16520	2.176000	0.68965	0.462000	0.41574	GGG	LRFN1	-	superfamily_Fibronectin_type3	ENSG00000128011		0.682	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN1	HGNC	protein_coding	OTTHUMT00000463835.1	-	0.00	13	0	C	NM_020862		39799033	-1	tier1	-	no_errors	ENST00000248668	ensembl	human	known	74_37	missense	47.06	9	8	SNP	0.178	T
LRP1B	53353	genome.wustl.edu	37	2	140997075	140997075	+	Missense_Mutation	SNP	C	C	T	rs369522771		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:140997075C>T	ENST00000389484.3	-	88	14322	c.13351G>A	c.(13351-13353)Gtc>Atc	p.V4451I		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4451					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACCAAGAGGACGAGAGGCACA	0.318										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0								C	ILE/VAL	1,4395	2.1+/-5.4	0,1,2197	100.0	93.0	96.0		13351	4.6	1.0	2		96	0,8598		0,0,4299	no	missense	LRP1B	NM_018557.2	29	0,1,6496	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	4451/4600	140997075	1,12993	2198	4299	6497	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13351G>A	2.37:g.140997075C>T	ENSP00000374135:p.Val4451Ile		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.V4451I	ENST00000389484.3	37	c.13351	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	12.83	2.056500	0.36277	2.27E-4	0.0	ENSG00000168702	ENST00000389484;ENST00000544579	T	0.42513	0.97	5.47	4.59	0.56863	.	0.164149	0.39759	U	0.001270	T	0.29093	0.0723	L	0.38175	1.15	0.37605	D	0.920719	P	0.45715	0.865	B	0.32465	0.146	T	0.22382	-1.0218	10	0.34782	T	0.22	.	14.1302	0.65247	0.0:0.9274:0.0:0.0726	.	4451	Q9NZR2	LRP1B_HUMAN	I	4451;4389	ENSP00000374135:V4451I	ENSP00000374135:V4451I	V	-	1	0	LRP1B	140713545	1.000000	0.71417	0.962000	0.40283	0.019000	0.09904	4.406000	0.59748	1.308000	0.44962	-0.218000	0.12543	GTC	LRP1B	-	NULL	ENSG00000168702		0.318	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2		0.00	27	0	C	NM_018557		140997075	-1			no_errors	ENST00000389484	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
LRRC16A	55604	genome.wustl.edu	37	6	25620262	25620262	+	3'UTR	SNP	C	C	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:25620262C>G	ENST00000329474.6	+	0	4935				LRRC16A_ENST00000476458.1_3'UTR	NM_001173977.1|NM_017640.5	NP_001167448.1|NP_060110.4	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization (GO:0007015)|barbed-end actin filament uncapping (GO:0051638)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|lamellipodium assembly (GO:0030032)|negative regulation of barbed-end actin filament capping (GO:2000813)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of lamellipodium organization (GO:1902745)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|ruffle organization (GO:0031529)|urate metabolic process (GO:0046415)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|lamellipodium (GO:0030027)|nucleus (GO:0005634)	protein complex binding (GO:0032403)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	50						CAAATCCGCACAGGACTCAAT	0.343																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK000055	CCDS54973.1	6p22.1	2010-09-10	2008-02-12	2008-02-12	ENSG00000079691	ENSG00000079691			21581	protein-coding gene	gene with protein product	"""capping protein, Arp2/3, and Myosin-I Linker homolog 1 (Dictyostelium)"""	609593	"""leucine rich repeat containing 16"""	LRRC16		19846667	Standard	NM_017640		Approved	dJ501N12.1, FLJ20048, CARMIL, CARMIL1	uc011djw.2	Q5VZK9	OTTHUMG00000014393	ENST00000329474.6:c.*451C>G	6.37:g.25620262C>G			B8X1J0|Q6ZUH5|Q6ZW07|Q9NXU7	RNA	SNP	-	NULL	ENST00000329474.6	37	NULL	CCDS54973.1	6																																																																																			LRRC16A	-	-	ENSG00000079691		0.343	LRRC16A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC16A	HGNC	protein_coding	OTTHUMT00000040045.2	-	0.00	24	0	C	NM_017640		25620262	+1	tier1	-	no_errors	ENST00000476458	ensembl	human	known	74_37	rna	37.84	23	14	SNP	0.803	G
LRRC8C	84230	genome.wustl.edu	37	1	90178646	90178646	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:90178646C>T	ENST00000370454.4	+	3	772	c.517C>T	c.(517-519)Cgg>Tgg	p.R173W	LRRC8C_ENST00000479252.1_Intron|RP11-302M6.4_ENST00000370453.5_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	173					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		TTGGACCACACGGGCTTTATC	0.463																																																	0													73.0	75.0	74.0					1																	90178646		2203	4300	6503	SO:0001583	missense	0				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.517C>T	1.37:g.90178646C>T	ENSP00000359483:p.Arg173Trp		B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.R173W	ENST00000370454.4	37	c.517	CCDS725.1	1	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504915	0.64410	.	.	ENSG00000171488	ENST00000370454	T	0.27890	1.64	5.94	0.0241	0.14140	.	0.000000	0.85682	D	0.000000	T	0.37999	0.1024	M	0.72118	2.19	0.38100	D	0.937243	D	0.89917	1.0	D	0.79784	0.993	T	0.42699	-0.9436	10	0.87932	D	0	.	10.6829	0.45826	0.577:0.3531:0.0:0.0699	.	173	Q8TDW0	LRC8C_HUMAN	W	173	ENSP00000359483:R173W	ENSP00000359483:R173W	R	+	1	2	LRRC8C	89951234	0.965000	0.33210	0.646000	0.29493	0.993000	0.82548	2.337000	0.43947	0.078000	0.16900	0.650000	0.86243	CGG	LRRC8C	-	NULL	ENSG00000171488		0.463	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	HGNC	protein_coding	OTTHUMT00000028435.2	-	0.00	27	0	C	NM_032270		90178646	+1	tier1	-	no_errors	ENST00000370454	ensembl	human	known	74_37	missense	31.48	37	17	SNP	0.183	T
LRRK2	120892	genome.wustl.edu	37	12	40677810	40677810	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:40677810G>T	ENST00000298910.7	+	19	2433	c.2375G>T	c.(2374-2376)aGg>aTg	p.R792M	LRRK2_ENST00000343742.2_Missense_Mutation_p.R792M	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	792					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TTGCTCTTAAGGAGGCTGGCC	0.443																																																	0													157.0	157.0	157.0					12																	40677810		2203	4300	6503	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2375G>T	12.37:g.40677810G>T	ENSP00000298910:p.Arg792Met		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.R792M	ENST00000298910.7	37	c.2375	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	G	10.74	1.434978	0.25813	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.36699	1.24;1.24	5.05	-0.209	0.13180	Ankyrin repeat-containing domain (1);	0.431488	0.25414	N	0.030854	T	0.30070	0.0753	L	0.29908	0.895	0.09310	N	1	P;D	0.57899	0.651;0.981	B;P	0.49047	0.241;0.599	T	0.28170	-1.0052	9	.	.	.	.	11.3844	0.49776	0.5793:0.0:0.4207:0.0	.	792;792	E9PC85;Q5S007	.;LRRK2_HUMAN	M	792	ENSP00000341930:R792M;ENSP00000298910:R792M	.	R	+	2	0	LRRK2	38964077	0.033000	0.19621	0.017000	0.16124	0.505000	0.33919	0.038000	0.13862	-0.259000	0.09432	-0.229000	0.12294	AGG	LRRK2	-	NULL	ENSG00000188906		0.443	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	28	0	G	XM_058513		40677810	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	33.33	20	10	SNP	0.006	T
LRRTM4	80059	genome.wustl.edu	37	2	77746109	77746109	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:77746109T>C	ENST00000409093.1	-	3	1222	c.886A>G	c.(886-888)Act>Gct	p.T296A	LRRTM4_ENST00000409911.1_Missense_Mutation_p.T297A|LRRTM4_ENST00000409088.3_Missense_Mutation_p.T296A|LRRTM4_ENST00000409884.1_Missense_Mutation_p.T296A|LRRTM4_ENST00000409282.1_Missense_Mutation_p.T297A			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	296					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		GCATTGACAGTTTCCTGTGAG	0.378																																																	0													46.0	43.0	44.0					2																	77746109		1861	4106	5967	SO:0001583	missense	0			AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.886A>G	2.37:g.77746109T>C	ENSP00000386357:p.Thr296Ala		Q4FZ98|Q6UXJ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.T297A	ENST00000409093.1	37	c.889	CCDS46346.1	2	.	.	.	.	.	.	.	.	.	.	T	8.259	0.810832	0.16537	.	.	ENSG00000176204	ENST00000409911;ENST00000409884;ENST00000409093;ENST00000409088;ENST00000409282	T;T;T;T;T	0.04083	3.71;3.71;3.71;3.71;3.71	5.84	5.84	0.93424	.	0.158494	0.56097	D	0.000024	T	0.04092	0.0114	N	0.20445	0.575	0.43517	D	0.995789	B;B;B	0.13594	0.008;0.001;0.008	B;B;B	0.20577	0.017;0.01;0.03	T	0.43766	-0.9371	10	0.09590	T	0.72	.	15.0295	0.71696	0.0:0.0:0.0:1.0	.	297;296;296	Q4KMX1;Q86VH4-2;Q86VH4	.;.;LRRT4_HUMAN	A	297;296;296;296;297	ENSP00000387228:T297A;ENSP00000387297:T296A;ENSP00000386357:T296A;ENSP00000386236:T296A;ENSP00000386286:T297A	ENSP00000386236:T296A	T	-	1	0	LRRTM4	77599617	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.544000	0.45761	2.220000	0.72140	0.533000	0.62120	ACT	LRRTM4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000176204		0.378	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRRTM4	HGNC	protein_coding	OTTHUMT00000328225.1	-	0.00	22	0	T	NM_024993		77746109	-1	tier1	-	no_errors	ENST00000409911	ensembl	human	known	74_37	missense	32.50	27	13	SNP	1.000	C
LY75	4065	genome.wustl.edu	37	2	160692031	160692031	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:160692031G>A	ENST00000263636.4	-	26	3660	c.3633C>T	c.(3631-3633)tgC>tgT	p.C1211C	LY75_ENST00000554112.1_Silent_p.C1211C|LY75_ENST00000553424.1_Silent_p.C1211C|LY75-CD302_ENST00000504764.1_Silent_p.C1211C|LY75-CD302_ENST00000505052.1_Silent_p.C1211C	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	1211	C-type lectin 7. {ECO:0000255|PROSITE- ProRule:PRU00040}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		GATTGTCATTGCAATCAACTG	0.368																																																	0													86.0	79.0	81.0					2																	160692031		2203	4300	6503	SO:0001819	synonymous_variant	0			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.3633C>T	2.37:g.160692031G>A			O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Silent	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.C1211	ENST00000263636.4	37	c.3633	CCDS2211.1	2																																																																																			LY75	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000054219		0.368	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000255035.1	-	0.00	42	0	G			160692031	-1	tier1	-	no_errors	ENST00000554112	ensembl	human	known	74_37	silent	42.55	27	20	SNP	0.007	A
MACF1	23499	genome.wustl.edu	37	1	39906684	39906684	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:39906684G>T	ENST00000372915.3	+	72	18241	c.18154G>T	c.(18154-18156)Gaa>Taa	p.E6052*	MACF1_ENST00000539005.1_Nonsense_Mutation_p.E3964*|MACF1_ENST00000289893.4_Nonsense_Mutation_p.E4596*|MACF1_ENST00000564288.1_Nonsense_Mutation_p.E6153*|MACF1_ENST00000567887.1_Nonsense_Mutation_p.E6190*|MACF1_ENST00000317713.7_Nonsense_Mutation_p.E4094*|MACF1_ENST00000545844.1_Nonsense_Mutation_p.E4094*|MACF1_ENST00000361689.2_Nonsense_Mutation_p.E4094*			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	6052					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GACTATTAAGGAAGAGACAGA	0.383																																																	0													94.0	95.0	95.0					1																	39906684		2203	4300	6503	SO:0001587	stop_gained	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.18154G>T	1.37:g.39906684G>T	ENSP00000362006:p.Glu6052*		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.E4094*	ENST00000372915.3	37	c.12280		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	50|50	17.182722|17.182722	0.99881|0.99881	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	.|.	.|.	.|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	0.000000|.	0.64402|.	D|.	0.000013|.	.|T	.|0.76976	.|0.4063	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.74210	.|-0.3739	.|4	0.56958|.	D|.	0.05|.	.|.	20.2191|20.2191	0.98319|0.98319	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|V	4094;6052;4094;4094;3964;4596|3097	.|.	ENSP00000289893:E4596X|.	E|G	+|+	1|2	0|0	MACF1|MACF1	39679271|39679271	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	8.062000|8.062000	0.89475|0.89475	2.780000|2.780000	0.95670|0.95670	0.655000|0.655000	0.94253|0.94253	GAA|GGA	MACF1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000127603		0.383	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	52	0	G	NM_033044		39906684	+1	tier1	-	no_errors	ENST00000317713	ensembl	human	known	74_37	nonsense	6.33	74	5	SNP	1.000	T
MAGEA10	4109	genome.wustl.edu	37	X	151304073	151304073	+	Missense_Mutation	SNP	C	C	T	rs145553450	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:151304073C>T	ENST00000370323.4	-	4	336	c.20G>A	c.(19-21)cGt>cAt	p.R7H	MAGEA10_ENST00000244096.3_Missense_Mutation_p.R7H|RP11-1007I13.4_ENST00000509345.2_RNA	NM_001251828.1|NM_021048.4	NP_001238757.1|NP_066386	P43363	MAGAA_HUMAN	melanoma antigen family A, 10	7						nucleus (GO:0005634)		p.R7H(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					GCAGCGCTGACGCTTTGGAGC	0.602																																																	1	Substitution - Missense(1)	large_intestine(1)						C	HIS/ARG,,HIS/ARG	0,3833		0,0,0,1631,571	86.0	88.0	87.0		20,,20	0.6	0.0	X	dbSNP_134	87	1,6725		0,0,1,2428,1869	no	missense,intron,missense	MAGEA10,MAGEA10-MAGEA5	NM_001011543.1,NM_001204811.1,NM_021048.3	29,,29	0,0,1,4059,2440	TT,TC,T,CC,C		0.0149,0.0,0.0095	probably-damaging,,probably-damaging	7/370,,7/370	151304073	1,10558	2202	4298	6500	SO:0001583	missense	0				CCDS14705.1	Xq28	2009-03-13			ENSG00000124260	ENSG00000124260			6797	protein-coding gene	gene with protein product	"""MAGE-10 antigen"", ""melanoma-associated antigen 10"", ""cancer/testis antigen family 1, member 10"""	300343		MAGE10		8575766	Standard	NM_001011543		Approved	MGC10599, CT1.10	uc004ffl.3	P43363	OTTHUMG00000024180	ENST00000370323.4:c.20G>A	X.37:g.151304073C>T	ENSP00000359347:p.Arg7His			Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.R7H	ENST00000370323.4	37	c.20	CCDS14705.1	X	.	.	.	.	.	.	.	.	.	.	C	8.597	0.885841	0.17540	0.0	1.49E-4	ENSG00000124260	ENST00000370323;ENST00000244096;ENST00000444834;ENST00000427322	T;T;T;T	0.04502	3.61;3.61;3.61;3.61	2.54	0.552	0.17230	Melanoma associated antigen, MAGE, N-terminal (1);	4.932270	0.00531	N	0.000218	T	0.02888	0.0086	N	0.08118	0	0.09310	N	1	B	0.33748	0.423	B	0.26517	0.07	T	0.32161	-0.9917	10	0.56958	D	0.05	.	4.3557	0.11178	0.2587:0.4915:0.2498:0.0	.	7	P43363	MAGAA_HUMAN	H	7	ENSP00000359347:R7H;ENSP00000244096:R7H;ENSP00000406161:R7H;ENSP00000391977:R7H	ENSP00000244096:R7H	R	-	2	0	MAGEA10	151054729	0.000000	0.05858	0.000000	0.03702	0.330000	0.28571	0.488000	0.22371	0.035000	0.15519	0.292000	0.19580	CGT	MAGEA10	-	pfam_Melanoma_ass_antigen_N	ENSG00000124260		0.602	MAGEA10-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGEA10	HGNC	protein_coding	OTTHUMT00000060916.3	-	0.00	46	0	C	NM_021048		151304073	-1	tier1	rs145553450	no_errors	ENST00000244096	ensembl	human	known	74_37	missense	37.50	25	15	SNP	0.000	T
MAPK8	5599	genome.wustl.edu	37	10	49634074	49634074	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:49634074G>T	ENST00000374189.1	+	8	1013	c.832G>T	c.(832-834)Gtc>Ttc	p.V278F	MAPK8_ENST00000360332.3_Missense_Mutation_p.V278F|MAPK8_ENST00000395611.3_Intron|MAPK8_ENST00000374182.3_Missense_Mutation_p.V278F			P45983	MK08_HUMAN	mitogen-activated protein kinase 8	278	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to nitric oxide (GO:0071732)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of deacetylase activity (GO:0090045)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|programmed necrotic cell death (GO:0097300)|regulation of histone deacetylation (GO:0031063)|regulation of protein localization (GO:0032880)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to cadmium ion (GO:0046686)|response to stress (GO:0006950)|response to UV (GO:0009411)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|JUN kinase activity (GO:0004705)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|urinary_tract(2)	34		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		CTTCCCTGATGTCCTTTTCCC	0.383																																																	0													120.0	115.0	117.0					10																	49634074		2203	4300	6503	SO:0001583	missense	0			L26318	CCDS7223.1, CCDS7224.1, CCDS7225.1, CCDS7226.1, CCDS60527.1	10q11	2011-06-09			ENSG00000107643	ENSG00000107643	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6881	protein-coding gene	gene with protein product	"""JUN N-terminal kinase"""	601158		PRKM8		8137421, 8654373	Standard	NM_002750		Approved	JNK, JNK1, SAPK1	uc001jgp.3	P45983	OTTHUMG00000018172	ENST00000374189.1:c.832G>T	10.37:g.49634074G>T	ENSP00000363304:p.Val278Phe		B5BTZ5|B7ZLV4|D3DX88|D3DX92|Q15709|Q15712|Q15713|Q308M2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_MAPK_JNK	p.V278F	ENST00000374189.1	37	c.832	CCDS7224.1	10	.	.	.	.	.	.	.	.	.	.	G	27.3	4.818501	0.90790	.	.	ENSG00000107643	ENST00000374189;ENST00000374182;ENST00000374179;ENST00000360332;ENST00000374176	D;D;D;D;D	0.83335	-1.71;-1.71;-1.71;-1.71;-1.71	5.73	5.73	0.89815	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.80352	0.4607	L	0.31804	0.96	0.80722	D	1	B;B;B;B	0.21905	0.014;0.062;0.062;0.05	B;B;B;B	0.33454	0.063;0.105;0.164;0.063	T	0.74115	-0.3769	10	0.44086	T	0.13	.	20.2602	0.98440	0.0:0.0:1.0:0.0	.	278;278;278;278	P45983-2;P45983;A1L4K2;P45983-3	.;MK08_HUMAN;.;.	F	278	ENSP00000363304:V278F;ENSP00000363297:V278F;ENSP00000363294:V278F;ENSP00000353483:V278F;ENSP00000363291:V278F	ENSP00000353483:V278F	V	+	1	0	MAPK8	49304080	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	6.716000	0.74702	2.861000	0.98227	0.655000	0.94253	GTC	MAPK8	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000107643		0.383	MAPK8-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAPK8	HGNC	protein_coding	OTTHUMT00000047931.1	-	0.00	32	0	G			49634074	+1	tier1	-	no_errors	ENST00000360332	ensembl	human	known	74_37	missense	15.00	17	3	SNP	1.000	T
MATN2	4147	genome.wustl.edu	37	8	98943561	98943561	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:98943561G>T	ENST00000520016.1	+	2	647	c.523G>T	c.(523-525)Gac>Tac	p.D175Y	MATN2_ENST00000521689.1_Missense_Mutation_p.D175Y|MATN2_ENST00000254898.5_Missense_Mutation_p.D175Y|MATN2_ENST00000524308.1_Missense_Mutation_p.D175Y|MATN2_ENST00000522025.2_Intron			O00339	MATN2_HUMAN	matrilin 2	175	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			GAGACCTCAGGACTCCGTGGC	0.577																																																	0													38.0	43.0	41.0					8																	98943561		2126	4245	6371	SO:0001583	missense	0			U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.523G>T	8.37:g.98943561G>T	ENSP00000430487:p.Asp175Tyr		A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	pfam_VWF_A,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_Matrilin_coiled-coil_trimer,smart_VWF_A,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_VWF_A	p.D175Y	ENST00000520016.1	37	c.523	CCDS55264.1	8	.	.	.	.	.	.	.	.	.	.	G	25.5	4.645705	0.87958	.	.	ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000378716;ENST00000524308;ENST00000520016	D;D;D;D	0.85171	-1.95;-1.95;-1.95;-1.95	5.82	5.82	0.92795	von Willebrand factor, type A (3);	0.000000	0.64402	D	0.000003	D	0.95868	0.8655	H	0.98155	4.16	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.96940	0.9687	10	0.87932	D	0	-39.4371	20.1001	0.97870	0.0:0.0:1.0:0.0	.	175;175;175;175	E9PF03;O00339-2;O00339;Q8N2G3	.;.;MATN2_HUMAN;.	Y	175	ENSP00000429977:D175Y;ENSP00000254898:D175Y;ENSP00000430221:D175Y;ENSP00000430487:D175Y	ENSP00000254898:D175Y	D	+	1	0	MATN2	99012737	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	9.807000	0.99171	2.760000	0.94817	0.655000	0.94253	GAC	MATN2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000132561		0.577	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	MATN2	HGNC	protein_coding	OTTHUMT00000380332.1		0.00	26	0	G			98943561	+1			no_errors	ENST00000254898	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	T
MBD1	4152	genome.wustl.edu	37	18	47799993	47799993	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:47799993C>T	ENST00000591416.1	-	12	1818	c.1387G>A	c.(1387-1389)Gca>Aca	p.A463T	MBD1_ENST00000587605.1_Missense_Mutation_p.A407T|MBD1_ENST00000382948.5_Missense_Mutation_p.A463T|MBD1_ENST00000457839.2_Missense_Mutation_p.A488T|MBD1_ENST00000339998.6_Missense_Mutation_p.A463T|MBD1_ENST00000269471.5_Missense_Mutation_p.A440T|MBD1_ENST00000585595.1_Missense_Mutation_p.A488T|MBD1_ENST00000347968.3_Missense_Mutation_p.A407T|MBD1_ENST00000585672.1_Missense_Mutation_p.A413T|MBD1_ENST00000398488.1_Missense_Mutation_p.A407T|MBD1_ENST00000591535.1_Missense_Mutation_p.A440T|MBD1_ENST00000398495.2_Missense_Mutation_p.A432T|MBD1_ENST00000424334.2_Missense_Mutation_p.A514T|MBD1_ENST00000436910.1_Missense_Mutation_p.A440T|MBD1_ENST00000269468.5_Missense_Mutation_p.A463T|MBD1_ENST00000349085.2_Missense_Mutation_p.A407T|MBD1_ENST00000398493.1_Missense_Mutation_p.A407T|MBD1_ENST00000353909.3_Missense_Mutation_p.A414T|MBD1_ENST00000590208.1_Missense_Mutation_p.A463T|MBD1_ENST00000588937.1_Missense_Mutation_p.A440T			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	463					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						GGACTGCTTGCGCCTTCCCGT	0.632																																																	0													47.0	45.0	45.0					18																	47799993		2203	4300	6503	SO:0001583	missense	0			Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.1387G>A	18.37:g.47799993C>T	ENSP00000467017:p.Ala463Thr		A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_dom,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_CXXC	p.A514T	ENST00000591416.1	37	c.1540	CCDS11943.1	18	.	.	.	.	.	.	.	.	.	.	C	13.28	2.190563	0.38707	.	.	ENSG00000141644	ENST00000382948;ENST00000353909;ENST00000349085;ENST00000269468;ENST00000347968;ENST00000436910;ENST00000269471;ENST00000424334;ENST00000339998;ENST00000398495;ENST00000457839;ENST00000398493;ENST00000398488	D;D;D;D;D;D;D;D;D;D;D;D;D	0.97505	-3.7;-3.71;-3.84;-3.7;-3.74;-3.75;-3.76;-3.7;-3.69;-4.41;-3.69;-3.74;-3.84	4.44	3.56	0.40772	.	0.330287	0.26311	N	0.025105	D	0.94892	0.8349	N	0.11560	0.145	0.25189	N	0.990141	P;D;B;B;P;P;B;D;B;P;B;P	0.89917	0.705;1.0;0.236;0.107;0.521;0.805;0.276;1.0;0.107;0.591;0.107;0.591	B;D;B;B;B;B;B;D;B;B;B;B	0.79108	0.047;0.991;0.026;0.016;0.062;0.102;0.024;0.992;0.016;0.089;0.016;0.089	D	0.88208	0.2888	10	0.30854	T	0.27	-8.1563	7.6917	0.28571	0.0:0.8851:0.0:0.1149	.	407;514;440;463;463;440;414;407;463;407;488;407	B4DUR3;B4DI41;Q9UIS9-8;A8K654;Q9UIS9-6;Q9UIS9-2;Q9UIS9-5;Q9UIS9-4;Q9UIS9;Q9UIS9-7;B4DXJ5;Q9UIS9-3	.;.;.;.;.;.;.;.;MBD1_HUMAN;.;.;.	T	463;414;407;463;407;440;440;514;463;463;488;407;407	ENSP00000372407:A463T;ENSP00000269469:A414T;ENSP00000342531:A407T;ENSP00000269468:A463T;ENSP00000285102:A407T;ENSP00000409561:A440T;ENSP00000269471:A440T;ENSP00000408846:A514T;ENSP00000339546:A463T;ENSP00000381508:A463T;ENSP00000405268:A488T;ENSP00000381506:A407T;ENSP00000381502:A407T	ENSP00000269468:A463T	A	-	1	0	MBD1	46053991	0.959000	0.32827	0.995000	0.50966	0.987000	0.75469	1.790000	0.38734	1.438000	0.47492	0.555000	0.69702	GCA	MBD1	-	NULL	ENSG00000141644		0.632	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MBD1	HGNC	protein_coding	OTTHUMT00000255926.3	-	0.00	32	0	C	NM_015846		47799993	-1	tier1	-	no_errors	ENST00000424334	ensembl	human	known	74_37	missense	8.89	40	4	SNP	0.996	T
MDGA1	266727	genome.wustl.edu	37	6	37606423	37606423	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:37606423G>A	ENST00000434837.3	-	15	3735	c.2557C>T	c.(2557-2559)Cgg>Tgg	p.R853W	MDGA1_ENST00000297153.7_Missense_Mutation_p.R857W|MDGA1_ENST00000505425.1_Missense_Mutation_p.R853W	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	853	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						TTCCGGGACCGCACCAGGAGG	0.612																																																	0													37.0	43.0	41.0					6																	37606423		2057	4196	6253	SO:0001583	missense	0			AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.2557C>T	6.37:g.37606423G>A	ENSP00000402584:p.Arg853Trp		A6NHG0|Q8NBE3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Ig-like_dom	p.R857W	ENST00000434837.3	37	c.2569	CCDS47417.1	6	.	.	.	.	.	.	.	.	.	.	G	24.6	4.547862	0.86022	.	.	ENSG00000112139	ENST00000434837;ENST00000297153;ENST00000505425	T;T;T	0.02631	4.22;4.22;4.22	5.04	4.17	0.49024	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.300767	0.23114	N	0.051769	T	0.09512	0.0234	M	0.89353	3.025	0.32666	N	0.517485	D;D	0.89917	1.0;0.999	D;D	0.73708	0.981;0.913	T	0.02491	-1.1151	10	0.87932	D	0	.	11.0973	0.48152	0.0:0.0:0.6662:0.3338	.	853;853	Q8NFP4-2;Q8NFP4	.;MDGA1_HUMAN	W	853;857;853	ENSP00000402584:R853W;ENSP00000297153:R857W;ENSP00000422042:R853W	ENSP00000297153:R857W	R	-	1	2	MDGA1	37714401	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.525000	0.53502	1.217000	0.43442	0.650000	0.86243	CGG	MDGA1	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom	ENSG00000112139		0.612	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDGA1	HGNC	protein_coding	OTTHUMT00000040419.3	-	0.00	16	0	G			37606423	-1	tier1	-	no_errors	ENST00000297153	ensembl	human	known	74_37	missense	57.14	9	12	SNP	1.000	A
MDGA1	266727	genome.wustl.edu	37	6	37626178	37626178	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:37626178C>T	ENST00000434837.3	-	3	1403	c.225G>A	c.(223-225)acG>acA	p.T75T	MDGA1_ENST00000297153.7_Silent_p.T75T|MDGA1_ENST00000505425.1_Silent_p.T75T	NM_153487.3	NP_705691.1	Q8NFP4	MDGA1_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 1	75	Ig-like 1.				brain development (GO:0007420)|cerebral cortex radially oriented cell migration (GO:0021799)|neuron migration (GO:0001764)|spinal cord association neuron differentiation (GO:0021527)	anchored component of plasma membrane (GO:0046658)|extracellular space (GO:0005615)				central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	38						CGCTACCTGCCGTCTTGGTCC	0.657																																																	0													66.0	74.0	71.0					6																	37626178		2088	4201	6289	SO:0001819	synonymous_variant	0			AF478693	CCDS47417.1	6p21	2013-01-29			ENSG00000112139	ENSG00000112139		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19267	protein-coding gene	gene with protein product		609626				15922729, 15019943	Standard	NM_153487		Approved	GPIM, MAMDC3	uc003onu.1	Q8NFP4	OTTHUMG00000014626	ENST00000434837.3:c.225G>A	6.37:g.37626178C>T			A6NHG0|Q8NBE3	Silent	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Ig-like_dom	p.T75	ENST00000434837.3	37	c.225	CCDS47417.1	6																																																																																			MDGA1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000112139		0.657	MDGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MDGA1	HGNC	protein_coding	OTTHUMT00000040419.3	-	0.00	35	0	C			37626178	-1	tier1	-	no_errors	ENST00000297153	ensembl	human	known	74_37	silent	30.95	29	13	SNP	0.000	T
MFAP1	4236	genome.wustl.edu	37	15	44107214	44107214	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:44107214C>T	ENST00000267812.3	-	3	590	c.358G>A	c.(358-360)Gta>Ata	p.V120I		NM_005926.2	NP_005917.2	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	120					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(6)|skin(2)|upper_aerodigestive_tract(3)	15		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		TCTCCTTCTACTTCTGAGTCA	0.413																																																	0													259.0	235.0	243.0					15																	44107214		2198	4298	6496	SO:0001583	missense	0				CCDS10105.1	15q15-q21	2014-05-20			ENSG00000140259	ENSG00000140259			7032	protein-coding gene	gene with protein product		600215				7835894	Standard	NM_005926		Approved		uc001zth.1	P55081	OTTHUMG00000060145	ENST00000267812.3:c.358G>A	15.37:g.44107214C>T	ENSP00000267812:p.Val120Ile		Q86TG6	Missense_Mutation	SNP	pfam_MFAP1_C	p.V120I	ENST00000267812.3	37	c.358	CCDS10105.1	15	.	.	.	.	.	.	.	.	.	.	C	15.84	2.950937	0.53186	.	.	ENSG00000140259	ENST00000267812	.	.	.	5.77	3.87	0.44632	.	0.305106	0.37393	N	0.002111	T	0.41465	0.1160	L	0.47716	1.5	0.34262	D	0.680035	B	0.02656	0.0	B	0.01281	0.0	T	0.46484	-0.9188	9	0.37606	T	0.19	-11.1703	6.5814	0.22596	0.135:0.6656:0.1301:0.0693	.	120	P55081	MFAP1_HUMAN	I	120	.	ENSP00000267812:V120I	V	-	1	0	MFAP1	41894506	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.432000	0.52824	0.871000	0.35750	0.655000	0.94253	GTA	MFAP1	-	NULL	ENSG00000140259		0.413	MFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP1	HGNC	protein_coding	OTTHUMT00000133491.2	-	0.00	52	0	C	NM_005926		44107214	-1	tier1	-	no_errors	ENST00000267812	ensembl	human	known	74_37	missense	42.50	23	17	SNP	0.998	T
MICAL2	9645	genome.wustl.edu	37	11	12264300	12264300	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:12264300G>T	ENST00000256194.4	+	20	2927	c.2639G>T	c.(2638-2640)gGa>gTa	p.G880V	MICAL2_ENST00000379612.3_Intron|MICAL2_ENST00000527546.1_Intron|MICAL2_ENST00000342902.5_Missense_Mutation_p.G880V|MICAL2_ENST00000537344.1_Intron	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	880					actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		TCCATGTTTGGACACGGGGAT	0.532																																																	0													90.0	91.0	91.0					11																	12264300		2201	4294	6495	SO:0001583	missense	0			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.2639G>T	11.37:g.12264300G>T	ENSP00000256194:p.Gly880Val		B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,pfam_FAD_bind_dom,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.G880V	ENST00000256194.4	37	c.2639	CCDS7809.1	11	.	.	.	.	.	.	.	.	.	.	G	15.00	2.702856	0.48307	.	.	ENSG00000133816	ENST00000256194;ENST00000342902	T;T	0.63255	0.01;-0.03	6.07	5.11	0.69529	.	0.213990	0.30356	N	0.009801	T	0.67002	0.2847	L	0.27053	0.805	0.80722	D	1	D;B	0.64830	0.994;0.335	P;B	0.60886	0.88;0.058	T	0.66484	-0.5912	10	0.44086	T	0.13	.	18.7119	0.91661	0.0:0.1258:0.8742:0.0	.	880;880	G3XAC8;O94851	.;MICA2_HUMAN	V	880	ENSP00000256194:G880V;ENSP00000344894:G880V	ENSP00000256194:G880V	G	+	2	0	MICAL2	12220876	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.941000	0.63540	2.884000	0.98904	0.655000	0.94253	GGA	MICAL2	-	NULL	ENSG00000133816		0.532	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL2	HGNC	protein_coding	OTTHUMT00000385993.1	-	0.00	23	0	G	NM_014632		12264300	+1	tier1	-	no_errors	ENST00000256194	ensembl	human	known	74_37	missense	20.00	12	3	SNP	1.000	T
MID1	4281	genome.wustl.edu	37	X	10437871	10437871	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:10437871G>T	ENST00000317552.4	-	7	1551	c.1151C>A	c.(1150-1152)cCt>cAt	p.P384H	MID1_ENST00000380779.1_Missense_Mutation_p.P384H|MID1_ENST00000380780.1_Missense_Mutation_p.P384H|MID1_ENST00000380787.1_Missense_Mutation_p.P384H|MID1_ENST00000453318.2_Missense_Mutation_p.P384H|MID1_ENST00000380782.2_Missense_Mutation_p.P384H|MID1_ENST00000380785.1_Missense_Mutation_p.P384H	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1	384	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						AATTGTGGGAGGGTTGGGAGC	0.498																																																	0													125.0	99.0	108.0					X																	10437871		2203	4300	6503	SO:0001583	missense	0			Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.1151C>A	X.37:g.10437871G>T	ENSP00000312678:p.Pro384His		B2RCG2|O75361|Q9BZX5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.P384H	ENST00000317552.4	37	c.1151	CCDS14138.1	X	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438138	0.83885	.	.	ENSG00000101871	ENST00000453318;ENST00000317552;ENST00000380785;ENST00000380779;ENST00000380787;ENST00000380780;ENST00000380782;ENST00000454373;ENST00000413894	T;T;T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.78;0.78;0.78	5.46	5.46	0.80206	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.186004	0.47852	D	0.000202	T	0.59183	0.2175	L	0.40543	1.245	0.54753	D	0.99998	P;P;P	0.45768	0.468;0.468;0.866	P;P;P	0.58331	0.628;0.628;0.837	T	0.59101	-0.7517	10	0.52906	T	0.07	.	18.4718	0.90777	0.0:0.0:1.0:0.0	.	384;384;334	A8K5A0;O15344;B4DLX8	.;TRI18_HUMAN;.	H	384;384;384;384;384;384;384;334;384	ENSP00000414521:P384H;ENSP00000312678:P384H;ENSP00000370162:P384H;ENSP00000370156:P384H;ENSP00000370164:P384H;ENSP00000370157:P384H;ENSP00000370159:P384H;ENSP00000391154:P384H	ENSP00000312678:P384H	P	-	2	0	MID1	10397871	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.218000	0.95166	2.304000	0.77564	0.600000	0.82982	CCT	MID1	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000101871		0.498	MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MID1	HGNC	protein_coding	OTTHUMT00000055738.1	-	0.00	11	0	G			10437871	-1	tier1	-	no_errors	ENST00000317552	ensembl	human	known	74_37	missense	36.36	7	4	SNP	1.000	T
MID2	11043	genome.wustl.edu	37	X	107159335	107159335	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:107159335C>A	ENST00000262843.6	+	6	1725	c.1177C>A	c.(1177-1179)Cta>Ata	p.L393I	MID2_ENST00000443968.2_Missense_Mutation_p.L393I|RP6-191P20.4_ENST00000430140.1_RNA	NM_012216.3|NM_052817.2	NP_036348.2|NP_438112.2	Q9UJV3	TRIM1_HUMAN	midline 2	393	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.				innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein localization to microtubule (GO:0035372)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)	19						AAAGAAACTGCTAGAGGGGTT	0.318																																																	0													93.0	96.0	95.0					X																	107159335		2202	4300	6502	SO:0001583	missense	0				CCDS14532.2, CCDS14533.2	Xq22.1-q22.2	2013-02-11			ENSG00000080561	ENSG00000080561		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7096	protein-coding gene	gene with protein product		300204				10400986	Standard	NM_012216		Approved	FXY2, TRIM1, RNF60	uc004enl.3	Q9UJV3	OTTHUMG00000022171	ENST00000262843.6:c.1177C>A	X.37:g.107159335C>A	ENSP00000262843:p.Leu393Ile		A6NEL8|A6PVI5|Q5JYF5|Q8WWK1|Q9UJR9	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L393I	ENST00000262843.6	37	c.1177	CCDS14532.2	X	.	.	.	.	.	.	.	.	.	.	C	16.29	3.082146	0.55861	.	.	ENSG00000080561	ENST00000262843;ENST00000443968	T;T	0.62105	0.06;0.05	5.23	3.26	0.37387	Fibronectin, type III (1);COS domain (1);	0.084203	0.51477	D	0.000095	T	0.67720	0.2923	M	0.66939	2.045	0.42010	D	0.990938	P;P	0.51351	0.944;0.871	P;P	0.55011	0.752;0.766	T	0.67003	-0.5780	10	0.49607	T	0.09	.	7.5388	0.27727	0.0:0.746:0.0:0.254	.	393;393	Q9UJV3;Q9UJV3-2	TRIM1_HUMAN;.	I	393	ENSP00000262843:L393I;ENSP00000413976:L393I	ENSP00000262843:L393I	L	+	1	2	MID2	107045991	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.093000	0.30939	0.843000	0.35070	0.600000	0.82982	CTA	MID2	-	superfamily_Fibronectin_type3	ENSG00000080561		0.318	MID2-001	KNOWN	basic|CCDS	protein_coding	MID2	HGNC	protein_coding	OTTHUMT00000057852.2	-	0.00	21	0	C	NM_012216		107159335	+1	tier1	-	no_errors	ENST00000262843	ensembl	human	known	74_37	missense	33.33	18	9	SNP	0.999	A
MIPOL1	145282	genome.wustl.edu	37	14	37754580	37754580	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:37754580G>C	ENST00000327441.7	+	8	1017	c.551G>C	c.(550-552)aGa>aCa	p.R184T	MIPOL1_ENST00000539062.2_Missense_Mutation_p.R153T|MIPOL1_ENST00000545536.1_Missense_Mutation_p.R153T|MIPOL1_ENST00000556451.1_Missense_Mutation_p.R153T|MIPOL1_ENST00000536774.1_Missense_Mutation_p.R3T|MIPOL1_ENST00000396294.2_Missense_Mutation_p.R184T|MIPOL1_ENST00000537471.1_Missense_Mutation_p.R184T	NM_001195296.1|NM_001195297.1|NM_138731.6	NP_001182225.1|NP_001182226.1|NP_620059.1	Q8TD10	MIPO1_HUMAN	mirror-image polydactyly 1	184						nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23	Breast(36;0.119)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;6.03e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.047)|all cancers(34;0.0953)|LUSC - Lung squamous cell carcinoma(13;0.0975)|BRCA - Breast invasive adenocarcinoma(188;0.196)	GBM - Glioblastoma multiforme(112;0.0358)		GTTATGTCTAGACTGCAATTA	0.368																																																	0													215.0	199.0	205.0					14																	37754580		2203	4300	6503	SO:0001583	missense	0			AY059470	CCDS9664.1	14q13.3	2010-05-25			ENSG00000151338	ENSG00000151338			21460	protein-coding gene	gene with protein product		606850				11954550, 19667180	Standard	NM_001195296		Approved		uc001wuc.3	Q8TD10	OTTHUMG00000140252	ENST00000327441.7:c.551G>C	14.37:g.37754580G>C	ENSP00000333539:p.Arg184Thr		D3DSA4|Q7Z3J0|Q8IV14	Missense_Mutation	SNP	NULL	p.R184T	ENST00000327441.7	37	c.551	CCDS9664.1	14	.	.	.	.	.	.	.	.	.	.	G	24.8	4.565901	0.86439	.	.	ENSG00000151338	ENST00000327441;ENST00000536774;ENST00000539062;ENST00000556451;ENST00000396294;ENST00000537471;ENST00000545536	T;T;T;T;T;T	0.64260	-0.05;-0.04;-0.09;-0.05;-0.05;-0.09	5.4	5.4	0.78164	.	0.051511	0.64402	D	0.000001	T	0.80253	0.4589	M	0.76574	2.34	0.42198	D	0.991751	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.82504	-0.0424	10	0.87932	D	0	-9.8459	19.1734	0.93590	0.0:0.0:1.0:0.0	.	184;153	Q8TD10;Q49AL5	MIPO1_HUMAN;.	T	184;3;153;153;184;184;153	ENSP00000333539:R184T;ENSP00000438319:R153T;ENSP00000450479:R153T;ENSP00000379589:R184T;ENSP00000444254:R184T;ENSP00000442529:R153T	ENSP00000333539:R184T	R	+	2	0	MIPOL1	36824331	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	7.679000	0.84048	2.539000	0.85634	0.561000	0.74099	AGA	MIPOL1	-	NULL	ENSG00000151338		0.368	MIPOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPOL1	HGNC	protein_coding	OTTHUMT00000276734.1	-	0.00	52	0	G	NM_138731		37754580	+1	tier1	-	no_errors	ENST00000327441	ensembl	human	known	74_37	missense	39.71	41	27	SNP	1.000	C
LIMA1	51474	genome.wustl.edu	37	12	50627994	50627995	+	Intron	INS	-	-	T	rs530660438		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:50627994_50627995insT	ENST00000341247.4	-	3	269				MIR1293_ENST00000408677.1_RNA|LIMA1_ENST00000394943.3_Intron	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1						actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						CCAGAACAACCttttttttttt	0.475																																																	0																																										SO:0001627	intron_variant	0			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.120-2501->A	12.37:g.50628005_50628005dupT			B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	RNA	INS	-	NULL	ENST00000341247.4	37	NULL	CCDS8802.1	12																																																																																			MIR1293	-	-	ENSG00000221604		0.475	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	MIR1293	HGNC	protein_coding	OTTHUMT00000406235.2		0.00	15	0	-	NM_016357		50627995	-1	tier1		no_errors	ENST00000408677	ensembl	human	known	74_37	rna	10.53	17	2	INS	0.533:0.541	T
MIR548A1	693125	genome.wustl.edu	37	6	18572021	18572021	+	RNA	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:18572021G>T	ENST00000385041.1	+	0	7					NR_030312.1				microRNA 548a-1																		GCACTGCAGGGAGGTAttaag	0.318																																																	0													67.0	63.0	64.0					6																	18572021		1568	3582	5150			0					6p22.3	2011-09-12		2008-12-18	ENSG00000207775	ENSG00000207775		"""ncRNAs / Micro RNAs"""	32796	non-coding RNA	RNA, micro				MIRN548A1			Standard	NR_030312		Approved	hsa-mir-548a-1	uc021yme.1				6.37:g.18572021G>T				RNA	SNP	-	NULL	ENST00000385041.1	37	NULL		6																																																																																			MIR548A1	-	-	ENSG00000207775		0.318	MIR548A1-201	KNOWN	basic	miRNA	MIR548A1	HGNC	miRNA			0.00	29	0	G	NR_030312		18572021	+1			no_errors	ENST00000385041	ensembl	human	known	74_37	rna	9.76	37	4	SNP	0.001	T
STRN3	29966	genome.wustl.edu	37	14	31483858	31483858	+	Intron	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:31483858G>T	ENST00000357479.5	-	1	479				MIR624_ENST00000385217.1_RNA|STRN3_ENST00000355683.5_Intron	NM_001083893.1	NP_001077362.1	Q13033	STRN3_HUMAN	striatin, calmodulin binding protein 3						negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to estradiol (GO:0032355)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		AAACCACTTAGGTGTAATGCT	0.313																																																	0													47.0	42.0	43.0					14																	31483858		1502	3414	4916	SO:0001627	intron_variant	0				CCDS9641.1, CCDS41938.1	14q13-q21	2013-01-10			ENSG00000196792	ENSG00000196792		"""WD repeat domain containing"""	15720	protein-coding gene	gene with protein product	"""cell cycle S/G2 nuclear autoantigen"""	614766				7864889, 10681496	Standard	NM_014574		Approved	SG2NA	uc001wqu.2	Q13033	OTTHUMG00000140201	ENST00000357479.5:c.282+11251C>A	14.37:g.31483858G>T			A2RTX7|A6NHZ7|Q9NRA5	RNA	SNP	-	NULL	ENST00000357479.5	37	NULL	CCDS41938.1	14																																																																																			MIR624	-	-	ENSG00000207952		0.313	STRN3-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MIR624	HGNC	protein_coding	OTTHUMT00000409713.1	-	0.00	48	0	G	NM_014574		31483858	-1	tier1	-	no_errors	ENST00000385217	ensembl	human	known	74_37	rna	5.00	76	4	SNP	0.001	T
MOB3B	79817	genome.wustl.edu	37	9	27455333	27455333	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:27455333G>A	ENST00000262244.5	-	2	640	c.216C>T	c.(214-216)aaC>aaT	p.N72N		NM_024761.4	NP_079037.3	Q86TA1	MOB3B_HUMAN	MOB kinase activator 3B	72							metal ion binding (GO:0046872)										CATAGATGAGGTTGATCCGAT	0.557																																																	0													182.0	152.0	162.0					9																	27455333		2203	4300	6503	SO:0001819	synonymous_variant	0			AK023266	CCDS6520.1	9p21.1	2012-07-05	2011-09-28	2011-09-28	ENSG00000120162	ENSG00000120162		"""MOB kinase activators"""	23825	protein-coding gene	gene with protein product	"""monopolar spindle 1 binding, MOB1, domain containing"""		"""MOB1, Mps One Binder kinase activator-like 2B (yeast)"", ""chromosome 9 open reading frame 35"""	MOBKL2B, C9orf35		12477932	Standard	NM_024761		Approved	MOB1D, FLJ13204	uc003zqn.3	Q86TA1	OTTHUMG00000019717	ENST00000262244.5:c.216C>T	9.37:g.27455333G>A			Q8NEB4|Q9H8V4	Silent	SNP	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.N72	ENST00000262244.5	37	c.216	CCDS6520.1	9																																																																																			MOB3B	-	pfam_Mob1_phocein,superfamily_Mob1_phocein	ENSG00000120162		0.557	MOB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOB3B	HGNC	protein_coding	OTTHUMT00000051974.2	-	0.00	32	0	G	NM_024761		27455333	-1	tier1	-	no_errors	ENST00000262244	ensembl	human	known	74_37	silent	37.93	16	11	SNP	1.000	A
MRPS17	51373	genome.wustl.edu	37	7	56022767	56022767	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:56022767G>T	ENST00000285298.4	+	3	418	c.289G>T	c.(289-291)Gga>Tga	p.G97*	MRPS17_ENST00000426595.1_Nonsense_Mutation_p.G192*	NM_015969.2	NP_057053.1	Q9Y2R5	RT17_HUMAN	mitochondrial ribosomal protein S17	97					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	8	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TCCAGTGACAGGAAAGCCCTG	0.458																																																	0													91.0	91.0	91.0					7																	56022767		2203	4300	6503	SO:0001587	stop_gained	0			AB051352	CCDS5520.1	7p11-q11.21	2012-09-13			ENSG00000239789	ENSG00000239789		"""Mitochondrial ribosomal proteins / small subunits"""	14047	protein-coding gene	gene with protein product	"""28S ribosomal protein S17, mitochondrial"""	611980				11279123	Standard	NM_015969		Approved	HSPC011, RPMS17, MRP-S17	uc003trd.3	Q9Y2R5	OTTHUMG00000023153	ENST00000285298.4:c.289G>T	7.37:g.56022767G>T	ENSP00000285298:p.Gly97*		Q86X15	Nonsense_Mutation	SNP	pfam_Ribosomal_S17,superfamily_NA-bd_OB-fold	p.G97*	ENST00000285298.4	37	c.289	CCDS5520.1	7	.	.	.	.	.	.	.	.	.	.	G	45	11.740746	0.99597	.	.	ENSG00000249773;ENSG00000239789;ENSG00000239789	ENST00000426595;ENST00000285298;ENST00000443449	.	.	.	4.84	3.97	0.46021	.	0.097576	0.45361	D	0.000371	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	12.4406	0.55623	0.0805:0.0:0.9195:0.0	.	.	.	.	X	192;97;97	.	ENSP00000285298:G97X	G	+	1	0	MRPS17;RP11-15K19.2	55990261	1.000000	0.71417	0.977000	0.42913	0.997000	0.91878	7.341000	0.79300	1.268000	0.44264	0.655000	0.94253	GGA	MRPS17	-	superfamily_NA-bd_OB-fold	ENSG00000239789		0.458	MRPS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS17	HGNC	protein_coding	OTTHUMT00000251527.2		0.00	15	0	G	NM_015969		56022767	+1			no_errors	ENST00000285298	ensembl	human	known	74_37	nonsense	6.45	58	4	SNP	0.999	T
MTFMT	123263	genome.wustl.edu	37	15	65312612	65312613	+	Splice_Site	INS	-	-	A	rs368210383		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:65312612_65312613insA	ENST00000220058.4	-	5	659		c.e5-2		MTFMT_ENST00000561025.1_5'Flank	NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase							mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)			endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	TGAAATGAGCTACAAAAAAAAA	0.381																																																	0																																										SO:0001630	splice_region_variant	0			AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.646-2->T	15.37:g.65312613_65312613dupA			B7Z734	Splice_Site	INS	-	e5-2	ENST00000220058.4	37	c.646-3_646-2	CCDS45280.1	15																																																																																			MTFMT	-	-	ENSG00000103707		0.381	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTFMT	HGNC	protein_coding	OTTHUMT00000418155.1		0.00	8	0	-	NM_139242	Intron	65312613	-1	tier1		no_errors	ENST00000220058	ensembl	human	known	74_37	splice_site_ins	40.00	6	4	INS	0.991:0.138	A
MTFMT	123263	genome.wustl.edu	37	15	65295576	65295576	+	Silent	SNP	G	G	T	rs200286768		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:65295576G>T	ENST00000220058.4	-	9	1007	c.994C>A	c.(994-996)Cga>Aga	p.R332R		NM_139242.3	NP_640335.2	Q96DP5	FMT_HUMAN	mitochondrial methionyl-tRNA formyltransferase	332						mitochondrion (GO:0005739)	methionyl-tRNA formyltransferase activity (GO:0004479)	p.R332*(2)		endometrium(1)|large_intestine(3)|lung(3)|ovary(3)	10					Tetrahydrofolic acid(DB00116)	ATCACTGATCGAACACCAATC	0.378																																																	2	Substitution - Nonsense(2)	large_intestine(2)											73.0	63.0	66.0					15																	65295576		1864	4104	5968	SO:0001819	synonymous_variant	0			AK055688	CCDS45280.1	15q22.31	2006-11-29		2005-08-09		ENSG00000103707			29666	protein-coding gene	gene with protein product		611766				9614118	Standard	NM_139242		Approved	FMT1	uc002aof.4	Q96DP5		ENST00000220058.4:c.994C>A	15.37:g.65295576G>T			B7Z734	Silent	SNP	pfam_Formyl_transf_N,pfam_Formyl_trans_C,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,tigrfam_Fmt	p.R332	ENST00000220058.4	37	c.994	CCDS45280.1	15																																																																																			MTFMT	-	pfam_Formyl_trans_C,superfamily_Formyl_transferase_C-like,tigrfam_Fmt	ENSG00000103707		0.378	MTFMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTFMT	HGNC	protein_coding	OTTHUMT00000418155.1		0.00	26	0	G	NM_139242		65295576	-1			no_errors	ENST00000220058	ensembl	human	known	74_37	silent	7.14	26	2	SNP	0.104	T
MTMR6	9107	genome.wustl.edu	37	13	25831386	25831386	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr13:25831386G>T	ENST00000381801.5	-	9	1804	c.1043C>A	c.(1042-1044)tCc>tAc	p.S348Y	MTMR6_ENST00000482345.1_5'Flank|MTMR6_ENST00000540661.1_Missense_Mutation_p.S348Y	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	348	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		AGAACCCAGGGAACAAACCTG	0.383																																																	0													103.0	93.0	96.0					13																	25831386		2203	4300	6503	SO:0001583	missense	0			AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.1043C>A	13.37:g.25831386G>T	ENSP00000371221:p.Ser348Tyr		B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,smart_Tyr_Pase_cat	p.S348Y	ENST00000381801.5	37	c.1043	CCDS9313.1	13	.	.	.	.	.	.	.	.	.	.	G	26.6	4.752669	0.89753	.	.	ENSG00000139505	ENST00000540661;ENST00000541021;ENST00000381801	D;D	0.96200	-3.94;-3.94	5.49	5.49	0.81192	Myotubularin phosphatase domain (1);	0.050500	0.85682	D	0.000000	D	0.98713	0.9568	H	0.97682	4.055	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.979	D	0.99544	1.0964	10	0.87932	D	0	.	19.3809	0.94532	0.0:0.0:1.0:0.0	.	348;348	Q9Y217;Q9Y217-2	MTMR6_HUMAN;.	Y	348	ENSP00000443161:S348Y;ENSP00000371221:S348Y	ENSP00000371221:S348Y	S	-	2	0	MTMR6	24729386	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.807000	0.99171	2.573000	0.86826	0.650000	0.86243	TCC	MTMR6	-	smart_Tyr_Pase_cat	ENSG00000139505		0.383	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR6	HGNC	protein_coding	OTTHUMT00000044225.1		0.00	21	0	G	NM_004685		25831386	-1			no_errors	ENST00000381801	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	T
ASB12	142689	genome.wustl.edu	37	X	63444240	63444240	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:63444240A>C	ENST00000396130.2	-	2	904	c.905T>G	c.(904-906)aTt>aGt	p.I302S	MTMR8_ENST00000453546.1_Missense_Mutation_p.I686S|ASB12_ENST00000362002.2_Missense_Mutation_p.I311S			Q8WXK4	ASB12_HUMAN	ankyrin repeat and SOCS box containing 12	302	SOCS box.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)			p.0?(2)		endometrium(2)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14						TAGGTAGCTAATCAACATGGG	0.522																																																	2	Whole gene deletion(2)	ovary(1)|large_intestine(1)											153.0	114.0	128.0					X																	63444240		2203	4300	6503	SO:0001583	missense	0			AF403030	CCDS14378.1, CCDS14378.2	Xq11.1	2013-01-10	2011-01-25		ENSG00000198881	ENSG00000198881		"""Ankyrin repeat domain containing"""	19763	protein-coding gene	gene with protein product		300891	"""ankyrin repeat and SOCS box-containing 12"""			12076535	Standard	NM_130388		Approved	FLJ39577		Q8WXK4	OTTHUMG00000021705	ENST00000396130.2:c.905T>G	X.37:g.63444240A>C	ENSP00000379435:p.Ile302Ser		J3KP57|Q2M3D5|Q52LK4|Q6ISF9|Q8N8F5	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.I686S	ENST00000396130.2	37	c.2057		X	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002209	0.74932	.	.	ENSG00000198881;ENSG00000198881;ENSG00000198881;ENSG00000102043	ENST00000362002;ENST00000396130;ENST00000361287;ENST00000453546	T;T;T	0.48522	0.81;0.81;0.81	3.9	3.9	0.45041	SOCS protein, C-terminal (2);	0.289414	0.38111	N	0.001805	T	0.54367	0.1854	M	0.68593	2.085	0.26426	N	0.976023	D;D	0.59767	0.986;0.96	P;P	0.54815	0.761;0.679	T	0.48068	-0.9067	10	0.18276	T	0.48	-13.7881	11.4528	0.50162	1.0:0.0:0.0:0.0	.	686;302	B4DQL0;Q8WXK4	.;ASB12_HUMAN	S	311;302;279;686	ENSP00000355195:I311S;ENSP00000379435:I302S;ENSP00000394003:I686S	ENSP00000354626:I279S	I	-	2	0	ASB12;MTMR8	63360965	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.804000	0.38873	1.762000	0.52044	0.430000	0.28490	ATT	MTMR8	-	pfam_SOCS_C,smart_SOCS_C	ENSG00000102043		0.522	ASB12-201	KNOWN	basic|appris_candidate	protein_coding	MTMR8	HGNC	protein_coding		-	0.00	50	0	A			63444240	-1	tier1	-	no_errors	ENST00000453546	ensembl	human	known	74_37	missense	30.43	32	14	SNP	1.000	C
MTPAP	55149	genome.wustl.edu	37	10	30657516	30657516	+	5'UTR	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:30657516T>G	ENST00000488290.1	-	0	502				RN7SL241P_ENST00000482973.2_RNA			Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase						cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						GTGCTCGGCCTCAGCTTGTAG	0.597																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000488290.1:c.-3601A>C	10.37:g.30657516T>G			D3DRX0|Q659E3|Q6P7E5|Q9HA74	RNA	SNP	-	NULL	ENST00000488290.1	37	NULL		10																																																																																			MTPAP	-	-	ENSG00000107951		0.597	MTPAP-002	KNOWN	basic	processed_transcript	MTPAP	HGNC	protein_coding	OTTHUMT00000047427.1	-	0.00	43	0	T	NM_018109		30657516	-1	tier1	-	no_errors	ENST00000471055	ensembl	human	known	74_37	rna	36.36	35	20	SNP	0.150	G
MUC16	94025	genome.wustl.edu	37	19	9019293	9019293	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:9019293A>G	ENST00000397910.4	-	23	37797	c.37594T>C	c.(37594-37596)Tcc>Ccc	p.S12532P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12534					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.S12532T(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTTGGGAGGGAGAATGGAGTC	0.458																																																	1	Substitution - Missense(1)	lung(1)											79.0	74.0	76.0					19																	9019293		1889	4116	6005	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.37594T>C	19.37:g.9019293A>G	ENSP00000381008:p.Ser12532Pro		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S12532P	ENST00000397910.4	37	c.37594	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	2.301	-0.360198	0.05103	.	.	ENSG00000181143	ENST00000397910	T	0.02916	4.11	1.42	-2.23	0.06930	.	.	.	.	.	T	0.02888	0.0086	L	0.52573	1.65	.	.	.	B	0.06786	0.001	B	0.04013	0.001	T	0.42361	-0.9456	8	0.87932	D	0	.	2.3782	0.04347	0.4086:0.2926:0.2988:0.0	.	12532	B5ME49	.	P	12532	ENSP00000381008:S12532P	ENSP00000381008:S12532P	S	-	1	0	MUC16	8880293	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.052000	0.14163	-0.694000	0.05113	-0.842000	0.03052	TCC	MUC16	-	NULL	ENSG00000181143		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	40	0	A	NM_024690		9019293	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	34.21	25	13	SNP	0.000	G
MUC16	94025	genome.wustl.edu	37	19	9074068	9074068	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:9074068A>T	ENST00000397910.4	-	3	13581	c.13378T>A	c.(13378-13380)Ttg>Atg	p.L4460M		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4462	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTTGTGACCAAGAAAGGTGTC	0.512																																																	0													105.0	102.0	103.0					19																	9074068		2036	4193	6229	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.13378T>A	19.37:g.9074068A>T	ENSP00000381008:p.Leu4460Met		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.L4460M	ENST00000397910.4	37	c.13378	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	4.326	0.059838	0.08339	.	.	ENSG00000181143	ENST00000397910	T	0.21932	1.98	1.7	-3.41	0.04839	.	.	.	.	.	T	0.17066	0.0410	L	0.29908	0.895	.	.	.	D	0.58268	0.982	P	0.50570	0.644	T	0.14755	-1.0461	8	0.87932	D	0	.	3.9418	0.09331	0.3111:0.2072:0.4817:0.0	.	4460	B5ME49	.	M	4460	ENSP00000381008:L4460M	ENSP00000381008:L4460M	L	-	1	2	MUC16	8935068	0.000000	0.05858	0.000000	0.03702	0.198000	0.23893	-1.174000	0.03105	-1.255000	0.02481	0.254000	0.18369	TTG	MUC16	-	NULL	ENSG00000181143		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	65	0	A	NM_024690		9074068	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	32.31	44	21	SNP	0.000	T
MUC16	94025	genome.wustl.edu	37	19	9089865	9089865	+	Silent	SNP	G	G	A	rs375827972		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:9089865G>A	ENST00000397910.4	-	1	2153	c.1950C>T	c.(1948-1950)tcC>tcT	p.S650S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	650	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGGAGACACGGAGACTGGGA	0.552													G|||	1	0.000199681	0.0	0.0	5008	,	,		20974	0.0		0.0	False		,,,				2504	0.001																0								G		1,4271		0,1,2135	127.0	129.0	128.0		1950	0.5	0.0	19		128	0,8514		0,0,4257	no	coding-synonymous	MUC16	NM_024690.2		0,1,6392	AA,AG,GG		0.0,0.0234,0.0078		650/14508	9089865	1,12785	2136	4257	6393	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.1950C>T	19.37:g.9089865G>A			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.S650	ENST00000397910.4	37	c.1950	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.552	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	37	0	G	NM_024690		9089865	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	37.25	32	19	SNP	0.000	A
MUC17	140453	genome.wustl.edu	37	7	100677506	100677506	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:100677506G>C	ENST00000306151.4	+	3	2873	c.2809G>C	c.(2809-2811)Gtc>Ctc	p.V937L		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	937	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CACGCCGGTAGTCAGTTCTGA	0.507																																																	0													376.0	326.0	343.0					7																	100677506		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2809G>C	7.37:g.100677506G>C	ENSP00000302716:p.Val937Leu		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.V937L	ENST00000306151.4	37	c.2809	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.751284	0.00663	.	.	ENSG00000169876	ENST00000306151	T	0.02446	4.29	1.19	-2.38	0.06622	.	.	.	.	.	T	0.01287	0.0042	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.41270	-0.9518	9	0.15499	T	0.54	.	2.0373	0.03542	0.2361:0.4229:0.1998:0.1412	.	937	Q685J3	MUC17_HUMAN	L	937	ENSP00000302716:V937L	ENSP00000302716:V937L	V	+	1	0	MUC17	100464226	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.010000	0.01454	-3.620000	0.00131	-1.435000	0.01079	GTC	MUC17	-	NULL	ENSG00000169876		0.507	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	-	0.00	72	0	G	NM_001040105		100677506	+1	tier1	-	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	47.69	34	31	SNP	0.000	C
MYCBP2	23077	genome.wustl.edu	37	13	77807343	77807343	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr13:77807343G>T	ENST00000544440.2	-	18	2588	c.2571C>A	c.(2569-2571)gcC>gcA	p.A857A	MYCBP2_ENST00000407578.2_Silent_p.A895A|MYCBP2_ENST00000357337.6_Silent_p.A857A|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		ATCTGAGTCTGGCTAGAGCCT	0.428																																																	0													193.0	190.0	191.0					13																	77807343		2203	4300	6503	SO:0001819	synonymous_variant	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.2571C>A	13.37:g.77807343G>T				Silent	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.A895	ENST00000544440.2	37	c.2685		13																																																																																			MYCBP2	-	superfamily_RCC1/BLIP-II,superfamily_ARM-type_fold	ENSG00000005810		0.428	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	-	0.00	43	0	G	NM_015057		77807343	-1	tier1	-	no_errors	ENST00000407578	ensembl	human	known	74_37	silent	14.29	18	3	SNP	1.000	T
MYO18B	84700	genome.wustl.edu	37	22	26423549	26423549	+	Missense_Mutation	SNP	G	G	A	rs200890530		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr22:26423549G>A	ENST00000407587.2	+	43	7781	c.7612G>A	c.(7612-7614)Ggt>Agt	p.G2538S	MYO18B_ENST00000335473.7_Missense_Mutation_p.G2537S|MYO18B_ENST00000536101.1_Missense_Mutation_p.G2537S			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2537						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TGCGGGTGACGGTGGCGAGCG	0.567																																																	0								G	SER/GLY	0,4018		0,0,2009	43.0	45.0	45.0		7609	1.6	0.0	22		45	1,8295		0,1,4147	no	missense	MYO18B	NM_032608.5	56	0,1,6156	AA,AG,GG		0.0121,0.0,0.0081	possibly-damaging	2537/2568	26423549	1,12313	2009	4148	6157	SO:0001583	missense	0			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.7612G>A	22.37:g.26423549G>A	ENSP00000386096:p.Gly2538Ser		B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G2537S	ENST00000407587.2	37	c.7609		22	.	.	.	.	.	.	.	.	.	.	G	7.994	0.754018	0.15778	0.0	1.21E-4	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.88201	-2.33;-2.33;-2.35	5.06	1.61	0.23674	.	0.099149	0.36374	N	0.002622	T	0.81403	0.4815	L	0.57536	1.79	0.09310	N	1	P;P;P;P;P	0.47910	0.652;0.66;0.66;0.902;0.77	B;B;B;B;B	0.34590	0.079;0.058;0.058;0.186;0.124	T	0.74904	-0.3505	10	0.72032	D	0.01	.	5.8363	0.18609	0.2449:0.1417:0.6133:0.0	.	2050;2539;2537;2538;2537	Q8IUG5-2;B0QYF5;Q8IUG5;F5GXR6;F5GYU7	.;.;MY18B_HUMAN;.;.	S	2537;2537;2538	ENSP00000441229:G2537S;ENSP00000334563:G2537S;ENSP00000386096:G2538S	ENSP00000334563:G2537S	G	+	1	0	MYO18B	24753549	0.993000	0.37304	0.002000	0.10522	0.008000	0.06430	2.864000	0.48404	0.548000	0.28955	-0.215000	0.12644	GGT	MYO18B	-	NULL	ENSG00000133454		0.567	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1		0.00	13	0	G	NM_032608		26423549	+1			no_errors	ENST00000335473	ensembl	human	known	74_37	missense	33.33	8	4	SNP	0.000	A
MYO5A	4644	genome.wustl.edu	37	15	52668563	52668563	+	Silent	SNP	G	G	T	rs376727710		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:52668563G>T	ENST00000399231.3	-	19	2644	c.2401C>A	c.(2401-2403)Cgg>Agg	p.R801R	MYO5A_ENST00000356338.6_Silent_p.R801R|MYO5A_ENST00000358212.6_Silent_p.R801R|MYO5A_ENST00000399233.2_Silent_p.R801R|MYO5A_ENST00000553916.1_Silent_p.R801R	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	801	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TGGTAGCCCCGCACGTATCTC	0.562																																																	0													63.0	64.0	64.0					15																	52668563		1949	4167	6116	SO:0001819	synonymous_variant	0				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.2401C>A	15.37:g.52668563G>T			A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R801	ENST00000399231.3	37	c.2401	CCDS42037.1	15																																																																																			MYO5A	-	pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000197535		0.562	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1		0.00	31	0	G	NM_000259		52668563	-1			no_errors	ENST00000358212	ensembl	human	known	74_37	silent	8.33	32	3	SNP	1.000	T
MYO5A	4644	genome.wustl.edu	37	15	52675383	52675383	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:52675383G>T	ENST00000399231.3	-	16	2160	c.1917C>A	c.(1915-1917)ttC>ttA	p.F639L	MYO5A_ENST00000356338.6_Missense_Mutation_p.F639L|MYO5A_ENST00000358212.6_Missense_Mutation_p.F639L|MYO5A_ENST00000399233.2_Missense_Mutation_p.F639L|MYO5A_ENST00000553916.1_Missense_Mutation_p.F639L	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	639	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GGGAGTTTCTGAACTGCATGA	0.453																																																	0													149.0	136.0	140.0					15																	52675383		1953	4164	6117	SO:0001583	missense	0				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.1917C>A	15.37:g.52675383G>T	ENSP00000382177:p.Phe639Leu		A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F639L	ENST00000399231.3	37	c.1917	CCDS42037.1	15	.	.	.	.	.	.	.	.	.	.	G	21.9	4.211242	0.79240	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	D;D;D;D;D	0.96396	-4.0;-4.0;-4.0;-4.0;-4.0	5.68	4.76	0.60689	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.98340	0.9449	H	0.95260	3.645	0.80722	D	1	D;P	0.65815	0.995;0.936	D;P	0.63877	0.919;0.725	D	0.98725	1.0710	10	0.87932	D	0	.	10.6536	0.45663	0.1678:0.0:0.8321:0.0	.	639;639	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	L	639;173;639;639;639;269;639	ENSP00000382177:F639L;ENSP00000382179:F639L;ENSP00000348693:F639L;ENSP00000350945:F639L;ENSP00000451109:F639L	ENSP00000348693:F639L	F	-	3	2	MYO5A	50462675	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	1.422000	0.34826	1.387000	0.46486	0.557000	0.71058	TTC	MYO5A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000197535		0.453	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1	-	0.00	32	0	G	NM_000259		52675383	-1	tier1	-	no_errors	ENST00000358212	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
MYOM2	9172	genome.wustl.edu	37	8	2092797	2092797	+	Silent	SNP	C	C	T	rs558116342		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:2092797C>T	ENST00000262113.4	+	37	4431	c.4290C>T	c.(4288-4290)gaC>gaT	p.D1430D	MYOM2_ENST00000523438.1_Silent_p.D855D|MYOM2_ENST00000520298.1_3'UTR	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1430	Ig-like C2-type 5.				muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AGAAGATCGACGTGACAGTGA	0.587													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13835	0.0		0.0	False		,,,				2504	0.0																0													107.0	90.0	96.0					8																	2092797		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.4290C>T	8.37:g.2092797C>T			Q7Z3Y2	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D1430	ENST00000262113.4	37	c.4290	CCDS5957.1	8																																																																																			MYOM2	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000036448		0.587	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	-	0.00	18	0	C	NM_003970		2092797	+1	tier1	-	no_errors	ENST00000262113	ensembl	human	known	74_37	silent	50.00	5	5	SNP	0.197	T
NAP1L3	4675	genome.wustl.edu	37	X	92928150	92928150	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:92928150T>C	ENST00000373079.3	-	1	417	c.154A>G	c.(154-156)Agt>Ggt	p.S52G	FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000322139.4_5'Flank|FAM133A_ENST00000538690.1_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.S45G|FAM133A_ENST00000332647.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	52	Ser-rich.				nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						ctgctgccactagtgctgctg	0.587																																																	0													14.0	14.0	14.0					X																	92928150		2186	4252	6438	SO:0001583	missense	0				CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.154A>G	X.37:g.92928150T>C	ENSP00000362171:p.Ser52Gly		B2RCM0|O60788	Missense_Mutation	SNP	pfam_NAP_family	p.S52G	ENST00000373079.3	37	c.154	CCDS14465.1	X	.	.	.	.	.	.	.	.	.	.	T	0.581	-0.837114	0.02692	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.36878	1.23	2.53	-0.21	0.13176	.	.	.	.	.	T	0.13841	0.0335	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22521	-1.0214	9	0.27082	T	0.32	.	0.161	0.00103	0.2321:0.1702:0.2336:0.3641	.	52	Q99457	NP1L3_HUMAN	G	52;45	ENSP00000362171:S52G	ENSP00000362171:S52G	S	-	1	0	NAP1L3	92814806	0.014000	0.17966	0.002000	0.10522	0.034000	0.12701	0.283000	0.18846	-0.119000	0.11830	0.308000	0.20428	AGT	NAP1L3	-	NULL	ENSG00000186310		0.587	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L3	HGNC	protein_coding	OTTHUMT00000057449.1	-	0.00	64	0	T	NM_004538		92928150	-1	tier1	-	no_errors	ENST00000373079	ensembl	human	known	74_37	missense	43.48	26	20	SNP	0.006	C
NBPF15	284565	genome.wustl.edu	37	1	148579636	148579636	+	Missense_Mutation	SNP	T	T	C	rs200012164	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:148579636T>C	ENST00000369187.3	+	6	695	c.206T>C	c.(205-207)tTt>tCt	p.F69S	NBPF15_ENST00000442702.2_Missense_Mutation_p.F69S|NBPF15_ENST00000464336.2_3'UTR	NM_173638.3	NP_775909.2	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15	69						cytoplasm (GO:0005737)				NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					CTCATAAAATTTATGCTGAGG	0.527																																																	0													12.0	18.0	17.0					1																	148579636		884	2001	2885	SO:0001583	missense	0			BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000369187.3:c.206T>C	1.37:g.148579636T>C	ENSP00000358188:p.Phe69Ser		Q3BBV9|Q8IX77	Missense_Mutation	SNP	pfam_NBPF_dom	p.F69S	ENST00000369187.3	37	c.206	CCDS932.1	1	.	.	.	.	.	.	.	.	.	.	.	0.003	-2.454233	0.00173	.	.	ENSG00000243452	ENST00000442702;ENST00000369187	T;T	0.02050	4.48;4.48	0.566	0.566	0.17317	.	.	.	.	.	T	0.00144	0.0004	N	0.00170	-1.935	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34750	-0.9816	8	0.02654	T	1	.	.	.	.	.	69	Q8N660	NBPFF_HUMAN	S	69	ENSP00000416864:F69S;ENSP00000358188:F69S	ENSP00000358188:F69S	F	+	2	0	NBPF15	146846260	0.001000	0.12720	0.007000	0.13788	0.014000	0.08584	0.004000	0.13106	-0.220000	0.09988	-1.160000	0.01791	TTT	NBPF15	-	NULL	ENSG00000243452		0.527	NBPF15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF15	HGNC	protein_coding	OTTHUMT00000038609.3	-	0.00	19	0	T	NM_173638		148579636	+1	tier1	rs200012164	no_errors	ENST00000369187	ensembl	human	known	74_37	missense	19.35	25	6	SNP	0.009	C
NCAM2	4685	genome.wustl.edu	37	21	22790836	22790836	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr21:22790836C>A	ENST00000400546.1	+	11	1676	c.1427C>A	c.(1426-1428)aCa>aAa	p.T476K	NCAM2_ENST00000284894.7_Missense_Mutation_p.T334K	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	476	Ig-like C2-type 5.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.T476I(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		TATAATTGCACAGCCACTAAT	0.308																																																	1	Substitution - Missense(1)	endometrium(1)											113.0	111.0	111.0					21																	22790836		1823	4081	5904	SO:0001583	missense	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.1427C>A	21.37:g.22790836C>A	ENSP00000383392:p.Thr476Lys		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.T476K	ENST00000400546.1	37	c.1427	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	C	21.8	4.204449	0.79127	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.65732	-0.17;-0.17	5.07	5.07	0.68467	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.78052	0.4223	M	0.66439	2.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.80703	-0.1264	10	0.87932	D	0	-22.5272	17.0099	0.86403	0.0:1.0:0.0:0.0	.	334;476	B7Z5K2;O15394	.;NCAM2_HUMAN	K	476;334	ENSP00000383392:T476K;ENSP00000284894:T334K	ENSP00000284894:T334K	T	+	2	0	NCAM2	21712707	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.027000	0.76463	2.359000	0.80004	0.467000	0.42956	ACA	NCAM2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000154654		0.308	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1		0.00	25	0	C	NM_004540		22790836	+1			no_errors	ENST00000400546	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	A
NCAM2	4685	genome.wustl.edu	37	21	22849731	22849731	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr21:22849731G>T	ENST00000400546.1	+	15	2265	c.2016G>T	c.(2014-2016)ttG>ttT	p.L672F	NCAM2_ENST00000284894.7_Missense_Mutation_p.L530F	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	672	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		CCAATAGATTGGGATATTCTG	0.378																																																	0													88.0	84.0	85.0					21																	22849731		1873	4111	5984	SO:0001583	missense	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.2016G>T	21.37:g.22849731G>T	ENSP00000383392:p.Leu672Phe		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.L672F	ENST00000400546.1	37	c.2016	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	G	17.13	3.309691	0.60414	.	.	ENSG00000154654	ENST00000400546;ENST00000284894	T;T	0.57273	0.41;0.41	5.8	1.49	0.22878	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.118262	0.56097	D	0.000028	T	0.49423	0.1556	N	0.22421	0.69	0.80722	D	1	D;D	0.71674	0.998;0.998	P;P	0.61592	0.891;0.891	T	0.45760	-0.9239	10	0.56958	D	0.05	-10.5762	7.1683	0.25704	0.1452:0.0:0.5345:0.3203	.	530;672	B7Z5K2;O15394	.;NCAM2_HUMAN	F	672;530	ENSP00000383392:L672F;ENSP00000284894:L530F	ENSP00000284894:L530F	L	+	3	2	NCAM2	21771602	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	0.929000	0.28844	0.364000	0.24374	0.650000	0.86243	TTG	NCAM2	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000154654		0.378	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1		0.00	43	0	G	NM_004540		22849731	+1			no_errors	ENST00000400546	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.995	T
NCOA1	8648	genome.wustl.edu	37	2	24949514	24949514	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:24949514G>T	ENST00000406961.1	+	15	3308	c.2656G>T	c.(2656-2658)Ggc>Tgc	p.G886C	NCOA1_ENST00000538539.1_Missense_Mutation_p.G886C|NCOA1_ENST00000288599.5_Missense_Mutation_p.G886C|NCOA1_ENST00000405141.1_Missense_Mutation_p.G886C|NCOA1_ENST00000348332.3_Missense_Mutation_p.G886C|NCOA1_ENST00000407230.1_Missense_Mutation_p.G735C|NCOA1_ENST00000395856.3_Missense_Mutation_p.G886C			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	886	Interaction with CREBBP.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ACCAGGAACAGGCGATCAGAT	0.353			T	PAX3	alveolar rhadomyosarcoma																																			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0													96.0	98.0	98.0					2																	24949514		2203	4299	6502	SO:0001583	missense	0			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.2656G>T	2.37:g.24949514G>T	ENSP00000385216:p.Gly886Cys		O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.G886C	ENST00000406961.1	37	c.2656	CCDS1712.1	2	.	.	.	.	.	.	.	.	.	.	G	23.7	4.441696	0.83993	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.02067	4.58;4.59;4.47;4.59;4.58;4.59;4.58	5.38	5.38	0.77491	.	0.416899	0.28119	N	0.016526	T	0.06416	0.0165	N	0.24115	0.695	0.35769	D	0.82074	D;D;D;D	0.69078	0.997;0.995;0.997;0.987	D;P;D;P	0.65874	0.911;0.817;0.939;0.67	T	0.42982	-0.9419	10	0.66056	D	0.02	.	17.3256	0.87246	0.0:0.0:1.0:0.0	.	886;886;886;735	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	C	886;886;735;886;886;886;886	ENSP00000385216:G886C;ENSP00000385097:G886C;ENSP00000385195:G735C;ENSP00000444039:G886C;ENSP00000320940:G886C;ENSP00000288599:G886C;ENSP00000379197:G886C	ENSP00000288599:G886C	G	+	1	0	NCOA1	24803018	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	5.735000	0.68587	2.680000	0.91292	0.644000	0.83932	GGC	NCOA1	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000084676		0.353	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	HGNC	protein_coding	OTTHUMT00000246852.3		0.00	55	0	G	NM_147223		24949514	+1			no_errors	ENST00000348332	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.981	T
NDP	4693	genome.wustl.edu	37	X	43809159	43809159	+	Nonsense_Mutation	SNP	G	G	T	rs104894877		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:43809159G>T	ENST00000378062.5	-	3	695	c.288C>A	c.(286-288)tgC>tgA	p.C96*	NDP-AS1_ENST00000435093.1_RNA|NDP_ENST00000470584.1_5'UTR	NM_000266.3	NP_000257.1	Q00604	NDP_HUMAN	Norrie disease (pseudoglioma)	96	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.		C -> W (in ND). {ECO:0000269|PubMed:10484772}.|C -> Y (in ND). {ECO:0000269|PubMed:10544980, ECO:0000269|PubMed:1303264, ECO:0000269|PubMed:1307245}.|HCC -> QCGL (in ND).		canonical Wnt signaling pathway (GO:0060070)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|extracellular matrix-cell signaling (GO:0035426)|nervous system development (GO:0007399)|placenta development (GO:0001890)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|vacuole organization (GO:0007033)|visual perception (GO:0007601)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	frizzled binding (GO:0005109)|growth factor activity (GO:0008083)|protein homodimerization activity (GO:0042803)			kidney(1)|lung(2)	3						TCTGGGGCCGGCAGCAGTGAC	0.637											OREG0019744	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0			GRCh37	CM992191	NDP	M	rs104894877						52.0	36.0	41.0					X																	43809159		2202	4298	6500	SO:0001587	stop_gained	0			X65882	CCDS14262.1	Xp11.4-p11.3	2013-02-26			ENSG00000124479	ENSG00000124479		"""Endogenous ligands"""	7678	protein-coding gene	gene with protein product		300658	"""exudative vitreoretinopathy 2 (X-linked)"""	EVR2		8252044	Standard	NM_000266		Approved	norrin	uc004dga.3	Q00604	OTTHUMG00000021391	ENST00000378062.5:c.288C>A	X.37:g.43809159G>T	ENSP00000367301:p.Cys96*	919	B2R8K6|Q5JYH5	Nonsense_Mutation	SNP	pfam_Cys_knot,pfam_DAN,smart_Cys_knot_C,pfscan_Cys_knot_C,prints_Norrie_dis	p.C96*	ENST00000378062.5	37	c.288	CCDS14262.1	X	.	.	.	.	.	.	.	.	.	.	G	40	7.929514	0.98565	.	.	ENSG00000124479	ENST00000378062	.	.	.	5.96	4.21	0.49690	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.217	11.9628	0.53017	0.1428:0.0:0.8572:0.0	.	.	.	.	X	96	.	ENSP00000367301:C96X	C	-	3	2	NDP	43694103	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.760000	0.38430	0.663000	0.31027	0.600000	0.82982	TGC	NDP	-	pfam_Cys_knot,pfam_DAN,smart_Cys_knot_C,pfscan_Cys_knot_C,prints_Norrie_dis	ENSG00000124479		0.637	NDP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDP	HGNC	protein_coding	OTTHUMT00000056309.1		0.00	62	0	G	NM_000266		43809159	-1			no_errors	ENST00000378062	ensembl	human	known	74_37	nonsense	5.33	71	4	SNP	1.000	T
NEK1	4750	genome.wustl.edu	37	4	170459006	170459006	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:170459006C>T	ENST00000439128.2	-	18	2259	c.1619G>A	c.(1618-1620)cGa>cAa	p.R540Q	NEK1_ENST00000507142.1_Missense_Mutation_p.R540Q|NEK1_ENST00000512193.1_Missense_Mutation_p.R471Q|NEK1_ENST00000511633.1_Missense_Mutation_p.R496Q|NEK1_ENST00000510533.1_Missense_Mutation_p.R496Q	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	540					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.R540Q(2)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		TTCCCGTTTTCGCTGCAGGAA	0.393																																																	2	Substitution - Missense(2)	large_intestine(2)											293.0	281.0	285.0					4																	170459006		1863	4095	5958	SO:0001583	missense	0			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.1619G>A	4.37:g.170459006C>T	ENSP00000408020:p.Arg540Gln		G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R540Q	ENST00000439128.2	37	c.1619	CCDS47162.1	4	.	.	.	.	.	.	.	.	.	.	C	35	5.438333	0.96168	.	.	ENSG00000137601	ENST00000439128;ENST00000511633;ENST00000510533;ENST00000507142;ENST00000512193	T;T;T;T;T	0.72394	-0.65;-0.65;-0.63;-0.64;-0.63	5.91	5.91	0.95273	.	0.000000	0.53938	D	0.000043	D	0.84543	0.5495	M	0.71581	2.175	0.58432	D	0.999998	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;0.999;0.999	D	0.84802	0.0785	10	0.72032	D	0.01	.	19.8969	0.96969	0.0:1.0:0.0:0.0	.	471;496;540;496;540	Q96PY6-4;G5E9Z3;Q96PY6-3;Q96PY6-2;Q96PY6	.;.;.;.;NEK1_HUMAN	Q	540;496;496;540;471	ENSP00000408020:R540Q;ENSP00000423332:R496Q;ENSP00000427653:R496Q;ENSP00000424757:R540Q;ENSP00000424938:R471Q	ENSP00000408020:R540Q	R	-	2	0	NEK1	170695581	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	6.040000	0.70980	2.799000	0.96334	0.650000	0.86243	CGA	NEK1	-	NULL	ENSG00000137601		0.393	NEK1-001	KNOWN	basic|CCDS	protein_coding	NEK1	HGNC	protein_coding	OTTHUMT00000363157.3		0.00	40	0	C			170459006	-1			no_errors	ENST00000507142	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	T
NF1	4763	genome.wustl.edu	37	17	29652954	29652954	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:29652954G>A	ENST00000358273.4	+	37	5335	c.4952G>A	c.(4951-4953)aGc>aAc	p.S1651N	NF1_ENST00000356175.3_Missense_Mutation_p.S1630N|NF1_ENST00000581113.2_3'UTR	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	1651	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.|Lipid binding.				actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		ACCGGGCCTAGCAATCGCTTT	0.398			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)											151.0	140.0	144.0					17																	29652954		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.4952G>A	17.37:g.29652954G>A	ENSP00000351015:p.Ser1651Asn		O00662|Q14284|Q14930|Q14931|Q9UMK3	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.S1651N	ENST00000358273.4	37	c.4952	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.256029	0.95336	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735	T;T;T	0.62639	0.01;0.01;0.01	5.84	5.84	0.93424	Cellular retinaldehyde-binding/triple function, C-terminal (2);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64405	0.2595	L	0.29908	0.895	0.80722	D	1	B;P;B	0.48589	0.064;0.912;0.016	B;P;B	0.54210	0.036;0.745;0.017	T	0.57075	-0.7873	10	0.22706	T	0.39	.	19.1261	0.93384	0.0:0.0:1.0:0.0	.	680;1630;1651	Q59FX3;P21359-2;P21359	.;.;NF1_HUMAN	N	1651;1630;1296	ENSP00000351015:S1651N;ENSP00000348498:S1630N;ENSP00000389907:S1296N	ENSP00000348498:S1630N	S	+	2	0	NF1	26677080	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.434000	0.97515	2.779000	0.95612	0.655000	0.94253	AGC	NF1	-	superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000196712		0.398	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2		0.00	26	0	G	NM_000267		29652954	+1			no_errors	ENST00000358273	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	A
NLRP10	338322	genome.wustl.edu	37	11	7981789	7981789	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:7981789G>T	ENST00000328600.2	-	2	1531	c.1370C>A	c.(1369-1371)gCc>gAc	p.A457D		NM_176821.3	NP_789791.1	Q86W26	NAL10_HUMAN	NLR family, pyrin domain containing 10	457	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to fungus (GO:0050832)|defense response to Gram-negative bacterium (GO:0050829)|dendritic cell migration (GO:0036336)|helper T cell enhancement of adaptive immune response (GO:0035397)|innate immune response (GO:0045087)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 type immune response (GO:2000318)	cytoplasm (GO:0005737)|extrinsic component of plasma membrane (GO:0019897)	ATP binding (GO:0005524)	p.A457V(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				Epithelial(150;1.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CTTCTTGATGGCAAGTCCCAA	0.493																																																	1	Substitution - Missense(1)	urinary_tract(1)											105.0	116.0	112.0					11																	7981789		2201	4296	6497	SO:0001583	missense	0			AY154465	CCDS7784.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000182261		"""Nucleotide-binding domain and leucine rich repeat containing"""	21464	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 10"""	609662	"""NACHT, leucine rich repeat and PYD containing 10"""	NALP10		12563287	Standard	NM_176821		Approved	NOD8, PAN5, Pynod, CLR11.1	uc001mfv.1	Q86W26		ENST00000328600.2:c.1370C>A	11.37:g.7981789G>T	ENSP00000327763:p.Ala457Asp		Q2M3C4|Q6JGT0	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,pfscan_NACHT_NTPase,pfscan_DAPIN	p.A457D	ENST00000328600.2	37	c.1370	CCDS7784.1	11	.	.	.	.	.	.	.	.	.	.	G	0	-2.757149	0.00085	.	.	ENSG00000182261	ENST00000328600	D	0.88509	-2.39	4.86	-0.307	0.12777	.	0.523565	0.16143	N	0.227610	T	0.58235	0.2108	N	0.00621	-1.32	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.56269	-0.8007	10	0.12430	T	0.62	.	0.9016	0.01275	0.153:0.2014:0.1721:0.4736	.	457	Q86W26	NAL10_HUMAN	D	457	ENSP00000327763:A457D	ENSP00000327763:A457D	A	-	2	0	NLRP10	7938365	0.000000	0.05858	0.017000	0.16124	0.001000	0.01503	-1.106000	0.03319	0.007000	0.14760	-0.262000	0.10625	GCC	NLRP10	-	NULL	ENSG00000182261		0.493	NLRP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP10	HGNC	protein_coding	OTTHUMT00000385705.1		0.00	27	0	G	NM_176821		7981789	-1			no_errors	ENST00000328600	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.000	T
NLRP9	338321	genome.wustl.edu	37	19	56223931	56223931	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:56223931C>T	ENST00000332836.2	-	7	2554	c.2527G>A	c.(2527-2529)Gat>Aat	p.D843N		NM_176820.2	NP_789790.2	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	843						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			NS(2)|breast(5)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(15)|lung(21)|ovary(2)|prostate(3)|skin(7)|urinary_tract(3)	74		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		TTACAGGAATCGGAAGTAAGG	0.423																																																	0													81.0	75.0	77.0					19																	56223931		2199	4293	6492	SO:0001583	missense	0			AY154464	CCDS12934.1	19q13.43	2006-12-08	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22941	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 9"""	609663	"""NACHT, leucine rich repeat and PYD containing 9"""	NALP9		12563287	Standard	NM_176820		Approved	NOD6, PAN12, CLR19.1	uc002qly.3	Q7RTR0		ENST00000332836.2:c.2527G>A	19.37:g.56223931C>T	ENSP00000331857:p.Asp843Asn		B2RN12|Q86W27	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.D843N	ENST00000332836.2	37	c.2527	CCDS12934.1	19	.	.	.	.	.	.	.	.	.	.	C	7.699	0.692731	0.15039	.	.	ENSG00000185792	ENST00000332836;ENST00000333452	T	0.48522	0.81	4.0	1.76	0.24704	.	.	.	.	.	T	0.27731	0.0682	L	0.31926	0.97	0.09310	N	1	B	0.33238	0.403	B	0.22880	0.042	T	0.11518	-1.0584	9	0.19147	T	0.46	.	5.3794	0.16183	0.0:0.6148:0.2684:0.1168	.	843	Q7RTR0	NALP9_HUMAN	N	843	ENSP00000331857:D843N	ENSP00000331857:D843N	D	-	1	0	NLRP9	60915743	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-1.123000	0.03263	0.451000	0.26802	0.638000	0.83543	GAT	NLRP9	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000185792		0.423	NLRP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP9	HGNC	protein_coding	OTTHUMT00000453653.1		0.00	13	0	C	NM_176820		56223931	-1			no_errors	ENST00000332836	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.000	T
NOS2	4843	genome.wustl.edu	37	17	26114756	26114756	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:26114756G>T	ENST00000313735.6	-	5	648	c.415C>A	c.(415-417)Ctt>Att	p.L139I		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	139					arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)	p.L139I(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	TGAGGTAGAAGCTCATCTGGA	0.517																																																	1	Substitution - Missense(1)	lung(1)											156.0	160.0	159.0					17																	26114756		2203	4300	6503	SO:0001583	missense	0			U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.415C>A	17.37:g.26114756G>T	ENSP00000327251:p.Leu139Ile		A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_euk,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.L139I	ENST00000313735.6	37	c.415	CCDS11223.1	17	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191123	0.78902	.	.	ENSG00000007171	ENST00000313735;ENST00000379105;ENST00000302153	T	0.27890	1.64	5.64	5.64	0.86602	Nitric oxide synthase, oxygenase domain (3);	0.084150	0.51477	D	0.000097	T	0.40297	0.1111	L	0.46567	1.45	0.47214	D	0.999353	B;B	0.30439	0.279;0.113	B;B	0.42653	0.394;0.316	T	0.12016	-1.0564	10	0.35671	T	0.21	.	18.6964	0.91603	0.0:0.0:1.0:0.0	.	139;139	F8WEM3;P35228	.;NOS2_HUMAN	I	139	ENSP00000327251:L139I	ENSP00000305638:L139I	L	-	1	0	NOS2	23138883	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.179000	0.58290	2.676000	0.91093	0.557000	0.71058	CTT	NOS2	-	pfam_NO_synthase_oxygenase_dom,superfamily_NO_synthase_oxygenase_dom,pirsf_NOS_euk	ENSG00000007171		0.517	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOS2	HGNC	protein_coding	OTTHUMT00000255597.1		0.00	37	0	G	NM_000625		26114756	-1			no_errors	ENST00000313735	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
NPIPB4	440345	genome.wustl.edu	37	16	21854859	21854859	+	Silent	SNP	G	G	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:21854859G>C	ENST00000415645.2	-	4	432	c.393C>G	c.(391-393)tcC>tcG	p.S131S	NPIPB4_ENST00000539318.1_5'UTR|NPIPB4_ENST00000451409.1_5'UTR|NPIPB4_ENST00000357370.5_Silent_p.S131S			C9JG80	NPIB4_HUMAN	nuclear pore complex interacting protein family, member B4	131						integral component of membrane (GO:0016021)											TTCCTCGAAAGGAAGAAACTC	0.428																																																	0																																										SO:0001819	synonymous_variant	0					16p12.2	2013-06-11			ENSG00000185864	ENSG00000185864			41985	protein-coding gene	gene with protein product							Standard	XM_006721108		Approved			C9JG80	OTTHUMG00000163555	ENST00000415645.2:c.393C>G	16.37:g.21854859G>C				Silent	SNP	NULL	p.S131	ENST00000415645.2	37	c.393		16																																																																																			NPIPB4	-	NULL	ENSG00000185864		0.428	NPIPB4-202	KNOWN	basic|appris_principal	protein_coding	NPIPB4	HGNC	protein_coding		-	0.00	256	0	G			21854859	-1	tier1	-	no_errors	ENST00000415645	ensembl	human	known	74_37	silent	14.50	229	39	SNP	0.001	C
NPR1	4881	genome.wustl.edu	37	1	153659784	153659784	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:153659784G>T	ENST00000368680.3	+	13	2516	c.2044G>T	c.(2044-2046)Gag>Tag	p.E682*		NM_000906.3	NP_000897.3	P16066	ANPRA_HUMAN	natriuretic peptide receptor 1	682	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cGMP biosynthetic process (GO:0030828)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|G-protein coupled peptide receptor activity (GO:0008528)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(17)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	all_lung(78;3.75e-32)|Lung NSC(65;1.37e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)		Amyl Nitrite(DB01612)|Erythrityl Tetranitrate(DB01613)|Isosorbide Dinitrate(DB00883)|Nesiritide(DB04899)|Nitroglycerin(DB00727)|Nitroprusside(DB00325)	CTATGGGCTGGAGAGCTTCAG	0.552																																					Pancreas(141;1349 1870 15144 15830 40702)												0													122.0	98.0	106.0					1																	153659784		2203	4300	6503	SO:0001587	stop_gained	0			BC063304	CCDS1051.1	1q21-q22	2014-03-03	2014-03-03		ENSG00000169418	ENSG00000169418			7943	protein-coding gene	gene with protein product	"""guanylate cyclase A"""	108960	"""atrionatriuretic peptide receptor A"", ""natriuretic peptide receptor A"""	ANPRA, NPRA		1979052	Standard	NM_000906		Approved	GUCY2A, ANPa	uc001fcs.4	P16066	OTTHUMG00000037085	ENST00000368680.3:c.2044G>T	1.37:g.153659784G>T	ENSP00000357669:p.Glu682*		B0ZBF0|Q5SR08|Q6P4Q3	Nonsense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.E682*	ENST00000368680.3	37	c.2044	CCDS1051.1	1	.	.	.	.	.	.	.	.	.	.	G	42	9.178245	0.99091	.	.	ENSG00000169418	ENST00000368680;ENST00000428723	.	.	.	4.09	4.09	0.47781	.	0.529159	0.17124	N	0.186112	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	14.1901	0.65633	0.0:0.0:1.0:0.0	.	.	.	.	X	682;161	.	ENSP00000357669:E682X	E	+	1	0	NPR1	151926408	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.934000	0.48956	2.287000	0.76781	0.455000	0.32223	GAG	NPR1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000169418		0.552	NPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR1	HGNC	protein_coding	OTTHUMT00000090034.1		0.00	29	0	G	NM_000906		153659784	+1			no_errors	ENST00000368680	ensembl	human	known	74_37	nonsense	7.89	35	3	SNP	1.000	T
NR6A1	2649	genome.wustl.edu	37	9	127289130	127289130	+	Missense_Mutation	SNP	G	G	T	rs374615385		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:127289130G>T	ENST00000487099.2	-	8	1286	c.1129C>A	c.(1129-1131)Cac>Aac	p.H377N	NR6A1_ENST00000416460.2_Missense_Mutation_p.H372N|NR6A1_ENST00000344523.4_Missense_Mutation_p.H376N|NR6A1_ENST00000373584.3_Missense_Mutation_p.H373N	NM_001278546.1	NP_001265475.1	Q15406	NR6A1_HUMAN	nuclear receptor subfamily 6, group A, member 1	377					cell proliferation (GO:0008283)|gamete generation (GO:0007276)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	17						TGGAACTTGTGATAGAGGTAG	0.493																																					Esophageal Squamous(192;272 2884 6208 20560)												0													173.0	145.0	155.0					9																	127289130		2203	4300	6503	SO:0001583	missense	0			U64876	CCDS35137.1, CCDS55340.1, CCDS65127.1	9q33.3	2014-01-21			ENSG00000148200	ENSG00000148200		"""Nuclear hormone receptors"""	7985	protein-coding gene	gene with protein product		602778		GCNF		9134503, 8982251	Standard	NM_001489		Approved	GCNF1, RTR, CT150	uc004bor.1	Q15406	OTTHUMG00000020661	ENST00000487099.2:c.1129C>A	9.37:g.127289130G>T	ENSP00000420267:p.His377Asn		O00551|O00603|Q5T6F4|Q8NHQ0|Q92898|Q99802	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.H377N	ENST00000487099.2	37	c.1129	CCDS35137.1	9	.	.	.	.	.	.	.	.	.	.	G	13.84	2.356270	0.41700	.	.	ENSG00000148200	ENST00000487099;ENST00000373584;ENST00000416460;ENST00000344523	D;D;D;D	0.96522	-4.04;-4.04;-4.04;-4.04	5.15	4.23	0.50019	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.102268	0.64402	D	0.000002	D	0.89466	0.6723	N	0.04880	-0.145	0.32871	D	0.509299	B;B;B	0.10296	0.002;0.003;0.001	B;B;B	0.06405	0.001;0.002;0.0	D	0.85502	0.1192	10	0.16896	T	0.51	.	14.8423	0.70235	0.0:0.1447:0.8553:0.0	.	373;377;372	F1DAM1;Q15406;Q15406-5	.;NR6A1_HUMAN;.	N	377;373;372;376	ENSP00000420267:H377N;ENSP00000362686:H373N;ENSP00000413701:H372N;ENSP00000341135:H376N	ENSP00000341135:H376N	H	-	1	0	NR6A1	126328951	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	9.139000	0.94554	1.250000	0.43966	0.655000	0.94253	CAC	NR6A1	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core	ENSG00000148200		0.493	NR6A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR6A1	HGNC	protein_coding	OTTHUMT00000054043.4	-	0.00	53	0	G			127289130	-1	tier1	-	no_errors	ENST00000487099	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
NRG1	3084	genome.wustl.edu	37	8	32607049	32607050	+	Intron	INS	-	-	T	rs3832550		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:32607049_32607050insT	ENST00000405005.3	+	8	700				NRG1_ENST00000521670.1_Intron|NRG1_ENST00000523681.1_3'UTR|NRG1_ENST00000523079.1_Intron|NRG1_ENST00000539990.1_Intron|NRG1_ENST00000519301.1_Intron|NRG1_ENST00000338921.4_Intron|NRG1_ENST00000356819.4_Intron|NRG1_ENST00000287842.3_Intron|NRG1_ENST00000287845.5_Intron|NRG1_ENST00000341377.5_Intron			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CCCTTTCTTTCTTTTTTTTGTC	0.386																																																	0									,,,,,,,,,	4,4260		0,4,2128					,,,,,,,,,	-0.8	1.0		dbSNP_107	96	10,8244		0,10,4117	no	intron,intron,intron,intron,intron,intron,intron,intron,intron,intron	NRG1	NM_013964.3,NM_013960.3,NM_013957.3,NM_013956.3,NM_001160008.1,NM_001160004.1,NM_001160001.1,NM_001159999.1,NM_001159996.1,NM_001159995.1	,,,,,,,,,	0,14,6245	A1A1,A1R,RR		0.1212,0.0938,0.1118	,,,,,,,,,	,,,,,,,,,		14,12504				SO:0001627	intron_variant	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.701-4840->T	8.37:g.32607057_32607057dupT			A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	RNA	INS	-	NULL	ENST00000405005.3	37	NULL	CCDS6085.1	8																																																																																			NRG1	-	-	ENSG00000157168		0.386	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1		0.00	42	0	-			32607050	+1	tier1		no_errors	ENST00000523681	ensembl	human	known	74_37	rna	34.29	23	12	INS	0.999:1.000	T
NRP1	8829	genome.wustl.edu	37	10	33552787	33552787	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:33552787G>T	ENST00000265371.4	-	5	970	c.445C>A	c.(445-447)Cag>Aag	p.Q149K	NRP1_ENST00000374867.2_Missense_Mutation_p.Q149K|NRP1_ENST00000374816.3_Missense_Mutation_p.Q149K|NRP1_ENST00000374822.4_Missense_Mutation_p.Q149K|NRP1_ENST00000374821.5_Missense_Mutation_p.Q149K|NRP1_ENST00000374823.5_Missense_Mutation_p.Q149K|NRP1_ENST00000432372.2_Missense_Mutation_p.Q149K|NRP1_ENST00000374875.1_5'UTR|NRP1_ENST00000395995.1_Missense_Mutation_p.Q149K			O14786	NRP1_HUMAN	neuropilin 1	149	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	GTGTAGTTCTGGGAACATTCA	0.408																																					Melanoma(104;886 1489 44640 45944 51153)												0													141.0	139.0	140.0					10																	33552787		2203	4300	6503	SO:0001583	missense	0			AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.445C>A	10.37:g.33552787G>T	ENSP00000265371:p.Gln149Lys		B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Missense_Mutation	SNP	pirsf_Neuropilin,pfam_CUB_dom,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_CUB_dom,smart_CUB_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.Q149K	ENST00000265371.4	37	c.445	CCDS7177.1	10	.	.	.	.	.	.	.	.	.	.	G	8.851	0.944701	0.18356	.	.	ENSG00000099250	ENST00000265371;ENST00000374867;ENST00000395995;ENST00000374822;ENST00000374821;ENST00000374823;ENST00000374816	T;T;T;T;T;T;T	0.27890	1.64;1.64;1.64;1.64;1.64;1.64;1.64	5.76	3.76	0.43208	CUB (5);	0.190457	0.53938	D	0.000051	T	0.12944	0.0314	N	0.04335	-0.225	0.36057	D	0.841158	B;B;B;B;B;B;B;B	0.25609	0.043;0.13;0.13;0.001;0.009;0.011;0.043;0.043	B;B;B;B;B;B;B;B	0.21360	0.014;0.03;0.034;0.0;0.002;0.004;0.014;0.009	T	0.18085	-1.0348	10	0.18276	T	0.48	-15.8368	10.3289	0.43809	0.0:0.1078:0.6254:0.2668	.	149;149;149;149;149;149;149;149	A8K9V7;E7EX60;Q5T7F0;Q5T7F1;O14786-2;Q68DN3;O14786;E9PEP6	.;.;.;.;.;.;NRP1_HUMAN;.	K	149	ENSP00000265371:Q149K;ENSP00000364001:Q149K;ENSP00000379317:Q149K;ENSP00000363955:Q149K;ENSP00000363954:Q149K;ENSP00000363956:Q149K;ENSP00000363949:Q149K	ENSP00000265371:Q149K	Q	-	1	0	NRP1	33592793	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.014000	0.40951	1.387000	0.46486	0.655000	0.94253	CAG	NRP1	-	pirsf_Neuropilin,pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000099250		0.408	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NRP1	HGNC	protein_coding	OTTHUMT00000051203.2		0.00	55	0	G			33552787	-1			no_errors	ENST00000265371	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
NTRK3	4916	genome.wustl.edu	37	15	88799256	88799256	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:88799256G>A	ENST00000360948.2	-	2	290	c.129C>T	c.(127-129)atC>atT	p.I43I	NTRK3_ENST00000317501.3_Silent_p.I43I|NTRK3_ENST00000558676.1_Silent_p.I43I|NTRK3-AS1_ENST00000569588.1_lincRNA|NTRK3_ENST00000394480.2_Silent_p.I43I|NTRK3_ENST00000557856.1_Silent_p.I43I|NTRK3_ENST00000357724.2_Silent_p.I43I|NTRK3_ENST00000540489.2_Silent_p.I43I|NTRK3_ENST00000355254.2_Silent_p.I43I	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	43					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			GCCGGCAATTGATCTCAGTCT	0.562			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																														Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0													275.0	229.0	244.0					15																	88799256		2201	4299	6500	SO:0001819	synonymous_variant	0			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.129C>T	15.37:g.88799256G>A			B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.I43	ENST00000360948.2	37	c.129	CCDS32322.1	15																																																																																			NTRK3	-	pfam_LRR-contain_N,smart_LRR-contain_N	ENSG00000140538		0.562	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding		-	0.00	48	0	G			88799256	-1	tier1	-	no_errors	ENST00000360948	ensembl	human	known	74_37	silent	24.07	41	13	SNP	1.000	A
NUAK1	9891	genome.wustl.edu	37	12	106464597	106464597	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:106464597G>A	ENST00000261402.2	-	6	2166	c.787C>T	c.(787-789)Cgg>Tgg	p.R263W		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						CTGATTTGCCGAATGAGGTTT	0.562																																																	0													136.0	119.0	125.0					12																	106464597		2203	4300	6503	SO:0001583	missense	0			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.787C>T	12.37:g.106464597G>A	ENSP00000261402:p.Arg263Trp		A7MD39|Q96KA8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.R263W	ENST00000261402.2	37	c.787	CCDS31892.1	12	.	.	.	.	.	.	.	.	.	.	G	17.84	3.488969	0.64074	.	.	ENSG00000074590	ENST00000261402;ENST00000549704;ENST00000548902	T;T;T	0.67523	-0.27;1.02;-0.27	4.92	4.92	0.64577	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.132265	0.33272	N	0.005094	T	0.81399	0.4814	M	0.84326	2.69	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.83956	0.0319	10	0.87932	D	0	.	11.544	0.50681	0.0:0.0:0.6902:0.3097	.	263	O60285	NUAK1_HUMAN	W	263;13;132	ENSP00000261402:R263W;ENSP00000449990:R13W;ENSP00000448288:R132W	ENSP00000261402:R263W	R	-	1	2	NUAK1	104988727	1.000000	0.71417	0.996000	0.52242	0.598000	0.36846	5.057000	0.64294	2.275000	0.75901	0.563000	0.77884	CGG	NUAK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000074590		0.562	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	HGNC	protein_coding	OTTHUMT00000405767.2	-	0.00	41	0	G	NM_014840		106464597	-1	tier1	-	no_errors	ENST00000261402	ensembl	human	known	74_37	missense	45.16	17	14	SNP	1.000	A
NUMB	8650	genome.wustl.edu	37	14	73759488	73759488	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:73759488G>T	ENST00000355058.3	-	8	682	c.404C>A	c.(403-405)aCc>aAc	p.T135N	NUMB_ENST00000555394.1_Missense_Mutation_p.T135N|NUMB_ENST00000556772.1_5'UTR|NUMB_ENST00000554546.1_Missense_Mutation_p.T124N|NUMB_ENST00000356296.4_Missense_Mutation_p.T135N|NUMB_ENST00000560335.1_Missense_Mutation_p.T135N|NUMB_ENST00000555238.1_Missense_Mutation_p.T135N|NUMB_ENST00000554521.2_Missense_Mutation_p.T124N|NUMB_ENST00000454166.4_Missense_Mutation_p.T135N|NUMB_ENST00000359560.3_Missense_Mutation_p.T124N|NUMB_ENST00000559312.1_Missense_Mutation_p.T135N|NUMB_ENST00000535282.1_Missense_Mutation_p.T124N|NUMB_ENST00000557597.1_Missense_Mutation_p.T124N|NUMB_ENST00000544991.3_Missense_Mutation_p.T135N|NUMB_ENST00000555738.2_Missense_Mutation_p.T124N			P49757	NUMB_HUMAN	numb homolog (Drosophila)	135	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		GCGACGAGTGGTGCCATCACG	0.458																																																	0													100.0	95.0	97.0					14																	73759488		2203	4300	6503	SO:0001583	missense	0			L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.404C>A	14.37:g.73759488G>T	ENSP00000347169:p.Thr135Asn		B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Missense_Mutation	SNP	pfam_Numb_domain,pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	p.T135N	ENST00000355058.3	37	c.404	CCDS32116.1	14	.	.	.	.	.	.	.	.	.	.	G	34	5.347385	0.95807	.	.	ENSG00000133961	ENST00000554546;ENST00000356296;ENST00000557597;ENST00000555238;ENST00000355058;ENST00000359560;ENST00000555394;ENST00000544991;ENST00000454166;ENST00000555738;ENST00000554521;ENST00000535282;ENST00000326018;ENST00000555859;ENST00000555307;ENST00000554394	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.19669	2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13;2.13	5.5	5.5	0.81552	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	T	0.52224	0.1721	M	0.81341	2.54	0.80722	D	1	B;D;D;B;P;P;D;D;D;P;D	0.71674	0.117;0.98;0.973;0.115;0.904;0.84;0.973;0.996;0.998;0.784;0.987	B;D;D;P;P;P;D;D;D;D;D	0.85130	0.358;0.995;0.973;0.754;0.82;0.887;0.943;0.997;0.985;0.96;0.958	T	0.55121	-0.8190	10	0.87932	D	0	-16.6128	19.757	0.96298	0.0:0.0:1.0:0.0	.	124;135;124;135;135;124;124;124;135;124;135	B1P2N6;B1P2N5;B1P2N8;B1P2N7;G3V3R1;Q86SW5;B2RCI6;P49757-4;P49757-2;P49757-3;P49757	.;.;.;.;.;.;.;.;.;.;NUMB_HUMAN	N	124;135;124;135;135;124;135;135;135;124;124;124;99;99;135;135	ENSP00000452416:T124N;ENSP00000348644:T135N;ENSP00000451117:T124N;ENSP00000451300:T135N;ENSP00000347169:T135N;ENSP00000352563:T124N;ENSP00000451625:T135N;ENSP00000446001:T135N;ENSP00000394025:T135N;ENSP00000452069:T124N;ENSP00000450817:T124N;ENSP00000441258:T124N;ENSP00000451326:T99N;ENSP00000452357:T135N;ENSP00000451374:T135N	ENSP00000315193:T99N	T	-	2	0	NUMB	72829241	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.813000	0.99286	2.758000	0.94735	0.561000	0.74099	ACC	NUMB	-	pfam_PTB/PI_dom,pfam_PTB,smart_PTB/PI_dom,pirsf_Numb/numb-like,pfscan_PTB/PI_dom	ENSG00000133961		0.458	NUMB-201	KNOWN	basic|CCDS	protein_coding	NUMB	HGNC	protein_coding	OTTHUMT00000414416.1	-	0.00	31	0	G			73759488	-1	tier1	-	no_errors	ENST00000355058	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
NUP210L	91181	genome.wustl.edu	37	1	154091161	154091161	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:154091161G>A	ENST00000368559.3	-	11	1521	c.1450C>T	c.(1450-1452)Cgt>Tgt	p.R484C	NUP210L_ENST00000271854.3_Missense_Mutation_p.R484C	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	484					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)		p.R484C(1)		NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			ACTTTATAACGATATAACATT	0.328																																																	1	Substitution - Missense(1)	large_intestine(1)											147.0	150.0	149.0					1																	154091161		1835	4085	5920	SO:0001583	missense	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.1450C>T	1.37:g.154091161G>A	ENSP00000357547:p.Arg484Cys		E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.R484C	ENST00000368559.3	37	c.1450	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	17.18	3.325049	0.60634	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.06068	3.35;3.35	5.0	5.0	0.66597	Invasin/intimin cell-adhesion (1);	0.463681	0.20461	N	0.091896	T	0.03871	0.0109	L	0.44542	1.39	0.45150	D	0.998168	D;D	0.61697	0.99;0.99	B;B	0.39660	0.306;0.306	T	0.42599	-0.9442	10	0.72032	D	0.01	-3.2393	16.0759	0.80967	0.0:0.0:1.0:0.0	.	484;484	E7EP56;Q5VU65	.;P210L_HUMAN	C	484	ENSP00000357547:R484C;ENSP00000271854:R484C	ENSP00000271854:R484C	R	-	1	0	NUP210L	152357785	1.000000	0.71417	0.956000	0.39512	0.534000	0.34807	4.858000	0.62947	2.337000	0.79520	0.460000	0.39030	CGT	NUP210L	-	superfamily_Invasin/intimin_cell_adhesion	ENSG00000143552		0.328	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3		0.00	36	0	G	NM_207308		154091161	-1			no_errors	ENST00000368559	ensembl	human	known	74_37	missense	5.36	53	3	SNP	0.999	A
OGT	8473	genome.wustl.edu	37	X	70767756	70767756	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:70767756G>T	ENST00000373719.3	+	5	748		c.e5-1		OGT_ENST00000373701.3_Splice_Site	NM_181672.2|NM_181673.2	NP_858058.1|NP_858059.1	O15294	OGT1_HUMAN	O-linked N-acetylglucosamine (GlcNAc) transferase						apoptotic process (GO:0006915)|cellular response to retinoic acid (GO:0071300)|chromatin organization (GO:0006325)|circadian regulation of gene expression (GO:0032922)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of protein ubiquitination (GO:0031397)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of catalytic activity (GO:0043085)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K27 methylation (GO:0061087)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glycolytic process (GO:0006110)|regulation of insulin receptor signaling pathway (GO:0046626)|regulation of Rac protein signal transduction (GO:0035020)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone acetyltransferase complex (GO:0000123)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)|MLL5-L complex (GO:0070688)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	acetylglucosaminyltransferase activity (GO:0008375)|enzyme activator activity (GO:0008047)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein N-acetylglucosaminyltransferase activity (GO:0016262)|protein O-GlcNAc transferase activity (GO:0097363)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|liver(3)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Renal(35;0.156)					CCCCTCCTAAGGCATGTTATT	0.438																																																	0													125.0	118.0	120.0					X																	70767756		2203	4300	6503	SO:0001630	splice_region_variant	0			U77413	CCDS14414.1, CCDS35502.1	Xq13	2013-07-24	2012-05-04		ENSG00000147162	ENSG00000147162	2.4.1.255	"""Tetratricopeptide (TTC) repeat domain containing"""	8127	protein-coding gene	gene with protein product	"""UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase"""	300255	"""O-linked N-acetylglucosamine (GlcNAc) transferase (UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase)"""			9083068	Standard	NM_181672		Approved	O-GLCNAC, HRNT1, MGC22921, FLJ23071	uc004eaa.2	O15294	OTTHUMG00000033316	ENST00000373719.3:c.532-1G>T	X.37:g.70767756G>T			Q7Z3K0|Q8WWM8|Q96CC1|Q9UG57	Splice_Site	SNP	-	e5-1	ENST00000373719.3	37	c.532-1	CCDS14414.1	X	.	.	.	.	.	.	.	.	.	.	g	21.0	4.085627	0.76642	.	.	ENSG00000147162	ENST00000373719;ENST00000373701;ENST00000455587	.	.	.	4.84	4.84	0.62591	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1634	0.86809	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	OGT	70684481	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.652000	0.98499	2.232000	0.73038	0.591000	0.81541	.	OGT	-	-	ENSG00000147162		0.438	OGT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGT	HGNC	protein_coding	OTTHUMT00000081829.3	-	0.00	52	0	G	NM_003605, NM_181672	Intron	70767756	+1	tier1	-	no_errors	ENST00000373719	ensembl	human	known	74_37	splice_site	9.43	48	5	SNP	1.000	T
OPCML	4978	genome.wustl.edu	37	11	132306622	132306622	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:132306622T>G	ENST00000331898.7	-	5	1294	c.716A>C	c.(715-717)aAg>aCg	p.K239T	OPCML_ENST00000529038.1_5'UTR|OPCML_ENST00000541867.1_Missense_Mutation_p.K239T|OPCML_ENST00000524381.1_Missense_Mutation_p.K232T|OPCML_ENST00000374778.4_Missense_Mutation_p.K198T	NM_002545.3	NP_002536.1	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion molecule-like	239	Ig-like C2-type 3.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)|opioid receptor signaling pathway (GO:0038003)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	opioid receptor activity (GO:0004985)			endometrium(5)|kidney(1)|large_intestine(12)|lung(17)|ovary(2)|skin(2)|urinary_tract(8)	47	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		CAGGATGCCCTTCTGACCGAC	0.507																																																	0													133.0	116.0	122.0					11																	132306622		2201	4297	6498	SO:0001583	missense	0			BX537377	CCDS8492.1, CCDS31722.1	11q25	2013-01-11	2001-11-28		ENSG00000183715	ENSG00000183715		"""Immunoglobulin superfamily / I-set domain containing"""	8143	protein-coding gene	gene with protein product	"""IgLON family member 1"""	600632	"""opioid-binding protein/cell adhesion molecule-like"""			8244387	Standard	XM_005271578		Approved	OPCM, OBCAM, IGLON1	uc001qgs.3	Q14982	OTTHUMG00000163658	ENST00000331898.7:c.716A>C	11.37:g.132306622T>G	ENSP00000330862:p.Lys239Thr		B2CZX2|B7ZLQ1|Q17RN7|Q7Z3W6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.K239T	ENST00000331898.7	37	c.716	CCDS8492.1	11	.	.	.	.	.	.	.	.	.	.	T	14.47	2.544578	0.45280	.	.	ENSG00000183715	ENST00000331898;ENST00000524381;ENST00000374778;ENST00000416724;ENST00000541867	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.68	5.68	0.88126	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.42787	0.1218	N	0.04787	-0.16	0.80722	D	1	B;B;B;B	0.20164	0.042;0.042;0.042;0.042	B;B;B;B	0.20577	0.03;0.03;0.017;0.017	T	0.32851	-0.9891	10	0.29301	T	0.29	-20.5111	15.5993	0.76611	0.0:0.0:0.0:1.0	.	239;232;238;239	B7ZLQ1;Q7Z3W6;B7ZLQ0;Q14982	.;.;.;OPCM_HUMAN	T	239;232;198;206;239	ENSP00000330862:K239T;ENSP00000434750:K232T;ENSP00000363910:K198T;ENSP00000445496:K239T	ENSP00000330862:K239T	K	-	2	0	OPCML	131811832	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	4.805000	0.62561	2.158000	0.67659	0.528000	0.53228	AAG	OPCML	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000183715		0.507	OPCML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPCML	HGNC	protein_coding	OTTHUMT00000374689.3	-	0.00	24	0	T	NM_001012393		132306622	-1	tier1	-	no_errors	ENST00000541867	ensembl	human	known	74_37	missense	29.41	12	5	SNP	1.000	G
OPRL1	4987	genome.wustl.edu	37	20	62729766	62729766	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr20:62729766C>T	ENST00000349451.3	+	6	1139	c.727C>T	c.(727-729)Cgt>Tgt	p.R243C	OPRL1_ENST00000355631.4_Missense_Mutation_p.R243C|OPRL1_ENST00000336866.2_Missense_Mutation_p.R243C	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	243					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					CCGGCGGCTCCGTGGAGTCCG	0.627																																																	0													170.0	147.0	155.0					20																	62729766		2203	4300	6503	SO:0001583	missense	0				CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.727C>T	20.37:g.62729766C>T	ENSP00000336764:p.Arg243Cys		Q8TD34|Q8WYH9|Q9H4K4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_X_opioid_rcpt,prints_GPCR_Rhodpsn,prints_Opioid_rcpt,prints_Somatstn_rcpt,prints_Neuropept_B/W_rcpt,prints_NPY_rcpt	p.R243C	ENST00000349451.3	37	c.727	CCDS13556.1	20	.	.	.	.	.	.	.	.	.	.	C	11.92	1.783331	0.31593	.	.	ENSG00000125510	ENST00000336866;ENST00000355631;ENST00000349451	T;T;T	0.42900	0.96;0.96;0.96	4.64	3.63	0.41609	GPCR, rhodopsin-like superfamily (1);	0.309883	0.30649	N	0.009161	T	0.60157	0.2247	M	0.78049	2.395	0.21740	N	0.999562	D;D	0.89917	0.999;1.0	P;D	0.65773	0.855;0.938	T	0.52320	-0.8591	10	0.87932	D	0	.	10.3533	0.43950	0.4129:0.5871:0.0:0.0	.	238;243	P41146-2;P41146	.;OPRX_HUMAN	C	243	ENSP00000336843:R243C;ENSP00000347848:R243C;ENSP00000336764:R243C	ENSP00000336843:R243C	R	+	1	0	OPRL1	62200210	0.992000	0.36948	0.149000	0.22428	0.006000	0.05464	2.579000	0.46059	2.130000	0.65690	0.505000	0.49811	CGT	OPRL1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Neuropept_B/W_rcpt	ENSG00000125510		0.627	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OPRL1	HGNC	protein_coding	OTTHUMT00000080295.1	-	0.00	33	0	C	NM_182647		62729766	+1	tier1	-	no_errors	ENST00000336866	ensembl	human	known	74_37	missense	40.74	16	11	SNP	0.133	T
OR13C8	138802	genome.wustl.edu	37	9	107331770	107331770	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:107331770G>A	ENST00000335040.1	+	1	322	c.322G>A	c.(322-324)Ggg>Agg	p.G108R		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	108						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						TTTTGCCATGGGGGCCACGGA	0.493																																																	0													111.0	103.0	106.0					9																	107331770		2203	4300	6503	SO:0001583	missense	0				CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.322G>A	9.37:g.107331770G>A	ENSP00000334068:p.Gly108Arg		Q5VVG0|Q96R44	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G108R	ENST00000335040.1	37	c.322	CCDS35090.1	9	.	.	.	.	.	.	.	.	.	.	G	10.21	1.286261	0.23478	.	.	ENSG00000186943	ENST00000335040	T	0.01347	4.99	5.18	4.29	0.51040	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000018	T	0.06600	0.0169	H	0.96889	3.9	0.34387	D	0.693732	P	0.45827	0.867	B	0.42995	0.404	T	0.17837	-1.0356	10	0.72032	D	0.01	.	12.0391	0.53442	0.0839:0.0:0.9161:0.0	.	108	Q8NGS7	O13C8_HUMAN	R	108	ENSP00000334068:G108R	ENSP00000334068:G108R	G	+	1	0	OR13C8	106371591	0.017000	0.18338	1.000000	0.80357	0.046000	0.14306	1.794000	0.38774	1.554000	0.49487	-0.137000	0.14449	GGG	OR13C8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000186943		0.493	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C8	HGNC	protein_coding	OTTHUMT00000053480.1	-	0.00	36	0	G			107331770	+1	tier1	-	no_errors	ENST00000335040	ensembl	human	known	74_37	missense	41.18	30	21	SNP	0.944	A
OR2M2	391194	genome.wustl.edu	37	1	248343315	248343315	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:248343315T>G	ENST00000359682.2	+	1	28	c.28T>G	c.(28-30)Tcc>Gcc	p.S10A		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	10						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GACCTTCAACTCCGACTTCAT	0.428																																																	0													209.0	206.0	207.0					1																	248343315		2203	4300	6503	SO:0001583	missense	0			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.28T>G	1.37:g.248343315T>G	ENSP00000352710:p.Ser10Ala		A3KFT4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S10A	ENST00000359682.2	37	c.28	CCDS31106.1	1	.	.	.	.	.	.	.	.	.	.	t	8.446	0.851989	0.17034	.	.	ENSG00000198601	ENST00000359682	T	0.00453	7.33	1.44	-2.87	0.05700	.	0.319420	0.17451	U	0.173770	T	0.00241	0.0007	L	0.31294	0.92	0.09310	N	1	P	0.36753	0.568	B	0.38106	0.265	T	0.47129	-0.9141	10	0.42905	T	0.14	.	6.4561	0.21930	0.5741:0.0:0.0:0.4259	.	10	Q96R28	OR2M2_HUMAN	A	10	ENSP00000352710:S10A	ENSP00000352710:S10A	S	+	1	0	OR2M2	246409938	0.000000	0.05858	0.000000	0.03702	0.332000	0.28634	-0.011000	0.12721	-0.206000	0.10203	0.248000	0.18094	TCC	OR2M2	-	NULL	ENSG00000198601		0.428	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M2	HGNC	protein_coding	OTTHUMT00000097356.2	-	0.00	75	0	T	NM_001004688		248343315	+1	tier1	-	no_errors	ENST00000359682	ensembl	human	known	74_37	missense	53.33	14	16	SNP	0.000	G
OR2T6	254879	genome.wustl.edu	37	1	248551709	248551709	+	Missense_Mutation	SNP	C	C	T	rs562359922		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:248551709C>T	ENST00000355728.2	+	1	800	c.800C>T	c.(799-801)aCc>aTc	p.T267I		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	267						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCTTACCACACCCCAATCAAA	0.478																																																	0													161.0	152.0	155.0					1																	248551709		2203	4300	6503	SO:0001583	missense	0			AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.800C>T	1.37:g.248551709C>T	ENSP00000347965:p.Thr267Ile		A6NE36	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.T267I	ENST00000355728.2	37	c.800	CCDS31114.1	1	.	.	.	.	.	.	.	.	.	.	C	7.568	0.666186	0.14710	.	.	ENSG00000198104	ENST00000355728	T	0.00115	8.71	4.2	3.26	0.37387	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	D	0.000268	T	0.00210	0.0006	L	0.60845	1.875	0.20403	N	0.999909	P	0.38440	0.631	P	0.44811	0.461	T	0.19549	-1.0302	10	0.72032	D	0.01	.	4.1148	0.10076	0.1658:0.5845:0.1607:0.089	.	267	Q8NHC8	OR2T6_HUMAN	I	267	ENSP00000347965:T267I	ENSP00000347965:T267I	T	+	2	0	OR2T6	246618332	0.000000	0.05858	0.819000	0.32651	0.173000	0.22820	0.692000	0.25482	1.076000	0.40961	0.643000	0.83706	ACC	OR2T6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198104		0.478	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T6	HGNC	protein_coding	OTTHUMT00000097344.1	-	0.00	46	0	C	NM_001005471		248551709	+1	tier1	-	no_errors	ENST00000355728	ensembl	human	known	74_37	missense	54.17	11	13	SNP	0.391	T
OR52H1	390067	genome.wustl.edu	37	11	5565870	5565870	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:5565870A>G	ENST00000322653.4	-	1	909	c.884T>C	c.(883-885)cTc>cCc	p.L295P	HBG2_ENST00000380259.2_Intron	NM_001005289.1	NP_001005289.1	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H, member 1	295						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(2)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CATGGGGTTGAGTGCAGGTGG	0.438																																																	0													172.0	167.0	169.0					11																	5565870		2201	4297	6498	SO:0001583	missense	0			AB065802	CCDS31386.1	11p15.4	2012-08-09			ENSG00000181616	ENSG00000181616		"""GPCR / Class A : Olfactory receptors"""	15218	protein-coding gene	gene with protein product							Standard	NM_001005289		Approved		uc010qzh.2	Q8NGJ2	OTTHUMG00000066909	ENST00000322653.4:c.884T>C	11.37:g.5565870A>G	ENSP00000326259:p.Leu295Pro		B9EH26|Q6IF79	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L295P	ENST00000322653.4	37	c.884	CCDS31386.1	11	.	.	.	.	.	.	.	.	.	.	A	18.21	3.572449	0.65765	.	.	ENSG00000181616	ENST00000322653	T	0.50813	0.73	5.22	5.22	0.72569	GPCR, rhodopsin-like superfamily (1);	0.135771	0.34676	N	0.003763	T	0.76047	0.3933	H	0.96518	3.835	0.47778	D	0.99951	D	0.59357	0.985	P	0.61874	0.895	D	0.84239	0.0471	10	0.87932	D	0	.	13.9278	0.63972	1.0:0.0:0.0:0.0	.	295	Q8NGJ2	O52H1_HUMAN	P	295	ENSP00000326259:L295P	ENSP00000326259:L295P	L	-	2	0	OR52H1	5522446	0.910000	0.30920	0.998000	0.56505	0.893000	0.52053	6.870000	0.75526	1.968000	0.57251	0.528000	0.53228	CTC	OR52H1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000181616		0.438	OR52H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52H1	HGNC	protein_coding	OTTHUMT00000143400.1	-	0.00	49	0	A	NM_001005289		5565870	-1	tier1	-	no_errors	ENST00000322653	ensembl	human	known	74_37	missense	24.53	40	13	SNP	0.589	G
OR4A47	403253	genome.wustl.edu	37	11	48510431	48510431	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:48510431C>A	ENST00000446524.1	+	1	163	c.87C>A	c.(85-87)ttC>ttA	p.F29L		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						TTGTTATGTTCTTGCTCTTCT	0.443																																																	0													36.0	34.0	35.0					11																	48510431		2200	4277	6477	SO:0001583	missense	0			BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.87C>A	11.37:g.48510431C>A	ENSP00000412752:p.Phe29Leu			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F29L	ENST00000446524.1	37	c.87	CCDS31490.1	11	.	.	.	.	.	.	.	.	.	.	N	8.248	0.808330	0.16467	.	.	ENSG00000237388	ENST00000446524	T	0.04454	3.62	4.91	-3.13	0.05266	.	0.224310	0.31554	N	0.007451	T	0.03827	0.0108	L	0.56124	1.755	0.09310	N	1	P	0.50528	0.936	B	0.37387	0.248	T	0.35126	-0.9801	10	0.72032	D	0.01	.	6.0913	0.19995	0.1324:0.3168:0.0:0.5508	.	29	Q6IF82	O4A47_HUMAN	L	29	ENSP00000412752:F29L	ENSP00000412752:F29L	F	+	3	2	OR4A47	48467007	0.000000	0.05858	0.004000	0.12327	0.019000	0.09904	-1.716000	0.01878	-0.402000	0.07633	-0.314000	0.08810	TTC	OR4A47	-	prints_GPCR_Rhodpsn	ENSG00000237388		0.443	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A47	HGNC	protein_coding	OTTHUMT00000390559.1	-	0.00	44	0	C	NM_001005512		48510431	+1	tier1	-	no_errors	ENST00000446524	ensembl	human	known	74_37	missense	29.51	43	18	SNP	0.004	A
OR5T3	390154	genome.wustl.edu	37	11	56019748	56019748	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:56019748G>T	ENST00000303059.3	+	1	73	c.73G>T	c.(73-75)Ggt>Tgt	p.G25C		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.G25C(1)		breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					GTTGTCATCAGGTTTGGATAT	0.373																																																	1	Substitution - Missense(1)	lung(1)											86.0	84.0	84.0					11																	56019748		2201	4295	6496	SO:0001583	missense	0			AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.73G>T	11.37:g.56019748G>T	ENSP00000305403:p.Gly25Cys		Q6IFC7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G25C	ENST00000303059.3	37	c.73	CCDS31524.1	11	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420746	0.42918	.	.	ENSG00000172489	ENST00000303059	T	0.02216	4.39	4.56	-2.4	0.06583	.	7.887880	0.01204	U	0.007653	T	0.01940	0.0061	N	0.08118	0	0.09310	N	1	D	0.61080	0.989	P	0.46320	0.512	T	0.28839	-1.0031	10	0.62326	D	0.03	.	4.5857	0.12280	0.3206:0.0:0.3848:0.2945	.	25	Q8NGG3	OR5T3_HUMAN	C	25	ENSP00000305403:G25C	ENSP00000305403:G25C	G	+	1	0	OR5T3	55776324	0.000000	0.05858	0.000000	0.03702	0.127000	0.20565	-0.172000	0.09868	-0.566000	0.06054	0.643000	0.83706	GGT	OR5T3	-	NULL	ENSG00000172489		0.373	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T3	HGNC	protein_coding	OTTHUMT00000391599.1		0.00	34	0	G	NM_001004747		56019748	+1			no_errors	ENST00000303059	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.000	T
OR6C75	390323	genome.wustl.edu	37	12	55759191	55759192	+	Frame_Shift_Ins	INS	-	-	T	rs398102300|rs75456529	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:55759191_55759192insT	ENST00000343399.3	+	1	297_298	c.297_298insT	c.(298-300)tttfs	p.F100fs		NM_001005497.1	NP_001005497.1	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C, member 75	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)	25						TGGCTCAGCTATTTTTTTTCAT	0.436																																																	0																																										SO:0001589	frameshift_variant	0				CCDS31820.1	12q13.2	2013-09-23			ENSG00000187857	ENSG00000187857		"""GPCR / Class A : Olfactory receptors"""	31304	protein-coding gene	gene with protein product							Standard	NM_001005497		Approved		uc010spk.2	A6NL08	OTTHUMG00000169886	ENST00000343399.3:c.305dupT	12.37:g.55759199_55759199dupT	ENSP00000368987:p.Phe100fs			Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I102fs	ENST00000343399.3	37	c.297_298	CCDS31820.1	12																																																																																			OR6C75	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000187857		0.436	OR6C75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C75	HGNC	protein_coding	OTTHUMT00000406418.1		0.00	25	0	-			55759192	+1	tier1		no_errors	ENST00000343399	ensembl	human	known	74_37	frame_shift_ins	32.26	21	10	INS	0.002:0.964	T
OR6N1	128372	genome.wustl.edu	37	1	158735897	158735897	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:158735897C>T	ENST00000335094.2	-	1	595	c.576G>A	c.(574-576)acG>acA	p.T192T		NM_001005185.1	NP_001005185.1	Q8NGY5	OR6N1_HUMAN	olfactory receptor, family 6, subfamily N, member 1	192						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T192T(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_hematologic(112;0.0378)					CATTTATAGACGTATCAGTGC	0.463																																																	1	Substitution - coding silent(1)	large_intestine(1)											106.0	111.0	109.0					1																	158735897		2203	4300	6503	SO:0001819	synonymous_variant	0			BK004199	CCDS30905.1	1q23.1	2012-08-09			ENSG00000197403	ENSG00000197403		"""GPCR / Class A : Olfactory receptors"""	15034	protein-coding gene	gene with protein product							Standard	NM_001005185		Approved		uc010piq.2	Q8NGY5	OTTHUMG00000022774	ENST00000335094.2:c.576G>A	1.37:g.158735897C>T			Q5VUU8|Q96R35	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T192	ENST00000335094.2	37	c.576	CCDS30905.1	1																																																																																			OR6N1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000197403		0.463	OR6N1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6N1	HGNC	protein_coding	OTTHUMT00000059067.1	-	0.00	19	0	C	NM_001005185		158735897	-1	tier1	-	no_errors	ENST00000335094	ensembl	human	known	74_37	silent	50.00	13	13	SNP	0.018	T
OTUD4	54726	genome.wustl.edu	37	4	146064566	146064566	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:146064566G>A	ENST00000447906.2	-	17	1821	c.1634C>T	c.(1633-1635)tCa>tTa	p.S545L	OTUD4_ENST00000455611.2_5'UTR|OTUD4_ENST00000454497.2_Missense_Mutation_p.S480L			Q01804	OTUD4_HUMAN	OTU deubiquitinase 4	545					protein K48-linked deubiquitination (GO:0071108)		poly(A) RNA binding (GO:0044822)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(180;0.151)					TGATGGTGATGAAACTGTTGC	0.368																																																	0													101.0	96.0	98.0					4																	146064566		2203	4300	6503	SO:0001583	missense	0				CCDS3764.1, CCDS47139.1	4q31.21	2014-02-24	2014-02-24		ENSG00000164164	ENSG00000164164		"""OTU domain containing"""	24949	protein-coding gene	gene with protein product		611744	"""OTU domain containing 4"""			1475186, 12727813, 19996094	Standard	NM_001102653		Approved	HSHIN1, KIAA1046, DUBA6	uc003ika.4	Q01804	OTTHUMG00000161480	ENST00000447906.2:c.1634C>T	4.37:g.146064566G>A	ENSP00000395487:p.Ser545Leu		B4DYS4|Q147U2|Q1ZYK1|Q6PG39|Q96MQ5|Q9NT94|Q9UPV6	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.S545L	ENST00000447906.2	37	c.1634		4	.	.	.	.	.	.	.	.	.	.	G	18.61	3.660946	0.67700	.	.	ENSG00000164164	ENST00000454497;ENST00000447906	T;T	0.32515	1.45;1.45	5.93	5.93	0.95920	.	0.114545	0.40908	D	0.000991	T	0.25754	0.0627	L	0.32530	0.975	0.80722	D	1	B;B	0.31931	0.347;0.236	B;B	0.26416	0.069;0.031	T	0.03910	-1.0993	10	0.87932	D	0	-10.5694	15.854	0.78960	0.0:0.0:1.0:0.0	.	545;544	G3V0I6;Q01804	.;OTUD4_HUMAN	L	480;545	ENSP00000409279:S480L;ENSP00000395487:S545L	ENSP00000395487:S545L	S	-	2	0	OTUD4	146284016	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	5.771000	0.68881	2.826000	0.97356	0.655000	0.94253	TCA	OTUD4	-	NULL	ENSG00000164164		0.368	OTUD4-004	KNOWN	basic|appris_principal	protein_coding	OTUD4	HGNC	protein_coding	OTTHUMT00000365117.2	-	0.00	16	0	G	NM_017493		146064566	-1	tier1	-	no_errors	ENST00000447906	ensembl	human	known	74_37	missense	28.12	23	9	SNP	1.000	A
OTUD6A	139562	genome.wustl.edu	37	X	69283089	69283089	+	Missense_Mutation	SNP	G	G	T	rs142480469		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:69283089G>T	ENST00000338352.2	+	1	749	c.715G>T	c.(715-717)Gac>Tac	p.D239Y		NM_207320.1	NP_997203.1	Q7L8S5	OTU6A_HUMAN	OTU deubiquitinase 6A	239	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				protein K11-linked deubiquitination (GO:0035871)|protein K27-linked deubiquitination (GO:1990167)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)		ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(8)|skin(3)|urinary_tract(1)	23						GATCCAGGCCGACTCGCCCAC	0.622																																																	0													72.0	58.0	63.0					X																	69283089		2203	4300	6503	SO:0001583	missense	0			AK098697	CCDS14395.1	Xq13.1	2014-02-24	2014-02-24			ENSG00000189401		"""OTU domain containing"""	32312	protein-coding gene	gene with protein product		300714	"""OTU domain containing 6A"""			23827681	Standard	NM_207320		Approved	FLJ25831, HSHIN6, DUBA2	uc004dxu.1	Q7L8S5		ENST00000338352.2:c.715G>T	X.37:g.69283089G>T	ENSP00000339389:p.Asp239Tyr		B2RPB7	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.D239Y	ENST00000338352.2	37	c.715	CCDS14395.1	X	.	.	.	.	.	.	.	.	.	.	G	8.277	0.814582	0.16607	.	.	ENSG00000189401	ENST00000338352	T	0.52295	0.67	4.42	-1.82	0.07857	Ovarian tumour, otubain (2);	0.520280	0.20572	N	0.089701	T	0.30479	0.0766	L	0.41710	1.295	0.09310	N	1	B	0.13145	0.007	B	0.20577	0.03	T	0.11690	-1.0577	10	0.42905	T	0.14	.	3.3329	0.07091	0.3014:0.1087:0.4781:0.1118	.	239	Q7L8S5	OTU6A_HUMAN	Y	239	ENSP00000339389:D239Y	ENSP00000339389:D239Y	D	+	1	0	OTUD6A	69199814	0.276000	0.24211	0.000000	0.03702	0.004000	0.04260	1.029000	0.30140	-0.923000	0.03785	-0.905000	0.02835	GAC	OTUD6A	-	pfam_OTU,pfscan_OTU	ENSG00000189401		0.622	OTUD6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD6A	HGNC	protein_coding	OTTHUMT00000358763.1	-	0.00	21	0	G	NM_207320		69283089	+1	tier1	-	no_errors	ENST00000338352	ensembl	human	known	74_37	missense	47.06	9	8	SNP	0.000	T
P2RY13	53829	genome.wustl.edu	37	3	151046141	151046142	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:151046141_151046142insT	ENST00000325602.5	-	2	721_722	c.702_703insA	c.(700-705)aaagtafs	p.V235fs	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000491549.1_Intron	NM_176894.2	NP_795713.2	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	235					negative regulation of adenylate cyclase activity (GO:0007194)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			GAATCATATACTTTTTTTGCAA	0.337																																																	0																																										SO:0001589	frameshift_variant	0			AF295368	CCDS3158.2	3q24	2012-08-08	2004-07-12	2004-07-14	ENSG00000181631	ENSG00000181631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	4537	protein-coding gene	gene with protein product		606380	"""G protein-coupled receptor 86"""	GPR94, GPR86		11273702, 11574155	Standard	NM_176894		Approved	FKSG77, P2Y13	uc003eyv.2	Q9BPV8	OTTHUMG00000155745	ENST00000325602.5:c.703dupA	3.37:g.151046148_151046148dupT	ENSP00000320376:p.Val235fs		B2R827|Q05C50|Q6DKN4|Q8IUT5|Q8TDU7|Q9BY61	Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_P2Y13_rcpt,prints_GPCR_Rhodpsn,prints_P2Y14_rcpt,pfscan_GPCR_Rhodpsn_7TM	p.V234fs	ENST00000325602.5	37	c.703_702	CCDS3158.2	3																																																																																			P2RY13	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_P2Y13_rcpt,prints_P2Y14_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181631		0.337	P2RY13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY13	HGNC	protein_coding	OTTHUMT00000341468.1		0.00	17	0	-	NM_023914		151046142	-1	tier1		no_errors	ENST00000325602	ensembl	human	known	74_37	frame_shift_ins	17.65	14	3	INS	1.000:0.880	T
PACS2	23241	genome.wustl.edu	37	14	105849726	105849726	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:105849726C>T	ENST00000325438.8	+	16	2148	c.1644C>T	c.(1642-1644)ccC>ccT	p.P548P	PACS2_ENST00000430725.2_Silent_p.P473P|PACS2_ENST00000447393.1_Silent_p.P552P|PACS2_ENST00000551743.1_Silent_p.P62P|PACS2_ENST00000458164.2_Silent_p.P552P|PACS2_ENST00000547217.1_Silent_p.P518P			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	548					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		CCCCGACCCCCGTGAAGATCG	0.637																																																	0													60.0	61.0	61.0					14																	105849726		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.1644C>T	14.37:g.105849726C>T			A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Silent	SNP	pfam_Phosphofurin_acidic_CS-1	p.P552	ENST00000325438.8	37	c.1656	CCDS32168.1	14																																																																																			PACS2	-	pfam_Phosphofurin_acidic_CS-1	ENSG00000179364		0.637	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PACS2	HGNC	protein_coding	OTTHUMT00000409209.1	-	0.00	22	0	C	XM_377355		105849726	+1	tier1	-	no_errors	ENST00000458164	ensembl	human	known	74_37	silent	44.44	15	12	SNP	0.045	T
PAK6	56924	genome.wustl.edu	37	15	40566472	40566472	+	Missense_Mutation	SNP	C	C	T	rs371992889		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:40566472C>T	ENST00000542403.2	+	8	1984	c.1873C>T	c.(1873-1875)Cac>Tac	p.H625Y	PAK6_ENST00000441369.1_Missense_Mutation_p.H625Y|PAK6_ENST00000260404.4_Missense_Mutation_p.H625Y|PAK6_ENST00000455577.2_Intron|RP11-133K1.2_ENST00000558658.1_3'UTR|PAK6_ENST00000453867.1_Missense_Mutation_p.H625Y|PAK6_ENST00000560346.1_Missense_Mutation_p.H625Y	NM_001276717.1	NP_001263646.1	Q9NQU5	PAK6_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 6	625	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cytoskeleton organization (GO:0007010)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(2)	24		all_cancers(109;1.13e-18)|all_epithelial(112;1.62e-15)|Lung NSC(122;5.67e-11)|all_lung(180;1.41e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0823)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.51e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0544)		GAAAAACTCTCACAAGGTCAG	0.587											OREG0023057	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													78.0	82.0	80.0					15																	40566472		2203	4300	6503	SO:0001583	missense	0			AF276893	CCDS10054.1, CCDS61590.1	15q14	2008-06-17	2008-06-17		ENSG00000137843	ENSG00000137843			16061	protein-coding gene	gene with protein product		608110	"""p21(CDKN1A)-activated kinase 6"""			11278661	Standard	NM_020168		Approved	PAK5	uc001zlb.3	Q9NQU5	OTTHUMG00000129921	ENST00000542403.2:c.1873C>T	15.37:g.40566472C>T	ENSP00000439597:p.His625Tyr	894	A8K2G2|B3KYB0|G5E9R2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CRIB_dom,superfamily_Kinase-like_dom,smart_CRIB_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRIB_dom,pfscan_Prot_kinase_dom	p.H625Y	ENST00000542403.2	37	c.1873	CCDS10054.1	15	.	.	.	.	.	.	.	.	.	.	C	13.90	2.373652	0.42105	.	.	ENSG00000137843	ENST00000441369;ENST00000453867;ENST00000260404;ENST00000542403	T;T;T;T	0.64438	-0.1;-0.1;-0.1;-0.1	4.96	3.05	0.35203	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.477560	0.24003	N	0.042459	T	0.39306	0.1073	N	0.04994	-0.135	0.49213	D	0.999762	B	0.02656	0.0	B	0.04013	0.001	T	0.18085	-1.0348	10	0.54805	T	0.06	.	10.703	0.45939	0.0:0.8413:0.0:0.1587	.	625	Q9NQU5	PAK6_HUMAN	Y	625	ENSP00000406873:H625Y;ENSP00000401153:H625Y;ENSP00000260404:H625Y;ENSP00000439597:H625Y	ENSP00000260404:H625Y	H	+	1	0	PAK6	38353764	1.000000	0.71417	0.768000	0.31515	0.980000	0.70556	3.024000	0.49674	0.593000	0.29745	0.561000	0.74099	CAC	PAK6	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000137843		0.587	PAK6-004	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PAK6	HGNC	protein_coding	OTTHUMT00000418355.1	-	0.00	34	0	C			40566472	+1	tier1	-	no_errors	ENST00000260404	ensembl	human	known	74_37	missense	35.14	23	13	SNP	1.000	T
PANK1	53354	genome.wustl.edu	37	10	91353588	91353588	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:91353588C>G	ENST00000307534.4	-	4	1624	c.1469G>C	c.(1468-1470)gGa>gCa	p.G490A	PANK1_ENST00000371774.2_Missense_Mutation_p.G292A|MIR107_ENST00000362127.1_RNA|PANK1_ENST00000322191.6_Intron|PANK1_ENST00000342512.3_Missense_Mutation_p.G265A	NM_148977.2	NP_683878.1	Q8TE04	PANK1_HUMAN	pantothenate kinase 1	490					coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell periphery (GO:0071944)|clathrin coat (GO:0030118)|cytosol (GO:0005829)|nucleus (GO:0005634)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			cervix(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	11						TACAGCAGATCCTTGAAGGCC	0.448																																																	0													220.0	192.0	201.0					10																	91353588		2203	4300	6503	SO:0001583	missense	0			AF355198	CCDS7405.1, CCDS7406.1, CCDS31244.1	10q23.31	2008-05-14	2002-11-13	2002-11-15	ENSG00000152782	ENSG00000152782			8598	protein-coding gene	gene with protein product		606160	"""pantothenate kinase"""	PANK		11809413	Standard	NM_148977		Approved	MGC24596, PANK1a, PANK1b	uc001kgp.2	Q8TE04	OTTHUMG00000018718	ENST00000307534.4:c.1469G>C	10.37:g.91353588C>G	ENSP00000302108:p.Gly490Ala		A6NIP0|Q7RTX6|Q7Z495|Q8TBQ8	Missense_Mutation	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.G490A	ENST00000307534.4	37	c.1469	CCDS31244.1	10	.	.	.	.	.	.	.	.	.	.	C	17.64	3.438641	0.62955	.	.	ENSG00000152782	ENST00000342512;ENST00000371774;ENST00000307534;ENST00000371775	D;D;D	0.99552	-6.15;-6.15;-6.15	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.99366	0.9777	L	0.45228	1.405	0.80722	D	1	P;D;P	0.89917	0.604;1.0;0.604	B;D;B	0.91635	0.202;0.999;0.202	D	0.99883	1.1116	10	0.20519	T	0.43	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	292;490;265	Q8TE04-4;Q8TE04;Q8TE04-2	.;PANK1_HUMAN;.	A	265;292;490;353	ENSP00000345118:G265A;ENSP00000360839:G292A;ENSP00000302108:G490A	ENSP00000302108:G490A	G	-	2	0	PANK1	91343568	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.760000	0.85248	2.941000	0.99782	0.655000	0.94253	GGA	PANK1	-	pfam_Type_II_PanK,tigrfam_Type_II_PanK	ENSG00000152782		0.448	PANK1-201	KNOWN	basic|CCDS	protein_coding	PANK1	HGNC	protein_coding			0.00	50	0	C			91353588	-1			no_errors	ENST00000307534	ensembl	human	known	74_37	missense	9.30	38	4	SNP	1.000	G
PCDHA7	56141	genome.wustl.edu	37	5	140216158	140216158	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:140216158C>T	ENST00000525929.1	+	1	2190	c.2190C>T	c.(2188-2190)ggC>ggT	p.G730G	PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000378125.3_Silent_p.G730G|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	730					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTCTGAGGGCGCATGTAGTT	0.632																																					NSCLC(160;258 2013 5070 22440 28951)												0													83.0	73.0	76.0					5																	140216158		2203	4299	6502	SO:0001819	synonymous_variant	0			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.2190C>T	5.37:g.140216158C>T			O75282	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G730	ENST00000525929.1	37	c.2190	CCDS54918.1	5																																																																																			PCDHA7	-	NULL	ENSG00000204963		0.632	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	-	0.00	56	0	C	NM_018910		140216158	+1	tier1	-	no_errors	ENST00000525929	ensembl	human	known	74_37	silent	9.09	40	4	SNP	0.061	T
PCDHA12	56137	genome.wustl.edu	37	5	140257158	140257158	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:140257158A>G	ENST00000398631.2	+	1	2101	c.2101A>G	c.(2101-2103)Atc>Gtc	p.I701V	PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	701					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGTACCTCATCATCGCCAT	0.662																																					Pancreas(113;759 1672 13322 24104 50104)												0													42.0	43.0	43.0					5																	140257158		2203	4299	6502	SO:0001583	missense	0			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.2101A>G	5.37:g.140257158A>G	ENSP00000381628:p.Ile701Val		O75278|Q2M1N8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.I701V	ENST00000398631.2	37	c.2101	CCDS47285.1	5	.	.	.	.	.	.	.	.	.	.	A	10.56	1.384724	0.25031	.	.	ENSG00000251664	ENST00000398631	T	0.48201	0.82	4.94	4.94	0.65067	.	.	.	.	.	T	0.45438	0.1342	M	0.71036	2.16	0.24293	N	0.995151	B;B	0.26147	0.143;0.088	B;B	0.31614	0.133;0.047	T	0.42783	-0.9431	9	0.10377	T	0.69	.	8.9399	0.35722	0.9159:0.0:0.0841:0.0	.	701;701	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	V	701	ENSP00000381628:I701V	ENSP00000381628:I701V	I	+	1	0	PCDHA12	140237342	0.000000	0.05858	0.998000	0.56505	0.553000	0.35397	-0.197000	0.09518	1.853000	0.53794	0.533000	0.62120	ATC	PCDHA12	-	NULL	ENSG00000251664		0.662	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	-	0.00	30	0	A	NM_018903		140257158	+1	tier1	-	no_errors	ENST00000398631	ensembl	human	known	74_37	missense	64.71	12	22	SNP	0.997	G
PCDHB3	56132	genome.wustl.edu	37	5	140482553	140482553	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:140482553T>G	ENST00000231130.2	+	1	2320	c.2320T>G	c.(2320-2322)Ttc>Gtc	p.F774V	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	774					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TATCCCCAACTTCGTTGCTCA	0.517																																																	0													77.0	79.0	79.0					5																	140482553		2202	4297	6499	SO:0001583	missense	0			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.2320T>G	5.37:g.140482553T>G	ENSP00000231130:p.Phe774Val		B2R8P2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F774V	ENST00000231130.2	37	c.2320	CCDS4245.1	5	.	.	.	.	.	.	.	.	.	.	T	10.13	1.265968	0.23136	.	.	ENSG00000113205	ENST00000231130	T	0.13307	2.6	3.34	-4.91	0.03085	.	.	.	.	.	T	0.09423	0.0232	L	0.42245	1.32	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.33854	-0.9852	9	0.41790	T	0.15	.	4.061	0.09839	0.2132:0.45:0.0:0.3368	.	774	Q9Y5E6	PCDB3_HUMAN	V	774	ENSP00000231130:F774V	ENSP00000231130:F774V	F	+	1	0	PCDHB3	140462737	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-2.816000	0.00752	-1.343000	0.02219	0.402000	0.26972	TTC	PCDHB3	-	NULL	ENSG00000113205		0.517	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2	-	0.00	43	0	T	NM_018937		140482553	+1	tier1	-	no_errors	ENST00000231130	ensembl	human	known	74_37	missense	64.52	11	20	SNP	0.000	G
PCDHB8	56128	genome.wustl.edu	37	5	140558592	140558592	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:140558592G>A	ENST00000239444.2	+	1	1222	c.977G>A	c.(976-978)gGa>gAa	p.G326E	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	326	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGAGATGCTGGAGGCTTTTCT	0.418																																																	0													176.0	246.0	222.0					5																	140558592		2203	4300	6503	SO:0001583	missense	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.977G>A	5.37:g.140558592G>A	ENSP00000239444:p.Gly326Glu		B9EGV1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G326E	ENST00000239444.2	37	c.977	CCDS4250.1	5	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839436	0.32513	.	.	ENSG00000120322	ENST00000239444	T	0.01745	4.66	4.25	4.25	0.50352	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.17916	0.0430	H	0.96518	3.835	0.32330	N	0.561242	D	0.76494	0.999	D	0.79784	0.993	T	0.47560	-0.9108	9	0.87932	D	0	.	16.2711	0.82622	0.0:0.0:1.0:0.0	.	326	Q9UN66	PCDB8_HUMAN	E	326	ENSP00000239444:G326E	ENSP00000239444:G326E	G	+	2	0	PCDHB8	140538776	1.000000	0.71417	0.126000	0.21872	0.223000	0.24884	3.461000	0.53035	1.911000	0.55334	0.585000	0.79938	GGA	PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000120322		0.418	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	-	0.00	71	0	G	NM_019120		140558592	+1	tier1	-	no_errors	ENST00000239444	ensembl	human	known	74_37	missense	26.92	38	14	SNP	0.943	A
CFAP221	200373	genome.wustl.edu	37	2	120404598	120404598	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:120404598G>A	ENST00000413369.3	+	22	2377	c.2290G>A	c.(2290-2292)Gaa>Aaa	p.E764K	PCDP1_ENST00000602047.1_Missense_Mutation_p.E478K	NM_001271049.1	NP_001257978																Colorectal(110;0.196)					TGCCTTACCAGAAGAGGACAG	0.408																																																	0													122.0	120.0	121.0					2																	120404598		2203	4300	6503	SO:0001583	missense	0																														ENST00000413369.3:c.2290G>A	2.37:g.120404598G>A	ENSP00000393222:p.Glu764Lys			Missense_Mutation	SNP	NULL	p.E764K	ENST00000413369.3	37	c.2290	CCDS33282.2	2	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098904	0.76870	.	.	ENSG00000163075	ENST00000295220;ENST00000413369	T	0.39056	1.1	4.52	4.52	0.55395	.	0.329212	0.27100	N	0.020938	T	0.42154	0.1190	L	0.43923	1.385	0.80722	D	1	P	0.45902	0.868	P	0.46758	0.526	T	0.36261	-0.9755	10	0.54805	T	0.06	-7.7817	12.6101	0.56546	0.0:0.0:1.0:0.0	.	764	Q4G0U5	PCDP1_HUMAN	K	478;764	ENSP00000393222:E764K	ENSP00000295220:E478K	E	+	1	0	AC069154.2	120121068	1.000000	0.71417	0.996000	0.52242	0.850000	0.48378	4.792000	0.62467	2.351000	0.79841	0.555000	0.69702	GAA	PCDP1	-	NULL	ENSG00000163075		0.408	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCDP1	Uniprot_gn	protein_coding	OTTHUMT00000464236.1	-	0.00	37	0	G			120404598	+1	tier1	-	no_errors	ENST00000413369	ensembl	human	known	74_37	missense	29.41	24	10	SNP	0.988	A
PCLO	27445	genome.wustl.edu	37	7	82578830	82578830	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:82578830T>G	ENST00000333891.9	-	6	11411	c.11074A>C	c.(11074-11076)Agt>Cgt	p.S3692R	PCLO_ENST00000423517.2_Missense_Mutation_p.S3692R|PCLO_ENST00000437081.1_Missense_Mutation_p.S412R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GCCCTGGAACTTTCGTCTGCT	0.463																																																	0													194.0	188.0	190.0					7																	82578830		1925	4138	6063	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.11074A>C	7.37:g.82578830T>G	ENSP00000334319:p.Ser3692Arg			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.S3692R	ENST00000333891.9	37	c.11074	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	T	13.52	2.261832	0.39995	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.17854	2.25;2.25	5.92	4.74	0.60224	.	.	.	.	.	T	0.16981	0.0408	L	0.45228	1.405	0.36286	D	0.856099	B;B;B	0.13145	0.002;0.007;0.007	B;B;B	0.09377	0.003;0.004;0.004	T	0.05084	-1.0907	9	0.87932	D	0	.	12.4032	0.55424	0.0:0.0:0.2653:0.7347	.	3623;3692;3692	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	R	3623;3692;3692;412	ENSP00000334319:S3692R;ENSP00000388393:S3692R	ENSP00000334319:S3692R	S	-	1	0	PCLO	82416766	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.115000	0.50391	1.026000	0.39733	0.528000	0.53228	AGT	PCLO	-	NULL	ENSG00000186472		0.463	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	28	0	T	NM_014510		82578830	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	41.18	20	14	SNP	1.000	G
PCLO	27445	genome.wustl.edu	37	7	82791891	82791891	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:82791891G>T	ENST00000333891.9	-	1	355	c.18C>A	c.(16-18)agC>agA	p.S6R	PCLO_ENST00000423517.2_Missense_Mutation_p.S6R	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						CCCCTTCCAAGCTCGCCTCGT	0.751																																																	0													5.0	6.0	5.0					7																	82791891		1804	3941	5745	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.18C>A	7.37:g.82791891G>T	ENSP00000334319:p.Ser6Arg			Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.S6R	ENST00000333891.9	37	c.18	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	G	12.51	1.959745	0.34565	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.28895	1.59;1.61	4.33	4.33	0.51752	.	.	.	.	.	T	0.39145	0.1067	L	0.27053	0.805	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.85130	0.997;0.997	T	0.24870	-1.0148	9	0.87932	D	0	.	9.1389	0.36890	0.1706:0.0:0.8294:0.0	.	6;6	Q9Y6V0-5;Q9Y6V0-6	.;.	R	6	ENSP00000334319:S6R;ENSP00000388393:S6R	ENSP00000334319:S6R	S	-	3	2	PCLO	82629827	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.876000	0.63079	2.228000	0.72767	0.555000	0.69702	AGC	PCLO	-	NULL	ENSG00000186472		0.751	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	20	0	G	NM_014510		82791891	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	missense	48.39	16	15	SNP	1.000	T
PDCD6IP	10015	genome.wustl.edu	37	3	33879704	33879704	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:33879704G>T	ENST00000307296.3	+	9	1443	c.1066G>T	c.(1066-1068)Gag>Tag	p.E356*	PDCD6IP_ENST00000457054.2_Nonsense_Mutation_p.E361*			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	356	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.|Interaction with CHMP4A, CHMP4B and CHMP4C.|Interaction with EIAV p9.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						AGATCTGTTTGAGAAGATGGT	0.363																																																	0													61.0	61.0	61.0					3																	33879704		2203	4300	6503	SO:0001587	stop_gained	0			BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.1066G>T	3.37:g.33879704G>T	ENSP00000307387:p.Glu356*		C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Nonsense_Mutation	SNP	pfam_BRO1_dom,pfscan_BRO1_dom	p.E361*	ENST00000307296.3	37	c.1081	CCDS2660.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.388758	0.97529	.	.	ENSG00000170248	ENST00000307296;ENST00000457054	.	.	.	4.92	4.92	0.64577	.	0.048947	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-19.3101	18.1209	0.89571	0.0:0.0:1.0:0.0	.	.	.	.	X	356;361	.	ENSP00000307387:E356X	E	+	1	0	PDCD6IP	33854708	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.864000	0.99589	2.281000	0.76405	0.585000	0.79938	GAG	PDCD6IP	-	pfam_BRO1_dom,pfscan_BRO1_dom	ENSG00000170248		0.363	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDCD6IP	HGNC	protein_coding	OTTHUMT00000253251.2	-	0.00	71	0	G			33879704	+1	tier1	-	no_errors	ENST00000457054	ensembl	human	known	74_37	nonsense	7.27	51	4	SNP	1.000	T
PDE8A	5151	genome.wustl.edu	37	15	85681097	85681097	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:85681097A>G	ENST00000310298.4	+	23	2705	c.2453A>G	c.(2452-2454)gAa>gGa	p.E818G	PDE8A_ENST00000394553.1_Missense_Mutation_p.E818G|PDE8A_ENST00000557957.1_Missense_Mutation_p.E746G|PDE8A_ENST00000339708.5_Missense_Mutation_p.E772G			O60658	PDE8A_HUMAN	phosphodiesterase 8A	818					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|phosphorelay signal transduction system (GO:0000160)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	25	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)		Caffeine(DB00201)|Ketotifen(DB00920)	GGACTGGACGAAATGAAGCTG	0.473																																																	0													98.0	82.0	88.0					15																	85681097		2203	4299	6502	SO:0001583	missense	0			AF056490	CCDS10336.1, CCDS10337.1, CCDS58397.1	15q25.3	2008-05-14			ENSG00000073417	ENSG00000073417	3.1.4.17	"""Phosphodiesterases"""	8793	protein-coding gene	gene with protein product		602972				9618252	Standard	NM_001243137		Approved	HsT19550	uc002blh.3	O60658	OTTHUMG00000148670	ENST00000310298.4:c.2453A>G	15.37:g.85681097A>G	ENSP00000311453:p.Glu818Gly		B3KXE6|H0YMZ7|Q6P9H3|Q969I1|Q96PC9|Q96PD0|Q96PD1|Q96T71|Q9UMB7|Q9UMC3	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_Sig_transdc_resp-reg_receiver,pfam_PAS_fold,pfam_PAS_4,superfamily_PAS,superfamily_CheY-like_superfamily,smart_HD/PDEase_dom,pfscan_PAS,prints_PDEase,tigrfam_PAS	p.E818G	ENST00000310298.4	37	c.2453	CCDS10336.1	15	.	.	.	.	.	.	.	.	.	.	A	11.32	1.603154	0.28534	.	.	ENSG00000073417	ENST00000310298;ENST00000394553;ENST00000339708	T;T;T	0.78481	-1.18;-1.18;-1.18	5.49	4.38	0.52667	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.866393	0.10264	N	0.695652	T	0.75206	0.3818	M	0.63428	1.95	0.50313	D	0.999863	B;B	0.09022	0.002;0.001	B;B	0.09377	0.004;0.0	T	0.69057	-0.5246	10	0.62326	D	0.03	.	9.7256	0.40330	0.919:0.0:0.081:0.0	.	772;818	O60658-2;O60658	.;PDE8A_HUMAN	G	818;818;772	ENSP00000311453:E818G;ENSP00000378056:E818G;ENSP00000340679:E772G	ENSP00000311453:E818G	E	+	2	0	PDE8A	83482101	1.000000	0.71417	0.011000	0.14972	0.001000	0.01503	5.326000	0.65875	1.100000	0.41517	-0.274000	0.10170	GAA	PDE8A	-	NULL	ENSG00000073417		0.473	PDE8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE8A	HGNC	protein_coding	OTTHUMT00000309018.1		0.00	10	0	A	NM_002605		85681097	+1			no_errors	ENST00000310298	ensembl	human	known	74_37	missense	21.43	11	3	SNP	0.893	G
PDZRN3	23024	genome.wustl.edu	37	3	73457313	73457313	+	Intron	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:73457313T>C	ENST00000263666.4	-	4	1033				PDZRN3_ENST00000462146.2_Intron|PDZRN3_ENST00000535920.1_Intron|PDZRN3_ENST00000479530.1_Intron|PDZRN3_ENST00000466780.1_Intron|PDZRN3_ENST00000308537.4_Silent_p.P339P	NM_015009.1	NP_055824.1	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3						neuromuscular junction development (GO:0007528)|protein ubiquitination (GO:0016567)	neuromuscular junction (GO:0031594)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(13)|lung(31)|ovary(4)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		AGCTCAGAGGTGGAGTGTGCA	0.458																																																	0																																										SO:0001627	intron_variant	0			AB029018	CCDS33789.1	3p14.1	2013-01-09	2008-08-14		ENSG00000121440	ENSG00000121440		"""RING-type (C3HC4) zinc fingers"""	17704	protein-coding gene	gene with protein product	"""likely ortholog of mouse semaF cytoplasmic domain associated protein 3"""	609729				10470851	Standard	XM_005264718		Approved	KIAA1095, SEMACAP3, LNX3	uc003dpl.1	Q9UPQ7	OTTHUMG00000158865	ENST00000263666.4:c.919-3767A>G	3.37:g.73457313T>C			A7MCZ6|Q8N2N7|Q96CC2|Q9NSQ2	Silent	SNP	pfam_PDZ,pfam_Znf_C3HC4_RING-type,superfamily_TRAF-like,superfamily_PDZ,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING,pfscan_Znf_TRAF	p.P339	ENST00000263666.4	37	c.1017	CCDS33789.1	3																																																																																			PDZRN3	-	superfamily_PDZ,smart_PDZ	ENSG00000121440		0.458	PDZRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN3	HGNC	protein_coding	OTTHUMT00000352460.1	-	0.00	48	0	T	XM_041363		73457313	-1	tier1	-	no_errors	ENST00000308537	ensembl	human	putative	74_37	silent	51.61	15	16	SNP	0.000	C
PEPD	5184	genome.wustl.edu	37	19	33882309	33882309	+	Missense_Mutation	SNP	G	G	T	rs577733369	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:33882309G>T	ENST00000244137.7	-	13	1077	c.1044C>A	c.(1042-1044)agC>agA	p.S348R	PEPD_ENST00000591968.1_5'UTR|PEPD_ENST00000397032.4_Missense_Mutation_p.S307R|PEPD_ENST00000436370.3_Missense_Mutation_p.S284R	NM_000285.3	NP_000276.2	P12955	PEPD_HUMAN	peptidase D	348					cellular amino acid metabolic process (GO:0006520)|collagen catabolic process (GO:0030574)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)	aminopeptidase activity (GO:0004177)|dipeptidase activity (GO:0016805)|manganese ion binding (GO:0030145)|metallocarboxypeptidase activity (GO:0004181)			endometrium(3)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)	17	Esophageal squamous(110;0.137)					CCACGCTGCCGCTCAGGATGC	0.667																																																	0													16.0	22.0	20.0					19																	33882309		2090	4199	6289	SO:0001583	missense	0			BC015027	CCDS42544.1, CCDS54244.1, CCDS54245.1	19q13.11	2008-02-05				ENSG00000124299	3.4.13.9		8840	protein-coding gene	gene with protein product	"""prolidase"""	613230				2925654, 1972707	Standard	NM_000285		Approved		uc002nur.4	P12955		ENST00000244137.7:c.1044C>A	19.37:g.33882309G>T	ENSP00000244137:p.Ser348Arg		A8K3Z1|A8K416|A8K696|A8MX47|B4DDB7|B4DGJ1|E9PCE8|Q8TBN9|Q9BT75	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Aminopep_P_N,superfamily_Pept_M24_structural-domain	p.S348R	ENST00000244137.7	37	c.1044	CCDS42544.1	19	.	.	.	.	.	.	.	.	.	.	G	9.498	1.102497	0.20632	.	.	ENSG00000124299	ENST00000244137;ENST00000397032;ENST00000436370	T;T;T	0.76448	-1.02;-1.02;-1.02	5.55	-5.68	0.02436	Peptidase M24, structural domain (3);	0.913139	0.09685	N	0.769168	T	0.43077	0.1231	N	0.02802	-0.49	0.58432	D	0.999998	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.003;0.003	T	0.20773	-1.0265	10	0.19590	T	0.45	-8.56	2.2578	0.04060	0.5042:0.097:0.1924:0.2064	.	284;307;348	E9PCE8;A8MX47;P12955	.;.;PEPD_HUMAN	R	348;307;284	ENSP00000244137:S348R;ENSP00000380226:S307R;ENSP00000391890:S284R	ENSP00000244137:S348R	S	-	3	2	PEPD	38574149	0.000000	0.05858	0.338000	0.25549	0.983000	0.72400	-1.404000	0.02494	-0.472000	0.06881	0.561000	0.74099	AGC	PEPD	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain	ENSG00000124299		0.667	PEPD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEPD	HGNC	protein_coding	OTTHUMT00000451432.3	-	0.00	38	0	G	NM_000285		33882309	-1	tier1	-	no_errors	ENST00000244137	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.000	T
PEX14	5195	genome.wustl.edu	37	1	10596278	10596278	+	Silent	SNP	G	G	T	rs139797106		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:10596278G>T	ENST00000356607.4	+	3	173	c.93G>T	c.(91-93)acG>acT	p.T31T	PEX14_ENST00000538836.1_Intron|PEX14_ENST00000492696.1_3'UTR	NM_004565.2	NP_004556.1	O75381	PEX14_HUMAN	peroxisomal biogenesis factor 14	31					microtubule anchoring (GO:0034453)|negative regulation of protein binding (GO:0032091)|negative regulation of protein homotetramerization (GO:1901094)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|peroxisome organization (GO:0007031)|peroxisome transport along microtubule (GO:0036250)|protein complex assembly (GO:0006461)|protein homooligomerization (GO:0051260)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, substrate release (GO:0044721)|protein import into peroxisome matrix, translocation (GO:0016561)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)|transcription corepressor activity (GO:0003714)			breast(3)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)	13	Ovarian(185;0.203)	all_lung(284;6.02e-06)|Lung NSC(185;9.62e-06)|Renal(390;0.000147)|Breast(348;0.000932)|Colorectal(325;0.00215)|Hepatocellular(190;0.00913)|Ovarian(437;0.023)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0292)|Colorectal(212;9.13e-08)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000482)|Kidney(185;0.00174)|KIRC - Kidney renal clear cell carcinoma(229;0.00457)|STAD - Stomach adenocarcinoma(132;0.0249)|READ - Rectum adenocarcinoma(331;0.0419)		AGATTGCCACGGCAGTGAAGT	0.463																																																	0													54.0	55.0	55.0					1																	10596278		2203	4300	6503	SO:0001819	synonymous_variant	0			AF045186	CCDS30582.1	1p36.22	2008-05-14			ENSG00000142655	ENSG00000142655			8856	protein-coding gene	gene with protein product		601791				9653144	Standard	NM_004565		Approved		uc001arn.3	O75381	OTTHUMG00000001908	ENST00000356607.4:c.93G>T	1.37:g.10596278G>T			B2R7N1|B3KML6|B7Z1N2|Q8WX51	Silent	SNP	pfam_Pex14_N	p.T31	ENST00000356607.4	37	c.93	CCDS30582.1	1																																																																																			PEX14	-	pfam_Pex14_N	ENSG00000142655		0.463	PEX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX14	HGNC	protein_coding	OTTHUMT00000005414.1		0.00	26	0	G			10596278	+1			no_errors	ENST00000356607	ensembl	human	known	74_37	silent	11.11	24	3	SNP	0.895	T
PFN2	5217	genome.wustl.edu	37	3	149683105	149683105	+	3'UTR	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:149683105G>T	ENST00000239940.7	-	0	1846				PFN2_ENST00000452853.2_3'UTR|PFN2_ENST00000423691.2_Missense_Mutation_p.S147Y|PFN2_ENST00000481767.1_3'UTR			P35080	PROF2_HUMAN	profilin 2						actin cytoskeleton organization (GO:0030036)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of ATPase activity (GO:0032781)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|regulation of synaptic vesicle exocytosis (GO:2000300)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|terminal bouton (GO:0043195)	actin monomer binding (GO:0003785)|adenyl-nucleotide exchange factor activity (GO:0000774)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GAACAAACTGGACACACTCCA	0.358																																																	0																																										SO:0001624	3_prime_UTR_variant	0			L10678	CCDS3148.1, CCDS46934.1	3q25.1	2006-10-16			ENSG00000070087	ENSG00000070087			8882	protein-coding gene	gene with protein product		176590				8975700, 8365484	Standard	NM_002628		Approved		uc003ext.1	P35080	OTTHUMG00000159683	ENST00000239940.7:c.*1171C>A	3.37:g.149683105G>T			B2R4C8|D3DNI4|Q4VBQ4|Q8WVF9|Q9HBK2	Missense_Mutation	SNP	pfam_Profilin_eukaryotes/bac,superfamily_Profilin_eukaryotes/bac,smart_Profilin_eukaryotes/bac,prints_Profilin_chordates	p.S147Y	ENST00000239940.7	37	c.440	CCDS3148.1	3	.	.	.	.	.	.	.	.	.	.	.	12.70	2.015934	0.35606	.	.	ENSG00000070087	ENST00000423691	D	0.88354	-2.37	5.77	5.77	0.91146	.	.	.	.	.	D	0.94801	0.8321	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.94707	0.7888	8	0.72032	D	0.01	.	18.536	0.91010	0.0:0.0:1.0:0.0	.	147	G5E9Q6	.	Y	147	ENSP00000408283:S147Y	ENSP00000408283:S147Y	S	-	2	0	PFN2	151165795	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.704000	0.74639	2.890000	0.99128	0.585000	0.79938	TCC	PFN2	-	NULL	ENSG00000070087		0.358	PFN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PFN2	HGNC	protein_coding	OTTHUMT00000356873.2	-	0.00	46	0	G	NM_002628		149683105	-1	tier1	-	no_errors	ENST00000423691	ensembl	human	putative	74_37	missense	7.69	48	4	SNP	1.000	T
PGAP2	27315	genome.wustl.edu	37	11	3844965	3844965	+	Intron	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:3844965G>T	ENST00000463452.2	+	3	248				PGAP2_ENST00000396986.2_Intron|PGAP2_ENST00000493547.2_Intron|PGAP2_ENST00000465307.2_Missense_Mutation_p.G57V|PGAP2_ENST00000496834.2_Intron|PGAP2_ENST00000278243.4_Intron|PGAP2_ENST00000532017.1_Intron|PGAP2_ENST00000396991.2_Intron|PGAP2_ENST00000479072.1_5'UTR|AC090587.2_ENST00000507938.1_RNA|PGAP2_ENST00000396993.4_Intron|PGAP2_ENST00000300730.6_Intron	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2						GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						AGGTCTTTTGGGAGAGGTATG	0.537																																																	0																																										SO:0001627	intron_variant	0			AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.166-148G>T	11.37:g.3844965G>T			E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	Missense_Mutation	SNP	NULL	p.G57V	ENST00000463452.2	37	c.170	CCDS58112.1	11	.	.	.	.	.	.	.	.	.	.	G	9.228	1.034996	0.19590	.	.	ENSG00000148985	ENST00000532523;ENST00000465307	.	.	.	4.14	3.22	0.36961	.	.	.	.	.	T	0.60196	0.2250	.	.	.	0.53005	D	0.999964	P	0.52061	0.95	P	0.50708	0.648	T	0.63319	-0.6664	7	0.87932	D	0	.	7.8989	0.29723	0.1109:0.0:0.8891:0.0	.	57	B7Z2X5	.	V	72;57	.	ENSP00000434401:G57V	G	+	2	0	PGAP2	3801541	0.019000	0.18553	0.073000	0.20177	0.013000	0.08279	-0.087000	0.11215	1.318000	0.45170	0.655000	0.94253	GGG	PGAP2	-	NULL	ENSG00000148985		0.537	PGAP2-049	KNOWN	basic|CCDS	protein_coding	PGAP2	HGNC	protein_coding	OTTHUMT00000383260.1	-	0.00	26	0	G			3844965	+1	tier1	-	no_errors	ENST00000465307	ensembl	human	putative	74_37	missense	46.15	14	12	SNP	0.529	T
PHACTR4	65979	genome.wustl.edu	37	1	28802626	28802626	+	Missense_Mutation	SNP	G	G	T	rs543331485		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:28802626G>T	ENST00000373839.3	+	8	1690	c.1429G>T	c.(1429-1431)Gat>Tat	p.D477Y	PHACTR4_ENST00000373836.3_Missense_Mutation_p.D487Y|PHACTR4_ENST00000493669.1_3'UTR	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	477					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		TAGTCCAGACGATGAAGAAGA	0.388																																																	0													78.0	72.0	74.0					1																	28802626		1934	4132	6066	SO:0001583	missense	0			AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.1429G>T	1.37:g.28802626G>T	ENSP00000362945:p.Asp477Tyr		A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.D487Y	ENST00000373839.3	37	c.1459	CCDS41293.1	1	.	.	.	.	.	.	.	.	.	.	G	18.70	3.679444	0.68042	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	T;T	0.26223	1.76;1.75	5.32	4.41	0.53225	.	0.406012	0.28262	N	0.015982	T	0.47358	0.1441	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.47315	-0.9127	10	0.62326	D	0.03	-6.8407	13.232	0.59949	0.0786:0.0:0.9214:0.0	.	487;477	Q8IZ21-2;Q8IZ21	.;PHAR4_HUMAN	Y	477;487;476	ENSP00000362945:D477Y;ENSP00000362942:D487Y	ENSP00000362942:D487Y	D	+	1	0	PHACTR4	28675213	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.180000	0.58296	1.374000	0.46228	0.655000	0.94253	GAT	PHACTR4	-	NULL	ENSG00000204138		0.388	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHACTR4	HGNC	protein_coding	OTTHUMT00000009868.4		0.00	30	0	G	NM_023923		28802626	+1			no_errors	ENST00000373836	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
PGLYRP3	114771	genome.wustl.edu	37	1	153275083	153275083	+	Splice_Site	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:153275083A>G	ENST00000290722.1	-	5	582	c.530T>C	c.(529-531)gTt>gCt	p.V177A		NM_052891.1	NP_443123.1	Q96LB9	PGRP3_HUMAN	peptidoglycan recognition protein 3	177					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(1)|liver(1)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	28	all_lung(78;3.35e-32)|Lung NSC(65;1.22e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTTGGGGCAAACTGTGGTAAA	0.473																																																	0													154.0	155.0	155.0					1																	153275083		2203	4300	6503	SO:0001630	splice_region_variant	0			AY035376	CCDS1035.1	1q21	2008-02-05			ENSG00000159527	ENSG00000159527			30014	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I alpha precursor"""	608197				11461926	Standard	NM_052891		Approved	PGRPIA, PGLYRPIalpha, PGRP-Ialpha	uc001fbn.1	Q96LB9	OTTHUMG00000014044	ENST00000290722.1:c.530-1T>C	1.37:g.153275083A>G			A1A4U8|Q5SY65	Missense_Mutation	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.V177A	ENST00000290722.1	37	c.530	CCDS1035.1	1	.	.	.	.	.	.	.	.	.	.	A	0.035	-1.310504	0.01342	.	.	ENSG00000159527	ENST00000290722	T	0.26373	1.74	4.18	-2.28	0.06826	N-acetylmuramoyl-L-alanine amidase domain (2);	0.490950	0.18383	N	0.142902	T	0.01029	0.0034	N	0.00707	-1.245	0.21579	N	0.999632	B	0.02656	0.0	B	0.06405	0.002	T	0.38950	-0.9637	10	0.02654	T	1	.	3.278	0.06906	0.2475:0.0:0.238:0.5144	.	177	Q96LB9	PGRP3_HUMAN	A	177	ENSP00000290722:V177A	ENSP00000290722:V177A	V	-	2	0	PGLYRP3	151541707	0.083000	0.21467	0.950000	0.38849	0.507000	0.33981	-1.232000	0.02936	-0.167000	0.10871	0.528000	0.53228	GTT	PGLYRP3	-	pfam_Amidase_domain	ENSG00000159527		0.473	PGLYRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGLYRP3	HGNC	protein_coding	OTTHUMT00000039488.1	-	0.00	82	0	A	NM_052891	Missense_Mutation	153275083	-1	tier1	-	no_errors	ENST00000290722	ensembl	human	known	74_37	missense	48.74	61	58	SNP	0.894	G
PHEX	5251	genome.wustl.edu	37	X	22151693	22151693	+	Silent	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:22151693A>G	ENST00000379374.4	+	12	1921	c.1356A>G	c.(1354-1356)aaA>aaG	p.K452K	PHEX_ENST00000535894.1_Silent_p.K355K|PHEX_ENST00000537599.1_Silent_p.K452K|PHEX_ENST00000418858.3_Silent_p.K155K	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	452					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						TGCTAGAGAAAGAAAATGAGT	0.403																																																	0													134.0	114.0	121.0					X																	22151693		2203	4300	6503	SO:0001819	synonymous_variant	0			U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.1356A>G	X.37:g.22151693A>G			O00678|Q13646|Q2M325|Q93032|Q99827	Silent	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.K452	ENST00000379374.4	37	c.1356	CCDS14204.1	X																																																																																			PHEX	-	pfam_Peptidase_M13_N	ENSG00000102174		0.403	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHEX	HGNC	protein_coding	OTTHUMT00000056035.1	-	0.00	32	0	A	NM_000444		22151693	+1	tier1	-	no_errors	ENST00000379374	ensembl	human	known	74_37	silent	42.86	24	18	SNP	1.000	G
PHLPP1	23239	genome.wustl.edu	37	18	60527822	60527822	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:60527822A>C	ENST00000262719.5	+	4	2288	c.2054A>C	c.(2053-2055)aAt>aCt	p.N685T	PHLPP1_ENST00000400316.4_Missense_Mutation_p.N173T			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	685					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						AGGGGGCTTAATGAACTGCAA	0.458																																																	0													32.0	30.0	31.0					18																	60527822		1866	4099	5965	SO:0001583	missense	0			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.2054A>C	18.37:g.60527822A>C	ENSP00000262719:p.Asn685Thr		A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	pfam_PP2C-like_dom,pfam_Leu-rich_rpt,superfamily_PP2C-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like_dom,pfscan_Pleckstrin_homology	p.N685T	ENST00000262719.5	37	c.2054	CCDS45881.2	18	.	.	.	.	.	.	.	.	.	.	A	12.87	2.066417	0.36470	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.24350	1.86;1.86	6.17	-6.3	0.02007	.	.	.	.	.	T	0.13286	0.0322	N	0.10707	0.03	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23332	-1.0191	9	0.22109	T	0.4	-0.0311	19.3475	0.94370	0.3382:0.0:0.6618:0.0	.	685	O60346	PHLP1_HUMAN	T	173;685	ENSP00000383170:N173T;ENSP00000262719:N685T	ENSP00000262719:N685T	N	+	2	0	PHLPP1	58678802	0.000000	0.05858	0.022000	0.16811	0.983000	0.72400	-0.388000	0.07352	-1.121000	0.02949	0.533000	0.62120	AAT	PHLPP1	-	NULL	ENSG00000081913		0.458	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	HGNC	protein_coding	OTTHUMT00000319249.2		0.00	21	0	A	NM_194449		60527822	+1			no_errors	ENST00000262719	ensembl	human	known	74_37	missense	25.00	12	4	SNP	0.001	C
PHOSPHO1	162466	genome.wustl.edu	37	17	47301623	47301623	+	Silent	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:47301623C>A	ENST00000310544.4	-	3	916	c.789G>T	c.(787-789)gtG>gtT	p.V263V	PHOSPHO1_ENST00000514112.1_Silent_p.V288V|PHOSPHO1_ENST00000413580.1_Silent_p.V288V			Q8TCT1	PHOP1_HUMAN	phosphatase, orphan 1	263					bone mineralization involved in bone maturation (GO:0035630)|dephosphorylation (GO:0016311)|endochondral ossification (GO:0001958)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of bone mineralization (GO:0030500)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|phosphocholine phosphatase activity (GO:0052731)|phosphoethanolamine phosphatase activity (GO:0052732)|pyrophosphatase activity (GO:0016462)							Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)		Choline(DB00122)	ACGACTTCAGCACCTGTTGCA	0.667																																																	0													9.0	10.0	10.0					17																	47301623		2168	4251	6419	SO:0001819	synonymous_variant	0			AJ457189	CCDS11547.1, CCDS45726.1	17q21.32	2008-05-02				ENSG00000173868			16815	protein-coding gene	gene with protein product						12464021	Standard	NM_178500		Approved		uc010wlv.1	Q8TCT1		ENST00000310544.4:c.789G>T	17.37:g.47301623C>A			E9PAM0|Q17RU6	Silent	SNP	pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,pirsf_Pase_PHOSPHO-typ,tigrfam_PyrdxlP_Pase-rel,tigrfam_HAD-SF_hydro_IB_PSP-like	p.V288	ENST00000310544.4	37	c.864	CCDS11547.1	17																																																																																			PHOSPHO1	-	pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,pirsf_Pase_PHOSPHO-typ	ENSG00000173868		0.667	PHOSPHO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHOSPHO1	HGNC	protein_coding	OTTHUMT00000364467.2	-	0.00	8	0	C			47301623	-1	tier1	-	no_errors	ENST00000413580	ensembl	human	known	74_37	silent	38.89	11	7	SNP	1.000	A
PIP5K1C	23396	genome.wustl.edu	37	19	3656454	3656454	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:3656454G>T	ENST00000335312.3	-	6	658	c.570C>A	c.(568-570)gtC>gtA	p.V190V	PIP5K1C_ENST00000539785.1_Silent_p.V190V|PIP5K1C_ENST00000537021.1_Silent_p.V190V|PIP5K1C_ENST00000589578.1_Silent_p.V190V|PIP5K1C_ENST00000587482.1_5'UTR	NM_001195733.1|NM_012398.2	NP_001182662.1|NP_036530.1	O60331	PI51C_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, gamma	190	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.				actin cytoskeleton organization (GO:0030036)|adherens junction assembly (GO:0034333)|axon guidance (GO:0007411)|clathrin-mediated endocytosis (GO:0072583)|cytoskeletal anchoring at plasma membrane (GO:0007016)|neutrophil chemotaxis (GO:0030593)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|platelet aggregation (GO:0070527)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle exocytosis (GO:0016079)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|uropod (GO:0001931)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			large_intestine(3)|ovary(1)|skin(3)|stomach(2)	9		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.95e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0026)|STAD - Stomach adenocarcinoma(1328;0.183)		CCTTGTGCATGACGGTCTTGA	0.627																																					Esophageal Squamous(135;99 1744 12852 27186 39851)												0													82.0	83.0	82.0					19																	3656454		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011161	CCDS32872.1, CCDS56074.1, CCDS74257.1	19p13.3	2012-10-02			ENSG00000186111	ENSG00000186111			8996	protein-coding gene	gene with protein product		606102				9535851	Standard	NM_001195733		Approved	PIP5Kgamma, KIAA0589, LCCS3	uc002lyj.2	O60331	OTTHUMG00000180870	ENST00000335312.3:c.570C>A	19.37:g.3656454G>T			B7Z9E7|C6GIJ7|C6GIJ8|Q7LE07	Silent	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.V190	ENST00000335312.3	37	c.570	CCDS32872.1	19																																																																																			PIP5K1C	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	ENSG00000186111		0.627	PIP5K1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PIP5K1C	HGNC	protein_coding	OTTHUMT00000453432.2	-	0.00	58	0	G	NM_012398		3656454	-1	tier1	-	no_errors	ENST00000537021	ensembl	human	known	74_37	silent	7.02	53	4	SNP	0.996	T
PITPNM2	57605	genome.wustl.edu	37	12	123497206	123497206	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:123497206G>A	ENST00000542749.1	-	3	432	c.369C>T	c.(367-369)ccC>ccT	p.P123P	PITPNM2_ENST00000280562.5_Silent_p.P123P|MIR4304_ENST00000580964.1_RNA|PITPNM2_ENST00000451868.2_5'UTR|PITPNM2_ENST00000546049.1_Silent_p.P123P|PITPNM2_ENST00000392428.1_Intron|PITPNM2_ENST00000320201.4_Silent_p.P123P			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	123					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TGAACACGTCGGGGTTTTCTC	0.498																																																	0													169.0	180.0	176.0					12																	123497206		2203	4300	6503	SO:0001819	synonymous_variant	0			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.369C>T	12.37:g.123497206G>A			Q9P271	Silent	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.P123	ENST00000542749.1	37	c.369	CCDS9242.1	12																																																																																			PITPNM2	-	pfam_PI_transfer,prints_PI_transfer	ENSG00000090975		0.498	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PITPNM2	HGNC	protein_coding	OTTHUMT00000401342.1	-	0.00	54	0	G	NM_020845		123497206	-1	tier1	-	no_errors	ENST00000320201	ensembl	human	known	74_37	silent	43.59	44	34	SNP	0.000	A
PLBD1	79887	genome.wustl.edu	37	12	14695201	14695201	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:14695201G>T	ENST00000240617.5	-	3	1012	c.360C>A	c.(358-360)aaC>aaA	p.N120K		NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	120					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						GTGGGTAGAGGTTTGTGTAGT	0.318																																																	0													217.0	201.0	206.0					12																	14695201		2203	4300	6503	SO:0001583	missense	0			BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.360C>A	12.37:g.14695201G>T	ENSP00000240617:p.Asn120Lys		A8K4E9|Q9BVV3|Q9H625	Missense_Mutation	SNP	pfam_PLipase_B-like	p.N120K	ENST00000240617.5	37	c.360	CCDS31751.1	12	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344544	0.82022	.	.	ENSG00000121316	ENST00000240617;ENST00000540572	T;T	0.24151	1.87;1.87	6.02	3.24	0.37175	.	0.000000	0.85682	D	0.000000	T	0.60625	0.2283	H	0.96175	3.78	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	T	0.66728	-0.5850	10	0.87932	D	0	-34.9526	9.7338	0.40376	0.2151:0.0:0.7849:0.0	.	120	Q6P4A8	PLBL1_HUMAN	K	120;73	ENSP00000240617:N120K;ENSP00000438367:N73K	ENSP00000240617:N120K	N	-	3	2	PLBD1	14586468	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	2.595000	0.46197	0.446000	0.26666	0.655000	0.94253	AAC	PLBD1	-	pfam_PLipase_B-like	ENSG00000121316		0.318	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD1	HGNC	protein_coding	OTTHUMT00000401203.1	-	0.00	63	0	G	NM_024829		14695201	-1	tier1	-	no_errors	ENST00000240617	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
PIWIL1	9271	genome.wustl.edu	37	12	130855864	130855864	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:130855864G>T	ENST00000245255.3	+	20	2737	c.2465G>T	c.(2464-2466)tGg>tTg	p.W822L	PIWIL1_ENST00000541480.1_3'UTR	NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	822	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TATTACAACTGGCCAGTAAGT	0.408																																																	0													169.0	145.0	153.0					12																	130855864		2203	4300	6503	SO:0001583	missense	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.2465G>T	12.37:g.130855864G>T	ENSP00000245255:p.Trp822Leu		A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.W822L	ENST00000245255.3	37	c.2465	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	G	15.78	2.935448	0.52866	.	.	ENSG00000125207	ENST00000245255	T	0.13538	2.58	5.45	5.45	0.79879	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.057384	0.85682	D	0.000000	T	0.36663	0.0975	M	0.62266	1.93	0.80722	D	1	B;D	0.89917	0.046;1.0	B;D	0.97110	0.049;1.0	T	0.01858	-1.1259	10	0.45353	T	0.12	-19.4412	18.2559	0.90020	0.0:0.0:1.0:0.0	.	822;822	Q96J94;Q96J94-2	PIWL1_HUMAN;.	L	822	ENSP00000245255:W822L	ENSP00000245255:W822L	W	+	2	0	PIWIL1	129421817	1.000000	0.71417	1.000000	0.80357	0.291000	0.27294	9.741000	0.98843	2.542000	0.85734	0.561000	0.74099	TGG	PIWIL1	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi	ENSG00000125207		0.408	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1		0.00	29	0	G			130855864	+1			no_errors	ENST00000245255	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	T
PLCE1	51196	genome.wustl.edu	37	10	96084763	96084763	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:96084763G>T	ENST00000371380.3	+	31	7070	c.6835G>T	c.(6835-6837)Gaa>Taa	p.E2279*	PLCE1_ENST00000371385.3_Nonsense_Mutation_p.E1971*|PLCE1_ENST00000464214.1_3'UTR|PLCE1_ENST00000371375.1_Nonsense_Mutation_p.E1971*|PLCE1_ENST00000260766.3_Nonsense_Mutation_p.E2279*|NOC3L_ENST00000543788.1_Intron			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	2279					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				CTTGACCTCAGAAAGTATCCA	0.468																																																	0													89.0	91.0	90.0					10																	96084763		1903	4125	6028	SO:0001587	stop_gained	0				CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.6835G>T	10.37:g.96084763G>T	ENSP00000360431:p.Glu2279*		A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_Ras-assoc,pfam_RasGRF_CDC25,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_Ras_GEF_dom,superfamily_C2_dom,smart_RasGRF_CDC25,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,smart_Ras-assoc,pfscan_C2_dom,pfscan_Ras-assoc,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,pfscan_RasGRF_CDC25,prints_Pinositol_PLipase_C	p.E2279*	ENST00000371380.3	37	c.6835	CCDS41552.1	10	.	.	.	.	.	.	.	.	.	.	G	52	18.967274	0.99913	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	.	.	.	5.59	5.59	0.84812	.	0.101909	0.43260	D	0.000600	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	19.2023	0.93715	0.0:0.0:1.0:0.0	.	.	.	.	X	2279;2279;1971;1971	.	ENSP00000260766:E2279X	E	+	1	0	PLCE1	96074753	1.000000	0.71417	0.992000	0.48379	0.965000	0.64279	7.159000	0.77483	2.628000	0.89032	0.655000	0.94253	GAA	PLCE1	-	NULL	ENSG00000138193		0.468	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCE1	HGNC	protein_coding	OTTHUMT00000049469.3	-	0.00	47	0	G	NM_016341		96084763	+1	tier1	-	no_errors	ENST00000260766	ensembl	human	known	74_37	nonsense	12.50	21	3	SNP	0.998	T
PLEC	5339	genome.wustl.edu	37	8	144995421	144995421	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:144995421G>A	ENST00000322810.4	-	32	9148	c.8979C>T	c.(8977-8979)ccC>ccT	p.P2993P	PLEC_ENST00000436759.2_Silent_p.P2883P|PLEC_ENST00000354589.3_Silent_p.P2856P|PLEC_ENST00000345136.3_Silent_p.P2856P|PLEC_ENST00000354958.2_Silent_p.P2834P|PLEC_ENST00000357649.2_Silent_p.P2860P|PLEC_ENST00000398774.2_Silent_p.P2824P|PLEC_ENST00000356346.3_Silent_p.P2842P|PLEC_ENST00000527096.1_Silent_p.P2879P	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2993	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGTGCGTGTTGGGGTCAAAGA	0.657																																																	0													83.0	93.0	90.0					8																	144995421		2129	4254	6383	SO:0001819	synonymous_variant	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.8979C>T	8.37:g.144995421G>A			Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.P2993	ENST00000322810.4	37	c.8979	CCDS43772.1	8																																																																																			PLEC	-	smart_Plectin_repeat	ENSG00000178209		0.657	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	-	0.00	30	0	G	NM_000445		144995421	-1	tier1	-	no_errors	ENST00000322810	ensembl	human	known	74_37	silent	12.12	29	4	SNP	1.000	A
PLXNB2	23654	genome.wustl.edu	37	22	50728606	50728606	+	Missense_Mutation	SNP	G	G	T	rs200224862		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr22:50728606G>T	ENST00000449103.1	-	3	548	c.408C>A	c.(406-408)gaC>gaA	p.D136E	PLXNB2_ENST00000359337.4_Missense_Mutation_p.D136E			O15031	PLXB2_HUMAN	plexin B2	136	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCCGCTGCCGTCCTCGTAGA	0.652																																																	0													31.0	35.0	34.0					22																	50728606		2129	4237	6366	SO:0001583	missense	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.408C>A	22.37:g.50728606G>T	ENSP00000409171:p.Asp136Glu		A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.D136E	ENST00000449103.1	37	c.408	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	G	0.017	-1.504905	0.00992	.	.	ENSG00000196576	ENST00000449103;ENST00000359337;ENST00000414275;ENST00000432455;ENST00000425954	T;T;T;T	0.04275	3.66;3.66;3.66;3.66	4.32	-3.48	0.04739	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.338722	0.25109	N	0.033062	T	0.02119	0.0066	N	0.14661	0.345	0.26873	N	0.967711	B	0.20887	0.049	B	0.31442	0.13	T	0.44817	-0.9303	10	0.02654	T	1	.	5.6263	0.17485	0.4901:0.0:0.2951:0.2147	.	136	O15031	PLXB2_HUMAN	E	136	ENSP00000409171:D136E;ENSP00000352288:D136E;ENSP00000392620:D136E;ENSP00000387470:D136E	ENSP00000352288:D136E	D	-	3	2	PLXNB2	49070733	0.598000	0.26882	0.012000	0.15200	0.045000	0.14185	-0.049000	0.11924	-0.428000	0.07339	-0.258000	0.10820	GAC	PLXNB2	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000196576		0.652	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3		0.00	38	0	G	NM_012401		50728606	-1			no_errors	ENST00000359337	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.062	T
POLR1E	64425	genome.wustl.edu	37	9	37501715	37501715	+	Missense_Mutation	SNP	G	G	T	rs561301994		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:37501715G>T	ENST00000377798.4	+	11	1087	c.974G>T	c.(973-975)cGg>cTg	p.R325L	POLR1E_ENST00000442009.2_Missense_Mutation_p.R255L|POLR1E_ENST00000377792.3_Missense_Mutation_p.R387L	NM_022490.1	NP_071935.1	O15160	RPAC1_HUMAN	polymerase (RNA) I polypeptide E, 53kDa	0					gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase I transcription (GO:0006363)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytosol (GO:0005829)|DNA-directed RNA polymerase I complex (GO:0005736)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)	p.R325Q(1)		autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	12				GBM - Glioblastoma multiforme(29;0.00851)|Lung(182;0.229)		TCTAGATTACGGAACTTAATT	0.353																																					Ovarian(116;843 1620 18506 32459 34463)												1	Substitution - Missense(1)	large_intestine(1)											117.0	114.0	115.0					9																	37501715		2203	4300	6503	SO:0001583	missense	0			AK091294	CCDS6611.1	9p13.1	2013-01-21	2006-03-09	2006-03-09	ENSG00000137054	ENSG00000137054		"""RNA polymerase subunits"""	17631	protein-coding gene	gene with protein product	"""RNA polymerase I associated factor 53"""		"""polymerase (RNA) I associated factor 1"""	PRAF1		8641287	Standard	XM_005251547		Approved	FLJ13390, PAF53, FLJ13970	uc003zzy.1	Q9GZS1	OTTHUMG00000019920	ENST00000377798.4:c.974G>T	9.37:g.37501715G>T	ENSP00000367029:p.Arg325Leu		O75395|Q5JTE3	Missense_Mutation	SNP	pfam_RNA_pol-assoc_fac_A49-like	p.R387L	ENST00000377798.4	37	c.1160	CCDS6611.1	9	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662990	0.67700	.	.	ENSG00000137054	ENST00000377798;ENST00000442009;ENST00000377792	T;T;T	0.24908	1.83;1.83;1.83	5.82	2.96	0.34315	.	0.185942	0.49916	D	0.000132	T	0.37945	0.1022	L	0.56769	1.78	0.38003	D	0.934304	P;D;P	0.60575	0.877;0.988;0.913	P;P;P	0.61003	0.549;0.882;0.562	T	0.33752	-0.9856	10	0.72032	D	0.01	-11.84	6.9771	0.24681	0.3846:0.0:0.6154:0.0	.	255;387;325	E7EX70;Q9GZS1;Q9GZS1-2	.;RPA49_HUMAN;.	L	325;255;387	ENSP00000367029:R325L;ENSP00000399887:R255L;ENSP00000367023:R387L	ENSP00000367023:R387L	R	+	2	0	POLR1E	37491715	1.000000	0.71417	0.998000	0.56505	0.797000	0.45037	3.208000	0.51114	0.786000	0.33708	0.561000	0.74099	CGG	POLR1E	-	pfam_RNA_pol-assoc_fac_A49-like	ENSG00000137054		0.353	POLR1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1E	HGNC	protein_coding	OTTHUMT00000052464.1		0.00	33	0	G	NM_022490		37501715	+1			no_errors	ENST00000377792	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
PPP1R3A	5506	genome.wustl.edu	37	7	113518469	113518469	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:113518469T>C	ENST00000284601.3	-	4	2746	c.2678A>G	c.(2677-2679)gAc>gGc	p.D893G		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	893					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GGCATCCGAGTCTGTTTTCTT	0.368																																																	0													88.0	85.0	86.0					7																	113518469		2203	4299	6502	SO:0001583	missense	0			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2678A>G	7.37:g.113518469T>C	ENSP00000284601:p.Asp893Gly		A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.D893G	ENST00000284601.3	37	c.2678	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	T	1.312	-0.601865	0.03744	.	.	ENSG00000154415	ENST00000284601	T	0.18016	2.24	5.81	1.83	0.25207	.	1.158770	0.06197	N	0.682552	T	0.13030	0.0316	L	0.45581	1.43	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.38628	-0.9652	10	0.16420	T	0.52	-0.4127	1.6004	0.02672	0.3211:0.0749:0.2203:0.3837	.	893	Q16821	PPR3A_HUMAN	G	893	ENSP00000284601:D893G	ENSP00000284601:D893G	D	-	2	0	PPP1R3A	113305705	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.085000	0.11250	0.994000	0.38892	0.528000	0.53228	GAC	PPP1R3A	-	NULL	ENSG00000154415		0.368	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	-	0.00	24	0	T	NM_002711		113518469	-1	tier1	-	no_errors	ENST00000284601	ensembl	human	known	74_37	missense	26.67	11	4	SNP	0.000	C
PPP3CC	5533	genome.wustl.edu	37	8	22396990	22396990	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:22396990G>T	ENST00000240139.5	+	13	1657	c.1330G>T	c.(1330-1332)Gaa>Taa	p.E444*	RP11-582J16.4_ENST00000514980.1_RNA|PPP3CC_ENST00000397775.3_Nonsense_Mutation_p.E453*|PPP3CC_ENST00000289963.8_Intron	NM_005605.4	NP_005596.2	P48454	PP2BC_HUMAN	protein phosphatase 3, catalytic subunit, gamma isozyme	444					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)		AGCCACAGTAGAAGCGGTAGA	0.463																																																	0													209.0	185.0	193.0					8																	22396990		2203	4300	6503	SO:0001587	stop_gained	0				CCDS34859.1, CCDS59094.1, CCDS59093.1	8p21.3	2010-03-17	2010-03-05		ENSG00000120910	ENSG00000120910	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9316	protein-coding gene	gene with protein product	"""calcineurin A gamma"", ""protein phosphatase 2B, catalytic subunit, gamma isoform"""	114107	"""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform"""			1339277	Standard	NM_005605		Approved	CALNA3, PP2Bgamma	uc011kzi.2	P48454	OTTHUMG00000163802	ENST00000240139.5:c.1330G>T	8.37:g.22396990G>T	ENSP00000240139:p.Glu444*		B4DRT5|Q9BSS6|Q9H4M5	Nonsense_Mutation	SNP	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.E444*	ENST00000240139.5	37	c.1330	CCDS34859.1	8	.	.	.	.	.	.	.	.	.	.	G	39	7.679642	0.98428	.	.	ENSG00000120910	ENST00000240139;ENST00000397775	.	.	.	5.83	4.0	0.46444	.	0.092183	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-11.7895	15.8733	0.79141	0.0:0.2331:0.7669:0.0	.	.	.	.	X	444;453	.	ENSP00000240139:E444X	E	+	1	0	PPP3CC	22452935	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.577000	0.53885	0.767000	0.33267	0.650000	0.86243	GAA	PPP3CC	-	NULL	ENSG00000120910		0.463	PPP3CC-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP3CC	HGNC	protein_coding	OTTHUMT00000375652.1	-	0.00	90	0	G	NM_005605		22396990	+1	tier1	-	no_errors	ENST00000240139	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	1.000	T
PPP4R4	57718	genome.wustl.edu	37	14	94708144	94708144	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:94708144G>T	ENST00000304338.3	+	10	1150	c.996G>T	c.(994-996)caG>caT	p.Q332H		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	332					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						CTCCAGATCAGCACTTGAGAT	0.299																																																	0													50.0	55.0	53.0					14																	94708144		2200	4296	6496	SO:0001583	missense	0			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.996G>T	14.37:g.94708144G>T	ENSP00000305924:p.Gln332His		Q9BUF8|Q9HCF0	Missense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.Q332H	ENST00000304338.3	37	c.996	CCDS9921.1	14	.	.	.	.	.	.	.	.	.	.	G	15.47	2.842151	0.51057	.	.	ENSG00000119698	ENST00000304338	T	0.31769	1.48	4.95	-1.06	0.10002	Armadillo-like helical (1);Armadillo-type fold (1);	0.106384	0.64402	D	0.000003	T	0.47002	0.1422	M	0.72479	2.2	0.80722	D	1	D	0.67145	0.996	D	0.64877	0.93	T	0.49418	-0.8942	10	0.72032	D	0.01	-14.2777	11.4956	0.50406	0.3051:0.0:0.6949:0.0	.	332	Q6NUP7	PP4R4_HUMAN	H	332	ENSP00000305924:Q332H	ENSP00000305924:Q332H	Q	+	3	2	PPP4R4	93777897	0.981000	0.34729	0.998000	0.56505	0.985000	0.73830	-0.012000	0.12699	-0.122000	0.11766	-0.469000	0.05056	CAG	PPP4R4	-	superfamily_ARM-type_fold	ENSG00000119698		0.299	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R4	HGNC	protein_coding	OTTHUMT00000413056.1	-	0.00	27	0	G	NM_058237		94708144	+1	tier1	-	no_errors	ENST00000304338	ensembl	human	known	74_37	missense	36.00	16	9	SNP	1.000	T
PRAMEF10	343071	genome.wustl.edu	37	1	12953256	12953256	+	Missense_Mutation	SNP	T	T	C	rs16850103		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:12953256T>C	ENST00000235347.4	-	4	995	c.916A>G	c.(916-918)Act>Gct	p.T306A		NM_001039361.3	NP_001034450.2	O60809	PRA10_HUMAN	PRAME family member 10	306			T -> A (in dbSNP:rs848424). {ECO:0000269|PubMed:15489334}.		negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(2)|breast(1)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	12	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCCCGATCAGTTAGGTAAGCA	0.507																																																	0													1.0	1.0	1.0					1																	12953256		13	126	139	SO:0001583	missense	0			AL049682	CCDS41255.1	1p36.21	2013-01-17			ENSG00000187545	ENSG00000187545		"""-"""	27997	protein-coding gene	gene with protein product							Standard	NM_001039361		Approved		uc001auo.3	O60809	OTTHUMG00000001981	ENST00000235347.4:c.916A>G	1.37:g.12953256T>C	ENSP00000235347:p.Thr306Ala		Q2M1V2	Missense_Mutation	SNP	NULL	p.T306A	ENST00000235347.4	37	c.916	CCDS41255.1	1	.	.	.	.	.	.	.	.	.	.	.	2.772	-0.255461	0.05829	.	.	ENSG00000187545	ENST00000235347	T	0.52057	0.68	1.92	-2.86	0.05717	.	0.993100	0.08177	N	0.986060	T	0.26376	0.0644	N	0.21373	0.66	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16012	-1.0417	10	0.34782	T	0.22	.	2.1493	0.03795	0.4786:0.1708:0.0:0.3506	.	306	O60809	PRA10_HUMAN	A	306	ENSP00000235347:T306A	ENSP00000235347:T306A	T	-	1	0	PRAMEF10	12875843	0.000000	0.05858	0.000000	0.03702	0.340000	0.28889	-2.129000	0.01313	-0.680000	0.05211	0.163000	0.16589	ACT	PRAMEF10	-	NULL	ENSG00000187545		0.507	PRAMEF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF10	HGNC	protein_coding	OTTHUMT00000005512.2	-	0.00	16	0	T	XM_496342		12953256	-1	tier1	rs199702833	no_errors	ENST00000235347	ensembl	human	known	74_37	missense	33.33	8	4	SNP	0.000	C
PRDM15	63977	genome.wustl.edu	37	21	43240471	43240471	+	Missense_Mutation	SNP	C	C	T	rs376732864		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr21:43240471C>T	ENST00000269844.3	-	24	3328	c.3218G>A	c.(3217-3219)cGc>cAc	p.R1073H	PRDM15_ENST00000398548.1_Missense_Mutation_p.R744H|PRDM15_ENST00000447207.2_Missense_Mutation_p.R707H|PRDM15_ENST00000538201.1_Missense_Mutation_p.R727H|PRDM15_ENST00000422911.1_Missense_Mutation_p.R764H	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	1073					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						GAGCTTGTGGCGCTCCAGGTT	0.637																																																	0									HIS/ARG,HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	101.0	79.0	87.0		2231,3218	5.2	1.0	21		87	0,8600		0,0,4300	no	missense,missense	PRDM15	NM_001040424.1,NM_022115.3	29,29	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	744/1179,1073/1508	43240471	1,13005	2203	4300	6503	SO:0001583	missense	0			AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.3218G>A	21.37:g.43240471C>T	ENSP00000269844:p.Arg1073His		E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.R1073H	ENST00000269844.3	37	c.3218	CCDS13676.1	21	.	.	.	.	.	.	.	.	.	.	c	33	5.226081	0.95173	2.27E-4	0.0	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000538201;ENST00000447207;ENST00000269844	T;T;T;T;T	0.55760	0.5;0.5;0.5;0.5;0.5	5.16	5.16	0.70880	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.68476	0.3005	L	0.52206	1.635	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.70842	-0.4762	9	0.66056	D	0.02	-36.7553	17.6424	0.88140	0.0:1.0:0.0:0.0	.	1073;764;744	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	H	764;744;727;707;1073	ENSP00000408592:R764H;ENSP00000381556:R744H;ENSP00000444044:R727H;ENSP00000390245:R707H;ENSP00000269844:R1073H	ENSP00000269844:R1073H	R	-	2	0	PRDM15	42113540	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.544000	0.82117	2.397000	0.81536	0.651000	0.88453	CGC	PRDM15	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000141956		0.637	PRDM15-201	KNOWN	basic|CCDS	protein_coding	PRDM15	HGNC	protein_coding		-	0.00	26	0	C	NM_022115		43240471	-1	tier1	-	no_errors	ENST00000269844	ensembl	human	known	74_37	missense	25.71	26	9	SNP	1.000	T
PRG4	10216	genome.wustl.edu	37	1	186276565	186276565	+	Missense_Mutation	SNP	A	A	G	rs558640103	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:186276565A>G	ENST00000445192.2	+	7	1759	c.1714A>G	c.(1714-1716)Acc>Gcc	p.T572A	PRG4_ENST00000367483.4_Missense_Mutation_p.T531A|PRG4_ENST00000367486.3_Missense_Mutation_p.T529A|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367485.4_Missense_Mutation_p.T479A	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	572	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.T572A(1)		NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						TGCACCCACCACCCCCAAGAA	0.642													-|||	2	0.000399361	0.0008	0.0	5008	,	,		7951	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	lung(1)											99.0	99.0	99.0					1																	186276565		2203	4297	6500	SO:0001583	missense	0			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1714A>G	1.37:g.186276565A>G	ENSP00000399679:p.Thr572Ala		Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	pfam_Somatomedin_B_dom,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Somatomedin_B_dom,smart_Hemopexin-like_repeat,prints_Somatomedin_B_chordata,pfscan_Somatomedin_B_dom	p.T572A	ENST00000445192.2	37	c.1714	CCDS1369.1	1	.	.	.	.	.	.	.	.	.	.	a	6.012	0.370698	0.11409	.	.	ENSG00000116690	ENST00000367486;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T	0.05513	3.43;3.54;3.44;3.54	3.96	1.21	0.21127	.	.	.	.	.	T	0.06096	0.0158	L	0.49126	1.545	0.09310	N	1	B;B;B;B	0.18013	0.025;0.025;0.015;0.025	B;B;B;B	0.19666	0.026;0.026;0.011;0.026	T	0.42292	-0.9460	8	.	.	.	.	3.8704	0.09035	0.6441:0.2029:0.1531:0.0	.	438;479;572;531	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	A	529;438;531;479;572	ENSP00000356456:T529A;ENSP00000356453:T531A;ENSP00000356455:T479A;ENSP00000399679:T572A	.	T	+	1	0	PRG4	184543188	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.247000	0.18179	0.012000	0.14892	-0.559000	0.04183	ACC	PRG4	-	NULL	ENSG00000116690		0.642	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	HGNC	protein_coding	OTTHUMT00000086346.1		0.00	33	0	A	NM_005807		186276565	+1			no_errors	ENST00000445192	ensembl	human	known	74_37	missense	8.62	51	5	SNP	0.000	G
PRKDC	5591	genome.wustl.edu	37	8	48734226	48734226	+	Missense_Mutation	SNP	G	G	T	rs375917051		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:48734226G>T	ENST00000314191.2	-	66	9103	c.9047C>A	c.(9046-9048)gCc>gAc	p.A3016D	PRKDC_ENST00000338368.3_Missense_Mutation_p.A3016D|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	3017	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GTCTATACTGGCTGTAGAACA	0.398								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0													42.0	43.0	43.0					8																	48734226		1834	4087	5921	SO:0001583	missense	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.9047C>A	8.37:g.48734226G>T	ENSP00000313420:p.Ala3016Asp		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.A3016D	ENST00000314191.2	37	c.9047		8	.	.	.	.	.	.	.	.	.	.	G	10.99	1.506778	0.26949	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.02472	4.35;4.28	5.4	-2.56	0.06268	PIK-related kinase (1);	0.709020	0.12885	N	0.431079	T	0.02610	0.0079	L	0.36672	1.1	0.22541	N	0.99901	B;B	0.19200	0.015;0.034	B;B	0.18871	0.023;0.023	T	0.45264	-0.9273	10	0.15952	T	0.53	.	12.4583	0.55716	0.827:0.0:0.173:0.0	.	3016;3017	E7EUY0;P78527	.;PRKDC_HUMAN	D	3016	ENSP00000313420:A3016D;ENSP00000345182:A3016D	ENSP00000313420:A3016D	A	-	2	0	PRKDC	48896779	0.975000	0.34042	0.013000	0.15412	0.214000	0.24535	2.312000	0.43726	-0.304000	0.08843	0.650000	0.86243	GCC	PRKDC	-	pfscan_PIK_FAT	ENSG00000253729		0.398	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		-	0.00	36	0	G	NM_001081640		48734226	-1	tier1	-	no_errors	ENST00000314191	ensembl	human	known	74_37	missense	12.82	34	5	SNP	0.536	T
PRRG3	79057	genome.wustl.edu	37	X	150869442	150869442	+	Silent	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:150869442T>G	ENST00000370353.3	+	4	1023	c.633T>G	c.(631-633)tcT>tcG	p.S211S	PRRG3_ENST00000538575.1_Silent_p.S211S			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	211						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					CCAGCGTGTCTTACAGTGACC	0.612																																																	0													98.0	83.0	88.0					X																	150869442		2203	4300	6503	SO:0001819	synonymous_variant	0			AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.633T>G	X.37:g.150869442T>G			A1A523|A1A575|Q8N2N6	Silent	SNP	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain,prints_GLA_domain	p.S211	ENST00000370353.3	37	c.633	CCDS14699.1	X																																																																																			PRRG3	-	NULL	ENSG00000130032		0.612	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG3	HGNC	protein_coding	OTTHUMT00000060880.1	-	0.00	15	0	T	NM_024082		150869442	+1	tier1	-	no_errors	ENST00000370353	ensembl	human	known	74_37	silent	58.82	7	10	SNP	0.860	G
PSMA3	5684	genome.wustl.edu	37	14	58737135	58737135	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:58737135G>T	ENST00000216455.4	+	9	680		c.e9-1		RP11-349A22.5_ENST00000555162.1_RNA|RP11-349A22.5_ENST00000555707.1_RNA|PSMA3_ENST00000412908.2_Splice_Site|PSMA3_ENST00000557508.1_Splice_Site|RP11-349A22.5_ENST00000554360.1_RNA|CTD-2002H8.2_ENST00000557322.1_RNA|RP11-349A22.5_ENST00000556225.1_RNA|RP11-349A22.5_ENST00000556002.1_RNA|RP11-349A22.5_ENST00000554378.1_RNA|RP11-349A22.5_ENST00000555275.1_RNA	NM_002788.3|NM_152132.2	NP_002779.1|NP_687033.1	P25788	PSA3_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 3						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|proteasome core complex, alpha-subunit complex (GO:0019773)	threonine-type endopeptidase activity (GO:0004298)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(2)	12						TTCTATTCTAGAATTTACATA	0.333																																																	0													119.0	120.0	119.0					14																	58737135		2203	4299	6502	SO:0001630	splice_region_variant	0				CCDS9731.1, CCDS45113.1	14q23	2008-08-29			ENSG00000100567	ENSG00000100567		"""Proteasome (prosome, macropain) subunits"""	9532	protein-coding gene	gene with protein product		176843				2025653, 8811196	Standard	NM_002788		Approved	HC8	uc001xdj.2	P25788	OTTHUMG00000140319	ENST00000216455.4:c.591-1G>T	14.37:g.58737135G>T			B2RCK6|Q86U83|Q8N1D8|Q9BS70	Splice_Site	SNP	-	e9-1	ENST00000216455.4	37	c.591-1	CCDS9731.1	14	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637148	0.67130	.	.	ENSG00000100567	ENST00000216455;ENST00000412908;ENST00000557508;ENST00000553677	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4404	0.90665	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PSMA3	57806888	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	6.320000	0.72876	2.762000	0.94881	0.591000	0.81541	.	PSMA3	-	-	ENSG00000100567		0.333	PSMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMA3	HGNC	protein_coding	OTTHUMT00000276923.1		0.00	67	0	G	NM_002788	Intron	58737135	+1			no_errors	ENST00000216455	ensembl	human	known	74_37	splice_site	5.13	74	4	SNP	1.000	T
PSPH	5723	genome.wustl.edu	37	7	56085002	56085002	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:56085002C>T	ENST00000395471.3	-	6	1151	c.346G>A	c.(346-348)Gta>Ata	p.V116I	PSPH_ENST00000275605.3_Missense_Mutation_p.V116I|PSPH_ENST00000459834.1_Intron			P78330	SERB_HUMAN	phosphoserine phosphatase	116					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)	p.V116I(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACATGCTCTACAATACTCCTA	0.393																																																	1	Substitution - Missense(1)	lung(1)											87.0	75.0	79.0					7																	56085002		2203	4300	6503	SO:0001583	missense	0			Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.346G>A	7.37:g.56085002C>T	ENSP00000378854:p.Val116Ile		B2RCR5|Q7Z3S5	Missense_Mutation	SNP	pfam_HAD-like_dom,pfam_Pyrimidine_nucleotidase_eu,pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,tigrfam_SerB,tigrfam_HAD-SF_hydro_IB_PSP-like	p.V116I	ENST00000395471.3	37	c.346	CCDS5522.1	7	.	.	.	.	.	.	.	.	.	.	C	10.73	1.432510	0.25813	.	.	ENSG00000146733	ENST00000275605;ENST00000395471;ENST00000421626	D;D;D	0.81908	-1.55;-1.55;-1.55	4.85	4.85	0.62838	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.65228	0.2671	N	0.05124	-0.11	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.18263	0.021;0.021	T	0.62992	-0.6736	10	0.02654	T	1	-16.2549	17.1115	0.86676	0.0:1.0:0.0:0.0	.	116;116	Q53EY1;P78330	.;SERB_HUMAN	I	116	ENSP00000275605:V116I;ENSP00000378854:V116I;ENSP00000398653:V116I	ENSP00000275605:V116I	V	-	1	0	PSPH	56052496	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.551000	0.82182	2.297000	0.77311	0.579000	0.79373	GTA	PSPH	-	pfam_HAD-like_dom,pfam_Pyrimidine_nucleotidase_eu,pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,tigrfam_SerB,tigrfam_HAD-SF_hydro_IB_PSP-like	ENSG00000146733		0.393	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PSPH	HGNC	protein_coding	OTTHUMT00000343304.1		0.00	53	0	C	NM_004577		56085002	-1			no_errors	ENST00000275605	ensembl	human	known	74_37	missense	7.08	105	8	SNP	1.000	T
PSPH	5723	genome.wustl.edu	37	7	56087300	56087300	+	Missense_Mutation	SNP	C	C	T	rs75395437		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:56087300C>T	ENST00000395471.3	-	5	1073	c.268G>A	c.(268-270)Ggc>Agc	p.G90S	PSPH_ENST00000275605.3_Missense_Mutation_p.G90S|PSPH_ENST00000459834.1_Intron			P78330	SERB_HUMAN	phosphoserine phosphatase	90					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			TACCTTATGCCGGGGGTCAGG	0.572													C|||	1	0.000199681	0.0008	0.0	5008	,	,		13158	0.0		0.0	False		,,,				2504	0.0																0													47.0	42.0	43.0					7																	56087300		2203	4300	6503	SO:0001583	missense	0			Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.268G>A	7.37:g.56087300C>T	ENSP00000378854:p.Gly90Ser		B2RCR5|Q7Z3S5	Missense_Mutation	SNP	pfam_HAD-like_dom,pfam_Pyrimidine_nucleotidase_eu,pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,tigrfam_SerB,tigrfam_HAD-SF_hydro_IB_PSP-like	p.G90S	ENST00000395471.3	37	c.268	CCDS5522.1	7	.	.	.	.	.	.	.	.	.	.	C	18.21	3.574214	0.65878	.	.	ENSG00000146733	ENST00000275605;ENST00000395471;ENST00000421626	D;D;D	0.88818	-2.43;-2.43;-2.43	5.03	4.15	0.48705	Haloacid dehalogenase-like hydrolase (1);HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.93259	0.7852	M	0.79805	2.47	0.80722	D	1	D;P	0.76494	0.999;0.921	P;P	0.61940	0.896;0.668	D	0.93579	0.6911	10	0.72032	D	0.01	-14.6976	12.7176	0.57123	0.0:0.9198:0.0:0.0802	.	90;90	Q53EY1;P78330	.;SERB_HUMAN	S	90	ENSP00000275605:G90S;ENSP00000378854:G90S;ENSP00000398653:G90S	ENSP00000275605:G90S	G	-	1	0	PSPH	56054794	1.000000	0.71417	0.778000	0.31720	0.277000	0.26821	5.698000	0.68302	1.121000	0.41925	-0.216000	0.12614	GGC	PSPH	-	pfam_HAD-like_dom,pfam_Pyrimidine_nucleotidase_eu,pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,tigrfam_SerB,tigrfam_HAD-SF_hydro_IB_PSP-like	ENSG00000146733		0.572	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PSPH	HGNC	protein_coding	OTTHUMT00000343304.1	-	0.00	38	0	C	NM_004577		56087300	-1	tier1	rs75395437	no_errors	ENST00000275605	ensembl	human	known	74_37	missense	53.54	92	106	SNP	0.998	T
PTGER3	5733	genome.wustl.edu	37	1	71477998	71477998	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:71477998T>G	ENST00000306666.5	-	2	1277	c.1067A>C	c.(1066-1068)aAg>aCg	p.K356T	PTGER3_ENST00000460330.1_Missense_Mutation_p.K356T|PTGER3_ENST00000370931.3_Missense_Mutation_p.K356T|PTGER3_ENST00000356595.4_Missense_Mutation_p.K356T|PTGER3_ENST00000414819.1_Missense_Mutation_p.K356T|PTGER3_ENST00000351052.5_Missense_Mutation_p.K356T|PTGER3_ENST00000354608.5_Missense_Mutation_p.K356T|PTGER3_ENST00000370932.2_Missense_Mutation_p.K356T|PTGER3_ENST00000370924.4_Missense_Mutation_p.K356T	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	356					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	CTGGCAAAACTTTCGAAGAAG	0.418																																																	0													100.0	98.0	99.0					1																	71477998		2203	4300	6503	SO:0001583	missense	0			X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.1067A>C	1.37:g.71477998T>G	ENSP00000302313:p.Lys356Thr		B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srbc,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_EP3_rcpt,prints_Prostanoid_rcpt,prints_EP3_rcpt_2,prints_Prostglndn_DP_rcpt,prints_GPCR_Rhodpsn,prints_Thbox_rcpt	p.K356T	ENST00000306666.5	37	c.1067	CCDS657.1	1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.375845	0.82682	.	.	ENSG00000050628	ENST00000370931;ENST00000370932;ENST00000351052;ENST00000460330;ENST00000370934;ENST00000354608;ENST00000356595;ENST00000414819;ENST00000306666;ENST00000370924	T;T;T;T;T;T;T;T;T	0.35421	1.31;2.14;1.31;1.31;1.31;1.31;1.31;1.31;1.31	5.65	5.65	0.86999	.	0.115995	0.56097	D	0.000021	T	0.49440	0.1557	M	0.69358	2.11	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.997;0.999;1.0;1.0;0.997;1.0;1.0;0.999	P;D;D;D;P;D;D;D	0.91635	0.886;0.996;0.998;0.999;0.884;0.999;0.999;0.996	T	0.47341	-0.9125	10	0.39692	T	0.17	-23.5059	15.525	0.75898	0.0:0.0:0.0:1.0	.	356;356;356;356;356;356;356;356	Q147U0;Q6TTN3;F5H821;B1AK19;Q147X8;P43115-3;P43115-4;P43115	.;.;.;.;.;.;.;PE2R3_HUMAN	T	356	ENSP00000359969:K356T;ENSP00000359970:K356T;ENSP00000280208:K356T;ENSP00000418073:K356T;ENSP00000346624:K356T;ENSP00000349003:K356T;ENSP00000401423:K356T;ENSP00000302313:K356T;ENSP00000359962:K356T	ENSP00000302313:K356T	K	-	2	0	PTGER3	71250586	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.405000	0.80007	2.156000	0.67533	0.402000	0.26972	AAG	PTGER3	-	NULL	ENSG00000050628		0.418	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTGER3	HGNC	protein_coding	OTTHUMT00000026076.1	-	0.00	39	0	T	NM_000957		71477998	-1	tier1	-	no_errors	ENST00000354608	ensembl	human	known	74_37	missense	39.71	41	27	SNP	1.000	G
PTPN11	5781	genome.wustl.edu	37	12	112924316	112924316	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:112924316G>T	ENST00000351677.2	+	11	1460	c.1262G>T	c.(1261-1263)cGg>cTg	p.R421L	PTPN11_ENST00000392597.1_Missense_Mutation_p.R421L	NM_002834.3	NP_002825.3	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type 11	425	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				abortive mitotic cell cycle (GO:0033277)|activation of MAPK activity (GO:0000187)|atrioventricular canal development (GO:0036302)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|brain development (GO:0007420)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage checkpoint (GO:0000077)|ephrin receptor signaling pathway (GO:0048013)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|genitalia development (GO:0048806)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|hormone metabolic process (GO:0042445)|hormone-mediated signaling pathway (GO:0009755)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|megakaryocyte development (GO:0035855)|multicellular organismal reproductive process (GO:0048609)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cortisol secretion (GO:0051463)|negative regulation of growth hormone secretion (GO:0060125)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ growth (GO:0035265)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of hormone secretion (GO:0046887)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of multicellular organism growth (GO:0040014)|regulation of protein export from nucleus (GO:0046825)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	insulin receptor binding (GO:0005158)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(406)|kidney(2)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(3)|stomach(3)	451						TACCACTTTCGGACCTGGCCG	0.557			Mis		"""JMML, AML, MDS"""		Noonan Syndrome		Noonan syndrome																															Dom	yes		12	12q24.1	5781	"""protein tyrosine phosphatase, non-receptor type 11"""	yes	L	0													52.0	51.0	51.0					12																	112924316		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	D13540	CCDS9163.1, CCDS58280.1	12q24.1	2014-09-17	2008-07-31		ENSG00000179295	ENSG00000179295		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"", ""SH2 domain containing"""	9644	protein-coding gene	gene with protein product		176876	"""Noonan syndrome 1"""	NS1		7894486, 1280823	Standard	NM_080601		Approved	BPTP3, SH-PTP2, SHP-2, PTP2C, SHP2	uc001ttx.3	Q06124	OTTHUMG00000134334	ENST00000351677.2:c.1262G>T	12.37:g.112924316G>T	ENSP00000340944:p.Arg421Leu		A8K1D9|Q96HD7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_SH2,smart_SH2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_SH2,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_SH2	p.R421L	ENST00000351677.2	37	c.1262	CCDS9163.1	12	.	.	.	.	.	.	.	.	.	.	G	6.843	0.524864	0.13066	.	.	ENSG00000179295	ENST00000392597;ENST00000351677	D;D	0.99121	-5.45;-5.45	5.18	4.26	0.50523	.	0.055988	0.64402	D	0.000003	D	0.89622	0.6768	N	0.00221	-1.82	0.53005	D	0.999961	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	D	0.86937	0.2077	10	0.02654	T	1	.	8.4001	0.32581	0.0776:0.0:0.7671:0.1553	.	421;421	Q06124-2;Q06124-3	.;.	L	421	ENSP00000376376:R421L;ENSP00000340944:R421L	ENSP00000340944:R421L	R	+	2	0	PTPN11	111408699	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.757000	0.55212	1.108000	0.41662	0.563000	0.77884	CGG	PTPN11	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-6/11,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000179295		0.557	PTPN11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN11	HGNC	protein_coding	OTTHUMT00000259496.2		0.00	21	0	G			112924316	+1			no_errors	ENST00000351677	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
PTPRA	5786	genome.wustl.edu	37	20	3002042	3002042	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr20:3002042G>T	ENST00000216877.6	+	13	1502	c.1102G>T	c.(1102-1104)Gac>Tac	p.D368Y	PTPRA_ENST00000356147.3_Missense_Mutation_p.D368Y|PTPRA_ENST00000358719.4_Missense_Mutation_p.D233Y|PTPRA_ENST00000399903.2_Missense_Mutation_p.D377Y|PTPRA_ENST00000380393.3_Missense_Mutation_p.D377Y|PTPRA_ENST00000318266.5_Missense_Mutation_p.D368Y|PTPRA_ENST00000425918.2_Missense_Mutation_p.D388Y	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	377	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TGTCCTGGTGGACTACACAGT	0.512																																																	0													203.0	158.0	173.0					20																	3002042		2203	4300	6503	SO:0001583	missense	0				CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.1102G>T	20.37:g.3002042G>T	ENSP00000216877:p.Asp368Tyr		A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.D388Y	ENST00000216877.6	37	c.1162	CCDS13039.1	20	.	.	.	.	.	.	.	.	.	.	G	22.3	4.273322	0.80580	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000425918;ENST00000318266;ENST00000356147	T;T;T;T;T;T;T	0.12879	2.64;2.64;2.64;2.64;2.64;2.64;2.64	4.78	4.78	0.61160	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.135771	0.52532	U	0.000067	T	0.32285	0.0824	L	0.55103	1.725	0.80722	D	1	P;D;D	0.76494	0.867;0.999;0.979	P;D;P	0.69654	0.512;0.965;0.676	T	0.00842	-1.1544	10	0.33940	T	0.23	.	18.3642	0.90385	0.0:0.0:1.0:0.0	.	388;377;368	B7Z2A4;P18433;P18433-4	.;PTPRA_HUMAN;.	Y	377;368;377;233;388;368;368	ENSP00000369756:D377Y;ENSP00000216877:D368Y;ENSP00000382787:D377Y;ENSP00000351559:D233Y;ENSP00000393553:D388Y;ENSP00000314568:D368Y;ENSP00000348468:D368Y	ENSP00000216877:D368Y	D	+	1	0	PTPRA	2950042	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.795000	0.85887	2.631000	0.89168	0.563000	0.77884	GAC	PTPRA	-	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000132670		0.512	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRA	HGNC	protein_coding	OTTHUMT00000077682.3	-	0.00	42	0	G			3002042	+1	tier1	-	no_errors	ENST00000425918	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
PTPRN	5798	genome.wustl.edu	37	2	220162791	220162791	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:220162791G>A	ENST00000295718.2	-	13	1943	c.1703C>T	c.(1702-1704)gCg>gTg	p.A568V	AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000497977.1_5'Flank|PTPRN_ENST00000409251.3_Missense_Mutation_p.A539V|PTPRN_ENST00000423636.2_Missense_Mutation_p.A478V	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	568					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GGTGCTGTGCGCAGTTTGGGG	0.627																																																	0													78.0	74.0	76.0					2																	220162791		2203	4300	6503	SO:0001583	missense	0				CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.1703C>T	2.37:g.220162791G>A	ENSP00000295718:p.Ala568Val		B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A568V	ENST00000295718.2	37	c.1703	CCDS2440.1	2	.	.	.	.	.	.	.	.	.	.	G	11.68	1.709756	0.30322	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.03689	3.88;3.84;3.85	4.58	4.58	0.56647	.	0.172440	0.38436	N	0.001700	T	0.04318	0.0119	L	0.27053	0.805	0.47949	D	0.999558	B;B	0.13594	0.008;0.003	B;B	0.06405	0.002;0.002	T	0.46359	-0.9197	10	0.56958	D	0.05	.	17.2091	0.86926	0.0:0.0:1.0:0.0	.	539;568	Q6NSL1;Q16849	.;PTPRN_HUMAN	V	539;568;539;478	ENSP00000386638:A539V;ENSP00000295718:A568V;ENSP00000444244:A478V	ENSP00000295718:A568V	A	-	2	0	PTPRN	219871035	0.998000	0.40836	0.267000	0.24556	0.004000	0.04260	5.985000	0.70556	2.386000	0.81285	0.655000	0.94253	GCG	PTPRN	-	NULL	ENSG00000054356		0.627	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRN	HGNC	protein_coding	OTTHUMT00000256819.2	-	0.00	51	0	G			220162791	-1	tier1	-	no_errors	ENST00000295718	ensembl	human	known	74_37	missense	32.69	35	17	SNP	0.849	A
PTRF	284119	genome.wustl.edu	37	17	40574673	40574673	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:40574673C>T	ENST00000357037.5	-	1	862	c.443G>A	c.(442-444)cGc>cAc	p.R148H		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		AAAGTTGCGGCGCCGCAGCAG	0.682																																																	0													25.0	20.0	22.0					17																	40574673		2201	4297	6498	SO:0001583	missense	0			AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.443G>A	17.37:g.40574673C>T	ENSP00000349541:p.Arg148His			Missense_Mutation	SNP	NULL	p.R148H	ENST00000357037.5	37	c.443	CCDS11425.1	17	.	.	.	.	.	.	.	.	.	.	C	37	5.986697	0.97173	.	.	ENSG00000177469	ENST00000357037;ENST00000357684	T	0.69685	-0.42	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.82291	0.5005	M	0.74467	2.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	D	0.84664	0.0708	10	0.87932	D	0	-14.399	18.5736	0.91145	0.0:1.0:0.0:0.0	.	130;148	B4DNU9;Q6NZI2	.;PTRF_HUMAN	H	148;103	ENSP00000349541:R148H	ENSP00000349541:R148H	R	-	2	0	PTRF	37828199	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.713000	0.84693	2.373000	0.80994	0.561000	0.74099	CGC	PTRF	-	NULL	ENSG00000177469		0.682	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTRF	HGNC	protein_coding	OTTHUMT00000449938.1	-	0.00	24	0	C	NM_012232		40574673	-1	tier1	-	no_errors	ENST00000357037	ensembl	human	known	74_37	missense	42.42	19	14	SNP	1.000	T
PUM2	23369	genome.wustl.edu	37	2	20508090	20508090	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:20508090G>T	ENST00000361078.2	-	5	796	c.774C>A	c.(772-774)taC>taA	p.Y258*	PUM2_ENST00000403432.1_Nonsense_Mutation_p.Y258*|PUM2_ENST00000338086.5_Nonsense_Mutation_p.Y258*|PUM2_ENST00000536417.1_Nonsense_Mutation_p.Y202*|PUM2_ENST00000319801.5_Nonsense_Mutation_p.Y258*|PUM2_ENST00000420234.1_5'Flank			Q8TB72	PUM2_HUMAN	pumilio RNA-binding family member 2	258	Interaction with SNAPIN.				regulation of translation (GO:0006417)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nuclear membrane (GO:0031965)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)	p.Y258Y(1)		breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(7)|lung(13)|ovary(2)|prostate(4)|urinary_tract(3)	42	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTGGGAATTGTAGTCAAAAA	0.423																																																	1	Substitution - coding silent(1)	endometrium(1)											59.0	58.0	58.0					2																	20508090		2203	4300	6503	SO:0001587	stop_gained	0			AF315591	CCDS1698.1, CCDS74486.1, CCDS74487.1	2p22-p21	2013-09-02	2013-09-02		ENSG00000055917	ENSG00000055917			14958	protein-coding gene	gene with protein product		607205	"""pumilio (Drosphila) homolog 2"", ""pumilio homolog 2 (Drosophila)"""			9039502, 12459267, 12511597	Standard	XM_005262607		Approved	PUMH2, KIAA0235	uc002rds.1	Q8TB72	OTTHUMG00000122098	ENST00000361078.2:c.774C>A	2.37:g.20508090G>T	ENSP00000354370:p.Tyr258*		B3KSL0|B4E2B6|D6W527|O00234|Q53TV7|Q8WY43|Q9HAN2	Nonsense_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.Y258*	ENST00000361078.2	37	c.774		2	.	.	.	.	.	.	.	.	.	.	G	36	5.935658	0.97122	.	.	ENSG00000055917	ENST00000338086;ENST00000361078;ENST00000319801;ENST00000440577;ENST00000403432;ENST00000536417;ENST00000442400	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.3156	20.6243	0.99512	0.0:0.0:1.0:0.0	.	.	.	.	X	258;258;258;149;258;202;258	.	ENSP00000326746:Y258X	Y	-	3	2	PUM2	20371571	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.059000	0.89462	2.886000	0.99085	0.644000	0.83932	TAC	PUM2	-	NULL	ENSG00000055917		0.423	PUM2-202	KNOWN	basic|appris_candidate_longest	protein_coding	PUM2	HGNC	protein_coding			0.00	12	0	G	NM_015317		20508090	-1			no_errors	ENST00000361078	ensembl	human	known	74_37	nonsense	10.00	18	2	SNP	1.000	T
PYGL	5836	genome.wustl.edu	37	14	51390756	51390756	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:51390756G>T	ENST00000216392.7	-	5	923	c.591C>A	c.(589-591)ttC>ttA	p.F197L	PYGL_ENST00000544180.2_Missense_Mutation_p.F163L|PYGL_ENST00000532462.1_Missense_Mutation_p.F197L	NM_002863.4	NP_002854.3	P06737	PYGL_HUMAN	phosphorylase, glycogen, liver	197					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|necroptotic process (GO:0070266)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	AMP binding (GO:0016208)|ATP binding (GO:0005524)|bile acid binding (GO:0032052)|drug binding (GO:0008144)|glucose binding (GO:0005536)|glycogen phosphorylase activity (GO:0008184)|protein homodimerization activity (GO:0042803)|purine nucleobase binding (GO:0002060)|pyridoxal phosphate binding (GO:0030170)|vitamin binding (GO:0019842)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(3)	25	all_epithelial(31;0.00825)|Breast(41;0.148)				Adenosine monophosphate(DB00131)	CAGGCAGCATGAATTCTGGGC	0.448																																																	0													157.0	144.0	148.0					14																	51390756		2203	4300	6503	SO:0001583	missense	0				CCDS32080.1, CCDS53894.1	14q11.2-q24.3	2013-03-01	2008-07-31		ENSG00000100504	ENSG00000100504	2.4.1.1	"""Glycogen phosphorylases"""	9725	protein-coding gene	gene with protein product	"""Hers disease"", ""glycogen storage disease type VI"", ""glycogen phosphorylase, liver form"""	613741	"""phosphorylase, glycogen; liver"""			2877458	Standard	NM_002863		Approved		uc001wyu.3	P06737	OTTHUMG00000166596	ENST00000216392.7:c.591C>A	14.37:g.51390756G>T	ENSP00000216392:p.Phe197Leu		A6NDQ4|B4DUB7|F5H816|O60567|O60752|O60913|Q501V9|Q641R5|Q96G82	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.F197L	ENST00000216392.7	37	c.591	CCDS32080.1	14	.	.	.	.	.	.	.	.	.	.	G	17.76	3.468139	0.63625	.	.	ENSG00000100504	ENST00000532462;ENST00000544180;ENST00000216392	D;D;D	0.92595	-3.0;-3.0;-3.07	6.17	6.17	0.99709	.	0.092608	0.85682	D	0.000000	D	0.85660	0.5748	N	0.25144	0.715	0.58432	D	0.999998	B;B;B	0.29270	0.133;0.009;0.24	B;B;B	0.28232	0.087;0.008;0.054	T	0.81488	-0.0910	10	0.27785	T	0.31	-14.1409	13.0796	0.59107	0.0723:0.0:0.9277:0.0	.	163;219;197	F5H816;Q6P1L4;P06737	.;.;PYGL_HUMAN	L	197;163;197	ENSP00000431657:F197L;ENSP00000443787:F163L;ENSP00000216392:F197L	ENSP00000216392:F197L	F	-	3	2	PYGL	50460506	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.790000	0.75115	2.941000	0.99782	0.655000	0.94253	TTC	PYGL	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000100504		0.448	PYGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGL	HGNC	protein_coding	OTTHUMT00000390654.3		0.00	50	0	G	NM_002863		51390756	-1			no_errors	ENST00000216392	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	T
PYY2	23615	genome.wustl.edu	37	17	26554454	26554454	+	RNA	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:26554454C>T	ENST00000441253.2	+	0	439					NR_003064.2		Q9NRI6	PYY2_HUMAN	peptide YY, 2 (pseudogene)							extracellular region (GO:0005576)											AAGACGCCTTCCTGGGGTAGC	0.692																																																	0																																												0			AF222904		17q11	2012-04-20	2012-04-20		ENSG00000237575	ENSG00000237575			9749	pseudogene	pseudogene	"""seminalplasmin"""	606637	"""peptide YY, 2 (seminalplasmin)"""			7831336	Standard	NR_003064		Approved		uc002haa.3	Q9NRI6	OTTHUMG00000132450		17.37:g.26554454C>T				RNA	SNP	-	NULL	ENST00000441253.2	37	NULL		17																																																																																			PYY2	-	-	ENSG00000237575		0.692	PYY2-002	KNOWN	basic	processed_transcript	PYY2	HGNC	pseudogene	OTTHUMT00000255606.2	-	0.00	49	0	C			26554454	+1	tier1	-	no_errors	ENST00000441253	ensembl	human	known	74_37	rna	32.69	35	17	SNP	0.997	T
QARS	5859	genome.wustl.edu	37	3	49141103	49141103	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:49141103G>T	ENST00000306125.6	-	4	749	c.412C>A	c.(412-414)Ctg>Atg	p.L138M	QARS_ENST00000470225.1_5'Flank|QARS_ENST00000420147.2_Missense_Mutation_p.L156M|QARS_ENST00000414533.1_Missense_Mutation_p.L127M			P47897	SYQ_HUMAN	glutaminyl-tRNA synthetase	138					brain development (GO:0007420)|gene expression (GO:0010467)|glutaminyl-tRNA aminoacylation (GO:0006425)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|glutamine-tRNA ligase activity (GO:0004819)			breast(1)|endometrium(1)|large_intestine(9)|lung(4)|ovary(1)|prostate(2)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)	L-Glutamine(DB00130)	CGTTCCACCAGGAGCTGGGGC	0.537																																																	0													29.0	33.0	32.0					3																	49141103		2203	4300	6503	SO:0001583	missense	0			X76013	CCDS2788.1, CCDS63633.1	3p21.31	2011-07-01			ENSG00000172053	ENSG00000172053	6.1.1.18	"""Aminoacyl tRNA synthetases / Class I"""	9751	protein-coding gene	gene with protein product	"""glutamine tRNA ligase"""	603727				8078941, 10393422	Standard	NM_005051		Approved		uc003cvx.4	P47897	OTTHUMG00000156774	ENST00000306125.6:c.412C>A	3.37:g.49141103G>T	ENSP00000307567:p.Leu138Met		B4DWJ2	Missense_Mutation	SNP	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,pfam_Gln-tRNA-synth_Ib_RNA-bd_N,pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,pfam_Gln-tRNA-synth_Ib_RNA-bd_2,superfamily_Ribosomal_L25/Gln-tRNA_synth,prints_Glu/Gln-tRNA-synth,tigrfam_Gln-tRNA-synth	p.L138M	ENST00000306125.6	37	c.412	CCDS2788.1	3	.	.	.	.	.	.	.	.	.	.	G	17.75	3.465393	0.63513	.	.	ENSG00000172053	ENST00000306125;ENST00000414533;ENST00000420147;ENST00000452739;ENST00000417025	T;T	0.24538	1.86;1.85	5.48	-2.7	0.06004	Glutaminyl-tRNA synthetase, class Ib, non-specific RNA-binding domain, N-terminal (1);	0.082034	0.50627	D	0.000114	T	0.43678	0.1258	M	0.86864	2.845	0.35407	D	0.792111	P;P;P	0.50369	0.934;0.832;0.832	P;P;P	0.55615	0.78;0.669;0.669	T	0.54892	-0.8225	10	0.66056	D	0.02	-10.0831	11.2646	0.49104	0.4984:0.0:0.5016:0.0	.	156;127;138	B7Z840;B4DWJ2;P47897	.;.;SYQ_HUMAN	M	138;127;156;180;138	ENSP00000307567:L138M;ENSP00000390015:L127M	ENSP00000307567:L138M	L	-	1	2	QARS	49116107	0.990000	0.36364	0.036000	0.18154	0.858000	0.48976	0.446000	0.21694	-1.035000	0.03291	-0.345000	0.07892	CTG	QARS	-	pfam_Gln-tRNA-synth_Ib_RNA-bd_N	ENSG00000172053		0.537	QARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QARS	HGNC	protein_coding	OTTHUMT00000345689.2	-	0.00	24	0	G	NM_005051		49141103	-1	tier1	-	no_errors	ENST00000306125	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.533	T
RAB11FIP1	80223	genome.wustl.edu	37	8	37730471	37730471	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:37730471G>T	ENST00000330843.4	-	4	1861	c.1849C>A	c.(1849-1851)Ctc>Atc	p.L617I	RAB11FIP1_ENST00000524118.1_Intron|RAB11FIP1_ENST00000522727.1_Intron|RAB11FIP1_ENST00000287263.4_Intron|RAB11FIP1_ENST00000523182.1_5'UTR	NM_001002814.2	NP_001002814.2	Q6WKZ4	RFIP1_HUMAN	RAB11 family interacting protein 1 (class I)	617					protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(4)|endometrium(3)|large_intestine(6)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	49		Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;3.62e-11)			CTGTCTACGAGAGGCCAGCTT	0.517																																																	0													93.0	88.0	89.0					8																	37730471		2203	4300	6503	SO:0001583	missense	0			AK092296	CCDS34881.1, CCDS34882.1	8p11.22	2005-10-04			ENSG00000156675	ENSG00000156675			30265	protein-coding gene	gene with protein product		608737				11786538, 11495908	Standard	NM_001002814		Approved	RCP, FLJ22622, FLJ22524, Rab11-FIP1	uc003xkm.2	Q6WKZ4	OTTHUMG00000164026	ENST00000330843.4:c.1849C>A	8.37:g.37730471G>T	ENSP00000331342:p.Leu617Ile		J3KNP0|Q307T1|Q6AZK4|Q6WKZ2|Q6WKZ6|Q86YV4|Q8TDL1|Q9H642	Missense_Mutation	SNP	pfam_Rab-bd_FIP-RBD,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.L617I	ENST00000330843.4	37	c.1849	CCDS34882.1	8	.	.	.	.	.	.	.	.	.	.	G	8.980	0.975117	0.18736	.	.	ENSG00000156675	ENST00000330843	T	0.11821	2.74	5.8	-6.13	0.02118	.	1.416330	0.04355	N	0.356485	T	0.06462	0.0166	N	0.08118	0	0.09310	N	1	B	0.21520	0.057	B	0.15870	0.014	T	0.37502	-0.9703	10	0.41790	T	0.15	0.0418	8.0689	0.30678	0.1734:0.1013:0.6253:0.1	.	617	Q6WKZ4	RFIP1_HUMAN	I	617	ENSP00000331342:L617I	ENSP00000331342:L617I	L	-	1	0	RAB11FIP1	37849629	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	-0.534000	0.06150	-1.201000	0.02659	-0.740000	0.03531	CTC	RAB11FIP1	-	NULL	ENSG00000156675		0.517	RAB11FIP1-002	KNOWN	basic|CCDS	protein_coding	RAB11FIP1	HGNC	protein_coding	OTTHUMT00000376816.1		0.00	35	0	G	NM_025151		37730471	-1			no_errors	ENST00000330843	ensembl	human	known	74_37	missense	6.06	31	2	SNP	0.000	T
RAB30	27314	genome.wustl.edu	37	11	82693420	82693420	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:82693420G>T	ENST00000533486.1	-	6	683	c.399C>A	c.(397-399)tcC>tcA	p.S133S	RAB30_ENST00000534141.1_Missense_Mutation_p.P132H|RP11-659G9.3_ENST00000527550.1_RNA|RAB30_ENST00000260056.2_Silent_p.S133S|RAB30_ENST00000527633.1_Silent_p.S133S	NM_014488.3	NP_055303.2	Q15771	RAB30_HUMAN	RAB30, member RAS oncogene family	133					Golgi organization (GO:0007030)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cis-Golgi network (GO:0005801)|Golgi cisterna (GO:0031985)|Golgi stack (GO:0005795)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13						CTCGCTGCTGGGAAACCTCTC	0.423																																																	0													88.0	84.0	86.0					11																	82693420		2203	4300	6503	SO:0001819	synonymous_variant	0			U57092	CCDS8264.1	11q12-q14	2008-07-21				ENSG00000137502		"""RAB, member RAS oncogene"""	9770	protein-coding gene	gene with protein product		605693				8863739, 9792283	Standard	NM_014488		Approved		uc001ozu.3	Q15771		ENST00000533486.1:c.399C>A	11.37:g.82693420G>T			Q6FGK1|Q6MZH2|Q96CI8	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.P132H	ENST00000533486.1	37	c.395	CCDS8264.1	11	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007512	0.54361	.	.	ENSG00000137502	ENST00000534141	T	0.63417	-0.04	5.96	-1.48	0.08745	.	.	.	.	.	T	0.39937	0.1097	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09143	-1.0688	7	.	.	.	.	5.5222	0.16939	0.0666:0.3214:0.3907:0.2213	.	132	Q6MZH2	.	H	132	ENSP00000434974:P132H	.	P	-	2	0	RAB30	82371068	1.000000	0.71417	0.995000	0.50966	0.974000	0.67602	1.825000	0.39081	-0.182000	0.10602	-0.122000	0.15005	CCC	RAB30	-	smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho	ENSG00000137502		0.423	RAB30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB30	HGNC	protein_coding	OTTHUMT00000392141.1	-	0.00	26	0	G	NM_014488		82693420	-1	tier1	-	no_errors	ENST00000534141	ensembl	human	putative	74_37	missense	8.00	46	4	SNP	0.998	T
RAB4B	53916	genome.wustl.edu	37	19	41284251	41284251	+	5'UTR	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:41284251A>G	ENST00000594800.1	+	0	131				RAB4B-EGLN2_ENST00000594136.1_5'UTR|RAB4B_ENST00000357052.2_5'UTR|RAB4B-EGLN2_ENST00000601949.1_3'UTR|RAB4B_ENST00000602069.1_3'UTR|MIA-RAB4B_ENST00000600729.1_Intron			P61018	RAB4B_HUMAN	RAB4B, member RAS oncogene family						glucose import (GO:0046323)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	insulin-responsive compartment (GO:0032593)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	11			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			GCGGCGCCATATTGCGGCCCT	0.731																																																	0													8.0	12.0	11.0					19																	41284251		2139	4193	6332	SO:0001623	5_prime_UTR_variant	0			AF165522	CCDS33030.1	19q13.2	2012-10-15			ENSG00000167578	ENSG00000167578		"""RAB, member RAS oncogene"""	9782	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein 4b"", ""small GTP binding protein RAB4B"""	612945					Standard	NM_016154		Approved	FLJ78649, MGC52123	uc002opd.2	P61018		ENST00000594800.1:c.-30A>G	19.37:g.41284251A>G			P22750|Q7Z514|Q9HBR6	RNA	SNP	-	NULL	ENST00000594800.1	37	NULL	CCDS33030.1	19																																																																																			RAB4B-EGLN2	-	-	ENSG00000171570		0.731	RAB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB4B-EGLN2	HGNC	protein_coding	OTTHUMT00000463168.1	-	0.00	83	0	A	NM_016154		41284251	+1	tier1	-	no_errors	ENST00000601949	ensembl	human	known	74_37	rna	34.04	62	32	SNP	1.000	G
RAD51	5888	genome.wustl.edu	37	15	41011090	41011090	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:41011090G>A	ENST00000267868.3	+	6	791	c.523G>A	c.(523-525)Gct>Act	p.A175T	RAD51_ENST00000382643.3_Missense_Mutation_p.A176T|RAD51_ENST00000557850.1_Missense_Mutation_p.A78T|RAD51_ENST00000532743.1_Missense_Mutation_p.A176T|RAD51_ENST00000423169.2_Missense_Mutation_p.A175T	NM_002875.4	NP_002866.2	Q06609	RAD51_HUMAN	RAD51 recombinase	175					ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA unwinding involved in DNA replication (GO:0006268)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|mitotic recombination (GO:0006312)|positive regulation of DNA ligation (GO:0051106)|protein homooligomerization (GO:0051260)|reciprocal meiotic recombination (GO:0007131)|regulation of double-strand break repair via homologous recombination (GO:0010569)	condensed chromosome (GO:0000793)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|lateral element (GO:0000800)|mitochondrion (GO:0005739)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|PML body (GO:0016605)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA polymerase binding (GO:0070182)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|single-stranded DNA binding (GO:0003697)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		GCTGGCAGTGGCTGAGAGGTA	0.473								Homologous recombination																																									0													93.0	90.0	91.0					15																	41011090		2203	4300	6503	SO:0001583	missense	0			D13804	CCDS10062.1, CCDS53931.1, CCDS53932.1	15q15.1	2014-06-12	2013-07-02		ENSG00000051180	ENSG00000051180			9817	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 5"""	179617	"""RAD51 (S. cerevisiae) homolog (E coli RecA homolog)"", ""RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)"", ""RAD51 homolog (S. cerevisiae)"""	RAD51A, RECA		8358431, 8479919	Standard	NM_002875		Approved	HsRad51, HsT16930, BRCC5	uc010bbx.3	Q06609	OTTHUMG00000130067	ENST00000267868.3:c.523G>A	15.37:g.41011090G>A	ENSP00000267868:p.Ala175Thr		B0FXP0|B2R8T6|Q6FHX9|Q6ZNA8|Q9BV60	Missense_Mutation	SNP	pfam_DNA_recomb/repair_Rad51_C,pfam_DNA_recomb/repair_RecA,superfamily_P-loop_NTPase,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,smart_AAA+_ATPase,pirsf_DNA_recomb/repair_RecA-like,pfscan_DNA_recomb_RecA/RadB_ATP-bd,pfscan_RecA_monomer-monomer_interface,tigrfam_DNA_recomb/repair_Rad51	p.A176T	ENST00000267868.3	37	c.526	CCDS10062.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.212762	0.95069	.	.	ENSG00000051180	ENST00000423169;ENST00000267868;ENST00000532743;ENST00000382643	T;T;T;T	0.57752	0.38;0.38;0.38;0.38	5.49	3.57	0.40892	DNA recombination/repair protein RecA/RadB, ATP-binding domain (1);ATPase, AAA+ type, core (1);DNA recombination and repair protein Rad51, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.82751	0.5105	H	0.99516	4.605	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.77004	0.97;0.989;0.989	D	0.87903	0.2692	9	.	.	.	-10.9173	11.247	0.49002	0.0707:0.1265:0.8028:0.0	.	175;176;175	Q06609-3;Q6ZNA8;Q06609	.;.;RAD51_HUMAN	T	175;175;176;176	ENSP00000406602:A175T;ENSP00000267868:A175T;ENSP00000433924:A176T;ENSP00000372088:A176T	.	A	+	1	0	RAD51	38798382	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.444000	0.80532	1.296000	0.44742	0.655000	0.94253	GCT	RAD51	-	pfam_DNA_recomb/repair_Rad51_C,pfam_DNA_recomb/repair_RecA,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pirsf_DNA_recomb/repair_RecA-like,pfscan_DNA_recomb_RecA/RadB_ATP-bd,tigrfam_DNA_recomb/repair_Rad51	ENSG00000051180		0.473	RAD51-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RAD51	HGNC	protein_coding	OTTHUMT00000252358.1	-	0.00	74	0	G	NM_002875, NM_133487		41011090	+1	tier1	-	no_errors	ENST00000382643	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	A
RAI1	10743	genome.wustl.edu	37	17	17700183	17700183	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:17700183G>T	ENST00000353383.1	+	3	4390	c.3921G>T	c.(3919-3921)cgG>cgT	p.R1307R	RAI1_ENST00000261641.6_Silent_p.R1307R	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1307					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		TCGCCTCTCGGGCAGCCTTCC	0.662																																																	0													48.0	59.0	56.0					17																	17700183		2203	4299	6502	SO:0001819	synonymous_variant	0			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.3921G>T	17.37:g.17700183G>T			Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Silent	SNP	smart_Znf_PHD	p.R1307	ENST00000353383.1	37	c.3921	CCDS11188.1	17																																																																																			RAI1	-	NULL	ENSG00000108557		0.662	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	HGNC	protein_coding	OTTHUMT00000131775.1		0.00	11	0	G	NM_030665		17700183	+1			no_errors	ENST00000353383	ensembl	human	known	74_37	silent	12.00	22	3	SNP	0.000	T
RAI14	26064	genome.wustl.edu	37	5	34808690	34808690	+	Splice_Site	SNP	G	G	T	rs150040739		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:34808690G>T	ENST00000265109.3	+	7	668	c.381G>T	c.(379-381)gcG>gcT	p.A127A	RAI14_ENST00000428746.2_Splice_Site_p.A127A|RAI14_ENST00000503673.1_Splice_Site_p.A127A|RAI14_ENST00000506376.1_Splice_Site_p.A119A|RAI14_ENST00000507276.1_3'UTR|RAI14_ENST00000515799.1_Splice_Site_p.A130A|RAI14_ENST00000397449.1_Splice_Site_p.A120A|RAI14_ENST00000512629.1_Splice_Site_p.A127A	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	127						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					TTCCCCCAGCGGCTCAGGGCT	0.478																																																	0													110.0	100.0	103.0					5																	34808690		2203	4300	6503	SO:0001630	splice_region_variant	0			AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.380-1G>T	5.37:g.34808690G>T			E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_t-SNARE,superfamily_UBA-like,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A130	ENST00000265109.3	37	c.390	CCDS34142.1	5																																																																																			RAI14	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000039560		0.478	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RAI14	HGNC	protein_coding	OTTHUMT00000366786.1	-	0.00	52	0	G	NM_015577	Silent	34808690	+1	tier1	-	no_errors	ENST00000515799	ensembl	human	known	74_37	silent	6.25	60	4	SNP	0.324	T
RANBP3	8498	genome.wustl.edu	37	19	5951456	5951456	+	Missense_Mutation	SNP	G	G	A	rs564177004		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:5951456G>A	ENST00000340578.6	-	3	287	c.230C>T	c.(229-231)cCg>cTg	p.P77L	RANBP3_ENST00000439268.2_Missense_Mutation_p.P77L|RANBP3_ENST00000034275.8_Intron|RANBP3_ENST00000591124.1_Intron|RANBP3_ENST00000541471.1_Intron|RANBP3_ENST00000591092.1_Intron	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	77	Poly-Pro.				intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						AGCGGGAGGCGGAGGAGTGCT	0.682													G|||	1	0.000199681	0.0	0.0	5008	,	,		15557	0.001		0.0	False		,,,				2504	0.0																0													14.0	19.0	17.0					19																	5951456		2076	4217	6293	SO:0001583	missense	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.230C>T	19.37:g.5951456G>A	ENSP00000341483:p.Pro77Leu		B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.P77L	ENST00000340578.6	37	c.230	CCDS42478.1	19	.	.	.	.	.	.	.	.	.	.	G	15.65	2.896213	0.52121	.	.	ENSG00000031823	ENST00000340578;ENST00000439268	T;T	0.32515	1.45;1.45	4.36	4.36	0.52297	.	0.173614	0.27388	U	0.019591	T	0.17619	0.0423	N	0.19112	0.55	0.80722	D	1	P;P	0.48998	0.918;0.866	B;B	0.38428	0.273;0.141	T	0.03739	-1.1008	10	0.22706	T	0.39	-5.4658	12.3837	0.55322	0.0:0.0:1.0:0.0	.	77;77	Q9H6Z4-2;Q9H6Z4	.;RANB3_HUMAN	L	77	ENSP00000341483:P77L;ENSP00000404837:P77L	ENSP00000341483:P77L	P	-	2	0	RANBP3	5902456	0.997000	0.39634	0.883000	0.34634	0.997000	0.91878	1.336000	0.33850	1.943000	0.56356	0.561000	0.74099	CCG	RANBP3	-	NULL	ENSG00000031823		0.682	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1	-	0.00	44	0	G	NM_007322		5951456	-1	tier1	-	no_errors	ENST00000340578	ensembl	human	known	74_37	missense	42.62	34	26	SNP	0.991	A
RANBP6	26953	genome.wustl.edu	37	9	6013410	6013410	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:6013410T>G	ENST00000259569.5	-	1	2208	c.2198A>C	c.(2197-2199)gAg>gCg	p.E733A	RANBP6_ENST00000485372.1_5'Flank	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	733					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		AGGCATGGACTCTGCTGCTGC	0.428																																																	0													80.0	81.0	81.0					9																	6013410		2203	4300	6503	SO:0001583	missense	0			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.2198A>C	9.37:g.6013410T>G	ENSP00000259569:p.Glu733Ala		Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.E733A	ENST00000259569.5	37	c.2198	CCDS6467.1	9	.	.	.	.	.	.	.	.	.	.	T	13.60	2.284418	0.40394	.	.	ENSG00000137040	ENST00000259569	T	0.21543	2.0	3.79	3.79	0.43588	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	T	0.19406	0.0466	L	0.45228	1.405	0.80722	D	1	B;B	0.34290	0.312;0.447	B;B	0.38921	0.089;0.285	T	0.03910	-1.0993	10	0.21540	T	0.41	-10.5645	11.1695	0.48563	0.0:0.0:0.0:1.0	.	321;733	B4DTX6;O60518	.;RNBP6_HUMAN	A	733	ENSP00000259569:E733A	ENSP00000259569:E733A	E	-	2	0	RANBP6	6003410	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.878000	0.69682	1.948000	0.56530	0.528000	0.53228	GAG	RANBP6	-	superfamily_ARM-type_fold	ENSG00000137040		0.428	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP6	HGNC	protein_coding	OTTHUMT00000051650.1	-	0.00	51	0	T	NM_012416		6013410	-1	tier1	-	no_errors	ENST00000259569	ensembl	human	known	74_37	missense	12.20	36	5	SNP	1.000	G
RASEF	158158	genome.wustl.edu	37	9	85615846	85615846	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:85615846G>T	ENST00000376447.3	-	10	1662	c.1402C>A	c.(1402-1404)Cag>Aag	p.Q468K		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	468					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						AAGCTCTCCTGCACCCCGTGT	0.502																																																	0													91.0	78.0	82.0					9																	85615846		2203	4300	6503	SO:0001583	missense	0			AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.1402C>A	9.37:g.85615846G>T	ENSP00000365630:p.Gln468Lys		A6NC29|Q96N04	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_Vinculin/catenin,smart_EF_hand_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,pfscan_EF_hand_dom,tigrfam_Small_GTP-bd_dom	p.Q468K	ENST00000376447.3	37	c.1402	CCDS6662.1	9	.	.	.	.	.	.	.	.	.	.	G	12.34	1.907876	0.33721	.	.	ENSG00000165105	ENST00000376447	T	0.59502	0.26	5.7	4.79	0.61399	.	0.628120	0.17335	N	0.177959	T	0.49253	0.1546	L	0.34521	1.04	0.80722	D	1	B	0.16396	0.017	B	0.11329	0.006	T	0.38887	-0.9640	10	0.41790	T	0.15	.	15.9875	0.80174	0.0:0.1398:0.8602:0.0	.	468	Q8IZ41	RASEF_HUMAN	K	468	ENSP00000365630:Q468K	ENSP00000365630:Q468K	Q	-	1	0	RASEF	84805666	1.000000	0.71417	0.771000	0.31576	0.571000	0.35966	3.570000	0.53834	1.376000	0.46267	0.585000	0.79938	CAG	RASEF	-	NULL	ENSG00000165105		0.502	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASEF	HGNC	protein_coding	OTTHUMT00000052825.1	-	0.00	38	0	G	NM_152573		85615846	-1	tier1	-	no_errors	ENST00000376447	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.980	T
RBBP8	5932	genome.wustl.edu	37	18	20596862	20596862	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:20596862G>T	ENST00000399722.2	+	17	2780	c.2429G>T	c.(2428-2430)gGg>gTg	p.G810V	RBBP8_ENST00000399725.2_Intron|RBBP8_ENST00000360790.5_Missense_Mutation_p.G815V|RBBP8_ENST00000581687.1_5'UTR|RBBP8_ENST00000327155.5_Missense_Mutation_p.G810V	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	810					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)	p.G810V(1)		central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			AAACTGCTTGGGCACACGTGT	0.318								Homologous recombination																																									1	Substitution - Missense(1)	endometrium(1)											107.0	109.0	108.0					18																	20596862		2203	4300	6503	SO:0001583	missense	0			AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.2429G>T	18.37:g.20596862G>T	ENSP00000382628:p.Gly810Val		A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	pfam_CtIP_N,pfam_DNA-repair_Sae2/CtIP	p.G810V	ENST00000399722.2	37	c.2429	CCDS11875.1	18	.	.	.	.	.	.	.	.	.	.	g	21.1	4.093801	0.76870	.	.	ENSG00000101773	ENST00000327155;ENST00000399722;ENST00000360790	T;T;T	0.63096	-0.02;-0.02;-0.01	5.33	4.46	0.54185	.	0.110694	0.64402	D	0.000008	T	0.80783	0.4689	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84031	0.0359	10	0.87932	D	0	-7.3178	13.0342	0.58860	0.0777:0.0:0.9223:0.0	.	815;810	E7ETY1;Q99708	.;COM1_HUMAN	V	810;810;815	ENSP00000323050:G810V;ENSP00000382628:G810V;ENSP00000354024:G815V	ENSP00000323050:G810V	G	+	2	0	RBBP8	18850860	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.252000	0.78309	1.253000	0.44018	0.637000	0.83480	GGG	RBBP8	-	pfam_DNA-repair_Sae2/CtIP	ENSG00000101773		0.318	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBBP8	HGNC	protein_coding	OTTHUMT00000446387.1		0.00	19	0	G	NM_203291		20596862	+1			no_errors	ENST00000327155	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
RBM4B	83759	genome.wustl.edu	37	11	66444293	66444293	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:66444293G>T	ENST00000525754.1	-	1	926	c.258C>A	c.(256-258)agC>agA	p.S86R	RBM4B_ENST00000531969.1_Missense_Mutation_p.S86R|RBM4B_ENST00000310046.4_Missense_Mutation_p.S86R|RBM4B_ENST00000531036.2_Missense_Mutation_p.S86R|RBM4B_ENST00000524637.1_Missense_Mutation_p.S86R			Q9BQ04	RBM4B_HUMAN	RNA binding motif protein 4B	86	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian regulation of gene expression (GO:0032922)|circadian rhythm (GO:0007623)|entrainment of circadian clock by photoperiod (GO:0043153)|mRNA processing (GO:0006397)|positive regulation of gene expression (GO:0010628)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.S86R(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(1)|urinary_tract(2)	10						TACAAGTGGGGCTGATGTTAC	0.483																																																	1	Substitution - Missense(1)	endometrium(1)											286.0	255.0	266.0					11																	66444293		2200	4295	6495	SO:0001583	missense	0			AK095158	CCDS8149.1, CCDS66144.1	11q13	2013-02-12	2006-01-25	2006-01-25				"""Zinc fingers, CCHC domain containing"", ""RNA binding motif (RRM) containing"""	28842	protein-coding gene	gene with protein product			"""RNA binding motif protein 30"""	RBM30		12477932	Standard	XR_247213		Approved	MGC10871, ZCCHC15, RBM4L, ZCRB3B, ZCCHC21B	uc001ojb.3	Q9BQ04		ENST00000525754.1:c.258C>A	11.37:g.66444293G>T	ENSP00000433071:p.Ser86Arg		B3KT83	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_CCHC,smart_RRM_dom,smart_Znf_CCHC,pfscan_Znf_CCHC,pfscan_RRM_dom	p.S86R	ENST00000525754.1	37	c.258	CCDS8149.1	11	.	.	.	.	.	.	.	.	.	.	G	16.48	3.133883	0.56828	.	.	ENSG00000173914	ENST00000525754;ENST00000310046;ENST00000531969;ENST00000524637	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	5.67	-9.01	0.00744	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.80974	0.4727	M	0.67397	2.05	0.45806	D	0.998685	P	0.41848	0.763	P	0.53313	0.723	D	0.83454	0.0050	10	0.39692	T	0.17	-26.1239	21.6	0.99957	0.1502:0.0:0.8498:0.0	.	86	Q9BQ04	RBM4B_HUMAN	R	86	ENSP00000433071:S86R;ENSP00000310471:S86R;ENSP00000435239:S86R;ENSP00000433113:S86R	ENSP00000310471:S86R	S	-	3	2	RBM4B	66200869	0.033000	0.19621	0.306000	0.25113	0.461000	0.32589	-1.327000	0.02682	-2.239000	0.00711	-1.218000	0.01608	AGC	RBM4B	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000173914		0.483	RBM4B-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBM4B	HGNC	protein_coding	OTTHUMT00000393851.1	-	0.00	106	0	G	NM_031492		66444293	-1	tier1	-	no_errors	ENST00000310046	ensembl	human	known	74_37	missense	5.88	128	8	SNP	0.930	T
RBMXL3	139804	genome.wustl.edu	37	X	114424873	114424873	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:114424873A>G	ENST00000424776.3	+	1	911	c.869A>G	c.(868-870)gAg>gGg	p.E290G	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	290							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CGCGACCATGAGTACACAGAT	0.607																																																	0													34.0	36.0	35.0					X																	114424873		692	1591	2283	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.869A>G	X.37:g.114424873A>G	ENSP00000417451:p.Glu290Gly		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E290G	ENST00000424776.3	37	c.869	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	A	7.138	0.581208	0.13686	.	.	ENSG00000175718	ENST00000424776	T	0.04502	3.61	0.869	0.869	0.19096	.	.	.	.	.	T	0.02342	0.0072	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43147	-0.9409	8	0.87932	D	0	.	.	.	.	.	290	Q8N7X1	RMXL3_HUMAN	G	290	ENSP00000417451:E290G	ENSP00000417451:E290G	E	+	2	0	RBMXL3	114331129	1.000000	0.71417	0.003000	0.11579	0.003000	0.03518	3.277000	0.51654	0.582000	0.29556	0.356000	0.21956	GAG	RBMXL3	-	NULL	ENSG00000175718		0.607	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	-	0.00	49	0	A	NM_001145346		114424873	+1	tier1	-	no_errors	ENST00000424776	ensembl	human	known	74_37	missense	34.09	29	15	SNP	0.027	G
REPS1	85021	genome.wustl.edu	37	6	139235842	139235842	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:139235842G>T	ENST00000450536.2	-	15	2351	c.1777C>A	c.(1777-1779)Ccc>Acc	p.P593T	REPS1_ENST00000415951.2_Missense_Mutation_p.P566T|REPS1_ENST00000258062.5_Missense_Mutation_p.P592T|REPS1_ENST00000367663.4_Missense_Mutation_p.P566T|REPS1_ENST00000409812.2_Missense_Mutation_p.P502T			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	593	Pro-rich.				receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		ACCTGTGAGGGCTGTGGTCTT	0.403																																																	0													127.0	126.0	126.0					6																	139235842		2203	4300	6503	SO:0001583	missense	0				CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.1777C>A	6.37:g.139235842G>T	ENSP00000392065:p.Pro593Thr		B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Missense_Mutation	SNP	smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	p.P593T	ENST00000450536.2	37	c.1777		6	.	.	.	.	.	.	.	.	.	.	G	29.3	4.995984	0.93167	.	.	ENSG00000135597	ENST00000450536;ENST00000367663;ENST00000529597;ENST00000409812;ENST00000258062;ENST00000415951;ENST00000367668;ENST00000530255	T;T;T;T;T;T	0.37058	1.22;1.27;1.25;1.25;1.23;1.27	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	T	0.47930	0.1472	L	0.58583	1.82	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.997;1.0;0.997;1.0	D;P;D;P;D	0.87578	0.943;0.879;0.998;0.879;0.996	T	0.10314	-1.0635	10	0.21540	T	0.41	-6.6724	18.3895	0.90477	0.0:0.0:1.0:0.0	.	592;541;502;593;566	Q96D71-3;B2R7D3;Q96D71-2;Q96D71;E9PMG1	.;.;.;REPS1_HUMAN;.	T	593;566;551;502;592;566;541;116	ENSP00000392065:P593T;ENSP00000356635:P566T;ENSP00000434251:P551T;ENSP00000386699:P502T;ENSP00000258062:P592T;ENSP00000397941:P566T	ENSP00000258062:P592T	P	-	1	0	REPS1	139277535	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.279000	0.78599	2.878000	0.98634	0.650000	0.86243	CCC	REPS1	-	NULL	ENSG00000135597		0.403	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	REPS1	HGNC	protein_coding	OTTHUMT00000042447.3	-	0.00	38	0	G			139235842	-1	tier1	-	no_errors	ENST00000450536	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
RGPD8	727851	genome.wustl.edu	37	2	113147112	113147112	+	Missense_Mutation	SNP	G	G	T	rs527746353		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:113147112G>T	ENST00000302558.3	-	20	3601	c.3410C>A	c.(3409-3411)tCt>tAt	p.S1137Y	RGPD8_ENST00000409750.1_Missense_Mutation_p.S997Y	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	1137	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)			endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						ATCACCATCAGAGAAATCACT	0.453																																																	0													16.0	14.0	15.0					2																	113147112		691	1578	2269	SO:0001583	missense	0			AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.3410C>A	2.37:g.113147112G>T	ENSP00000306637:p.Ser1137Tyr		Q5CZA8	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.S1137Y	ENST00000302558.3	37	c.3410	CCDS46394.1	2	.	.	.	.	.	.	.	.	.	.	-	10.33	1.320392	0.23994	.	.	ENSG00000169629	ENST00000302558;ENST00000409750	T;T	0.46451	0.87;0.87	2.3	2.3	0.28687	Pleckstrin homology-type (1);Ran binding protein 1 (3);	.	.	.	.	T	0.66157	0.2761	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.71699	-0.4514	9	0.87932	D	0	-29.2216	10.3508	0.43934	0.0:0.0:1.0:0.0	.	1137	O14715	RGPD8_HUMAN	Y	1137;997	ENSP00000306637:S1137Y;ENSP00000386511:S997Y	ENSP00000306637:S1137Y	S	-	2	0	RGPD8	112863583	1.000000	0.71417	0.998000	0.56505	0.395000	0.30598	9.529000	0.98049	1.299000	0.44798	0.152000	0.16155	TCT	RGPD8	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000169629		0.453	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RGPD8	HGNC	protein_coding	OTTHUMT00000375951.1	-	0.00	130	0	G	XM_001722279		113147112	-1	tier1	-	no_errors	ENST00000302558	ensembl	human	known	74_37	missense	21.76	133	37	SNP	1.000	T
RGS12	6002	genome.wustl.edu	37	4	3319606	3319606	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:3319606G>A	ENST00000344733.5	+	2	2613	c.1709G>A	c.(1708-1710)gGc>gAc	p.G570D	RGS12_ENST00000382788.3_Missense_Mutation_p.G570D|RGS12_ENST00000336727.3_Missense_Mutation_p.G570D|RGS12_ENST00000543385.1_Missense_Mutation_p.G570D	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12	570					positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		ATCAACTGCGGCACACTGCCC	0.652																																																	0													58.0	68.0	64.0					4																	3319606		2203	4300	6503	SO:0001583	missense	0			AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.1709G>A	4.37:g.3319606G>A	ENSP00000339381:p.Gly570Asp		B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Missense_Mutation	SNP	pfam_Raf-like_ras-bd,pfam_RGS_dom,pfam_PDZ,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_PTB/PI_dom,smart_Regulat_G_prot_signal_superfam,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_PDZ,pfscan_PTB/PI_dom,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.G570D	ENST00000344733.5	37	c.1709	CCDS3366.1	4	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203403	0.58234	.	.	ENSG00000159788	ENST00000543385;ENST00000344733;ENST00000336727;ENST00000382788	T;T;T;T	0.34472	1.36;1.55;1.55;1.55	4.8	3.92	0.45320	.	0.109028	0.64402	D	0.000006	T	0.44222	0.1283	L	0.59436	1.845	0.80722	D	1	P;D;D	0.59357	0.835;0.975;0.985	B;B;P	0.50896	0.443;0.357;0.653	T	0.40440	-0.9563	10	0.51188	T	0.08	-38.0709	13.0196	0.58779	0.0:0.0:0.8374:0.1626	.	570;570;570	Q8WX97;O14924;O14924-4	.;RGS12_HUMAN;.	D	570	ENSP00000440566:G570D;ENSP00000339381:G570D;ENSP00000338509:G570D;ENSP00000372238:G570D	ENSP00000338509:G570D	G	+	2	0	RGS12	3289404	1.000000	0.71417	0.950000	0.38849	0.692000	0.40212	7.151000	0.77411	0.946000	0.37632	0.491000	0.48974	GGC	RGS12	-	NULL	ENSG00000159788		0.652	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RGS12	HGNC	protein_coding	OTTHUMT00000206602.1	-	0.00	34	0	G	NM_002926		3319606	+1	tier1	-	no_errors	ENST00000344733	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	A
RIBC1	158787	genome.wustl.edu	37	X	53457373	53457373	+	Silent	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:53457373T>C	ENST00000375327.3	+	7	846	c.693T>C	c.(691-693)tgT>tgC	p.C231C	RIBC1_ENST00000414955.2_Silent_p.C116C|RP3-339A18.6_ENST00000418049.1_RNA|HSD17B10_ENST00000495986.1_5'Flank	NM_001031745.2	NP_001026915.1	Q8N443	RIBC1_HUMAN	RIB43A domain with coiled-coils 1	231										lung(2)	2						GTCAGCGCTGTGAGCGTCAGC	0.607																																																	0													36.0	27.0	30.0					X																	53457373		2202	4297	6499	SO:0001819	synonymous_variant	0			AK057345	CCDS14353.1, CCDS35299.1, CCDS59168.1	Xp11.23	2006-04-12			ENSG00000158423	ENSG00000158423			26537	protein-coding gene	gene with protein product							Standard	NM_144968		Approved	FLJ32783	uc004dsk.4	Q8N443	OTTHUMG00000021615	ENST00000375327.3:c.693T>C	X.37:g.53457373T>C			B4E297|E9PDU2|Q5H931|Q96A80	Silent	SNP	pfam_RIB43A	p.C231	ENST00000375327.3	37	c.693	CCDS35299.1	X																																																																																			RIBC1	-	pfam_RIB43A	ENSG00000158423		0.607	RIBC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RIBC1	HGNC	protein_coding	OTTHUMT00000056762.1	-	0.00	10	0	T	NM_144968		53457373	+1	tier1	-	no_errors	ENST00000375327	ensembl	human	known	74_37	silent	40.00	15	10	SNP	0.002	C
RHOXF2	84528	genome.wustl.edu	37	X	119293306	119293306	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:119293306C>T	ENST00000371388.3	+	2	655	c.465C>T	c.(463-465)cgC>cgT	p.R155R		NM_032498.1	NP_115887.1	Q9BQY4	RHXF2_HUMAN	Rhox homeobox family, member 2	155					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(2)	8						TTTTCCAACGCGAGCAGTTCC	0.657																																																	0													36.0	36.0	36.0					X																	119293306		2198	4296	6494	SO:0001819	synonymous_variant	0				CCDS14594.1	Xq24	2012-12-20			ENSG00000131721	ENSG00000131721		"""Homeoboxes / PRD class"""	30011	protein-coding gene	gene with protein product	"""cancer/testis antigen 107"""	300447				12490318	Standard	NM_032498		Approved	THG1, PEPP-2, PEPP2, CT107		Q9BQY4	OTTHUMG00000022296	ENST00000371388.3:c.465C>T	X.37:g.119293306C>T			Q9BR00	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R155	ENST00000371388.3	37	c.465	CCDS14594.1	X																																																																																			RHOXF2	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000131721		0.657	RHOXF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOXF2	HGNC	protein_coding	OTTHUMT00000411977.1	-	0.00	83	0	C	NM_032498		119293306	+1	tier1	-	no_errors	ENST00000371388	ensembl	human	known	74_37	silent	18.45	84	19	SNP	0.000	T
RNH1	6050	genome.wustl.edu	37	11	499889	499889	+	Missense_Mutation	SNP	G	G	T	rs577864215		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:499889G>T	ENST00000534797.1	-	3	1790	c.383C>A	c.(382-384)gCg>gAg	p.A128E	RNH1_ENST00000397614.1_Missense_Mutation_p.A128E|RNH1_ENST00000533592.1_5'Flank|RNH1_ENST00000438658.2_Missense_Mutation_p.A128E|RNH1_ENST00000356187.5_Missense_Mutation_p.A128E|RNH1_ENST00000397604.3_Missense_Mutation_p.A128E|RNH1_ENST00000354420.2_Missense_Mutation_p.A128E|RNH1_ENST00000397615.2_Missense_Mutation_p.A128E|RNH1_ENST00000533410.1_Missense_Mutation_p.A128E			O60930	RNH1_HUMAN	ribonuclease/angiogenin inhibitor 1	0					mitochondrial DNA replication (GO:0006264)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)	p.A128V(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.26e-26)|Epithelial(43;1.34e-25)|OV - Ovarian serous cystadenocarcinoma(40;5.31e-20)|BRCA - Breast invasive adenocarcinoma(625;8.01e-05)|Lung(200;0.0378)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGCAGGCCCGCATCCCCCAA	0.682																																																	1	Substitution - Missense(1)	lung(1)											49.0	47.0	48.0					11																	499889		2202	4300	6502	SO:0001583	missense	0				CCDS7697.1	11p15.5	2008-02-05	2005-06-01	2005-06-01	ENSG00000023191	ENSG00000023191			10074	protein-coding gene	gene with protein product		173320	"""ribonuclease/angiogenin inhibitor"""	RNH			Standard	NM_203386		Approved	RAI	uc001lpo.1	P13489	OTTHUMG00000119086	ENST00000534797.1:c.383C>A	11.37:g.499889G>T	ENSP00000433999:p.Ala128Glu		B3KQU4|O60523|O60857|Q57Z93|Q5U0C1|Q6FHD4	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp	p.A128E	ENST00000534797.1	37	c.383	CCDS7697.1	11	.	.	.	.	.	.	.	.	.	.	G	1.734	-0.493379	0.04322	.	.	ENSG00000023191	ENST00000534797;ENST00000397614;ENST00000397615;ENST00000397604;ENST00000533410;ENST00000438658;ENST00000354420;ENST00000356187;ENST00000527485;ENST00000529368;ENST00000529306;ENST00000531149	T;T;T;T;T;T;T;T;T;T;T;T	0.59364	0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27;0.27	3.03	-3.64	0.04515	.	1.099880	0.07135	N	0.846309	T	0.35537	0.0935	L	0.37507	1.11	0.09310	N	1	B	0.11235	0.004	B	0.12837	0.008	T	0.23013	-1.0200	10	0.10902	T	0.67	.	0.4476	0.00496	0.2248:0.1465:0.2564:0.3723	.	128	P13489	RINI_HUMAN	E	128	ENSP00000433999:A128E;ENSP00000380738:A128E;ENSP00000380739:A128E;ENSP00000380729:A128E;ENSP00000435594:A128E;ENSP00000416589:A128E;ENSP00000346402:A128E;ENSP00000348515:A128E;ENSP00000435748:A128E;ENSP00000435057:A128E;ENSP00000434947:A128E;ENSP00000435798:A128E	ENSP00000346402:A128E	A	-	2	0	RNH1	489889	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.090000	0.11163	-0.761000	0.04670	-0.333000	0.08304	GCG	RNH1	-	smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000023191		0.682	RNH1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNH1	HGNC	protein_coding	OTTHUMT00000384301.1		0.00	71	0	G	NM_203389		499889	-1			no_errors	ENST00000354420	ensembl	human	known	74_37	missense	5.26	54	3	SNP	0.000	T
RP1L1	94137	genome.wustl.edu	37	8	10465226	10465226	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:10465226C>T	ENST00000382483.3	-	4	6605	c.6382G>A	c.(6382-6384)Gag>Aag	p.E2128K		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	2208	25 X 16 AA approximate tandem repeats of [ED]-[AT]-[PQ]-[ED]-[AVT]-E-[GKE]-[ED]- [AMT]-Q-[EPK]-[EAT]-[TSELP]-[EG]- [EGSQDI]-[AVIE].				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		CCTTCTGACTCTGGCTGGGCC	0.622																																																	0													157.0	171.0	167.0					8																	10465226		1882	4091	5973	SO:0001583	missense	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.6382G>A	8.37:g.10465226C>T	ENSP00000371923:p.Glu2128Lys		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.E2128K	ENST00000382483.3	37	c.6382	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	C	9.878	1.200710	0.22121	.	.	ENSG00000183638	ENST00000382483	T	0.07908	3.15	1.33	1.33	0.21861	.	.	.	.	.	T	0.06645	0.0170	N	0.14661	0.345	0.09310	N	1	P	0.51791	0.948	P	0.48189	0.57	T	0.39961	-0.9588	9	0.16896	T	0.51	.	10.528	0.44960	0.0:1.0:0.0:0.0	.	2128	A6NKC6	.	K	2128	ENSP00000371923:E2128K	ENSP00000371923:E2128K	E	-	1	0	RP1L1	10502636	0.006000	0.16342	0.003000	0.11579	0.011000	0.07611	1.417000	0.34770	1.055000	0.40461	0.484000	0.47621	GAG	RP1L1	-	NULL	ENSG00000183638		0.622	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	-	0.00	53	0	C			10465226	-1	tier1	-	no_errors	ENST00000382483	ensembl	human	known	74_37	missense	9.74	176	19	SNP	0.024	T
RPH3A	22895	genome.wustl.edu	37	12	113266162	113266162	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:113266162G>T	ENST00000389385.4	+	3	536	c.39G>T	c.(37-39)tgG>tgT	p.W13C	RPH3A_ENST00000447659.2_Missense_Mutation_p.W13C|RPH3A_ENST00000543106.2_Missense_Mutation_p.W13C|RPH3A_ENST00000548866.1_Missense_Mutation_p.W13C|RPH3A_ENST00000551052.1_Missense_Mutation_p.W13C|RPH3A_ENST00000415485.3_Missense_Mutation_p.W13C|RPH3A_ENST00000420983.2_Missense_Mutation_p.W13C	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	13					intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		CTAACCGTTGGATGTACCCCA	0.473																																																	0													187.0	161.0	170.0					12																	113266162		2203	4300	6503	SO:0001583	missense	0			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.39G>T	12.37:g.113266162G>T	ENSP00000374036:p.Trp13Cys		B7Z3C3|Q96AE0	Missense_Mutation	SNP	pfam_C2_dom,pfam_Znf_FYVE-typ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,smart_C2_dom,pfscan_C2_dom,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel,prints_Synaptotagmin,prints_C2_dom	p.W13C	ENST00000389385.4	37	c.39	CCDS44979.1	12	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930417	0.52866	.	.	ENSG00000089169	ENST00000549736;ENST00000548197;ENST00000547686;ENST00000543106;ENST00000551593;ENST00000551748;ENST00000546703;ENST00000547840;ENST00000547728;ENST00000549769;ENST00000552667;ENST00000389385;ENST00000447659;ENST00000551198;ENST00000551052;ENST00000415485;ENST00000553114;ENST00000548866;ENST00000420983	T;T;D;T;T;T;T	0.81908	-0.97;-0.97;-1.55;-0.98;-0.97;-0.39;-0.97	5.7	5.7	0.88788	Rabphilin-3A effector, zinc-binding (1);	0.000000	0.50627	D	0.000120	D	0.90885	0.7136	M	0.77486	2.375	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.998;0.997	D	0.91576	0.5275	10	0.87932	D	0	.	15.3248	0.74150	0.0:0.0:1.0:0.0	.	13;13;13;13	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	C	13	ENSP00000440384:W13C;ENSP00000374036:W13C;ENSP00000413254:W13C;ENSP00000448297:W13C;ENSP00000405357:W13C;ENSP00000450347:W13C;ENSP00000408889:W13C	ENSP00000374036:W13C	W	+	3	0	RPH3A	111750545	1.000000	0.71417	1.000000	0.80357	0.392000	0.30506	4.419000	0.59835	2.696000	0.92011	0.655000	0.94253	TGG	RPH3A	-	pfam_Znf_FYVE-typ	ENSG00000089169		0.473	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	HGNC	protein_coding	OTTHUMT00000405561.1	-	0.00	47	0	G	NM_014954		113266162	+1	tier1	-	no_errors	ENST00000389385	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
RPL10L	140801	genome.wustl.edu	37	14	47120896	47120896	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:47120896T>C	ENST00000298283.3	-	1	132	c.44A>G	c.(43-45)aAg>aGg	p.K15R		NM_080746.2	NP_542784.1	Q96L21	RL10L_HUMAN	ribosomal protein L10-like	15					spermatogenesis (GO:0007283)|translation (GO:0006412)	cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	structural constituent of ribosome (GO:0003735)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(20)|ovary(1)	27						TGGGTACGGCTTGTTCTTACA	0.537																																																	0													85.0	90.0	89.0					14																	47120896		2203	4300	6503	SO:0001583	missense	0			AB063608	CCDS32071.1	14q21.2	2011-09-15			ENSG00000165496	ENSG00000165496		"""L ribosomal proteins"""	17976	protein-coding gene	gene with protein product						19123937	Standard	NM_080746		Approved		uc001wwg.3	Q96L21	OTTHUMG00000157869	ENST00000298283.3:c.44A>G	14.37:g.47120896T>C	ENSP00000298283:p.Lys15Arg		Q8IUD1	Missense_Mutation	SNP	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	p.K15R	ENST00000298283.3	37	c.44	CCDS32071.1	14	.	.	.	.	.	.	.	.	.	.	T	21.4	4.142896	0.77888	.	.	ENSG00000165496	ENST00000298283	T	0.74002	-0.8	4.08	4.08	0.47627	Ribosomal protein L10e/L16 (2);	0.000000	0.85682	D	0.000000	D	0.87943	0.6305	M	0.92077	3.27	0.80722	D	1	D	0.71674	0.998	D	0.79108	0.992	D	0.90191	0.4250	10	0.87932	D	0	-23.4845	11.6729	0.51413	0.0:0.0:0.0:1.0	.	15	Q96L21	RL10L_HUMAN	R	15	ENSP00000298283:K15R	ENSP00000298283:K15R	K	-	2	0	RPL10L	46190646	1.000000	0.71417	1.000000	0.80357	0.743000	0.42351	7.239000	0.78182	2.080000	0.62538	0.533000	0.62120	AAG	RPL10L	-	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	ENSG00000165496		0.537	RPL10L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10L	HGNC	protein_coding	OTTHUMT00000349819.1	-	0.00	50	0	T			47120896	-1	tier1	-	no_errors	ENST00000298283	ensembl	human	known	74_37	missense	47.22	19	17	SNP	1.000	C
RTL1	388015	genome.wustl.edu	37	14	101350670	101350670	+	Silent	SNP	C	C	T	rs397823434|rs35401447	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:101350670C>T	ENST00000534062.1	-	1	514	c.456G>A	c.(454-456)gaG>gaA	p.E152E	MIR432_ENST00000606207.1_RNA|MIR136_ENST00000385207.1_RNA|MIR127_ENST00000384876.1_RNA|MIR433_ENST00000384837.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	152					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						TCTGGTTTTGCTCTTGAGGAG	0.517																																																	0													246.0	212.0	223.0					14																	101350670		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.456G>A	14.37:g.101350670C>T			E9PKS8	Silent	SNP	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.E152	ENST00000534062.1	37	c.456	CCDS53910.1	14																																																																																			RTL1	-	NULL	ENSG00000254656		0.517	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1		0.00	52	0	C	NM_001134888		101350670	-1			no_errors	ENST00000534062	ensembl	human	known	74_37	silent	7.58	61	5	SNP	0.005	T
S100A7L2	645922	genome.wustl.edu	37	1	153410796	153410796	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:153410796G>T	ENST00000368725.2	-	2	42	c.43C>A	c.(43-45)Cct>Act	p.P15T		NM_001045479.1	NP_001038944.2	Q5SY68	S1A7B_HUMAN	S100 calcium binding protein A7-like 2	4	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			NS(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	all_lung(78;2.4e-33)|Lung NSC(65;8.13e-32)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCACCTAGAGGGATATTCATC	0.398																																																	0													151.0	128.0	136.0					1																	153410796		2203	4300	6503	SO:0001583	missense	0					1q21.3	2013-01-10			ENSG00000197364	ENSG00000197364		"""EF-hand domain containing"""	21655	protein-coding gene	gene with protein product							Standard	NM_001045479		Approved	s100a7b	uc010pdx.2	Q5SY68	OTTHUMG00000013129	ENST00000368725.2:c.43C>A	1.37:g.153410796G>T	ENSP00000357714:p.Pro15Thr			Missense_Mutation	SNP	pfscan_EF_hand_dom	p.P15T	ENST00000368725.2	37	c.43		1	.	.	.	.	.	.	.	.	.	.	.	0.052	-1.245968	0.01481	.	.	ENSG00000197364	ENST00000368725;ENST00000368724;ENST00000453814	T;T;T	0.16597	2.63;2.63;2.33	1.81	-0.998	0.10212	.	.	.	.	.	T	0.00724	0.0024	N	0.00707	-1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44711	-0.9310	9	0.02654	T	1	.	2.4467	0.04508	0.2663:0.0:0.29:0.4437	.	4	Q5SY68	S1A7B_HUMAN	T	4;4;15	ENSP00000357714:P4T;ENSP00000357713:P4T;ENSP00000405610:P15T	ENSP00000357713:P4T	P	-	1	0	S100A7L2	151677420	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.032000	0.13732	-0.261000	0.09405	-0.602000	0.04101	CCT	S100A7L2	-	NULL	ENSG00000197364		0.398	S100A7L2-001	KNOWN	basic|appris_principal	protein_coding	S100A7L2	HGNC	protein_coding	OTTHUMT00000036797.2		0.00	13	0	G	NM_001045479		153410796	-1			no_errors	ENST00000368725	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.000	T
SALL1	6299	genome.wustl.edu	37	16	51174409	51174409	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:51174409G>T	ENST00000251020.4	-	2	1757	c.1724C>A	c.(1723-1725)cCa>cAa	p.P575Q	SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000440970.1_Missense_Mutation_p.P478Q|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	575					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GATGGGGGCTGGCTCTTCCGT	0.607																																					GBM(103;1352 1446 1855 4775 8890)												0													42.0	47.0	45.0					16																	51174409		2198	4300	6498	SO:0001583	missense	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1724C>A	16.37:g.51174409G>T	ENSP00000251020:p.Pro575Gln		Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P575Q	ENST00000251020.4	37	c.1724	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	G	17.02	3.282368	0.59867	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.07216	3.22;3.21	5.32	5.32	0.75619	.	0.103319	0.64402	D	0.000002	T	0.28400	0.0702	M	0.72353	2.195	0.58432	D	0.99999	D	0.76494	0.999	D	0.66196	0.942	T	0.00585	-1.1658	10	0.42905	T	0.14	.	18.9957	0.92812	0.0:0.0:1.0:0.0	.	575	Q9NSC2	SALL1_HUMAN	Q	575;478;539	ENSP00000251020:P575Q;ENSP00000407914:P478Q	ENSP00000251020:P575Q	P	-	2	0	SALL1	49731910	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.326000	0.65875	2.475000	0.83589	0.557000	0.71058	CCA	SALL1	-	NULL	ENSG00000103449		0.607	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	-	0.00	16	0	G	NM_002968		51174409	-1	tier1	-	no_errors	ENST00000251020	ensembl	human	known	74_37	missense	60.00	4	6	SNP	1.000	T
SBNO1	55206	genome.wustl.edu	37	12	123829962	123829962	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:123829962G>A	ENST00000602398.1	-	4	520	c.393C>T	c.(391-393)cgC>cgT	p.R131R	SBNO1_ENST00000267176.4_Silent_p.R130R|SBNO1_ENST00000602750.1_Silent_p.R130R|SBNO1_ENST00000420886.2_Silent_p.R131R			A3KN83	SBNO1_HUMAN	strawberry notch homolog 1 (Drosophila)	131					regulation of transcription, DNA-templated (GO:0006355)					NS(2)|breast(6)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(11)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(2)	62	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000701)|Epithelial(86;0.00197)		AGACTGACGGGCGTGTGCTTG	0.413																																																	0													285.0	241.0	256.0					12																	123829962		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001563	CCDS9246.1, CCDS53844.1	12q24.31	2006-10-06	2006-10-06			ENSG00000139697			22973	protein-coding gene	gene with protein product		614274	"""sno, strawberry notch homolog 1 (Drosophila)"""				Standard	NM_018183		Approved	MOP3, FLJ10701, FLJ10833, Sno	uc010tap.2	A3KN83		ENST00000602398.1:c.393C>T	12.37:g.123829962G>A			Q05C06|Q3ZTS3|Q9H3T8|Q9NVB2	Silent	SNP	pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Prismane-like	p.R131	ENST00000602398.1	37	c.393	CCDS53844.1	12																																																																																			SBNO1	-	NULL	ENSG00000139697		0.413	SBNO1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO1	HGNC	protein_coding	OTTHUMT00000467684.1	-	0.00	104	0	G	NM_018183		123829962	-1	tier1	-	no_errors	ENST00000420886	ensembl	human	known	74_37	silent	39.22	62	40	SNP	0.893	A
SEC11C	90701	genome.wustl.edu	37	18	56825870	56825871	+	Frame_Shift_Ins	INS	-	-	T	rs202018793		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:56825870_56825871insT	ENST00000587834.1	+	6	1004_1005	c.532_533insT	c.(532-534)cttfs	p.L178fs	SEC11C_ENST00000588875.1_Frame_Shift_Ins_p.F159fs	NM_033280.2	NP_150596.1	Q9BY50	SC11C_HUMAN	SEC11 homolog C (S. cerevisiae)	178					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	serine-type peptidase activity (GO:0008236)			endometrium(1)|large_intestine(4)|liver(2)|lung(2)	9		Colorectal(73;0.175)				CCAGTATGCTCTTTTGGCTGTA	0.371																																																	0																																										SO:0001589	frameshift_variant	0			AF212233	CCDS11970.1	18q21.32	2006-11-07	2006-11-07	2006-11-07	ENSG00000166562	ENSG00000166562			23400	protein-coding gene	gene with protein product			"""SEC11-like 3 (S. cerevisiae)"""	SEC11L3			Standard	NM_033280		Approved	SPC21, SPCS4C	uc002lht.3	Q9BY50	OTTHUMG00000132762	ENST00000587834.1:c.536dupT	18.37:g.56825874_56825874dupT	ENSP00000468633:p.Leu178fs		B2RAA3	Frame_Shift_Ins	INS	pfam_Peptidase_S24_S26,superfamily_Peptidase_S24_S26A/B/C,prints_Peptidase_S26B,tigrfam_Peptidase_S26B	p.L179fs	ENST00000587834.1	37	c.532_533	CCDS11970.1	18																																																																																			SEC11C	-	tigrfam_Peptidase_S26B	ENSG00000166562		0.371	SEC11C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC11C	HGNC	protein_coding	OTTHUMT00000256134.2		0.00	53	0	-	NM_033280		56825871	+1	tier1		no_errors	ENST00000587834	ensembl	human	known	74_37	frame_shift_ins	34.92	41	22	INS	1.000:0.999	T
SEC24D	9871	genome.wustl.edu	37	4	119673227	119673227	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:119673227G>T	ENST00000280551.6	-	13	1869	c.1631C>A	c.(1630-1632)cCa>cAa	p.P544Q	SEC24D_ENST00000379735.5_Missense_Mutation_p.P545Q|SEC24D_ENST00000505134.1_5'UTR|SEC24D_ENST00000419654.2_Missense_Mutation_p.P100Q|SEC24D_ENST00000429811.2_Missense_Mutation_p.P100Q|SEC24D_ENST00000511481.1_Missense_Mutation_p.P175Q			O94855	SC24D_HUMAN	SEC24 family member D	544					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						AAACATGTCTGGAATCTGGTC	0.368																																																	0													99.0	98.0	99.0					4																	119673227		2203	4300	6503	SO:0001583	missense	0			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.1631C>A	4.37:g.119673227G>T	ENSP00000280551:p.Pro544Gln		Q8IYI7	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.P545Q	ENST00000280551.6	37	c.1634	CCDS3710.1	4	.	.	.	.	.	.	.	.	.	.	G	33	5.213473	0.95069	.	.	ENSG00000150961	ENST00000280551;ENST00000379735;ENST00000429811;ENST00000511481;ENST00000419654	T;T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.86;-0.86	5.54	5.54	0.83059	Sec23/Sec24, trunk domain (1);	0.000000	0.85682	D	0.000000	D	0.88702	0.6508	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.994;0.999	D	0.90161	0.4228	10	0.87932	D	0	-13.4791	19.4727	0.94969	0.0:0.0:1.0:0.0	.	545;544	O94855-2;O94855	.;SC24D_HUMAN	Q	544;545;100;175;100	ENSP00000280551:P544Q;ENSP00000369059:P545Q;ENSP00000409775:P100Q;ENSP00000425491:P175Q;ENSP00000388324:P100Q	ENSP00000280551:P544Q	P	-	2	0	SEC24D	119892675	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.706000	0.98722	2.594000	0.87642	0.585000	0.79938	CCA	SEC24D	-	pfam_Sec23/24_trunk_dom	ENSG00000150961		0.368	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24D	HGNC	protein_coding	OTTHUMT00000256514.4	-	0.00	40	0	G			119673227	-1	tier1	-	no_errors	ENST00000379735	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	T
SELP	6403	genome.wustl.edu	37	1	169578896	169578896	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:169578896G>T	ENST00000263686.6	-	8	1216	c.1179C>A	c.(1177-1179)gtC>gtA	p.V393V	SELP_ENST00000367791.2_Intron|SELP_ENST00000367792.2_Silent_p.V331V|SELP_ENST00000458599.2_Silent_p.V331V|SELP_ENST00000367794.2_Silent_p.V331V|SELP_ENST00000367788.2_Silent_p.V331V|SELP_ENST00000367793.2_Silent_p.V331V|SELP_ENST00000367786.2_Silent_p.V331V	NM_003005.3	NP_002996.2	P16109	LYAM3_HUMAN	selectin P (granule membrane protein 140kDa, antigen CD62)	393	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|defense response to Gram-negative bacterium (GO:0050829)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of platelet activation (GO:0010572)|regulation of integrin activation (GO:0033623)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|platelet dense granule membrane (GO:0031088)	fucose binding (GO:0042806)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|lipopolysaccharide binding (GO:0001530)|oligosaccharide binding (GO:0070492)|sialic acid binding (GO:0033691)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(32)|ovary(4)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(923;0.208)				Dalteparin(DB06779)|Heparin(DB01109)|Nadroparin(DB08813)	TGCTTCCGTGGACAGGACTCT	0.493																																																	0													85.0	73.0	77.0					1																	169578896		2203	4300	6503	SO:0001819	synonymous_variant	0			BC068533	CCDS1282.1	1q22-q25	2008-02-05	2002-08-29		ENSG00000174175	ENSG00000174175		"""CD molecules"""	10721	protein-coding gene	gene with protein product		173610	"""selectin P (granule membrane protein 140kD, antigen CD62)"""	GRMP		1375831	Standard	NM_003005		Approved	CD62, PSEL, PADGEM, GMP140, CD62P	uc001ggi.4	P16109	OTTHUMG00000034685	ENST00000263686.6:c.1179C>A	1.37:g.169578896G>T			Q5R344|Q8IVD1	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.V393	ENST00000263686.6	37	c.1179	CCDS1282.1	1	.	.	.	.	.	.	.	.	.	.	G	12.17	1.858064	0.32791	.	.	ENSG00000174175	ENST00000446728	.	.	.	5.74	-2.5	0.06384	.	.	.	.	.	T	0.06005	0.0156	.	.	.	0.23101	N	0.998292	.	.	.	.	.	.	T	0.35847	-0.9772	4	.	.	.	-7.0E-4	0.6905	0.00890	0.2929:0.1191:0.3437:0.2443	.	.	.	.	T	331	.	.	P	-	1	0	SELP	167845520	0.000000	0.05858	0.000000	0.03702	0.857000	0.48899	-0.266000	0.08631	-0.822000	0.04306	0.650000	0.86243	CCA	SELP	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000174175		0.493	SELP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SELP	HGNC	protein_coding	OTTHUMT00000083916.4		0.00	28	0	G	NM_003005		169578896	-1			no_errors	ENST00000263686	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.007	T
SEPT14	346288	genome.wustl.edu	37	7	55910813	55910813	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:55910813G>T	ENST00000388975.3	-	5	496	c.380C>A	c.(379-381)cCa>cAa	p.P127Q	SEPT14_ENST00000477628.1_5'Flank	NM_207366.2	NP_997249.2	Q6ZU15	SEP14_HUMAN	septin 14	127	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|skin(2)	23	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GTCAACTATTGGTTGGTAGCT	0.353																																																	0													73.0	65.0	67.0					7																	55910813		1837	4090	5927	SO:0001583	missense	0			AK126048	CCDS5519.2	7p11.2	2013-01-21			ENSG00000154997	ENSG00000154997		"""Septins"""	33280	protein-coding gene	gene with protein product		612140					Standard	NM_207366		Approved	FLJ44060	uc003tqz.2	Q6ZU15	OTTHUMG00000129341	ENST00000388975.3:c.380C>A	7.37:g.55910813G>T	ENSP00000373627:p.Pro127Gln		A6NCC2|B4DXD6	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.P127Q	ENST00000388975.3	37	c.380	CCDS5519.2	7	.	.	.	.	.	.	.	.	.	.	g	12.74	2.028857	0.35797	.	.	ENSG00000154997	ENST00000388975	T	0.54866	0.55	4.32	3.44	0.39384	.	0.115254	0.37219	N	0.002188	T	0.69913	0.3164	M	0.77406	2.37	0.32805	D	0.500637	D	0.76494	0.999	D	0.78314	0.991	T	0.78526	-0.2170	10	0.87932	D	0	.	10.9331	0.47230	0.0971:0.0:0.9029:0.0	.	127	Q6ZU15	SEP14_HUMAN	Q	127	ENSP00000373627:P127Q	ENSP00000373627:P127Q	P	-	2	0	SEPT14	55878307	1.000000	0.71417	0.854000	0.33618	0.076000	0.17211	3.978000	0.56881	1.099000	0.41499	0.650000	0.86243	CCA	SEPT14	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	ENSG00000154997		0.353	SEPT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT14	HGNC	protein_coding	OTTHUMT00000251489.2		0.00	25	0	G	NM_207366		55910813	-1			no_errors	ENST00000388975	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.999	T
SERF2	10169	genome.wustl.edu	37	15	44084580	44084580	+	Splice_Site	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:44084580C>T	ENST00000381359.1	+	3	935	c.6C>T	c.(4-6)acC>acT	p.T2T	MIR1282_ENST00000408865.1_RNA|RP11-296A16.1_ENST00000417761.2_Intron|SERF2_ENST00000409960.2_Splice_Site_p.T2T|SERF2_ENST00000249786.4_Splice_Site_p.T2T|SERF2_ENST00000339624.5_Splice_Site_p.T2T|SERF2_ENST00000402131.1_5'UTR|SERF2_ENST00000403425.1_5'UTR|SERF2_ENST00000409614.1_5'Flank|SERF2_ENST00000594896.1_5'UTR|SERF2_ENST00000409646.1_Splice_Site_p.T2T|SERF2_ENST00000409291.1_5'UTR	NM_001199877.1	NP_001186806.1	P84101	SERF2_HUMAN	small EDRK-rich factor 2	2						cytosol (GO:0005829)|nucleus (GO:0005634)				lung(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		TCGCCATGACCCGTGAGCACC	0.622											OREG0003943	type=REGULATORY REGION|Gene=LOC478280|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													126.0	93.0	104.0					15																	44084580		2198	4298	6496	SO:0001630	splice_region_variant	0			AF073298	CCDS32218.1, CCDS55963.1, CCDS55964.1, CCDS55965.1	15q15.1	2008-01-18			ENSG00000140264	ENSG00000140264			10757	protein-coding gene	gene with protein product		605054				9731538	Standard	NM_001199876		Approved	H4F5rel, 4F5REL, FAM2C, HsT17089	uc010bdq.3	P84101	OTTHUMG00000059935	ENST00000381359.1:c.7+1C>T	15.37:g.44084580C>T		921	A6NL45|B5MCG1|B9A026|O75918|O88891|Q9BZH7	Silent	SNP	pfam_Uncharacterised_SERF	p.T2	ENST00000381359.1	37	c.6	CCDS32218.1	15																																																																																			SERF2	-	pfam_Uncharacterised_SERF	ENSG00000140264		0.622	SERF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERF2	HGNC	protein_coding	OTTHUMT00000133233.2	-	0.00	50	0	C	NM_005770	Silent	44084580	+1	tier1	-	no_errors	ENST00000448830	ensembl	human	known	74_37	silent	31.71	28	13	SNP	1.000	T
SERPINA6	866	genome.wustl.edu	37	14	94776192	94776192	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:94776192C>A	ENST00000341584.3	-	3	911	c.765G>T	c.(763-765)atG>atT	p.M255I		NM_001756.3	NP_001747	P08185	CBG_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6	255					glucocorticoid metabolic process (GO:0008211)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|transport (GO:0006810)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)|steroid binding (GO:0005496)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	26		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)	CCACGTAGTTCATCTGCACCA	0.542																																																	0													147.0	117.0	127.0					14																	94776192		2203	4300	6503	SO:0001583	missense	0			J02943	CCDS9924.1	14q32.13	2014-02-18	2005-08-18		ENSG00000170099	ENSG00000170099		"""Serine (or cysteine) peptidase inhibitors"""	1540	protein-coding gene	gene with protein product	"""corticosteroid binding globulin"", ""transcortin"""	122500	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 6"""	CBG		3299377, 7912884, 24172014	Standard	NM_001756		Approved		uc001ycv.3	P08185	OTTHUMG00000171346	ENST00000341584.3:c.765G>T	14.37:g.94776192C>A	ENSP00000342850:p.Met255Ile		A8K456|Q7Z2Q9	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.M255I	ENST00000341584.3	37	c.765	CCDS9924.1	14	.	.	.	.	.	.	.	.	.	.	C	10.81	1.455130	0.26161	.	.	ENSG00000170099	ENST00000341584	D	0.84370	-1.84	5.03	4.13	0.48395	Serpin domain (3);	0.401289	0.20792	N	0.085596	T	0.78629	0.4313	L	0.33624	1.015	0.31970	N	0.607332	B	0.17038	0.02	B	0.26416	0.069	T	0.78580	-0.2149	10	0.51188	T	0.08	.	10.8096	0.46538	0.1359:0.6011:0.263:0.0	.	255	P08185	CBG_HUMAN	I	255	ENSP00000342850:M255I	ENSP00000342850:M255I	M	-	3	0	SERPINA6	93845945	0.656000	0.27385	0.987000	0.45799	0.028000	0.11728	0.173000	0.16724	1.464000	0.47987	0.655000	0.94253	ATG	SERPINA6	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000170099		0.542	SERPINA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA6	HGNC	protein_coding	OTTHUMT00000413065.1	-	0.00	42	0	C	NM_001756		94776192	-1	tier1	-	no_errors	ENST00000341584	ensembl	human	known	74_37	missense	42.86	20	15	SNP	1.000	A
SERPINB9	5272	genome.wustl.edu	37	6	2900764	2900764	+	Missense_Mutation	SNP	C	C	T	rs372377669		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:2900764C>T	ENST00000380698.4	-	2	171	c.82G>A	c.(82-84)Gtg>Atg	p.V28M		NM_004155.5	NP_004146.1	P50453	SPB9_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 9	28					cellular response to estrogen stimulus (GO:0071391)|immune response (GO:0006955)|mast cell mediated immunity (GO:0002448)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|pancreas(1)|prostate(1)	15	Ovarian(93;0.0412)	all_hematologic(90;0.108)				GAACAGAACACGTTGTGCGAA	0.517																																																	0								C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	245.0	224.0	231.0		82	3.5	0.7	6		231	0,8600		0,0,4300	no	missense	SERPINB9	NM_004155.4	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	28/377	2900764	1,13005	2203	4300	6503	SO:0001583	missense	0			L40378	CCDS4478.1	6p25.2	2014-02-18	2005-08-18		ENSG00000170542	ENSG00000170542		"""Serine (or cysteine) peptidase inhibitors"""	8955	protein-coding gene	gene with protein product		601799	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 9"""	PI9		8530382, 9858835, 24172014	Standard	NM_004155		Approved	CAP3	uc003mug.4	P50453	OTTHUMG00000014131	ENST00000380698.4:c.82G>A	6.37:g.2900764C>T	ENSP00000370074:p.Val28Met		B2RBW3|Q5TD03	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom,prints_Serpin_B9/Maspin	p.V28M	ENST00000380698.4	37	c.82	CCDS4478.1	6	.	.	.	.	.	.	.	.	.	.	C	15.88	2.964273	0.53507	2.27E-4	0.0	ENSG00000170542	ENST00000380698	D	0.85955	-2.05	5.37	3.55	0.40652	Serpin domain (3);	0.233607	0.44097	D	0.000484	D	0.87966	0.6311	M	0.85299	2.745	0.35687	D	0.814557	D	0.67145	0.996	D	0.68621	0.959	D	0.88209	0.2889	10	0.66056	D	0.02	.	4.8872	0.13708	0.0:0.4558:0.3553:0.1889	.	28	P50453	SPB9_HUMAN	M	28	ENSP00000370074:V28M	ENSP00000370074:V28M	V	-	1	0	SERPINB9	2845763	0.014000	0.17966	0.659000	0.29680	0.005000	0.04900	-0.060000	0.11712	1.378000	0.46305	-0.175000	0.13238	GTG	SERPINB9	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom,prints_Serpin_B9/Maspin	ENSG00000170542		0.517	SERPINB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB9	HGNC	protein_coding	OTTHUMT00000039656.1	-	0.00	61	0	C			2900764	-1	tier1	-	no_errors	ENST00000380698	ensembl	human	known	74_37	missense	37.25	32	19	SNP	0.549	T
SF3B4	10262	genome.wustl.edu	37	1	149898421	149898421	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:149898421C>T	ENST00000271628.8	-	3	1137	c.553G>A	c.(553-555)Gag>Aag	p.E185K	MTMR11_ENST00000492824.1_5'Flank	NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	185					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CCATGGCGCTCACCCTTGGAG	0.547																																																	0													85.0	82.0	83.0					1																	149898421		2203	4300	6503	SO:0001583	missense	0			L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.553G>A	1.37:g.149898421C>T	ENSP00000271628:p.Glu185Lys		Q5SZ63	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E185K	ENST00000271628.8	37	c.553	CCDS941.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.329436	0.95733	.	.	ENSG00000143368	ENST00000271628;ENST00000457312	T;T	0.26660	1.72;2.69	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.43033	0.1229	M	0.79123	2.44	0.80722	D	1	D;D	0.63046	0.992;0.992	D;D	0.63703	0.917;0.917	T	0.40346	-0.9568	10	0.54805	T	0.06	.	16.9828	0.86333	0.0:1.0:0.0:0.0	.	185;185	Q53FG6;Q15427	.;SF3B4_HUMAN	K	185;142	ENSP00000271628:E185K;ENSP00000391114:E142K	ENSP00000271628:E185K	E	-	1	0	SF3B4	148165045	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.367000	0.79558	2.552000	0.86080	0.643000	0.83706	GAG	SF3B4	-	NULL	ENSG00000143368		0.547	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B4	HGNC	protein_coding	OTTHUMT00000033753.1	-	0.00	38	0	C	NM_005850		149898421	-1	tier1	-	no_errors	ENST00000271628	ensembl	human	known	74_37	missense	21.57	40	11	SNP	1.000	T
SH3BP1	23616	genome.wustl.edu	37	22	38049875	38049875	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr22:38049875G>T	ENST00000357436.4	+	17	2001	c.1688G>T	c.(1687-1689)cGg>cTg	p.R563L	SH3BP1_ENST00000599616.1_Missense_Mutation_p.R499L|Z83844.1_ENST00000456099.1_RNA	NM_018957.3	NP_061830.3	Q9Y3L3	3BP1_HUMAN	SH3-domain binding protein 1	563					signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Melanoma(58;0.0574)					GACATGGCTCGGAGGAGTGAG	0.657																																																	0													29.0	31.0	30.0					22																	38049875		2200	4300	6500	SO:0001583	missense	0				CCDS13952.2	22q13.1	2011-07-04			ENSG00000100092	ENSG00000100092		"""Rho GTPase activating proteins"""	10824	protein-coding gene	gene with protein product						10591208, 12029088	Standard	NM_018957		Approved	ARHGAP43	uc003ati.3	Q9Y3L3	OTTHUMG00000030996	ENST00000357436.4:c.1688G>T	22.37:g.38049875G>T	ENSP00000350018:p.Arg563Leu		Q5R3N0|Q6IBZ2|Q6ZVL9|Q96HQ5|Q9NSQ9	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_BAR_dom,superfamily_Rho_GTPase_activation_prot,smart_BAR_dom,smart_RhoGAP_dom,pfscan_BAR_dom,pfscan_RhoGAP_dom	p.R563L	ENST00000357436.4	37	c.1688	CCDS13952.2	22	.	.	.	.	.	.	.	.	.	.	G	15.91	2.972935	0.53614	.	.	ENSG00000100092	ENST00000357436;ENST00000397014	T	0.17528	2.27	5.45	4.44	0.53790	.	0.000000	0.53938	D	0.000058	T	0.26846	0.0657	L	0.34521	1.04	0.80722	D	1	D;P;P;D	0.89917	1.0;0.916;0.931;0.997	D;P;P;D	0.81914	0.995;0.522;0.468;0.987	T	0.01762	-1.1279	10	0.31617	T	0.26	.	10.0865	0.42421	0.0899:0.0:0.9101:0.0	.	477;499;563;477	E7EUD3;Q6ZT62;Q9Y3L3;Q6ZTJ5	.;.;3BP1_HUMAN;.	L	563;477	ENSP00000350018:R563L	ENSP00000350018:R563L	R	+	2	0	SH3BP1	36379821	0.993000	0.37304	0.995000	0.50966	0.559000	0.35586	2.491000	0.45303	1.547000	0.49401	0.655000	0.94253	CGG	SH3BP1	-	NULL	ENSG00000100092		0.657	SH3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP1	HGNC	protein_coding	OTTHUMT00000075884.4		0.00	69	0	G	NM_018957		38049875	+1			no_errors	ENST00000357436	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.876	T
SH3GLB2	56904	genome.wustl.edu	37	9	131777085	131777085	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:131777085G>T	ENST00000372564.3	-	4	578	c.433C>A	c.(433-435)Cgc>Agc	p.R145S	SH3GLB2_ENST00000416629.1_Missense_Mutation_p.R145S|SH3GLB2_ENST00000372559.1_Missense_Mutation_p.R145S|SH3GLB2_ENST00000372554.4_Missense_Mutation_p.R145S|SH3GLB2_ENST00000417224.1_Missense_Mutation_p.R145S	NM_020145.2	NP_064530.1	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2	145	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.					cytoplasm (GO:0005737)				NS(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|ovary(1)|prostate(1)	12						AGGAAGTTGCGCAAGGGTGTG	0.572																																																	0													104.0	106.0	105.0					9																	131777085		2203	4300	6503	SO:0001583	missense	0			AF257319	CCDS6916.1, CCDS69680.1	9q34	2008-02-05	2001-12-04		ENSG00000148341	ENSG00000148341			10834	protein-coding gene	gene with protein product		609288	"""SH3-domain, GRB2-like, endophilin B2"""			11161816	Standard	NM_020145		Approved	KIAA1848	uc004bwv.3	Q9NR46	OTTHUMG00000020769	ENST00000372564.3:c.433C>A	9.37:g.131777085G>T	ENSP00000361645:p.Arg145Ser		A6NC47|A8MPS4|Q8WY61|Q96JH9	Missense_Mutation	SNP	pfam_BAR_dom,pfam_BAR_dom-cont,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain	p.R145S	ENST00000372564.3	37	c.433	CCDS6916.1	9	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158906	0.78226	.	.	ENSG00000148341	ENST00000372564;ENST00000372559;ENST00000543311;ENST00000372554;ENST00000417224;ENST00000416629	T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09	5.57	4.67	0.58626	BAR (3);IRSp53/MIM homology domain (IMD) (1);	0.000000	0.85682	D	0.000000	T	0.76421	0.3985	M	0.65975	2.015	0.80722	D	1	D;P	0.89917	1.0;0.895	D;P	0.91635	0.999;0.693	T	0.78023	-0.2366	10	0.52906	T	0.07	-1.1613	13.9138	0.63883	0.0732:0.0:0.9268:0.0	.	145;145	Q9NR46-2;Q9NR46	.;SHLB2_HUMAN	S	145	ENSP00000361645:R145S;ENSP00000361640:R145S;ENSP00000361634:R145S;ENSP00000402566:R145S;ENSP00000388282:R145S	ENSP00000361634:R145S	R	-	1	0	SH3GLB2	130816906	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.964000	0.49192	1.502000	0.48669	0.655000	0.94253	CGC	SH3GLB2	-	pfam_BAR_dom,pfam_BAR_dom-cont,smart_BAR_dom,pfscan_BAR_dom	ENSG00000148341		0.572	SH3GLB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GLB2	HGNC	protein_coding	OTTHUMT00000054535.2		0.00	48	0	G			131777085	-1			no_errors	ENST00000372554	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
SH3PXD2A	9644	genome.wustl.edu	37	10	105362805	105362805	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:105362805A>G	ENST00000369774.4	-	15	2446	c.2170T>C	c.(2170-2172)Tcg>Ccg	p.S724P	SH3PXD2A_ENST00000355946.2_Missense_Mutation_p.S696P|SH3PXD2A_ENST00000538130.1_Missense_Mutation_p.S559P|SH3PXD2A_ENST00000315994.6_5'UTR|SH3PXD2A_ENST00000427662.2_Intron|SH3PXD2A_ENST00000540321.1_Missense_Mutation_p.S591P			Q5TCZ1	SPD2A_HUMAN	SH3 and PX domains 2A	724	Ser-rich.				superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(1)|urinary_tract(1)	38		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		CCTGCGTCCGAAGCAGAGCGG	0.612																																																	0													68.0	73.0	71.0					10																	105362805		2203	4300	6503	SO:0001583	missense	0			AB007878	CCDS31278.1	10q25.1	2006-02-13	2006-02-13	2006-02-13	ENSG00000107957	ENSG00000107957			23664	protein-coding gene	gene with protein product	"""five SH3 domains"""		"""SH3 multiple domains 1"""	SH3MD1		9687503	Standard	XM_005270297		Approved	FISH, KIAA0418	uc001kxj.1	Q5TCZ1	OTTHUMG00000018997	ENST00000369774.4:c.2170T>C	10.37:g.105362805A>G	ENSP00000358789:p.Ser724Pro		D3DR98|O43302|Q5TCZ2|Q5TDQ8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.S724P	ENST00000369774.4	37	c.2170		10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.86|16.86	3.240258|3.240258	0.58995|0.58995	.|.	.|.	ENSG00000107957|ENSG00000107957	ENST00000420222|ENST00000369774;ENST00000355946;ENST00000315994;ENST00000536035;ENST00000540321;ENST00000538130	.|T;T;T;T	.|0.66815	.|-0.14;-0.2;-0.04;-0.23	5.17|5.17	5.17|5.17	0.71159|0.71159	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.77136|0.77136	0.4086|0.4086	L|L	0.52573|0.52573	1.65|1.65	0.49213|0.49213	D|D	0.99976|0.99976	.|D;D;D;D	.|0.76494	.|0.998;0.998;0.998;0.999	.|D;D;D;D	.|0.80764	.|0.986;0.986;0.99;0.994	T|T	0.78119|0.78119	-0.2328|-0.2328	5|10	.|0.51188	.|T	.|0.08	-9.5027|-9.5027	14.9964|14.9964	0.71436|0.71436	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|724;573;569;696	.|Q5TCZ1;B7Z9L8;B7Z3B0;Q5TCZ1-3	.|SPD2A_HUMAN;.;.;.	S|P	650|724;696;531;639;591;559	.|ENSP00000358789:S724P;ENSP00000348215:S696P;ENSP00000443663:S591P;ENSP00000441514:S559P	.|ENSP00000318135:S531P	F|S	-|-	2|1	0|0	SH3PXD2A|SH3PXD2A	105352795|105352795	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.875000|0.875000	0.50365|0.50365	5.285000|5.285000	0.65633|0.65633	1.955000|1.955000	0.56771|0.56771	0.459000|0.459000	0.35465|0.35465	TTC|TCG	SH3PXD2A	-	NULL	ENSG00000107957		0.612	SH3PXD2A-001	KNOWN	basic	protein_coding	SH3PXD2A	HGNC	protein_coding	OTTHUMT00000050178.1	-	0.00	49	0	A	NM_014631		105362805	-1	tier1	-	no_errors	ENST00000369774	ensembl	human	known	74_37	missense	31.34	46	21	SNP	1.000	G
SHROOM2	357	genome.wustl.edu	37	X	9864214	9864214	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:9864214G>C	ENST00000380913.3	+	4	2356	c.2266G>C	c.(2266-2268)Gct>Cct	p.A756P		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	756	ASD1. {ECO:0000255|PROSITE- ProRule:PRU00637}.				apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				ACGGTTCACAGCTGAGCAGAA	0.632																																																	0													19.0	17.0	17.0					X																	9864214		2202	4298	6500	SO:0001583	missense	0			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.2266G>C	X.37:g.9864214G>C	ENSP00000370299:p.Ala756Pro		B9EIQ7	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A756P	ENST00000380913.3	37	c.2266	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	G	14.83	2.651638	0.47362	.	.	ENSG00000146950	ENST00000380913	T	0.45276	0.9	5.04	5.04	0.67666	Apx/shroom, ASD1 (2);	0.330672	0.31872	N	0.006925	T	0.48995	0.1531	L	0.43152	1.355	0.54753	D	0.999986	D	0.65815	0.995	D	0.63283	0.913	T	0.42732	-0.9434	10	0.34782	T	0.22	-8.7163	8.312	0.32077	0.1905:0.0:0.8095:0.0	.	756	Q13796	SHRM2_HUMAN	P	756	ENSP00000370299:A756P	ENSP00000370299:A756P	A	+	1	0	SHROOM2	9824214	0.076000	0.21285	0.004000	0.12327	0.475000	0.33008	2.530000	0.45641	2.098000	0.63641	0.600000	0.82982	GCT	SHROOM2	-	pfam_ASD1	ENSG00000146950		0.632	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	-	0.00	57	0	G	NM_001649		9864214	+1	tier1	-	no_errors	ENST00000380913	ensembl	human	known	74_37	missense	39.22	31	20	SNP	0.183	C
SLC12A1	6557	genome.wustl.edu	37	15	48499977	48499977	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:48499977T>C	ENST00000558405.1	+	1	75	c.61T>C	c.(61-63)Ttt>Ctt	p.F21L	SLC12A1_ENST00000561031.1_Missense_Mutation_p.F21L|SLC12A1_ENST00000396577.3_Missense_Mutation_p.F21L|SLC12A1_ENST00000380993.3_Missense_Mutation_p.F21L|SLC12A1_ENST00000330289.6_Missense_Mutation_p.F21L			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	21					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TACCAATCGCTTTCAAGTTAG	0.403																																																	0													54.0	52.0	53.0					15																	48499977		2198	4297	6495	SO:0001583	missense	0				CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.61T>C	15.37:g.48499977T>C	ENSP00000453409:p.Phe21Leu		A8JYA2|E9PDW4	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt2,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.F21L	ENST00000558405.1	37	c.61	CCDS10129.2	15	.	.	.	.	.	.	.	.	.	.	T	23.5	4.429601	0.83776	.	.	ENSG00000074803	ENST00000380993;ENST00000396577;ENST00000330289	D;D;D	0.92595	-2.03;-2.03;-3.07	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000002	D	0.91195	0.7226	N	0.08118	0	0.44254	D	0.997101	P;D	0.69078	0.93;0.997	P;D	0.79784	0.496;0.993	D	0.93621	0.6948	10	0.87932	D	0	.	15.3794	0.74641	0.0:0.0:0.0:1.0	.	21;21	Q8IUN5;Q13621	.;S12A1_HUMAN	L	21	ENSP00000370381:F21L;ENSP00000379822:F21L;ENSP00000331550:F21L	ENSP00000331550:F21L	F	+	1	0	SLC12A1	46287269	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.894000	0.69806	2.030000	0.59900	0.460000	0.39030	TTT	SLC12A1	-	NULL	ENSG00000074803		0.403	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC12A1	HGNC	protein_coding	OTTHUMT00000417131.1	-	0.00	21	0	T			48499977	+1	tier1	-	no_errors	ENST00000380993	ensembl	human	known	74_37	missense	34.48	19	10	SNP	1.000	C
SLC12A6	9990	genome.wustl.edu	37	15	34544397	34544397	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:34544397G>T	ENST00000354181.3	-	10	1799	c.1307C>A	c.(1306-1308)cCt>cAt	p.P436H	SLC12A6_ENST00000558667.1_Missense_Mutation_p.P436H|SLC12A6_ENST00000397702.2_Missense_Mutation_p.P377H|SLC12A6_ENST00000558589.1_Missense_Mutation_p.P427H|SLC12A6_ENST00000458406.2_Missense_Mutation_p.P377H|SLC12A6_ENST00000560611.1_Missense_Mutation_p.P436H|SLC12A6_ENST00000290209.5_Missense_Mutation_p.P385H|SLC12A6_ENST00000397707.2_Missense_Mutation_p.P421H|SLC12A6_ENST00000451844.2_Missense_Mutation_p.P248H|SLC12A6_ENST00000560164.1_Missense_Mutation_p.P248H			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	436					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)			central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	AGCCAATCCAGGAATGCCCTG	0.388																																																	0													76.0	68.0	71.0					15																	34544397		2201	4298	6499	SO:0001583	missense	0			AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.1307C>A	15.37:g.34544397G>T	ENSP00000346112:p.Pro436His		A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pfam_K/Cl_cotranspt_1/3,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.P427H	ENST00000354181.3	37	c.1280	CCDS58352.1	15	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686617	0.88639	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	D;D;D;D;D	0.88509	-2.39;-2.39;-2.39;-2.39;-2.39	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.95111	0.8416	M	0.86028	2.79	0.80722	D	1	D;D;D;D	0.89917	0.987;1.0;0.982;1.0	P;D;P;D	0.83275	0.797;0.996;0.693;0.986	D	0.95326	0.8425	10	0.87932	D	0	.	18.2333	0.89941	0.0:0.0:1.0:0.0	.	421;436;385;248	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	H	385;421;427;377;377;248	ENSP00000290209:P385H;ENSP00000380819:P421H;ENSP00000380814:P377H;ENSP00000387725:P377H;ENSP00000390199:P248H	ENSP00000290209:P385H	P	-	2	0	SLC12A6	32331689	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.625000	0.98406	2.835000	0.97688	0.650000	0.86243	CCT	SLC12A6	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000140199		0.388	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SLC12A6	HGNC	protein_coding	OTTHUMT00000417991.1	-	0.00	17	0	G	NM_005135		34544397	-1	tier1	-	no_errors	ENST00000558589	ensembl	human	known	74_37	missense	23.08	10	3	SNP	1.000	T
SLC12A1	6557	genome.wustl.edu	37	15	48527094	48527094	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:48527094T>G	ENST00000558405.1	+	8	1122	c.1108T>G	c.(1108-1110)Ttt>Gtt	p.F370V	SLC12A1_ENST00000559723.1_3'UTR|SLC12A1_ENST00000396577.3_Missense_Mutation_p.F370V|SLC12A1_ENST00000380993.3_Missense_Mutation_p.F370V|SLC12A1_ENST00000330289.6_Missense_Mutation_p.F370V			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	370					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	TGCAGAAAACTTTGGGCCACG	0.403																																																	0													83.0	86.0	85.0					15																	48527094		2198	4297	6495	SO:0001583	missense	0				CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.1108T>G	15.37:g.48527094T>G	ENSP00000453409:p.Phe370Val		A8JYA2|E9PDW4	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt2,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.F370V	ENST00000558405.1	37	c.1108	CCDS10129.2	15	.	.	.	.	.	.	.	.	.	.	T	24.3	4.511784	0.85389	.	.	ENSG00000074803	ENST00000428362;ENST00000380993;ENST00000396577;ENST00000330289	D;D;D	0.98987	-5.3;-5.3;-5.3	5.06	5.06	0.68205	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.98855	0.9613	M	0.66506	2.035	0.80722	D	1	P;D;D	0.55605	0.774;0.972;0.972	P;P;P	0.58721	0.688;0.844;0.808	D	0.99640	1.0988	10	0.72032	D	0.01	.	15.1141	0.72388	0.0:0.0:0.0:1.0	.	370;370;370	Q8IUN5;E9PDW4;Q13621	.;.;S12A1_HUMAN	V	183;370;370;370	ENSP00000370381:F370V;ENSP00000379822:F370V;ENSP00000331550:F370V	ENSP00000331550:F370V	F	+	1	0	SLC12A1	46314386	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.981000	0.63819	2.032000	0.59987	0.383000	0.25322	TTT	SLC12A1	-	pfam_AA-permease/SLC12A_dom,tigrfam_Na/K/Cl_cotransptS	ENSG00000074803		0.403	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC12A1	HGNC	protein_coding	OTTHUMT00000417131.1	-	0.00	42	0	T			48527094	+1	tier1	-	no_errors	ENST00000380993	ensembl	human	known	74_37	missense	40.82	29	20	SNP	1.000	G
SLC22A24	283238	genome.wustl.edu	37	11	62850901	62850901	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:62850901G>A	ENST00000417740.1	-	7	1540	c.1099C>T	c.(1099-1101)Ctg>Ttg	p.L367L		NM_001136506.2	NP_001129978.2	Q8N4F4	S22AO_HUMAN	solute carrier family 22, member 24	0					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				kidney(1)|stomach(1)	2						TTGAGTATCAGGCCATAAAAG	0.403																																																	0													106.0	93.0	97.0					11																	62850901		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS73308.1	11q12.3	2013-05-22			ENSG00000197658	ENSG00000197658		"""Solute carriers"""	28542	protein-coding gene	gene with protein product		611698				17714910	Standard	NM_001136506		Approved	MGC34821, NET46	uc021qkp.1	Q8N4F4	OTTHUMG00000165372	ENST00000417740.1:c.1099C>T	11.37:g.62850901G>A				Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L367	ENST00000417740.1	37	c.1099		11																																																																																			SLC22A24	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000197658		0.403	SLC22A24-003	PUTATIVE	non_canonical_polymorphism|basic|appris_principal|exp_conf	protein_coding	SLC22A24	HGNC	protein_coding	OTTHUMT00000383747.1	-	0.00	17	0	G	NM_173586		62850901	-1	tier1	-	no_errors	ENST00000417740	ensembl	human	putative	74_37	silent	30.77	9	4	SNP	0.793	A
SLC25A13	10165	genome.wustl.edu	37	7	95906517	95906517	+	Missense_Mutation	SNP	G	G	T	rs148573021		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:95906517G>T	ENST00000265631.5	-	3	339	c.203C>A	c.(202-204)aCc>aAc	p.T68N	SLC25A13_ENST00000416240.2_Missense_Mutation_p.T68N|SLC25A13_ENST00000542654.1_5'UTR			Q9UJS0	CMC2_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 13	68	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				aspartate transport (GO:0015810)|ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular respiration (GO:0045333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)|transporter activity (GO:0005215)			breast(4)|central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(8)|liver(2)|lung(14)|prostate(1)|skin(4)	42	all_cancers(62;7.75e-08)|all_epithelial(64;1.16e-07)		STAD - Stomach adenocarcinoma(171;0.194)		L-Aspartic Acid(DB00128)	CCCATCTTTGGTCTGATCCAC	0.348																																																	0													40.0	37.0	38.0					7																	95906517		2201	4297	6498	SO:0001583	missense	0			AF118838	CCDS5645.1, CCDS55130.1	7q21.3	2013-05-22	2012-03-29		ENSG00000004864	ENSG00000004864		"""Solute carriers"", ""EF-hand domain containing"""	10983	protein-coding gene	gene with protein product	"""mitochondrial aspartate glutamate carrier 2"""	603859	"""solute carrier family 25, member 13 (citrin)"""	CTLN2		10369257	Standard	NM_014251		Approved	CITRIN, ARALAR2	uc003uog.4	Q9UJS0	OTTHUMG00000023074	ENST00000265631.5:c.203C>A	7.37:g.95906517G>T	ENSP00000265631:p.Thr68Asn		O14566|O14575|Q546F9|Q9NZW1|Q9UNI7	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_EF_hand_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.T68N	ENST00000265631.5	37	c.203	CCDS5645.1	7	.	.	.	.	.	.	.	.	.	.	G	16.15	3.043103	0.55003	.	.	ENSG00000004864	ENST00000265631;ENST00000416240	T;T	0.62364	0.03;0.03	5.34	5.34	0.76211	EF-hand-like domain (1);	0.058194	0.64402	D	0.000003	T	0.65585	0.2705	M	0.79475	2.455	0.80722	D	1	B;B	0.27316	0.175;0.175	B;B	0.24394	0.053;0.053	T	0.63941	-0.6523	10	0.36615	T	0.2	-16.1451	19.0346	0.92971	0.0:0.0:1.0:0.0	.	68;68	Q546F9;Q9UJS0	.;CMC2_HUMAN	N	68	ENSP00000265631:T68N;ENSP00000400101:T68N	ENSP00000265631:T68N	T	-	2	0	SLC25A13	95744453	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.228000	0.72288	2.671000	0.90904	0.563000	0.77884	ACC	SLC25A13	-	NULL	ENSG00000004864		0.348	SLC25A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A13	HGNC	protein_coding	OTTHUMT00000059395.2		0.00	35	0	G	NM_014251		95906517	-1			no_errors	ENST00000416240	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
SLC25A22	79751	genome.wustl.edu	37	11	792616	792616	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:792616C>T	ENST00000320230.5	-	7	1005	c.524G>A	c.(523-525)cGc>cAc	p.R175H	CEND1_ENST00000330106.4_5'Flank|CEND1_ENST00000524587.1_5'Flank|SLC25A22_ENST00000531214.1_Missense_Mutation_p.R175H	NM_001191061.1|NM_024698.5	NP_001177990.1|NP_078974.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22	175					L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CAGCAGGTCGCGGGTCAGCTG	0.721																																					Colon(93;848 1468 3270 23355 49636)												0													9.0	11.0	11.0					11																	792616		2183	4274	6457	SO:0001583	missense	0			AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310	ENST00000320230.5:c.524G>A	11.37:g.792616C>T	ENSP00000322020:p.Arg175His		A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,prints_Mit_carrier,pfscan_Mitochondrial_sb/sol_carrier	p.R175H	ENST00000320230.5	37	c.524	CCDS7715.1	11	.	.	.	.	.	.	.	.	.	.	c	15.54	2.864911	0.51482	.	.	ENSG00000177542	ENST00000320230;ENST00000531214;ENST00000481290;ENST00000531437	T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36	3.51	3.51	0.40186	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.86049	0.5840	M	0.73753	2.245	0.80722	D	1	P	0.47841	0.901	P	0.55055	0.767	D	0.86396	0.1739	10	0.38643	T	0.18	-30.6309	15.5948	0.76569	0.0:1.0:0.0:0.0	.	175	Q9H936	GHC1_HUMAN	H	175;175;200;171	ENSP00000322020:R175H;ENSP00000437236:R175H;ENSP00000431829:R200H;ENSP00000435862:R171H	ENSP00000322020:R175H	R	-	2	0	SLC25A22	782616	0.806000	0.28996	0.987000	0.45799	0.021000	0.10359	1.919000	0.40015	1.954000	0.56735	0.506000	0.49869	CGC	SLC25A22	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000177542		0.721	SLC25A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A22	HGNC	protein_coding	OTTHUMT00000257107.2		0.00	12	0	C			792616	-1			no_errors	ENST00000320230	ensembl	human	known	74_37	missense	33.33	10	5	SNP	1.000	T
SLC25A36	55186	genome.wustl.edu	37	3	140660731	140660731	+	5'UTR	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:140660731C>T	ENST00000324194.6	+	0	3				SLC25A36_ENST00000507429.1_5'UTR|SLC25A36_ENST00000453248.2_5'Flank|SLC25A36_ENST00000446041.2_5'UTR|SLC25A36_ENST00000393015.4_3'UTR			Q96CQ1	S2536_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier ), member 36						response to estradiol (GO:0032355)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						GCTGGAGTGCCGCGGGGAGGG	0.726																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK001480	CCDS3114.1, CCDS46927.1	3q23	2013-05-22	2012-03-29		ENSG00000114120	ENSG00000114120		"""Solute carriers"""	25554	protein-coding gene	gene with protein product			"""solute carrier family 25, member 36"""				Standard	NM_001104647		Approved	FLJ10618, PNC2	uc003etr.2	Q96CQ1	OTTHUMG00000160260	ENST00000324194.6:c.-166C>T	3.37:g.140660731C>T			A8MYF7|Q05CY1|Q9H0G8|Q9NVN5	RNA	SNP	-	NULL	ENST00000324194.6	37	NULL	CCDS46927.1	3																																																																																			SLC25A36	-	-	ENSG00000114120		0.726	SLC25A36-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A36	HGNC	protein_coding	OTTHUMT00000359929.1	-	0.00	15	0	C	NM_018155		140660731	+1	tier1	-	no_errors	ENST00000393015	ensembl	human	known	74_37	rna	64.29	5	9	SNP	0.000	T
SLC25A51	92014	genome.wustl.edu	37	9	37888069	37888069	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:37888069G>T	ENST00000377716.2	-	3	1222	c.479C>A	c.(478-480)gCt>gAt	p.A160D	SLC25A51_ENST00000380590.3_Missense_Mutation_p.A160D|SLC25A51_ENST00000242275.6_Missense_Mutation_p.A160D|SLC25A51_ENST00000496760.1_Intron|RP11-613M10.9_ENST00000540557.1_Intron			Q9H1U9	S2551_HUMAN	solute carrier family 25, member 51	160					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											TGCCTTGAAAGCCTGGTAAGT	0.438																																																	0													164.0	151.0	155.0					9																	37888069		2203	4300	6503	SO:0001583	missense	0			BC008500	CCDS6614.1	9p13.3-p12	2013-05-22	2012-03-29	2012-03-29	ENSG00000122696	ENSG00000122696		"""Solute carriers"""	23323	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 1"""	MCART1		12477932	Standard	NM_033412		Approved	MGC14836, CG7943	uc004aav.2	Q9H1U9	OTTHUMG00000019935	ENST00000377716.2:c.479C>A	9.37:g.37888069G>T	ENSP00000366945:p.Ala160Asp			Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.A160D	ENST00000377716.2	37	c.479	CCDS6614.1	9	.	.	.	.	.	.	.	.	.	.	.	18.42	3.619419	0.66787	.	.	ENSG00000122696	ENST00000380590;ENST00000377716;ENST00000242275	T;T;T	0.81415	-1.49;-1.49;-1.49	4.49	4.49	0.54785	Mitochondrial carrier domain (2);	0.141857	0.47852	D	0.000201	D	0.90079	0.6901	M	0.85777	2.775	0.54753	D	0.999983	D	0.56287	0.975	D	0.72075	0.976	D	0.91823	0.5469	10	0.87932	D	0	.	15.0327	0.71720	0.0:0.0:1.0:0.0	.	160	Q9H1U9	MCAR1_HUMAN	D	160	ENSP00000369964:A160D;ENSP00000366945:A160D;ENSP00000242275:A160D	ENSP00000242275:A160D	A	-	2	0	MCART1	37878069	1.000000	0.71417	1.000000	0.80357	0.636000	0.38137	9.255000	0.95524	2.225000	0.72522	0.585000	0.79938	GCT	SLC25A51	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000122696		0.438	SLC25A51-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC25A51	HGNC	protein_coding	OTTHUMT00000313746.1	-	0.00	46	0	G	NM_033412		37888069	-1	tier1	-	no_errors	ENST00000242275	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
SLC30A5	64924	genome.wustl.edu	37	5	68423939	68423939	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:68423939G>T	ENST00000396591.3	+	15	2717	c.2107G>T	c.(2107-2109)Gaa>Taa	p.E703*	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	703					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TGATGTGCTAGAACAAAGAAT	0.348																																																	0													125.0	131.0	129.0					5																	68423939		2203	4300	6503	SO:0001587	stop_gained	0			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.2107G>T	5.37:g.68423939G>T	ENSP00000379836:p.Glu703*		B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Nonsense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.E703*	ENST00000396591.3	37	c.2107	CCDS3996.1	5	.	.	.	.	.	.	.	.	.	.	G	45	11.935581	0.99619	.	.	ENSG00000145740	ENST00000396591;ENST00000438236	.	.	.	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	18.4567	0.90722	0.0:0.0:1.0:0.0	.	.	.	.	X	703;298	.	ENSP00000379836:E703X	E	+	1	0	SLC30A5	68459695	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	9.411000	0.97342	2.689000	0.91719	0.491000	0.48974	GAA	SLC30A5	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000145740		0.348	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A5	HGNC	protein_coding	OTTHUMT00000254017.2	-	0.00	28	0	G			68423939	+1	tier1	-	no_errors	ENST00000396591	ensembl	human	known	74_37	nonsense	13.33	26	4	SNP	1.000	T
SLC43A1	8501	genome.wustl.edu	37	11	57268693	57268693	+	Missense_Mutation	SNP	G	G	T	rs139021670	byFrequency	TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:57268693G>T	ENST00000278426.3	-	3	619	c.264C>A	c.(262-264)agC>agA	p.S88R	SLC43A1_ENST00000528450.1_Missense_Mutation_p.S88R|SLC43A1_ENST00000533515.1_5'Flank	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1											breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						GGGTGGTGGCGCTGAGCACGA	0.652																																																	0													96.0	84.0	88.0					11																	57268693		2201	4296	6497	SO:0001583	missense	0			AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.264C>A	11.37:g.57268693G>T	ENSP00000278426:p.Ser88Arg			Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S88R	ENST00000278426.3	37	c.264	CCDS7958.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	20.4|20.4	3.983575|3.983575	0.74474|0.74474	.|.	.|.	ENSG00000149150|ENSG00000149150	ENST00000525764|ENST00000278426;ENST00000528450;ENST00000533066;ENST00000533263	.|T;T;T;T	.|0.69435	.|-0.4;-0.4;-0.4;-0.4	5.33|5.33	-9.83|-9.83	0.00482|0.00482	.|Major facilitator superfamily domain, general substrate transporter (1);	.|0.081063	.|0.85682	.|D	.|0.000000	T|T	0.73552|0.73552	0.3601|0.3601	M|M	0.78049|0.78049	2.395|2.395	0.37941|0.37941	D|D	0.932322|0.932322	.|D	.|0.64830	.|0.994	.|D	.|0.66716	.|0.946	D|D	0.86567|0.86567	0.1845|0.1845	5|10	.|0.25751	.|T	.|0.34	-21.2337|-21.2337	16.1792|16.1792	0.81889|0.81889	0.4316:0.0:0.5684:0.0|0.4316:0.0:0.5684:0.0	.|.	.|88	.|O75387	.|LAT3_HUMAN	S|R	34|88	.|ENSP00000278426:S88R;ENSP00000435673:S88R;ENSP00000435647:S88R;ENSP00000435486:S88R	.|ENSP00000278426:S88R	R|S	-|-	1|3	0|2	SLC43A1|SLC43A1	57025269|57025269	0.021000|0.021000	0.18746|0.18746	0.423000|0.423000	0.26634|0.26634	0.834000|0.834000	0.47266|0.47266	-1.013000|-1.013000	0.03645|0.03645	-2.396000|-2.396000	0.00582|0.00582	-1.170000|-1.170000	0.01741|0.01741	CGC|AGC	SLC43A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000149150		0.652	SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC43A1	HGNC	protein_coding	OTTHUMT00000392541.1		0.00	22	0	G	NM_003627		57268693	-1			no_errors	ENST00000278426	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.650	T
SLC4A1AP	22950	genome.wustl.edu	37	2	27886964	27886964	+	Silent	SNP	G	G	A	rs140696526		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:27886964G>A	ENST00000326019.6	+	1	627	c.345G>A	c.(343-345)gaG>gaA	p.E115E	SUPT7L_ENST00000405491.1_5'Flank|SUPT7L_ENST00000464789.2_5'Flank|SUPT7L_ENST00000404798.2_5'Flank|SUPT7L_ENST00000337768.5_5'Flank|SUPT7L_ENST00000406540.1_5'Flank	NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	115				SNSGE -> PIAKP (in Ref. 6; AAN12269). {ECO:0000305}.		cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					ATTCTGGGGAGCCCGACATCC	0.642																																																	0													47.0	52.0	50.0					2																	27886964		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.345G>A	2.37:g.27886964G>A			A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Silent	SNP	pfam_FHA_dom,pfam_dsRNA-bd_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.E115	ENST00000326019.6	37	c.345	CCDS33166.1	2																																																																																			SLC4A1AP	-	NULL	ENSG00000163798		0.642	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1AP	HGNC	protein_coding	OTTHUMT00000324550.1	-	0.00	41	0	G	NM_018158		27886964	+1	tier1	-	no_errors	ENST00000326019	ensembl	human	known	74_37	silent	57.14	18	24	SNP	0.013	A
SLC9A7	84679	genome.wustl.edu	37	X	46522028	46522028	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:46522028C>T	ENST00000328306.4	-	6	869	c.844G>A	c.(844-846)Gca>Aca	p.A282T		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	282					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						AAAAGAAGTGCGTAAAGATCC	0.438																																					Pancreas(118;454 1696 1930 13865 39976)												0													114.0	85.0	94.0					X																	46522028		2203	4300	6503	SO:0001583	missense	0			AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.844G>A	X.37:g.46522028C>T	ENSP00000330320:p.Ala282Thr		O75827|Q5JXP9	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.A282T	ENST00000328306.4	37	c.844	CCDS14269.1	X	.	.	.	.	.	.	.	.	.	.	C	22.9	4.353124	0.82132	.	.	ENSG00000065923	ENST00000328306	T	0.13089	2.62	5.09	5.09	0.68999	Cation/H+ exchanger (1);	0.100915	0.64402	D	0.000002	T	0.12646	0.0307	N	0.20986	0.625	0.80722	D	1	P;P	0.49307	0.891;0.922	P;P	0.45971	0.499;0.474	T	0.12372	-1.0550	10	0.10111	T	0.7	.	17.8859	0.88854	0.0:1.0:0.0:0.0	.	53;282	B3KPP8;Q96T83	.;SL9A7_HUMAN	T	282	ENSP00000330320:A282T	ENSP00000330320:A282T	A	-	1	0	SLC9A7	46406972	1.000000	0.71417	0.949000	0.38748	0.947000	0.59692	5.605000	0.67634	2.244000	0.73946	0.600000	0.82982	GCA	SLC9A7	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000065923		0.438	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A7	HGNC	protein_coding	OTTHUMT00000056370.1	-	0.00	16	0	C	NM_032591		46522028	-1	tier1	-	no_errors	ENST00000328306	ensembl	human	known	74_37	missense	71.43	4	10	SNP	1.000	T
SLC9A6	10479	genome.wustl.edu	37	X	135126796	135126796	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:135126796C>T	ENST00000370698.3	+	16	1958	c.1923C>T	c.(1921-1923)gtC>gtT	p.V641V	SLC9A6_ENST00000370701.1_Silent_p.V621V|SLC9A6_ENST00000370695.4_Silent_p.V673V	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	641					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					ATGAACTGGTCATTCGAGGAA	0.483																																																	0													112.0	96.0	101.0					X																	135126796		2203	4300	6503	SO:0001819	synonymous_variant	0			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1923C>T	X.37:g.135126796C>T			A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.V673	ENST00000370698.3	37	c.2019	CCDS14654.1	X																																																																																			SLC9A6	-	NULL	ENSG00000198689		0.483	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	SLC9A6	HGNC	protein_coding	OTTHUMT00000058450.1	-	0.00	48	0	C	NM_006359		135126796	+1	tier1	-	no_errors	ENST00000370695	ensembl	human	known	74_37	silent	35.48	40	22	SNP	1.000	T
SLCO2B1	11309	genome.wustl.edu	37	11	74880255	74880255	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:74880255G>T	ENST00000289575.5	+	5	881	c.486G>T	c.(484-486)ctG>ctT	p.L162L	SLCO2B1_ENST00000526660.1_Intron|SLCO2B1_ENST00000532236.1_Silent_p.L46L|SLCO2B1_ENST00000428359.2_Silent_p.L140L|SLCO2B1_ENST00000525650.1_Silent_p.L18L|SLCO2B1_ENST00000454962.2_Intron|SLCO2B1_ENST00000341411.4_Intron|SLCO2B1_ENST00000531756.1_Intron	NM_007256.4	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family, member 2B1	162					liver development (GO:0001889)|sodium-independent icosanoid transport (GO:0071718)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid transmembrane transporter activity (GO:0015125)|organic anion transmembrane transporter activity (GO:0008514)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|endometrium(1)|large_intestine(7)|lung(20)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	39					Acetic acid(DB03166)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Digoxin(DB00390)|Dinoprostone(DB00917)|Ergoloid mesylate(DB01049)|Estradiol(DB00783)|Estrone(DB00655)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Glyburide(DB01016)|Ibuprofen(DB01050)|Iloprost(DB01088)|Latanoprost(DB00654)|Montelukast(DB00471)|Niacin(DB00627)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rosuvastatin(DB01098)|Salicylic acid(DB00936)|Tolbutamide(DB01124)	CCCTGTGCCTGCCCACAACCT	0.522																																																	0													51.0	51.0	51.0					11																	74880255		2200	4293	6493	SO:0001819	synonymous_variant	0			AB026256	CCDS8235.1, CCDS44683.1, CCDS53679.1	11q13	2013-05-22	2003-11-25	2003-11-26				"""Solute carriers"""	10962	protein-coding gene	gene with protein product		604988	"""solute carrier family 21 (organic anion transporter), member 9"""	SLC21A9			Standard	NM_007256		Approved	OATP-B, OATP2B1	uc001owb.3	O94956		ENST00000289575.5:c.486G>T	11.37:g.74880255G>T			A8K2G9|B4DGA9|B4DTB0|E7ERN5|E9PPU8|Q9H2Z0|Q9UFU1	Silent	SNP	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.L162	ENST00000289575.5	37	c.486	CCDS8235.1	11																																																																																			SLCO2B1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000137491		0.522	SLCO2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLCO2B1	HGNC	protein_coding	OTTHUMT00000383933.1	-	0.00	27	0	G	NM_007256		74880255	+1	tier1	-	no_errors	ENST00000289575	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.136	T
SLCO4C1	353189	genome.wustl.edu	37	5	101583021	101583021	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:101583021G>T	ENST00000310954.6	-	10	2032	c.1746C>A	c.(1744-1746)tgC>tgA	p.C582*		NM_180991.4	NP_851322.3			solute carrier organic anion transporter family, member 4C1											breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	50		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TAAAGAAAATGCAAAGGAATA	0.353																																																	0													110.0	120.0	116.0					5																	101583021		2203	4300	6503	SO:0001587	stop_gained	0			AY273896	CCDS34205.1	5q21	2013-05-22	2003-11-25		ENSG00000173930	ENSG00000173930		"""Solute carriers"""	23612	protein-coding gene	gene with protein product		609013					Standard	NM_180991		Approved	SLC21A20, OATP4C1, OATPX, OATP-H	uc003knm.3	Q6ZQN7	OTTHUMG00000162757	ENST00000310954.6:c.1746C>A	5.37:g.101583021G>T	ENSP00000309741:p.Cys582*			Nonsense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.C582*	ENST00000310954.6	37	c.1746	CCDS34205.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.511471	0.96402	.	.	ENSG00000173930	ENST00000310954	.	.	.	6.17	-0.269	0.12930	.	0.244668	0.35151	N	0.003414	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	0.9751	0.01424	0.1998:0.228:0.3377:0.2345	.	.	.	.	X	582	.	ENSP00000309741:C582X	C	-	3	2	SLCO4C1	101610920	0.007000	0.16637	0.192000	0.23308	0.138000	0.21146	0.484000	0.22308	-0.348000	0.08286	0.655000	0.94253	TGC	SLCO4C1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000173930		0.353	SLCO4C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO4C1	HGNC	protein_coding	OTTHUMT00000370332.1	-	0.00	35	0	G	NM_180991		101583021	-1	tier1	-	no_errors	ENST00000310954	ensembl	human	known	74_37	nonsense	12.12	29	4	SNP	0.332	T
SMCO4	56935	genome.wustl.edu	37	11	93212196	93212196	+	Missense_Mutation	SNP	G	G	A	rs202058974		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:93212196G>A	ENST00000298966.2	-	3	545	c.160C>T	c.(160-162)Cgc>Tgc	p.R54C	SMCO4_ENST00000525141.1_Missense_Mutation_p.R54C|SMCO4_ENST00000527149.1_Missense_Mutation_p.R54C	NM_020179.2	NP_064564.1	Q9NRQ5	SMCO4_HUMAN	single-pass membrane protein with coiled-coil domains 4	54						integral component of membrane (GO:0016021)											ATGGTGGGGCGCGTGGCCACG	0.642													G|||	1	0.000199681	0.0008	0.0	5008	,	,		14007	0.0		0.0	False		,,,				2504	0.0																0								G	CYS/ARG	2,4400	4.2+/-10.8	0,2,2199	57.0	48.0	51.0		160	6.0	1.0	11		51	1,8595	1.2+/-3.3	0,1,4297	no	missense	C11orf75	NM_020179.2	180	0,3,6496	AA,AG,GG		0.0116,0.0454,0.0231	probably-damaging	54/60	93212196	3,12995	2201	4298	6499	SO:0001583	missense	0			BC031564	CCDS8292.1	11q21	2013-03-11	2013-03-11	2013-03-11	ENSG00000166002	ENSG00000166002			24810	protein-coding gene	gene with protein product		609477	"""chromosome 11 open reading frame 75"""	C11orf75		10863097	Standard	NM_020179		Approved	FN5	uc001pds.4	Q9NRQ5	OTTHUMG00000167442	ENST00000298966.2:c.160C>T	11.37:g.93212196G>A	ENSP00000298966:p.Arg54Cys			Missense_Mutation	SNP	NULL	p.R54C	ENST00000298966.2	37	c.160	CCDS8292.1	11	.	.	.	.	.	.	.	.	.	.	G	14.81	2.645817	0.47258	4.54E-4	1.16E-4	ENSG00000166002	ENST00000525141;ENST00000298966;ENST00000527149	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.60958	0.2309	.	.	.	0.80722	D	1	D	0.71674	0.998	B	0.43838	0.433	T	0.66264	-0.5967	8	0.87932	D	0	-13.645	20.428	0.99075	0.0:0.0:1.0:0.0	.	54	Q9NRQ5	CK075_HUMAN	C	54	.	ENSP00000298966:R54C	R	-	1	0	C11orf75	92851844	1.000000	0.71417	0.980000	0.43619	0.869000	0.49853	4.601000	0.61090	2.837000	0.97791	0.655000	0.94253	CGC	SMCO4	-	NULL	ENSG00000166002		0.642	SMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCO4	HGNC	protein_coding	OTTHUMT00000394630.1	-	0.00	29	0	G	NM_020179		93212196	-1	tier1	rs202058974	no_errors	ENST00000298966	ensembl	human	known	74_37	missense	57.14	18	24	SNP	0.994	A
SNAP91	9892	genome.wustl.edu	37	6	84315485	84315485	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:84315485G>T	ENST00000439399.2	-	14	1376	c.1060C>A	c.(1060-1062)Cca>Aca	p.P354T	SNAP91_ENST00000195649.6_Missense_Mutation_p.P354T|SNAP91_ENST00000520213.1_Missense_Mutation_p.P338T|SNAP91_ENST00000520302.1_Missense_Mutation_p.P352T|SNAP91_ENST00000521485.1_Missense_Mutation_p.P354T|SNAP91_ENST00000437520.1_Missense_Mutation_p.P338T|SNAP91_ENST00000428679.2_Missense_Mutation_p.P354T|SNAP91_ENST00000369694.2_Missense_Mutation_p.P354T|SNAP91_ENST00000521743.1_Missense_Mutation_p.P354T	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	354					clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GAAAAGTCTGGCTGGAGGTCC	0.463																																																	0													20.0	24.0	23.0					6																	84315485		2012	4143	6155	SO:0001583	missense	0			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.1060C>A	6.37:g.84315485G>T	ENSP00000400459:p.Pro354Thr		A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	pfam_ANTH_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.P354T	ENST00000439399.2	37	c.1060	CCDS47455.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.25|11.25	1.582661|1.582661	0.28180|0.28180	.|.	.|.	ENSG00000065609|ENSG00000065609	ENST00000369691|ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000521931;ENST00000447888	.|T;T;T;T;T;T;T;T;T;T	.|0.58652	.|2.26;2.28;2.28;2.26;2.28;0.32;2.32;2.28;0.32;0.32	5.72|5.72	4.85|4.85	0.62838|0.62838	.|.	.|0.156329	.|0.64402	.|D	.|0.000015	T|T	0.65196|0.65196	0.2668|0.2668	L|L	0.60455|0.60455	1.87|1.87	0.43803|0.43803	D|D	0.996352|0.996352	.|D;D;D;D	.|0.76494	.|0.999;0.998;0.998;0.998	.|D;D;D;D	.|0.78314	.|0.991;0.981;0.981;0.981	T|T	0.69544|0.69544	-0.5117|-0.5117	5|10	.|0.56958	.|D	.|0.05	-10.3685|-10.3685	15.0746|15.0746	0.72066|0.72066	0.0681:0.0:0.9319:0.0|0.0681:0.0:0.9319:0.0	.|.	.|338;352;354;352	.|O60641-3;E5RI02;O60641;E1P549	.|.;.;AP180_HUMAN;.	D|T	13|354;354;354;354;354;338;352;354;338;352;80	.|ENSP00000429776:P354T;ENSP00000358708:P354T;ENSP00000400459:P354T;ENSP00000195649:P354T;ENSP00000412492:P354T;ENSP00000413277:P338T;ENSP00000428511:P352T;ENSP00000428215:P354T;ENSP00000428026:P338T;ENSP00000430071:P352T	.|ENSP00000195649:P354T	A|P	-|-	2|1	0|0	SNAP91|SNAP91	84372204|84372204	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.039000|0.039000	0.13416|0.13416	6.698000|6.698000	0.74608|0.74608	1.559000|1.559000	0.49555|0.49555	-0.145000|-0.145000	0.13849|0.13849	GCC|CCA	SNAP91	-	NULL	ENSG00000065609		0.463	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SNAP91	HGNC	protein_coding	OTTHUMT00000375296.1	-	0.00	56	0	G			84315485	-1	tier1	-	no_errors	ENST00000369694	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
SNTG1	54212	genome.wustl.edu	37	8	51617305	51617305	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:51617305G>A	ENST00000522124.1	+	16	1845	c.1184G>A	c.(1183-1185)cGg>cAg	p.R395Q	SNTG1_ENST00000518864.1_Missense_Mutation_p.R395Q|SNTG1_ENST00000276467.5_Missense_Mutation_p.R395Q|SNTG1_ENST00000517473.1_Missense_Mutation_p.R395Q	NM_018967.2	NP_061840.1	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	395					cell communication (GO:0007154)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)|syntrophin complex (GO:0016013)	protein C-terminus binding (GO:0008022)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(36)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	66		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				GAAGTAGAACGGATACAGGTG	0.493																																																	0													81.0	67.0	72.0					8																	51617305		2203	4300	6503	SO:0001583	missense	0			AJ003030	CCDS6147.1, CCDS75737.1	8q11-q12	2008-07-03				ENSG00000147481			13740	protein-coding gene	gene with protein product		608714				10747910	Standard	NM_018967		Approved	SYN4, G1SYN	uc003xqs.1	Q9NSN8		ENST00000522124.1:c.1184G>A	8.37:g.51617305G>A	ENSP00000429842:p.Arg395Gln		Q2M3Q0|Q9NY98	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology	p.R395Q	ENST00000522124.1	37	c.1184	CCDS6147.1	8	.	.	.	.	.	.	.	.	.	.	G	26.6	4.756508	0.89843	.	.	ENSG00000147481	ENST00000518864;ENST00000522124;ENST00000517473;ENST00000276467	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.19	5.19	0.71726	.	0.048531	0.85682	D	0.000000	D	0.84871	0.5568	L	0.50333	1.59	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.945	T	0.82271	-0.0540	10	0.30078	T	0.28	.	18.0775	0.89432	0.0:0.0:1.0:0.0	.	395;395	Q9NSN8-2;Q9NSN8	.;SNTG1_HUMAN	Q	395	ENSP00000429276:R395Q;ENSP00000429842:R395Q;ENSP00000431123:R395Q;ENSP00000276467:R395Q	ENSP00000276467:R395Q	R	+	2	0	SNTG1	51779858	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.141000	0.94612	2.577000	0.86979	0.643000	0.83706	CGG	SNTG1	-	NULL	ENSG00000147481		0.493	SNTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG1	HGNC	protein_coding	OTTHUMT00000377964.1	-	0.00	23	0	G			51617305	+1	tier1	-	no_errors	ENST00000518864	ensembl	human	known	74_37	missense	27.78	13	5	SNP	1.000	A
SPAG6	9576	genome.wustl.edu	37	10	22690117	22690118	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:22690117_22690118insA	ENST00000376624.3	+	9	1367_1368	c.1225_1226insA	c.(1225-1227)caafs	p.Q409fs	SPAG6_ENST00000313311.6_Frame_Shift_Ins_p.Q409fs|SPAG6_ENST00000376601.1_Frame_Shift_Ins_p.Q170fs|SPAG6_ENST00000538630.1_Frame_Shift_Ins_p.Q384fs|SPAG6_ENST00000490361.1_3'UTR|SPAG6_ENST00000376603.2_Frame_Shift_Ins_p.Q485fs|RP11-301N24.3_ENST00000422675.1_RNA	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	409					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.Q409R(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						GAATATCCTGCAAAAATGTACC	0.347																																																	1	Substitution - Missense(1)	prostate(1)																																								SO:0001589	frameshift_variant	0			AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.1230dupA	10.37:g.22690122_22690122dupA	ENSP00000365811:p.Gln409fs		A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Frame_Shift_Ins	INS	pfam_Armadillo,pfam_HEAT,pfam_26S_Psome_nonATP_su5,superfamily_ARM-type_fold,smart_Armadillo	p.C487fs	ENST00000376624.3	37	c.1453_1454	CCDS7139.1	10																																																																																			SPAG6	-	superfamily_ARM-type_fold	ENSG00000077327		0.347	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG6	HGNC	protein_coding	OTTHUMT00000047187.1		0.00	29	0	-			22690118	+1	tier1		no_errors	ENST00000376603	ensembl	human	known	74_37	frame_shift_ins	37.84	23	14	INS	1.000:1.000	A
SPATA22	84690	genome.wustl.edu	37	17	3346496	3346496	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:3346496T>C	ENST00000573128.1	-	8	1355	c.872A>G	c.(871-873)aAt>aGt	p.N291S	SPATA22_ENST00000397168.3_Missense_Mutation_p.N291S|SPATA22_ENST00000268981.5_Intron|SPATA22_ENST00000575375.1_Missense_Mutation_p.N291S|SPATA22_ENST00000541913.1_Missense_Mutation_p.N275S|SPATA22_ENST00000355380.4_Missense_Mutation_p.N248S|SPATA22_ENST00000572969.1_Missense_Mutation_p.N291S			Q8NHS9	SPT22_HUMAN	spermatogenesis associated 22	291					fertilization (GO:0009566)|gamete generation (GO:0007276)|meiotic DNA repair synthesis (GO:0000711)|regulation of meiotic cell cycle (GO:0051445)|reproductive system development (GO:0061458)|synapsis (GO:0007129)	chromosome (GO:0005694)				breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|skin(2)	19						AGGCAGAGTATTTTTCCCATC	0.358																																																	0													64.0	59.0	61.0					17																	3346496		2202	4298	6500	SO:0001583	missense	0			AY035868	CCDS11027.1, CCDS54066.1, CCDS54067.1	17p13.3	2005-12-19							30705	protein-coding gene	gene with protein product						12477932	Standard	NM_001170696		Approved	NYD-SP20	uc002fvn.3	Q8NHS9		ENST00000573128.1:c.872A>G	17.37:g.3346496T>C	ENSP00000459580:p.Asn291Ser		B4DXB1|D3DTI9|J3KN63|Q969H3|Q96JT4	Missense_Mutation	SNP	NULL	p.N291S	ENST00000573128.1	37	c.872	CCDS11027.1	17	.	.	.	.	.	.	.	.	.	.	T	9.727	1.161267	0.21538	.	.	ENSG00000141255	ENST00000355380;ENST00000397168;ENST00000541913	T;T;T	0.81247	-1.47;-1.47;-1.47	5.32	1.89	0.25635	.	0.497403	0.19780	N	0.106259	T	0.61464	0.2349	N	0.12182	0.205	0.24531	N	0.994115	B;B;B	0.23377	0.077;0.077;0.084	B;B;B	0.19391	0.025;0.025;0.015	T	0.48490	-0.9031	10	0.31617	T	0.26	-6.9924	8.6232	0.33872	0.0:0.2231:0.0:0.7769	.	275;248;291	F5GWB9;Q8NHS9-2;Q8NHS9	.;.;SPT22_HUMAN	S	248;291;275	ENSP00000347541:N248S;ENSP00000380354:N291S;ENSP00000441920:N275S	ENSP00000347541:N248S	N	-	2	0	SPATA22	3293246	1.000000	0.71417	0.989000	0.46669	0.903000	0.53119	2.165000	0.42396	0.103000	0.17682	-0.379000	0.06801	AAT	SPATA22	-	NULL	ENSG00000141255		0.358	SPATA22-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPATA22	HGNC	protein_coding	OTTHUMT00000438067.2	-	0.00	35	0	T	NM_032598		3346496	-1	tier1	-	no_errors	ENST00000397168	ensembl	human	known	74_37	missense	27.27	24	9	SNP	0.989	C
SPATA31E1	286234	genome.wustl.edu	37	9	90503319	90503319	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:90503319G>T	ENST00000325643.5	+	4	3983	c.3917G>T	c.(3916-3918)aGg>aTg	p.R1306M		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	1306					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)		p.R1306M(1)									GGCCCACCAAGGCAGTTTATG	0.587																																																	1	Substitution - Missense(1)	lung(1)											61.0	58.0	59.0					9																	90503319		2203	4300	6503	SO:0001583	missense	0			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.3917G>T	9.37:g.90503319G>T	ENSP00000322640:p.Arg1306Met		B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	NULL	p.R1306M	ENST00000325643.5	37	c.3917	CCDS6676.1	9	.	.	.	.	.	.	.	.	.	.	g	10.58	1.390916	0.25118	.	.	ENSG00000177992	ENST00000325643	T	0.05513	3.43	2.47	-4.94	0.03057	.	2.061170	0.02357	N	0.076538	T	0.16938	0.0407	L	0.49126	1.545	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.39461	-0.9613	10	0.66056	D	0.02	.	6.9003	0.24279	0.6734:0.147:0.1795:0.0	.	1306	Q6ZUB1	CI079_HUMAN	M	1306	ENSP00000322640:R1306M	ENSP00000322640:R1306M	R	+	2	0	C9orf79	89693139	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.264000	0.08658	-1.944000	0.01038	-0.136000	0.14681	AGG	SPATA31E1	-	NULL	ENSG00000177992		0.587	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31E1	HGNC	protein_coding	OTTHUMT00000052954.2	-	0.00	14	0	G	NM_178828		90503319	+1	tier1	-	no_errors	ENST00000325643	ensembl	human	known	74_37	missense	66.67	4	8	SNP	0.000	T
SPIN2A	54466	genome.wustl.edu	37	X	57162331	57162331	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:57162331T>C	ENST00000374908.1	-	1	1099	c.700A>G	c.(700-702)Acc>Gcc	p.T234A	SPIN2A_ENST00000374906.3_Missense_Mutation_p.T234A			Q99865	SPI2A_HUMAN	spindlin family, member 2A	234					cell cycle (GO:0007049)|gamete generation (GO:0007276)|regulation of cell cycle (GO:0051726)	nucleus (GO:0005634)				breast(1)|kidney(1)|ovary(1)	3						GAGGGTTTGGTTTCCACTTGG	0.413													T|||	1	0.000264901	0.0	0.0	3775	,	,		15795	0.0		0.0	False		,,,				2504	0.001																0													164.0	136.0	145.0					X																	57162331		2201	4291	6492	SO:0001583	missense	0			Y09858	CCDS35312.1	Xp11.1	2008-02-05	2006-12-05	2006-12-05	ENSG00000147059	ENSG00000147059			20694	protein-coding gene	gene with protein product		300621	"""spindlin family, member 2"""	SPIN2		9271673	Standard	NM_019003		Approved	DXF34	uc004dvb.3	Q99865	OTTHUMG00000022705	ENST00000374908.1:c.700A>G	X.37:g.57162331T>C	ENSP00000364043:p.Thr234Ala		O75650|Q6IPW2|Q9UJJ0	Missense_Mutation	SNP	pfam_Spin_Ssty	p.T234A	ENST00000374908.1	37	c.700	CCDS35312.1	X	.	.	.	.	.	.	.	.	.	.	.	0.023	-1.403561	0.01165	.	.	ENSG00000147059	ENST00000374908;ENST00000374906	T;T	0.38722	1.12;1.12	2.69	1.83	0.25207	.	0.071062	0.53938	N	0.000046	T	0.08492	0.0211	N	0.00237	-1.79	0.21553	N	0.999647	B	0.02656	0.0	B	0.01281	0.0	T	0.40421	-0.9564	10	0.02654	T	1	-1.9066	7.3232	0.26540	0.0:0.8536:0.0:0.1464	.	234	Q99865	SPI2A_HUMAN	A	234	ENSP00000364043:T234A;ENSP00000364041:T234A	ENSP00000364041:T234A	T	-	1	0	SPIN2A	57179056	1.000000	0.71417	1.000000	0.80357	0.800000	0.45204	4.578000	0.60929	0.552000	0.29026	-0.452000	0.05504	ACC	SPIN2A	-	pfam_Spin_Ssty	ENSG00000147059		0.413	SPIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN2A	HGNC	protein_coding	OTTHUMT00000058915.1		0.00	47	0	T	NM_019003		57162331	-1			no_errors	ENST00000374906	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	C
SPON1	10418	genome.wustl.edu	37	11	14287100	14287100	+	RNA	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:14287100C>T	ENST00000534587.1	-	0	38				SPON1_ENST00000310358.7_RNA																							ACGGCCTGGTCAGAATGCACC	0.498																																																	0													62.0	62.0	62.0					11																	14287100		1981	4158	6139			0																															11.37:g.14287100C>T				RNA	SNP	-	NULL	ENST00000534587.1	37	NULL		11	.	.	.	.	.	.	.	.	.	.	C	42	9.206269	0.99099	.	.	ENSG00000152268	ENST00000310358	.	.	.	5.7	5.7	0.88788	.	0.057003	0.64402	D	0.000003	T	0.59293	0.2183	.	.	.	0.39503	D	0.968221	B	0.28128	0.201	B	0.28385	0.089	T	0.65998	-0.6032	7	0.87932	D	0	.	17.3401	0.87293	0.0:1.0:0.0:0.0	.	764	Q9HCB6	SPON1_HUMAN	L	763	.	ENSP00000309297:S763L	S	+	2	0	SPON1	14243676	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.688000	0.91661	0.655000	0.94253	TCA	SPON1	-	-	ENSG00000152268		0.498	RP11-21L19.1-001	KNOWN	basic	antisense	SPON1	HGNC	antisense	OTTHUMT00000386031.1	-	0.00	50	0	C			14287100	+1	tier1	-	no_errors	ENST00000310358	ensembl	human	known	74_37	rna	42.31	30	22	SNP	1.000	T
SPRED1	161742	genome.wustl.edu	37	15	38643496	38643496	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:38643496G>T	ENST00000299084.4	+	7	1826	c.966G>T	c.(964-966)aaG>aaT	p.K322N		NM_152594.2	NP_689807.1	Q7Z699	SPRE1_HUMAN	sprouty-related, EVH1 domain containing 1	322					inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)|protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			kidney(6)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(109;4.88e-13)|all_epithelial(112;1.83e-11)|Lung NSC(122;2.21e-09)|all_lung(180;4.64e-08)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(113;2.41e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		AAATTAAGAAGTCAAAACGAA	0.403									Legius syndrome																												Melanoma(196;2146 2959 7698 16532)												0													70.0	69.0	69.0					15																	38643496		2200	4297	6497	SO:0001583	missense	0	Familial Cancer Database	Neurofibromatosis type 1 - like syndrome, SPRED1 disorder	AK091222	CCDS32193.1	15q14	2014-06-13			ENSG00000166068	ENSG00000166068			20249	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 147"""	609291					Standard	NM_152594		Approved	FLJ33903, PPP1R147	uc001zka.4	Q7Z699		ENST00000299084.4:c.966G>T	15.37:g.38643496G>T	ENSP00000299084:p.Lys322Asn		B2RPJ8|Q05D53|Q8N256	Missense_Mutation	SNP	pfam_Sprouty,pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.K322N	ENST00000299084.4	37	c.966	CCDS32193.1	15	.	.	.	.	.	.	.	.	.	.	G	11.37	1.618633	0.28801	.	.	ENSG00000166068	ENST00000299084	D	0.85484	-1.99	6.01	3.16	0.36331	.	0.231687	0.50627	D	0.000105	T	0.75693	0.3884	L	0.39397	1.21	0.37773	D	0.926755	B	0.12630	0.006	B	0.08055	0.003	T	0.66878	-0.5812	10	0.33141	T	0.24	4.4571	6.5954	0.22669	0.2745:0.1288:0.5967:0.0	.	322	Q7Z699	SPRE1_HUMAN	N	322	ENSP00000299084:K322N	ENSP00000299084:K322N	K	+	3	2	SPRED1	36430788	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.040000	0.41203	0.452000	0.26830	0.632000	0.83419	AAG	SPRED1	-	NULL	ENSG00000166068		0.403	SPRED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED1	HGNC	protein_coding	OTTHUMT00000418217.1		0.00	21	0	G			38643496	+1			no_errors	ENST00000299084	ensembl	human	known	74_37	missense	9.09	20	2	SNP	1.000	T
SREK1	140890	genome.wustl.edu	37	5	65476025	65476025	+	IGR	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:65476025G>T	ENST00000380918.3	+	0	2433				SREK1_ENST00000334121.6_3'UTR|SREK1_ENST00000284041.3_3'UTR	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						TCATTCTTAGGCTCACTTTTT	0.338																																					GBM(10;31 347 27684 38976 41583)												0																																										SO:0001628	intergenic_variant	0			AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809		5.37:g.65476025G>T			A4FTW3|Q2M1J0|Q86X37	RNA	SNP	-	NULL	ENST00000380918.3	37	NULL	CCDS3991.1	5																																																																																			SREK1	-	-	ENSG00000153914		0.338	SREK1-002	KNOWN	basic|CCDS	protein_coding	SREK1	HGNC	protein_coding	OTTHUMT00000381118.1	-	0.00	22	0	G	NM_001077199		65476025	+1	tier1	-	no_errors	ENST00000284041	ensembl	human	known	74_37	rna	20.00	12	3	SNP	0.047	T
SRRM1	10250	genome.wustl.edu	37	1	24973643	24973643	+	Intron	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:24973643G>T	ENST00000323848.9	+	3	549				SRRM1_ENST00000537199.1_5'Flank|SRRM1_ENST00000374389.4_Intron|SRRM1_ENST00000479034.1_Intron|SRRM1_ENST00000447431.2_Intron	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		ACAGCAGAGTGAGTGTCCCAA	0.413																																					Ovarian(68;897 1494 3282 17478)												0																																										SO:0001627	intron_variant	0			AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.234+363G>T	1.37:g.24973643G>T			O60585|Q5VVN4	RNA	SNP	-	NULL	ENST00000323848.9	37	NULL	CCDS255.1	1																																																																																			SRRM1	-	-	ENSG00000133226		0.413	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM1	HGNC	protein_coding	OTTHUMT00000009292.2	-	0.00	31	0	G	NM_005839		24973643	+1	tier1	-	no_errors	ENST00000466910	ensembl	human	known	74_37	rna	10.64	42	5	SNP	1.000	T
SRRM4	84530	genome.wustl.edu	37	12	119594330	119594330	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:119594330G>T	ENST00000267260.4	+	13	1951	c.1563G>T	c.(1561-1563)cgG>cgT	p.R521R		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	521	Arg-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						CCTACTATCGGCCCAGCCCCT	0.692																																																	0													19.0	24.0	23.0					12																	119594330		2020	4169	6189	SO:0001819	synonymous_variant	0			AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.1563G>T	12.37:g.119594330G>T			A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Silent	SNP	NULL	p.R521	ENST00000267260.4	37	c.1563	CCDS44994.1	12																																																																																			SRRM4	-	NULL	ENSG00000139767		0.692	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM4	HGNC	protein_coding	OTTHUMT00000401640.2	-	0.00	26	0	G	NM_194286		119594330	+1	tier1	-	no_errors	ENST00000267260	ensembl	human	known	74_37	silent	46.88	16	15	SNP	1.000	T
STAM2	10254	genome.wustl.edu	37	2	153001458	153001458	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:153001458G>T	ENST00000263904.4	-	6	810	c.461C>A	c.(460-462)gCt>gAt	p.A154D	STAM2_ENST00000465460.1_Intron	NM_005843.4	NP_005834.4	O75886	STAM2_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 2	154					endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(3)|large_intestine(4)|lung(8)|ovary(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.22)		ATTCTTGGCAGCAGCTGAGAC	0.328																																																	0													226.0	207.0	214.0					2																	153001458		2203	4300	6503	SO:0001583	missense	0			AF042274	CCDS2196.1	2q23.3	2009-04-29			ENSG00000115145	ENSG00000115145			11358	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	606244				10899310, 10993906	Standard	NM_005843		Approved	Hbp	uc002tyc.4	O75886	OTTHUMG00000131885	ENST00000263904.4:c.461C>A	2.37:g.153001458G>T	ENSP00000263904:p.Ala154Asp		A8K8A0|D3DPA1|Q7LDQ0|Q9UF58	Missense_Mutation	SNP	pfam_VHS,pfam_SH3_domain,pfam_SH3_2,pfam_Ubiquitin-int_motif,superfamily_ENTH_VHS,superfamily_SH3_domain,smart_VHS_subgr,smart_Ubiquitin-int_motif,smart_SH3_domain,pfscan_SH3_domain,pfscan_Ubiquitin-int_motif,pfscan_VHS,prints_SH3_domain,prints_p67phox	p.A154D	ENST00000263904.4	37	c.461	CCDS2196.1	2	.	.	.	.	.	.	.	.	.	.	G	16.34	3.096441	0.56075	.	.	ENSG00000115145	ENST00000263904	T	0.19806	2.12	5.38	4.5	0.54988	Src homology-3 domain (1);	1.559180	0.03401	N	0.203404	T	0.28067	0.0692	L	0.36672	1.1	0.33524	D	0.592705	B;B	0.28512	0.214;0.032	B;B	0.39617	0.305;0.027	T	0.11275	-1.0594	10	0.20046	T	0.44	-1.8757	13.5447	0.61695	0.0749:0.0:0.9251:0.0	.	154;154	O75886-2;O75886	.;STAM2_HUMAN	D	154	ENSP00000263904:A154D	ENSP00000263904:A154D	A	-	2	0	STAM2	152709704	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.943000	0.49026	2.512000	0.84698	0.579000	0.79373	GCT	STAM2	-	superfamily_SH3_domain	ENSG00000115145		0.328	STAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAM2	HGNC	protein_coding	OTTHUMT00000254835.2	-	0.00	34	0	G	NM_005843		153001458	-1	tier1	-	no_errors	ENST00000263904	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
STARD3	10948	genome.wustl.edu	37	17	37813294	37813294	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:37813294G>T	ENST00000336308.5	+	3	471	c.253G>T	c.(253-255)Gag>Tag	p.E85*	STARD3_ENST00000580611.1_Intron|STARD3_ENST00000544210.2_Nonsense_Mutation_p.E85*|STARD3_ENST00000394250.4_Nonsense_Mutation_p.E85*|STARD3_ENST00000578232.1_3'UTR	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	85	MENTAL. {ECO:0000255|PROSITE- ProRule:PRU00770}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CTTGGAGCAGGAGATCATCCA	0.557																																																	0													141.0	125.0	131.0					17																	37813294		2203	4300	6503	SO:0001587	stop_gained	0				CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.253G>T	17.37:g.37813294G>T	ENSP00000337446:p.Glu85*		A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Nonsense_Mutation	SNP	pfam_MENTAL,pfam_START_lipid-bd_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,prints_StAR	p.E85*	ENST00000336308.5	37	c.253	CCDS11341.1	17	.	.	.	.	.	.	.	.	.	.	G	20.4	3.988337	0.74589	.	.	ENSG00000131748	ENST00000336308;ENST00000544210;ENST00000394250;ENST00000443521	.	.	.	4.43	4.43	0.53597	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	16.4129	0.83725	0.0:0.0:1.0:0.0	.	.	.	.	X	85	.	ENSP00000337446:E85X	E	+	1	0	STARD3	35066820	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.564000	0.90726	2.159000	0.67721	0.655000	0.94253	GAG	STARD3	-	pfam_MENTAL	ENSG00000131748		0.557	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD3	HGNC	protein_coding	OTTHUMT00000256933.1		0.00	42	0	G			37813294	+1			no_errors	ENST00000336308	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	1.000	T
STON1	11037	genome.wustl.edu	37	2	48808901	48808901	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:48808901A>C	ENST00000406226.1	+	3	1324	c.1129A>C	c.(1129-1131)Aag>Cag	p.K377Q	STON1_ENST00000404752.1_Missense_Mutation_p.K377Q|STON1-GTF2A1L_ENST00000309827.2_Missense_Mutation_p.K377Q|STON1-GTF2A1L_ENST00000394754.1_Missense_Mutation_p.K377Q|STON1-GTF2A1L_ENST00000402114.2_Missense_Mutation_p.K377Q|STON1-GTF2A1L_ENST00000394751.3_Missense_Mutation_p.K377Q|STON1-GTF2A1L_ENST00000405008.1_Missense_Mutation_p.K377Q|STON1_ENST00000309835.3_Missense_Mutation_p.K377Q	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	377	SHD. {ECO:0000255|PROSITE- ProRule:PRU00403}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			GCAGATGCTGAAGTTGGGGTC	0.413																																																	0													69.0	68.0	69.0					2																	48808901		2203	4300	6503	SO:0001583	missense	0			AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1129A>C	2.37:g.48808901A>C	ENSP00000384615:p.Lys377Gln		A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Missense_Mutation	SNP	pfam_TFIIA_asu/bsu,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,superfamily_TFIIA_b-brl,superfamily_TFIIA_a-hlx,pfscan_Clathrin_mu_C,pfscan_SHD	p.K377Q	ENST00000406226.1	37	c.1129	CCDS1841.1	2	.	.	.	.	.	.	.	.	.	.	A	19.64	3.865302	0.71949	.	.	ENSG00000243244;ENSG00000243244;ENSG00000243244;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781	ENST00000404752;ENST00000406226;ENST00000309835;ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751	T;T;T;T;T;T;T;T	0.39056	1.37;1.37;1.37;1.15;1.1;1.15;1.15;1.38	5.16	5.16	0.70880	Stonin homology (1);	0.000000	0.85682	D	0.000000	T	0.66636	0.2809	M	0.81942	2.565	0.53688	D	0.999972	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.998	T	0.72137	-0.4381	10	0.87932	D	0	.	15.1597	0.72775	1.0:0.0:0.0:0.0	.	377;377;377	A8MXJ1;Q53S48;Q9Y6Q2	.;.;STON1_HUMAN	Q	377	ENSP00000385273:K377Q;ENSP00000384615:K377Q;ENSP00000310969:K377Q;ENSP00000385499:K377Q;ENSP00000385701:K377Q;ENSP00000378236:K377Q;ENSP00000311493:K377Q;ENSP00000378234:K377Q	ENSP00000310969:K377Q	K	+	1	0	STON1-GTF2A1L;STON1	48662405	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.128000	0.94424	2.162000	0.67917	0.533000	0.62120	AAG	STON1-GTF2A1L	-	pfscan_SHD	ENSG00000068781		0.413	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STON1-GTF2A1L	HGNC	protein_coding	OTTHUMT00000323848.2	-	0.00	23	0	A	NM_006873		48808901	+1	tier1	-	no_errors	ENST00000309827	ensembl	human	known	74_37	missense	26.47	25	9	SNP	1.000	C
STK17B	9262	genome.wustl.edu	37	2	197004398	197004398	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:197004398G>T	ENST00000263955.4	-	7	1068	c.782C>A	c.(781-783)tCa>tAa	p.S261*	STK17B_ENST00000409228.1_Nonsense_Mutation_p.S261*	NM_004226.3	NP_004217.1	O94768	ST17B_HUMAN	serine/threonine kinase 17b	261	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of fibroblast apoptotic process (GO:2000271)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|kidney(2)|large_intestine(1)|lung(10)	15			OV - Ovarian serous cystadenocarcinoma(117;0.141)			CTGTGAAACTGATGAAAAAGT	0.294																																																	0													86.0	89.0	88.0					2																	197004398		2203	4298	6501	SO:0001587	stop_gained	0			AB011421	CCDS2315.1	2q33.1	2008-02-05	2007-02-12		ENSG00000081320	ENSG00000081320			11396	protein-coding gene	gene with protein product	"""death-associated protein kinase-related 2"""	604727	"""serine/threonine kinase 17b (apoptosis-inducing)"""			9786912	Standard	NM_004226		Approved	DRAK2	uc002utk.3	O94768	OTTHUMG00000132735	ENST00000263955.4:c.782C>A	2.37:g.197004398G>T	ENSP00000263955:p.Ser261*			Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S261*	ENST00000263955.4	37	c.782	CCDS2315.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.378606	0.97520	.	.	ENSG00000081320	ENST00000263955;ENST00000409228	.	.	.	5.11	4.22	0.49857	.	0.000000	0.39210	N	0.001433	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8931	0.63753	0.0:0.1524:0.8476:0.0	.	.	.	.	X	261	.	ENSP00000263955:S261X	S	-	2	0	STK17B	196712643	0.995000	0.38212	1.000000	0.80357	0.996000	0.88848	3.371000	0.52379	1.335000	0.45486	0.591000	0.81541	TCA	STK17B	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000081320		0.294	STK17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK17B	HGNC	protein_coding	OTTHUMT00000256092.2	-	0.00	33	0	G			197004398	-1	tier1	-	no_errors	ENST00000263955	ensembl	human	known	74_37	nonsense	8.70	42	4	SNP	1.000	T
STXBP3	6814	genome.wustl.edu	37	1	109350121	109350121	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:109350121G>T	ENST00000370008.3	+	18	1684	c.1634G>T	c.(1633-1635)cGt>cTt	p.R545L		NM_007269.2	NP_009200.2	O00186	STXB3_HUMAN	syntaxin binding protein 3	545					blood coagulation (GO:0007596)|membrane organization (GO:0061024)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|neutrophil degranulation (GO:0043312)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein heterooligomerization (GO:0051291)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|specific granule (GO:0042581)|tertiary granule (GO:0070820)	syntaxin binding (GO:0019905)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(3)|urinary_tract(1)	13		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0386)|Lung(183;0.104)|COAD - Colon adenocarcinoma(174;0.137)|Epithelial(280;0.231)		TCTGAAGTGCGTTGTGCTTAT	0.348																																																	0													124.0	128.0	126.0					1																	109350121		2203	4300	6503	SO:0001583	missense	0			D63506	CCDS790.1	1p13.3	2008-02-05			ENSG00000116266	ENSG00000116266			11446	protein-coding gene	gene with protein product		608339				10194441	Standard	NM_007269		Approved	UNC-18C	uc001dvy.3	O00186	OTTHUMG00000011122	ENST00000370008.3:c.1634G>T	1.37:g.109350121G>T	ENSP00000359025:p.Arg545Leu		A8K269|A8K5K7|Q53FW1|Q86YJ3|Q9UPD7	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.R545L	ENST00000370008.3	37	c.1634	CCDS790.1	1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.731791	0.89390	.	.	ENSG00000116266	ENST00000370008	T	0.80123	-1.34	5.94	4.07	0.47477	.	0.000000	0.85682	D	0.000000	D	0.88811	0.6538	M	0.91196	3.185	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.89546	0.3796	10	0.42905	T	0.14	-10.8523	12.778	0.57459	0.1357:0.0:0.8643:0.0	.	545	O00186	STXB3_HUMAN	L	545	ENSP00000359025:R545L	ENSP00000359025:R545L	R	+	2	0	STXBP3	109151644	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.964000	0.76061	1.530000	0.49136	0.650000	0.86243	CGT	STXBP3	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000116266		0.348	STXBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP3	HGNC	protein_coding	OTTHUMT00000030591.1	-	0.00	31	0	G	NM_007269		109350121	+1	tier1	-	no_errors	ENST00000370008	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
SUN1	23353	genome.wustl.edu	37	7	881709	881709	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:881709G>T	ENST00000405266.1	+	3	417	c.393G>T	c.(391-393)cgG>cgT	p.R131R	SUN1_ENST00000425407.2_Silent_p.R81R|SUN1_ENST00000456758.2_Silent_p.R189R|SUN1_ENST00000403868.1_Silent_p.R131R|SUN1_ENST00000452783.2_Silent_p.R131R|SUN1_ENST00000457378.2_Silent_p.R152R|SUN1_ENST00000389574.3_Silent_p.R81R|SUN1_ENST00000401592.1_Silent_p.R131R|SUN1_ENST00000469755.1_3'UTR			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	131	LMNA-binding.				cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)				NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						TGACTCGACGGCCTCCTGTAT	0.567																																																	0													79.0	81.0	80.0					7																	881709		2084	4216	6300	SO:0001819	synonymous_variant	0			AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.393G>T	7.37:g.881709G>T			A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Silent	SNP	pfam_SUN1,pfam_Sad1_UNC_C	p.R189	ENST00000405266.1	37	c.567		7																																																																																			SUN1	-	pfam_SUN1	ENSG00000164828		0.567	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	SUN1	HGNC	protein_coding	OTTHUMT00000322566.1	-	0.00	52	0	G	NM_025154		881709	+1	tier1	-	no_errors	ENST00000456758	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.005	T
SYDE2	84144	genome.wustl.edu	37	1	85656020	85656020	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:85656020C>A	ENST00000341460.5	-	2	1210	c.1161G>T	c.(1159-1161)ttG>ttT	p.L387F		NM_032184.1	NP_115560.1	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2 (C. elegans)	387					activation of Rho GTPase activity (GO:0032862)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)	20				all cancers(265;0.0126)|Epithelial(280;0.0336)		CACCAAAACTCAAGGCACTTG	0.448																																																	0													70.0	70.0	70.0					1																	85656020		2087	4217	6304	SO:0001583	missense	0			AL834286	CCDS44169.1	1p22.3	2008-02-05		2005-08-09	ENSG00000097096	ENSG00000097096			25841	protein-coding gene	gene with protein product							Standard	NM_032184		Approved	FLJ13815	uc009wcm.3	Q5VT97	OTTHUMG00000009956	ENST00000341460.5:c.1161G>T	1.37:g.85656020C>A	ENSP00000340594:p.Leu387Phe		Q5VT96|Q8NDB8|Q9H8A6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L387F	ENST00000341460.5	37	c.1161	CCDS44169.1	1	.	.	.	.	.	.	.	.	.	.	C	5.557	0.287693	0.10513	.	.	ENSG00000097096	ENST00000341460	T	0.08102	3.13	6.05	2.97	0.34412	.	0.458962	0.18410	N	0.142067	T	0.06416	0.0165	M	0.65975	2.015	0.09310	N	1	P;D	0.53885	0.8;0.963	P;P	0.53809	0.467;0.735	T	0.24693	-1.0153	10	0.66056	D	0.02	.	2.3033	0.04168	0.1856:0.4568:0.1974:0.1602	.	387;387	Q5VT97;Q5VT97-2	SYDE2_HUMAN;.	F	387	ENSP00000340594:L387F	ENSP00000340594:L387F	L	-	3	2	SYDE2	85428608	0.002000	0.14202	0.270000	0.24601	0.047000	0.14425	0.704000	0.25661	0.387000	0.25024	-0.142000	0.14014	TTG	SYDE2	-	NULL	ENSG00000097096		0.448	SYDE2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYDE2	HGNC	protein_coding	OTTHUMT00000127989.2	-	0.00	31	0	C			85656020	-1	tier1	-	no_errors	ENST00000341460	ensembl	human	known	74_37	missense	40.74	16	11	SNP	0.016	A
SYN1	6853	genome.wustl.edu	37	X	47435959	47435959	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:47435959G>T	ENST00000295987.7	-	7	1042	c.918C>A	c.(916-918)ccC>ccA	p.P306P	SYN1_ENST00000340666.4_Silent_p.P306P	NM_006950.3	NP_008881.2	P17600	SYN1_HUMAN	synapsin I	306	C; actin-binding and synaptic-vesicle binding.				neurotransmitter secretion (GO:0007269)|regulation of neurotransmitter secretion (GO:0046928)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|protein kinase binding (GO:0019901)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(6)|lung(6)|ovary(1)	21						CATCGATGAAGGGCTCGGCAG	0.557																																																	0													187.0	127.0	147.0					X																	47435959		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14280.1, CCDS35233.1	Xp11.2	2012-10-02			ENSG00000008056	ENSG00000008056			11494	protein-coding gene	gene with protein product		313440					Standard	NM_133499		Approved		uc004die.3	P17600	OTTHUMG00000021454	ENST00000295987.7:c.918C>A	X.37:g.47435959G>T			B1AJQ1|O75825|Q5H9A9	Silent	SNP	pfam_Synapsin_ATP-bd_dom,pfam_Synapsin_pre-ATP-grasp_dom,pfam_Synapsin_P_site,pfam_ATP-grasp_RimK-type,superfamily_PreATP-grasp_dom,prints_Synapsin	p.P306	ENST00000295987.7	37	c.918	CCDS14280.1	X																																																																																			SYN1	-	pfam_Synapsin_ATP-bd_dom,pfam_ATP-grasp_RimK-type	ENSG00000008056		0.557	SYN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYN1	HGNC	protein_coding	OTTHUMT00000056445.1	-	0.00	54	0	G	NM_006950		47435959	-1	tier1	-	no_errors	ENST00000295987	ensembl	human	known	74_37	silent	8.70	42	4	SNP	1.000	T
SYNC	81493	genome.wustl.edu	37	1	33161294	33161294	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:33161294G>A	ENST00000409190.3	-	2	863	c.405C>T	c.(403-405)caC>caT	p.H135H	SYNC_ENST00000373484.3_Silent_p.H135H	NM_030786.2	NP_110413	Q9H7C4	SYNCI_HUMAN	syncoilin, intermediate filament protein	135	Head.				intermediate filament-based process (GO:0045103)	cytosol (GO:0005829)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural molecule activity (GO:0005198)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12						CATAAACAACGTGCTCTGGGC	0.577																																																	0													81.0	72.0	75.0					1																	33161294		692	1591	2283	SO:0001819	synonymous_variant	0			AK024707	CCDS367.2, CCDS53294.1	1p35.1	2013-01-16	2008-09-19	2008-09-19	ENSG00000162520	ENSG00000162520		"""Intermediate filaments type III"""	28897	protein-coding gene	gene with protein product		611750	"""syncoilin, intermediate filament 1"""	SYNC1		11053421	Standard	NM_030786		Approved	SYNCOILIN	uc001bvt.2	Q9H7C4	OTTHUMG00000008087	ENST00000409190.3:c.405C>T	1.37:g.33161294G>A			B4DNK8|B4DY58|C9IY41	Silent	SNP	pfam_IF	p.H135	ENST00000409190.3	37	c.405	CCDS367.2	1																																																																																			SYNC	-	NULL	ENSG00000162520		0.577	SYNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNC	HGNC	protein_coding	OTTHUMT00000022129.3		0.00	19	0	G	NM_030786		33161294	-1			no_errors	ENST00000409190	ensembl	human	known	74_37	silent	35.00	13	7	SNP	0.672	A
SYNE1	23345	genome.wustl.edu	37	6	152737805	152737805	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:152737805C>A	ENST00000367255.5	-	41	6368	c.5767G>T	c.(5767-5769)Gcc>Tcc	p.A1923S	SYNE1_ENST00000265368.4_Missense_Mutation_p.A1923S|SYNE1_ENST00000423061.1_Missense_Mutation_p.A1930S|SYNE1_ENST00000341594.5_Missense_Mutation_p.A1960S|SYNE1_ENST00000448038.1_Missense_Mutation_p.A1930S	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1923					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGACTGACGGCAGCAGATTCT	0.453										HNSCC(10;0.0054)																																							0													106.0	103.0	104.0					6																	152737805		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.5767G>T	6.37:g.152737805C>A	ENSP00000356224:p.Ala1923Ser		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.A1923S	ENST00000367255.5	37	c.5767	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	11.05	1.525832	0.27299	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.60548	0.25;0.28;0.18;0.24;0.39	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000007	T	0.31575	0.0801	L	0.45581	1.43	0.80722	D	1	P;P;P;B	0.44429	0.835;0.636;0.636;0.136	B;B;B;B	0.37422	0.249;0.156;0.156;0.046	T	0.25117	-1.0141	10	0.07644	T	0.81	.	15.3849	0.74691	0.1393:0.8607:0.0:0.0	.	1906;1923;1923;1930	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	S	1923;1930;1923;1930;1960	ENSP00000356224:A1923S;ENSP00000396024:A1930S;ENSP00000265368:A1923S;ENSP00000390975:A1930S;ENSP00000341887:A1960S	ENSP00000265368:A1923S	A	-	1	0	SYNE1	152779498	1.000000	0.71417	0.286000	0.24833	0.005000	0.04900	4.804000	0.62554	2.885000	0.99019	0.655000	0.94253	GCC	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.453	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2		0.00	10	0	C	NM_182961		152737805	-1			no_errors	ENST00000265368	ensembl	human	known	74_37	missense	27.27	8	3	SNP	0.997	A
SYNE1	23345	genome.wustl.edu	37	6	152738136	152738136	+	Missense_Mutation	SNP	T	T	G	rs376944188		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:152738136T>G	ENST00000367255.5	-	41	6037	c.5436A>C	c.(5434-5436)gaA>gaC	p.E1812D	SYNE1_ENST00000265368.4_Missense_Mutation_p.E1812D|SYNE1_ENST00000423061.1_Missense_Mutation_p.E1819D|SYNE1_ENST00000341594.5_Missense_Mutation_p.E1849D|SYNE1_ENST00000448038.1_Missense_Mutation_p.E1819D	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1812					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGCTCTCTACTTCTGCTGCGT	0.498										HNSCC(10;0.0054)																																							0													92.0	92.0	92.0					6																	152738136		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.5436A>C	6.37:g.152738136T>G	ENSP00000356224:p.Glu1812Asp		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E1812D	ENST00000367255.5	37	c.5436	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	8.274	0.814034	0.16537	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	6.16	2.52	0.30459	.	0.087235	0.49305	D	0.000151	T	0.28134	0.0694	L	0.60455	1.87	0.80722	D	1	B;D;D;D	0.58970	0.321;0.984;0.984;0.98	B;P;P;P	0.53861	0.123;0.554;0.554;0.736	T	0.12630	-1.0540	10	0.22109	T	0.4	.	4.8236	0.13405	0.1262:0.1978:0.0:0.676	.	1795;1812;1812;1819	B3W695;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	D	1812;1819;1812;1819;1849	ENSP00000356224:E1812D;ENSP00000396024:E1819D;ENSP00000265368:E1812D;ENSP00000390975:E1819D;ENSP00000341887:E1849D	ENSP00000265368:E1812D	E	-	3	2	SYNE1	152779829	1.000000	0.71417	0.083000	0.20561	0.179000	0.23085	1.657000	0.37366	0.208000	0.20626	-0.309000	0.09137	GAA	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.498	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	22	0	T	NM_182961		152738136	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	45.45	6	5	SNP	0.998	G
SYT16	83851	genome.wustl.edu	37	14	62550978	62550978	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:62550978C>T	ENST00000430451.2	+	5	1696	c.1499C>T	c.(1498-1500)tCg>tTg	p.S500L		NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	500					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		TCCACGCAGTCGCTGTCTCAT	0.547																																																	0													106.0	104.0	105.0					14																	62550978		2000	4172	6172	SO:0001583	missense	0			BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1499C>T	14.37:g.62550978C>T	ENSP00000394700:p.Ser500Leu		B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.S500L	ENST00000430451.2	37	c.1499	CCDS45121.1	14	.	.	.	.	.	.	.	.	.	.	C	26.3	4.720805	0.89205	.	.	ENSG00000139973	ENST00000430451	T	0.06142	3.34	5.44	4.56	0.56223	.	0.062074	0.64402	N	0.000002	T	0.25457	0.0619	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	T	0.02909	-1.1095	10	0.87932	D	0	-7.6599	14.256	0.66053	0.0:0.929:0.0:0.071	.	500	Q17RD7	SYT16_HUMAN	L	500	ENSP00000394700:S500L	ENSP00000394700:S500L	S	+	2	0	SYT16	61620731	1.000000	0.71417	0.996000	0.52242	0.967000	0.64934	5.607000	0.67648	1.526000	0.49068	0.643000	0.83706	TCG	SYT16	-	NULL	ENSG00000139973		0.547	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SYT16	HGNC	protein_coding	OTTHUMT00000411700.1	-	0.00	25	0	C	NM_031914		62550978	+1	tier1	-	no_errors	ENST00000430451	ensembl	human	novel	74_37	missense	38.71	18	12	SNP	1.000	T
TAB2	23118	genome.wustl.edu	37	6	149699963	149699963	+	Silent	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:149699963A>C	ENST00000367456.1	+	4	1489	c.912A>C	c.(910-912)tcA>tcC	p.S304S	TAB2_ENST00000286332.5_Silent_p.S304S|TAB2_ENST00000392282.1_Silent_p.S304S|TAB2_ENST00000538427.1_Silent_p.S304S|TAB2_ENST00000536230.1_Silent_p.S272S			Q9NYJ8	TAB2_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 2	304					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase activity (GO:0045860)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)	p.S304S(1)		breast(2)|endometrium(6)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|urinary_tract(1)	22						CTGGTAGCTCACAGTCTTCTG	0.413																																																	1	Substitution - coding silent(1)	lung(1)											142.0	127.0	132.0					6																	149699963		2203	4300	6503	SO:0001819	synonymous_variant	0			AF241230	CCDS5214.1	6q25.1	2010-08-05	2010-02-05	2010-02-05	ENSG00000055208	ENSG00000055208			17075	protein-coding gene	gene with protein product		605101	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 2"""	MAP3K7IP2		9872452, 10882101	Standard	XR_250046		Approved	KIAA0733	uc010kib.2	Q9NYJ8	OTTHUMG00000015783	ENST00000367456.1:c.912A>C	6.37:g.149699963A>C			B2RCC4|E1P5A0|O94838|Q6I9W8|Q76N06|Q9UFP7	Silent	SNP	pfam_CUE,pfam_Znf_RanBP2,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.S304	ENST00000367456.1	37	c.912	CCDS5214.1	6																																																																																			TAB2	-	NULL	ENSG00000055208		0.413	TAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB2	HGNC	protein_coding	OTTHUMT00000042633.3		0.00	20	0	A			149699963	+1			no_errors	ENST00000286332	ensembl	human	known	74_37	silent	6.67	28	2	SNP	0.999	C
TAF1L	138474	genome.wustl.edu	37	9	32630161	32630161	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:32630161C>A	ENST00000242310.4	-	1	5506	c.5417G>T	c.(5416-5418)aGa>aTa	p.R1806I		NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1806					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TTGTTTGGGTCTTATTCCACC	0.493																																																	0													215.0	169.0	185.0					9																	32630161		2203	4300	6503	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.5417G>T	9.37:g.32630161C>A	ENSP00000418379:p.Arg1806Ile		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R1806I	ENST00000242310.4	37	c.5417	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	C	9.629	1.135953	0.21123	.	.	ENSG00000122728	ENST00000242310	T	0.10668	2.85	0.479	-0.958	0.10347	.	0.000000	0.85682	D	0.000000	T	0.04137	0.0115	N	0.08118	0	0.38772	D	0.954564	B	0.14438	0.01	B	0.10450	0.005	T	0.49000	-0.8984	10	0.49607	T	0.09	.	2.8391	0.05524	0.2565:0.4972:0.0:0.2462	.	1806	Q8IZX4	TAF1L_HUMAN	I	1806	ENSP00000418379:R1806I	ENSP00000418379:R1806I	R	-	2	0	TAF1L	32620161	1.000000	0.71417	0.089000	0.20774	0.016000	0.09150	2.756000	0.47549	-1.785000	0.01271	-1.076000	0.02234	AGA	TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.493	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	-	0.00	75	0	C			32630161	-1	tier1	-	no_errors	ENST00000242310	ensembl	human	known	74_37	missense	44.44	45	36	SNP	0.654	A
TAF1L	138474	genome.wustl.edu	37	9	32630838	32630838	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:32630838C>A	ENST00000242310.4	-	1	4829	c.4740G>T	c.(4738-4740)aaG>aaT	p.K1580N	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1580	Bromo 2. {ECO:0000255|PROSITE- ProRule:PRU00035}.				DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)	p.K1580N(1)		breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GACTCTGATACTTGTGCTTGG	0.383																																																	1	Substitution - Missense(1)	lung(1)											135.0	132.0	133.0					9																	32630838		2203	4300	6503	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.4740G>T	9.37:g.32630838C>A	ENSP00000418379:p.Lys1580Asn		Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.K1580N	ENST00000242310.4	37	c.4740	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	C	16.13	3.036174	0.54896	.	.	ENSG00000122728	ENST00000242310	T	0.34472	1.36	0.489	0.489	0.16854	Bromodomain (6);Bromodomain, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.43743	0.1261	L	0.49640	1.575	0.39930	D	0.974278	D	0.71674	0.998	D	0.63192	0.912	T	0.39603	-0.9606	10	0.62326	D	0.03	.	6.7111	0.23278	0.0:0.9999:0.0:1.0E-4	.	1580	Q8IZX4	TAF1L_HUMAN	N	1580	ENSP00000418379:K1580N	ENSP00000418379:K1580N	K	-	3	2	TAF1L	32620838	1.000000	0.71417	0.991000	0.47740	0.865000	0.49528	0.442000	0.21628	0.514000	0.28300	0.205000	0.17691	AAG	TAF1L	-	pirsf_TAF1_animal,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	ENSG00000122728		0.383	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2		0.00	50	0	C			32630838	-1			no_errors	ENST00000242310	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	A
TARS	6897	genome.wustl.edu	37	5	33455098	33455098	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:33455098G>T	ENST00000265112.3	+	5	813	c.502G>T	c.(502-504)Gtc>Ttc	p.V168F	TARS_ENST00000455217.2_Missense_Mutation_p.V201F|TARS_ENST00000414361.2_Missense_Mutation_p.V47F|TARS_ENST00000541634.1_Missense_Mutation_p.V64F|TARS_ENST00000502553.1_Missense_Mutation_p.V168F	NM_152295.4	NP_689508.3	P26639	SYTC_HUMAN	threonyl-tRNA synthetase	168					gene expression (GO:0010467)|threonyl-tRNA aminoacylation (GO:0006435)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|threonine-tRNA ligase activity (GO:0004829)			NS(1)|biliary_tract(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)	29					L-Threonine(DB00156)	CATGGAAAGAGTCTATGGTGG	0.408																																																	0													122.0	117.0	119.0					5																	33455098		2203	4300	6503	SO:0001583	missense	0			AK095852	CCDS3899.1, CCDS58943.1	5p13.2	2012-10-02			ENSG00000113407	ENSG00000113407	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	11572	protein-coding gene	gene with protein product	"""threonine tRNA ligase 1, cytoplasmic"""	187790					Standard	NM_152295		Approved		uc011coc.3	P26639	OTTHUMG00000090683	ENST00000265112.3:c.502G>T	5.37:g.33455098G>T	ENSP00000265112:p.Val168Phe		A8K8I1|B4DEG8|Q96FP5|Q9BWA6	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa	p.V168F	ENST00000265112.3	37	c.502	CCDS3899.1	5	.	.	.	.	.	.	.	.	.	.	G	11.32	1.604915	0.28623	.	.	ENSG00000113407	ENST00000502553;ENST00000265112;ENST00000541634;ENST00000455217;ENST00000414361	T;T;T;T	0.07327	3.2;3.2;3.2;3.2	5.86	5.86	0.93980	Threonyl/alanyl tRNA synthetase, class II-like, putative editing domain (1);	0.053292	0.64402	D	0.000001	T	0.05547	0.0146	N	0.19112	0.55	0.58432	D	0.999992	B;B;B;B	0.06786	0.001;0.001;0.0;0.001	B;B;B;B	0.06405	0.002;0.002;0.002;0.002	T	0.40850	-0.9541	10	0.11182	T	0.66	-13.3406	11.1944	0.48704	0.11:0.0:0.89:0.0	.	47;201;64;168	E7ERI3;B4DEG8;G3XAN9;P26639	.;.;.;SYTC_HUMAN	F	168;168;64;201;47	ENSP00000424387:V168F;ENSP00000265112:V168F;ENSP00000438469:V64F;ENSP00000387710:V201F	ENSP00000265112:V168F	V	+	1	0	TARS	33490855	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.745000	0.55119	2.797000	0.96272	0.644000	0.83932	GTC	TARS	-	superfamily_Thr/Ala-tRNA-synth_IIc_edit,tigrfam_Thr-tRNA-ligase_IIa	ENSG00000113407		0.408	TARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS	HGNC	protein_coding	OTTHUMT00000207367.1	-	0.00	27	0	G	NM_152295		33455098	+1	tier1	-	no_errors	ENST00000265112	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	T
TAS1R3	83756	genome.wustl.edu	37	1	1269397	1269397	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:1269397G>A	ENST00000339381.5	+	6	2144	c.2112G>A	c.(2110-2112)ccG>ccA	p.P704P		NM_152228.1	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3	704					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			kidney(2)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(1)	12	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)		TGGCCTTCCCGCCGGAGGTGG	0.701																																																	0													28.0	24.0	26.0					1																	1269397		2197	4296	6493	SO:0001819	synonymous_variant	0			AC026283	CCDS30556.1	1p36	2012-08-22			ENSG00000169962	ENSG00000169962		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	15661	protein-coding gene	gene with protein product		605865				11319557	Standard	XM_006710939		Approved	T1R3	uc010nyk.2	Q7RTX0	OTTHUMG00000003071	ENST00000339381.5:c.2112G>A	1.37:g.1269397G>A			Q5TA49|Q8NGW9	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3	p.P704	ENST00000339381.5	37	c.2112	CCDS30556.1	1																																																																																			TAS1R3	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3	ENSG00000169962		0.701	TAS1R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS1R3	HGNC	protein_coding	OTTHUMT00000008493.1	-	0.00	29	0	G			1269397	+1	tier1	-	no_errors	ENST00000339381	ensembl	human	known	74_37	silent	30.30	23	10	SNP	0.000	A
TARS2	80222	genome.wustl.edu	37	1	150470031	150470031	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:150470031C>G	ENST00000369064.3	+	10	1080	c.1046C>G	c.(1045-1047)tCc>tGc	p.S349C	TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000606933.1_Missense_Mutation_p.S267C|TARS2_ENST00000369054.2_Missense_Mutation_p.S219C|TARS2_ENST00000463555.1_3'UTR	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	349					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	CGTGGTTTCTCCGAGGTGAAA	0.537																																																	0													81.0	71.0	75.0					1																	150470031		2203	4300	6503	SO:0001583	missense	0			BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.1046C>G	1.37:g.150470031C>G	ENSP00000358060:p.Ser349Cys		Q53GW7|Q96I50|Q9H9V2	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,pfscan_aa-tRNA-synth_II,prints_Thr-tRNA-ligase_IIa,tigrfam_Thr-tRNA-ligase_IIa	p.S349C	ENST00000369064.3	37	c.1046	CCDS952.1	1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613960	0.46631	.	.	ENSG00000143374	ENST00000369054;ENST00000369064;ENST00000369051;ENST00000369052	T;T;T	0.68479	-0.33;-0.33;-0.33	5.65	4.74	0.60224	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.243309	0.35291	N	0.003318	T	0.71151	0.3306	M	0.69463	2.115	0.80722	D	1	D;D;D	0.76494	0.999;0.996;0.996	D;P;P	0.65443	0.935;0.855;0.855	T	0.75777	-0.3198	10	0.66056	D	0.02	-20.2645	11.2241	0.48873	0.0:0.8022:0.1277:0.0701	.	219;74;349	Q9H9V2;E7EVR9;Q9BW92	.;.;SYTM_HUMAN	C	219;349;74;74	ENSP00000358050:S219C;ENSP00000358060:S349C;ENSP00000358047:S74C	ENSP00000358047:S74C	S	+	2	0	TARS2	148736655	0.110000	0.22057	0.998000	0.56505	0.305000	0.27757	0.492000	0.22435	1.633000	0.50488	-0.137000	0.14449	TCC	TARS2	-	pfam_aa-tRNA-synt_IIb_cons-dom,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-ligase_IIa	ENSG00000143374		0.537	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARS2	HGNC	protein_coding	OTTHUMT00000035847.1	-	0.00	26	0	C	NM_025150		150470031	+1	tier1	-	no_errors	ENST00000369064	ensembl	human	known	74_37	missense	23.68	29	9	SNP	0.988	G
TBC1D17	79735	genome.wustl.edu	37	19	50381354	50381354	+	Intron	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:50381354G>A	ENST00000221543.5	+	2	320				TBC1D17_ENST00000535102.2_Intron|AKT1S1_ENST00000344175.5_5'Flank|AKT1S1_ENST00000391835.1_5'Flank|AKT1S1_ENST00000391834.2_5'Flank|AKT1S1_ENST00000391831.1_5'Flank|AKT1S1_ENST00000391832.3_5'Flank|AKT1S1_ENST00000482622.1_Intron|TBC1D17_ENST00000598789.1_3'UTR|AKT1S1_ENST00000391833.1_5'Flank	NM_024682.2	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17						autophagy (GO:0006914)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	Rab GTPase activator activity (GO:0005097)			NS(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		CCCCAGGCTGGTCCCCTCGCT	0.682																																																	0													11.0	11.0	11.0					19																	50381354		2148	4225	6373	SO:0001627	intron_variant	0			AK090606	CCDS12785.1, CCDS54294.1	19q13.33	2013-07-09				ENSG00000104946			25699	protein-coding gene	gene with protein product						22854040	Standard	NM_024682		Approved	FLJ12168	uc002pqo.3	Q9HA65		ENST00000221543.5:c.22-46G>A	19.37:g.50381354G>A			B4DT12|B9A6L8|F5H1W7	RNA	SNP	-	NULL	ENST00000221543.5	37	NULL	CCDS12785.1	19																																																																																			TBC1D17	-	-	ENSG00000104946		0.682	TBC1D17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D17	HGNC	protein_coding	OTTHUMT00000466404.1	-	0.00	44	0	G	NM_024682		50381354	+1	tier1	-	no_errors	ENST00000598789	ensembl	human	known	74_37	rna	39.22	31	20	SNP	0.000	A
TBC1D31	93594	genome.wustl.edu	37	8	124154635	124154635	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:124154635G>T	ENST00000287380.1	+	19	2864	c.2774G>T	c.(2773-2775)aGg>aTg	p.R925M	TBC1D31_ENST00000327098.5_Intron|TBC1D31_ENST00000518805.1_Missense_Mutation_p.R479M|TBC1D31_ENST00000378080.2_Intron|TBC1D31_ENST00000522420.1_Missense_Mutation_p.R820M|TBC1D31_ENST00000309336.3_Intron|TBC1D31_ENST00000521676.1_Missense_Mutation_p.R802M	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	925						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										AAACTCCTTAGGGAAAACAGA	0.348																																																	0													58.0	59.0	59.0					8																	124154635		2203	4300	6503	SO:0001583	missense	0			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.2774G>T	8.37:g.124154635G>T	ENSP00000287380:p.Arg925Met		B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.R925M	ENST00000287380.1	37	c.2774	CCDS6338.1	8	.	.	.	.	.	.	.	.	.	.	G	8.873	0.949817	0.18431	.	.	ENSG00000156787	ENST00000287380;ENST00000522420;ENST00000521676;ENST00000518805	D;D;D;D	0.86230	-2.09;-2.09;-2.09;-2.09	5.36	0.217	0.15264	.	0.708126	0.14177	N	0.336308	T	0.80628	0.4659	N	0.24115	0.695	0.29175	N	0.876882	P;B	0.45283	0.855;0.291	P;B	0.46718	0.525;0.125	T	0.73688	-0.3904	10	0.49607	T	0.09	-4.5471	9.209	0.37306	0.4944:0.0:0.5056:0.0	.	820;925	E7ERK7;Q96DN5	.;WDR67_HUMAN	M	925;820;802;479	ENSP00000287380:R925M;ENSP00000429334:R820M;ENSP00000430628:R802M;ENSP00000429494:R479M	ENSP00000287380:R925M	R	+	2	0	WDR67	124223816	0.915000	0.31059	0.296000	0.24974	0.424000	0.31475	0.201000	0.17276	-0.016000	0.14127	0.471000	0.43371	AGG	TBC1D31	-	NULL	ENSG00000156787		0.348	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D31	HGNC	protein_coding	OTTHUMT00000381721.1		0.00	27	0	G	NM_145647		124154635	+1			no_errors	ENST00000287380	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.073	T
TDRD10	126668	genome.wustl.edu	37	1	154492834	154492834	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:154492834C>T	ENST00000368480.3	+	5	281	c.196C>T	c.(196-198)Cag>Tag	p.Q66*	TDRD10_ENST00000368482.4_Nonsense_Mutation_p.Q66*			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	66	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCACAAAATCCAGAATGGCTG	0.428																																																	0													145.0	142.0	143.0					1																	154492834		1948	4155	6103	SO:0001587	stop_gained	0			AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.196C>T	1.37:g.154492834C>T	ENSP00000357465:p.Gln66*		A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Nonsense_Mutation	SNP	pfam_Tudor,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Q66*	ENST00000368480.3	37	c.196	CCDS41406.1	1	.	.	.	.	.	.	.	.	.	.	c	42	9.634428	0.99224	.	.	ENSG00000163239	ENST00000368482;ENST00000368480	.	.	.	4.0	0.992	0.19819	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	6.361	0.21429	0.0:0.6671:0.0:0.3329	.	.	.	.	X	66	.	ENSP00000357465:Q66X	Q	+	1	0	TDRD10	152759458	0.086000	0.21541	0.001000	0.08648	0.694000	0.40290	0.212000	0.17497	0.098000	0.17522	0.558000	0.71614	CAG	TDRD10	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000163239		0.428	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD10	HGNC	protein_coding	OTTHUMT00000090700.2	-	0.00	56	0	C	NM_182499		154492834	+1	tier1	-	no_errors	ENST00000368480	ensembl	human	known	74_37	nonsense	24.17	91	29	SNP	0.004	T
TECTA	7007	genome.wustl.edu	37	11	121060584	121060584	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr11:121060584G>T	ENST00000392793.1	+	23	6633	c.6362G>T	c.(6361-6363)tGc>tTc	p.C2121F	TECTA_ENST00000264037.2_Missense_Mutation_p.C2121F			O75443	TECTA_HUMAN	tectorin alpha	2121					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GGCAAGAGCTGCAGAGGTAGA	0.567																																																	0													84.0	76.0	79.0					11																	121060584		2203	4299	6502	SO:0001583	missense	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.6362G>T	11.37:g.121060584G>T	ENSP00000376543:p.Cys2121Phe			Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_ZP_dom,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_ZP_dom,pfscan_ZP_dom	p.C2121F	ENST00000392793.1	37	c.6362	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	G	24.3	4.515683	0.85389	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	D;D	0.99953	-8.81;-8.81	5.71	5.71	0.89125	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.99951	0.9979	M	0.83483	2.645	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	D	0.95521	0.8594	10	0.87932	D	0	.	19.4679	0.94950	0.0:0.0:1.0:0.0	.	2121	O75443	TECTA_HUMAN	F	2121	ENSP00000376543:C2121F;ENSP00000264037:C2121F	ENSP00000264037:C2121F	C	+	2	0	TECTA	120565794	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	9.434000	0.97515	2.698000	0.92095	0.561000	0.74099	TGC	TECTA	-	smart_EG-like_dom	ENSG00000109927		0.567	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	-	0.00	31	0	G	NM_005422		121060584	+1	tier1	-	no_errors	ENST00000264037	ensembl	human	known	74_37	missense	47.06	9	8	SNP	1.000	T
TENM1	10178	genome.wustl.edu	37	X	123514857	123514857	+	Silent	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:123514857C>A	ENST00000371130.3	-	31	7770	c.7707G>T	c.(7705-7707)ggG>ggT	p.G2569G	TENM1_ENST00000422452.2_Silent_p.G2576G|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2569					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GAGTGTCCCTCCCCTCTATGG	0.488																																																	0													98.0	78.0	85.0					X																	123514857		2203	4300	6503	SO:0001819	synonymous_variant	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7707G>T	X.37:g.123514857C>A			B2RTR5|Q5JZ17	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.G2576	ENST00000371130.3	37	c.7728	CCDS14609.1	X																																																																																			TENM1	-	NULL	ENSG00000009694		0.488	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	-	0.00	22	0	C	NM_014253		123514857	-1	tier1	-	no_errors	ENST00000422452	ensembl	human	known	74_37	silent	44.74	21	17	SNP	0.925	A
TENM2	57451	genome.wustl.edu	37	5	167675091	167675091	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:167675091G>T	ENST00000518659.1	+	27	7186	c.7147G>T	c.(7147-7149)Ggc>Tgc	p.G2383C	TENM2_ENST00000545108.1_Missense_Mutation_p.G2382C|TENM2_ENST00000519204.1_Missense_Mutation_p.G2262C|TENM2_ENST00000520394.1_Missense_Mutation_p.G2144C|TENM2_ENST00000403607.2_Missense_Mutation_p.G2207C	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2383					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CAGCATCAACGGCCTCATGAT	0.537																																																	0													159.0	162.0	161.0					5																	167675091		2026	4186	6212	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.7147G>T	5.37:g.167675091G>T	ENSP00000429430:p.Gly2383Cys		Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.G2383C	ENST00000518659.1	37	c.7147		5	.	.	.	.	.	.	.	.	.	.	G	16.33	3.092971	0.56075	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.94537	-2.96;-2.94;-3.1;-3.4;-3.45	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	D	0.98223	0.9412	H	0.96142	3.775	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.951	D	0.99470	1.0945	10	0.87932	D	0	.	17.997	0.89187	0.0:0.0:1.0:0.0	.	2382;2383;2144	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	C	2383;2382;2262;2144;2207	ENSP00000429430:G2383C;ENSP00000438635:G2382C;ENSP00000428964:G2262C;ENSP00000427874:G2144C;ENSP00000384905:G2207C	ENSP00000384905:G2207C	G	+	1	0	ODZ2	167607669	1.000000	0.71417	0.327000	0.25402	0.733000	0.41908	9.601000	0.98297	2.556000	0.86216	0.561000	0.74099	GGC	TENM2	-	NULL	ENSG00000145934		0.537	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1		0.00	16	0	G	NM_001122679		167675091	+1			no_errors	ENST00000518659	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	T
TFAP2D	83741	genome.wustl.edu	37	6	50683161	50683161	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:50683161G>A	ENST00000008391.3	+	2	600	c.372G>A	c.(370-372)tcG>tcA	p.S124S		NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					CGCTCAAGTCGTCCTGCCTGG	0.607																																																	0													74.0	74.0	74.0					6																	50683161		2203	4300	6503	SO:0001819	synonymous_variant	0			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.372G>A	6.37:g.50683161G>A				Silent	SNP	pfam_TF_AP2_C,prints_TF_AP2_C	p.S124	ENST00000008391.3	37	c.372	CCDS4933.1	6																																																																																			TFAP2D	-	NULL	ENSG00000008197		0.607	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2D	HGNC	protein_coding	OTTHUMT00000040881.1	-	0.00	34	0	G	NM_172238		50683161	+1	tier1	-	no_errors	ENST00000008391	ensembl	human	known	74_37	silent	47.50	21	19	SNP	1.000	A
THSD7B	80731	genome.wustl.edu	37	2	138320876	138320876	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:138320876A>G	ENST00000409968.1	+	16	3402	c.3224A>G	c.(3223-3225)gAg>gGg	p.E1075G	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Missense_Mutation_p.E1047G|THSD7B_ENST00000272643.3_Missense_Mutation_p.E1078G			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	1077	TSP type-1 13. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		ATCAACAATGAGCTGAGGTCC	0.453																																																	0													108.0	102.0	103.0					2																	138320876		1969	4151	6120	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.3224A>G	2.37:g.138320876A>G	ENSP00000387145:p.Glu1075Gly			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.E1078G	ENST00000409968.1	37	c.3233		2	.	.	.	.	.	.	.	.	.	.	A	17.82	3.483808	0.63962	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.24350	2.39;2.23;1.86	5.41	5.41	0.78517	.	0.110518	0.64402	D	0.000008	T	0.40347	0.1113	L	0.55481	1.735	0.80722	D	1	D	0.56521	0.976	P	0.57911	0.829	T	0.07578	-1.0765	10	0.23891	T	0.37	.	15.7835	0.78281	1.0:0.0:0.0:0.0	.	1047	C9JKN6	.	G	1075;1078;1047	ENSP00000387145:E1075G;ENSP00000272643:E1078G;ENSP00000413841:E1047G	ENSP00000272643:E1078G	E	+	2	0	THSD7B	138037346	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.063000	0.71162	2.190000	0.69967	0.477000	0.44152	GAG	THSD7B	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000144229		0.453	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	-	0.00	34	0	A	XM_046570.9		138320876	+1	tier1	-	no_errors	ENST00000272643	ensembl	human	known	74_37	missense	22.45	38	11	SNP	1.000	G
TICRR	90381	genome.wustl.edu	37	15	90145182	90145182	+	Missense_Mutation	SNP	C	C	G	rs201733600		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:90145182C>G	ENST00000268138.7	+	12	2647	c.2542C>G	c.(2542-2544)Cgt>Ggt	p.R848G	TICRR_ENST00000560985.1_Missense_Mutation_p.R847G			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	848					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										GCAGGAACTTCGTACCAGATC	0.408																																																	0													90.0	81.0	84.0					15																	90145182		1896	4125	6021	SO:0001583	missense	0			AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.2542C>G	15.37:g.90145182C>G	ENSP00000268138:p.Arg848Gly		B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Missense_Mutation	SNP	NULL	p.R848G	ENST00000268138.7	37	c.2542	CCDS10352.2	15	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618292	0.66787	.	.	ENSG00000140534	ENST00000268138	T	0.17054	2.3	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.45135	0.1327	M	0.72894	2.215	0.53688	D	0.999979	D	0.89917	1.0	D	0.91635	0.999	T	0.17077	-1.0381	10	0.56958	D	0.05	-18.8599	20.3242	0.98691	0.0:1.0:0.0:0.0	.	848	Q7Z2Z1	TICRR_HUMAN	G	848	ENSP00000268138:R848G	ENSP00000268138:R848G	R	+	1	0	C15orf42	87946186	1.000000	0.71417	0.928000	0.36995	0.549000	0.35272	4.101000	0.57769	2.882000	0.98803	0.655000	0.94253	CGT	TICRR	-	NULL	ENSG00000140534		0.408	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TICRR	HGNC	protein_coding	OTTHUMT00000312856.1	-	0.00	12	0	C	NM_152259		90145182	+1	tier1	-	no_errors	ENST00000268138	ensembl	human	known	74_37	missense	55.00	9	11	SNP	1.000	G
TIMD4	91937	genome.wustl.edu	37	5	156375476	156375476	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:156375476G>A	ENST00000274532.2	-	5	851	c.795C>T	c.(793-795)caC>caT	p.H265H	TIMD4_ENST00000407087.3_Intron	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4	265	Ser-rich.					integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACATTGACACGTGGGATGTTG	0.378																																																	0													77.0	65.0	69.0					5																	156375476		2203	4300	6503	SO:0001819	synonymous_variant	0			BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.795C>T	5.37:g.156375476G>A			B5MCL9	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.H265	ENST00000274532.2	37	c.795	CCDS4332.1	5																																																																																			TIMD4	-	NULL	ENSG00000145850		0.378	TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMD4	HGNC	protein_coding	OTTHUMT00000252568.1		0.00	13	0	G	NM_138379		156375476	-1			no_errors	ENST00000274532	ensembl	human	known	74_37	silent	12.50	14	2	SNP	0.001	A
TIMP4	7079	genome.wustl.edu	37	3	12195084	12195084	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:12195084G>T	ENST00000287814.4	-	5	1116	c.606C>A	c.(604-606)gaC>gaA	p.D202E	SYN2_ENST00000432424.2_RNA	NM_003256.3	NP_003247.1	Q99727	TIMP4_HUMAN	TIMP metallopeptidase inhibitor 4	202					central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|ovulation cycle (GO:0042698)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)	extracellular space (GO:0005615)|sarcomere (GO:0030017)	metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)	p.D202D(1)		central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	11						TGCAGGTGCCGTCAACATGCT	0.547																																					Melanoma(199;1446 2144 30617 38794 51714)												1	Substitution - coding silent(1)	kidney(1)											163.0	144.0	150.0					3																	12195084		2203	4300	6503	SO:0001583	missense	0			U76456	CCDS2608.1	3p25	2005-10-31	2005-08-08		ENSG00000157150	ENSG00000157150			11823	protein-coding gene	gene with protein product		601915	"""tissue inhibitor of metalloproteinase 4"""			8939999, 9693046	Standard	NM_003256		Approved		uc003bwo.3	Q99727	OTTHUMG00000129763	ENST00000287814.4:c.606C>A	3.37:g.12195084G>T	ENSP00000287814:p.Asp202Glu		B2R7K6	Missense_Mutation	SNP	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP,pfscan_Netrin_domain	p.D202E	ENST00000287814.4	37	c.606	CCDS2608.1	3	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099773	0.56183	.	.	ENSG00000157150	ENST00000287814	D	0.93247	-3.19	4.78	-0.823	0.10815	Tissue inhibitor of metalloproteinases-like, OB-fold (1);	0.000000	0.85682	D	0.000000	D	0.89643	0.6774	L	0.47078	1.49	0.48087	D	0.999583	P	0.43231	0.801	P	0.45449	0.481	T	0.83279	-0.0039	10	0.20046	T	0.44	.	10.7988	0.46476	0.5571:0.0:0.4429:0.0	.	202	Q99727	TIMP4_HUMAN	E	202	ENSP00000287814:D202E	ENSP00000287814:D202E	D	-	3	2	TIMP4	12170084	0.142000	0.22610	0.937000	0.37676	0.914000	0.54420	-0.398000	0.07259	-0.212000	0.10109	-0.658000	0.03865	GAC	TIMP4	-	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP	ENSG00000157150		0.547	TIMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMP4	HGNC	protein_coding	OTTHUMT00000251978.1		0.00	25	0	G	NM_003256		12195084	-1			no_errors	ENST00000287814	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.991	T
TMC4	147798	genome.wustl.edu	37	19	54672292	54672292	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:54672292C>T	ENST00000376591.4	-	4	706	c.575G>A	c.(574-576)gGa>gAa	p.G192E	TMC4_ENST00000476013.2_5'UTR|TMC4_ENST00000301187.4_Missense_Mutation_p.G186E	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	192					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GGGAGCGCCTCCCAACCAGGT	0.662											OREG0025670	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													28.0	23.0	25.0					19																	54672292		2189	4289	6478	SO:0001583	missense	0			AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.575G>A	19.37:g.54672292C>T	ENSP00000365776:p.Gly192Glu	1002	Q7Z5M3|Q8N5E4|Q8TBS7	Missense_Mutation	SNP	pfam_TMC	p.G186E	ENST00000376591.4	37	c.557	CCDS46174.1	19	.	.	.	.	.	.	.	.	.	.	C	0.678	-0.799326	0.02841	.	.	ENSG00000167608	ENST00000301187;ENST00000376591;ENST00000446291	T;T;T	0.40756	1.02;1.02;1.02	4.2	-0.352	0.12598	.	7739.210000	0.00166	N	0.000000	T	0.10637	0.0260	N	0.00554	-1.385	0.36032	D	0.839455	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.57087	-0.7871	10	0.02654	T	1	0.0059	0.5327	0.00631	0.2596:0.1212:0.1805:0.4387	.	192;186	Q7Z404;Q7Z404-1	TMC4_HUMAN;.	E	186;192;96	ENSP00000301187:G186E;ENSP00000365776:G192E;ENSP00000416444:G96E	ENSP00000301187:G186E	G	-	2	0	TMC4	59364104	0.025000	0.19082	0.715000	0.30552	0.593000	0.36681	-0.144000	0.10280	0.120000	0.18254	-0.458000	0.05436	GGA	TMC4	-	NULL	ENSG00000167608		0.662	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TMC4	HGNC	protein_coding	OTTHUMT00000156164.2	-	0.00	12	0	C			54672292	-1	tier1	-	no_errors	ENST00000301187	ensembl	human	known	74_37	missense	18.52	22	5	SNP	0.647	T
TMEM104	54868	genome.wustl.edu	37	17	72781696	72781696	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:72781696G>T	ENST00000335464.5	+	3	283	c.121G>T	c.(121-123)Ggg>Tgg	p.G41W	TMEM104_ENST00000582773.1_Missense_Mutation_p.G41W|TMEM104_ENST00000582330.1_Missense_Mutation_p.G41W|TMEM104_ENST00000417024.2_Intron	NM_017728.3	NP_060198.3	Q8NE00	TM104_HUMAN	transmembrane protein 104	41						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(1)	19	all_lung(278;0.23)					CGCCACTGCCGGGTGGCTTGT	0.617																																																	0													99.0	77.0	85.0					17																	72781696		2203	4300	6503	SO:0001583	missense	0			AK074029	CCDS32723.1	17q25.1	2005-12-19				ENSG00000109066			25984	protein-coding gene	gene with protein product							Standard	NM_017728		Approved	FLJ20255, FLJ00021	uc002jls.4	Q8NE00		ENST00000335464.5:c.121G>T	17.37:g.72781696G>T	ENSP00000334849:p.Gly41Trp		Q8TEU1|Q9NT56|Q9NXH1	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.G41W	ENST00000335464.5	37	c.121	CCDS32723.1	17	.	.	.	.	.	.	.	.	.	.	G	18.44	3.624864	0.66901	.	.	ENSG00000109066	ENST00000335464	T	0.64260	-0.09	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	D	0.82660	0.5085	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.86868	0.2034	10	0.87932	D	0	-25.6966	17.6953	0.88279	0.0:0.0:1.0:0.0	.	41;41	Q8NE00-2;Q8NE00	.;TM104_HUMAN	W	41	ENSP00000334849:G41W	ENSP00000334849:G41W	G	+	1	0	TMEM104	70293291	1.000000	0.71417	0.802000	0.32245	0.229000	0.25112	9.266000	0.95659	2.193000	0.70182	0.313000	0.20887	GGG	TMEM104	-	pfam_AA_transpt_TM	ENSG00000109066		0.617	TMEM104-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM104	HGNC	protein_coding	OTTHUMT00000444442.1		0.00	34	0	G	NM_017728		72781696	+1			no_errors	ENST00000335464	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
TMEM150C	441027	genome.wustl.edu	37	4	83406769	83406769	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:83406769G>T	ENST00000515780.2	-	8	849	c.645C>A	c.(643-645)ttC>ttA	p.F215L	TMEM150C_ENST00000449862.2_Missense_Mutation_p.F215L			B9EJG8	T150C_HUMAN	transmembrane protein 150C	215						integral component of membrane (GO:0016021)				ovary(1)	1						GGTAATGCCGGAACTCCACGG	0.502																																																	0													48.0	46.0	47.0					4																	83406769		1938	4153	6091	SO:0001583	missense	0			BC147027	CCDS47087.1	4q21.22	2010-06-25			ENSG00000249242	ENSG00000249242			37263	protein-coding gene	gene with protein product							Standard	NM_001080506		Approved	FLJ12993	uc003hmy.1	B9EJG8	OTTHUMG00000161083	ENST00000515780.2:c.645C>A	4.37:g.83406769G>T	ENSP00000420919:p.Phe215Leu		B7Z4J5|B7Z4L3|B7Z692|B7Z6X6	Missense_Mutation	SNP	pfam_Frag1/DRAM/Sfk1	p.F215L	ENST00000515780.2	37	c.645	CCDS47087.1	4	.	.	.	.	.	.	.	.	.	.	G	21.9	4.212308	0.79240	.	.	ENSG00000249242	ENST00000449862;ENST00000515780	T;T	0.56776	0.44;0.44	5.28	4.42	0.53409	.	.	.	.	.	T	0.67543	0.2904	M	0.63843	1.955	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	T	0.66874	-0.5813	9	0.41790	T	0.15	-8.7143	14.2683	0.66135	0.0733:0.0:0.9267:0.0	.	215	B9EJG8	T150C_HUMAN	L	215	ENSP00000403438:F215L;ENSP00000420919:F215L	ENSP00000403438:F215L	F	-	3	2	TMEM150C	83625793	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	3.882000	0.56160	2.446000	0.82766	0.462000	0.41574	TTC	TMEM150C	-	pfam_Frag1/DRAM/Sfk1	ENSG00000249242		0.502	TMEM150C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM150C	HGNC	protein_coding	OTTHUMT00000363685.2	-	0.00	39	0	G	NM_001080506		83406769	-1	tier1	-	no_errors	ENST00000449862	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
TMEM144	55314	genome.wustl.edu	37	4	159133833	159133833	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:159133833G>T	ENST00000296529.6	+	3	534	c.14G>T	c.(13-15)gGa>gTa	p.G5V	TMEM144_ENST00000514558.1_Missense_Mutation_p.G5V|TMEM144_ENST00000509278.1_Missense_Mutation_p.G5V	NM_018342.4	NP_060812.2	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	5						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(7)|lung(9)|prostate(1)	19	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		AGCAACAATGGAGCAGACCTA	0.348																																																	0													173.0	142.0	153.0					4																	159133833		2203	4300	6503	SO:0001583	missense	0			AK002017	CCDS3799.1	4q32.1	2008-02-05			ENSG00000164124	ENSG00000164124			25633	protein-coding gene	gene with protein product						12477932	Standard	NM_018342		Approved	FLJ11155	uc003ipx.3	Q7Z5S9	OTTHUMG00000162013	ENST00000296529.6:c.14G>T	4.37:g.159133833G>T	ENSP00000296529:p.Gly5Val		D3DP24|Q49A05|Q9NUT3	Missense_Mutation	SNP	pfam_DUF1632_TMEM144,pfam_Sugar_transport	p.G5V	ENST00000296529.6	37	c.14	CCDS3799.1	4	.	.	.	.	.	.	.	.	.	.	G	10.18	1.279690	0.23307	.	.	ENSG00000164124	ENST00000505049;ENST00000505189;ENST00000511038;ENST00000508243;ENST00000296529;ENST00000512481;ENST00000504569;ENST00000509278;ENST00000514558;ENST00000503200;ENST00000502698;ENST00000514971	T;T;T	0.42131	1.0;0.98;0.99	5.57	-2.03	0.07365	.	1.031830	0.07618	N	0.926506	T	0.28830	0.0715	L	0.38175	1.15	0.09310	N	0.999991	B	0.20671	0.047	B	0.18561	0.022	T	0.24657	-1.0154	10	0.27082	T	0.32	0.4043	6.5269	0.22307	0.2767:0.3348:0.3885:0.0	.	5	Q7Z5S9	TM144_HUMAN	V	5	ENSP00000422297:G5V;ENSP00000296529:G5V;ENSP00000426211:G5V	ENSP00000296529:G5V	G	+	2	0	TMEM144	159353283	0.002000	0.14202	0.000000	0.03702	0.171000	0.22731	0.065000	0.14466	-0.513000	0.06496	-0.150000	0.13652	GGA	TMEM144	-	NULL	ENSG00000164124		0.348	TMEM144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM144	HGNC	protein_coding	OTTHUMT00000365597.1	-	0.00	49	0	G	NM_018342		159133833	+1	tier1	-	no_errors	ENST00000296529	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	T
TMEM179	388021	genome.wustl.edu	37	14	105061558	105061558	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr14:105061558C>T	ENST00000556573.1	-	3	707	c.466G>A	c.(466-468)Gac>Aac	p.D156N	TMEM179_ENST00000341595.3_Missense_Mutation_p.D156N			Q6ZVK1	T179A_HUMAN	transmembrane protein 179	156						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|skin(1)	4			all cancers(16;0.00276)|OV - Ovarian serous cystadenocarcinoma(23;0.0262)|Epithelial(46;0.058)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.129)		AGCTCCAAGTCGATGTCCTGG	0.597																																																	0													79.0	70.0	73.0					14																	105061558		2203	4300	6503	SO:0001583	missense	0			AK124477	CCDS66723.1, CCDS73688.1	14q32.33	2012-04-11	2006-10-16	2006-10-16	ENSG00000258986	ENSG00000258986			20137	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 90"""	C14orf90			Standard	NM_001286390		Approved	FLJ42486, TMEM179A	uc001yox.1	Q6ZVK1	OTTHUMG00000170829	ENST00000556573.1:c.466G>A	14.37:g.105061558C>T	ENSP00000450958:p.Asp156Asn			Missense_Mutation	SNP	NULL	p.D156N	ENST00000556573.1	37	c.466		14	.	.	.	.	.	.	.	.	.	.	C	10.39	1.337564	0.24253	.	.	ENSG00000189203;ENSG00000258986;ENSG00000258986	ENST00000415614;ENST00000556573;ENST00000341595	T;T;T	0.28255	1.62;1.62;1.62	3.87	2.93	0.34026	.	0.052955	0.64402	N	0.000001	T	0.24314	0.0589	L	0.47190	1.495	0.58432	D	0.999998	B	0.30793	0.295	B	0.23419	0.046	T	0.04268	-1.0964	10	0.39692	T	0.17	.	10.7849	0.46398	0.0:0.8997:0.0:0.1003	.	156	Q6ZVK1-2	.	N	156	ENSP00000397763:D156N;ENSP00000450958:D156N;ENSP00000340477:D156N	ENSP00000340477:D156N	D	-	1	0	RP11-614O9.3;TMEM179	104132603	0.976000	0.34144	0.177000	0.23020	0.097000	0.18754	2.454000	0.44979	0.663000	0.31027	0.555000	0.69702	GAC	TMEM179	-	NULL	ENSG00000258986		0.597	TMEM179-002	KNOWN	basic|appris_principal	protein_coding	TMEM179	HGNC	protein_coding	OTTHUMT00000410585.1	-	0.00	25	0	C	NM_207379		105061558	-1	tier1	-	no_errors	ENST00000556573	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.993	T
TMEM43	79188	genome.wustl.edu	37	3	14177323	14177323	+	Missense_Mutation	SNP	G	G	T	rs193922707		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:14177323G>T	ENST00000306077.4	+	10	1051	c.797G>T	c.(796-798)cGg>cTg	p.R266L	RP11-434D12.1_ENST00000608606.1_Silent_p.P11P	NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	266					nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						GTGATTGCCCGGCAGCGGGGT	0.632																																																	0													91.0	87.0	88.0					3																	14177323		2203	4300	6503	SO:0001583	missense	0			BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.797G>T	3.37:g.14177323G>T	ENSP00000303992:p.Arg266Leu		Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Missense_Mutation	SNP	pfam_TMEM43_fam	p.R266L	ENST00000306077.4	37	c.797	CCDS2618.1	3	.	.	.	.	.	.	.	.	.	.	g	13.48	2.251038	0.39797	.	.	ENSG00000170876	ENST00000306077	T	0.38240	1.15	5.69	3.89	0.44902	.	0.188897	0.45867	D	0.000340	T	0.31071	0.0785	N	0.21282	0.65	0.37980	D	0.933566	P;P	0.49447	0.924;0.532	P;B	0.48063	0.565;0.212	T	0.16247	-1.0409	10	0.48119	T	0.1	-11.5406	11.6498	0.51282	0.0671:0.1244:0.8085:0.0	.	196;266	Q8TEP9;Q9BTV4	.;TMM43_HUMAN	L	266	ENSP00000303992:R266L	ENSP00000303992:R266L	R	+	2	0	TMEM43	14152324	1.000000	0.71417	0.999000	0.59377	0.378000	0.30076	3.487000	0.53222	0.760000	0.33108	-0.185000	0.12909	CGG	TMEM43	-	pfam_TMEM43_fam	ENSG00000170876		0.632	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM43	HGNC	protein_coding	OTTHUMT00000252030.2		0.00	16	0	G	NM_024334		14177323	+1			no_errors	ENST00000306077	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	T
TNXB	7148	genome.wustl.edu	37	6	32037592	32037592	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:32037592delT	ENST00000375244.3	-	15	5526	c.5325delA	c.(5323-5325)aaafs	p.K1775fs	TNXB_ENST00000375247.2_Frame_Shift_Del_p.K1775fs			P22105	TENX_HUMAN	tenascin XB	1857	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CCAGACGGGGTTTTGGGGGAC	0.592																																																	0													26.0	28.0	27.0					6																	32037592		1928	4137	6065	SO:0001589	frameshift_variant	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.5325delA	6.37:g.32037592delT	ENSP00000364393:p.Lys1775fs		P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Frame_Shift_Del	DEL	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C_dom,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.K1775fs	ENST00000375244.3	37	c.5325		6																																																																																			TNXB	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000168477		0.592	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2		0.00	44	0	T	NM_019105		32037592	-1	tier1		no_errors	ENST00000375247	ensembl	human	known	74_37	frame_shift_del	7.14	26	2	DEL	0.394	-
TOMM34	10953	genome.wustl.edu	37	20	43572202	43572202	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr20:43572202G>T	ENST00000372813.3	-	6	869	c.717C>A	c.(715-717)gtC>gtA	p.V239V	PABPC1L_ENST00000490798.1_Intron|PABPC1L_ENST00000372819.1_Intron	NM_006809.4	NP_006800.2	Q15785	TOM34_HUMAN	translocase of outer mitochondrial membrane 34	239					protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	11		Myeloproliferative disorder(115;0.0122)				ACTGCTTCAGGACCAAATAGC	0.502																																																	0													123.0	110.0	115.0					20																	43572202		2203	4300	6503	SO:0001819	synonymous_variant	0			U58970	CCDS13340.1	20q12-q13.1	2013-01-10			ENSG00000025772	ENSG00000025772		"""Tetratricopeptide (TTC) repeat domain containing"""	15746	protein-coding gene	gene with protein product	"""outer mitochondrial membrane translocase (34kD)"""					9324309	Standard	NM_006809		Approved	TOM34, HTOM34P	uc002xmy.3	Q15785	OTTHUMG00000032552	ENST00000372813.3:c.717C>A	20.37:g.43572202G>T			Q53GH9|Q6IBN7|Q9NTZ3	Silent	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.V239	ENST00000372813.3	37	c.717	CCDS13340.1	20																																																																																			TOMM34	-	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000025772		0.502	TOMM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM34	HGNC	protein_coding	OTTHUMT00000079390.3		0.00	43	0	G	NM_006809		43572202	-1			no_errors	ENST00000372813	ensembl	human	known	74_37	silent	6.06	31	2	SNP	0.795	T
TOX	9760	genome.wustl.edu	37	8	60031543	60031543	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:60031543C>A	ENST00000361421.1	-	1	224	c.4G>T	c.(4-6)Gac>Tac	p.D2Y	RP11-25K19.1_ENST00000517898.1_RNA|RP11-25K19.1_ENST00000518993.1_RNA|RP11-25K19.1_ENST00000523683.1_RNA	NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	2						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				AATCTTACGTCCATTTCACTC	0.502																																					Pancreas(161;610 1969 17913 21374 22725)												0													62.0	63.0	62.0					8																	60031543		2203	4300	6503	SO:0001583	missense	0				CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.4G>T	8.37:g.60031543C>A	ENSP00000354842:p.Asp2Tyr		Q96AV5	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.D2Y	ENST00000361421.1	37	c.4	CCDS34897.1	8	.	.	.	.	.	.	.	.	.	.	C	16.03	3.008095	0.54361	.	.	ENSG00000198846	ENST00000361421	T	0.21543	2.0	4.64	4.64	0.57946	.	0.136173	0.33631	N	0.004720	T	0.23532	0.0569	L	0.39898	1.24	0.49051	D	0.999744	P	0.35844	0.524	B	0.40444	0.329	T	0.03051	-1.1078	9	.	.	.	.	17.8762	0.88826	0.0:1.0:0.0:0.0	.	2	O94900	TOX_HUMAN	Y	2	ENSP00000354842:D2Y	.	D	-	1	0	TOX	60194097	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	5.377000	0.66184	2.281000	0.76405	0.561000	0.74099	GAC	TOX	-	NULL	ENSG00000198846		0.502	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX	HGNC	protein_coding	OTTHUMT00000378307.1	-	0.00	25	0	C	NM_014729		60031543	-1	tier1	-	no_errors	ENST00000361421	ensembl	human	known	74_37	missense	20.00	36	9	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577520	7577521	+	In_Frame_Ins	INS	-	-	TGG			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:7577520_7577521insTGG	ENST00000269305.4	-	7	949_950	c.760_761insCCA	c.(760-762)atc>aCCAtc	p.253_254insT	TP53_ENST00000445888.2_In_Frame_Ins_p.253_254insT|TP53_ENST00000359597.4_In_Frame_Ins_p.253_254insT|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_In_Frame_Ins_p.253_254insT|TP53_ENST00000413465.2_In_Frame_Ins_p.253_254insT|TP53_ENST00000455263.2_In_Frame_Ins_p.253_254insT	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	253	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		I -> D (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|I -> F (in a sporadic cancer; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> M (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).|T -> A (in sporadic cancers; somatic mutation).|T -> I (in sporadic cancers; somatic mutation).|T -> N (in sporadic cancers; somatic mutation).|T -> P (in sporadic cancers; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.I254V(7)|p.I254F(7)|p.I254S(6)|p.L252_I254delLTI(4)|p.I254fs*10(4)|p.I254T(3)|p.I254N(3)|p.I254D(3)|p.T253fs*91(2)|p.T253_I255del(2)|p.I254del(2)|p.I254fs*91(1)|p.?(1)|p.I254fs*7(1)|p.I254_T256del(1)|p.R249_T256delRPILTIIT(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAGTGTGATGATGGTGAGGATG	0.584		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	56	Substitution - Missense(29)|Deletion - In frame(10)|Whole gene deletion(8)|Insertion - Frameshift(4)|Deletion - Frameshift(4)|Unknown(1)	haematopoietic_and_lymphoid_tissue(12)|large_intestine(9)|lung(7)|bone(4)|liver(4)|upper_aerodigestive_tract(3)|stomach(3)|central_nervous_system(3)|oesophagus(3)|breast(3)|ovary(2)|endometrium(1)|skin(1)|prostate(1)																																								SO:0001652	inframe_insertion	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.758_760dupCCA	17.37:g.7577521_7577523dupTGG	ENSP00000269305:p.Thr253_Thr253dup		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Ins	INS	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.254in_frame_insT	ENST00000269305.4	37	c.761_760	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.584	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1		0.00	161	0	-	NM_000546		7577521	-1	tier1		no_errors	ENST00000269305	ensembl	human	known	74_37	in_frame_ins	32.54	141	68	INS	1.000:1.000	TGG
TP53	7157	genome.wustl.edu	37	17	7578257	7578257	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:7578257C>A	ENST00000269305.4	-	6	781	c.592G>T	c.(592-594)Gaa>Taa	p.E198*	TP53_ENST00000445888.2_Nonsense_Mutation_p.E198*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E198*|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Nonsense_Mutation_p.E198*|TP53_ENST00000413465.2_Nonsense_Mutation_p.E198*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E198*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	198	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		E -> D (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E198*(27)|p.0?(8)|p.E198K(5)|p.?(5)|p.P191_E198>Q(3)|p.E105*(3)|p.E66*(3)|p.E198fs*11(2)|p.E198Q(2)|p.E198fs*7(1)|p.E198fs*49(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AAATTTCCTTCCACTCGGATA	0.547		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	64	Substitution - Nonsense(33)|Whole gene deletion(8)|Substitution - Missense(7)|Complex - deletion inframe(5)|Unknown(5)|Insertion - Frameshift(2)|Deletion - Frameshift(2)|Deletion - In frame(1)|Complex - frameshift(1)	urinary_tract(9)|breast(7)|ovary(7)|upper_aerodigestive_tract(5)|biliary_tract(5)|lung(5)|prostate(5)|bone(4)|central_nervous_system(3)|oesophagus(3)|skin(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|liver(2)|stomach(1)|soft_tissue(1)											112.0	100.0	104.0					17																	7578257		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.592G>T	17.37:g.7578257C>A	ENSP00000269305:p.Glu198*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E198*	ENST00000269305.4	37	c.592	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	15.84	2.950903	0.53186	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-10.9371	16.7921	0.85592	0.0:1.0:0.0:0.0	.	.	.	.	X	198;198;198;198;198;198;187;105;66;105;66	.	ENSP00000269305:E198X	E	-	1	0	TP53	7518982	1.000000	0.71417	1.000000	0.80357	0.024000	0.10985	7.775000	0.85489	2.634000	0.89283	0.563000	0.77884	GAA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.547	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	320	0	C	NM_000546		7578257	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	35.20	278	151	SNP	1.000	A
TP53BP1	7158	genome.wustl.edu	37	15	43724394	43724394	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:43724394G>T	ENST00000263801.3	-	17	3910	c.3658C>A	c.(3658-3660)Cag>Aag	p.Q1220K	TP53BP1_ENST00000382044.4_Missense_Mutation_p.Q1225K|TP53BP1_ENST00000450115.2_Missense_Mutation_p.Q1225K|TP53BP1_ENST00000382039.3_Missense_Mutation_p.Q1225K	NM_005657.2	NP_005648.1	Q12888	TP53B_HUMAN	tumor protein p53 binding protein 1	1220					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	damaged DNA binding (GO:0003684)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription cofactor activity (GO:0001104)|telomeric DNA binding (GO:0042162)			breast(4)|endometrium(5)|kidney(7)|large_intestine(22)|lung(13)|ovary(4)|pancreas(2)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(3)	72		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;1.59e-06)		TCTCTCACCTGGCTATGGAGC	0.468								Other conserved DNA damage response genes																																									0													126.0	106.0	113.0					15																	43724394		2201	4298	6499	SO:0001583	missense	0			U09477	CCDS10096.1, CCDS45250.1, CCDS45251.1	15q15-q21	2007-08-02	2007-08-02		ENSG00000067369	ENSG00000067369			11999	protein-coding gene	gene with protein product		605230	"""tumor protein p53-binding protein, 1"""			8016121, 9748285	Standard	NM_005657		Approved	53BP1, p202	uc001zrr.4	Q12888	OTTHUMG00000059757	ENST00000263801.3:c.3658C>A	15.37:g.43724394G>T	ENSP00000263801:p.Gln1220Lys		F8VY86|Q2M1Z7|Q4LE46|Q5FWZ3|Q7Z3U4	Missense_Mutation	SNP	pfam_53-BP1_Tudor,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q1225K	ENST00000263801.3	37	c.3673	CCDS10096.1	15	.	.	.	.	.	.	.	.	.	.	G	25.1	4.608150	0.87258	.	.	ENSG00000067369	ENST00000263801;ENST00000382044;ENST00000382039;ENST00000450115	T;T;T;T	0.04706	3.57;3.57;3.57;3.6	4.88	4.88	0.63580	.	0.079507	0.51477	D	0.000092	T	0.11623	0.0283	L	0.27053	0.805	0.48571	D	0.999677	D;D;D;D	0.58268	0.969;0.969;0.982;0.982	D;D;D;D	0.70227	0.93;0.93;0.968;0.968	T	0.36065	-0.9763	10	0.25106	T	0.35	-8.1293	17.1322	0.86729	0.0:0.0:1.0:0.0	.	1225;1220;1225;1225	B7Z3E7;Q12888;Q12888-2;F8VY86	.;TP53B_HUMAN;.;.	K	1220;1225;1225;1225	ENSP00000263801:Q1220K;ENSP00000371475:Q1225K;ENSP00000371470:Q1225K;ENSP00000393497:Q1225K	ENSP00000263801:Q1220K	Q	-	1	0	TP53BP1	41511686	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.556000	0.67307	2.691000	0.91804	0.650000	0.86243	CAG	TP53BP1	-	NULL	ENSG00000067369		0.468	TP53BP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TP53BP1	HGNC	protein_coding	OTTHUMT00000132897.3	-	0.00	68	0	G			43724394	-1	tier1	-	no_errors	ENST00000382044	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
TPO	7173	genome.wustl.edu	37	2	1459994	1459994	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:1459994C>T	ENST00000345913.4	+	7	850	c.759C>T	c.(757-759)ttC>ttT	p.F253F	TPO_ENST00000497517.2_Intron|TPO_ENST00000349624.3_Silent_p.F253F|TPO_ENST00000382198.1_Silent_p.F253F|TPO_ENST00000382201.3_Silent_p.F253F|TPO_ENST00000337415.3_Silent_p.F253F|TPO_ENST00000346956.3_Silent_p.F253F|TPO_ENST00000329066.4_Silent_p.F253F	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase	253					cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	AAGCTGCCTTCGGGGGAGGGG	0.473																																																	0													81.0	70.0	73.0					2																	1459994		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.759C>T	2.37:g.1459994C>T			P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Silent	SNP	pfam_Haem_peroxidase_animal,pfam_EGF-like_Ca-bd_dom,superfamily_Haem_peroxidase,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.F253	ENST00000345913.4	37	c.759	CCDS1643.1	2																																																																																			TPO	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000115705		0.473	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	HGNC	protein_coding	OTTHUMT00000206594.2	-	0.00	20	0	C	NM_000547		1459994	+1	tier1	-	no_errors	ENST00000329066	ensembl	human	known	74_37	silent	52.63	9	10	SNP	0.001	T
TPP2	7174	genome.wustl.edu	37	13	103268839	103268839	+	Missense_Mutation	SNP	G	G	T	rs202026163		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr13:103268839G>T	ENST00000376065.4	+	4	520	c.484G>T	c.(484-486)Ggc>Tgc	p.G162C	TPP2_ENST00000376052.3_Missense_Mutation_p.G162C	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	162	Peptidase S8.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)	p.G162S(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGCCAACAACGGCTCTTCTCA	0.413																																																	1	Substitution - Missense(1)	large_intestine(1)											87.0	92.0	90.0					13																	103268839		2203	4300	6503	SO:0001583	missense	0			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.484G>T	13.37:g.103268839G>T	ENSP00000365233:p.Gly162Cys		Q5VZU8	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53_dom,prints_Peptidase_S8_subtilisin-rel	p.G162C	ENST00000376065.4	37	c.484	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	G	13.67	2.307716	0.40795	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	.	.	.	5.55	2.91	0.33838	Peptidase S8/S53, subtilisin/kexin/sedolisin (2);	0.356145	0.32459	N	0.006067	T	0.48624	0.1510	L	0.55481	1.735	0.28682	N	0.905058	B	0.32753	0.383	P	0.44696	0.458	T	0.49234	-0.8961	9	0.52906	T	0.07	.	6.7401	0.23431	0.1165:0.0:0.3537:0.5298	.	162	P29144	TPP2_HUMAN	C	162	.	ENSP00000365220:G162C	G	+	1	0	TPP2	102066840	0.996000	0.38824	0.304000	0.25085	0.959000	0.62525	3.295000	0.51794	0.633000	0.30452	0.585000	0.79938	GGC	TPP2	-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom	ENSG00000134900		0.413	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2		0.00	28	0	G			103268839	+1			no_errors	ENST00000376065	ensembl	human	known	74_37	missense	10.00	17	2	SNP	0.224	T
TRAPPC8	22878	genome.wustl.edu	37	18	29487486	29487486	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:29487486G>T	ENST00000283351.4	-	9	1661	c.1326C>A	c.(1324-1326)tgC>tgA	p.C442*	TRAPPC8_ENST00000582539.1_Nonsense_Mutation_p.C388*|TRAPPC8_ENST00000582513.1_Nonsense_Mutation_p.C442*	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	442					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CAGTATGATAGCAACTGTAAG	0.373																																																	0													77.0	78.0	78.0					18																	29487486		2203	4300	6503	SO:0001587	stop_gained	0			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.1326C>A	18.37:g.29487486G>T	ENSP00000283351:p.Cys442*		A0JP15|B3KME5|Q9H0L2	Nonsense_Mutation	SNP	NULL	p.C442*	ENST00000283351.4	37	c.1326	CCDS11901.1	18	.	.	.	.	.	.	.	.	.	.	G	35	5.537867	0.96460	.	.	ENSG00000153339	ENST00000283351	.	.	.	5.36	-0.313	0.12754	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	10.4269	0.44385	0.445:0.0:0.555:0.0	.	.	.	.	X	442	.	ENSP00000283351:C442X	C	-	3	2	TRAPPC8	27741484	0.991000	0.36638	0.985000	0.45067	0.884000	0.51177	0.197000	0.17197	-0.405000	0.07599	-0.142000	0.14014	TGC	TRAPPC8	-	NULL	ENSG00000153339		0.373	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	TRAPPC8	HGNC	protein_coding	OTTHUMT00000255355.1		0.00	38	0	G	NM_014939		29487486	-1			no_errors	ENST00000283351	ensembl	human	known	74_37	nonsense	8.57	32	3	SNP	0.998	T
TRHDE	29953	genome.wustl.edu	37	12	72969051	72969051	+	Silent	SNP	T	T	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:72969051T>A	ENST00000261180.4	+	11	2109	c.2013T>A	c.(2011-2013)acT>acA	p.T671T	TRHDE_ENST00000549138.1_3'UTR	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	671					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						ACAGAATAACTTATTTGGACA	0.338																																																	0													73.0	74.0	74.0					12																	72969051		2203	4300	6503	SO:0001819	synonymous_variant	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2013T>A	12.37:g.72969051T>A			A5PL19|Q6UWJ4	Silent	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.T671	ENST00000261180.4	37	c.2013	CCDS9004.1	12																																																																																			TRHDE	-	NULL	ENSG00000072657		0.338	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	-	0.00	27	0	T	NM_013381		72969051	+1	tier1	-	no_errors	ENST00000261180	ensembl	human	known	74_37	silent	21.21	26	7	SNP	0.290	A
TRIM24	8805	genome.wustl.edu	37	7	138189052	138189052	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:138189052C>T	ENST00000343526.4	+	2	597	c.382C>T	c.(382-384)Cca>Tca	p.P128S	TRIM24_ENST00000497516.1_3'UTR|TRIM24_ENST00000415680.2_Missense_Mutation_p.P128S			O15164	TIF1A_HUMAN	tripartite motif containing 24	128					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						CATTCGTTGCCCAGTTTGCAG	0.358																																					Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)												0													109.0	107.0	108.0					7																	138189052		2203	4300	6503	SO:0001583	missense	0			AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.382C>T	7.37:g.138189052C>T	ENSP00000340507:p.Pro128Ser		A4D1R7|A4D1R8|O95854	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Bromodomain,prints_Bromodomain	p.P128S	ENST00000343526.4	37	c.382	CCDS5847.1	7	.	.	.	.	.	.	.	.	.	.	C	24.3	4.510915	0.85389	.	.	ENSG00000122779	ENST00000343526;ENST00000452999;ENST00000536822;ENST00000415680;ENST00000378381	D;D	0.83755	-1.76;-1.75	5.17	5.17	0.71159	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.246052	0.38111	N	0.001816	D	0.90010	0.6881	M	0.83774	2.66	0.80722	D	1	D;B	0.56968	0.978;0.383	P;B	0.55615	0.78;0.444	D	0.91461	0.5189	10	0.87932	D	0	-11.3632	18.4584	0.90729	0.0:1.0:0.0:0.0	.	128;128	O15164;O15164-2	TIF1A_HUMAN;.	S	128;128;39;128;86	ENSP00000340507:P128S;ENSP00000390829:P128S	ENSP00000340507:P128S	P	+	1	0	TRIM24	137839592	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.292000	0.51772	2.684000	0.91462	0.650000	0.86243	CCA	TRIM24	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000122779		0.358	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM24	HGNC	protein_coding	OTTHUMT00000341814.1	-	0.00	12	0	C	NM_015905		138189052	+1	tier1	-	no_errors	ENST00000343526	ensembl	human	known	74_37	missense	18.52	21	5	SNP	1.000	T
TRIM38	10475	genome.wustl.edu	37	6	25972225	25972225	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:25972225G>T	ENST00000357085.3	+	5	1112	c.636G>T	c.(634-636)ctG>ctT	p.L212L	TRIM38_ENST00000349458.3_Silent_p.L212L	NM_006355.3	NP_006346.1	O00635	TRI38_HUMAN	tripartite motif containing 38	212					negative regulation of defense response to virus (GO:0050687)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of viral entry into host cell (GO:0046598)|positive regulation of viral genome replication (GO:0045070)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|regulation of interferon-beta production (GO:0032648)|signal transduction (GO:0007165)	intracellular (GO:0005622)	signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	23						TGAGTAGACTGAGGGACTATG	0.488																																																	0													75.0	79.0	77.0					6																	25972225		2203	4300	6503	SO:0001819	synonymous_variant	0			U90547	CCDS4568.1	6p21.3	2011-04-20	2011-01-25	2002-06-07	ENSG00000112343	ENSG00000112343		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	10059	protein-coding gene	gene with protein product			"""ring finger protein 15"", ""tripartite motif-containing 38"""	RNF15			Standard	XR_241880		Approved	RORET	uc003nfm.4	O00635	OTTHUMG00000014414	ENST00000357085.3:c.636G>T	6.37:g.25972225G>T			B2R862	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.L212	ENST00000357085.3	37	c.636	CCDS4568.1	6																																																																																			TRIM38	-	NULL	ENSG00000112343		0.488	TRIM38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM38	HGNC	protein_coding	OTTHUMT00000040076.2		0.00	26	0	G			25972225	+1			no_errors	ENST00000349458	ensembl	human	known	74_37	silent	6.90	27	2	SNP	0.874	T
TRIML2	205860	genome.wustl.edu	37	4	189012836	189012836	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:189012836G>A	ENST00000512729.1	-	7	1229	c.855C>T	c.(853-855)tcC>tcT	p.S285S	TRIML2_ENST00000326754.3_Silent_p.S310S	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	285	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		CTTTCTCTCCGGAAGCTCTGG	0.592																																																	0													147.0	154.0	152.0					4																	189012836		2203	4300	6503	SO:0001819	synonymous_variant	0			AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.855C>T	4.37:g.189012836G>A			B7Z6J6	Silent	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.S285	ENST00000512729.1	37	c.855	CCDS3850.1	4																																																																																			TRIML2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000179046		0.592	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	HGNC	protein_coding	OTTHUMT00000359733.1	-	0.00	29	0	G	NM_173553		189012836	-1	tier1	-	no_errors	ENST00000512729	ensembl	human	known	74_37	silent	38.24	21	13	SNP	0.000	A
TRIML1	339976	genome.wustl.edu	37	4	189060790	189060790	+	Silent	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:189060790A>G	ENST00000332517.3	+	1	218	c.78A>G	c.(76-78)ccA>ccG	p.P26P	RP11-366H4.3_ENST00000501322.2_RNA	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	26					multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		TCAGCAGCCCAGTGACCACCG	0.512																																					Melanoma(31;213 1036 16579 23968 32372)												0													177.0	173.0	175.0					4																	189060790		2203	4300	6503	SO:0001819	synonymous_variant	0			AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.78A>G	4.37:g.189060790A>G			Q96BE5	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.P26	ENST00000332517.3	37	c.78	CCDS3851.1	4																																																																																			TRIML1	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000184108		0.512	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIML1	HGNC	protein_coding	OTTHUMT00000359813.1	-	0.00	22	0	A	NM_178556		189060790	+1	tier1	-	no_errors	ENST00000332517	ensembl	human	known	74_37	silent	21.43	11	3	SNP	0.263	G
TROVE2	6738	genome.wustl.edu	37	1	193054347	193054347	+	3'UTR	DEL	A	A	-	rs567626813|rs56152513		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:193054347delA	ENST00000367446.3	+	0	2313				TROVE2_ENST00000367445.3_Intron|TROVE2_ENST00000367444.3_Intron|TROVE2_ENST00000367443.1_Intron|TROVE2_ENST00000460715.2_3'UTR|TROVE2_ENST00000432079.1_3'UTR	NM_004600.5	NP_004591.2	P10155	RO60_HUMAN	TROVE domain family, member 2						cilium morphogenesis (GO:0060271)|immune system development (GO:0002520)|response to UV (GO:0009411)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|RNA binding (GO:0003723)|U2 snRNA binding (GO:0030620)			biliary_tract(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(7)|prostate(2)|urinary_tract(1)	21						CCAAGGGGGTAAAAAAAAAAA	0.299																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC036658	CCDS41449.1, CCDS1379.1, CCDS41450.1, CCDS41450.2, CCDS53451.1	1q31	2014-08-06	2005-06-14	2005-06-14	ENSG00000116747	ENSG00000116747			11313	protein-coding gene	gene with protein product		600063	"""Sjogren syndrome antigen A2 (60kDa, ribonucleoprotein autoantigen SS-A/Ro)"""	SSA2		8188321	Standard	NM_001042369		Approved	Ro60	uc001gss.3	P10155	OTTHUMG00000035675	ENST00000367446.3:c.*486A>-	1.37:g.193054347delA			B2RBB9|Q5LJ98|Q5LJ99|Q5LJA0|Q86WL3|Q86WL4|Q92787|Q9H1W6	RNA	DEL	-	NULL	ENST00000367446.3	37	NULL	CCDS1379.1	1																																																																																			TROVE2	-	-	ENSG00000116747		0.299	TROVE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TROVE2	HGNC	protein_coding	OTTHUMT00000086688.1		0.00	22	0	A	NM_004600		193054347	+1	tier1		no_errors	ENST00000460715	ensembl	human	known	74_37	rna	35.29	11	6	DEL	0.000	-
TRPM7	54822	genome.wustl.edu	37	15	50870860	50870860	+	Splice_Site	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr15:50870860G>A	ENST00000313478.7	-	31	4875	c.4594C>T	c.(4594-4596)Cca>Tca	p.P1532S	TRPM7_ENST00000560955.1_Splice_Site_p.P1531S|TRPM7_ENST00000561443.1_5'UTR	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1532					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TCTTCAGATGGCCTAAAGAAA	0.279																																																	0													127.0	114.0	118.0					15																	50870860		1829	4081	5910	SO:0001630	splice_region_variant	0			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.4593-1C>T	15.37:g.50870860G>A			Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.P1532S	ENST00000313478.7	37	c.4594	CCDS42035.1	15	.	.	.	.	.	.	.	.	.	.	G	14.38	2.519387	0.44866	.	.	ENSG00000092439	ENST00000313478	T	0.49432	0.78	5.49	4.57	0.56435	.	0.781765	0.12209	N	0.489485	T	0.23492	0.0568	N	0.02247	-0.625	0.46131	D	0.99888	B	0.02656	0.0	B	0.01281	0.0	T	0.06516	-1.0822	10	0.22109	T	0.4	-6.4728	11.4698	0.50261	0.0842:0.0:0.9158:0.0	.	1532	Q96QT4	TRPM7_HUMAN	S	1532	ENSP00000320239:P1532S	ENSP00000320239:P1532S	P	-	1	0	TRPM7	48658152	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.496000	0.45346	1.439000	0.47511	0.655000	0.94253	CCA	TRPM7	-	NULL	ENSG00000092439		0.279	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	-	0.00	52	0	G	NM_017672	Missense_Mutation	50870860	-1	tier1	-	no_errors	ENST00000313478	ensembl	human	known	74_37	missense	43.55	35	27	SNP	1.000	A
TSC1	7248	genome.wustl.edu	37	9	135796783	135796783	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:135796783G>T	ENST00000298552.3	-	8	925	c.704C>A	c.(703-705)aCt>aAt	p.T235N	TSC1_ENST00000545250.1_Missense_Mutation_p.T184N|TSC1_ENST00000403810.1_Missense_Mutation_p.T235N|TSC1_ENST00000475903.1_5'Flank|TSC1_ENST00000440111.2_Missense_Mutation_p.T235N	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	235					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CTTGGATCCAGTCACTAATTC	0.393			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	1	Unknown(1)	bone(1)											107.0	102.0	104.0					9																	135796783		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.704C>A	9.37:g.135796783G>T	ENSP00000298552:p.Thr235Asn		B7Z897|Q5VVN5	Missense_Mutation	SNP	pfam_Hamartin,superfamily_ARM-type_fold	p.T235N	ENST00000298552.3	37	c.704	CCDS6956.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.327622	0.95733	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250;ENST00000537172;ENST00000424271;ENST00000403810	D;D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48;-2.48	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.94758	0.8308	M	0.78049	2.395	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0;0.999	D;D;D;D;D;D	0.97110	0.999;0.998;0.993;0.995;1.0;0.995	D	0.94638	0.7828	10	0.87932	D	0	-9.9543	19.4074	0.94653	0.0:0.0:1.0:0.0	.	114;184;235;235;235;235	B7Z604;B7Z897;Q86WV8;Q59IT9;Q32NF0;Q92574	.;.;.;.;.;TSC1_HUMAN	N	235;235;184;114;114;235	ENSP00000298552:T235N;ENSP00000394524:T235N;ENSP00000444017:T184N;ENSP00000438099:T114N;ENSP00000386093:T235N	ENSP00000298552:T235N	T	-	2	0	TSC1	134786604	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.831000	0.97527	0.650000	0.86243	ACT	TSC1	-	pfam_Hamartin	ENSG00000165699		0.393	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC1	HGNC	protein_coding	OTTHUMT00000054799.1	-	0.00	44	0	G			135796783	-1	tier1	-	no_errors	ENST00000298552	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
TSHZ3	57616	genome.wustl.edu	37	19	31769056	31769056	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:31769056G>T	ENST00000240587.4	-	2	1970	c.1643C>A	c.(1642-1644)cCc>cAc	p.P548H		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	548					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					ATGGATGCTGGGATAGCCCCC	0.562																																																	0													120.0	121.0	121.0					19																	31769056		2203	4300	6503	SO:0001583	missense	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1643C>A	19.37:g.31769056G>T	ENSP00000240587:p.Pro548His		Q9H0G6|Q9P254	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.P548H	ENST00000240587.4	37	c.1643	CCDS12421.2	19	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957087	0.73902	.	.	ENSG00000121297	ENST00000240587	T	0.36878	1.23	5.2	5.2	0.72013	.	0.051807	0.85682	D	0.000000	T	0.60907	0.2305	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.64529	-0.6386	10	0.87932	D	0	-34.0375	18.749	0.91806	0.0:0.0:1.0:0.0	.	548	Q63HK5	TSH3_HUMAN	H	548	ENSP00000240587:P548H	ENSP00000240587:P548H	P	-	2	0	TSHZ3	36460896	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.441000	0.97557	2.412000	0.81896	0.655000	0.94253	CCC	TSHZ3	-	NULL	ENSG00000121297		0.562	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	-	0.00	40	0	G	NM_020856		31769056	-1	tier1	-	no_errors	ENST00000240587	ensembl	human	known	74_37	missense	11.11	40	5	SNP	1.000	T
CFAP70	118491	genome.wustl.edu	37	10	75053076	75053076	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:75053076G>T	ENST00000310715.3	-	17	2045	c.1925C>A	c.(1924-1926)gCa>gAa	p.A642E	TTC18_ENST00000394865.1_Missense_Mutation_p.A642E|TTC18_ENST00000401621.2_Missense_Mutation_p.A642E|TTC18_ENST00000340329.3_Intron|TTC18_ENST00000355577.3_Missense_Mutation_p.A111E|TTC18_ENST00000493787.1_5'UTR	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		642						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					TGCTTCAAATGCAAAGAGTTG	0.373																																																	0													128.0	112.0	117.0					10																	75053076		2203	4300	6503	SO:0001583	missense	0																														ENST00000310715.3:c.1925C>A	10.37:g.75053076G>T	ENSP00000310829:p.Ala642Glu		C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A642E	ENST00000310715.3	37	c.1925	CCDS7324.3	10	.	.	.	.	.	.	.	.	.	.	G	27.0	4.788857	0.90367	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000433268;ENST00000394865	T;T;D;T	0.94576	-1.3;-1.3;-3.46;-1.3	5.63	5.63	0.86233	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.96803	0.8956	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97084	0.9786	10	0.72032	D	0.01	-18.5194	17.1754	0.86840	0.0:0.0:1.0:0.0	.	642	Q5T0N1	TTC18_HUMAN	E	642;642;642;49;642	ENSP00000310829:A642E;ENSP00000384479:A642E;ENSP00000409527:A49E;ENSP00000378334:A642E	ENSP00000310829:A642E	A	-	2	0	TTC18	74723082	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.638000	0.83328	2.632000	0.89209	0.557000	0.71058	GCA	TTC18	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000156042		0.373	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC18	HGNC	protein_coding		-	0.00	39	0	G			75053076	-1	tier1	-	no_errors	ENST00000310715	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	T
TTC28	23331	genome.wustl.edu	37	22	28492219	28492219	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr22:28492219G>T	ENST00000397906.2	-	11	3866	c.3725C>A	c.(3724-3726)gCt>gAt	p.A1242D		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1242					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						ATAGCCTGCAGCCAGGGAATA	0.493																																																	0													106.0	97.0	99.0					22																	28492219		692	1591	2283	SO:0001583	missense	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.3725C>A	22.37:g.28492219G>T	ENSP00000381003:p.Ala1242Asp		K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A1242D	ENST00000397906.2	37	c.3725	CCDS46678.1	22	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849868	0.91277	.	.	ENSG00000100154	ENST00000397906	D	0.90324	-2.65	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.95522	0.8545	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.95824	0.8852	10	0.87932	D	0	-13.2876	18.3669	0.90394	0.0:0.0:1.0:0.0	.	1242	Q96AY4	TTC28_HUMAN	D	1242	ENSP00000381003:A1242D	ENSP00000381003:A1242D	A	-	2	0	TTC28	26822219	1.000000	0.71417	0.957000	0.39632	0.983000	0.72400	9.238000	0.95380	2.577000	0.86979	0.655000	0.94253	GCT	TTC28	-	NULL	ENSG00000100154		0.493	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	-	0.00	45	0	G	XM_929318		28492219	-1	tier1	-	no_errors	ENST00000397906	ensembl	human	novel	74_37	missense	6.78	55	4	SNP	1.000	T
TTC28	23331	genome.wustl.edu	37	22	28497217	28497217	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr22:28497217C>T	ENST00000397906.2	-	9	3500	c.3359G>A	c.(3358-3360)cGc>cAc	p.R1120H		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1120					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						AAGGCCATGGCGAATTTTTGC	0.463																																																	0													117.0	106.0	110.0					22																	28497217		692	1591	2283	SO:0001583	missense	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.3359G>A	22.37:g.28497217C>T	ENSP00000381003:p.Arg1120His		K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R1120H	ENST00000397906.2	37	c.3359	CCDS46678.1	22	.	.	.	.	.	.	.	.	.	.	C	26.2	4.709924	0.89018	.	.	ENSG00000100154	ENST00000397906	T	0.75050	-0.9	5.48	5.48	0.80851	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.054727	0.85682	D	0.000000	D	0.83027	0.5165	M	0.70595	2.14	0.80722	D	1	D	0.76494	0.999	P	0.61477	0.889	T	0.78932	-0.2009	10	0.16420	T	0.52	-13.9564	18.3525	0.90343	0.0:1.0:0.0:0.0	.	1120	Q96AY4	TTC28_HUMAN	H	1120	ENSP00000381003:R1120H	ENSP00000381003:R1120H	R	-	2	0	TTC28	26827217	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.252000	0.78309	2.575000	0.86900	0.655000	0.94253	CGC	TTC28	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000100154		0.463	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	-	0.00	42	0	C	XM_929318		28497217	-1	tier1	-	no_errors	ENST00000397906	ensembl	human	novel	74_37	missense	32.26	42	20	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179590609	179590609	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:179590609A>C	ENST00000591111.1	-	68	19713	c.19489T>G	c.(19489-19491)Ttc>Gtc	p.F6497V	RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.F6814V|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.F5570V			Q8WZ42	TITIN_HUMAN	titin	12098	Ig-like 46.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTGTGTGGAAGTTTTTGGAT	0.428																																																	0													124.0	119.0	121.0					2																	179590609		1903	4148	6051	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.19489T>G	2.37:g.179590609A>C	ENSP00000465570:p.Phe6497Val		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.F5570V	ENST00000591111.1	37	c.16708		2	.	.	.	.	.	.	.	.	.	.	A	9.962	1.223173	0.22457	.	.	ENSG00000155657	ENST00000342992	T	0.66280	-0.2	5.72	5.72	0.89469	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.54464	0.1860	L	0.48877	1.53	0.80722	D	1	B	0.26147	0.143	B	0.23275	0.045	T	0.56733	-0.7930	9	0.87932	D	0	.	10.6206	0.45478	0.9284:0.0:0.0716:0.0	.	6497	Q8WZ42	TITIN_HUMAN	V	5570	ENSP00000343764:F5570V	ENSP00000343764:F5570V	F	-	1	0	TTN	179298854	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	4.131000	0.57970	2.311000	0.77944	0.533000	0.62120	TTC	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.428	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	58	0	A	NM_133378		179590609	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	38.98	36	23	SNP	0.998	C
TTN	7273	genome.wustl.edu	37	2	179509215	179509215	+	Intron	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:179509215G>A	ENST00000591111.1	-	168	35779				TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|RP11-171I2.3_ENST00000605021.1_lincRNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGGCAGAAAGAGCAAGGAGT	0.413																																																	0													145.0	122.0	129.0					2																	179509215		692	1591	2283	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.35554+59C>T	2.37:g.179509215G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	SNP	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			TTN-AS1	-	-	ENSG00000237298		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN-AS1	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	23	0	G	NM_133378		179509215	+1	tier1	-	no_errors	ENST00000418062	ensembl	human	known	74_37	rna	50.00	16	16	SNP	0.037	A
TTN	7273	genome.wustl.edu	37	2	179649066	179649066	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:179649066C>T	ENST00000591111.1	-	16	2730	c.2506G>A	c.(2506-2508)Ggt>Agt	p.G836S	TTN_ENST00000359218.5_Missense_Mutation_p.G790S|TTN_ENST00000460472.2_Missense_Mutation_p.G790S|TTN_ENST00000589042.1_Missense_Mutation_p.G836S|TTN_ENST00000342175.6_Missense_Mutation_p.G790S|TTN_ENST00000342992.6_Missense_Mutation_p.G836S|TTN_ENST00000360870.5_Missense_Mutation_p.G836S			Q8WZ42	TITIN_HUMAN	titin	33667					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.G836R(3)|p.G790R(3)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATAGCACTACCGGCTATTGAT	0.453																																																	6	Substitution - Missense(6)	lung(6)											60.0	54.0	56.0					2																	179649066		2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2506G>A	2.37:g.179649066C>T	ENSP00000465570:p.Gly836Ser		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.G836S	ENST00000591111.1	37	c.2506		2	.	.	.	.	.	.	.	.	.	.	C	18.52	3.641320	0.67244	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.81163	-1.46;-1.24;-1.27;-1.28;-0.16	5.52	5.52	0.82312	Ribonuclease H-like (1);	.	.	.	.	D	0.86247	0.5887	L	0.36672	1.1	0.41321	D	0.987176	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	P;P;P;D;D	0.79108	0.854;0.854;0.854;0.916;0.992	D	0.87284	0.2294	9	0.87932	D	0	.	19.7987	0.96497	0.0:1.0:0.0:0.0	.	790;790;790;836;836	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	S	836;790;790;790;790;836	ENSP00000343764:G836S;ENSP00000434586:G790S;ENSP00000340554:G790S;ENSP00000352154:G790S;ENSP00000354117:G836S	ENSP00000340554:G790S	G	-	1	0	TTN	179357311	1.000000	0.71417	0.871000	0.34182	0.996000	0.88848	7.447000	0.80620	2.767000	0.95098	0.655000	0.94253	GGT	TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.453	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	23	0	C	NM_133378		179649066	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	28.95	27	11	SNP	0.999	T
TUBB2B	347733	genome.wustl.edu	37	6	3225656	3225656	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr6:3225656C>T	ENST00000259818.7	-	4	858	c.667G>A	c.(667-669)Ggg>Agg	p.G223R	TUBB2B_ENST00000473006.1_5'UTR	NM_178012.4	NP_821080.1	Q9BVA1	TBB2B_HUMAN	tubulin, beta 2B class IIb	223					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|neuron migration (GO:0001764)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			kidney(2)|large_intestine(5)|lung(1)|prostate(1)|skin(1)	10	Ovarian(93;0.0386)	all_hematologic(90;0.108)				TTGAGGTCCCCGTAGGTGGGG	0.617																																																	0													41.0	27.0	32.0					6																	3225656		1508	3172	4680	SO:0001583	missense	0			BC001352	CCDS4485.1	6p25.2	2011-10-10	2011-10-10		ENSG00000137285	ENSG00000137285		"""Tubulins"""	30829	protein-coding gene	gene with protein product	"""class IIb beta-tubulin"""	612850	"""tubulin, beta 2B"""			8619474, 9110174	Standard	NM_178012		Approved	MGC8685, DKFZp566F223, bA506K6.1	uc003mvg.3	Q9BVA1	OTTHUMG00000014143	ENST00000259818.7:c.667G>A	6.37:g.3225656C>T	ENSP00000259818:p.Gly223Arg		A8K068	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.G223R	ENST00000259818.7	37	c.667	CCDS4485.1	6	.	.	.	.	.	.	.	.	.	.	C	16.62	3.172948	0.57584	.	.	ENSG00000137285	ENST00000259818	T	0.67865	-0.29	5.06	5.06	0.68205	Tubulin/FtsZ, GTPase domain (3);	0.000000	0.64402	D	0.000003	T	0.79185	0.4403	M	0.74467	2.265	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.77004	0.976;0.976;0.989	T	0.82090	-0.0629	10	0.87932	D	0	.	18.4992	0.90875	0.0:1.0:0.0:0.0	.	223;223;223	Q8IZ29;Q8IWP6;Q9BVA1	.;.;TBB2B_HUMAN	R	223	ENSP00000259818:G223R	ENSP00000259818:G223R	G	-	1	0	TUBB2B	3170655	1.000000	0.71417	0.963000	0.40424	0.977000	0.68977	7.620000	0.83070	2.368000	0.80403	0.603000	0.83216	GGG	TUBB2B	-	superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Beta_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	ENSG00000137285		0.617	TUBB2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB2B	HGNC	protein_coding	OTTHUMT00000039680.2	-	0.00	63	0	C	NM_178012		3225656	-1	tier1	-	no_errors	ENST00000259818	ensembl	human	known	74_37	missense	42.11	33	24	SNP	1.000	T
TUBB3	10381	genome.wustl.edu	37	16	90001934	90001934	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:90001934C>A	ENST00000315491.7	+	4	1198	c.1075C>A	c.(1075-1077)Cgc>Agc	p.R359S	TUBB3_ENST00000556922.1_Missense_Mutation_p.R706S|TUBB3_ENST00000555576.1_Intron|TUBB3_ENST00000554444.1_Missense_Mutation_p.R287S|TUBB3_ENST00000304984.5_Missense_Mutation_p.R287S	NM_006086.3	NP_006077.2	Q13509	TBB3_HUMAN	tubulin, beta 3 class III	359					'de novo' posttranslational protein folding (GO:0051084)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)	Ixabepilone(DB04845)	CATCCCGCCCCGCGGCCTCAA	0.607																																																	0													175.0	153.0	160.0					16																	90001934		2198	4300	6498	SO:0001583	missense	0			BC000748	CCDS10988.1, CCDS56012.1	16q24.3	2014-02-04	2011-10-10		ENSG00000198211	ENSG00000198211		"""Tubulins"""	20772	protein-coding gene	gene with protein product	"""class III beta-tubulin"""	602661	"""tubulin, beta 3"", ""fibrosis of extraocular muscles, congenital, 3"""	FEOM3		9473684, 8098743, 20074521	Standard	NM_006086		Approved	beta-4, CFEOM3, CFEOM3A	uc002fph.2	Q13509	OTTHUMG00000138985	ENST00000315491.7:c.1075C>A	16.37:g.90001934C>A	ENSP00000320295:p.Arg359Ser		A8K854|Q9BTZ0|Q9BW10	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.R359S	ENST00000315491.7	37	c.1075	CCDS10988.1	16	.	.	.	.	.	.	.	.	.	.	C	11.12	1.546013	0.27652	.	.	ENSG00000258947;ENSG00000258947;ENSG00000258947;ENSG00000198211;ENSG00000198211	ENST00000556922;ENST00000555399;ENST00000304984;ENST00000554444;ENST00000315491	T;T;T;T	0.80824	-1.42;-1.42;-1.42;-1.42	4.66	4.66	0.58398	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.56097	D	0.000026	T	0.78923	0.4360	M	0.62209	1.925	0.51012	D	0.999906	B;B	0.23490	0.007;0.086	B;B	0.25506	0.028;0.061	T	0.75213	-0.3397	9	.	.	.	.	17.5117	0.87762	0.0:1.0:0.0:0.0	.	359;359	Q13509;B2RBD5	TBB3_HUMAN;.	S	706;359;287;287;359	ENSP00000451560:R706S;ENSP00000302777:R287S;ENSP00000451617:R287S;ENSP00000320295:R359S	.	R	+	1	0	RP11-566K11.2;TUBB3	88529435	1.000000	0.71417	0.940000	0.37924	0.834000	0.47266	5.725000	0.68507	2.313000	0.78055	0.561000	0.74099	CGC	TUBB3	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin	ENSG00000258947		0.607	TUBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB3	Uniprot_gn	protein_coding	OTTHUMT00000272874.1		0.00	47	0	C	NM_006086		90001934	+1			no_errors	ENST00000315491	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	A
TXNDC2	84203	genome.wustl.edu	37	18	9887085	9887085	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:9887085G>A	ENST00000306084.6	+	2	808	c.609G>A	c.(607-609)caG>caA	p.Q203Q	TXNDC2_ENST00000536353.2_Intron|TXNDC2_ENST00000357775.5_Silent_p.Q136Q	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	203	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						AAGCCATCCAGCCCAAAGAGG	0.577																																																	0													152.0	154.0	153.0					18																	9887085		2203	4300	6503	SO:0001819	synonymous_variant	0			AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.609G>A	18.37:g.9887085G>A			A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Silent	SNP	pfam_Thioredoxin_domain,pfam_Glutenin,superfamily_Thioredoxin-like_fold	p.Q203	ENST00000306084.6	37	c.609	CCDS42414.1	18																																																																																			TXNDC2	-	pfam_Glutenin	ENSG00000168454		0.577	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TXNDC2	HGNC	protein_coding	OTTHUMT00000254487.1	-	0.00	46	0	G			9887085	+1	tier1	-	no_errors	ENST00000306084	ensembl	human	known	74_37	silent	22.45	38	11	SNP	0.000	A
TXNDC2	84203	genome.wustl.edu	37	18	9888020	9888020	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:9888020G>T	ENST00000306084.6	+	2	1743	c.1544G>T	c.(1543-1545)aGa>aTa	p.R515I	TXNDC2_ENST00000536353.2_3'UTR|TXNDC2_ENST00000357775.5_Missense_Mutation_p.R448I	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	515	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						GAGGTGGTGAGAGAGTGCGCC	0.498																																																	0													98.0	83.0	88.0					18																	9888020		2203	4300	6503	SO:0001583	missense	0			AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.1544G>T	18.37:g.9888020G>T	ENSP00000304908:p.Arg515Ile		A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	pfam_Thioredoxin_domain,pfam_Glutenin,superfamily_Thioredoxin-like_fold	p.R515I	ENST00000306084.6	37	c.1544	CCDS42414.1	18	.	.	.	.	.	.	.	.	.	.	G	6.303	0.424083	0.11928	.	.	ENSG00000168454	ENST00000536353;ENST00000357775;ENST00000306084;ENST00000426718	T;T	0.14391	2.51;2.51	4.05	-7.0	0.01599	Thioredoxin domain (1);Thioredoxin-like fold (3);	1.135910	0.06622	N	0.757516	T	0.05823	0.0152	N	0.17474	0.49	0.09310	N	1	B	0.30634	0.288	B	0.29267	0.1	T	0.34378	-0.9831	9	.	.	.	0.4968	3.4368	0.07449	0.2658:0.1327:0.471:0.1305	.	515	Q86VQ3	TXND2_HUMAN	I	313;448;515;500	ENSP00000350419:R448I;ENSP00000304908:R515I	.	R	+	2	0	TXNDC2	9878020	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.970000	0.03810	-1.499000	0.01821	-0.157000	0.13467	AGA	TXNDC2	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000168454		0.498	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TXNDC2	HGNC	protein_coding	OTTHUMT00000254487.1	-	0.00	56	0	G			9888020	+1	tier1	-	no_errors	ENST00000306084	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.000	T
UCK1	83549	genome.wustl.edu	37	9	134404446	134404446	+	Intron	SNP	C	C	T	rs370591704		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:134404446C>T	ENST00000372215.4	-	5	602				UCK1_ENST00000372208.3_Intron|UCK1_ENST00000372210.3_Intron|UCK1_ENST00000372211.3_Intron|UCK1_ENST00000459858.1_5'UTR	NM_001261450.1|NM_001261451.1|NM_031432.2	NP_001248379.1|NP_001248380.1|NP_113620.1	Q9HA47	UCK1_HUMAN	uridine-cytidine kinase 1						CTP salvage (GO:0044211)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)	cytosol (GO:0005829)	ATP binding (GO:0005524)|nucleoside kinase activity (GO:0019206)|uridine kinase activity (GO:0004849)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|skin(1)|upper_aerodigestive_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;2.34e-05)|Epithelial(140;0.000219)		AAGGGGCAGGCGTGCTTCAGA	0.682																																					Melanoma(42;523 1129 28385 43975 48113)												0								C	,	0,4406		0,0,2203	49.0	37.0	41.0		,	-6.0	0.0	9		41	1,8599		0,1,4299	no	intron,intron	UCK1	NM_001135954.1,NM_031432.2	,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,	,	134404446	1,13005	2203	4300	6503	SO:0001627	intron_variant	0			AF237290	CCDS6944.1, CCDS48046.1, CCDS59151.1, CCDS59152.1	9q34.1	2008-02-05			ENSG00000130717	ENSG00000130717	2.7.1.48		14859	protein-coding gene	gene with protein product		609328				11306702	Standard	NM_031432		Approved	URK1, FLJ12255	uc031tfj.1	Q9HA47	OTTHUMG00000020823	ENST00000372215.4:c.509-21G>A	9.37:g.134404446C>T			Q5JT09|Q5JT10|Q5JT12|Q5JT13|Q6IA74|Q96BJ0	RNA	SNP	-	NULL	ENST00000372215.4	37	NULL	CCDS6944.1	9																																																																																			UCK1	-	-	ENSG00000130717		0.682	UCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCK1	HGNC	protein_coding	OTTHUMT00000054726.1	-	0.00	36	0	C	NM_031432		134404446	-1	tier1	-	no_errors	ENST00000459858	ensembl	human	known	74_37	rna	40.00	33	22	SNP	0.000	T
UGT2B11	10720	genome.wustl.edu	37	4	70080365	70080365	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:70080365C>A	ENST00000446444.1	-	1	84	c.76G>T	c.(76-78)Gtg>Ttg	p.V26L	RP11-704M14.1_ENST00000505646.1_RNA|RP11-704M14.1_ENST00000504301.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	26					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						CACACCAGCACTTTTCCACAA	0.448																																																	0													202.0	205.0	204.0					4																	70080365		2203	4300	6503	SO:0001583	missense	0			AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.76G>T	4.37:g.70080365C>A	ENSP00000387683:p.Val26Leu		Q3KNV9	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.V26L	ENST00000446444.1	37	c.76	CCDS3527.1	4	.	.	.	.	.	.	.	.	.	.	-	3.885	-0.025160	0.07589	.	.	ENSG00000213759	ENST00000446444	T	0.60424	0.19	1.96	1.05	0.20165	.	0.109182	0.38492	U	0.001680	T	0.47563	0.1452	M	0.64170	1.965	0.21220	N	0.999756	B	0.27229	0.172	B	0.33339	0.162	T	0.21280	-1.0250	10	0.25106	T	0.35	.	3.4761	0.07585	0.0:0.592:0.0:0.408	.	26	O75310	UDB11_HUMAN	L	26	ENSP00000387683:V26L	ENSP00000387683:V26L	V	-	1	0	UGT2B11	70114954	0.408000	0.25360	0.426000	0.26672	0.028000	0.11728	0.777000	0.26718	1.087000	0.41251	0.184000	0.17185	GTG	UGT2B11	-	pfam_UDP_glucos_trans	ENSG00000213759		0.448	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B11	HGNC	protein_coding	OTTHUMT00000251551.2	-	0.00	113	0	C	NM_001073		70080365	-1	tier1	-	no_errors	ENST00000446444	ensembl	human	known	74_37	missense	34.58	70	37	SNP	0.895	A
UNC80	285175	genome.wustl.edu	37	2	210806029	210806029	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:210806029G>T	ENST00000439458.1	+	43	6613	c.6533G>T	c.(6532-6534)aGc>aTc	p.S2178I	UNC80_ENST00000272845.6_Missense_Mutation_p.S2173I	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2178					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GGCATGCCGAGCGAGTTTCCA	0.517																																																	0													169.0	155.0	159.0					2																	210806029		692	1591	2283	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.6533G>T	2.37:g.210806029G>T	ENSP00000391088:p.Ser2178Ile		B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.S2178I	ENST00000439458.1	37	c.6533	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	G	32	5.159331	0.94686	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.34472	1.36;1.36	5.07	5.07	0.68467	.	0.041576	0.85682	D	0.000000	T	0.52125	0.1715	L	0.38175	1.15	0.80722	D	1	D	0.64830	0.994	D	0.74348	0.983	T	0.55692	-0.8101	10	0.87932	D	0	-9.6517	18.438	0.90653	0.0:0.0:1.0:0.0	.	2178	Q8N2C7	UNC80_HUMAN	I	2178;2173	ENSP00000391088:S2178I;ENSP00000272845:S2173I	ENSP00000272845:S2173I	S	+	2	0	UNC80	210514274	1.000000	0.71417	0.993000	0.49108	0.965000	0.64279	9.575000	0.98187	2.362000	0.80069	0.561000	0.74099	AGC	UNC80	-	NULL	ENSG00000144406		0.517	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		-	0.00	87	0	G	NM_182587		210806029	+1	tier1	-	no_errors	ENST00000439458	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
URB2	9816	genome.wustl.edu	37	1	229781688	229781688	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr1:229781688C>T	ENST00000258243.2	+	6	4014	c.3878C>T	c.(3877-3879)gCg>gTg	p.A1293V		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1293						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						TTGTGGCGTGCGTGTCCCCAG	0.522																																																	0													215.0	190.0	198.0					1																	229781688		2203	4300	6503	SO:0001583	missense	0			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.3878C>T	1.37:g.229781688C>T	ENSP00000258243:p.Ala1293Val		Q5VYC9	Missense_Mutation	SNP	pfam_Urb2/Npa2_C	p.A1293V	ENST00000258243.2	37	c.3878	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	C	4.935	0.173684	0.09391	.	.	ENSG00000135763	ENST00000258243	T	0.30714	1.52	5.43	4.5	0.54988	.	0.448888	0.25575	N	0.029728	T	0.27832	0.0685	L	0.47716	1.5	0.09310	N	1	P	0.41498	0.752	B	0.39185	0.293	T	0.18493	-1.0335	9	.	.	.	-8.546	13.3838	0.60785	0.0:0.9227:0.0:0.0773	.	1293	Q14146	URB2_HUMAN	V	1293	ENSP00000258243:A1293V	.	A	+	2	0	URB2	227848311	0.004000	0.15560	0.030000	0.17652	0.981000	0.71138	1.855000	0.39378	2.709000	0.92574	0.491000	0.48974	GCG	URB2	-	NULL	ENSG00000135763		0.522	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	-	0.00	43	0	C	NM_014777		229781688	+1	tier1	-	no_errors	ENST00000258243	ensembl	human	known	74_37	missense	48.65	19	18	SNP	0.023	T
USP32P2	220594	genome.wustl.edu	37	17	18415649	18415649	+	RNA	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:18415649G>T	ENST00000425211.1	-	0	3620				USP32P2_ENST00000412260.1_RNA																							TTTTTAAAGTGCAAAACAAAC	0.408																																																	0																																												0																															17.37:g.18415649G>T				RNA	SNP	-	NULL	ENST00000425211.1	37	NULL		17																																																																																			USP32P2	-	-	ENSG00000233327		0.408	CTD-2303H24.2-001	KNOWN	basic|readthrough_transcript	processed_transcript	USP32P2	HGNC	processed_transcript	OTTHUMT00000473021.1	-	0.00	80	0	G			18415649	-1	tier1	-	no_errors	ENST00000412260	ensembl	human	known	74_37	rna	5.97	63	4	SNP	0.074	T
VAC14	55697	genome.wustl.edu	37	16	70819617	70819617	+	Silent	SNP	G	G	A	rs151275776		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr16:70819617G>A	ENST00000261776.5	-	3	671	c.411C>T	c.(409-411)gaC>gaT	p.D137D		NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	137					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				TGCTCAGCCCGTCAAAGAGCA	0.612																																																	0								G		1,4387		0,1,2193	36.0	27.0	30.0		411	-8.8	0.0	16	dbSNP_134	30	1,8581		0,1,4290	no	coding-synonymous	VAC14	NM_018052.3		0,2,6483	AA,AG,GG		0.0117,0.0228,0.0154		137/783	70819617	2,12968	2194	4291	6485	SO:0001819	synonymous_variant	0			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.411C>T	16.37:g.70819617G>A			B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Silent	SNP	pfam_VAC14_Fig4p-bd,pfam_HEAT,superfamily_ARM-type_fold	p.D137	ENST00000261776.5	37	c.411	CCDS10896.1	16																																																																																			VAC14	-	superfamily_ARM-type_fold	ENSG00000103043		0.612	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	HGNC	protein_coding	OTTHUMT00000268973.3	-	0.00	22	0	G	NM_018052		70819617	-1	tier1	rs151275776	no_errors	ENST00000261776	ensembl	human	known	74_37	silent	58.33	5	7	SNP	0.190	A
VAV1	7409	genome.wustl.edu	37	19	6853990	6853990	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:6853990G>T	ENST00000602142.1	+	26	2447	c.2365G>T	c.(2365-2367)Gcc>Tcc	p.A789S	VAV1_ENST00000304076.2_Missense_Mutation_p.A767S|VAV1_ENST00000599806.1_Missense_Mutation_p.A734S|VAV1_ENST00000596764.1_Missense_Mutation_p.A757S|VAV1_ENST00000539284.1_Missense_Mutation_p.A692S	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	789	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A789T(1)		biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CACAGCCAAAGCCCGCTATGA	0.542																																																	1	Substitution - Missense(1)	lung(1)											104.0	96.0	98.0					19																	6853990		2203	4300	6503	SO:0001583	missense	0				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.2365G>T	19.37:g.6853990G>T	ENSP00000472929:p.Ala789Ser		B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH3_domain,prints_SH2,prints_SM22_calponin	p.A789S	ENST00000602142.1	37	c.2365	CCDS12174.1	19	.	.	.	.	.	.	.	.	.	.	G	28.0	4.879377	0.91740	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T	0.81330	-1.48	4.35	4.35	0.52113	Src homology-3 domain (5);	0.063689	0.64402	D	0.000009	D	0.90676	0.7075	M	0.90145	3.09	0.58432	D	0.999999	P;P;D;D	0.63880	0.64;0.794;0.993;0.975	P;P;D;D	0.69824	0.716;0.819;0.966;0.944	D	0.92606	0.6095	10	0.87932	D	0	.	14.4087	0.67101	0.0:0.0:1.0:0.0	.	692;789;734;789	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	S	789;692	ENSP00000443242:A692S	ENSP00000302269:A789S	A	+	1	0	VAV1	6804990	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.237000	0.89807	2.278000	0.76064	0.561000	0.74099	GCC	VAV1	-	pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain	ENSG00000141968		0.542	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV1	HGNC	protein_coding	OTTHUMT00000458475.1		0.00	26	0	G			6853990	+1			no_errors	ENST00000602142	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
VAV2	7410	genome.wustl.edu	37	9	136671268	136671268	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr9:136671268G>T	ENST00000371850.3	-	9	802	c.771C>A	c.(769-771)gcC>gcA	p.A257A	VAV2_ENST00000371851.1_Silent_p.A252A|VAV2_ENST00000406606.3_Silent_p.A252A	NM_001134398.1	NP_001127870.1	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor	257	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	35				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		ACACGTCGATGGCCCTCAGGA	0.647																																																	0													81.0	53.0	63.0					9																	136671268		2200	4300	6500	SO:0001819	synonymous_variant	0				CCDS6979.1, CCDS48053.1	9q34.1	2013-02-14	2007-07-25		ENSG00000160293	ENSG00000160293		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12658	protein-coding gene	gene with protein product		600428	"""vav 2 oncogene"""			7762982	Standard	NM_003371		Approved		uc004ces.3	P52735	OTTHUMG00000020882	ENST00000371850.3:c.771C>A	9.37:g.136671268G>T			A2RUM4|A8MQ12|B6ZDF5|Q5SYV3|Q5SYV4|Q5SYV5|Q6N012|Q6PIJ9|Q6Q317	Silent	SNP	pfam_DH-domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH3_domain,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH2,prints_SH3_domain	p.A257	ENST00000371850.3	37	c.771	CCDS48053.1	9																																																																																			VAV2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000160293		0.647	VAV2-001	KNOWN	basic|CCDS	protein_coding	VAV2	HGNC	protein_coding	OTTHUMT00000054939.1	-	0.00	63	0	G			136671268	-1	tier1	-	no_errors	ENST00000371850	ensembl	human	known	74_37	silent	5.41	70	4	SNP	1.000	T
VAX1	11023	genome.wustl.edu	37	10	118893720	118893720	+	Silent	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:118893720C>T	ENST00000369206.5	-	3	803	c.804G>A	c.(802-804)gcG>gcA	p.A268A	VAX1_ENST00000277905.2_Intron	NM_001112704.1	NP_001106175.1	Q5SQQ9	VAX1_HUMAN	ventral anterior homeobox 1	268	Ala-rich.				axon guidance (GO:0007411)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|palate development (GO:0060021)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(8)|ovary(2)	12				all cancers(201;0.0108)		GGCTGTGGCCCGCGGCCGGGG	0.766																																																	0													13.0	15.0	14.0					10																	118893720		692	1589	2281	SO:0001819	synonymous_variant	0			AK127095	CCDS7597.1, CCDS44483.1	10q26.11	2011-06-20			ENSG00000148704	ENSG00000148704		"""Homeoboxes / ANTP class : NKL subclass"""	12660	protein-coding gene	gene with protein product		604294				9636075, 10485894	Standard	NM_199131		Approved		uc009xyx.3	Q5SQQ9	OTTHUMG00000019117	ENST00000369206.5:c.804G>A	10.37:g.118893720C>T			B1AVW5|Q6ZSX0	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_HTH_motif	p.A268	ENST00000369206.5	37	c.804	CCDS44483.1	10																																																																																			VAX1	-	NULL	ENSG00000148704		0.766	VAX1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VAX1	HGNC	protein_coding	OTTHUMT00000050559.3	-	0.00	17	0	C	XM_301242		118893720	-1	tier1	-	no_errors	ENST00000369206	ensembl	human	known	74_37	silent	48.15	14	13	SNP	0.001	T
VIPR2	7434	genome.wustl.edu	37	7	158937138	158937138	+	Intron	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:158937138C>T	ENST00000262178.2	-	1	237				VIPR2_ENST00000402066.1_Missense_Mutation_p.R109H|VIPR2_ENST00000421760.2_Intron	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2						activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		CAGGAAGAAACGATCCCGTTT	0.721																																					Pancreas(154;1876 1931 2329 17914 20079)												0																																										SO:0001627	intron_variant	0			CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.51+274G>A	7.37:g.158937138C>T			Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_VIP_rcpt_2,prints_GPCR_2_secretin-like,prints_GPCR_2_VIP_rcpt	p.R109H	ENST00000262178.2	37	c.326	CCDS5950.1	7	.	.	.	.	.	.	.	.	.	.	c	15.09	2.728967	0.48833	.	.	ENSG00000106018	ENST00000402066	T	0.53423	0.62	2.49	-1.44	0.08856	.	.	.	.	.	T	0.29355	0.0731	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.24905	-1.0147	5	.	.	.	.	3.3168	0.07036	0.0:0.3837:0.2465:0.3697	.	.	.	.	H	109	ENSP00000384497:R109H	.	R	-	2	0	VIPR2	158629899	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	0.342000	0.19926	-0.300000	0.08895	0.473000	0.43528	CGT	VIPR2	-	NULL	ENSG00000106018		0.721	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPR2	HGNC	protein_coding	OTTHUMT00000322675.1	-	0.00	22	0	C	NM_003382		158937138	-1	tier1	-	no_errors	ENST00000402066	ensembl	human	novel	74_37	missense	17.65	14	3	SNP	0.000	T
VPS4B	9525	genome.wustl.edu	37	18	61064444	61064444	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr18:61064444G>A	ENST00000238497.5	-	9	1118	c.915C>T	c.(913-915)gcC>gcT	p.A305A	VPS4B_ENST00000591383.1_5'Flank	NM_004869.3	NP_004860.2	O75351	VPS4B_HUMAN	vacuolar protein sorting 4 homolog B (S. cerevisiae)	305					ATP catabolic process (GO:0006200)|cell cycle (GO:0007049)|cell division (GO:0051301)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|intracellular cholesterol transport (GO:0032367)|membrane organization (GO:0061024)|positive regulation of viral release from host cell (GO:1902188)|potassium ion transport (GO:0006813)|protein transport (GO:0015031)|regulation of viral process (GO:0050792)|response to lipid (GO:0033993)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|nucleus (GO:0005634)|vacuolar membrane (GO:0005774)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)			breast(1)|large_intestine(3)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	13						TTGCTGCTCGGGCATGGGGTT	0.403																																																	0													61.0	62.0	62.0					18																	61064444		2203	4300	6503	SO:0001819	synonymous_variant	0			AF038960	CCDS11983.1	18q21.33	2010-04-21	2006-04-04	2002-06-14	ENSG00000119541	ENSG00000119541		"""ATPases / AAA-type"""	10895	protein-coding gene	gene with protein product		609983	"""suppressor of K+ transport defect 1"", ""vacuolar protein sorting 4B (yeast)"""	SKD1		11563910	Standard	XM_006722582		Approved	VPS4-2, SKD1B	uc002lix.3	O75351	OTTHUMG00000132790	ENST00000238497.5:c.915C>T	18.37:g.61064444G>A			Q69HW4|Q9GZS7	Silent	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase	p.A305	ENST00000238497.5	37	c.915	CCDS11983.1	18																																																																																			VPS4B	-	superfamily_P-loop_NTPase	ENSG00000119541		0.403	VPS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4B	HGNC	protein_coding	OTTHUMT00000256198.2	-	0.00	27	0	G	NM_004869		61064444	-1	tier1	-	no_errors	ENST00000238497	ensembl	human	known	74_37	silent	34.62	17	9	SNP	0.901	A
VWA8	23078	genome.wustl.edu	37	13	42461412	42461412	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr13:42461412G>T	ENST00000379310.3	-	6	805	c.737C>A	c.(736-738)cCa>cAa	p.P246Q	VWA8_ENST00000281496.6_Missense_Mutation_p.P246Q	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	246						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										AGAATACCTTGGCACTGGCAA	0.403																																																	0													67.0	71.0	70.0					13																	42461412		2203	4300	6503	SO:0001583	missense	0			AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.737C>A	13.37:g.42461412G>T	ENSP00000368612:p.Pro246Gln		O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_VWF_A,superfamily_P-loop_NTPase,smart_AAA+_ATPase,smart_VWF_A,pfscan_VWF_A	p.P246Q	ENST00000379310.3	37	c.737	CCDS41881.1	13	.	.	.	.	.	.	.	.	.	.	G	25.9	4.682382	0.88542	.	.	ENSG00000102763	ENST00000251030;ENST00000379310;ENST00000281496;ENST00000398857	T;T	0.56275	0.47;0.47	5.11	5.11	0.69529	ATPase, dynein-related, AAA domain (1);	0.000000	0.64402	D	0.000001	T	0.71702	0.3371	M	0.71581	2.175	0.80722	D	1	D	0.55605	0.972	D	0.64687	0.928	T	0.74765	-0.3554	10	0.72032	D	0.01	.	18.9359	0.92584	0.0:0.0:1.0:0.0	.	246	A3KMH1	K0564_HUMAN	Q	150;246;246;246	ENSP00000368612:P246Q;ENSP00000281496:P246Q	ENSP00000251030:P150Q	P	-	2	0	KIAA0564	41359412	1.000000	0.71417	0.983000	0.44433	0.985000	0.73830	9.740000	0.98839	2.538000	0.85594	0.650000	0.86243	CCA	VWA8	-	pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase	ENSG00000102763		0.403	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA8	HGNC	protein_coding	OTTHUMT00000354828.2	-	0.00	23	0	G	NM_015058		42461412	-1	tier1	-	no_errors	ENST00000379310	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	T
WBP2	23558	genome.wustl.edu	37	17	73843603	73843603	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:73843603G>A	ENST00000591399.1	-	7	1044	c.620C>T	c.(619-621)cCg>cTg	p.P207L	WBP2_ENST00000433525.2_Missense_Mutation_p.P162L|WBP2_ENST00000344296.4_Missense_Mutation_p.P185L|WBP2_ENST00000590450.1_5'Flank|UNC13D_ENST00000207549.4_5'Flank|WBP2_ENST00000590221.1_Missense_Mutation_p.P203L|WBP2_ENST00000254806.3_Missense_Mutation_p.P207L|WBP2_ENST00000585462.1_Missense_Mutation_p.P185L			Q969T9	WBP2_HUMAN	WW domain binding protein 2	207	Pro-rich.				cellular response to estrogen stimulus (GO:0071391)|establishment of protein localization (GO:0045184)|positive regulation of gene expression, epigenetic (GO:0045815)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nuclear chromatin (GO:0000790)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription coactivator activity (GO:0001105)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)	7			all cancers(21;2.61e-06)|Epithelial(20;2.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00092)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCCGCTGACCGGAGGTTCCAT	0.677																																																	0													18.0	22.0	20.0					17																	73843603		2200	4294	6494	SO:0001583	missense	0			U79458	CCDS11731.1	17q25	2008-02-01				ENSG00000132471			12738	protein-coding gene	gene with protein product		606962				7644498	Standard	NM_012478		Approved	WBP-2	uc002jps.3	Q969T9		ENST00000591399.1:c.620C>T	17.37:g.73843603G>A	ENSP00000467579:p.Pro207Leu		O95638	Missense_Mutation	SNP	pfam_WW-domain-binding,pfam_GRAM	p.P207L	ENST00000591399.1	37	c.620	CCDS11731.1	17	.	.	.	.	.	.	.	.	.	.	g	15.50	2.852523	0.51270	.	.	ENSG00000132471	ENST00000254806;ENST00000344296;ENST00000433525;ENST00000416574	T;T;D	0.84370	1.82;1.39;-1.84	3.92	3.92	0.45320	.	0.215756	0.49305	D	0.000147	D	0.87124	0.6099	N	0.25426	0.745	0.80722	D	1	D;B;B;B	0.89917	1.0;0.042;0.02;0.02	D;B;B;B	0.85130	0.997;0.02;0.005;0.005	D	0.87454	0.2403	10	0.41790	T	0.15	0.5214	16.1347	0.81475	0.0:0.0:1.0:0.0	.	176;162;207;207	B4DV07;B4DFG2;Q7Z511;Q969T9	.;.;.;WBP2_HUMAN	L	207;185;162;176	ENSP00000254806:P207L;ENSP00000341570:P185L;ENSP00000415251:P162L	ENSP00000254806:P207L	P	-	2	0	WBP2	71355198	1.000000	0.71417	0.870000	0.34147	0.972000	0.66771	5.923000	0.70045	2.027000	0.59764	0.556000	0.70494	CCG	WBP2	-	NULL	ENSG00000132471		0.677	WBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP2	HGNC	protein_coding	OTTHUMT00000448862.1		0.00	21	0	G	NM_012478		73843603	-1			no_errors	ENST00000254806	ensembl	human	known	74_37	missense	21.43	11	3	SNP	0.989	A
WDFY3	23001	genome.wustl.edu	37	4	85731152	85731152	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:85731152G>T	ENST00000295888.4	-	14	2640	c.2233C>A	c.(2233-2235)Caa>Aaa	p.Q745K	WDFY3_ENST00000322366.6_Missense_Mutation_p.Q745K|WDFY3-AS1_ENST00000510449.1_RNA	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	745					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		AAAAGTCTTTGAAATGGCTGT	0.398																																																	0													153.0	146.0	148.0					4																	85731152		2203	4300	6503	SO:0001583	missense	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.2233C>A	4.37:g.85731152G>T	ENSP00000295888:p.Gln745Lys		Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl_sf,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q745K	ENST00000295888.4	37	c.2233	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	G	14.92	2.679344	0.47886	.	.	ENSG00000163625	ENST00000322366;ENST00000295888	T;T	0.62941	-0.01;-0.01	6.07	5.22	0.72569	.	0.103912	0.64402	D	0.000002	T	0.51702	0.1690	L	0.40543	1.245	0.80722	D	1	B;B	0.25007	0.116;0.033	B;B	0.22386	0.039;0.009	T	0.49634	-0.8919	10	0.07482	T	0.82	.	17.2219	0.86960	0.0:0.1259:0.8741:0.0	.	745;745	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	K	745	ENSP00000318466:Q745K;ENSP00000295888:Q745K	ENSP00000295888:Q745K	Q	-	1	0	WDFY3	85950176	1.000000	0.71417	0.995000	0.50966	0.552000	0.35366	7.477000	0.81069	1.537000	0.49254	0.655000	0.94253	CAA	WDFY3	-	superfamily_ARM-type_fold	ENSG00000163625		0.398	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	-	0.00	58	0	G	NM_014991		85731152	-1	tier1	-	no_errors	ENST00000295888	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	T
WDR36	134430	genome.wustl.edu	37	5	110461440	110461440	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:110461440G>T	ENST00000513710.2	+	22	2657	c.2653G>T	c.(2653-2655)Gac>Tac	p.D885Y	WDR36_ENST00000506538.2_Missense_Mutation_p.D885Y			Q8NI36	WDR36_HUMAN	WD repeat domain 36	885					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.D885N(1)		cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		GATGATGCTGGACAGAAAGCG	0.453																																																	1	Substitution - Missense(1)	lung(1)											166.0	161.0	163.0					5																	110461440		2202	4300	6502	SO:0001583	missense	0			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.2653G>T	5.37:g.110461440G>T	ENSP00000424628:p.Asp885Tyr		A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D885Y	ENST00000513710.2	37	c.2653	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	G	10.02	1.236094	0.22626	.	.	ENSG00000134987	ENST00000506538;ENST00000513710	T;T	0.77229	-1.08;-1.08	5.39	3.48	0.39840	Small-subunit processome, Utp21 (1);	0.549745	0.21922	N	0.067155	T	0.66809	0.2827	L	0.44542	1.39	0.80722	D	1	B	0.30634	0.288	B	0.30401	0.115	T	0.69146	-0.5222	10	0.87932	D	0	-3.5768	5.9583	0.19286	0.1453:0.1982:0.6565:0.0	.	885	Q8NI36	WDR36_HUMAN	Y	885	ENSP00000423067:D885Y;ENSP00000424628:D885Y	ENSP00000423067:D885Y	D	+	1	0	WDR36	110489339	0.999000	0.42202	0.999000	0.59377	0.232000	0.25224	1.549000	0.36212	2.668000	0.90789	0.650000	0.86243	GAC	WDR36	-	pfam_SSU_processome_Utp21	ENSG00000134987		0.453	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3		0.00	46	0	G	NM_139281		110461440	+1			no_errors	ENST00000506538	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.957	T
WDR48	57599	genome.wustl.edu	37	3	39130733	39130733	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr3:39130733G>T	ENST00000302313.5	+	16	1620	c.1592G>T	c.(1591-1593)cGa>cTa	p.R531L	WDR48_ENST00000544962.1_Missense_Mutation_p.R256L|WDR48_ENST00000418020.1_5'UTR|WDR48_ENST00000396258.3_Missense_Mutation_p.R449L	NM_020839.2	NP_065890.1	Q8TAF3	WDR48_HUMAN	WD repeat domain 48	531					double-strand break repair via homologous recombination (GO:0000724)|embryonic organ development (GO:0048568)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|positive regulation of epithelial cell proliferation (GO:0050679)|protein deubiquitination (GO:0016579)|regulation of protein monoubiquitination (GO:1902525)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CTGCTCTGCCGAGATTCCGGG	0.443																																																	0													197.0	188.0	191.0					3																	39130733		2203	4300	6503	SO:0001583	missense	0			AF468833	CCDS33738.1	3p21.33	2014-06-16			ENSG00000114742	ENSG00000114742		"""WD repeat domain containing"""	30914	protein-coding gene	gene with protein product		612167				10819331, 12196293, 24482476	Standard	NM_020839		Approved	KIAA1449, P80, SPG60	uc003cit.3	Q8TAF3	OTTHUMG00000155972	ENST00000302313.5:c.1592G>T	3.37:g.39130733G>T	ENSP00000307491:p.Arg531Leu		B4DM86|B4DQI2|B4DY84|Q63HJ2|Q658Y1|Q8N3Z1|Q9NSK8|Q9P279	Missense_Mutation	SNP	pfam_DUF3337,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R531L	ENST00000302313.5	37	c.1592	CCDS33738.1	3	.	.	.	.	.	.	.	.	.	.	G	29.8	5.033715	0.93575	.	.	ENSG00000114742	ENST00000302313;ENST00000544962;ENST00000396258	T;D;T	0.89552	1.06;-2.53;0.78	5.71	5.71	0.89125	.	0.060161	0.64402	D	0.000004	D	0.88295	0.6398	L	0.49350	1.555	0.80722	D	1	B;P;P;P	0.50369	0.275;0.865;0.865;0.934	B;B;B;P	0.44811	0.061;0.331;0.331;0.461	D	0.86468	0.1783	10	0.30078	T	0.28	-10.2043	19.8506	0.96738	0.0:0.0:1.0:0.0	.	256;449;522;531	Q8TAF3-5;Q8TAF3-4;Q8TAF3-3;Q8TAF3	.;.;.;WDR48_HUMAN	L	531;256;449	ENSP00000307491:R531L;ENSP00000445187:R256L;ENSP00000379557:R449L	ENSP00000307491:R531L	R	+	2	0	WDR48	39105737	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.973000	0.88032	2.686000	0.91538	0.655000	0.94253	CGA	WDR48	-	pfam_DUF3337	ENSG00000114742		0.443	WDR48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR48	HGNC	protein_coding	OTTHUMT00000342529.1		0.00	54	0	G	NM_020839		39130733	+1			no_errors	ENST00000302313	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	T
WIPF1	7456	genome.wustl.edu	37	2	175436912	175436912	+	Silent	SNP	G	G	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:175436912G>A	ENST00000392547.2	-	5	720	c.621C>T	c.(619-621)ccC>ccT	p.P207P	WIPF1_ENST00000359761.3_Silent_p.P207P|WIPF1_ENST00000272746.5_Silent_p.P207P|AC018890.6_ENST00000412835.1_RNA|WIPF1_ENST00000392546.2_Silent_p.P207P|AC018890.6_ENST00000442996.1_RNA|WIPF1_ENST00000409891.1_Silent_p.P207P|WIPF1_ENST00000467149.1_5'Flank|WIPF1_ENST00000409415.3_Silent_p.P207P	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	207					actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)			NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						TGGGGCCTCCGGGCACTGGTG	0.632																																																	0																																										SO:0001819	synonymous_variant	0			AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.621C>T	2.37:g.175436912G>A			B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Silent	SNP	smart_WH2_dom,pfscan_WH2_dom	p.P207	ENST00000392547.2	37	c.621	CCDS2260.1	2																																																																																			WIPF1	-	NULL	ENSG00000115935		0.632	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIPF1	HGNC	protein_coding	OTTHUMT00000255453.1	-	0.00	15	0	G	NM_003387		175436912	-1	tier1	-	no_errors	ENST00000272746	ensembl	human	known	74_37	silent	36.84	12	7	SNP	0.019	A
WRN	7486	genome.wustl.edu	37	8	30954306	30954306	+	Missense_Mutation	SNP	G	G	A	rs572026265		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:30954306G>A	ENST00000298139.5	+	17	2170	c.1921G>A	c.(1921-1923)Gta>Ata	p.V641I		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	641	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)	p.V641L(1)		central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		GATTGTATACGTAACTCCAGA	0.328			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome				G|||	1	0.000199681	0.0	0.0014	5008	,	,		15199	0.0		0.0	False		,,,				2504	0.0				Ovarian(18;161 598 2706 14834 27543)		yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	1	Substitution - Missense(1)	endometrium(1)											90.0	87.0	88.0					8																	30954306		2202	4300	6502	SO:0001583	missense	0	Familial Cancer Database	WS, Adult Progeria		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.1921G>A	8.37:g.30954306G>A	ENSP00000298139:p.Val641Ile		A1KYY9	Missense_Mutation	SNP	pfam_3'-5'_exonuclease_dom,pfam_Helicase_C,pfam_RQC_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_HRDC_dom,superfamily_P-loop_NTPase,superfamily_RNaseH-like_dom,superfamily_HRDC-like,smart_3'-5'_exonuclease_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_RQC_domain,smart_HRDC_dom,pfscan_HRDC_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.V641I	ENST00000298139.5	37	c.1921	CCDS6082.1	8	.	.	.	.	.	.	.	.	.	.	G	1.250	-0.618944	0.03663	.	.	ENSG00000165392	ENST00000298139	T	0.04809	3.55	5.94	-5.61	0.02489	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.554973	0.19048	N	0.124115	T	0.01627	0.0052	N	0.17082	0.46	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.09377	0.004;0.003	T	0.44742	-0.9308	10	0.02654	T	1	1.0413	1.9316	0.03328	0.3887:0.311:0.1875:0.1128	.	51;641	Q59F09;Q14191	.;WRN_HUMAN	I	641	ENSP00000298139:V641I	ENSP00000298139:V641I	V	+	1	0	WRN	31073848	0.003000	0.15002	0.004000	0.12327	0.130000	0.20726	-0.049000	0.11924	-0.800000	0.04433	-0.295000	0.09555	GTA	WRN	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000165392		0.328	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WRN	HGNC	protein_coding	OTTHUMT00000376248.1		0.00	31	0	G			30954306	+1			no_errors	ENST00000298139	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.061	A
WWC3	55841	genome.wustl.edu	37	X	10096179	10096179	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:10096179C>T	ENST00000380861.4	+	16	2649	c.2258C>T	c.(2257-2259)aCc>aTc	p.T753I	WWC3_ENST00000454666.1_Missense_Mutation_p.T753I	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	753					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						CCTGCACACACCATCTCCATC	0.602																																																	0													51.0	46.0	48.0					X																	10096179		2203	4300	6503	SO:0001583	missense	0			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.2258C>T	X.37:g.10096179C>T	ENSP00000370242:p.Thr753Ile		A8KA96|Q659C1|Q9BTQ1	Missense_Mutation	SNP	superfamily_C2_dom	p.T753I	ENST00000380861.4	37	c.2258	CCDS14136.1	X	.	.	.	.	.	.	.	.	.	.	C	5.936	0.356813	0.11239	.	.	ENSG00000047644	ENST00000380861;ENST00000454666;ENST00000543412	T;T	0.05025	3.51;3.51	3.32	1.32	0.21799	.	2.302670	0.01865	N	0.036846	T	0.04182	0.0116	N	0.12182	0.205	0.09310	N	1	B	0.26195	0.144	B	0.26614	0.071	T	0.36114	-0.9761	9	.	.	.	-0.7009	3.1842	0.06594	0.2576:0.5919:0.0:0.1505	.	753	Q9ULE0	WWC3_HUMAN	I	753;753;248	ENSP00000370242:T753I;ENSP00000399584:T753I	.	T	+	2	0	WWC3	10056179	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	0.123000	0.15708	0.605000	0.29947	-0.713000	0.03633	ACC	WWC3	-	NULL	ENSG00000047644		0.602	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC3	HGNC	protein_coding	OTTHUMT00000055725.1	-	0.00	46	0	C	NM_015691		10096179	+1	tier1	-	no_errors	ENST00000380861	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.001	T
XIRP2	129446	genome.wustl.edu	37	2	168100411	168100411	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:168100411G>T	ENST00000409195.1	+	9	2598	c.2509G>T	c.(2509-2511)Gat>Tat	p.D837Y	XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.D837Y|XIRP2_ENST00000409273.1_Missense_Mutation_p.D615Y|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	662					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AATAGGTACAGATGTCTCCAG	0.393																																																	0													89.0	89.0	89.0					2																	168100411		1825	4081	5906	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.2509G>T	2.37:g.168100411G>T	ENSP00000386840:p.Asp837Tyr		A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.D837Y	ENST00000409195.1	37	c.2509	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	G	15.83	2.947859	0.53186	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.64085	-0.08;-0.08;-0.08	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.79930	0.4531	M	0.77820	2.39	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.81629	-0.0846	10	0.87932	D	0	-23.3832	16.278	0.82656	0.0:0.1326:0.8674:0.0	.	662;662;615	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	Y	837;837;615	ENSP00000386840:D837Y;ENSP00000295237:D837Y;ENSP00000387255:D615Y	ENSP00000295237:D837Y	D	+	1	0	XIRP2	167808657	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.435000	0.66532	2.754000	0.94517	0.650000	0.86243	GAT	XIRP2	-	pfam_Actin-binding_Xin_repeat	ENSG00000163092		0.393	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	-	0.00	16	0	G	NM_152381		168100411	+1	tier1	-	no_errors	ENST00000295237	ensembl	human	known	74_37	missense	44.12	19	15	SNP	1.000	T
XIST	7503	genome.wustl.edu	37	X	73069583	73069583	+	lincRNA	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:73069583A>G	ENST00000429829.1	-	0	3005					NR_001564.2				X inactive specific transcript (non-protein coding)																		AGGATAAGCAATGGACAACTT	0.438																																																	0													28.0	26.0	26.0					X																	73069583		876	1988	2864			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73069583A>G				RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.438	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	-	0.00	14	0	A	NR_001564		73069583	-1	tier1	-	no_errors	ENST00000429829	ensembl	human	known	74_37	rna	34.78	15	8	SNP	0.011	G
XKR4	114786	genome.wustl.edu	37	8	56015110	56015110	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr8:56015110C>T	ENST00000327381.6	+	1	162	c.62C>T	c.(61-63)cCg>cTg	p.P21L		NM_052898.1	NP_443130.1	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related family, member 4	21						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34			Epithelial(17;0.000117)|all cancers(17;0.000836)			GCGTTCACCCCGCTGCAGAAC	0.652																																																	0													29.0	29.0	29.0					8																	56015110		2203	4299	6502	SO:0001583	missense	0			AY534241	CCDS34893.1	8q12.1	2006-01-12	2006-01-12		ENSG00000206579	ENSG00000206579			29394	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 4"""				Standard	NM_052898		Approved	KIAA1889	uc003xsf.3	Q5GH76	OTTHUMG00000164288	ENST00000327381.6:c.62C>T	8.37:g.56015110C>T	ENSP00000328326:p.Pro21Leu		Q96PZ8	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.P21L	ENST00000327381.6	37	c.62	CCDS34893.1	8	.	.	.	.	.	.	.	.	.	.	C	13.12	2.141854	0.37825	.	.	ENSG00000206579	ENST00000327381;ENST00000543752	D	0.84298	-1.83	2.83	2.83	0.33086	.	0.576281	0.14565	N	0.311813	T	0.68329	0.2989	N	0.19112	0.55	0.49798	D	0.999822	P	0.43094	0.799	B	0.22880	0.042	T	0.71024	-0.4712	10	0.52906	T	0.07	-17.3018	11.1218	0.48296	0.0:1.0:0.0:0.0	.	21	Q5GH76	XKR4_HUMAN	L	21	ENSP00000328326:P21L	ENSP00000328326:P21L	P	+	2	0	XKR4	56177664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.212000	0.51145	1.436000	0.47453	0.549000	0.68633	CCG	XKR4	-	NULL	ENSG00000206579		0.652	XKR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR4	HGNC	protein_coding	OTTHUMT00000378129.2	-	0.00	19	0	C	NM_052898		56015110	+1	tier1	-	no_errors	ENST00000327381	ensembl	human	known	74_37	missense	41.18	10	7	SNP	1.000	T
XPNPEP2	7512	genome.wustl.edu	37	X	128888489	128888489	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:128888489G>T	ENST00000371106.3	+	12	1341	c.1149G>T	c.(1147-1149)ctG>ctT	p.L383L		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	383						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						TGGTCTGGCTGGAGAAGAACG	0.607																																																	0													59.0	39.0	46.0					X																	128888489		2200	4295	6495	SO:0001819	synonymous_variant	0			U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1149G>T	X.37:g.128888489G>T			A0AV16|O75994	Silent	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.L383	ENST00000371106.3	37	c.1149	CCDS14613.1	X																																																																																			XPNPEP2	-	superfamily_Pept_M24_structural-domain	ENSG00000122121		0.607	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP2	HGNC	protein_coding	OTTHUMT00000058210.1	-	0.00	57	0	G	NM_003399		128888489	+1	tier1	-	no_errors	ENST00000371106	ensembl	human	known	74_37	silent	8.70	41	4	SNP	1.000	T
YPEL5	51646	genome.wustl.edu	37	2	30381857	30381858	+	3'UTR	DNP	TT	TT	GC	rs181942852		TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:30381857_30381858TT>GC	ENST00000379520.3	+	0	1018_1019				YPEL5_ENST00000379519.3_3'UTR|YPEL5_ENST00000402003.3_3'UTR|YPEL5_ENST00000402708.1_3'UTR|YPEL5_ENST00000261353.4_3'UTR|YPEL5_ENST00000495673.1_3'UTR	NM_001127401.1	NP_001120873.1	P62699	YPEL5_HUMAN	yippee-like 5 (Drosophila)											NS(1)|endometrium(1)|kidney(1)|lung(3)|prostate(1)	7	Acute lymphoblastic leukemia(172;0.155)					ctttctttctttctttcttttt	0.342																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF135161	CCDS1771.1	2p23	2004-06-28			ENSG00000119801	ENSG00000119801			18329	protein-coding gene	gene with protein product		609726					Standard	NM_016061		Approved	CGI-127	uc002rmz.4	P62699	OTTHUMG00000097839	Exception_encountered	2.37:g.30381857_30381858delinsGC			D6W568|Q65Z97|Q8R174|Q9D6M1|Q9UMX7|Q9Y3C9	RNA	SNP	-	NULL	ENST00000379520.3	37	NULL	CCDS1771.1	2																																																																																			YPEL5	-	-	ENSG00000119801		0.342	YPEL5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YPEL5	HGNC	protein_coding	OTTHUMT00000215128.1	-	0.00	17|16	0	T	NM_016061		30381857|30381858	+1	tier1	-	no_errors	ENST00000495673	ensembl	human	known	74_37	rna	47.62|45.45	11|12	10	SNP	0.661|0.250	G|C
ZBED1	9189	genome.wustl.edu	37	X	2407851	2407851	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:2407851G>T	ENST00000381223.4	-	2	1113	c.910C>A	c.(910-912)Cag>Aag	p.Q304K	ZBED1_ENST00000381218.3_Missense_Mutation_p.Q304K|ZBED1_ENST00000381222.2_Missense_Mutation_p.Q304K|DHRSX_ENST00000334651.5_Intron|ZBED1_ENST00000515319.1_5'Flank	NM_001171135.1|NM_001171136.1|NM_004729.3	NP_001164606.1|NP_001164607.1|NP_004720.1	O96006	ZBED1_HUMAN	zinc finger, BED-type containing 1	304					metabolic process (GO:0008152)	nuclear chromosome (GO:0000228)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transposase activity (GO:0004803)			endometrium(8)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	25		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TTCGGGAGCTGGAAGGCCTGC	0.617																																																	0													61.0	64.0	63.0					X																	2407851		2203	4296	6499	SO:0001583	missense	0			AB018328	CCDS14118.1	Xp22.33 and Yp11	2013-05-03	2004-01-14	2004-01-16	ENSG00000214717	ENSG00000214717		"""Pseudoautosomal regions / PAR1"", ""Zinc fingers, BED-type"""	447	protein-coding gene	gene with protein product		300178	"""Ac-like transposable element"""	ALTE		9872452, 9887332, 23533661	Standard	NM_001171135		Approved	TRAMP, KIAA0785, DREF, hDREF	uc004cqh.2	O96006	OTTHUMG00000021069	ENST00000381223.4:c.910C>A	X.37:g.2407851G>T	ENSP00000370621:p.Gln304Lys		Q96BY4	Missense_Mutation	SNP	pfam_HATC_dom_C,pfam_Znf_BED_prd,superfamily_RNaseH-like_dom,smart_Znf_BED_prd,pfscan_Znf_BED_prd	p.Q304K	ENST00000381223.4	37	c.910	CCDS14118.1	X	.	.	.	.	.	.	.	.	.	.	g	0.005	-2.121801	0.00346	.	.	ENSG00000214717	ENST00000381223;ENST00000381222;ENST00000381218	T;T;T	0.18502	2.21;2.21;2.21	3.19	3.19	0.36642	Ribonuclease H-like (1);	1.179390	0.06480	N	0.732669	T	0.09158	0.0226	.	.	.	0.09310	N	1	B	0.19583	0.037	B	0.12837	0.008	T	0.06607	-1.0817	9	0.05833	T	0.94	-26.9338	13.9326	0.64006	0.0:0.0:1.0:0.0	.	304	O96006	ZBED1_HUMAN	K	304	ENSP00000370621:Q304K;ENSP00000370620:Q304K;ENSP00000370616:Q304K	ENSP00000370616:Q304K	Q	-	1	0	ZBED1	2417851	1.000000	0.71417	0.032000	0.17829	0.032000	0.12392	3.752000	0.55172	1.232000	0.43678	0.515000	0.50301	CAG	ZBED1	-	superfamily_RNaseH-like_dom	ENSG00000214717		0.617	ZBED1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBED1	HGNC	protein_coding	OTTHUMT00000144310.3	-	0.00	35	0	G	NM_004729		2407851	-1	tier1	-	no_errors	ENST00000381218	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.996	T
ZBTB32	27033	genome.wustl.edu	37	19	36207122	36207122	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:36207122G>T	ENST00000392197.2	+	6	1430	c.1112G>T	c.(1111-1113)cGg>cTg	p.R371L	KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000341701.1_5'Flank|KMT2B_ENST00000222270.7_5'Flank|ZBTB32_ENST00000262630.3_Missense_Mutation_p.R371L|KMT2B_ENST00000420124.1_5'Flank			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	371					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCTCGGTCTCGGCCCTATGCG	0.637																																																	0													29.0	29.0	29.0					19																	36207122		2203	4299	6502	SO:0001583	missense	0			AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.1112G>T	19.37:g.36207122G>T	ENSP00000376035:p.Arg371Leu		Q8WVP2	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R371L	ENST00000392197.2	37	c.1112	CCDS12471.1	19	.	.	.	.	.	.	.	.	.	.	G	23.1	4.370892	0.82573	.	.	ENSG00000011590	ENST00000262630;ENST00000392197	T;T	0.34275	1.37;1.37	4.86	4.86	0.63082	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.44097	D	0.000490	T	0.47746	0.1462	L	0.32530	0.975	0.42374	D	0.992464	D	0.76494	0.999	D	0.72075	0.976	T	0.49234	-0.8961	10	0.87932	D	0	-20.9756	13.3569	0.60633	0.0:0.0:1.0:0.0	.	371	Q9Y2Y4	ZBT32_HUMAN	L	371	ENSP00000262630:R371L;ENSP00000376035:R371L	ENSP00000262630:R371L	R	+	2	0	ZBTB32	40898962	0.985000	0.35326	0.876000	0.34364	0.914000	0.54420	2.019000	0.41001	2.519000	0.84933	0.655000	0.94253	CGG	ZBTB32	-	NULL	ENSG00000011590		0.637	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB32	HGNC	protein_coding	OTTHUMT00000109491.3		0.00	22	0	G	NM_014383		36207122	+1			no_errors	ENST00000262630	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.903	T
ZC4H2	55906	genome.wustl.edu	37	X	64139828	64139828	+	Intron	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:64139828G>T	ENST00000374839.3	-	3	505				ZC4H2_ENST00000447788.2_Intron|ZC4H2_ENST00000488608.1_5'UTR|ZC4H2_ENST00000545618.1_Intron|ZC4H2_ENST00000337990.2_Intron	NM_018684.3	NP_061154.1	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing						nervous system development (GO:0007399)|neuromuscular junction development (GO:0007528)|spinal cord motor neuron differentiation (GO:0021522)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						aaaggcctgggactaaaacta	0.463																																																	0																																										SO:0001627	intron_variant	0			AF270491	CCDS14380.1, CCDS55431.1, CCDS55432.1	Xq11.1	2013-07-23	2008-10-01	2008-10-01	ENSG00000126970	ENSG00000126970		"""Zinc fingers"""	24931	protein-coding gene	gene with protein product		300897	"""KIAA1166"", ""Wieacker-Wolff syndrome"""	KIAA1166, WWS		10574461, 12097419, 23623388	Standard	NM_018684		Approved	HCA127	uc004dvu.3	Q9NQZ6	OTTHUMG00000021712	ENST00000374839.3:c.398+132C>A	X.37:g.64139828G>T			B2RDC2|B3KVZ5|B4DED0|E7EM74|G3V1L3|Q53H73|Q5JTF9|Q9H9C3|Q9H9H7|Q9ULQ4	RNA	SNP	-	NULL	ENST00000374839.3	37	NULL	CCDS14380.1	X																																																																																			ZC4H2	-	-	ENSG00000126970		0.463	ZC4H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC4H2	HGNC	protein_coding	OTTHUMT00000056958.1	-	0.00	21	0	G	NM_018684		64139828	-1	tier1	-	no_errors	ENST00000488608	ensembl	human	known	74_37	rna	61.90	8	13	SNP	0.000	T
ZCCHC5	203430	genome.wustl.edu	37	X	77912922	77912922	+	Silent	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:77912922G>T	ENST00000321110.1	-	2	1291	c.996C>A	c.(994-996)ctC>ctA	p.L332L		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	332							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						CCCCTTGGCAGAGTTGATGGA	0.468																																																	0													73.0	61.0	65.0					X																	77912922		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.996C>A	X.37:g.77912922G>T			B2RMZ0|Q5JQE9	Silent	SNP	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.L332	ENST00000321110.1	37	c.996	CCDS14440.1	X																																																																																			ZCCHC5	-	NULL	ENSG00000179300		0.468	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC5	HGNC	protein_coding	OTTHUMT00000057319.1	-	0.00	54	0	G	NM_152694		77912922	-1	tier1	-	no_errors	ENST00000321110	ensembl	human	known	74_37	silent	31.43	24	11	SNP	0.170	T
ZKSCAN5	23660	genome.wustl.edu	37	7	99123486	99123486	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:99123486G>T	ENST00000394170.2	+	6	1074	c.823G>T	c.(823-825)Gac>Tac	p.D275Y	ZKSCAN5_ENST00000326775.5_Missense_Mutation_p.D275Y|ZKSCAN5_ENST00000451158.1_Missense_Mutation_p.D275Y	NM_014569.3	NP_055384.1	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	275	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	21	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GATTTCTGATGACTCTGAATC	0.438																																																	0													104.0	106.0	105.0					7																	99123486		2203	4300	6503	SO:0001583	missense	0			AF170025	CCDS5667.1	7q22	2013-01-09	2007-02-20	2007-02-20	ENSG00000196652	ENSG00000196652		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12867	protein-coding gene	gene with protein product		611272	"""zinc finger protein homologous to Zfp95 in mouse"", ""zinc finger protein 95 homolog (mouse)"""	ZFP95		10585779	Standard	NM_014569		Approved	ZNF914, ZSCAN37	uc003uqv.3	Q9Y2L8	OTTHUMG00000156749	ENST00000394170.2:c.823G>T	7.37:g.99123486G>T	ENSP00000377725:p.Asp275Tyr		A4D280|D6W5S9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.D275Y	ENST00000394170.2	37	c.823	CCDS5667.1	7	.	.	.	.	.	.	.	.	.	.	G	10.85	1.466559	0.26335	.	.	ENSG00000196652	ENST00000537357;ENST00000326775;ENST00000451158;ENST00000394170	T;T;T	0.38077	1.16;1.16;1.16	4.64	4.64	0.57946	Krueppel-associated box (2);	0.498377	0.18447	N	0.140942	T	0.31167	0.0788	L	0.45352	1.415	0.29157	N	0.878014	P;P	0.34462	0.454;0.454	B;B	0.31614	0.133;0.133	T	0.33854	-0.9852	10	0.62326	D	0.03	.	13.206	0.59795	0.0:0.0:1.0:0.0	.	275;275	Q8N718;Q9Y2L8	.;ZKSC5_HUMAN	Y	275	ENSP00000322872:D275Y;ENSP00000392104:D275Y;ENSP00000377725:D275Y	ENSP00000322872:D275Y	D	+	1	0	ZKSCAN5	98961422	0.812000	0.29077	0.906000	0.35671	0.573000	0.36030	-0.606000	0.05654	2.590000	0.87494	0.655000	0.94253	GAC	ZKSCAN5	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000196652		0.438	ZKSCAN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN5	HGNC	protein_coding	OTTHUMT00000345597.1	-	0.00	31	0	G	NM_014569		99123486	+1	tier1	-	no_errors	ENST00000326775	ensembl	human	known	74_37	missense	46.51	23	20	SNP	0.861	T
ZNF257	113835	genome.wustl.edu	37	19	22255698	22255698	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:22255698G>T	ENST00000594947.1	+	2	235	c.91G>T	c.(91-93)Gat>Tat	p.D31Y	ZNF257_ENST00000600162.1_Missense_Mutation_p.D31Y	NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	31	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTTATATAGGGATGTGATGTT	0.403																																																	0													134.0	137.0	136.0					19																	22255698		2203	4297	6500	SO:0001583	missense	0			AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.91G>T	19.37:g.22255698G>T	ENSP00000470209:p.Asp31Tyr		B3KPS4|E9PG34|Q8NE34	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D31Y	ENST00000594947.1	37	c.91	CCDS46030.1	19	.	.	.	.	.	.	.	.	.	.	G	12.33	1.906572	0.33628	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	0.9	0.9	0.19278	Krueppel-associated box (4);	.	.	.	.	T	0.70596	0.3242	H	0.95645	3.7	0.24949	N	0.99181	D	0.52996	0.957	D	0.63192	0.912	T	0.58825	-0.7568	8	0.87932	D	0	.	4.9573	0.14048	0.0:0.0:1.0:0.0	.	31	Q9Y2Q1	ZN257_HUMAN	Y	31	.	ENSP00000380312:D31Y	D	+	1	0	ZNF257	22047538	0.019000	0.18553	0.832000	0.32986	0.831000	0.47069	0.622000	0.24433	0.308000	0.22923	0.313000	0.20887	GAT	ZNF257	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197134		0.403	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF257	HGNC	protein_coding	OTTHUMT00000464382.1	-	0.00	87	0	G			22255698	+1	tier1	-	no_errors	ENST00000594947	ensembl	human	known	74_37	missense	43.75	36	28	SNP	0.899	T
ZNF254	9534	genome.wustl.edu	37	19	24309740	24309740	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:24309740A>G	ENST00000357002.4	+	4	1053	c.938A>G	c.(937-939)aAg>aGg	p.K313R	ZNF254_ENST00000342944.6_Missense_Mutation_p.K228R	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	313					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				ACTGAGCATAAGAAAATTCAT	0.373																																																	0													43.0	44.0	44.0					19																	24309740		2202	4300	6502	SO:0001583	missense	0			AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.938A>G	19.37:g.24309740A>G	ENSP00000349494:p.Lys313Arg		A4QPC0|Q86XL7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K313R	ENST00000357002.4	37	c.938	CCDS32983.1	19	.	.	.	.	.	.	.	.	.	.	A	10.39	1.336727	0.24253	.	.	ENSG00000213096	ENST00000342944;ENST00000357002	T;T	0.49720	2.25;0.77	1.11	1.11	0.20524	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.22475	0.0542	N	0.02266	-0.62	0.19300	N	0.999977	B	0.27316	0.175	B	0.33339	0.162	T	0.26710	-1.0095	9	0.40728	T	0.16	.	5.9783	0.19393	1.0:0.0:0.0:0.0	.	313	O75437	ZN254_HUMAN	R	228;313	ENSP00000445527:K228R;ENSP00000349494:K313R	ENSP00000445527:K228R	K	+	2	0	ZNF254	24101580	0.000000	0.05858	0.003000	0.11579	0.022000	0.10575	0.017000	0.13399	0.446000	0.26666	0.254000	0.18369	AAG	ZNF254	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213096		0.373	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF254	HGNC	protein_coding	OTTHUMT00000466453.1	-	0.00	25	0	A	NM_004876		24309740	+1	tier1	-	no_errors	ENST00000357002	ensembl	human	known	74_37	missense	55.56	12	15	SNP	0.814	G
ZNF268	10795	genome.wustl.edu	37	12	133781005	133781005	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr12:133781005G>T	ENST00000536435.2	+	6	3063	c.2733G>T	c.(2731-2733)caG>caT	p.Q911H	ZNF268_ENST00000228289.5_Missense_Mutation_p.Q911H|ZNF268_ENST00000537565.1_Missense_Mutation_p.Q750H|ZNF268_ENST00000541009.2_3'UTR|ZNF268_ENST00000536899.2_3'UTR|ZNF268_ENST00000542986.2_3'UTR	NM_001165885.1|NM_003415.2	NP_001159357.1|NP_003406.1	Q14587	ZN268_HUMAN	zinc finger protein 268	911					cell differentiation (GO:0030154)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of mitotic cell cycle (GO:0007346)|regulation of protein heterodimerization activity (GO:0043497)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(3)|endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(1)	24	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		GTGCACATCAGAGAACACATA	0.413																																																	0													70.0	68.0	69.0					12																	133781005		692	1591	2283	SO:0001583	missense	0			X78926	CCDS45012.1, CCDS53851.1, CCDS53852.1, CCDS53853.1, CCDS53854.1, CCDS59239.1, CCDS59240.1	12q24.33	2013-01-08				ENSG00000090612		"""Zinc fingers, C2H2-type"", ""-"""	13061	protein-coding gene	gene with protein product		604753				7865130	Standard	NM_003415		Approved	HZF3	uc010tcf.2	Q14587	OTTHUMG00000167946	ENST00000536435.2:c.2733G>T	12.37:g.133781005G>T	ENSP00000444412:p.Gln911His		Q8TDG8|Q96RH4|Q9BZJ9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q911H	ENST00000536435.2	37	c.2733	CCDS45012.1	12	.	.	.	.	.	.	.	.	.	.	G	17.38	3.376307	0.61735	.	.	ENSG00000090612	ENST00000541009;ENST00000228289;ENST00000537565	T;T	0.18502	2.21;2.21	3.89	2.99	0.34606	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35158	0.0922	M	0.66297	2.02	0.25595	N	0.986655	D	0.76494	0.999	D	0.64144	0.922	T	0.07121	-1.0789	8	.	.	.	.	10.8873	0.46974	0.0969:0.0:0.9031:0.0	.	911	Q14587	ZN268_HUMAN	H	911;911;750	ENSP00000228289:Q911H;ENSP00000445713:Q750H	.	Q	+	3	2	ZNF268	.	0.065000	0.20965	0.970000	0.41538	0.987000	0.75469	1.974000	0.40559	0.968000	0.38212	0.591000	0.81541	CAG	ZNF268	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000090612		0.413	ZNF268-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF268	HGNC	protein_coding	OTTHUMT00000397191.2	-	0.00	24	0	G	NM_152943		133781005	+1	tier1	-	no_errors	ENST00000228289	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	T
ZNF430	80264	genome.wustl.edu	37	19	21239956	21239956	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:21239956T>A	ENST00000261560.5	+	5	1023	c.842T>A	c.(841-843)aTa>aAa	p.I281K	AC012627.1_ENST00000578233.1_RNA	NM_001172671.1|NM_025189.3	NP_001166142.1|NP_079465.3	Q9H8G1	ZN430_HUMAN	zinc finger protein 430	281					regulation of transcription, DNA-templated (GO:0006355)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.I281T(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	23						ACACATAAGATAATTCATACT	0.393																																																	1	Substitution - Missense(1)	large_intestine(1)											56.0	61.0	59.0					19																	21239956		2203	4297	6500	SO:0001583	missense	0			AK023721	CCDS32978.1	19p12	2013-01-08				ENSG00000118620		"""Zinc fingers, C2H2-type"", ""-"""	20808	protein-coding gene	gene with protein product							Standard	NM_025189		Approved	FLJ13659	uc002npj.3	Q9H8G1		ENST00000261560.5:c.842T>A	19.37:g.21239956T>A	ENSP00000261560:p.Ile281Lys		Q86V70	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I281K	ENST00000261560.5	37	c.842	CCDS32978.1	19	.	.	.	.	.	.	.	.	.	.	.	0	-2.655858	0.00108	.	.	ENSG00000118620	ENST00000261560	T	0.12774	2.65	1.04	-2.09	0.07232	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.02455	0.0075	N	0.00972	-1.085	0.39840	D	0.973092	P;B	0.39352	0.669;0.037	B;B	0.34931	0.192;0.06	T	0.48625	-0.9019	9	0.15499	T	0.54	.	0.7341	0.00962	0.1968:0.2047:0.3701:0.2284	.	280;281	Q2NKJ9;Q9H8G1	.;ZN430_HUMAN	K	281	ENSP00000261560:I281K	ENSP00000261560:I281K	I	+	2	0	ZNF430	21031796	0.000000	0.05858	0.015000	0.15790	0.014000	0.08584	0.263000	0.18478	-0.649000	0.05430	-0.714000	0.03626	ATA	ZNF430	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000118620		0.393	ZNF430-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF430	HGNC	protein_coding	OTTHUMT00000463539.1		0.00	18	0	T	NM_025189		21239956	+1			no_errors	ENST00000261560	ensembl	human	known	74_37	missense	7.69	24	2	SNP	0.998	A
ZNF438	220929	genome.wustl.edu	37	10	31137949	31137949	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr10:31137949C>T	ENST00000361310.3	-	6	1714	c.1385G>A	c.(1384-1386)gGg>gAg	p.G462E	ZNF438_ENST00000331737.6_Missense_Mutation_p.G452E|ZNF438_ENST00000444692.2_Missense_Mutation_p.G452E|ZNF438_ENST00000452305.1_Missense_Mutation_p.G452E|ZNF438_ENST00000436087.2_Missense_Mutation_p.G462E|ZNF438_ENST00000538351.2_Missense_Mutation_p.G413E|ZNF438_ENST00000413025.1_Missense_Mutation_p.G462E|ZNF438_ENST00000442986.1_Missense_Mutation_p.G462E|ZNF438_ENST00000375311.1_Missense_Mutation_p.G26E			Q7Z4V0	ZN438_HUMAN	zinc finger protein 438	462					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(15)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(175;0.0587)				TCCTAGGCCCCCAAGCATCTG	0.473																																																	0													62.0	67.0	65.0					10																	31137949		2203	4300	6503	SO:0001583	missense	0			AK057323	CCDS7168.1, CCDS44369.1, CCDS53504.1	10p11.23	2006-02-15			ENSG00000183621	ENSG00000183621		"""Zinc fingers, C2H2-type"""	21029	protein-coding gene	gene with protein product							Standard	NM_182755		Approved	bA330O11.1	uc010qeb.2	Q7Z4V0	OTTHUMG00000017904	ENST00000361310.3:c.1385G>A	10.37:g.31137949C>T	ENSP00000354663:p.Gly462Glu		A2A3J4|A8K9L5|Q5T426|Q658Q4|Q6ZN65	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G462E	ENST00000361310.3	37	c.1385	CCDS7168.1	10	.	.	.	.	.	.	.	.	.	.	C	13.77	2.336424	0.41398	.	.	ENSG00000183621	ENST00000331737;ENST00000361310;ENST00000436087;ENST00000442986;ENST00000413025;ENST00000452305;ENST00000444692;ENST00000538351;ENST00000430896;ENST00000375311	T;T;T;T;T;T;T;T;T	0.06608	3.28;3.28;3.28;3.28;3.28;3.28;3.28;3.28;3.28	5.05	2.99	0.34606	.	0.457424	0.25869	N	0.027767	T	0.04497	0.0123	L	0.50333	1.59	0.09310	N	1	B;B	0.28850	0.144;0.225	B;B	0.26517	0.032;0.07	T	0.38373	-0.9664	10	0.05525	T	0.97	-6.0055	4.0272	0.09693	0.0:0.5943:0.2538:0.1519	.	462;452	Q7Z4V0;Q7Z4V0-2	ZN438_HUMAN;.	E	452;462;462;462;462;452;452;413;181;26	ENSP00000333571:G452E;ENSP00000354663:G462E;ENSP00000406934:G462E;ENSP00000412363:G462E;ENSP00000387546:G462E;ENSP00000413060:G452E;ENSP00000410898:G452E;ENSP00000445461:G413E;ENSP00000364460:G26E	ENSP00000333571:G452E	G	-	2	0	ZNF438	31177955	0.002000	0.14202	0.002000	0.10522	0.004000	0.04260	1.468000	0.35332	1.321000	0.45227	0.655000	0.94253	GGG	ZNF438	-	NULL	ENSG00000183621		0.473	ZNF438-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF438	HGNC	protein_coding	OTTHUMT00000277006.1	-	0.00	27	0	C	NM_182755		31137949	-1	tier1	-	no_errors	ENST00000361310	ensembl	human	known	74_37	missense	50.00	18	18	SNP	0.007	T
ZNF454	285676	genome.wustl.edu	37	5	178392572	178392572	+	Silent	SNP	T	T	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr5:178392572T>C	ENST00000320129.3	+	5	1470	c.1167T>C	c.(1165-1167)tgT>tgC	p.C389C	ZNF454_ENST00000519564.1_Silent_p.C389C	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	389					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		GTAATGAATGTGGGAAAGCTT	0.418																																																	0													54.0	57.0	56.0					5																	178392572		2203	4300	6503	SO:0001819	synonymous_variant	0			AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.1167T>C	5.37:g.178392572T>C			Q2M1P2|Q2M323	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C389	ENST00000320129.3	37	c.1167	CCDS4441.1	5																																																																																			ZNF454	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000178187		0.418	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF454	HGNC	protein_coding	OTTHUMT00000253476.2		0.00	13	0	T	XM_209718		178392572	+1			no_errors	ENST00000320129	ensembl	human	known	74_37	silent	14.29	12	2	SNP	1.000	C
ZNF649	65251	genome.wustl.edu	37	19	52394846	52394846	+	Silent	SNP	A	A	G			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:52394846A>G	ENST00000354957.3	-	5	827	c.543T>C	c.(541-543)acT>acC	p.T181T	ZNF649_ENST00000600738.1_Silent_p.T181T|CTC-429C10.2_ENST00000600329.1_RNA	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		TCCCACAGTCAGTGCATTCAT	0.438																																																	0													222.0	208.0	213.0					19																	52394846		2203	4300	6503	SO:0001819	synonymous_variant	0			BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.543T>C	19.37:g.52394846A>G			A8MYJ5|B2RDC4|Q9H9N2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T181	ENST00000354957.3	37	c.543	CCDS12843.1	19																																																																																			ZNF649	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198093		0.438	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF649	HGNC	protein_coding	OTTHUMT00000461097.1	-	0.00	115	0	A	NM_023074		52394846	-1	tier1	-	no_errors	ENST00000354957	ensembl	human	known	74_37	silent	32.33	90	43	SNP	0.020	G
ZNF655	79027	genome.wustl.edu	37	7	99158210	99158210	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:99158210G>T	ENST00000394163.2	+	2	211	c.28G>T	c.(28-30)Gca>Tca	p.A10S	ZNF655_ENST00000493277.1_Missense_Mutation_p.A10S|ZNF655_ENST00000252713.4_Missense_Mutation_p.A10S|ZNF655_ENST00000440391.1_Missense_Mutation_p.A10S|GS1-259H13.10_ENST00000455905.1_Missense_Mutation_p.A10S|ZNF655_ENST00000425063.1_Missense_Mutation_p.A10S|ZNF655_ENST00000320583.5_Missense_Mutation_p.A10S|ZNF655_ENST00000454654.1_Missense_Mutation_p.A10S|ZNF655_ENST00000449244.1_Missense_Mutation_p.A10S|ZNF655_ENST00000357864.2_Missense_Mutation_p.A10S|ZNF655_ENST00000424881.1_Missense_Mutation_p.A10S|GS1-259H13.10_ENST00000486324.1_3'UTR	NM_001009960.1|NM_138494.2	NP_001009960.1|NP_612503.1	Q8N720	ZN655_HUMAN	zinc finger protein 655	10					negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	16	all_epithelial(64;3.19e-09)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					CCAGGAAGCAGCAGGGTCACC	0.488																																																	0													103.0	99.0	101.0					7																	99158210		2203	4300	6503	SO:0001583	missense	0			AY099353	CCDS5669.1, CCDS5670.1, CCDS34695.1, CCDS47655.1	7q22.1	2013-01-08			ENSG00000197343	ENSG00000197343		"""Zinc fingers, C2H2-type"", ""-"""	30899	protein-coding gene	gene with protein product						11179890, 15558030	Standard	NM_001083956		Approved	VIK-1, VIK	uc010lgc.3	Q8N720	OTTHUMG00000156637	ENST00000394163.2:c.28G>T	7.37:g.99158210G>T	ENSP00000377718:p.Ala10Ser		A4D291|A6NGD3|B4E3M4|B7Z9Q9|D6W5T4|Q8IV00|Q8TA89|Q96EZ3|Q9BQ85	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A10S	ENST00000394163.2	37	c.28	CCDS5669.1	7	.	.	.	.	.	.	.	.	.	.	G	22.2	4.264506	0.80358	.	.	ENSG00000197343	ENST00000320583;ENST00000357864;ENST00000452314;ENST00000252713;ENST00000454654;ENST00000449244;ENST00000425063;ENST00000493277;ENST00000422164;ENST00000422647;ENST00000427931;ENST00000424881;ENST00000440391;ENST00000394163	T;T;T;T;T;T;T;T	0.33216	5.14;3.32;3.39;1.43;1.42;1.43;3.39;3.32	4.39	3.49	0.39957	.	0.162845	0.29362	N	0.012366	T	0.27866	0.0686	L	0.34521	1.04	0.27059	N	0.963603	B;B;B;P	0.52061	0.11;0.028;0.067;0.95	B;B;B;P	0.49502	0.097;0.031;0.045;0.613	T	0.05649	-1.0872	10	0.26408	T	0.33	-14.6898	9.6659	0.39983	0.0:0.0:0.7927:0.2073	.	10;10;10;10	Q8N720-3;A6NGD3;Q8N720;Q8N720-2	.;.;ZN655_HUMAN;.	S	10	ENSP00000322363:A10S;ENSP00000252713:A10S;ENSP00000419135:A10S;ENSP00000389260:A10S;ENSP00000393750:A10S;ENSP00000392244:A10S;ENSP00000393876:A10S;ENSP00000377718:A10S	ENSP00000252713:A10S	A	+	1	0	ZNF655	98996146	0.999000	0.42202	0.998000	0.56505	0.977000	0.68977	1.167000	0.31847	1.399000	0.46721	0.563000	0.77884	GCA	ZNF655	-	NULL	ENSG00000197343		0.488	ZNF655-009	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ZNF655	HGNC	protein_coding	OTTHUMT00000344929.1	-	0.00	56	0	G	NM_138494		99158210	+1	tier1	-	no_errors	ENST00000424881	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.998	T
ZNF702P	79986	genome.wustl.edu	37	19	53473437	53473437	+	RNA	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr19:53473437C>A	ENST00000600068.1	-	0	489				ZNF702P_ENST00000270443.4_RNA																							TCTTGCCACACTGATTACACT	0.383																																																	0													75.0	65.0	68.0					19																	53473437		692	1591	2283			0																															19.37:g.53473437C>A				RNA	SNP	-	NULL	ENST00000600068.1	37	NULL		19																																																																																			ZNF702P	-	-	ENSG00000242779		0.383	CTD-2620I22.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	ZNF702P	HGNC	processed_transcript	OTTHUMT00000463881.1	-	0.00	65	0	C			53473437	-1	tier1	-	no_errors	ENST00000270443	ensembl	human	known	74_37	rna	7.55	49	4	SNP	0.000	A
ZNF732	654254	genome.wustl.edu	37	4	265627	265627	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr4:265627C>A	ENST00000419098.1	-	4	1029	c.1019G>T	c.(1018-1020)gGc>gTc	p.G340V		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	340					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						AAAGGCTTTGCCACATTCTTC	0.393																																																	0													49.0	46.0	47.0					4																	265627		692	1591	2283	SO:0001583	missense	0			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.1019G>T	4.37:g.265627C>A	ENSP00000415774:p.Gly340Val			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G340V	ENST00000419098.1	37	c.1019	CCDS46990.1	4	.	.	.	.	.	.	.	.	.	.	C	11.94	1.788620	0.31685	.	.	ENSG00000186777	ENST00000419098	T	0.07444	3.19	0.977	0.977	0.19733	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.37404	0.1002	H	0.97214	3.96	0.51233	D	0.999911	D	0.89917	1.0	D	0.97110	1.0	T	0.34054	-0.9844	9	0.87932	D	0	.	7.3306	0.26580	0.0:1.0:0.0:0.0	.	340	B4DXR9	ZN732_HUMAN	V	340	ENSP00000415774:G340V	ENSP00000415774:G340V	G	-	2	0	ZNF732	255627	0.005000	0.15991	0.703000	0.30354	0.674000	0.39518	0.216000	0.17585	0.399000	0.25367	0.400000	0.26472	GGC	ZNF732	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186777		0.393	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF732	HGNC	protein_coding	OTTHUMT00000357937.2	-	0.00	21	0	C	NM_001137608		265627	-1	tier1	-	no_errors	ENST00000419098	ensembl	human	known	74_37	missense	14.29	24	4	SNP	0.940	A
ZNF75D	7626	genome.wustl.edu	37	X	134427910	134427910	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chrX:134427910A>C	ENST00000370766.3	-	3	2866	c.157T>G	c.(157-159)Tgg>Ggg	p.W53G	ZNF75D_ENST00000494295.1_Intron|ZNF75D_ENST00000370764.1_Missense_Mutation_p.W53G	NM_007131.3	NP_009062.2	P51815	ZN75D_HUMAN	zinc finger protein 75D	53	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(14)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						CGGAAGCTCCAGAAGTGCCTG	0.483																																																	0													91.0	81.0	84.0					X																	134427910		2203	4300	6503	SO:0001583	missense	0			S43109	CCDS14648.1, CCDS55503.1	Xq26	2013-01-09	2008-06-11	2008-06-11	ENSG00000186376	ENSG00000186376		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13145	protein-coding gene	gene with protein product		314997	"""zinc finger protein 75 (D8C6)"""	ZNF82, ZNF75		1505955	Standard	XM_005262469		Approved	ZKSCAN24, D8C6, ZSCAN28	uc004eyo.3	P51815	OTTHUMG00000022482	ENST00000370766.3:c.157T>G	X.37:g.134427910A>C	ENSP00000359802:p.Trp53Gly		A6NK62|B3KRI7|Q5JPG0|Q6LDE0	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.W53G	ENST00000370766.3	37	c.157	CCDS14648.1	X	.	.	.	.	.	.	.	.	.	.	A	9.467	1.094688	0.20471	.	.	ENSG00000186376	ENST00000370766;ENST00000370764	T;T	0.03951	3.75;3.75	3.13	-1.79	0.07932	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.02455	0.0075	N	0.14661	0.345	0.09310	N	1	B;B	0.32396	0.134;0.369	B;B	0.28011	0.085;0.078	T	0.41716	-0.9493	9	0.87932	D	0	.	2.3893	0.04374	0.3113:0.0:0.2904:0.3983	.	53;53	P51815;A6NK62	ZN75D_HUMAN;.	G	53	ENSP00000359802:W53G;ENSP00000359800:W53G	ENSP00000359800:W53G	W	-	1	0	ZNF75D	134255576	0.991000	0.36638	0.013000	0.15412	0.600000	0.36913	0.001000	0.13038	-0.534000	0.06315	-0.445000	0.05633	TGG	ZNF75D	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000186376		0.483	ZNF75D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF75D	HGNC	protein_coding	OTTHUMT00000058415.1	-	0.00	21	0	A	NM_007131		134427910	-1	tier1	-	no_errors	ENST00000370766	ensembl	human	known	74_37	missense	39.29	17	11	SNP	0.011	C
ZNF804A	91752	genome.wustl.edu	37	2	185802136	185802136	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:185802136A>C	ENST00000302277.6	+	4	2607	c.2013A>C	c.(2011-2013)gaA>gaC	p.E671D		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	671							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						GTGACAATGAAGAAATGTGTA	0.313																																																	0													83.0	86.0	85.0					2																	185802136		2203	4296	6499	SO:0001583	missense	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2013A>C	2.37:g.185802136A>C	ENSP00000303252:p.Glu671Asp		A7E253|Q6ZN26	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.E671D	ENST00000302277.6	37	c.2013	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	A	20.7	4.039470	0.75617	.	.	ENSG00000170396	ENST00000302277	T	0.06687	3.27	5.54	1.85	0.25348	.	0.367231	0.23162	N	0.051233	T	0.08044	0.0201	L	0.53249	1.67	0.09310	N	1	B	0.15473	0.013	B	0.12156	0.007	T	0.28839	-1.0031	10	0.42905	T	0.14	-9.3478	5.2704	0.15622	0.7239:0.0:0.1445:0.1316	.	671	Q7Z570	Z804A_HUMAN	D	671	ENSP00000303252:E671D	ENSP00000303252:E671D	E	+	3	2	ZNF804A	185510381	0.985000	0.35326	0.222000	0.23844	0.576000	0.36127	1.220000	0.32491	0.080000	0.16959	0.533000	0.62120	GAA	ZNF804A	-	NULL	ENSG00000170396		0.313	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	-	0.00	21	0	A	NM_194250		185802136	+1	tier1	-	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	40.00	21	14	SNP	0.015	C
ZNF804B	219578	genome.wustl.edu	37	7	88966323	88966323	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr7:88966323A>C	ENST00000333190.4	+	4	4636	c.4027A>C	c.(4027-4029)Aat>Cat	p.N1343H		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1343							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AGAGGCCTTAAATGTGTCCAC	0.358										HNSCC(36;0.09)																																							0													53.0	54.0	54.0					7																	88966323		2201	4298	6499	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.4027A>C	7.37:g.88966323A>C	ENSP00000329638:p.Asn1343His		B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.N1343H	ENST00000333190.4	37	c.4027	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	A	16.42	3.119013	0.56505	.	.	ENSG00000182348	ENST00000333190	T	0.06933	3.24	5.2	5.2	0.72013	.	0.251241	0.35555	N	0.003129	T	0.21145	0.0509	L	0.57536	1.79	0.28897	N	0.893492	D	0.76494	0.999	D	0.64042	0.921	T	0.02294	-1.1181	10	0.66056	D	0.02	-22.0225	10.7254	0.46066	0.9231:0.0:0.0768:0.0	.	1343	A4D1E1	Z804B_HUMAN	H	1343	ENSP00000329638:N1343H	ENSP00000329638:N1343H	N	+	1	0	ZNF804B	88804259	0.994000	0.37717	0.997000	0.53966	0.930000	0.56654	3.431000	0.52814	2.302000	0.77476	0.533000	0.62120	AAT	ZNF804B	-	NULL	ENSG00000182348		0.358	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	-	0.00	15	0	A	NM_181646		88966323	+1	tier1	-	no_errors	ENST00000333190	ensembl	human	known	74_37	missense	38.89	11	7	SNP	1.000	C
ZSWIM2	151112	genome.wustl.edu	37	2	187693010	187693010	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr2:187693010C>A	ENST00000295131.2	-	9	1642	c.1603G>T	c.(1603-1605)Gga>Tga	p.G535*		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	535					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			TGAAATTTTCCACTGATGCAT	0.403																																																	0													85.0	81.0	82.0					2																	187693010		2203	4300	6503	SO:0001587	stop_gained	0			AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.1603G>T	2.37:g.187693010C>A	ENSP00000295131:p.Gly535*		B3KXV6|Q53SI3|Q57ZY3	Nonsense_Mutation	SNP	pfam_Znf_SWIM,pfam_Znf_ZZ,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Znf_ZZ	p.G535*	ENST00000295131.2	37	c.1603	CCDS33348.1	2	.	.	.	.	.	.	.	.	.	.	C	11.82	1.751336	0.31046	.	.	ENSG00000163012	ENST00000295131	.	.	.	5.46	0.995	0.19838	.	0.703722	0.13486	N	0.384311	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-1.4912	7.8494	0.29446	0.0:0.5765:0.0:0.4235	.	.	.	.	X	535	.	ENSP00000295131:G535X	G	-	1	0	ZSWIM2	187401255	0.000000	0.05858	0.010000	0.14722	0.006000	0.05464	0.490000	0.22403	0.267000	0.21916	0.491000	0.48974	GGA	ZSWIM2	-	NULL	ENSG00000163012		0.403	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM2	HGNC	protein_coding	OTTHUMT00000334565.1		0.00	15	0	C	NM_182521		187693010	-1			no_errors	ENST00000295131	ensembl	human	known	74_37	nonsense	6.25	30	2	SNP	0.001	A
ZZEF1	23140	genome.wustl.edu	37	17	3912932	3912932	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OJ-01A-11D-A27G-09	TCGA-L5-A4OJ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	240ae3a5-496b-4240-86ef-c9e428345a77	9cfe6810-0d93-48ff-b2d6-2758e2a7d40f	g.chr17:3912932G>T	ENST00000381638.2	-	53	8823	c.8699C>A	c.(8698-8700)aCt>aAt	p.T2900N		NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	2900							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						GAAGAGCTCAGTGAGGGCACG	0.627																																																	0													102.0	83.0	89.0					17																	3912932		2203	4300	6503	SO:0001583	missense	0			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.8699C>A	17.37:g.3912932G>T	ENSP00000371051:p.Thr2900Asn		A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_CUB_dom,smart_EF_hand_dom,smart_Znf_ZZ,pfscan_EF_hand_dom,pfscan_Znf_ZZ	p.T2900N	ENST00000381638.2	37	c.8699	CCDS11043.1	17	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740055	0.89573	.	.	ENSG00000074755	ENST00000381638	T	0.27890	1.64	5.64	5.64	0.86602	.	0.106409	0.64402	D	0.000005	T	0.33000	0.0848	L	0.27053	0.805	0.58432	D	0.999999	P	0.51653	0.947	P	0.47346	0.544	T	0.07829	-1.0752	10	0.87932	D	0	-13.8492	20.0846	0.97795	0.0:0.0:1.0:0.0	.	2900	O43149	ZZEF1_HUMAN	N	2900	ENSP00000371051:T2900N	ENSP00000371051:T2900N	T	-	2	0	ZZEF1	3859681	1.000000	0.71417	0.966000	0.40874	0.995000	0.86356	8.938000	0.92943	2.823000	0.97156	0.643000	0.83706	ACT	ZZEF1	-	NULL	ENSG00000074755		0.627	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	HGNC	protein_coding	OTTHUMT00000207480.1	-	0.00	27	0	G	NM_015113		3912932	-1	tier1	-	no_errors	ENST00000381638	ensembl	human	known	74_37	missense	9.80	46	5	SNP	1.000	T
