#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA12	26154	genome.wustl.edu	37	2	215917224	215917224	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:215917224A>C	ENST00000272895.7	-	5	713	c.494T>G	c.(493-495)cTt>cGt	p.L165R		NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	165					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TTCCAAGCCAAGAATTCGTGC	0.393																																					Ovarian(66;664 1488 5121 34295)												0													88.0	83.0	85.0					2																	215917224		2203	4300	6503	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.494T>G	2.37:g.215917224A>C	ENSP00000272895:p.Leu165Arg		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L165R	ENST00000272895.7	37	c.494	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	A	18.74	3.689447	0.68271	.	.	ENSG00000144452	ENST00000272895	D	0.90197	-2.63	5.64	5.64	0.86602	.	0.118063	0.38164	N	0.001788	D	0.90570	0.7044	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.66716	0.946	D	0.90678	0.4603	10	0.46703	T	0.11	.	12.2624	0.54658	1.0:0.0:0.0:0.0	.	165	Q86UK0	ABCAC_HUMAN	R	165	ENSP00000272895:L165R	ENSP00000272895:L165R	L	-	2	0	ABCA12	215625469	0.998000	0.40836	0.838000	0.33150	0.904000	0.53231	4.138000	0.58017	2.147000	0.66899	0.455000	0.32223	CTT	ABCA12	-	NULL	ENSG00000144452		0.393	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	-	0.00	36	0	A	NM_173076		215917224	-1	tier1	-	no_errors	ENST00000272895	ensembl	human	known	74_37	missense	45.00	11	9	SNP	0.891	C
ADAMTS19	171019	genome.wustl.edu	37	5	129015552	129015552	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr5:129015552A>T	ENST00000274487.4	+	17	2729	c.2584A>T	c.(2584-2586)Aga>Tga	p.R862*	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	862	Spacer.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TCATTATGTAAGACGAGGCCT	0.433																																																	0													102.0	100.0	101.0					5																	129015552		2203	4300	6503	SO:0001587	stop_gained	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2584A>T	5.37:g.129015552A>T	ENSP00000274487:p.Arg862*			Nonsense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R862*	ENST00000274487.4	37	c.2584	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	A	40	8.503256	0.98838	.	.	ENSG00000145808	ENST00000274487	.	.	.	4.54	3.41	0.39046	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.9926	0.53184	0.5558:0.4442:0.0:0.0	.	.	.	.	X	862	.	.	R	+	1	2	ADAMTS19	129043451	0.994000	0.37717	0.981000	0.43875	0.962000	0.63368	2.401000	0.44513	1.085000	0.41206	0.528000	0.53228	AGA	ADAMTS19	-	pfam_ADAM_spacer1	ENSG00000145808		0.433	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	-	0.00	49	0	A	NM_133638		129015552	+1	tier1	-	no_errors	ENST00000274487	ensembl	human	known	74_37	nonsense	65.12	15	28	SNP	0.998	T
AGBL1	123624	genome.wustl.edu	37	15	86807505	86807505	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr15:86807505T>G	ENST00000441037.2	+	10	1060	c.965T>G	c.(964-966)cTt>cGt	p.L322R	AGBL1_ENST00000389298.3_Missense_Mutation_p.L53R|AGBL1_ENST00000421325.2_Missense_Mutation_p.L322R	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	322					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						CAGTCCAAACTTGGAGATGAT	0.453																																																	0													39.0	42.0	41.0					15																	86807505		2178	4292	6470	SO:0001583	missense	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.965T>G	15.37:g.86807505T>G	ENSP00000413001:p.Leu322Arg		A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.L322R	ENST00000441037.2	37	c.965	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	T	3.977	-0.007210	0.07773	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.10005	2.92;2.95	4.92	-6.28	0.02020	Armadillo-type fold (1);	3.151850	0.00691	N	0.000731	T	0.04407	0.0121	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.29805	0.257;0.257;0.037	B;B;B	0.29077	0.069;0.098;0.043	T	0.28490	-1.0042	10	0.17369	T	0.5	4.7957	8.6604	0.34088	0.0:0.4614:0.3348:0.2038	.	21;53;322	Q96MI9-2;Q96MI9-3;Q96MI9	.;.;CBPC4_HUMAN	R	351;322;53	ENSP00000397173:L322R;ENSP00000373949:L53R	ENSP00000373949:L53R	L	+	2	0	AGBL1	84608509	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.662000	0.05305	-1.047000	0.03242	-1.140000	0.01884	CTT	AGBL1	-	superfamily_ARM-type_fold	ENSG00000166748		0.453	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	-	0.00	36	0	T	NM_152336		86807505	+1	tier1	-	no_errors	ENST00000441037	ensembl	human	known	74_37	missense	70.83	7	17	SNP	0.001	G
ALK	238	genome.wustl.edu	37	2	29451843	29451843	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:29451843G>T	ENST00000389048.3	-	16	3628	c.2722C>A	c.(2722-2724)Cag>Aag	p.Q908K	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	908	Gly-rich.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	TTCATGGCCTGGGGGCAGGAA	0.597			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome																														yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0													32.0	32.0	32.0					2																	29451843		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.2722C>A	2.37:g.29451843G>T	ENSP00000373700:p.Gln908Lys		Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q908K	ENST00000389048.3	37	c.2722	CCDS33172.1	2	.	.	.	.	.	.	.	.	.	.	G	21.4	4.140547	0.77775	.	.	ENSG00000171094	ENST00000389048	T	0.76578	-1.03	5.36	5.36	0.76844	.	0.000000	0.45867	D	0.000336	T	0.68146	0.2969	N	0.19112	0.55	0.80722	D	1	B	0.22276	0.067	B	0.29353	0.101	T	0.62163	-0.6912	9	.	.	.	.	19.1002	0.93270	0.0:0.0:1.0:0.0	.	908	Q9UM73	ALK_HUMAN	K	908	ENSP00000373700:Q908K	.	Q	-	1	0	ALK	29305347	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.770000	0.74990	2.508000	0.84585	0.561000	0.74099	CAG	ALK	-	NULL	ENSG00000171094		0.597	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1	-	0.00	36	0	G	NM_004304		29451843	-1	tier1	-	no_errors	ENST00000389048	ensembl	human	known	74_37	missense	24.32	28	9	SNP	1.000	T
AMBN	258	genome.wustl.edu	37	4	71472353	71472353	+	Missense_Mutation	SNP	C	C	T	rs146171297		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:71472353C>T	ENST00000322937.6	+	13	1353	c.1250C>T	c.(1249-1251)aCg>aTg	p.T417M	AMBN_ENST00000449493.2_Missense_Mutation_p.T402M	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	417					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			ATGGATACCACGATGGCCCCA	0.517													C|||	1	0.000199681	0.0	0.0	5008	,	,		19579	0.0		0.0	False		,,,				2504	0.001																0								C	MET/THR	0,4406		0,0,2203	62.0	66.0	65.0		1250	5.8	0.9	4	dbSNP_134	65	1,8599	1.2+/-3.3	0,1,4299	no	missense	AMBN	NM_016519.5	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	417/448	71472353	1,13005	2203	4300	6503	SO:0001583	missense	0			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.1250C>T	4.37:g.71472353C>T	ENSP00000313809:p.Thr417Met		Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	pfam_Amelin,smart_Amelin	p.T417M	ENST00000322937.6	37	c.1250	CCDS3543.1	4	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163914	0.38217	0.0	1.16E-4	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.40225	1.04;1.04	5.76	5.76	0.90799	.	0.163302	0.42964	D	0.000621	T	0.65302	0.2678	M	0.75777	2.31	0.43326	D	0.995358	D	0.89917	1.0	D	0.97110	1.0	T	0.67681	-0.5608	10	0.87932	D	0	-7.8248	15.4698	0.75432	0.0:1.0:0.0:0.0	.	417	Q9NP70	AMBN_HUMAN	M	417;416;402	ENSP00000313809:T417M;ENSP00000391234:T402M	ENSP00000313809:T417M	T	+	2	0	AMBN	71506942	0.992000	0.36948	0.896000	0.35187	0.004000	0.04260	3.995000	0.57001	2.726000	0.93360	0.563000	0.77884	ACG	AMBN	-	pfam_Amelin,smart_Amelin	ENSG00000178522		0.517	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBN	HGNC	protein_coding	OTTHUMT00000252165.1	-	0.00	49	0	C	NM_016519		71472353	+1	tier1	rs146171297	no_errors	ENST00000322937	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.966	T
ANKRD11	29123	genome.wustl.edu	37	16	89348236	89348236	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr16:89348236G>T	ENST00000301030.4	-	9	5174	c.4714C>A	c.(4714-4716)Ctc>Atc	p.L1572I	ANKRD11_ENST00000378330.2_Missense_Mutation_p.L1572I	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	1572	Lys-rich.				bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L1572F(1)		breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TCCCCCAGGAGCTTCTCCCTG	0.577																																																	1	Substitution - Missense(1)	breast(1)											69.0	61.0	64.0					16																	89348236		2198	4300	6498	SO:0001583	missense	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.4714C>A	16.37:g.89348236G>T	ENSP00000301030:p.Leu1572Ile		Q6NTG1|Q6QMF8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L1572I	ENST00000301030.4	37	c.4714	CCDS32513.1	16	.	.	.	.	.	.	.	.	.	.	G	14.97	2.694069	0.48202	.	.	ENSG00000167522	ENST00000301030;ENST00000378330	T;T	0.44482	0.92;0.92	5.08	4.01	0.46588	.	0.000000	0.64402	D	0.000011	T	0.37293	0.0998	N	0.14661	0.345	0.80722	D	1	D	0.58620	0.983	P	0.53988	0.739	T	0.13229	-1.0517	10	0.34782	T	0.22	.	12.7855	0.57502	0.0876:0.0:0.9124:0.0	.	1572	Q6UB99	ANR11_HUMAN	I	1572	ENSP00000301030:L1572I;ENSP00000367581:L1572I	ENSP00000301030:L1572I	L	-	1	0	ANKRD11	87875737	1.000000	0.71417	0.994000	0.49952	0.686000	0.39977	6.162000	0.71874	0.968000	0.38212	0.462000	0.41574	CTC	ANKRD11	-	NULL	ENSG00000167522		0.577	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3		0.00	35	0	G	NM_013275		89348236	-1			no_errors	ENST00000301030	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
AP2M1	1173	genome.wustl.edu	37	3	183901682	183901683	+	3'UTR	INS	-	-	GG			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:183901682_183901683insGG	ENST00000292807.5	+	0	1734_1735				AP2M1_ENST00000461733.1_3'UTR|ABCF3_ENST00000292808.5_5'Flank|ABCF3_ENST00000429586.2_5'Flank|AP2M1_ENST00000439647.1_3'UTR|EIF2B5_ENST00000444495.1_Intron|AP2M1_ENST00000382456.3_3'UTR	NM_004068.3	NP_004059.2	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of protein localization to plasma membrane (GO:1903077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(1)	18	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAAAGCCAGGTGGGTTCCCTTT	0.624																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U36188	CCDS43177.1, CCDS43178.1	3q28	2008-07-18			ENSG00000161203	ENSG00000161203			564	protein-coding gene	gene with protein product	"""clathrin-associated/assembly/adaptor protein, medium 1"", ""plasma membrane adaptor AP-2 50kDA protein"", ""clathrin coat adaptor protein AP50"", ""clathrin adaptor complex AP2, mu subunit"", ""HA2 50 kDA subunit"", ""clathrin assembly protein complex 2 medium chain"", ""AP-2 mu 2 chain"""	601024		CLAPM1		8595912	Standard	NM_004068		Approved	AP50, mu2	uc003fmw.3	Q96CW1	OTTHUMG00000156822	ENST00000292807.5:c.*279->GG	3.37:g.183901683_183901684dupGG			A6NE12|D3DNT1|P20172|P53679	RNA	INS	-	NULL	ENST00000292807.5	37	NULL	CCDS43177.1	3																																																																																			AP2M1	-	-	ENSG00000161203		0.624	AP2M1-003	KNOWN	basic|CCDS	protein_coding	AP2M1	HGNC	protein_coding	OTTHUMT00000346013.1		0.00	38	0	-	NM_004068		183901683	+1	tier1		no_errors	ENST00000461733	ensembl	human	known	74_37	rna	9.80	46	5	INS	0.984:0.977	GG
AP3B1	8546	genome.wustl.edu	37	5	77477450	77477450	+	Missense_Mutation	SNP	C	C	T	rs140209190		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr5:77477450C>T	ENST00000255194.6	-	8	998	c.823G>A	c.(823-825)Gaa>Aaa	p.E275K	AP3B1_ENST00000519295.1_Missense_Mutation_p.E226K	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	275					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		TCATCAGATTCGTAGAAATTC	0.343									Hermansky-Pudlak syndrome																																								0								C	LYS/GLU	0,4406		0,0,2203	109.0	107.0	108.0		823	5.9	1.0	5	dbSNP_134	108	1,8597	1.2+/-3.3	0,1,4298	no	missense	AP3B1	NM_003664.3	56	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	275/1095	77477450	1,13003	2203	4299	6502	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.823G>A	5.37:g.77477450C>T	ENSP00000255194:p.Glu275Lys		E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_beta	p.E275K	ENST00000255194.6	37	c.823	CCDS4041.1	5	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684973	0.88639	0.0	1.16E-4	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760;ENST00000535667	T;T	0.56611	0.45;0.46	5.92	5.92	0.95590	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-type fold (1);	0.280783	0.44688	D	0.000436	T	0.61375	0.2342	L	0.54323	1.7	0.58432	D	0.999998	D	0.57257	0.979	P	0.50791	0.65	T	0.58171	-0.7683	10	0.41790	T	0.15	-4.7293	20.3172	0.98658	0.0:1.0:0.0:0.0	.	275	O00203	AP3B1_HUMAN	K	275;226;275;179	ENSP00000255194:E275K;ENSP00000430597:E226K	ENSP00000255194:E275K	E	-	1	0	AP3B1	77513206	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	5.756000	0.68757	2.801000	0.96364	0.650000	0.86243	GAA	AP3B1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_beta	ENSG00000132842		0.343	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	HGNC	protein_coding	OTTHUMT00000225548.2	-	0.00	53	0	C			77477450	-1	tier1	rs140209190	no_errors	ENST00000255194	ensembl	human	known	74_37	missense	71.43	10	25	SNP	1.000	T
AP5B1	91056	genome.wustl.edu	37	11	65546613	65546613	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:65546613G>A	ENST00000532090.2	-	2	1561	c.1351C>T	c.(1351-1353)Cgg>Tgg	p.R451W		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	451					endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						AGGGCTGCCCGCTGCCGCAAG	0.652																																																	0													8.0	11.0	10.0					11																	65546613		1861	4032	5893	SO:0001583	missense	0			JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.1351C>T	11.37:g.65546613G>A	ENSP00000454303:p.Arg451Trp		A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Missense_Mutation	SNP	NULL	p.R451W	ENST00000532090.2	37	c.1351	CCDS58146.1	11																																																																																			AP5B1	-	NULL	ENSG00000254470		0.652	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AP5B1	HGNC	protein_coding	OTTHUMT00000390636.2	-	0.00	33	0	G	NM_138368		65546613	-1	tier1	-	no_errors	ENST00000532090	ensembl	human	novel	74_37	missense	43.24	21	16	SNP	0.776	A
ARID1B	57492	genome.wustl.edu	37	6	157525061	157525061	+	Silent	SNP	G	G	C	rs146620657		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:157525061G>C	ENST00000350026.5	+	18	4918	c.4917G>C	c.(4915-4917)acG>acC	p.T1639T	ARID1B_ENST00000367148.1_Silent_p.T1692T|ARID1B_ENST00000346085.5_Silent_p.T1652T|ARID1B_ENST00000275248.4_Silent_p.T1634T	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1639					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CTGAGAGTACGTGGGCTTTGG	0.438																																																	0													509.0	505.0	506.0					6																	157525061		2203	4296	6499	SO:0001819	synonymous_variant	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.4917G>C	6.37:g.157525061G>C			Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Silent	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.T1692	ENST00000350026.5	37	c.5076	CCDS5251.2	6																																																																																			ARID1B	-	NULL	ENSG00000049618		0.438	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	-	0.00	156	0	G	NM_020732		157525061	+1	tier1	-	no_errors	ENST00000367148	ensembl	human	known	74_37	silent	22.22	146	42	SNP	0.010	C
ASTN2	23245	genome.wustl.edu	37	9	120053713	120053713	+	Silent	SNP	G	G	A	rs150992416	byFrequency	TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr9:120053713G>A	ENST00000313400.4	-	2	622	c.522C>T	c.(520-522)caC>caT	p.H174H	ASTN2_ENST00000373996.3_Silent_p.H174H|ASTN2_ENST00000361209.2_Silent_p.H174H|ASTN2_ENST00000361477.3_De_novo_Start_OutOfFrame			O75129	ASTN2_HUMAN	astrotactin 2	174					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TCATGGAGACGTGGAAGTACA	0.602													G|||	3	0.000599042	0.0015	0.0	5008	,	,		14919	0.0		0.001	False		,,,				2504	0.0																0								G		1,4405	2.1+/-5.4	0,1,2202	66.0	62.0	63.0		522	0.7	1.0	9	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ASTN2	NM_014010.4		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		174/1289	120053713	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.522C>T	9.37:g.120053713G>A			A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Silent	SNP	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.H174	ENST00000313400.4	37	c.522		9																																																																																			ASTN2	-	NULL	ENSG00000148219		0.602	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding		-	0.00	32	0	G	NM_014010		120053713	-1	tier1	rs150992416	no_errors	ENST00000313400	ensembl	human	known	74_37	silent	24.14	22	7	SNP	0.999	A
ASS1	445	genome.wustl.edu	37	9	133352306	133352306	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr9:133352306G>A	ENST00000372394.1	+	10	1127	c.646G>A	c.(646-648)Gcc>Acc	p.A216T	ASS1_ENST00000352480.5_Missense_Mutation_p.A216T|ASS1_ENST00000493984.2_3'UTR|ASS1_ENST00000372393.3_Missense_Mutation_p.A216T			P00966	ASSY_HUMAN	argininosuccinate synthase 1	216					acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	CCCAGCCAAAGCCCCCAACAC	0.547																																																	0													112.0	119.0	116.0					9																	133352306		2203	4300	6503	SO:0001583	missense	0			X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.646G>A	9.37:g.133352306G>A	ENSP00000361471:p.Ala216Thr		Q6LDL2|Q86UZ0|Q96GT4	Missense_Mutation	SNP	pfam_Arginosuc_synth,pfam_QueC,tigrfam_Arginosuc_synth	p.A216T	ENST00000372394.1	37	c.646	CCDS6933.1	9	.	.	.	.	.	.	.	.	.	.	G	16.51	3.143877	0.57044	.	.	ENSG00000130707	ENST00000334909;ENST00000352480;ENST00000372394;ENST00000372393	D;D;D	0.98701	-5.08;-5.08;-5.08	6.08	4.24	0.50183	Argininosuccinate synthetase, catalytic/multimerisation domain body (1);	0.205072	0.42548	U	0.000682	D	0.96833	0.8966	M	0.63169	1.94	0.40695	D	0.982431	B;B;B;B;B	0.32040	0.004;0.353;0.353;0.011;0.011	B;B;B;B;B	0.33454	0.04;0.164;0.164;0.027;0.027	D	0.95859	0.8881	10	0.87932	D	0	.	6.0428	0.19744	0.1488:0.0:0.6262:0.225	.	216;99;99;216;216	A8KAP9;B4E395;E9PDT0;Q5T6L4;P00966	.;.;.;.;ASSY_HUMAN	T	216	ENSP00000253004:A216T;ENSP00000361471:A216T;ENSP00000361469:A216T	ENSP00000361470:A216T	A	+	1	0	ASS1	132342127	0.961000	0.32948	0.999000	0.59377	0.818000	0.46254	0.963000	0.29293	1.594000	0.50039	0.655000	0.94253	GCC	ASS1	-	pfam_Arginosuc_synth,tigrfam_Arginosuc_synth	ENSG00000130707		0.547	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ASS1	HGNC	protein_coding	OTTHUMT00000054652.1	-	0.00	35	0	G	NM_000050		133352306	+1	tier1	-	no_errors	ENST00000352480	ensembl	human	known	74_37	missense	44.44	15	12	SNP	0.962	A
ASXL1	171023	genome.wustl.edu	37	20	31019408	31019408	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr20:31019408G>T	ENST00000375687.4	+	10	1329	c.905G>T	c.(904-906)cGt>cTt	p.R302L	ASXL1_ENST00000306058.5_Missense_Mutation_p.R297L	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	302	Interaction with KDM1A. {ECO:0000250}.|Interaction with NCOA1. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GGCCTGTTGCGTCTCAGCAGC	0.502			"""F, N, Mis"""		"""MDS, CMML"""																																			Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	0													70.0	70.0	70.0					20																	31019408		2203	4300	6503	SO:0001583	missense	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.905G>T	20.37:g.31019408G>T	ENSP00000364839:p.Arg302Leu		B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	NULL	p.R302L	ENST00000375687.4	37	c.905	CCDS13201.1	20	.	.	.	.	.	.	.	.	.	.	G	20.5	4.003623	0.74932	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058;ENST00000553345	T;T	0.22743	1.95;1.94	5.27	4.31	0.51392	.	0.000000	0.85682	D	0.000000	T	0.45115	0.1326	M	0.71036	2.16	0.58432	D	0.999998	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.996	T	0.41395	-0.9511	10	0.87932	D	0	-11.2832	14.3458	0.66662	0.0721:0.0:0.9279:0.0	.	297;302	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	L	302;302;302;241;297;74	ENSP00000364839:R302L;ENSP00000305119:R297L	ENSP00000305119:R297L	R	+	2	0	ASXL1	30483069	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.059000	0.57470	2.751000	0.94390	0.650000	0.86243	CGT	ASXL1	-	NULL	ENSG00000171456		0.502	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2	-	0.00	98	0	G	NM_015338		31019408	+1	tier1	-	no_errors	ENST00000375687	ensembl	human	known	74_37	missense	44.36	74	59	SNP	1.000	T
ATP2B2	491	genome.wustl.edu	37	3	10400482	10400482	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:10400482G>A	ENST00000352432.4	-	13	2098	c.2029C>T	c.(2029-2031)Cgc>Tgc	p.R677C	ATP2B2_ENST00000360273.2_Missense_Mutation_p.R677C|ATP2B2_ENST00000383800.4_Missense_Mutation_p.R632C|ATP2B2_ENST00000343816.4_Missense_Mutation_p.R663C|ATP2B2_ENST00000397077.1_Missense_Mutation_p.R632C			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	677					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						GGGAAGTCGCGGTAGGCCACG	0.627																																					Ovarian(125;1619 1709 15675 19819 38835)												0													63.0	53.0	56.0					3																	10400482		2203	4300	6503	SO:0001583	missense	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.2029C>T	3.37:g.10400482G>A	ENSP00000324172:p.Arg677Cys		O00766|Q12994|Q16818	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.R677C	ENST00000352432.4	37	c.2029	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099322	0.76983	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.98329	-4.87;-4.87;-4.87;-4.87;-4.87;-4.87	4.65	2.76	0.32466	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.98770	0.9586	M	0.83384	2.64	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.996;0.997;0.996	D	0.99069	1.0833	10	0.87932	D	0	-19.1534	13.1409	0.59434	0.0:0.0:0.5844:0.4156	.	612;644;677	F5H7F7;Q4LE63;Q01814	.;.;AT2B2_HUMAN	C	677;632;632;677;663;612;533;677	ENSP00000324172:R677C;ENSP00000373311:R632C;ENSP00000380267:R632C;ENSP00000353414:R677C;ENSP00000344677:R663C;ENSP00000414854:R533C	ENSP00000342954:R677C	R	-	1	0	ATP2B2	10375482	1.000000	0.71417	0.990000	0.47175	0.998000	0.95712	4.791000	0.62460	0.349000	0.23975	0.491000	0.48974	CGC	ATP2B2	-	superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_plasma	ENSG00000157087		0.627	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	-	0.00	38	0	G	NM_001683		10400482	-1	tier1	-	no_errors	ENST00000352432	ensembl	human	known	74_37	missense	41.86	50	36	SNP	1.000	A
ATP13A5	344905	genome.wustl.edu	37	3	193051635	193051635	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:193051635G>C	ENST00000342358.4	-	11	1293	c.1176C>G	c.(1174-1176)ttC>ttG	p.F392L		NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	392						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TGTATAGTTTGAAGTTCAGAG	0.448																																																	0													104.0	101.0	102.0					3																	193051635		2203	4300	6503	SO:0001583	missense	0			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.1176C>G	3.37:g.193051635G>C	ENSP00000341942:p.Phe392Leu		Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.F392L	ENST00000342358.4	37	c.1176	CCDS33914.1	3	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685581	0.88639	.	.	ENSG00000187527	ENST00000342358	D	0.90261	-2.64	5.53	4.65	0.58169	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.64402	D	0.000001	D	0.93249	0.7849	M	0.71871	2.18	0.46521	D	0.999083	P	0.49696	0.927	P	0.58620	0.842	D	0.93181	0.6574	10	0.59425	D	0.04	-17.9563	12.5221	0.56065	0.0809:0.0:0.9191:0.0	.	392	Q4VNC0	AT135_HUMAN	L	392	ENSP00000341942:F392L	ENSP00000341942:F392L	F	-	3	2	ATP13A5	194534329	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.128000	0.57951	2.611000	0.88343	0.650000	0.86243	TTC	ATP13A5	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Cation_typ_V	ENSG00000187527		0.448	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1	-	0.00	65	0	G	NM_198505		193051635	-1	tier1	-	no_errors	ENST00000342358	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	C
ATP8A1	10396	genome.wustl.edu	37	4	42509113	42509113	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:42509113T>G	ENST00000381668.5	-	23	2237	c.2006A>C	c.(2005-2007)gAa>gCa	p.E669A	ATP8A1_ENST00000264449.10_Missense_Mutation_p.E654A	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	669					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	TTCTATGGTTTCAGGCACTTG	0.373																																																	0													186.0	175.0	178.0					4																	42509113		2203	4300	6503	SO:0001583	missense	0			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.2006A>C	4.37:g.42509113T>G	ENSP00000371084:p.Glu669Ala		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.E669A	ENST00000381668.5	37	c.2006	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	T	26.5	4.747997	0.89663	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	D;D	0.93659	-3.26;-3.26	6.03	6.03	0.97812	HAD-like domain (2);	0.000000	0.85682	D	0.000000	D	0.97161	0.9072	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	0.99;1.0	D;D	0.77004	0.958;0.989	D	0.97553	1.0093	10	0.59425	D	0.04	.	16.5602	0.84551	0.0:0.0:0.0:1.0	.	654;669	Q32M35;Q9Y2Q0	.;AT8A1_HUMAN	A	669;654	ENSP00000371084:E669A;ENSP00000264449:E654A	ENSP00000264449:E654A	E	-	2	0	ATP8A1	42203870	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.649000	0.83500	2.313000	0.78055	0.454000	0.30748	GAA	ATP8A1	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000124406		0.373	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	HGNC	protein_coding	OTTHUMT00000216861.2	-	0.00	115	0	T	NM_006095		42509113	-1	tier1	-	no_errors	ENST00000381668	ensembl	human	known	74_37	missense	13.33	117	18	SNP	1.000	G
BICC1	80114	genome.wustl.edu	37	10	60556253	60556253	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr10:60556253T>G	ENST00000373886.3	+	10	1337	c.1333T>G	c.(1333-1335)Tta>Gta	p.L445V	BICC1_ENST00000263103.1_Missense_Mutation_p.L71V	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	445					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						CCTGGATATCTTAGCTTCAGC	0.517																																																	0													87.0	77.0	80.0					10																	60556253		2203	4300	6503	SO:0001583	missense	0			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.1333T>G	10.37:g.60556253T>G	ENSP00000362993:p.Leu445Val			Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_KH_dom,smart_SAM,pfscan_SAM,pfscan_KH_dom_type_1	p.L445V	ENST00000373886.3	37	c.1333	CCDS31206.1	10	.	.	.	.	.	.	.	.	.	.	T	18.16	3.561758	0.65538	.	.	ENSG00000122870	ENST00000373886;ENST00000263103	T;T	0.50548	1.62;0.74	5.18	4.03	0.46877	.	0.000000	0.85682	D	0.000000	T	0.61324	0.2338	L	0.54323	1.7	0.48975	D	0.999732	D;D	0.69078	0.997;0.997	D;D	0.78314	0.991;0.978	T	0.62210	-0.6902	10	0.66056	D	0.02	-8.7709	11.1332	0.48360	0.0:0.0731:0.0:0.9269	.	365;445	E7EU62;Q9H694	.;BICC1_HUMAN	V	445;71	ENSP00000362993:L445V;ENSP00000263103:L71V	ENSP00000263103:L71V	L	+	1	2	BICC1	60226259	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.757000	0.47557	0.909000	0.36697	0.533000	0.62120	TTA	BICC1	-	NULL	ENSG00000122870		0.517	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	HGNC	protein_coding	OTTHUMT00000048150.2	-	0.00	46	0	T	NM_025044		60556253	+1	tier1	-	no_errors	ENST00000373886	ensembl	human	known	74_37	missense	25.71	26	9	SNP	1.000	G
BRIP1	83990	genome.wustl.edu	37	17	59885878	59885878	+	Missense_Mutation	SNP	C	C	T	rs145601931		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr17:59885878C>T	ENST00000259008.2	-	7	1135	c.868G>A	c.(868-870)Ggt>Agt	p.G290S	BRIP1_ENST00000577598.1_Missense_Mutation_p.G290S	NM_032043.2	NP_114432.2	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	290	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(9)|kidney(5)|large_intestine(9)|liver(2)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	55						TTGAAGTTACCGACTACCTCA	0.403			"""F, N, Mis"""			"""AML, leukemia, breast"""		Involved in tolerance or repair of DNA crosslinks																															yes	Rec		"""Fanconi anaemia J, breast cancer susceptiblity"""	17	17q22	83990	BRCA1 interacting protein C-terminal helicase 1		"""L, E"""	0								C	SER/GLY	0,4406		0,0,2203	125.0	114.0	118.0		868	4.3	0.9	17	dbSNP_134	118	1,8599	1.2+/-3.3	0,1,4299	no	missense	BRIP1	NM_032043.2	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	290/1250	59885878	1,13005	2203	4300	6503	SO:0001583	missense	0			AF360549	CCDS11631.1	17q22.2	2014-09-17				ENSG00000136492		"""Fanconi anemia, complementation groups"""	20473	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-associated helicase 1"""	605882				11595410, 11301010	Standard	NM_032043		Approved	OF, BACH1, FANCJ	uc002izk.2	Q9BX63		ENST00000259008.2:c.868G>A	17.37:g.59885878C>T	ENSP00000259008:p.Gly290Ser		Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_DEAD_2,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_TIL_dom,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.G290S	ENST00000259008.2	37	c.868	CCDS11631.1	17	.	.	.	.	.	.	.	.	.	.	C	5.895	0.349201	0.11182	0.0	1.16E-4	ENSG00000136492	ENST00000259008	T	0.69926	-0.44	5.29	4.32	0.51571	DEAD-like helicase (1);DEAD2 (1);Helicase, superfamily 1/2, ATP-binding domain, DinG/Rad3-type (1);	0.294904	0.39759	N	0.001276	T	0.37758	0.1015	N	0.04203	-0.255	0.25962	N	0.982616	P	0.46912	0.886	B	0.38156	0.266	T	0.18429	-1.0337	9	.	.	.	-4.5077	8.0862	0.30773	0.0:0.8079:0.0:0.1921	.	290	Q9BX63	FANCJ_HUMAN	S	290	ENSP00000259008:G290S	.	G	-	1	0	BRIP1	57240660	0.928000	0.31464	0.946000	0.38457	0.470000	0.32858	2.809000	0.47971	1.371000	0.46172	-0.244000	0.11960	GGT	BRIP1	-	pfam_DEAD_2,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase-like_DEXD_c2,smart_Helicase_ATP-bd,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000136492		0.403	BRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRIP1	HGNC	protein_coding	OTTHUMT00000445362.1		0.00	40	0	C	NM_032043		59885878	-1			no_errors	ENST00000259008	ensembl	human	known	74_37	missense	5.41	34	2	SNP	0.920	T
C4orf50	389197	genome.wustl.edu	37	4	5969167	5969167	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:5969167T>G	ENST00000324058.5	-	5	520	c.431A>C	c.(430-432)aAg>aCg	p.K144T	C4orf50_ENST00000531445.1_Missense_Mutation_p.K618T			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50	144										breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						CATCTCAGACTTGACGTCCAG	0.512																																																	0													144.0	126.0	132.0					4																	5969167		2203	4300	6503	SO:0001583	missense	0			BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971	ENST00000324058.5:c.431A>C	4.37:g.5969167T>G	ENSP00000317287:p.Lys144Thr			Missense_Mutation	SNP	NULL	p.K618T	ENST00000324058.5	37	c.1853		4	.	.	.	.	.	.	.	.	.	.	T	3.806	-0.040746	0.07452	.	.	ENSG00000181215	ENST00000531445;ENST00000324058	T;T	0.23754	1.89;1.89	2.99	-2.42	0.06542	.	1.305730	0.05264	N	0.516271	T	0.16769	0.0403	N	0.22421	0.69	0.09310	N	1	B	0.25169	0.119	B	0.19391	0.025	T	0.31998	-0.9923	10	0.45353	T	0.12	-1.0281	8.2578	0.31766	0.0:0.6278:0.0:0.3722	.	144	Q6ZRC1	CD050_HUMAN	T	618;144	ENSP00000437121:K618T;ENSP00000317287:K144T	ENSP00000317287:K144T	K	-	2	0	C4orf50	6020068	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-0.337000	0.07852	-0.543000	0.06240	0.533000	0.62120	AAG	C4orf50	-	NULL	ENSG00000181215		0.512	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	C4orf50	HGNC	protein_coding		-	0.00	30	0	T	NM_207405		5969167	-1	tier1	-	no_errors	ENST00000531445	ensembl	human	known	74_37	missense	86.54	7	45	SNP	0.001	G
C6orf118	168090	genome.wustl.edu	37	6	165715455	165715455	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:165715455A>C	ENST00000230301.8	-	2	376	c.356T>G	c.(355-357)gTc>gGc	p.V119G	C6orf118_ENST00000543069.1_Missense_Mutation_p.V15G	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	119										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		CTCACTGGGGACCAGGGCCGT	0.657																																																	0													66.0	70.0	69.0					6																	165715455		2203	4300	6503	SO:0001583	missense	0				CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.356T>G	6.37:g.165715455A>C	ENSP00000230301:p.Val119Gly		Q8TC11	Missense_Mutation	SNP	superfamily_Ribonuclease/ribotoxin	p.V119G	ENST00000230301.8	37	c.356	CCDS5288.1	6	.	.	.	.	.	.	.	.	.	.	A	6.940	0.543216	0.13250	.	.	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.15487	2.58;2.42	5.31	0.305	0.15801	.	2.124770	0.01950	N	0.042540	T	0.02929	0.0087	L	0.31664	0.95	0.09310	N	0.999991	B	0.12013	0.005	B	0.08055	0.003	T	0.32508	-0.9904	10	0.20519	T	0.43	.	0.8465	0.01162	0.4626:0.1934:0.1977:0.1463	.	119	Q5T5N4	CF118_HUMAN	G	119;15	ENSP00000230301:V119G;ENSP00000439288:V15G	ENSP00000230301:V119G	V	-	2	0	C6orf118	165635445	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.045000	0.14013	-0.167000	0.10871	0.533000	0.62120	GTC	C6orf118	-	NULL	ENSG00000112539		0.657	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C6orf118	HGNC	protein_coding	OTTHUMT00000043026.1	-	0.00	28	0	A	NM_144980		165715455	-1	tier1	-	no_errors	ENST00000230301	ensembl	human	known	74_37	missense	34.62	17	9	SNP	0.000	C
CACNA1H	8912	genome.wustl.edu	37	16	1254037	1254037	+	Missense_Mutation	SNP	C	C	T	rs181892888	byFrequency	TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr16:1254037C>T	ENST00000348261.5	+	10	2278	c.2030C>T	c.(2029-2031)tCg>tTg	p.S677L	CACNA1H_ENST00000358590.4_Missense_Mutation_p.S677L|RP11-616M22.3_ENST00000564700.1_RNA|CACNA1H_ENST00000565831.1_Missense_Mutation_p.S677L	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	677					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GGCCATCTGTCGGGCCTCAGT	0.706													C|||	17	0.00339457	0.0008	0.0	5008	,	,		14190	0.0159		0.0	False		,,,				2504	0.0																0								C	LEU/SER,LEU/SER	1,3713		0,1,1856	5.0	6.0	6.0		2030,2030	4.3	0.9	16		6	0,8092		0,0,4046	yes	missense,missense	CACNA1H	NM_001005407.1,NM_021098.2	145,145	0,1,5902	TT,TC,CC		0.0,0.0269,0.0085	probably-damaging,probably-damaging	677/2348,677/2354	1254037	1,11805	1857	4046	5903	SO:0001583	missense	0			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.2030C>T	16.37:g.1254037C>T	ENSP00000334198:p.Ser677Leu		B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.S677L	ENST00000348261.5	37	c.2030	CCDS45375.1	16	8	0.003663003663003663	1	0.0020325203252032522	0	0.0	7	0.012237762237762238	0	0.0	C	13.76	2.333523	0.41297	2.69E-4	0.0	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.96619	-4.07;-4.02	4.29	4.29	0.51040	.	4.674440	0.00357	N	0.000027	D	0.94663	0.8279	L	0.36672	1.1	0.36662	D	0.878007	P;D	0.63046	0.915;0.992	B;P	0.49853	0.132;0.624	D	0.87742	0.2586	10	0.36615	T	0.2	.	15.9081	0.79447	0.0:1.0:0.0:0.0	.	677;677	O95180-2;O95180	.;CAC1H_HUMAN	L	677	ENSP00000334198:S677L;ENSP00000351401:S677L	ENSP00000334198:S677L	S	+	2	0	CACNA1H	1194038	0.996000	0.38824	0.944000	0.38274	0.159000	0.22180	6.911000	0.75746	2.233000	0.73108	0.561000	0.74099	TCG	CACNA1H	-	NULL	ENSG00000196557		0.706	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1		0.00	21	0	C	NM_001005407		1254037	+1			no_errors	ENST00000348261	ensembl	human	known	74_37	missense	33.33	12	6	SNP	0.999	T
CAPS2	84698	genome.wustl.edu	37	12	75669817	75669817	+	3'UTR	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr12:75669817A>C	ENST00000409445.3	-	0	2076				RP11-560G2.1_ENST00000549953.1_RNA|CAPS2_ENST00000409004.1_5'UTR|CAPS2_ENST00000409799.1_3'UTR	NM_032606.3	NP_115995.2	Q9BXY5	CAYP2_HUMAN	calcyphosine 2								calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	10						TTACCTCAGAAGTTTATAGAA	0.338																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF251056	CCDS9008.2, CCDS66424.1, CCDS73497.1	12q14.1	2013-01-10	2005-05-09		ENSG00000180881	ENSG00000180881		"""EF-hand domain containing"""	16471	protein-coding gene	gene with protein product		607724	"""calcyphosphine 2"""			11846421	Standard	NM_032606		Approved		uc001sxk.4	Q9BXY5	OTTHUMG00000152787	ENST00000409445.3:c.*206T>G	12.37:g.75669817A>C			Q6PH84|Q8N242|Q8NAY5	RNA	SNP	-	NULL	ENST00000409445.3	37	NULL	CCDS9008.2	12																																																																																			CAPS2	-	-	ENSG00000180881		0.338	CAPS2-001	KNOWN	basic|CCDS	protein_coding	CAPS2	HGNC	protein_coding	OTTHUMT00000327880.2	-	0.00	23	0	A			75669817	-1	tier1	-	no_errors	ENST00000409004	ensembl	human	known	74_37	rna	66.67	4	8	SNP	0.000	C
CCDC60	160777	genome.wustl.edu	37	12	119866563	119866563	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr12:119866563A>C	ENST00000327554.2	+	2	631	c.166A>C	c.(166-168)Agc>Cgc	p.S56R	CCDC60_ENST00000536742.1_Missense_Mutation_p.S56R|CCDC60_ENST00000546345.1_3'UTR|CCDC60_ENST00000539847.1_Missense_Mutation_p.S56R|RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	56										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		CCTTATACGAAGCCGGTGAGT	0.483																																																	0													63.0	55.0	58.0					12																	119866563		2203	4299	6502	SO:0001583	missense	0			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.166A>C	12.37:g.119866563A>C	ENSP00000333374:p.Ser56Arg			Missense_Mutation	SNP	NULL	p.S56R	ENST00000327554.2	37	c.166	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	A	14.52	2.559747	0.45590	.	.	ENSG00000183273	ENST00000536742;ENST00000327554;ENST00000539847	T;T;T	0.62232	0.29;1.86;0.04	4.54	3.41	0.39046	.	0.722947	0.13281	N	0.399723	T	0.53238	0.1784	L	0.57536	1.79	0.30179	N	0.800564	P	0.34639	0.461	B	0.31812	0.136	T	0.52961	-0.8505	9	.	.	.	-1.7314	6.9135	0.24347	0.8981:0.0:0.1019:0.0	.	56	Q8IWA6	CCD60_HUMAN	R	56	ENSP00000445505:S56R;ENSP00000333374:S56R;ENSP00000443403:S56R	.	S	+	1	0	CCDC60	118350946	0.998000	0.40836	0.991000	0.47740	0.965000	0.64279	3.568000	0.53820	1.078000	0.41014	0.533000	0.62120	AGC	CCDC60	-	NULL	ENSG00000183273		0.483	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	HGNC	protein_coding	OTTHUMT00000401680.1	-	0.00	26	0	A	NM_178499		119866563	+1	tier1	-	no_errors	ENST00000327554	ensembl	human	known	74_37	missense	78.95	4	15	SNP	0.992	C
CCIN	881	genome.wustl.edu	37	9	36170618	36170619	+	Frame_Shift_Ins	INS	-	-	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr9:36170618_36170619insG	ENST00000335119.2	+	1	1230_1231	c.1119_1120insG	c.(1120-1122)gggfs	p.G374fs		NM_005893.2	NP_005884.2	Q13939	CALI_HUMAN	calicin	374					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				breast(3)|endometrium(2)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(4)	21			STAD - Stomach adenocarcinoma(86;0.228)			TGGTGACCTGTGGGGGGACAGT	0.584																																																	0																																										SO:0001589	frameshift_variant	0			Z46967	CCDS6599.1	9p13.1	2013-10-02			ENSG00000185972	ENSG00000185972		"""BTB/POZ domain containing"""	1568	protein-coding gene	gene with protein product		603960				7641791	Standard	NM_005893		Approved	KBTBD14, BTBD20	uc003zzb.4	Q13939	OTTHUMG00000019901	ENST00000335119.2:c.1125dupG	9.37:g.36170624_36170624dupG	ENSP00000334996:p.Gly374fs		Q9BXG7	Frame_Shift_Ins	INS	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.T375fs	ENST00000335119.2	37	c.1119_1120	CCDS6599.1	9																																																																																			CCIN	-	pfam_Kelch_1,smart_Kelch_1	ENSG00000185972		0.584	CCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCIN	HGNC	protein_coding	OTTHUMT00000052418.1		0.00	64	0	-	NM_005893		36170619	+1	tier1		no_errors	ENST00000335119	ensembl	human	known	74_37	frame_shift_ins	19.18	59	14	INS	0.655:0.977	G
CDHR3	222256	genome.wustl.edu	37	7	105636791	105636791	+	Missense_Mutation	SNP	G	G	A	rs200623269		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr7:105636791G>A	ENST00000317716.9	+	6	784	c.704G>A	c.(703-705)cGc>cAc	p.R235H	CDHR3_ENST00000470188.1_Intron|CDHR3_ENST00000541203.1_Intron|CDHR3_ENST00000478080.1_Missense_Mutation_p.R147H|CDHR3_ENST00000343407.5_5'UTR|CDHR3_ENST00000542731.1_Missense_Mutation_p.R235H	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	235	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						GAAGTCCCTCGCTTTACCAGG	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		19518	0.0		0.001	False		,,,				2504	0.0																0								G	HIS/ARG	2,4074		0,2,2036	34.0	37.0	36.0		704	-0.1	0.6	7		36	5,8347		0,5,4171	yes	missense	CDHR3	NM_152750.4	29	0,7,6207	AA,AG,GG		0.0599,0.0491,0.0563	benign	235/886	105636791	7,12421	2038	4176	6214	SO:0001583	missense	0			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.704G>A	7.37:g.105636791G>A	ENSP00000325954:p.Arg235His		Q8TCI7	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R235H	ENST00000317716.9	37	c.704	CCDS47684.1	7	.	.	.	.	.	.	.	.	.	.	G	4.951	0.176682	0.09443	4.91E-4	5.99E-4	ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080	T;T;T	0.38887	1.11;1.11;1.11	5.27	-0.0994	0.13624	Cadherin (2);Cadherin-like (1);	0.448728	0.24044	N	0.042079	T	0.26702	0.0653	L	0.45698	1.435	0.26193	N	0.979556	B;B	0.09022	0.001;0.002	B;B	0.04013	0.001;0.001	T	0.15636	-1.0430	10	0.15952	T	0.53	-3.3985	4.534	0.12019	0.1906:0.0:0.5143:0.2952	.	222;235	B3KYA0;Q6ZTQ4	.;CDHR3_HUMAN	H	235;235;147	ENSP00000439766:R235H;ENSP00000325954:R235H;ENSP00000417771:R147H	ENSP00000325954:R235H	R	+	2	0	CDHR3	105424027	0.249000	0.23941	0.582000	0.28627	0.419000	0.31324	0.384000	0.20668	0.078000	0.16900	-1.142000	0.01873	CGC	CDHR3	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000128536		0.587	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	HGNC	protein_coding	OTTHUMT00000349025.2	-	0.00	38	0	G	NM_152750		105636791	+1	tier1	rs200623269	no_errors	ENST00000317716	ensembl	human	known	74_37	missense	74.29	9	26	SNP	0.321	A
CELF2	10659	genome.wustl.edu	37	10	11367844	11367844	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr10:11367844T>G	ENST00000379261.4	+	12	1393	c.1301T>G	c.(1300-1302)tTt>tGt	p.F434C	CELF2_ENST00000542579.1_Missense_Mutation_p.F447C|CELF2_ENST00000399850.3_Missense_Mutation_p.F416C|CELF2_ENST00000537122.1_Missense_Mutation_p.F329C|CELF2_ENST00000608830.1_Missense_Mutation_p.F414C|CELF2_ENST00000609692.1_Intron|CELF2_ENST00000450189.1_Missense_Mutation_p.F447C|CELF2_ENST00000354440.2_Missense_Mutation_p.F416C|CELF2_ENST00000427450.1_Missense_Mutation_p.F416C|CELF2_ENST00000354897.3_Missense_Mutation_p.F428C|CELF2_ENST00000416382.2_Missense_Mutation_p.F434C|CELF2_ENST00000417956.2_Missense_Mutation_p.F414C|CELF2_ENST00000315874.4_Missense_Mutation_p.F416C	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2	434	Necessary for RNA-binding, TNNT2 exon 5 and NMDA R1 exon 21 inclusion.|RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						CCACAGGAATTTGGAGACCAG	0.418																																																	0													131.0	119.0	123.0					10																	11367844		1868	4106	5974	SO:0001583	missense	0			U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.1301T>G	10.37:g.11367844T>G	ENSP00000368563:p.Phe434Cys		B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA	p.F447C	ENST00000379261.4	37	c.1340	CCDS44354.1	10	.	.	.	.	.	.	.	.	.	.	T	15.56	2.869336	0.51588	.	.	ENSG00000048740	ENST00000379261;ENST00000416382;ENST00000450189;ENST00000542579;ENST00000399850;ENST00000417956;ENST00000315874;ENST00000354440;ENST00000354897;ENST00000427450;ENST00000537122;ENST00000538632	T;T;T;T;T;T;T;T;T;T	0.15017	2.46;2.46;2.46;2.46;2.46;2.46;2.46;2.46;2.46;2.46	5.25	5.25	0.73442	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.33702	0.0872	L	0.41236	1.265	0.80722	D	1	B;B;B;D;B;B	0.76494	0.025;0.012;0.136;0.999;0.072;0.045	B;B;B;D;B;B	0.85130	0.158;0.12;0.151;0.997;0.148;0.158	T	0.04481	-1.0948	10	0.59425	D	0.04	-10.4627	15.1706	0.72869	0.0:0.0:0.0:1.0	.	422;440;435;447;447;434	B4DDE7;B4DS31;B2RA86;E9PC62;O95319-3;O95319	.;.;.;.;.;CELF2_HUMAN	C	434;434;447;447;416;414;416;416;424;416;329;240	ENSP00000368563:F434C;ENSP00000406451:F434C;ENSP00000389951:F447C;ENSP00000443926:F447C;ENSP00000382743:F416C;ENSP00000404834:F414C;ENSP00000315328:F416C;ENSP00000346426:F416C;ENSP00000388530:F416C;ENSP00000438884:F329C	ENSP00000315328:F416C	F	+	2	0	CELF2	11407850	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	1.980000	0.57719	0.528000	0.53228	TTT	CELF2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000048740		0.418	CELF2-201	KNOWN	basic|CCDS	protein_coding	CELF2	HGNC	protein_coding		-	0.00	88	0	T			11367844	+1	tier1	-	no_errors	ENST00000450189	ensembl	human	known	74_37	missense	42.03	40	29	SNP	1.000	G
CHRNB2	1141	genome.wustl.edu	37	1	154543681	154543681	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:154543681G>A	ENST00000368476.3	+	5	646	c.382G>A	c.(382-384)Gag>Aag	p.E128K		NM_000748.2	NP_000739.1	P17787	ACHB2_HUMAN	cholinergic receptor, nicotinic, beta 2 (neuronal)	128					action potential (GO:0001508)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|central nervous system projection neuron axonogenesis (GO:0021952)|cognition (GO:0050890)|conditioned taste aversion (GO:0001661)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|lateral geniculate nucleus development (GO:0021771)|learning (GO:0007612)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|neurological system process (GO:0050877)|optic nerve morphogenesis (GO:0021631)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|protein heterooligomerization (GO:0051291)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of circadian sleep/wake cycle, REM sleep (GO:0042320)|regulation of dendrite morphogenesis (GO:0048814)|regulation of dopamine metabolic process (GO:0042053)|regulation of dopamine secretion (GO:0014059)|regulation of synapse assembly (GO:0051963)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|sensory perception of pain (GO:0019233)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|smooth muscle contraction (GO:0006939)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic transmission involved in micturition (GO:0060084)|synaptic transmission, cholinergic (GO:0007271)|vestibulocochlear nerve development (GO:0021562)|visual learning (GO:0008542)|visual perception (GO:0007601)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)|ligand-gated ion channel activity (GO:0015276)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|skin(1)|urinary_tract(3)	28	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)		Dextromethorphan(DB00514)|Galantamine(DB00674)|Nicotine(DB00184)	CGGCATGTACGAGGTGTCCTT	0.552																																																	0													143.0	131.0	135.0					1																	154543681		2203	4300	6503	SO:0001583	missense	0			U62437	CCDS1070.1	1q21.3	2012-02-11	2006-02-01		ENSG00000160716	ENSG00000160716		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1962	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 2 (neuronal)"""	118507	"""cholinergic receptor, nicotinic, beta polypeptide 2 (neuronal)"""			1505988	Standard	NM_000748		Approved		uc001ffg.3	P17787	OTTHUMG00000037262	ENST00000368476.3:c.382G>A	1.37:g.154543681G>A	ENSP00000357461:p.Glu128Lys		Q9UEH9	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.E128K	ENST00000368476.3	37	c.382	CCDS1070.1	1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260916	0.80246	.	.	ENSG00000160716	ENST00000368476	T	0.77877	-1.13	4.27	4.27	0.50696	Neurotransmitter-gated ion-channel ligand-binding (3);	0.119854	0.53938	D	0.000043	D	0.84853	0.5564	M	0.71036	2.16	0.54753	D	0.999989	D	0.89917	1.0	D	0.97110	1.0	D	0.87022	0.2129	10	0.72032	D	0.01	.	16.4609	0.84044	0.0:0.0:1.0:0.0	.	128	P17787	ACHB2_HUMAN	K	128	ENSP00000357461:E128K	ENSP00000357461:E128K	E	+	1	0	CHRNB2	152810305	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	7.644000	0.83416	2.171000	0.68590	0.563000	0.77884	GAG	CHRNB2	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,tigrfam_Neur_channel	ENSG00000160716		0.552	CHRNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB2	HGNC	protein_coding	OTTHUMT00000090697.1	-	0.00	58	0	G	NM_000748		154543681	+1	tier1	-	no_errors	ENST00000368476	ensembl	human	known	74_37	missense	12.09	80	11	SNP	1.000	A
CNTNAP5	129684	genome.wustl.edu	37	2	124979370	124979370	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:124979370A>C	ENST00000431078.1	+	2	535	c.171A>C	c.(169-171)caA>caC	p.Q57H		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	57	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GCCCAGCTCAACTCAACTGGA	0.473																																																	0													64.0	60.0	62.0					2																	124979370		1979	4167	6146	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.171A>C	2.37:g.124979370A>C	ENSP00000399013:p.Gln57His		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.Q57H	ENST00000431078.1	37	c.171	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	A	13.75	2.329454	0.41197	.	.	ENSG00000155052	ENST00000431078	D	0.97232	-4.3	5.5	-5.67	0.02444	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.150668	0.29830	N	0.011097	D	0.93743	0.8000	L	0.46157	1.445	0.31120	N	0.708938	B	0.10296	0.003	B	0.15052	0.012	T	0.77938	-0.2400	10	0.48119	T	0.1	.	16.9853	0.86338	0.343:0.0:0.657:0.0	.	57	Q8WYK1	CNTP5_HUMAN	H	57	ENSP00000399013:Q57H	ENSP00000399013:Q57H	Q	+	3	2	CNTNAP5	124695840	0.223000	0.23663	0.887000	0.34795	0.949000	0.60115	-0.798000	0.04565	-1.037000	0.03283	-0.256000	0.11100	CAA	CNTNAP5	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000155052		0.473	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	-	0.00	42	0	A			124979370	+1	tier1	-	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	28.57	30	12	SNP	0.768	C
COG8	84342	genome.wustl.edu	37	16	69368468	69368468	+	Silent	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr16:69368468G>A	ENST00000306875.4	-	3	1483	c.1369C>T	c.(1369-1371)Ctg>Ttg	p.L457L	RP11-343C2.12_ENST00000562949.1_Silent_p.L103L|COG8_ENST00000562081.1_Silent_p.L457L	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	457					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						TCCTGCGCCAGGGCCACAGGG	0.572																																																	0													50.0	48.0	49.0					16																	69368468		2198	4300	6498	SO:0001819	synonymous_variant	0			AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.1369C>T	16.37:g.69368468G>A			Q0VAK2|Q8WVV6|Q9H6F8	Silent	SNP	pfam_COG8,superfamily_Cullin_repeat-like_dom,pirsf_COG8_Metazoal_Plant	p.L457	ENST00000306875.4	37	c.1369	CCDS10876.1	16																																																																																			COG8	-	pirsf_COG8_Metazoal_Plant	ENSG00000213380		0.572	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG8	HGNC	protein_coding	OTTHUMT00000268948.2		0.00	13	0	G	NM_032382		69368468	-1			no_errors	ENST00000306875	ensembl	human	known	74_37	silent	17.39	19	4	SNP	1.000	A
COL25A1	84570	genome.wustl.edu	37	4	109810879	109810879	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:109810879C>A	ENST00000399132.1	-	17	1447	c.917G>T	c.(916-918)gGa>gTa	p.G306V	COL25A1_ENST00000399127.1_Missense_Mutation_p.G302V|COL25A1_ENST00000399126.1_Missense_Mutation_p.G306V	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		AGCAGATGATCCAGGGTCACC	0.423																																																	0													98.0	95.0	96.0					4																	109810879		1905	4138	6043	SO:0001583	missense	0			AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.917G>T	4.37:g.109810879C>A	ENSP00000382083:p.Gly306Val			Missense_Mutation	SNP	pfam_Collagen	p.G306V	ENST00000399132.1	37	c.917	CCDS43258.1	4	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214715	0.58452	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	D;D;D	0.99637	-6.29;-5.53;-6.29	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000001	D	0.99750	0.9900	M	0.93462	3.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.97639	1.0147	9	.	.	.	-5.9611	18.9387	0.92597	0.0:1.0:0.0:0.0	.	306;306	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	V	306;308;302;302;306;236	ENSP00000382083:G306V;ENSP00000382078:G302V;ENSP00000382077:G306V	.	G	-	2	0	COL25A1	110030328	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.866000	0.63005	2.817000	0.96982	0.557000	0.71058	GGA	COL25A1	-	NULL	ENSG00000188517		0.423	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL25A1	HGNC	protein_coding	OTTHUMT00000315938.2		0.00	45	0	C	NM_032518		109810879	-1			no_errors	ENST00000399132	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	A
COL27A1	85301	genome.wustl.edu	37	9	117063406	117063406	+	Splice_Site	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr9:117063406G>A	ENST00000356083.3	+	52	5146		c.e52+1			NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1						extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GGGACTCCCGGTATGTGTGGG	0.587																																																	0													61.0	65.0	64.0					9																	117063406		2203	4300	6503	SO:0001630	splice_region_variant	0			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4755+1G>A	9.37:g.117063406G>A			Q66K43|Q96JF7	Splice_Site	SNP	-	e52+1	ENST00000356083.3	37	c.4755+1	CCDS6802.1	9	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243064	0.79912	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	.	.	.	5.47	5.47	0.80525	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8229	0.85923	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL27A1	116103227	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.833000	0.92089	2.564000	0.86499	0.561000	0.74099	.	COL27A1	-	-	ENSG00000196739		0.587	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	HGNC	protein_coding	OTTHUMT00000053763.1	-	0.00	92	0	G	NM_032888	Intron	117063406	+1	tier1	-	no_errors	ENST00000356083	ensembl	human	known	74_37	splice_site	28.00	54	21	SNP	1.000	A
COL6A5	256076	genome.wustl.edu	37	3	130159234	130159234	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:130159234A>C	ENST00000432398.2	+	35	6546	c.6052A>C	c.(6052-6054)Agt>Cgt	p.S2018R	COL6A5_ENST00000265379.6_Missense_Mutation_p.S2018R	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	2018	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						TCCTTGGGAAAGTTCCAGGAG	0.408																																																	0													87.0	81.0	83.0					3																	130159234		1867	4103	5970	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.6052A>C	3.37:g.130159234A>C	ENSP00000390895:p.Ser2018Arg		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.S2018R	ENST00000432398.2	37	c.6052		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	1.209|1.209	-0.630326|-0.630326	0.03610|0.03610	.|.	.|.	ENSG00000172752|ENSG00000172752	ENST00000512836|ENST00000432398;ENST00000265379	.|D;D	.|0.82433	.|-1.61;-1.61	4.87|4.87	-4.99|-4.99	0.03010|0.03010	.|von Willebrand factor, type A (3);	.|1.549430	.|0.03900	.|N	.|0.280159	T|T	0.67534|0.67534	0.2903|0.2903	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	.|B;B	.|0.09022	.|0.002;0.002	.|B;B	.|0.12156	.|0.007;0.003	T|T	0.49661|0.49661	-0.8916|-0.8916	5|10	.|0.24483	.|T	.|0.36	.|.	2.9221|2.9221	0.05772|0.05772	0.2743:0.1186:0.4337:0.1733|0.2743:0.1186:0.4337:0.1733	.|.	.|2018;2018	.|A8TX70;A8TX70-2	.|CO6A5_HUMAN;.	T|R	269|2018	.|ENSP00000390895:S2018R;ENSP00000265379:S2018R	.|ENSP00000265379:S2018R	K|S	+|+	2|1	0|0	COL6A5|COL6A5	131641924|131641924	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-0.180000|-0.180000	0.09754|0.09754	-0.524000|-0.524000	0.06400|0.06400	-0.256000|-0.256000	0.11100|0.11100	AAG|AGT	COL6A5	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000172752		0.408	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	45	0	A	NM_153264		130159234	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	38.71	19	12	SNP	0.000	C
COL6A6	131873	genome.wustl.edu	37	3	130380752	130380752	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:130380752T>G	ENST00000358511.6	+	34	6133	c.6102T>G	c.(6100-6102)aaT>aaG	p.N2034K	COL6A6_ENST00000453409.2_Missense_Mutation_p.N2034K	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	2034	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CTGAGTTCAATCTTACCACCT	0.498																																																	0													69.0	66.0	67.0					3																	130380752		1897	4116	6013	SO:0001583	missense	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.6102T>G	3.37:g.130380752T>G	ENSP00000351310:p.Asn2034Lys		A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.N2034K	ENST00000358511.6	37	c.6102	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	T	14.63	2.593099	0.46214	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	T;T	0.14266	2.52;2.52	6.04	2.86	0.33363	von Willebrand factor, type A (3);	.	.	.	.	T	0.19446	0.0467	N	0.19112	0.55	0.30213	N	0.797545	D;B	0.71674	0.998;0.151	D;B	0.79784	0.993;0.108	T	0.08411	-1.0723	9	0.23302	T	0.38	.	10.854	0.46786	0.0:0.7025:0.0:0.2975	.	2034;2034	A6NMZ7;F8W6Y7	CO6A6_HUMAN;.	K	2034	ENSP00000351310:N2034K;ENSP00000399236:N2034K	ENSP00000351310:N2034K	N	+	3	2	COL6A6	131863442	0.971000	0.33674	1.000000	0.80357	0.640000	0.38277	0.039000	0.13884	0.877000	0.35895	-0.366000	0.07423	AAT	COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000206384		0.498	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	-	0.00	27	0	T	NM_001102608		130380752	+1	tier1	-	no_errors	ENST00000358511	ensembl	human	known	74_37	missense	32.14	19	9	SNP	0.995	G
CPXM2	119587	genome.wustl.edu	37	10	125526577	125526577	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr10:125526577C>A	ENST00000241305.3	-	10	1545	c.1391G>T	c.(1390-1392)tGg>tTg	p.W464L	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	464					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CTCTGCCTCCCAGAGCAGCGT	0.517																																																	0													135.0	125.0	129.0					10																	125526577		2203	4300	6503	SO:0001583	missense	0			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.1391G>T	10.37:g.125526577C>A	ENSP00000241305:p.Trp464Leu		B4E3Q2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.W464L	ENST00000241305.3	37	c.1391	CCDS7637.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.7|25.7	4.661401|4.661401	0.88154|0.88154	.|.	.|.	ENSG00000121898|ENSG00000121898	ENST00000418782|ENST00000241305;ENST00000540123	.|T	.|0.04603	.|3.59	4.69|4.69	4.69|4.69	0.59074|0.59074	.|Peptidase M14, carboxypeptidase A (2);	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.22551	.|0.0544	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	.|T	.|0.00852	.|-1.1540	.|10	.|0.87932	.|D	.|0	.|-14.9976	17.8309|17.8309	0.88682|0.88682	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|464	.|Q8N436	.|CPXM2_HUMAN	.|L	-1|464;297	.|ENSP00000241305:W464L	.|ENSP00000241305:W464L	.|W	-|-	.|2	.|0	CPXM2|CPXM2	125516567|125516567	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.895000|0.895000	0.52256|0.52256	7.624000|7.624000	0.83124|0.83124	2.420000|2.420000	0.82092|0.82092	0.650000|0.650000	0.86243|0.86243	.|TGG	CPXM2	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000121898		0.517	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM2	HGNC	protein_coding	OTTHUMT00000050853.1	-	0.00	78	0	C	NM_198148		125526577	-1	tier1	-	no_errors	ENST00000241305	ensembl	human	known	74_37	missense	36.84	48	28	SNP	1.000	A
CSMD1	64478	genome.wustl.edu	37	8	4494898	4494898	+	Missense_Mutation	SNP	C	C	T	rs201992115		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:4494898C>T	ENST00000520002.1	-	2	823	c.268G>A	c.(268-270)Gat>Aat	p.D90N	CSMD1_ENST00000539096.1_Missense_Mutation_p.D90N|CSMD1_ENST00000400186.3_Missense_Mutation_p.D90N|CSMD1_ENST00000537824.1_Missense_Mutation_p.D90N|CSMD1_ENST00000602723.1_Missense_Mutation_p.D90N|CSMD1_ENST00000602557.1_Missense_Mutation_p.D90N|CSMD1_ENST00000542608.1_Missense_Mutation_p.D90N			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	90	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GGCTGTCCATCGTAAACTGAT	0.378																																																	0													114.0	115.0	114.0					8																	4494898		1880	4119	5999	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.268G>A	8.37:g.4494898C>T	ENSP00000430733:p.Asp90Asn		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.D90N	ENST00000520002.1	37	c.268		8	.	.	.	.	.	.	.	.	.	.	C	21.7	4.184263	0.78677	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.36699	1.24;1.24;1.24;1.24;1.24	5.18	5.18	0.71444	.	.	.	.	.	T	0.60143	0.2246	M	0.71920	2.185	0.41481	D	0.98816	D	0.89917	1.0	D	0.91635	0.999	T	0.63677	-0.6583	9	0.62326	D	0.03	.	16.1821	0.81915	0.0:1.0:0.0:0.0	.	90	E5RIG2	.	N	90	ENSP00000383047:D90N;ENSP00000430733:D90N;ENSP00000441462:D90N;ENSP00000446243:D90N;ENSP00000441675:D90N	ENSP00000383047:D90N	D	-	1	0	CSMD1	4482306	1.000000	0.71417	0.084000	0.20598	0.489000	0.33432	7.755000	0.85180	2.420000	0.82092	0.585000	0.79938	GAT	CSMD1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000183117		0.378	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	-	0.00	37	0	C	NM_033225		4494898	-1	tier1	rs201992115	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	36.67	38	22	SNP	1.000	T
CT47B1	643311	genome.wustl.edu	37	X	120008881	120008881	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chrX:120008881G>T	ENST00000371311.3	-	1	898	c.644C>A	c.(643-645)gCc>gAc	p.A215D		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	215										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						GGGCTCCCTGGCCATCTCGGC	0.692																																																	0													28.0	27.0	27.0					X																	120008881		692	1590	2282	SO:0001583	missense	0				CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.644C>A	X.37:g.120008881G>T	ENSP00000360360:p.Ala215Asp		A6NM97	Missense_Mutation	SNP	NULL	p.A215D	ENST00000371311.3	37	c.644	CCDS48161.1	X	.	.	.	.	.	.	.	.	.	.	G	9.737	1.163907	0.21538	.	.	ENSG00000236446	ENST00000371311	.	.	.	1.24	1.24	0.21308	.	.	.	.	.	T	0.21761	0.0524	L	0.27053	0.805	0.09310	N	1	D	0.62365	0.991	P	0.47102	0.537	T	0.10314	-1.0635	8	0.27082	T	0.32	.	5.4369	0.16486	0.0:0.0:1.0:0.0	.	215	P0C2W7	CT47B_HUMAN	D	215	.	ENSP00000360360:A215D	A	-	2	0	CT47B1	119892909	0.003000	0.15002	0.001000	0.08648	0.106000	0.19336	1.644000	0.37228	0.903000	0.36546	0.171000	0.16805	GCC	CT47B1	-	NULL	ENSG00000236446		0.692	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CT47B1	HGNC	protein_coding	OTTHUMT00000058121.1	-	0.00	60	0	G	NM_001145718		120008881	-1	tier1	-	no_errors	ENST00000371311	ensembl	human	known	74_37	missense	85.07	19	114	SNP	0.001	T
CTNND2	1501	genome.wustl.edu	37	5	11110989	11110991	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	TTC	TTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr5:11110989_11110991delTTC	ENST00000304623.8	-	14	2631_2633	c.2442_2444delGAA	c.(2440-2445)aagaaa>aaa	p.814_815KK>K	CTNND2_ENST00000503622.1_In_Frame_Del_p.477_478KK>K|CTNND2_ENST00000458100.2_In_Frame_Del_p.381_382KK>K|CTNND2_ENST00000359640.2_In_Frame_Del_p.814_815KK>K|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000511377.1_In_Frame_Del_p.723_724KK>K	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	814	Poly-Lys.				cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GGATTTCTTTTTCTTCTTCTTCT	0.502																																																	0																																										SO:0001651	inframe_deletion	0			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2442_2444delGAA	5.37:g.11110998_11111000delTTC	ENSP00000307134:p.Lys817del		B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	In_Frame_Del	DEL	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.K817in_frame_del	ENST00000304623.8	37	c.2444_2442	CCDS3881.1	5																																																																																			CTNND2	-	superfamily_ARM-type_fold	ENSG00000169862		0.502	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	HGNC	protein_coding	OTTHUMT00000206999.1		0.00	35	0	TTC	NM_001332		11110991	-1	tier1		no_errors	ENST00000304623	ensembl	human	known	74_37	in_frame_del	12.00	22	3	DEL	1.000:1.000:1.000	-
CTR9	9646	genome.wustl.edu	37	11	10785358	10785358	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:10785358G>A	ENST00000361367.2	+	9	1552	c.1126G>A	c.(1126-1128)Gaa>Aaa	p.E376K		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	376					cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TAATAATTACGAAACTATGAA	0.348																																																	0													77.0	83.0	81.0					11																	10785358		2201	4294	6495	SO:0001583	missense	0			D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.1126G>A	11.37:g.10785358G>A	ENSP00000355013:p.Glu376Lys		D3DQV8|Q15015	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E376K	ENST00000361367.2	37	c.1126	CCDS7805.1	11	.	.	.	.	.	.	.	.	.	.	G	26.8	4.769608	0.90020	.	.	ENSG00000198730	ENST00000361367	T	0.52057	0.68	5.62	4.71	0.59529	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.70842	0.3270	M	0.87758	2.905	0.80722	D	1	D	0.89917	1.0	D	0.66351	0.943	T	0.76846	-0.2808	10	0.56958	D	0.05	-28.0406	15.0528	0.71888	0.0687:0.0:0.9313:0.0	.	376	Q6PD62	CTR9_HUMAN	K	376	ENSP00000355013:E376K	ENSP00000355013:E376K	E	+	1	0	CTR9	10741934	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.674000	0.98633	1.513000	0.48852	0.655000	0.94253	GAA	CTR9	-	pfscan_TPR-contain_dom	ENSG00000198730		0.348	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTR9	HGNC	protein_coding	OTTHUMT00000386215.1	-	0.00	17	0	G	NM_014633		10785358	+1	tier1	-	no_errors	ENST00000361367	ensembl	human	known	74_37	missense	80.00	1	4	SNP	1.000	A
CWF19L2	143884	genome.wustl.edu	37	11	107200658	107200658	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:107200658G>T	ENST00000282251.5	-	17	2554	c.2527C>A	c.(2527-2529)Cat>Aat	p.H843N		NM_152434.2	NP_689647.2	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control (S. pombe)	843							catalytic activity (GO:0003824)			endometrium(4)|kidney(2)|large_intestine(13)|lung(21)	40		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		CCAAAGTAATGAGGGAATTTG	0.383																																																	0													64.0	60.0	62.0					11																	107200658		2201	4297	6498	SO:0001583	missense	0			AK056905	CCDS8336.2	11q23.1	2005-09-22			ENSG00000152404	ENSG00000152404			26508	protein-coding gene	gene with protein product						14702039	Standard	NM_152434		Approved	FLJ32343	uc010rvp.2	Q2TBE0	OTTHUMG00000152975	ENST00000282251.5:c.2527C>A	11.37:g.107200658G>T	ENSP00000282251:p.His843Asn		A4FU66|A4FU67|A4FU68|Q6PHW1|Q96MI1	Missense_Mutation	SNP	pfam_Cwf19-like_C_dom-1,pfam_Cwf19-like_C_dom-2,superfamily_HIT-like	p.H843N	ENST00000282251.5	37	c.2527	CCDS8336.2	11	.	.	.	.	.	.	.	.	.	.	G	9.789	1.177280	0.21787	.	.	ENSG00000152404	ENST00000282251	T	0.29142	1.58	5.75	5.75	0.90469	Cwf19-like protein, C-terminal domain-2 (1);	0.244954	0.48286	D	0.000191	T	0.25531	0.0621	L	0.43923	1.385	0.80722	D	1	B	0.19073	0.033	B	0.19946	0.027	T	0.05835	-1.0861	10	0.14656	T	0.56	-3.1107	12.279	0.54753	0.0766:0.0:0.9234:0.0	.	843	Q2TBE0	C19L2_HUMAN	N	843	ENSP00000282251:H843N	ENSP00000282251:H843N	H	-	1	0	CWF19L2	106705868	1.000000	0.71417	1.000000	0.80357	0.356000	0.29392	4.773000	0.62331	2.716000	0.92895	0.655000	0.94253	CAT	CWF19L2	-	pfam_Cwf19-like_C_dom-2	ENSG00000152404		0.383	CWF19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWF19L2	HGNC	protein_coding	OTTHUMT00000328825.2	-	0.00	72	0	G	NM_152434		107200658	-1	tier1	-	no_errors	ENST00000282251	ensembl	human	known	74_37	missense	6.94	67	5	SNP	1.000	T
CYSLTR1	10800	genome.wustl.edu	37	X	77528873	77528873	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chrX:77528873G>C	ENST00000373304.3	-	3	663	c.371C>G	c.(370-372)gCa>gGa	p.A124G		NM_001282187.1|NM_001282188.1|NM_006639.3	NP_001269116.1|NP_001269117.1|NP_006630.1	Q9Y271	CLTR1_HUMAN	cysteinyl leukotriene receptor 1	124					defense response (GO:0006952)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|respiratory gaseous exchange (GO:0007585)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	leukotriene receptor activity (GO:0004974)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14					Cinalukast(DB00587)|Montelukast(DB00471)|Nedocromil(DB00716)|Pranlukast(DB01411)|Zafirlukast(DB00549)	AAAAACAATTGCAATGCACCG	0.403																																																	0													63.0	55.0	58.0					X																	77528873		2202	4299	6501	SO:0001583	missense	0			AF119711	CCDS14439.1	Xq13-q21	2012-08-10			ENSG00000173198	ENSG00000173198		"""GPCR / Class A : Leukotriene receptors"""	17451	protein-coding gene	gene with protein product		300201				10391245, 10462554	Standard	NM_006639		Approved	CysLT1, CysLT(1), CYSLT1R	uc004edb.3	Q9Y271	OTTHUMG00000021889	ENST00000373304.3:c.371C>G	X.37:g.77528873G>C	ENSP00000362401:p.Ala124Gly		B2R954|D3DTE4|Q5JS94|Q8IV19	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Cyst_leuk_rcpt,prints_CLT1_recept,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.A124G	ENST00000373304.3	37	c.371	CCDS14439.1	X	.	.	.	.	.	.	.	.	.	.	g	19.41	3.821630	0.71028	.	.	ENSG00000173198	ENST00000373304	T	0.54675	0.56	4.45	4.45	0.53987	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.64940	0.2644	L	0.52206	1.635	0.49798	D	0.999828	D	0.89917	1.0	D	0.87578	0.998	T	0.62515	-0.6838	10	0.31617	T	0.26	.	13.6743	0.62445	0.0:0.0:1.0:0.0	.	124	Q9Y271	CLTR1_HUMAN	G	124	ENSP00000362401:A124G	ENSP00000362401:A124G	A	-	2	0	CYSLTR1	77415529	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	9.589000	0.98235	1.790000	0.52503	0.452000	0.29995	GCA	CYSLTR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000173198		0.403	CYSLTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYSLTR1	HGNC	protein_coding	OTTHUMT00000057315.1	-	0.00	34	0	G			77528873	-1	tier1	-	no_errors	ENST00000373304	ensembl	human	known	74_37	missense	19.35	25	6	SNP	1.000	C
DAB2IP	153090	genome.wustl.edu	37	9	124525826	124525826	+	Missense_Mutation	SNP	G	G	A	rs142519289		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr9:124525826G>A	ENST00000408936.3	+	7	1395	c.1213G>A	c.(1213-1215)Ggg>Agg	p.G405R	DAB2IP_ENST00000309989.1_Missense_Mutation_p.G281R|DAB2IP_ENST00000259371.2_Missense_Mutation_p.G377R			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	405	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						GGACCGCTGCGGGGACAACGA	0.617																																																	0								G	ARG/GLY,ARG/GLY	0,4406		0,0,2203	70.0	59.0	63.0		1129,841	4.2	1.0	9	dbSNP_134	63	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	DAB2IP	NM_032552.2,NM_138709.1	125,125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	377/1133,281/1066	124525826	1,13005	2203	4300	6503	SO:0001583	missense	0			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.1213G>A	9.37:g.124525826G>A	ENSP00000386183:p.Gly405Arg		A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_dom,smart_Pleckstrin_homology,smart_C2_dom,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.G405R	ENST00000408936.3	37	c.1213		9	.	.	.	.	.	.	.	.	.	.	G	18.78	3.697835	0.68386	0.0	1.16E-4	ENSG00000136848	ENST00000259371;ENST00000408936;ENST00000373782;ENST00000309989	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	5.09	4.18	0.49190	.	0.050828	0.85682	N	0.000000	T	0.67353	0.2884	L	0.38838	1.175	0.80722	D	1	P	0.35745	0.518	B	0.32762	0.152	T	0.64504	-0.6392	10	0.26408	T	0.33	.	14.8168	0.70041	0.0:0.145:0.855:0.0	.	377	G3XA90	.	R	377;405;314;281	ENSP00000259371:G377R;ENSP00000386183:G405R;ENSP00000362887:G314R;ENSP00000310827:G281R	ENSP00000259371:G377R	G	+	1	0	DAB2IP	123565647	1.000000	0.71417	0.978000	0.43139	0.950000	0.60333	5.781000	0.68964	1.239000	0.43787	0.655000	0.94253	GGG	DAB2IP	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000136848		0.617	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	DAB2IP	HGNC	protein_coding	OTTHUMT00000317857.1	-	0.00	31	0	G	NM_032552		124525826	+1	tier1	rs142519289	no_errors	ENST00000408936	ensembl	human	known	74_37	missense	45.45	18	15	SNP	1.000	A
DCSTAMP	81501	genome.wustl.edu	37	8	105361511	105361511	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:105361511A>C	ENST00000297581.2	+	2	780	c.731A>C	c.(730-732)aAc>aCc	p.N244T	DCSTAMP_ENST00000517991.1_Missense_Mutation_p.N244T|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	244					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)											AAGTATGAAAACATCTACATC	0.488																																																	0													102.0	97.0	99.0					8																	105361511		2203	4300	6503	SO:0001583	missense	0			AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.731A>C	8.37:g.105361511A>C	ENSP00000297581:p.Asn244Thr		B7ZVW2|E7ESG0|Q2M2D5	Missense_Mutation	SNP	pfam_DC_STAMP-like,superfamily_ABC1_TM_dom	p.N244T	ENST00000297581.2	37	c.731	CCDS6301.1	8	.	.	.	.	.	.	.	.	.	.	A	21.9	4.217786	0.79352	.	.	ENSG00000164935	ENST00000297581;ENST00000517991	T;T	0.58060	0.36;0.36	5.76	5.76	0.90799	Dendritic cell-specific transmembrane protein-like (1);	0.000000	0.85682	D	0.000000	T	0.73536	0.3599	M	0.81942	2.565	0.58432	D	0.999993	D	0.89917	1.0	D	0.97110	1.0	T	0.76184	-0.3052	9	.	.	.	-20.8224	14.6526	0.68808	1.0:0.0:0.0:0.0	.	244	Q9H295	TM7S4_HUMAN	T	244	ENSP00000297581:N244T;ENSP00000428869:N244T	.	N	+	2	0	TM7SF4	105430687	1.000000	0.71417	0.612000	0.29024	0.933000	0.57130	5.910000	0.69931	2.211000	0.71520	0.454000	0.30748	AAC	DCSTAMP	-	pfam_DC_STAMP-like	ENSG00000164935		0.488	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCSTAMP	HGNC	protein_coding	OTTHUMT00000380810.1	-	0.00	69	0	A	NM_030788		105361511	+1	tier1	-	no_errors	ENST00000297581	ensembl	human	known	74_37	missense	18.81	81	19	SNP	0.991	C
DIP2B	57609	genome.wustl.edu	37	12	51112540	51112540	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr12:51112540G>A	ENST00000301180.5	+	24	2934	c.2900G>A	c.(2899-2901)cGt>cAt	p.R967H		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	967						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						GCTGGAAAACGTATAGCACAA	0.453																																																	0													154.0	129.0	137.0					12																	51112540		2203	4300	6503	SO:0001583	missense	0			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2900G>A	12.37:g.51112540G>A	ENSP00000301180:p.Arg967His		Q6B011|Q8N1L5|Q8NB38	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.R967H	ENST00000301180.5	37	c.2900	CCDS31799.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.179710	0.94846	.	.	ENSG00000066084	ENST00000301180	T	0.26223	1.75	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.57184	0.2036	M	0.85945	2.785	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.63368	-0.6653	10	0.72032	D	0.01	-13.3974	18.9332	0.92574	0.0:0.0:1.0:0.0	.	967	Q9P265	DIP2B_HUMAN	H	967	ENSP00000301180:R967H	ENSP00000301180:R967H	R	+	2	0	DIP2B	49398807	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.174000	0.94824	2.885000	0.99019	0.655000	0.94253	CGT	DIP2B	-	NULL	ENSG00000066084		0.453	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1	-	0.00	119	0	G	NM_173602		51112540	+1	tier1	-	no_errors	ENST00000301180	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	A
DLC1	10395	genome.wustl.edu	37	8	13357035	13357035	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:13357035T>G	ENST00000276297.4	-	2	955	c.546A>C	c.(544-546)aaA>aaC	p.K182N	DLC1_ENST00000511869.1_Missense_Mutation_p.K182N|DLC1_ENST00000316609.5_Missense_Mutation_p.K182N	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	182					actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)	p.K182N(3)		NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						AGTCAGTAACTTTTCTCTCCC	0.393																																																	3	Substitution - Missense(3)	lung(3)											119.0	124.0	122.0					8																	13357035		2203	4299	6502	SO:0001583	missense	0			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.546A>C	8.37:g.13357035T>G	ENSP00000276297:p.Lys182Asn		B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.K182N	ENST00000276297.4	37	c.546	CCDS5989.1	8	.	.	.	.	.	.	.	.	.	.	T	9.241	1.038264	0.19669	.	.	ENSG00000164741	ENST00000276297;ENST00000316609;ENST00000511869	T;T;T	0.29397	1.57;1.57;1.57	5.12	5.12	0.69794	.	0.766586	0.11412	N	0.566664	T	0.25568	0.0622	L	0.52573	1.65	0.09310	N	1	B;P;B	0.43352	0.225;0.804;0.001	B;B;B	0.40134	0.047;0.32;0.001	T	0.35226	-0.9797	10	0.42905	T	0.14	.	2.3523	0.04287	0.1619:0.0822:0.1484:0.6076	.	182;182;182	E9PF76;Q96QB1-3;Q96QB1	.;.;RHG07_HUMAN	N	182	ENSP00000276297:K182N;ENSP00000321034:K182N;ENSP00000425878:K182N	ENSP00000276297:K182N	K	-	3	2	DLC1	13401406	0.001000	0.12720	0.005000	0.12908	0.068000	0.16541	0.571000	0.23669	2.288000	0.76882	0.533000	0.62120	AAA	DLC1	-	NULL	ENSG00000164741		0.393	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	-	0.00	24	0	T	NM_182643, NM_006094		13357035	-1	tier1	-	no_errors	ENST00000276297	ensembl	human	known	74_37	missense	36.00	16	9	SNP	0.001	G
DNAH11	8701	genome.wustl.edu	37	7	21779255	21779255	+	Silent	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr7:21779255G>A	ENST00000409508.3	+	48	7909	c.7878G>A	c.(7876-7878)ccG>ccA	p.P2626P	DNAH11_ENST00000328843.6_Silent_p.P2633P	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2633	AAA 3. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GCATGAATCCGATGGTGGGCA	0.423									Kartagener syndrome																																								0													120.0	109.0	113.0					7																	21779255		1909	4128	6037	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.7878G>A	7.37:g.21779255G>A			Q9UJ82	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P2633	ENST00000409508.3	37	c.7899		7																																																																																			DNAH11	-	superfamily_P-loop_NTPase,smart_AAA+_ATPase	ENSG00000105877		0.423	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	-	0.00	71	0	G	NM_003777		21779255	+1	tier1	-	no_errors	ENST00000328843	ensembl	human	known	74_37	silent	50.00	57	57	SNP	0.030	A
DNM1P47	100216544	genome.wustl.edu	37	15	102299730	102299730	+	RNA	SNP	C	C	T	rs367964853		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr15:102299730C>T	ENST00000561463.1	+	0	7776									DNM1 pseudogene 47																		AAACTGCACTCGCGTGGGAAC	0.592																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102299730C>T				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.592	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	13	0	C	NG_009149		102299730	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	36.36	7	4	SNP	1.000	T
DTX2	113878	genome.wustl.edu	37	7	76112341	76112342	+	In_Frame_Ins	INS	-	-	CAC	rs555222086		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr7:76112341_76112342insCAC	ENST00000324432.5	+	5	1295_1296	c.785_786insCAC	c.(784-789)aacacc>aaCACcacc	p.264_265insT	DTX2_ENST00000430490.2_In_Frame_Ins_p.264_265insT|DTX2_ENST00000446820.2_In_Frame_Ins_p.264_265insT|DTX2_ENST00000413936.2_In_Frame_Ins_p.264_265insT|DTX2_ENST00000446600.1_In_Frame_Ins_p.173_174insT|DTX2_ENST00000307569.8_In_Frame_Ins_p.264_265insT	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	264					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						CCCAGGCTGAACACCACCAACG	0.678																																																	0																																										SO:0001652	inframe_insertion	0				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.789_791dupCAC	7.37:g.76112345_76112347dupCAC	ENSP00000322885:p.Thr264_Thr264dup		Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	In_Frame_Ins	INS	pfam_WWE-dom,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.265in_frame_insT	ENST00000324432.5	37	c.785_786	CCDS5587.1	7																																																																																			DTX2	-	NULL	ENSG00000091073		0.678	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DTX2	HGNC	protein_coding	OTTHUMT00000253104.2		0.00	31	0	-			76112342	+1	tier1		no_errors	ENST00000324432	ensembl	human	known	74_37	in_frame_ins	47.22	19	17	INS	0.797:0.424	CAC
EBF2	64641	genome.wustl.edu	37	8	25898183	25898183	+	Silent	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:25898183G>A	ENST00000520164.1	-	4	894	c.357C>T	c.(355-357)gtC>gtT	p.V119V	EBF2_ENST00000408929.3_5'UTR	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	119					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		GTTCCGTGCGGACACCTGCGG	0.652																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)												0													14.0	20.0	18.0					8																	25898183		1917	4096	6013	SO:0001819	synonymous_variant	0			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.357C>T	8.37:g.25898183G>A			A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Silent	SNP	pfam_IPT,superfamily_Ig_E-set,smart_IPT	p.V119	ENST00000520164.1	37	c.357	CCDS43726.1	8																																																																																			EBF2	-	NULL	ENSG00000221818		0.652	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBF2	HGNC	protein_coding	OTTHUMT00000375886.2	-	0.00	31	0	G	NM_022659		25898183	-1	tier1	-	no_errors	ENST00000520164	ensembl	human	known	74_37	silent	28.81	42	17	SNP	1.000	A
EMX1	2016	genome.wustl.edu	37	2	73143814	73143814	+	3'UTR	SNP	T	T	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:73143814T>A	ENST00000394111.5	+	0	426				EMX1_ENST00000258106.6_5'Flank			Q04741	EMX1_HUMAN	empty spiracles homeobox 1						brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|in utero embryonic development (GO:0001701)|neuron projection extension (GO:1990138)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			cervix(1)|large_intestine(2)|lung(3)	6						TCTCTTGAGATGGGCTCGGGC	0.642																																																	0																																										SO:0001624	3_prime_UTR_variant	0			X68879	CCDS1921.2	2p13.2	2011-06-20	2007-02-15		ENSG00000135638	ENSG00000135638		"""Homeoboxes / ANTP class : NKL subclass"""	3340	protein-coding gene	gene with protein product		600034	"""empty spiracles homolog 1 (Drosophila)"""			7959790	Standard	XM_005264203		Approved		uc002sin.1	Q04741	OTTHUMG00000129778	ENST00000394111.5:c.*423T>A	2.37:g.73143814T>A			Q0D2P0|Q53T30|Q86XB0	RNA	SNP	-	NULL	ENST00000394111.5	37	NULL		2	.	.	.	.	.	.	.	.	.	.	T	7.530	0.658492	0.14645	.	.	ENSG00000135638	ENST00000394111	.	.	.	3.14	-2.2	0.06994	.	.	.	.	.	T	0.34308	0.0893	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.40308	-0.9570	5	0.87932	D	0	.	3.497	0.07658	0.1883:0.3126:0.0:0.4991	.	.	.	.	K	1	.	ENSP00000377670:M1K	M	+	2	0	EMX1	72997322	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-3.026000	0.00640	-0.546000	0.06216	-0.475000	0.04921	ATG	EMX1	-	-	ENSG00000135638		0.642	EMX1-002	KNOWN	basic	processed_transcript	EMX1	HGNC	protein_coding	OTTHUMT00000251992.3	-	0.00	78	0	T			73143814	+1	tier1	-	no_errors	ENST00000394111	ensembl	human	known	74_37	rna	15.85	69	13	SNP	0.000	A
ULK4P2	100288380	genome.wustl.edu	37	15	32716844	32716844	+	RNA	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr15:32716844A>G	ENST00000562108.1	-	0	341				U8_ENST00000384260.1_RNA|ULK4P1_ENST00000565949.1_RNA																							TTATGATCCTACCTGAAAATG	0.299																																																	0																																												0																															15.37:g.32716844A>G				Splice_Site	SNP	-	NULL	ENST00000562108.1	37	c.NULL		15	.	.	.	.	.	.	.	.	.	.	a	7.848	0.723405	0.15439	.	.	ENSG00000215304	ENST00000321578	.	.	.	1.52	1.52	0.23074	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.2072	0.25913	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	FAM7A1	30504136	1.000000	0.71417	0.952000	0.39060	0.117000	0.20001	3.647000	0.54403	0.972000	0.38314	0.102000	0.15555	.	RP13-395E19.3	-	-	ENSG00000215304		0.299	RP13-395E19.3-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000215304	Clone_based_vega_gene	processed_transcript	OTTHUMT00000429843.1	-	0.00	49	0	A			32716844	-1	tier1	-	no_errors	ENST00000562108	ensembl	human	known	74_37	splice_site	30.56	25	11	SNP	0.993	G
RP11-764K9.1	0	genome.wustl.edu	37	9	68400311	68400311	+	lincRNA	SNP	C	C	T	rs371083648		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr9:68400311C>T	ENST00000417843.2	-	0	1508																											CTGCTTGGGCCGTTCTTGTCA	0.552																																																	0																																												0																															9.37:g.68400311C>T				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.552	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	8	0	C			68400311	-1	tier1	-	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	50.00	3	3	SNP	0.045	T
RP11-423O2.5	0	genome.wustl.edu	37	1	142803343	142803343	+	lincRNA	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:142803343T>C	ENST00000423385.1	-	0	1622																											GCACAAtttttttatgaaggt	0.378																																																	0																																												0																															1.37:g.142803343T>C				RNA	SNP	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			RP11-423O2.5	-	-	ENSG00000234978		0.378	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	Clone_based_vega_gene	lincRNA	OTTHUMT00000193203.1	-	0.00	201	0	T			142803343	-1	tier1	-	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	11.30	101	13	SNP	0.002	C
RP11-782C8.2	0	genome.wustl.edu	37	1	143194180	143194180	+	lincRNA	SNP	C	C	T	rs199907503		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:143194180C>T	ENST00000412204.2	-	0	2449				RP11-782C8.1_ENST00000438000.1_lincRNA																							GGAATTCTTACGGGCATTTGG	0.393																																																	0																																												0																															1.37:g.143194180C>T				Splice_Site	SNP	-	NULL	ENST00000412204.2	37	c.NULL		1																																																																																			RP11-782C8.2	-	-	ENSG00000232274		0.393	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	-	0.00	22	0	C			143194180	-1	tier1	rs199907503	no_errors	ENST00000412204	ensembl	human	known	74_37	splice_site	24.24	25	8	SNP	0.000	T
RP11-744K17.2	0	genome.wustl.edu	37	17	21935376	21935376	+	lincRNA	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr17:21935376A>G	ENST00000582527.1	+	0	658																											AAAGTTAAGTAATTTCCAGGA	0.398																																																	0																																												0																															17.37:g.21935376A>G				RNA	SNP	-	NULL	ENST00000582527.1	37	NULL		17																																																																																			RP11-744K17.2	-	-	ENSG00000266885		0.398	RP11-744K17.2-001	KNOWN	basic	lincRNA	ENSG00000266885	Clone_based_vega_gene	lincRNA	OTTHUMT00000431350.1	-	0.00	21	0	A			21935376	+1	tier1	-	no_errors	ENST00000582527	ensembl	human	known	74_37	rna	46.15	7	6	SNP	0.121	G
AC006116.24	0	genome.wustl.edu	37	19	56888218	56888218	+	RNA	DEL	T	T	-	rs374673565		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:56888218delT	ENST00000591836.1	-	0	435				ZNF542_ENST00000490123.1_RNA																							TGTTCATTGATTTTTTTTCCC	0.338																																																	0																																												0																															19.37:g.56888218delT				RNA	DEL	-	NULL	ENST00000591836.1	37	NULL		19																																																																																			AC006116.24	-	-	ENSG00000267776		0.338	AC006116.24-001	KNOWN	basic	sense_intronic	ENSG00000267776	Clone_based_vega_gene	sense_intronic	OTTHUMT00000459747.1		0.00	31	0	T			56888218	-1	tier1		no_errors	ENST00000591836	ensembl	human	known	74_37	rna	29.41	12	5	DEL	0.075	-
CCDC85A	114800	genome.wustl.edu	37	2	56613262	56613262	+	3'UTR	SNP	A	A	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:56613262A>T	ENST00000407595.2	+	0	3936				RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A											breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TTGAGTATTAAGTATATGTGT	0.264																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.*1772A>T	2.37:g.56613262A>T				RNA	SNP	-	NULL	ENST00000407595.2	37	NULL	CCDS46290.1	2																																																																																			RP11-482H16.1	-	-	ENSG00000271894		0.264	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000271894	Clone_based_vega_gene	protein_coding	OTTHUMT00000324993.1	-	0.00	45	0	A			56613262	+1	tier1	-	no_errors	ENST00000607540	ensembl	human	known	74_37	rna	29.41	24	10	SNP	1.000	T
EPB41L3	23136	genome.wustl.edu	37	18	5394763	5394763	+	Silent	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr18:5394763T>C	ENST00000341928.2	-	22	3523	c.3183A>G	c.(3181-3183)aaA>aaG	p.K1061K	EPB41L3_ENST00000427684.2_Silent_p.K358K|EPB41L3_ENST00000542146.1_Silent_p.K366K|EPB41L3_ENST00000342933.3_Silent_p.K1061K|EPB41L3_ENST00000540638.2_Silent_p.K839K|EPB41L3_ENST00000544123.1_Intron|EPB41L3_ENST00000400111.3_Silent_p.K839K|EPB41L3_ENST00000542652.2_5'UTR	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	1061	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						GGTGCTGCTCTTTGGCCTCTT	0.502																																																	0													212.0	174.0	187.0					18																	5394763		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.3183A>G	18.37:g.5394763T>C			B7Z4I5|F5GX05|O95713|Q9BRP5	Silent	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.K1061	ENST00000341928.2	37	c.3183	CCDS11838.1	18																																																																																			EPB41L3	-	pirsf_Band_41_protein,pfam_Band_4.1_C	ENSG00000082397		0.502	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPB41L3	HGNC	protein_coding	OTTHUMT00000254424.1	-	0.00	57	0	T	NM_012307		5394763	-1	tier1	-	no_errors	ENST00000341928	ensembl	human	known	74_37	silent	64.95	34	63	SNP	1.000	C
EPHA7	2045	genome.wustl.edu	37	6	93964462	93964462	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:93964462T>G	ENST00000369303.4	-	14	2619	c.2435A>C	c.(2434-2436)aAa>aCa	p.K812T		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	812	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TGATGTGAATTTCCGGTACTG	0.373																																																	0													129.0	111.0	117.0					6																	93964462		2203	4300	6503	SO:0001583	missense	0			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2435A>C	6.37:g.93964462T>G	ENSP00000358309:p.Lys812Thr		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.K812T	ENST00000369303.4	37	c.2435	CCDS5031.1	6	.	.	.	.	.	.	.	.	.	.	T	26.0	4.694791	0.88830	.	.	ENSG00000135333	ENST00000369303	D	0.83250	-1.7	5.51	5.51	0.81932	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.048204	0.85682	D	0.000000	T	0.81588	0.4854	N	0.21324	0.655	0.80722	D	1	D;P;P	0.56746	0.977;0.914;0.93	D;P;P	0.71414	0.973;0.519;0.651	D	0.84953	0.0872	10	0.54805	T	0.06	.	15.6344	0.76941	0.0:0.0:0.0:1.0	.	808;807;812	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	T	812	ENSP00000358309:K812T	ENSP00000358309:K812T	K	-	2	0	EPHA7	94021183	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	7.955000	0.87856	2.105000	0.64084	0.533000	0.62120	AAA	EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000135333		0.373	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	-	0.00	52	0	T			93964462	-1	tier1	-	no_errors	ENST00000369303	ensembl	human	known	74_37	missense	60.71	11	17	SNP	1.000	G
EPPK1	83481	genome.wustl.edu	37	8	144940783	144940783	+	Silent	SNP	G	G	A	rs563449577		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:144940783G>A	ENST00000525985.1	-	2	6710	c.6639C>T	c.(6637-6639)gaC>gaT	p.D2213D				P58107	EPIPL_HUMAN	epiplakin 1	2213						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGACGCGGTCGTCCTCCATGA	0.622													G|||	1	0.000199681	0.0008	0.0	5008	,	,		16943	0.0		0.0	False		,,,				2504	0.0																0													137.0	141.0	140.0					8																	144940783		2045	4179	6224	SO:0001819	synonymous_variant	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6639C>T	8.37:g.144940783G>A			Q76E58|Q9NSU9	Silent	SNP	pfam_Plectin_repeat,smart_Plectin_repeat	p.D2213	ENST00000525985.1	37	c.6639		8																																																																																			EPPK1	-	NULL	ENSG00000227184		0.622	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	HGNC	protein_coding	OTTHUMT00000382675.1		0.00	14	0	G	NM_031308		144940783	-1			no_errors	ENST00000525985	ensembl	human	known	74_37	silent	9.68	28	3	SNP	0.007	A
ERC2	26059	genome.wustl.edu	37	3	55544128	55544128	+	3'UTR	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:55544128T>G	ENST00000288221.6	-	0	4345				ERC2_ENST00000486496.1_5'UTR	NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2							cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		ACCTCAAAATTTGGTCTTTTT	0.333																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.*1216A>C	3.37:g.55544128T>G			Q2T9F6|Q86TK4	RNA	SNP	-	NULL	ENST00000288221.6	37	NULL	CCDS46851.1	3																																																																																			ERC2	-	-	ENSG00000187672		0.333	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	-	0.00	48	0	T	NM_015576		55544128	-1	tier1	-	no_errors	ENST00000484530	ensembl	human	known	74_37	rna	44.12	19	15	SNP	0.000	G
ETAA1	54465	genome.wustl.edu	37	2	67630536	67630536	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:67630536A>G	ENST00000272342.5	+	5	852	c.722A>G	c.(721-723)cAt>cGt	p.H241R	ETAA1_ENST00000462772.1_Intron	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	241						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						TGGTCATTACATAATATAGTT	0.303																																																	0													48.0	54.0	52.0					2																	67630536		2199	4297	6496	SO:0001583	missense	0			AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.722A>G	2.37:g.67630536A>G	ENSP00000272342:p.His241Arg		Q05BT7|Q53SC4	Missense_Mutation	SNP	NULL	p.H241R	ENST00000272342.5	37	c.722	CCDS1882.1	2	.	.	.	.	.	.	.	.	.	.	A	4.376	0.069272	0.08436	.	.	ENSG00000143971	ENST00000272342	T	0.17054	2.3	5.96	-11.9	0.00025	.	1.959440	0.01916	N	0.040151	T	0.09992	0.0245	L	0.51422	1.61	0.09310	N	1	P	0.38420	0.63	B	0.31495	0.131	T	0.14227	-1.0480	10	0.28530	T	0.3	-17.3627	4.4264	0.11505	0.5737:0.0866:0.1901:0.1496	.	241	Q9NY74	ETAA1_HUMAN	R	241	ENSP00000272342:H241R	ENSP00000272342:H241R	H	+	2	0	ETAA1	67484040	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.109000	0.10840	-1.928000	0.01059	-0.924000	0.02725	CAT	ETAA1	-	NULL	ENSG00000143971		0.303	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETAA1	HGNC	protein_coding	OTTHUMT00000251735.1	-	0.00	45	0	A	NM_019002		67630536	+1	tier1	-	no_errors	ENST00000272342	ensembl	human	known	74_37	missense	23.40	36	11	SNP	0.000	G
EYS	346007	genome.wustl.edu	37	6	66044948	66044948	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:66044948A>G	ENST00000370621.3	-	11	2217	c.1691T>C	c.(1690-1692)cTg>cCg	p.L564P	EYS_ENST00000370618.3_Missense_Mutation_p.L564P|EYS_ENST00000342421.5_Missense_Mutation_p.L564P|EYS_ENST00000503581.1_Missense_Mutation_p.L564P|EYS_ENST00000370616.2_Missense_Mutation_p.L564P|EYS_ENST00000393380.2_Missense_Mutation_p.L564P			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	564					detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						TGTATTTTCCAGATACATGTT	0.358																																																	0													182.0	166.0	171.0					6																	66044948		2203	4300	6503	SO:0001583	missense	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.1691T>C	6.37:g.66044948A>G	ENSP00000359655:p.Leu564Pro		A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.L564P	ENST00000370621.3	37	c.1691		6	.	.	.	.	.	.	.	.	.	.	a	5.150	0.213347	0.09757	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616;ENST00000393380;ENST00000342421;ENST00000370618	T;T;T;T;T;T	0.34472	1.36;1.36;1.36;1.36;1.36;1.36	3.56	0.971	0.19698	.	.	.	.	.	T	0.15046	0.0363	N	0.24115	0.695	0.09310	N	1	P;D;D	0.58620	0.95;0.983;0.971	P;P;P	0.53649	0.648;0.731;0.543	T	0.05007	-1.0912	9	0.62326	D	0.03	.	3.0506	0.06168	0.667:0.0:0.1228:0.2102	.	564;564;564	Q5T1H1-1;Q5T1H1-2;Q5SZM4	.;.;.	P	564	ENSP00000424243:L564P;ENSP00000359655:L564P;ENSP00000359650:L564P;ENSP00000377042:L564P;ENSP00000341818:L564P;ENSP00000359652:L564P	ENSP00000341818:L564P	L	-	2	0	EYS	66101669	0.019000	0.18553	0.007000	0.13788	0.014000	0.08584	0.948000	0.29096	-0.013000	0.14199	-0.669000	0.03829	CTG	EYS	-	smart_EG-like_dom	ENSG00000188107		0.358	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	-	0.00	57	0	A	XM_294050		66044948	-1	tier1	-	no_errors	ENST00000370616	ensembl	human	known	74_37	missense	45.45	12	10	SNP	0.002	G
FAM179A	165186	genome.wustl.edu	37	2	29247111	29247111	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:29247111G>A	ENST00000379558.4	+	13	2075	c.1724G>A	c.(1723-1725)cGc>cAc	p.R575H	FAM179A_ENST00000403861.2_Missense_Mutation_p.R520H|FAM179A_ENST00000465300.1_3'UTR	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	575										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GAGATCGCCCGCTGCTTGCTG	0.597																																																	0													34.0	35.0	35.0					2																	29247111		2037	4177	6214	SO:0001583	missense	0			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.1724G>A	2.37:g.29247111G>A	ENSP00000368876:p.Arg575His		Q6ZUF5	Missense_Mutation	SNP	pfam_CLASP_N_dom,superfamily_ARM-type_fold	p.R575H	ENST00000379558.4	37	c.1724	CCDS1769.2	2	.	.	.	.	.	.	.	.	.	.	G	22.8	4.332314	0.81801	.	.	ENSG00000189350	ENST00000401723;ENST00000379558;ENST00000403861;ENST00000440012	T;T;T;T	0.67171	2.38;2.38;2.38;-0.25	4.93	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);CLASP N-terminal domain (1);	0.000000	0.64402	D	0.000006	T	0.80649	0.4663	M	0.66939	2.045	0.40314	D	0.978759	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.81965	-0.0691	10	0.48119	T	0.1	.	17.7168	0.88340	0.0:0.0:1.0:0.0	.	520;575	F8W8E4;Q6ZUX3	.;F179A_HUMAN	H	10;575;520;70	ENSP00000384897:R10H;ENSP00000368876:R575H;ENSP00000384699:R520H;ENSP00000396739:R70H	ENSP00000368876:R575H	R	+	2	0	FAM179A	29100615	1.000000	0.71417	0.999000	0.59377	0.906000	0.53458	2.793000	0.47845	2.262000	0.75019	0.462000	0.41574	CGC	FAM179A	-	pfam_CLASP_N_dom,superfamily_ARM-type_fold	ENSG00000189350		0.597	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM179A	HGNC	protein_coding	OTTHUMT00000317848.4	-	0.00	56	0	G	NM_199280		29247111	+1	tier1	-	no_errors	ENST00000379558	ensembl	human	known	74_37	missense	33.33	34	17	SNP	1.000	A
RP11-38L15.8	0	genome.wustl.edu	37	10	46914512	46914512	+	lincRNA	SNP	A	A	C	rs7070988	byFrequency	TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr10:46914512A>C	ENST00000605984.1	-	0	444				FAM35BP_ENST00000475914.1_RNA																							GGAAATAAGAAAGACCTGCAT	0.358													A|||	609	0.121605	0.211	0.0821	5008	,	,		20219	0.0546		0.1193	False		,,,				2504	0.1002																0																																												0																															10.37:g.46914512A>C				RNA	SNP	-	NULL	ENST00000605984.1	37	NULL		10																																																																																			FAM35BP	-	-	ENSG00000165874		0.358	RP11-38L15.8-001	KNOWN	basic	lincRNA	FAM35BP	HGNC	lincRNA	OTTHUMT00000471245.1	-	0.00	9	0	A			46914512	+1	tier1	-	no_errors	ENST00000475914	ensembl	human	known	74_37	rna	50.00	4	4	SNP	0.999	C
FAM65C	140876	genome.wustl.edu	37	20	49226215	49226215	+	Silent	SNP	G	G	A	rs374374141		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr20:49226215G>A	ENST00000327979.2	-	7	870	c.459C>T	c.(457-459)cgC>cgT	p.R153R	FAM65C_ENST00000045083.2_Silent_p.R153R|FAM65C_ENST00000535356.1_Silent_p.R157R			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	153										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						AGGCGCCGTCGCGCAGGCGGC	0.741																																																	0								G		0,4172		0,0,2086	8.0	9.0	8.0		459	-10.6	0.1	20		8	2,8108		0,2,4053	no	coding-synonymous	FAM65C	NM_080829.2		0,2,6139	AA,AG,GG		0.0247,0.0,0.0163		153/947	49226215	2,12280	2086	4055	6141	SO:0001819	synonymous_variant	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.459C>T	20.37:g.49226215G>A			Q5QPB6|Q9NQQ2	Silent	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.R157	ENST00000327979.2	37	c.471	CCDS13431.2	20																																																																																			FAM65C	-	NULL	ENSG00000042062		0.741	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1		0.00	10	0	G			49226215	-1			no_errors	ENST00000535356	ensembl	human	known	74_37	silent	22.22	14	4	SNP	0.005	A
FANCA	2175	genome.wustl.edu	37	16	89811415	89811415	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr16:89811415A>C	ENST00000389301.3	-	36	3608	c.3578T>G	c.(3577-3579)cTg>cGg	p.L1193R	FANCA_ENST00000568369.1_Missense_Mutation_p.L1193R	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1193					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		TTCCCGGGGCAGCGGGCTCTG	0.647			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	0													49.0	44.0	45.0					16																	89811415		2198	4300	6498	SO:0001583	missense	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3578T>G	16.37:g.89811415A>C	ENSP00000373952:p.Leu1193Arg		A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	pfam_Fanconia,prints_Fanconia	p.L1193R	ENST00000389301.3	37	c.3578	CCDS32515.1	16	.	.	.	.	.	.	.	.	.	.	A	19.35	3.811502	0.70797	.	.	ENSG00000187741	ENST00000389301;ENST00000305699	D	0.93604	-3.25	4.44	4.44	0.53790	.	0.000000	0.44902	D	0.000408	D	0.96081	0.8723	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.998;0.998	D	0.96309	0.9227	10	0.87932	D	0	-15.1277	11.7291	0.51726	1.0:0.0:0.0:0.0	.	170;1193;1193	B7Z6Y4;B4DRI7;O15360	.;.;FANCA_HUMAN	R	1193;170	ENSP00000373952:L1193R	ENSP00000306281:L170R	L	-	2	0	FANCA	88338916	0.997000	0.39634	0.788000	0.31933	0.138000	0.21146	5.539000	0.67199	1.780000	0.52325	0.374000	0.22700	CTG	FANCA	-	NULL	ENSG00000187741		0.647	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	HGNC	protein_coding	OTTHUMT00000421927.1	-	0.00	49	0	A			89811415	-1	tier1	-	no_errors	ENST00000389301	ensembl	human	known	74_37	missense	30.56	25	11	SNP	0.900	C
FBXL7	23194	genome.wustl.edu	37	5	15936744	15936744	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr5:15936744G>A	ENST00000504595.1	+	4	1406	c.925G>A	c.(925-927)Gtc>Atc	p.V309I	FBXL7_ENST00000510662.1_Missense_Mutation_p.V262I|FBXL7_ENST00000329673.7_Missense_Mutation_p.V297I|MIR887_ENST00000401258.1_RNA	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	309					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.V309I(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						GCGCCGCTGCGTCCGCCTGAC	0.652																																																	1	Substitution - Missense(1)	large_intestine(1)											39.0	43.0	41.0					5																	15936744		2188	4285	6473	SO:0001583	missense	0			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.925G>A	5.37:g.15936744G>A	ENSP00000423630:p.Val309Ile		B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.V309I	ENST00000504595.1	37	c.925	CCDS54833.1	5	.	.	.	.	.	.	.	.	.	.	G	2.691	-0.273254	0.05716	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.02395	4.31;4.38;4.31	5.16	5.16	0.70880	.	0.380499	0.30269	N	0.010002	T	0.01905	0.0060	N	0.11255	0.115	0.31291	N	0.689393	B	0.06786	0.001	B	0.08055	0.003	T	0.26883	-1.0090	10	0.30078	T	0.28	.	9.4235	0.38565	0.1583:0.0:0.8417:0.0	.	309	Q9UJT9	FBXL7_HUMAN	I	309;262;297	ENSP00000423630:V309I;ENSP00000425184:V262I;ENSP00000329632:V297I	ENSP00000329632:V297I	V	+	1	0	FBXL7	15989744	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	2.164000	0.42387	2.414000	0.81942	0.655000	0.94253	GTC	FBXL7	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000183580		0.652	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL7	HGNC	protein_coding	OTTHUMT00000366117.1	-	0.00	49	0	G	NM_012304		15936744	+1	tier1	-	no_errors	ENST00000504595	ensembl	human	known	74_37	missense	81.36	11	48	SNP	0.997	A
FCRL2	79368	genome.wustl.edu	37	1	157737295	157737295	+	Silent	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:157737295T>C	ENST00000361516.3	-	6	936	c.888A>G	c.(886-888)ccA>ccG	p.P296P	FCRL2_ENST00000368181.4_Intron|FCRL2_ENST00000392274.3_Silent_p.P296P|FCRL2_ENST00000469986.1_Silent_p.P43P	NM_030764.3	NP_110391.2	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2	296					cell-cell signaling (GO:0007267)|positive regulation of signal transduction (GO:0009967)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|skin(2)	51	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GGCGAGACACTGGAACTGACA	0.587																																																	0													59.0	63.0	61.0					1																	157737295		2203	4300	6503	SO:0001819	synonymous_variant	0			AF319438	CCDS1168.1	1q23.1	2013-01-14	2002-01-14	2005-03-23	ENSG00000132704	ENSG00000132704		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14875	protein-coding gene	gene with protein product		606509	"""SH2 domain-containing phosphatase anchor protein 1"""	SPAP1		11162587	Standard	NM_030764		Approved	FCRH2, IRTA4, CD307b	uc001fre.2	Q96LA5	OTTHUMG00000019399	ENST00000361516.3:c.888A>G	1.37:g.157737295T>C			A0N0M5|A1L307|A6NMS0|Q6NTA1|Q9BZI4|Q9BZI5|Q9BZI6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P296	ENST00000361516.3	37	c.888	CCDS1168.1	1																																																																																			FCRL2	-	NULL	ENSG00000132704		0.587	FCRL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRL2	HGNC	protein_coding	OTTHUMT00000051408.2	-	0.00	31	0	T	NM_030764		157737295	-1	tier1	-	no_errors	ENST00000361516	ensembl	human	known	74_37	silent	42.11	33	24	SNP	0.879	C
FCRL1	115350	genome.wustl.edu	37	1	157771711	157771711	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:157771711A>G	ENST00000368176.3	-	5	947	c.880T>C	c.(880-882)Ttc>Ctc	p.F294L	FCRL1_ENST00000489998.1_5'UTR|FCRL1_ENST00000491942.1_Missense_Mutation_p.F294L|FCRL1_ENST00000358292.3_Missense_Mutation_p.F294L	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ATACCTGTGAAGTTGAGTGTC	0.552																																					GBM(54;482 1003 11223 30131 35730)												0													80.0	86.0	84.0					1																	157771711		2203	4300	6503	SO:0001583	missense	0			BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.880T>C	1.37:g.157771711A>G	ENSP00000357158:p.Phe294Leu		B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.F294L	ENST00000368176.3	37	c.880	CCDS1170.1	1	.	.	.	.	.	.	.	.	.	.	A	12.06	1.823380	0.32237	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.38240	1.15;1.32;1.32	5.14	-10.3	0.00346	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.060490	0.07342	N	0.880866	T	0.04907	0.0132	N	0.12182	0.205	0.09310	N	0.999996	B;B;B	0.10296	0.002;0.002;0.003	B;B;B	0.09377	0.004;0.004;0.0	T	0.26883	-1.0090	10	0.28530	T	0.3	.	8.702	0.34332	0.2992:0.5272:0.0:0.1737	.	294;294;294	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	L	294	ENSP00000351039:F294L;ENSP00000357158:F294L;ENSP00000418130:F294L	ENSP00000351039:F294L	F	-	1	0	FCRL1	156038335	0.000000	0.05858	0.024000	0.17045	0.761000	0.43186	-2.010000	0.01454	-2.149000	0.00797	0.533000	0.62120	TTC	FCRL1	-	smart_Ig_sub	ENSG00000163534		0.552	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	HGNC	protein_coding	OTTHUMT00000051401.1	-	0.00	28	0	A	NM_052938		157771711	-1	tier1	-	no_errors	ENST00000368176	ensembl	human	known	74_37	missense	31.25	33	15	SNP	0.016	G
FGF13	2258	genome.wustl.edu	37	X	137793725	137793725	+	5'UTR	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chrX:137793725G>T	ENST00000315930.6	-	0	102				FGF13_ENST00000441825.2_Intron|FGF13_ENST00000541469.1_Intron|FGF13_ENST00000305414.4_Intron|FGF13-AS1_ENST00000446383.1_RNA|FGF13_ENST00000370603.3_Intron|FGF13-AS1_ENST00000438238.1_RNA	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13						cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					GCAACTTCTTGGCGTGATAAT	0.657																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.-560C>A	X.37:g.137793725G>T			B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	RNA	SNP	-	NULL	ENST00000315930.6	37	NULL	CCDS14665.1	X																																																																																			FGF13-AS1	-	-	ENSG00000226031		0.657	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF13-AS1	HGNC	protein_coding	OTTHUMT00000058534.2	-	0.00	42	0	G	NM_004114		137793725	+1	tier1	-	no_errors	ENST00000446383	ensembl	human	known	74_37	rna	42.57	58	43	SNP	0.015	T
LINC01446	401337	genome.wustl.edu	37	7	53833872	53833872	+	lincRNA	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr7:53833872T>C	ENST00000380970.2	-	0	565					NR_038371.1																						TATATTCTTGTCTTGGGAGTC	0.348																																																	0																																												0																															7.37:g.53833872T>C				RNA	SNP	-	NULL	ENST00000380970.2	37	NULL		7																																																																																			GS1-179L18.1	-	-	ENSG00000205628		0.348	GS1-179L18.1-001	KNOWN	basic	lincRNA	FLJ45974	Clone_based_vega_gene	lincRNA	OTTHUMT00000342819.1	-	0.00	72	0	T			53833872	-1	tier1	-	no_errors	ENST00000380970	ensembl	human	known	74_37	rna	28.05	59	23	SNP	0.128	C
FMO4	2329	genome.wustl.edu	37	1	171289011	171289011	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:171289011C>G	ENST00000367749.3	+	3	377	c.47C>G	c.(46-48)tCc>tGc	p.S16C		NM_002022.1	NP_002013.1	P31512	FMO4_HUMAN	flavin containing monooxygenase 4	16					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_cancers(6;3.9e-08)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					AGTGGCCTCTCCTCCATCAAA	0.458																																					Pancreas(24;816 862 7754 7993 32832)												0													210.0	193.0	199.0					1																	171289011		2203	4300	6503	SO:0001583	missense	0			BC002780	CCDS1295.1	1q24.3	2011-08-04			ENSG00000076258	ENSG00000076258	1.14.13.8		3772	protein-coding gene	gene with protein product		136131		FMO2		8311461	Standard	NM_002022		Approved		uc001gho.3	P31512	OTTHUMG00000035506	ENST00000367749.3:c.47C>G	1.37:g.171289011C>G	ENSP00000356723:p.Ser16Cys		Q53XR0	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_4,prints_Flavin_mOase_1,prints_Flavin_mOase_3	p.S16C	ENST00000367749.3	37	c.47	CCDS1295.1	1	.	.	.	.	.	.	.	.	.	.	C	12.89	2.072751	0.36566	.	.	ENSG00000076258	ENST00000367749	T	0.59772	0.24	5.18	5.18	0.71444	.	0.408219	0.26627	N	0.023332	T	0.43389	0.1245	L	0.43554	1.36	0.37878	D	0.930285	B	0.14438	0.01	B	0.29353	0.101	T	0.47018	-0.9149	10	0.56958	D	0.05	-15.0553	17.477	0.87661	0.0:1.0:0.0:0.0	.	16	P31512	FMO4_HUMAN	C	16	ENSP00000356723:S16C	ENSP00000356723:S16C	S	+	2	0	FMO4	169555635	0.052000	0.20516	0.998000	0.56505	0.318000	0.28184	1.857000	0.39399	2.404000	0.81709	0.650000	0.86243	TCC	FMO4	-	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase	ENSG00000076258		0.458	FMO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO4	HGNC	protein_coding	OTTHUMT00000086223.1	-	0.00	61	0	C	NM_002022		171289011	+1	tier1	-	no_errors	ENST00000367749	ensembl	human	known	74_37	missense	46.49	61	53	SNP	1.000	G
FOLH1B	219595	genome.wustl.edu	37	11	89421812	89421812	+	RNA	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:89421812T>G	ENST00000532352.1	+	0	1482							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						TTGGAATTGCTTCAGGCAGAG	0.308																																																	0													68.0	77.0	74.0					11																	89421812		2196	4294	6490			0			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89421812T>G				RNA	SNP	-	NULL	ENST00000532352.1	37	NULL		11																																																																																			FOLH1B	-	-	ENSG00000134612		0.308	FOLH1B-004	KNOWN	basic	processed_transcript	FOLH1B	HGNC	pseudogene	OTTHUMT00000395421.1	-	0.00	61	0	T	NM_153696		89421812	+1	tier1	-	no_errors	ENST00000525540	ensembl	human	known	74_37	rna	61.29	12	19	SNP	0.981	G
FREM2	341640	genome.wustl.edu	37	13	39262874	39262874	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr13:39262874C>T	ENST00000280481.7	+	1	1609	c.1393C>T	c.(1393-1395)Ccg>Tcg	p.P465S		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	465					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		AGGCAGTGGTCCGCAAAACTT	0.582																																																	0													51.0	55.0	54.0					13																	39262874		2203	4300	6503	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1393C>T	13.37:g.39262874C>T	ENSP00000280481:p.Pro465Ser		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.P465S	ENST00000280481.7	37	c.1393	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.048761	0.00394	.	.	ENSG00000150893	ENST00000280481	T	0.16743	2.32	5.6	3.81	0.43845	.	0.505278	0.18484	N	0.139857	T	0.12518	0.0304	L	0.43152	1.355	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.36407	-0.9749	10	0.13108	T	0.6	.	7.0062	0.24838	0.0:0.7083:0.0:0.2917	.	465	Q5SZK8	FREM2_HUMAN	S	465	ENSP00000280481:P465S	ENSP00000280481:P465S	P	+	1	0	FREM2	38160874	0.000000	0.05858	0.003000	0.11579	0.315000	0.28087	0.485000	0.22324	0.675000	0.31264	0.561000	0.74099	CCG	FREM2	-	NULL	ENSG00000150893		0.582	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	-	0.00	55	0	C	NM_207361		39262874	+1	tier1	-	no_errors	ENST00000280481	ensembl	human	known	74_37	missense	35.48	20	11	SNP	0.008	T
FREM2	341640	genome.wustl.edu	37	13	39262883	39262883	+	Silent	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr13:39262883T>C	ENST00000280481.7	+	1	1618	c.1402T>C	c.(1402-1404)Ttg>Ctg	p.L468L		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	468					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TCCGCAAAACTTGGTCATCAG	0.587																																																	0													51.0	53.0	52.0					13																	39262883		2203	4300	6503	SO:0001819	synonymous_variant	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1402T>C	13.37:g.39262883T>C			Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.L468	ENST00000280481.7	37	c.1402	CCDS31960.1	13																																																																																			FREM2	-	NULL	ENSG00000150893		0.587	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	-	0.00	55	0	T	NM_207361		39262883	+1	tier1	-	no_errors	ENST00000280481	ensembl	human	known	74_37	silent	33.33	20	10	SNP	0.992	C
GABBR1	2550	genome.wustl.edu	37	6	29581140	29581140	+	Silent	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:29581140G>A	ENST00000377034.4	-	12	1781	c.1446C>T	c.(1444-1446)aaC>aaT	p.N482N	GABBR1_ENST00000376977.3_Silent_p.N482N|GABBR1_ENST00000377012.4_Silent_p.N365N|GABBR1_ENST00000355973.3_Silent_p.N365N|GABBR1_ENST00000377016.4_Silent_p.N420N	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	482					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	CAGATGTCTTGTTCAGGGCCA	0.557																																																	0													106.0	114.0	111.0					6																	29581140		1510	2709	4219	SO:0001819	synonymous_variant	0			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1446C>T	6.37:g.29581140G>A			B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Sushi_SCR_CCP,superfamily_Peripla_BP_I,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,pfscan_Sushi_SCR_CCP,pfscan_GPCR_3_C	p.N482	ENST00000377034.4	37	c.1446	CCDS4663.1	6																																																																																			GABBR1	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1	ENSG00000204681		0.557	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	HGNC	protein_coding	OTTHUMT00000076141.3	-	0.00	49	0	G			29581140	-1	tier1	-	no_errors	ENST00000377034	ensembl	human	known	74_37	silent	16.42	56	11	SNP	1.000	A
GATA3	2625	genome.wustl.edu	37	10	8097681	8097681	+	Silent	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr10:8097681G>T	ENST00000346208.3	+	2	518	c.63G>T	c.(61-63)ggG>ggT	p.G21G	RP11-379F12.3_ENST00000458727.1_lincRNA|GATA3-AS1_ENST00000355358.1_lincRNA|RP11-379F12.4_ENST00000418270.1_lincRNA|GATA3_ENST00000379328.3_Silent_p.G21G			P23771	GATA3_HUMAN	GATA binding protein 3	21					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TGCTCAACGGGCAGCACCCGG	0.706			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																																	Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	0													19.0	17.0	18.0					10																	8097681		2176	4259	6435	SO:0001819	synonymous_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.63G>T	10.37:g.8097681G>T			Q5VWG7|Q5VWG8|Q96J16	Silent	SNP	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.G21	ENST00000346208.3	37	c.63	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.706	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	-	0.00	48	0	G	NM_001002295		8097681	+1	tier1	-	no_errors	ENST00000379328	ensembl	human	known	74_37	silent	12.50	28	4	SNP	0.996	T
GBA2	57704	genome.wustl.edu	37	9	35737850	35737850	+	Silent	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr9:35737850A>G	ENST00000378103.3	-	16	2923	c.2400T>C	c.(2398-2400)gcT>gcC	p.A800A	GBA2_ENST00000467252.1_5'Flank|GBA2_ENST00000378088.1_Silent_p.A101A|GBA2_ENST00000545786.1_Silent_p.A806A|GBA2_ENST00000378094.4_Silent_p.A800A	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2	800					bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TCCCATTCACAGCCCCCATGG	0.572																																																	0													86.0	80.0	82.0					9																	35737850		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.2400T>C	9.37:g.35737850A>G			D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Silent	SNP	pfam_Glucosylceramidase,pfam_GBA2_N,superfamily_6-hairpin_glycosidase-like,pirsf_Beta_glucosidase_GBA2-type	p.A806	ENST00000378103.3	37	c.2418	CCDS6589.1	9																																																																																			GBA2	-	pfam_Glucosylceramidase,superfamily_6-hairpin_glycosidase-like,pirsf_Beta_glucosidase_GBA2-type	ENSG00000070610		0.572	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GBA2	HGNC	protein_coding	OTTHUMT00000055456.1	-	0.00	50	0	A	NM_020944		35737850	-1	tier1	-	no_errors	ENST00000545786	ensembl	human	known	74_37	silent	21.18	67	18	SNP	0.993	G
GPBAR1	151306	genome.wustl.edu	37	2	219128374	219128374	+	Silent	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:219128374C>T	ENST00000522678.1	+	2	1795	c.927C>T	c.(925-927)gaC>gaT	p.D309D	GPBAR1_ENST00000521462.1_Silent_p.D309D|GPBAR1_ENST00000519574.1_Silent_p.D309D|GPBAR1_ENST00000479077.1_Silent_p.D309D	NM_001077191.1	NP_001070659.1	Q8TDU6	GPBAR_HUMAN	G protein-coupled bile acid receptor 1	309					cell surface bile acid receptor signaling pathway (GO:0038184)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid receptor activity (GO:0038181)|G-protein coupled bile acid receptor activity (GO:0038182)			cervix(1)|kidney(1)|large_intestine(1)|ovary(1)	4		Renal(207;0.0474)		Epithelial(149;7.19e-07)|all cancers(144;0.000131)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCTCCCGGGACAGTCCCGGCC	0.647																																																	0													32.0	36.0	35.0					2																	219128374		2049	4218	6267	SO:0001819	synonymous_variant	0			AB086170	CCDS46515.1	2q35	2012-08-08			ENSG00000179921	ENSG00000179921			19680	protein-coding gene	gene with protein product		610147				12419312	Standard	NM_170699		Approved	BG37, GPCR, TGR5, M-BAR, GPCR19, GPR131, MGC40597	uc010zjw.1	Q8TDU6	OTTHUMG00000155203	ENST00000522678.1:c.927C>T	2.37:g.219128374C>T			B3KV35	Silent	SNP	pfam_GPCR_Rhodpsn,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.D309	ENST00000522678.1	37	c.927	CCDS46515.1	2																																																																																			GPBAR1	-	NULL	ENSG00000179921		0.647	GPBAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GPBAR1	HGNC	protein_coding	OTTHUMT00000338767.3	-	0.00	20	0	C	NM_001077191		219128374	+1	tier1	-	no_errors	ENST00000479077	ensembl	human	known	74_37	silent	29.63	19	8	SNP	0.034	T
GRID1	2894	genome.wustl.edu	37	10	87628820	87628820	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr10:87628820G>A	ENST00000327946.7	-	6	983	c.898C>T	c.(898-900)Cgc>Tgc	p.R300C		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	300					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GAGGAGATGCGGTGGTTGTTC	0.567										Multiple Myeloma(13;0.14)																																							0													205.0	153.0	171.0					10																	87628820		2203	4300	6503	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.898C>T	10.37:g.87628820G>A	ENSP00000330148:p.Arg300Cys		B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R300C	ENST00000327946.7	37	c.898	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	G	23.7	4.449921	0.84101	.	.	ENSG00000182771	ENST00000327946	D	0.86230	-2.09	5.58	5.58	0.84498	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91938	0.7447	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92327	0.5870	10	0.87932	D	0	.	13.5144	0.61533	0.0:0.0:0.8441:0.1559	.	300	Q9ULK0	GRID1_HUMAN	C	300	ENSP00000330148:R300C	ENSP00000330148:R300C	R	-	1	0	GRID1	87618800	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	5.527000	0.67123	2.617000	0.88574	0.563000	0.77884	CGC	GRID1	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000182771		0.567	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	-	0.00	68	0	G	XM_043613		87628820	-1	tier1	-	no_errors	ENST00000327946	ensembl	human	known	74_37	missense	37.29	37	22	SNP	1.000	A
GRM4	2914	genome.wustl.edu	37	6	34071373	34071373	+	Intron	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:34071373A>G	ENST00000538487.2	-	3	963				GRM4_ENST00000374181.4_Intron|GRM4_ENST00000609222.1_Silent_p.H35H|GRM4_ENST00000374177.3_Intron|GRM4_ENST00000455714.2_5'Flank|GRM4_ENST00000544773.2_Intron|GRM4_ENST00000535756.1_Silent_p.H35H	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4						activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CAGGTTTTACATGCTGACTCA	0.537																																																	0																																										SO:0001627	intron_variant	0			U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.520-11497T>C	6.37:g.34071373A>G			B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Silent	SNP	pfam_GPCR_3_C,pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_9-Cys_dom,superfamily_Peripla_BP_I,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_4,prints_GPCR_3_mtglu_rcpt	p.H35	ENST00000538487.2	37	c.105	CCDS4787.1	6																																																																																			GRM4	-	superfamily_Peripla_BP_I	ENSG00000124493		0.537	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM4	HGNC	protein_coding	OTTHUMT00000040213.2		0.00	44	0	A			34071373	-1			no_errors	ENST00000535756	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.998	G
GUCY2C	2984	genome.wustl.edu	37	12	14836151	14836151	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr12:14836151T>G	ENST00000261170.3	-	4	572	c.436A>C	c.(436-438)Agt>Cgt	p.S146R	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	146					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	AATCCAAAACTTCCAGCTGAG	0.383																																																	0													85.0	78.0	80.0					12																	14836151		2203	4300	6503	SO:0001583	missense	0				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.436A>C	12.37:g.14836151T>G	ENSP00000261170:p.Ser146Arg		B2RMY6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_A/G_cyclase,superfamily_Peripla_BP_I,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.S146R	ENST00000261170.3	37	c.436	CCDS8664.1	12	.	.	.	.	.	.	.	.	.	.	T	23.4	4.415057	0.83449	.	.	ENSG00000070019	ENST00000261170	D	0.85411	-1.98	5.46	5.46	0.80206	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91212	0.7231	M	0.75777	2.31	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.91583	0.5280	10	0.56958	D	0.05	.	11.9384	0.52886	0.0:0.0:0.0:1.0	.	146	P25092	GUC2C_HUMAN	R	146	ENSP00000261170:S146R	ENSP00000261170:S146R	S	-	1	0	GUCY2C	14727418	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.026000	0.70873	2.077000	0.62373	0.533000	0.62120	AGT	GUCY2C	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000070019		0.383	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2C	HGNC	protein_coding	OTTHUMT00000400835.1	-	0.00	71	0	T			14836151	-1	tier1	-	no_errors	ENST00000261170	ensembl	human	known	74_37	missense	68.09	15	32	SNP	1.000	G
HDGF	3068	genome.wustl.edu	37	1	156722139	156722139	+	5'Flank	SNP	C	C	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:156722139C>A	ENST00000357325.5	-	0	0				HDGF_ENST00000537739.1_5'Flank|PRCC_ENST00000491853.1_Intron|HDGF_ENST00000368206.5_Missense_Mutation_p.G6V|HDGF_ENST00000465180.1_Intron|HDGF_ENST00000368209.5_5'Flank|HDGF_ENST00000416666.2_5'Flank	NM_004494.2	NP_004485.1	P51858	HDGF_HUMAN	hepatoma-derived growth factor						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein localization to nucleus (GO:0034504)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription corepressor binding (GO:0001222)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9	all_hematologic(923;0.088)|Hepatocellular(266;0.158)	Breast(1374;0.198)		Colorectal(1306;0.018)		CACAAATTGGCCACCTTCCGG	0.532																																																	0													126.0	136.0	133.0					1																	156722139		692	1591	2283	SO:0001631	upstream_gene_variant	0			D16431	CCDS1156.1, CCDS44247.1, CCDS44248.1	1q23.1	2013-10-14	2010-03-19		ENSG00000143321	ENSG00000143321			4856	protein-coding gene	gene with protein product	"""high-mobility group protein 1-like"""	600339	"""hepatoma-derived growth factor (high-mobility group protein 1-like)"""			8833162	Standard	NM_004494		Approved	HMG1L2	uc001fpy.4	P51858	OTTHUMG00000041295		1.37:g.156722139C>A	Exception_encountered		B3KU21|D3DVC9|Q5SZ07|Q5SZ08|Q5SZ09	Missense_Mutation	SNP	pfam_PWWP_dom	p.G6V	ENST00000357325.5	37	c.17	CCDS1156.1	1	.	.	.	.	.	.	.	.	.	.	C	12.09	1.833839	0.32421	.	.	ENSG00000143321	ENST00000368206	T	0.40225	1.04	2.65	0.74	0.18330	.	0.768885	0.11083	U	0.601609	T	0.13114	0.0318	N	0.08118	0	0.21290	N	0.999733	P	0.48350	0.909	P	0.49799	0.622	T	0.05550	-1.0878	10	0.87932	D	0	.	4.5486	0.12098	0.0:0.678:0.0:0.322	.	6	Q5SZ07	.	V	6	ENSP00000357189:G6V	ENSP00000357189:G6V	G	-	2	0	HDGF	154988763	0.002000	0.14202	0.047000	0.18901	0.288000	0.27193	-0.148000	0.10219	0.203000	0.20529	0.313000	0.20887	GGC	HDGF	-	NULL	ENSG00000143321		0.532	HDGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDGF	HGNC	protein_coding	OTTHUMT00000098946.1	-	0.00	36	0	C	NM_004494		156722139	-1	tier1	-	no_errors	ENST00000368206	ensembl	human	known	74_37	missense	29.17	17	7	SNP	0.053	A
HIPK2	28996	genome.wustl.edu	37	7	139257834	139257834	+	Missense_Mutation	SNP	C	C	T	rs544605371		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr7:139257834C>T	ENST00000406875.3	-	15	3530	c.3436G>A	c.(3436-3438)Gtg>Atg	p.V1146M	HIPK2_ENST00000428878.2_Missense_Mutation_p.V1119M	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	1146	Autoinhibitory domain (AID).				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					CCCATGCTCACGGGGACCTGG	0.687													C|||	1	0.000199681	0.0	0.0	5008	,	,		10303	0.0		0.0	False		,,,				2504	0.001																0													27.0	34.0	32.0					7																	139257834		2154	4249	6403	SO:0001583	missense	0			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.3436G>A	7.37:g.139257834C>T	ENSP00000385571:p.Val1146Met		Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V1146M	ENST00000406875.3	37	c.3436		7	.	.	.	.	.	.	.	.	.	.	C	20.2	3.952591	0.73787	.	.	ENSG00000064393	ENST00000406875;ENST00000428878	T;T	0.61274	0.12;0.14	5.2	4.29	0.51040	.	.	.	.	.	T	0.74107	0.3673	.	.	.	0.49483	D	0.999792	D;D	0.76494	0.998;0.999	P;D	0.64237	0.84;0.923	T	0.77222	-0.2667	8	0.52906	T	0.07	.	15.3549	0.74421	0.0:0.8597:0.1403:0.0	.	1146;1119	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	M	1146;1119	ENSP00000385571:V1146M;ENSP00000413724:V1119M	ENSP00000385571:V1146M	V	-	1	0	HIPK2	138908374	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.144000	0.77357	1.124000	0.41980	0.655000	0.94253	GTG	HIPK2	-	NULL	ENSG00000064393		0.687	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	HIPK2	HGNC	protein_coding	OTTHUMT00000349430.3	-	0.00	71	0	C	NM_022740		139257834	-1	tier1	-	no_errors	ENST00000406875	ensembl	human	known	74_37	missense	29.49	55	23	SNP	0.999	T
HRNR	388697	genome.wustl.edu	37	1	152191005	152191005	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:152191005A>T	ENST00000368801.2	-	3	3175	c.3100T>A	c.(3100-3102)Tct>Act	p.S1034T	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1034					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGGCTTGAAGACCACCCTGAG	0.597																																																	0													170.0	192.0	185.0					1																	152191005		2203	4300	6503	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.3100T>A	1.37:g.152191005A>T	ENSP00000357791:p.Ser1034Thr		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.S1034T	ENST00000368801.2	37	c.3100	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	A	7.084	0.570735	0.13560	.	.	ENSG00000197915	ENST00000368801	T	0.01725	4.67	3.13	1.98	0.26296	.	.	.	.	.	T	0.00440	0.0014	N	0.12471	0.22	0.09310	N	1	P	0.51791	0.948	P	0.45610	0.487	T	0.38112	-0.9676	9	0.13470	T	0.59	.	5.0067	0.14291	0.8515:0.0:0.1485:0.0	.	1034	Q86YZ3	HORN_HUMAN	T	1034	ENSP00000357791:S1034T	ENSP00000357791:S1034T	S	-	1	0	HRNR	150457629	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.593000	0.23999	0.412000	0.25729	0.378000	0.23410	TCT	HRNR	-	NULL	ENSG00000197915		0.597	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	-	0.00	91	0	A	XM_373868		152191005	-1	tier1	-	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	36.91	94	55	SNP	0.001	T
HTR1A	3350	genome.wustl.edu	37	5	63256592	63256592	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr5:63256592C>T	ENST00000323865.3	-	1	1188	c.955G>A	c.(955-957)Gcc>Acc	p.A319T	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	319					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	TCGAAAGAGGCGGGGGCACAA	0.632																																																	0													46.0	49.0	48.0					5																	63256592		2203	4300	6503	SO:0001583	missense	0			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.955G>A	5.37:g.63256592C>T	ENSP00000316244:p.Ala319Thr		Q6LAE7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_5HT1A_rcpt,prints_GPCR_Rhodpsn,prints_5HT_rcpt,prints_NPY_rcpt	p.A319T	ENST00000323865.3	37	c.955	CCDS34168.1	5	.	.	.	.	.	.	.	.	.	.	C	5.148	0.212921	0.09757	.	.	ENSG00000178394	ENST00000323865	T	0.62788	0.0	5.7	-1.84	0.07809	GPCR, rhodopsin-like superfamily (1);	1.160630	0.06370	N	0.713439	T	0.36635	0.0974	N	0.20807	0.61	0.09310	N	0.999995	B	0.02656	0.0	B	0.08055	0.003	T	0.13656	-1.0501	10	0.10636	T	0.68	.	0.9262	0.01325	0.2312:0.318:0.1152:0.3356	.	319	P08908	5HT1A_HUMAN	T	319	ENSP00000316244:A319T	ENSP00000316244:A319T	A	-	1	0	HTR1A	63292348	0.000000	0.05858	0.041000	0.18516	0.451000	0.32288	-0.887000	0.04152	-0.257000	0.09459	-0.274000	0.10170	GCC	HTR1A	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_5HT1A_rcpt	ENSG00000178394		0.632	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1A	HGNC	protein_coding	OTTHUMT00000368397.1	-	0.00	20	0	C	NM_000524		63256592	-1	tier1	-	no_errors	ENST00000323865	ensembl	human	known	74_37	missense	40.00	15	10	SNP	0.002	T
IFI16	3428	genome.wustl.edu	37	1	159021683	159021683	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:159021683A>C	ENST00000295809.7	+	10	2135	c.1880A>C	c.(1879-1881)aAg>aCg	p.K627T	IFI16_ENST00000340979.6_Missense_Mutation_p.K515T|IFI16_ENST00000368131.4_Missense_Mutation_p.K571T|IFI16_ENST00000448393.2_Missense_Mutation_p.K515T|IFI16_ENST00000430894.2_Missense_Mutation_p.K575T|IFI16_ENST00000368132.3_Missense_Mutation_p.K571T|IFI16_ENST00000359709.3_Missense_Mutation_p.K571T			Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	627	HIN-200 2. {ECO:0000255|PROSITE- ProRule:PRU00106}.|Interaction with TP53 core domain.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of innate immune response (GO:0002218)|autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular response to glucose starvation (GO:0042149)|cellular response to ionizing radiation (GO:0071479)|defense response to virus (GO:0051607)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|monocyte differentiation (GO:0030224)|myeloid cell differentiation (GO:0030099)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|negative regulation of DNA binding (GO:0043392)|negative regulation of innate immune response (GO:0045824)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|positive regulation of cytokine production (GO:0001819)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of autophagy (GO:0010506)|regulation of gene expression, epigenetic (GO:0040029)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0429)					TTCACCCCAAAGAAGATCATT	0.423																																																	0													102.0	101.0	101.0					1																	159021683		2203	4300	6503	SO:0001583	missense	0			M63838	CCDS1180.3, CCDS58039.1	1q22	2008-02-05			ENSG00000163565	ENSG00000163565			5395	protein-coding gene	gene with protein product		147586				1526658, 7959953	Standard	NM_005531		Approved	IFNGIP1, PYHIN2	uc010pis.2	Q16666	OTTHUMG00000037108	ENST00000295809.7:c.1880A>C	1.37:g.159021683A>C	ENSP00000295809:p.Lys627Thr		B4DJT8|H3BLV7|Q59GX0|Q5T3W7|Q5T3W8|Q5T3X0|Q5T3X1|Q5T3X2|Q8N9E5|Q8NEQ7|Q96AJ5|Q9UH78	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like_dom,pfscan_DAPIN,pfscan_HIN200/IF120x	p.K627T	ENST00000295809.7	37	c.1880		1	.	.	.	.	.	.	.	.	.	.	A	14.04	2.415329	0.42817	.	.	ENSG00000163565	ENST00000359709;ENST00000295809;ENST00000340979;ENST00000368131;ENST00000368132;ENST00000430894	T;T;T;T;T	0.15952	2.38;2.38;2.38;2.38;2.38	4.85	0.721	0.18219	.	.	.	.	.	T	0.16428	0.0395	M	0.67700	2.07	0.09310	N	1	P;B;P	0.52577	0.825;0.286;0.954	D;B;D	0.65010	0.91;0.36;0.931	T	0.08086	-1.0739	9	0.72032	D	0.01	.	2.971	0.05923	0.5741:0.0:0.2473:0.1785	.	575;515;571	E7EPR3;Q16666-3;Q16666-2	.;.;.	T	256;627;515;571;571;575	ENSP00000295809:K627T;ENSP00000342741:K515T;ENSP00000357113:K571T;ENSP00000357114:K571T;ENSP00000394935:K575T	ENSP00000295809:K627T	K	+	2	0	IFI16	157288307	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.765000	0.26546	-0.051000	0.13334	-0.405000	0.06341	AAG	IFI16	-	pfam_HIN200/IF120x,pfscan_HIN200/IF120x	ENSG00000163565		0.423	IFI16-013	KNOWN	basic	protein_coding	IFI16	HGNC	protein_coding	OTTHUMT00000421720.1	-	0.00	49	0	A	NM_005531		159021683	+1	tier1	-	no_errors	ENST00000295809	ensembl	human	known	74_37	missense	25.86	43	15	SNP	0.000	C
IMPG2	50939	genome.wustl.edu	37	3	101010330	101010330	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:101010330C>A	ENST00000193391.7	-	4	713	c.526G>T	c.(526-528)Gta>Tta	p.V176L		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	176					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	CACCTGCTTACAGTTTCCTTT	0.338																																																	0													92.0	89.0	90.0					3																	101010330		2203	4300	6503	SO:0001583	missense	0			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.526G>T	3.37:g.101010330C>A	ENSP00000193391:p.Val176Leu		A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.V176L	ENST00000193391.7	37	c.526	CCDS2940.1	3	.	.	.	.	.	.	.	.	.	.	c	9.922	1.212344	0.22289	.	.	ENSG00000081148	ENST00000193391	T	0.22336	1.96	5.28	-6.53	0.01866	.	1.417710	0.04218	N	0.332989	T	0.10594	0.0259	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.24621	-1.0155	10	0.18710	T	0.47	0.3913	0.8651	0.01202	0.2054:0.1857:0.2021:0.4067	.	176;176	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	L	176	ENSP00000193391:V176L	ENSP00000193391:V176L	V	-	1	0	IMPG2	102493020	0.005000	0.15991	0.004000	0.12327	0.974000	0.67602	-0.420000	0.07062	-1.269000	0.02436	-0.119000	0.15052	GTA	IMPG2	-	NULL	ENSG00000081148		0.338	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG2	HGNC	protein_coding	OTTHUMT00000353256.3	-	0.00	43	0	C			101010330	-1	tier1	-	no_errors	ENST00000193391	ensembl	human	known	74_37	missense	28.81	42	17	SNP	0.000	A
ITGA8	8516	genome.wustl.edu	37	10	15649773	15649773	+	Missense_Mutation	SNP	G	G	A	rs147309422		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr10:15649773G>A	ENST00000378076.3	-	17	2020	c.1667C>T	c.(1666-1668)aCg>aTg	p.T556M		NM_003638.1	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	556					brain development (GO:0007420)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|integrin-mediated signaling pathway (GO:0007229)|kidney development (GO:0001822)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|metanephros development (GO:0001656)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|substrate adhesion-dependent cell spreading (GO:0034446)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|dendritic spine membrane (GO:0032591)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integrin alpha8-beta1 complex (GO:0034678)|integrin complex (GO:0008305)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	metal ion binding (GO:0046872)			NS(2)|breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(57)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	96						AAGGAAGAGCGTCCGTTTAAT	0.428																																																	0								G	MET/THR	0,4406		0,0,2203	144.0	137.0	139.0		1667	4.9	0.2	10	dbSNP_134	139	2,8598	2.2+/-6.3	0,2,4298	no	missense	ITGA8	NM_003638.1	81	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	556/1064	15649773	2,13004	2203	4300	6503	SO:0001583	missense	0			L36531	CCDS31155.1	10p13	2010-03-23			ENSG00000077943	ENSG00000077943		"""Integrins"""	6144	protein-coding gene	gene with protein product		604063				7768999	Standard	XM_005252633		Approved		uc001ioc.1	P53708	OTTHUMG00000017733	ENST00000378076.3:c.1667C>T	10.37:g.15649773G>A	ENSP00000367316:p.Thr556Met		B0YJ31|Q5VX94	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.T556M	ENST00000378076.3	37	c.1667	CCDS31155.1	10	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298813	0.40694	0.0	2.33E-4	ENSG00000077943	ENST00000378076;ENST00000538044	T	0.45276	0.9	5.84	4.93	0.64822	Integrin alpha-2 (1);	0.145069	0.64402	D	0.000006	T	0.57607	0.2065	M	0.65498	2.005	0.37223	D	0.905314	D;D	0.71674	0.997;0.998	P;P	0.61800	0.831;0.894	T	0.59306	-0.7479	10	0.33940	T	0.23	.	14.3627	0.66785	0.0706:0.0:0.9294:0.0	.	541;556	F5H818;P53708	.;ITA8_HUMAN	M	556;541	ENSP00000367316:T556M	ENSP00000367316:T556M	T	-	2	0	ITGA8	15689779	0.999000	0.42202	0.215000	0.23724	0.076000	0.17211	3.595000	0.54016	2.767000	0.95098	0.591000	0.81541	ACG	ITGA8	-	pfam_Integrin_alpha-2	ENSG00000077943		0.428	ITGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA8	HGNC	protein_coding	OTTHUMT00000046987.1	-	0.00	11	0	G	NM_003638		15649773	-1	tier1	rs147309422	no_errors	ENST00000378076	ensembl	human	known	74_37	missense	36.36	14	8	SNP	0.747	A
JAM3	83700	genome.wustl.edu	37	11	134009549	134009549	+	Intron	SNP	C	C	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:134009549C>A	ENST00000299106.4	+	2	235				JAM3_ENST00000441717.3_Intron|JAM3_ENST00000529443.2_Intron|JAM3_ENST00000524969.1_Intron			Q9BX67	JAM3_HUMAN	junctional adhesion molecule 3						adaptive immune response (GO:0002250)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|establishment of cell polarity (GO:0030010)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|myelination (GO:0042552)|myeloid progenitor cell differentiation (GO:0002318)|neutrophil homeostasis (GO:0001780)|regulation of actin cytoskeleton organization by cell-cell adhesion (GO:0090138)|regulation of neutrophil chemotaxis (GO:0090022)|spermatid development (GO:0007286)|transmission of nerve impulse (GO:0019226)	cell-cell contact zone (GO:0044291)|desmosome (GO:0030057)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	integrin binding (GO:0005178)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)	10	all_hematologic(175;0.127)	all_cancers(12;1.06e-21)|all_epithelial(12;3.37e-16)|all_lung(97;7.03e-06)|Lung NSC(97;1.67e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0506)|Esophageal squamous(93;0.0566)		Epithelial(10;1.55e-09)|BRCA - Breast invasive adenocarcinoma(10;1.35e-08)|all cancers(11;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00402)|Lung(977;0.245)		TTTCCCTTGGCTCCTTCCAGT	0.403											OREG0021547	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			AF356518	CCDS8494.1, CCDS55799.1, CCDS8494.2	11q25	2013-01-29			ENSG00000166086	ENSG00000166086		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15532	protein-coding gene	gene with protein product		606871					Standard	NM_032801		Approved	JAM-C, JAMC	uc001qhb.3	Q9BX67	OTTHUMG00000167130	ENST00000299106.4:c.77-197C>A	11.37:g.134009549C>A		1607	B3KWG9|Q8WWL8|Q96FL1	RNA	SNP	-	NULL	ENST00000299106.4	37	NULL	CCDS8494.2	11																																																																																			JAM3	-	-	ENSG00000166086		0.403	JAM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	JAM3	HGNC	protein_coding	OTTHUMT00000393303.4	-	0.00	21	0	C	NM_032801		134009549	+1	tier1	-	no_errors	ENST00000532165	ensembl	human	known	74_37	rna	45.45	6	5	SNP	0.000	A
JPH2	57158	genome.wustl.edu	37	20	42744353	42744353	+	Silent	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr20:42744353C>T	ENST00000372980.3	-	4	2834	c.1962G>A	c.(1960-1962)gcG>gcA	p.A654A		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	654					calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CCTCCTTCCGCGCCTTCTTCT	0.667																																																	0													41.0	45.0	44.0					20																	42744353		2202	4300	6502	SO:0001819	synonymous_variant	0			AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.1962G>A	20.37:g.42744353C>T			E1P5X1|O95913|Q5JY74|Q9UJN4	Silent	SNP	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.A654	ENST00000372980.3	37	c.1962	CCDS13325.1	20																																																																																			JPH2	-	pirsf_Junctophilin	ENSG00000149596		0.667	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH2	HGNC	protein_coding	OTTHUMT00000080307.1		0.00	17	0	C			42744353	-1			no_errors	ENST00000372980	ensembl	human	known	74_37	silent	14.71	29	5	SNP	0.005	T
KCNA4	3739	genome.wustl.edu	37	11	30034788	30034788	+	5'UTR	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:30034788A>C	ENST00000328224.6	-	0	671				KCNA4_ENST00000526518.1_5'UTR	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4						potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	TTCTACTCAAAGTCTATCAGG	0.433																																																	0																																										SO:0001623	5_prime_UTR_variant	0			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.-563T>G	11.37:g.30034788A>C				RNA	SNP	-	NULL	ENST00000328224.6	37	NULL	CCDS41629.1	11																																																																																			KCNA4	-	-	ENSG00000182255		0.433	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA4	HGNC	protein_coding	OTTHUMT00000388074.2	-	0.00	70	0	A	NM_002233		30034788	-1	tier1	-	no_errors	ENST00000526518	ensembl	human	putative	74_37	rna	66.67	25	50	SNP	0.005	C
KCNK3	3777	genome.wustl.edu	37	2	26950852	26950852	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:26950852G>A	ENST00000302909.3	+	2	726	c.601G>A	c.(601-603)Ggc>Agc	p.G201S		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	201					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	CACCACCATCGGCTTCGGCGA	0.622																																					GBM(80;1457 1631 27100 45946)												0													70.0	61.0	64.0					2																	26950852		2203	4300	6503	SO:0001583	missense	0			AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.601G>A	2.37:g.26950852G>A	ENSP00000306275:p.Gly201Ser		Q53SU2	Missense_Mutation	SNP	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl_TASK,prints_KCNK3,prints_2pore_dom_K_chnl	p.G201S	ENST00000302909.3	37	c.601	CCDS1727.1	2	.	.	.	.	.	.	.	.	.	.	g	26.8	4.771470	0.90108	.	.	ENSG00000171303	ENST00000538762;ENST00000302909	D	0.90324	-2.65	5.11	5.11	0.69529	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	D	0.97414	0.9154	H	0.98721	4.31	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.98931	1.0787	10	0.87932	D	0	.	16.4019	0.83643	0.0:0.0:1.0:0.0	.	201	O14649	KCNK3_HUMAN	S	78;201	ENSP00000306275:G201S	ENSP00000306275:G201S	G	+	1	0	KCNK3	26804356	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.787000	0.99055	2.535000	0.85469	0.556000	0.70494	GGC	KCNK3	-	pfam_2pore_dom_K_chnl_dom,pirsf_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl	ENSG00000171303		0.622	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK3	HGNC	protein_coding	OTTHUMT00000246861.2	-	0.00	65	0	G	NM_002246		26950852	+1	tier1	-	no_errors	ENST00000302909	ensembl	human	known	74_37	missense	25.61	61	21	SNP	1.000	A
KCNT2	343450	genome.wustl.edu	37	1	196250003	196250003	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:196250003A>C	ENST00000294725.9	-	25	3812	c.2897T>G	c.(2896-2898)cTt>cGt	p.L966R	KCNT2_ENST00000367433.5_Missense_Mutation_p.L942R|KCNT2_ENST00000367431.4_Missense_Mutation_p.L892R|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.L892R			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	966					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)	p.L966R(1)		NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						AGATGTAGTAAGTTTCTGAGA	0.328																																																	1	Substitution - Missense(1)	large_intestine(1)											93.0	95.0	94.0					1																	196250003		2203	4300	6503	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2897T>G	1.37:g.196250003A>C	ENSP00000294725:p.Leu966Arg		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.L966R	ENST00000294725.9	37	c.2897	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.021575	0.54576	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.78246	-1.16;-1.16;-1.16	5.52	5.52	0.82312	.	0.000000	0.53938	D	0.000056	T	0.77075	0.4077	L	0.50333	1.59	0.80722	D	1	P;P;P;P;P	0.51147	0.904;0.942;0.714;0.823;0.904	B;P;P;P;B	0.49799	0.418;0.622;0.499;0.499;0.418	T	0.73216	-0.4053	10	0.13470	T	0.59	-12.0344	14.9129	0.70773	1.0:0.0:0.0:0.0	.	966;924;942;892;966	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	R	942;892;966	ENSP00000356403:L942R;ENSP00000356401:L892R;ENSP00000294725:L966R	ENSP00000294725:L966R	L	-	2	0	KCNT2	194516626	1.000000	0.71417	0.507000	0.27676	0.995000	0.86356	8.347000	0.90062	2.222000	0.72286	0.455000	0.32223	CTT	KCNT2	-	NULL	ENSG00000162687		0.328	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	-	0.00	64	0	A	NM_198503		196250003	-1	tier1	-	no_errors	ENST00000294725	ensembl	human	known	74_37	missense	40.35	34	23	SNP	0.977	C
KIAA1244	57221	genome.wustl.edu	37	6	138576830	138576830	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:138576830T>C	ENST00000251691.4	+	10	1194	c.1028T>C	c.(1027-1029)cTc>cCc	p.L343P		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		AAGCCCGTGCTCCAGTCCCTC	0.617																																																	0													22.0	23.0	23.0					6																	138576830		2203	4300	6503	SO:0001583	missense	0			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.1028T>C	6.37:g.138576830T>C	ENSP00000251691:p.Leu343Pro			Missense_Mutation	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold,superfamily_Sec7_dom,smart_Sec7_dom	p.L343P	ENST00000251691.4	37	c.1028	CCDS5189.2	6	.	.	.	.	.	.	.	.	.	.	T	25.3	4.621617	0.87460	.	.	ENSG00000112379	ENST00000251691	T	0.08370	3.1	5.68	5.68	0.88126	.	0.067032	0.64402	D	0.000017	T	0.21761	0.0524	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.01021	-1.1478	10	0.87932	D	0	-24.9383	15.9354	0.79698	0.0:0.0:0.0:1.0	.	343	Q5TH69	BIG3_HUMAN	P	343	ENSP00000251691:L343P	ENSP00000251691:L343P	L	+	2	0	KIAA1244	138618523	1.000000	0.71417	0.984000	0.44739	0.964000	0.63967	8.040000	0.89188	2.182000	0.69389	0.533000	0.62120	CTC	KIAA1244	-	superfamily_ARM-type_fold	ENSG00000112379		0.617	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1244	HGNC	protein_coding	OTTHUMT00000042425.4	-	0.00	25	0	T	NM_020340		138576830	+1	tier1	-	no_errors	ENST00000251691	ensembl	human	known	74_37	missense	19.23	21	5	SNP	1.000	C
KIAA1462	57608	genome.wustl.edu	37	10	30316554	30316554	+	Silent	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr10:30316554C>T	ENST00000375377.1	-	3	2624	c.2523G>A	c.(2521-2523)gaG>gaA	p.E841E		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	841					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						CTTCCTGGAGCTCCTTGTTAA	0.542																																																	0													60.0	64.0	63.0					10																	30316554		2054	4197	6251	SO:0001819	synonymous_variant	0			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.2523G>A	10.37:g.30316554C>T			Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Silent	SNP	NULL	p.E841	ENST00000375377.1	37	c.2523	CCDS41500.1	10																																																																																			KIAA1462	-	NULL	ENSG00000165757		0.542	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	HGNC	protein_coding	OTTHUMT00000047409.1	-	0.00	66	0	C	NM_020848		30316554	-1	tier1	-	no_errors	ENST00000375377	ensembl	human	known	74_37	silent	25.86	43	15	SNP	1.000	T
KIAA2022	340533	genome.wustl.edu	37	X	73960102	73960102	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chrX:73960102C>G	ENST00000055682.6	-	3	4901	c.4290G>C	c.(4288-4290)aaG>aaC	p.K1430N		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1430					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TGTTACTATACTTTTTATCAA	0.438																																																	0													186.0	159.0	168.0					X																	73960102		2203	4300	6503	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.4290G>C	X.37:g.73960102C>G	ENSP00000055682:p.Lys1430Asn		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.K1430N	ENST00000055682.6	37	c.4290	CCDS35337.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.899|7.899	0.733889|0.733889	0.15574|0.15574	.|.	.|.	ENSG00000050030|ENSG00000050030	ENST00000373468;ENST00000055682|ENST00000424929	T;T|.	0.30714|.	1.52;1.52|.	5.36|5.36	3.55|3.55	0.40652|0.40652	.|.	0.175676|.	0.48767|.	D|.	0.000173|.	T|T	0.22282|0.22282	0.0537|0.0537	N|N	0.08118|0.08118	0|0	0.32533|0.32533	N|N	0.534686|0.534686	B|.	0.06786|.	0.001|.	B|.	0.08055|.	0.003|.	T|T	0.28332|0.28332	-1.0047|-1.0047	10|5	0.12766|.	T|.	0.61|.	-13.459|-13.459	7.5844|7.5844	0.27985|0.27985	0.0:0.4309:0.4578:0.1112|0.0:0.4309:0.4578:0.1112	.|.	1430|.	Q5QGS0|.	K2022_HUMAN|.	N|L	1430|32	ENSP00000362567:K1430N;ENSP00000055682:K1430N|.	ENSP00000055682:K1430N|.	K|V	-|-	3|1	2|0	KIAA2022|KIAA2022	73876827|73876827	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.991000|0.991000	0.79684|0.79684	2.721000|2.721000	0.47260|0.47260	1.034000|1.034000	0.39945|0.39945	0.544000|0.544000	0.68410|0.68410	AAG|GTA	KIAA2022	-	NULL	ENSG00000050030		0.438	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	-	0.00	31	0	C	NM_001008537		73960102	-1	tier1	-	no_errors	ENST00000055682	ensembl	human	known	74_37	missense	18.75	26	6	SNP	1.000	G
KIF21A	55605	genome.wustl.edu	37	12	39725518	39725518	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr12:39725518G>T	ENST00000361418.5	-	22	3142	c.3127C>A	c.(3127-3129)Cac>Aac	p.H1043N	KIF21A_ENST00000544797.2_Missense_Mutation_p.H1030N|KIF21A_ENST00000541463.2_Missense_Mutation_p.H1007N|KIF21A_ENST00000395670.3_Missense_Mutation_p.H1043N|KIF21A_ENST00000361961.3_Missense_Mutation_p.H1030N			Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	1043					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(41)|ovary(5)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	86		Lung NSC(34;0.179)|all_lung(34;0.213)				GACAGGAAGTGATCTAGCAGG	0.363																																																	0													189.0	168.0	175.0					12																	39725518		2203	4300	6503	SO:0001583	missense	0			AK000059	CCDS31773.1, CCDS53774.1, CCDS53775.1, CCDS53776.1	12q12	2013-01-10						"""Kinesins"", ""WD repeat domain containing"""	19349	protein-coding gene	gene with protein product		608283	"""fibrosis of the extraocular muscles, congenital, 1"""	FEOM1		10225949	Standard	NM_017641		Approved	FLJ20052	uc001rly.3	Q7Z4S6	OTTHUMG00000169335	ENST00000361418.5:c.3127C>A	12.37:g.39725518G>T	ENSP00000354878:p.His1043Asn		A8MX28|B0I1R9|B9EGE4|F5H0C3|F5H219|Q2UVF1|Q6UKL9|Q7Z668|Q86WZ5|Q8IVZ8|Q9C0F5|Q9NXU4|Q9Y590	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_P-loop_NTPase,superfamily_WD40_repeat_dom,superfamily_Prefoldin,superfamily_ARM-type_fold,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.H1043N	ENST00000361418.5	37	c.3127	CCDS53776.1	12	.	.	.	.	.	.	.	.	.	.	G	17.80	3.478933	0.63849	.	.	ENSG00000139116	ENST00000361961;ENST00000395670;ENST00000341813;ENST00000545778;ENST00000551264;ENST00000544797;ENST00000361418;ENST00000541463;ENST00000551066	T;T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	6.07	6.07	0.98685	Prefoldin (1);	0.000000	0.56097	D	0.000030	T	0.81206	0.4774	L	0.37630	1.12	0.80722	D	1	D;D;B;D;D;D	0.76494	0.996;0.996;0.376;0.996;0.999;0.999	D;D;B;D;D;D	0.87578	0.986;0.986;0.145;0.986;0.996;0.998	T	0.74057	-0.3787	10	0.17832	T	0.49	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	1030;1007;1043;1030;1043;97	F5H219;F5H0C3;Q7Z4S6;Q7Z4S6-2;Q7Z4S6-3;F5H0V8	.;.;KI21A_HUMAN;.;.;.	N	1030;1043;1043;97;91;1030;1043;1007;64	ENSP00000354851:H1030N;ENSP00000379029:H1043N;ENSP00000448792:H91N;ENSP00000445606:H1030N;ENSP00000354878:H1043N;ENSP00000438075:H1007N;ENSP00000447070:H64N	ENSP00000344501:H1043N	H	-	1	0	KIF21A	38011785	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.738000	0.84966	2.885000	0.99019	0.655000	0.94253	CAC	KIF21A	-	superfamily_Prefoldin	ENSG00000139116		0.363	KIF21A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF21A	HGNC	protein_coding	OTTHUMT00000403581.1	-	0.00	49	0	G	NM_017641		39725518	-1	tier1	-	no_errors	ENST00000395670	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	T
KRR1	11103	genome.wustl.edu	37	12	75893716	75893716	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr12:75893716T>A	ENST00000229214.4	-	10	1042	c.1019A>T	c.(1018-1020)aAa>aTa	p.K340I	KRR1_ENST00000438169.2_Missense_Mutation_p.K283I|GLIPR1_ENST00000266659.3_3'UTR	NM_007043.6	NP_008974.5	Q13601	KRR1_HUMAN	KRR1, small subunit (SSU) processome component, homolog (yeast)	340	Lys-rich.				rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(1)|pancreas(1)|urinary_tract(1)	11						CACATCAATTTTAGTTTCAGT	0.323																																																	0													90.0	83.0	85.0					12																	75893716		2203	4300	6503	SO:0001583	missense	0			U55766	CCDS9012.1	12q	2011-03-15	2006-05-18	2006-05-18	ENSG00000111615	ENSG00000111615			5176	protein-coding gene	gene with protein product		612817	"""HIV-1 rev binding protein 2"", ""HIV-1 Rev binding protein 2"""	HRB2		7505766, 11027267, 11359931, 8675026	Standard	NM_007043		Approved	RIP-1	uc001sxt.3	Q13601	OTTHUMG00000169759	ENST00000229214.4:c.1019A>T	12.37:g.75893716T>A	ENSP00000229214:p.Lys340Ile		A0FIK6|A0JLP0|B2R989|E7EUQ0|Q8NEA8|Q8TC37|Q96AT5	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom	p.K340I	ENST00000229214.4	37	c.1019	CCDS9012.1	12	.	.	.	.	.	.	.	.	.	.	T	21.5	4.152900	0.78001	.	.	ENSG00000111615	ENST00000229214;ENST00000438169	T;T	0.51325	0.78;0.71	5.64	4.5	0.54988	.	0.090622	0.85682	D	0.000000	T	0.51058	0.1652	N	0.19112	0.55	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.972	T	0.52873	-0.8517	10	0.56958	D	0.05	3.3743	10.4333	0.44419	0.0:0.0771:0.0:0.9229	.	283;340	E7EUQ0;Q13601	.;KRR1_HUMAN	I	340;283	ENSP00000229214:K340I;ENSP00000411740:K283I	ENSP00000229214:K340I	K	-	2	0	KRR1	74179983	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.565000	0.60836	0.982000	0.38575	0.459000	0.35465	AAA	KRR1	-	NULL	ENSG00000111615		0.323	KRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRR1	HGNC	protein_coding	OTTHUMT00000405727.1	-	0.00	50	0	T	NM_007043		75893716	-1	tier1	-	no_errors	ENST00000229214	ensembl	human	known	74_37	missense	32.35	23	11	SNP	1.000	A
KRTAP6-1	337966	genome.wustl.edu	37	21	31986100	31986100	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr21:31986100A>G	ENST00000329122.2	-	1	149	c.124T>C	c.(124-126)Ttc>Ctc	p.F42L	KRTAP20-1_ENST00000334664.2_5'Flank	NM_181602.1	NP_853633.1	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	42						cytosol (GO:0005829)|intermediate filament (GO:0005882)				breast(2)|endometrium(1)|lung(7)	10						AGTCTGCGGAAGCCACAGCCA	0.597																																																	0													127.0	131.0	129.0					21																	31986100		2203	4300	6503	SO:0001583	missense	0			AP001708	CCDS13602.1	21q22.1	2006-03-13			ENSG00000184724	ENSG00000184724		"""Keratin associated proteins"""	18931	protein-coding gene	gene with protein product						12359730	Standard	NM_181602		Approved	KAP6.1, C21orf103	uc002yop.3	Q3LI64	OTTHUMG00000057788	ENST00000329122.2:c.124T>C	21.37:g.31986100A>G	ENSP00000332690:p.Phe42Leu			Missense_Mutation	SNP	NULL	p.F42L	ENST00000329122.2	37	c.124	CCDS13602.1	21	.	.	.	.	.	.	.	.	.	.	A	10.78	1.448173	0.26074	.	.	ENSG00000184724	ENST00000329122;ENST00000399871	T	0.19250	2.16	4.53	2.01	0.26516	.	.	.	.	.	T	0.17365	0.0417	.	.	.	0.18873	N	0.999985	B	0.18166	0.026	B	0.21708	0.036	T	0.25467	-1.0131	8	0.87932	D	0	.	8.2183	0.31526	0.6826:0.0:0.0:0.3174	.	42	Q3LI64	KRA61_HUMAN	L	42;28	ENSP00000332690:F42L	ENSP00000332690:F42L	F	-	1	0	KRTAP6-1	30907971	0.552000	0.26505	0.028000	0.17463	0.787000	0.44495	0.811000	0.27198	0.304000	0.22809	0.433000	0.28618	TTC	KRTAP6-1	-	NULL	ENSG00000184724		0.597	KRTAP6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP6-1	HGNC	protein_coding	OTTHUMT00000128240.2	-	0.00	125	0	A	NM_181602		31986100	-1	tier1	-	no_errors	ENST00000329122	ensembl	human	known	74_37	missense	42.45	61	45	SNP	0.474	G
LAMA1	284217	genome.wustl.edu	37	18	7050932	7050932	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr18:7050932A>G	ENST00000389658.3	-	4	442	c.349T>C	c.(349-351)Ttt>Ctt	p.F117L		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	117	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				GCAACTTGAAAGACCTGAAAC	0.448																																																	0													52.0	46.0	48.0					18																	7050932		2203	4300	6503	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.349T>C	18.37:g.7050932A>G	ENSP00000374309:p.Phe117Leu			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.F117L	ENST00000389658.3	37	c.349	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	A	29.6	5.018577	0.93404	.	.	ENSG00000101680	ENST00000389658	D	0.81996	-1.56	5.96	5.96	0.96718	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.92024	0.7473	M	0.86178	2.8	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	D	0.93101	0.6508	10	0.87932	D	0	.	16.4484	0.83959	1.0:0.0:0.0:0.0	.	117	P25391	LAMA1_HUMAN	L	117	ENSP00000374309:F117L	ENSP00000374309:F117L	F	-	1	0	LAMA1	7040932	1.000000	0.71417	0.994000	0.49952	0.839000	0.47603	9.100000	0.94213	2.285000	0.76669	0.533000	0.62120	TTT	LAMA1	-	pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,pfscan_Laminin_N	ENSG00000101680		0.448	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	32	0	A	NM_005559		7050932	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	50.00	17	17	SNP	1.000	G
LAMA5	3911	genome.wustl.edu	37	20	60885984	60885984	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr20:60885984G>A	ENST00000252999.3	-	74	10321	c.10255C>T	c.(10255-10257)Cgc>Tgc	p.R3419C	LAMA5_ENST00000492698.1_5'Flank	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3419	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GGCCGGGAGCGCTGGCGGCTC	0.701																																																	0													12.0	16.0	14.0					20																	60885984		2097	4175	6272	SO:0001583	missense	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.10255C>T	20.37:g.60885984G>A	ENSP00000252999:p.Arg3419Cys		Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.R3419C	ENST00000252999.3	37	c.10255	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	g	14.43	2.533407	0.45073	.	.	ENSG00000130702	ENST00000252999	T	0.79141	-1.24	4.79	3.76	0.43208	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.417945	0.25467	N	0.030469	T	0.80454	0.4626	M	0.67397	2.05	0.09310	N	0.999996	D	0.76494	0.999	P	0.54965	0.765	T	0.72239	-0.4351	10	0.87932	D	0	.	7.2037	0.25895	0.0:0.1573:0.5478:0.295	.	3419	O15230	LAMA5_HUMAN	C	3419	ENSP00000252999:R3419C	ENSP00000252999:R3419C	R	-	1	0	LAMA5	60319379	0.000000	0.05858	0.929000	0.37066	0.040000	0.13550	0.541000	0.23207	2.216000	0.71823	0.556000	0.70494	CGC	LAMA5	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000130702		0.701	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	-	0.00	15	0	G	NM_005560		60885984	-1	tier1	-	no_errors	ENST00000252999	ensembl	human	known	74_37	missense	73.91	6	17	SNP	0.048	A
LINC00242	401288	genome.wustl.edu	37	6	170190176	170190176	+	lincRNA	SNP	A	A	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:170190176A>T	ENST00000437615.1	-	0	1127				LINC00574_ENST00000420557.2_lincRNA	NR_026781.1		Q5T6M2	CF122_HUMAN	long intergenic non-protein coding RNA 242																		CCGGTGCTTGACTGGAGGAGG	0.582											OREG0017803	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													98.0	88.0	91.0					6																	170190176		692	1591	2283			0			AK056013		6q28	2012-10-12	2011-08-11	2011-08-11	ENSG00000229214	ENSG00000229214		"""Long non-coding RNAs"""	21249	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 122"", ""non-protein coding RNA 242"""	C6orf122, NCRNA00242			Standard	NR_026781		Approved	FLJ31451, dJ266L20.5	uc003qxj.1	Q5T6M2	OTTHUMG00000016064		6.37:g.170190176A>T		1883	Q0VD89|Q96N37	RNA	SNP	-	NULL	ENST00000437615.1	37	NULL		6																																																																																			LINC00242	-	-	ENSG00000229214		0.582	LINC00242-001	KNOWN	basic	lincRNA	LINC00242	HGNC	lincRNA	OTTHUMT00000043231.2		0.00	55	0	A	NR_026781		170190176	-1			no_errors	ENST00000437615	ensembl	human	known	74_37	rna	15.71	59	11	SNP	0.000	T
LINC00477	144360	genome.wustl.edu	37	12	24736553	24736553	+	lincRNA	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr12:24736553T>C	ENST00000483544.1	-	0	549					NR_029451.2		Q96M19	CL067_HUMAN	long intergenic non-protein coding RNA 477							integral component of membrane (GO:0016021)											CTTAAAAAACTTAAGAAGGAA	0.547																																																	0													40.0	48.0	45.0					12																	24736553		2203	4300	6503			0			AK057456		12p12.1	2012-10-12	2011-08-31	2011-08-31	ENSG00000197503	ENSG00000197503		"""Long non-coding RNAs"""	26557	non-coding RNA	RNA, long non-coding	"""family with sequence similarity 191, member B"""		"""chromosome 12 open reading frame 67"""	C12orf67		14702039	Standard	NR_029451		Approved	FLJ32894, FAM191B	uc001rgb.1	Q96M19	OTTHUMG00000159485		12.37:g.24736553T>C				RNA	SNP	-	NULL	ENST00000483544.1	37	NULL		12																																																																																			LINC00477	-	-	ENSG00000197503		0.547	LINC00477-001	KNOWN	basic	lincRNA	LINC00477	HGNC	lincRNA	OTTHUMT00000355725.1	-	0.00	14	0	T	NM_144667		24736553	-1	tier1	-	no_errors	ENST00000483544	ensembl	human	known	74_37	rna	27.78	25	10	SNP	0.389	C
LOC100507002	100507002	genome.wustl.edu	37	17	63096999	63096999	+	lincRNA	SNP	C	C	A	rs540665712		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr17:63096999C>A	ENST00000582940.1	+	0	70																											GCCTCCCCGTCGACCACCCAG	0.687																																																	0																																												0																															17.37:g.63096999C>A				RNA	SNP	-	NULL	ENST00000582940.1	37	NULL		17																																																																																			RP11-160O5.1	-	-	ENSG00000263470		0.687	RP11-160O5.1-001	KNOWN	basic	lincRNA	LOC100507002	Clone_based_vega_gene	lincRNA	OTTHUMT00000445723.1	-	0.00	16	0	C			63096999	+1	tier1	-	no_errors	ENST00000582940	ensembl	human	known	74_37	rna	62.07	11	18	SNP	0.000	A
LOC101929762	101929762	genome.wustl.edu	37	4	120116877	120116877	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:120116877delA	ENST00000326780.3	-	2	290	c.236delT	c.(235-237)ttcfs	p.F79fs	RP11-455G16.1_ENST00000515843.1_Intron																							AAGTGGTATGAAAAAAAAATG	0.368																																																	0																																										SO:0001589	frameshift_variant	0																														ENST00000326780.3:c.236delT	4.37:g.120116877delA	ENSP00000317768:p.Phe79fs			Frame_Shift_Del	DEL	pfam_Ribosomal-S32_mit	p.F79fs	ENST00000326780.3	37	c.236		4																																																																																			RP11-455G16.1	-	NULL	ENSG00000178636		0.368	RP11-455G16.1-201	KNOWN	basic|appris_principal	protein_coding	LOC101929762	Clone_based_vega_gene	protein_coding			0.00	37	0	A			120116877	-1	tier1		no_errors	ENST00000326780	ensembl	human	known	74_37	frame_shift_del	8.82	31	3	DEL	0.022	-
LOXL2	4017	genome.wustl.edu	37	8	23186066	23186066	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:23186066G>A	ENST00000389131.3	-	6	1348	c.979C>T	c.(979-981)Cga>Tga	p.R327*	LOXL2_ENST00000518472.1_5'Flank	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	327	SRCR 3. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		CCTCTCAGTCGCACCAGGGGT	0.642																																																	0													64.0	58.0	60.0					8																	23186066		2203	4300	6503	SO:0001587	stop_gained	0			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.979C>T	8.37:g.23186066G>A	ENSP00000373783:p.Arg327*		B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Nonsense_Mutation	SNP	pfam_Lysyl_oxidase,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_Lysyl_oxidase,prints_SRCR	p.R327*	ENST00000389131.3	37	c.979	CCDS34864.1	8	.	.	.	.	.	.	.	.	.	.	G	43	10.050652	0.99325	.	.	ENSG00000134013	ENST00000389131	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.8224	0.63331	0.0:0.0:0.8463:0.1537	.	.	.	.	X	327	.	ENSP00000373783:R327X	R	-	1	2	LOXL2	23242011	1.000000	0.71417	0.998000	0.56505	0.874000	0.50279	5.138000	0.64795	2.593000	0.87608	0.455000	0.32223	CGA	LOXL2	-	superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_SRCR	ENSG00000134013		0.642	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL2	HGNC	protein_coding	OTTHUMT00000375603.1	-	0.00	31	0	G			23186066	-1	tier1	-	no_errors	ENST00000389131	ensembl	human	known	74_37	nonsense	22.41	45	13	SNP	1.000	A
LPAR1	1902	genome.wustl.edu	37	9	113637739	113637739	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr9:113637739A>C	ENST00000374431.3	-	5	1440	c.1057T>G	c.(1057-1059)Ttg>Gtg	p.L353V	LPAR1_ENST00000358883.4_Missense_Mutation_p.L353V|LPAR1_ENST00000374430.2_Missense_Mutation_p.L353V|LPAR1_ENST00000538760.1_Missense_Mutation_p.L354V|LPAR1_ENST00000541779.1_Missense_Mutation_p.L354V	NM_057159.2	NP_476500.1	Q92633	LPAR1_HUMAN	lysophosphatidic acid receptor 1	353					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|bleb assembly (GO:0032060)|cellular response to oxygen levels (GO:0071453)|G-protein coupled receptor signaling pathway (GO:0007186)|myelination (GO:0042552)|negative regulation of neuron projection development (GO:0010977)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle cell chemotaxis (GO:0071673)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lysophosphatidic acid receptor activity (GO:0070915)|phospholipid binding (GO:0005543)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(1)|ovary(2)|prostate(6)|skin(1)	21						ACTCCAGCCAAGATGGTGTGG	0.582																																					NSCLC(115;661 2323 9836 34256)												0													104.0	96.0	98.0					9																	113637739		2203	4300	6503	SO:0001583	missense	0			U80811	CCDS6777.1	9q	2012-08-08	2008-04-11	2008-04-11	ENSG00000198121	ENSG00000198121		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	3166	protein-coding gene	gene with protein product		602282	"""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2"""	EDG2		8922387, 9070858	Standard	NM_001401		Approved	edg-2, rec.1.3, vzg-1, Gpcr26, Mrec1.3, LPA1, GPR26	uc004bfc.3	Q92633	OTTHUMG00000020486	ENST00000374431.3:c.1057T>G	9.37:g.113637739A>C	ENSP00000363553:p.Leu353Val		B4DK36|O00656|O00722|P78351	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_LPA_rcpt_EDG2,prints_LPA_rcpt,prints_GPCR_Rhodpsn	p.L354V	ENST00000374431.3	37	c.1060	CCDS6777.1	9	.	.	.	.	.	.	.	.	.	.	A	13.90	2.373866	0.42105	.	.	ENSG00000198121	ENST00000374431;ENST00000541779;ENST00000374430;ENST00000358883;ENST00000449490;ENST00000538760	T;T;T;T;T	0.78481	-1.18;-1.07;-1.18;-1.18;-1.18	6.06	1.13	0.20643	.	0.260016	0.31624	N	0.007340	T	0.53850	0.1822	N	0.14661	0.345	0.52099	D	0.999945	B;B;P	0.39216	0.435;0.435;0.664	B;B;B	0.30029	0.11;0.071;0.102	T	0.43909	-0.9362	10	0.33141	T	0.24	.	9.9448	0.41602	0.5143:0.0:0.4857:0.0	.	354;354;353	B4DQ18;B4DK36;Q92633	.;.;LPAR1_HUMAN	V	353;354;353;353;335;354	ENSP00000363553:L353V;ENSP00000445697:L354V;ENSP00000363552:L353V;ENSP00000351755:L353V;ENSP00000440201:L354V	ENSP00000351755:L353V	L	-	1	2	LPAR1	112677560	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	0.970000	0.29383	-0.033000	0.13736	0.533000	0.62120	TTG	LPAR1	-	prints_LPA_rcpt_EDG2	ENSG00000198121		0.582	LPAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR1	HGNC	protein_coding	OTTHUMT00000053631.1	-	0.00	66	0	A	NM_057159		113637739	-1	tier1	-	no_errors	ENST00000538760	ensembl	human	known	74_37	missense	30.43	48	21	SNP	0.997	C
LRP1B	53353	genome.wustl.edu	37	2	141459345	141459345	+	Silent	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:141459345G>A	ENST00000389484.3	-	40	7343	c.6372C>T	c.(6370-6372)acC>acT	p.T2124T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2124					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTCCAAGGCCGGTTCTCATGG	0.403										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													160.0	147.0	151.0					2																	141459345		2203	4300	6503	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6372C>T	2.37:g.141459345G>A			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.T2124	ENST00000389484.3	37	c.6372	CCDS2182.1	2																																																																																			LRP1B	-	NULL	ENSG00000168702		0.403	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	55	0	G	NM_018557		141459345	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	23.40	36	11	SNP	0.863	A
LRP4	4038	genome.wustl.edu	37	11	46911918	46911918	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:46911918C>T	ENST00000378623.1	-	14	2067	c.1825G>A	c.(1825-1827)Ggg>Agg	p.G609R		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	609					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		ATACGGCGCCCGGCATAGTCG	0.592											OREG0020948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													91.0	76.0	81.0					11																	46911918		2201	4299	6500	SO:0001583	missense	0			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.1825G>A	11.37:g.46911918C>T	ENSP00000367888:p.Gly609Arg	942	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.G609R	ENST00000378623.1	37	c.1825	CCDS31478.1	11	.	.	.	.	.	.	.	.	.	.	C	16.77	3.214828	0.58452	.	.	ENSG00000134569	ENST00000378623	D	0.94613	-3.47	5.63	5.63	0.86233	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	D	0.89972	0.6870	N	0.11673	0.155	0.58432	D	0.999998	D	0.53619	0.961	P	0.45946	0.498	D	0.88612	0.3157	10	0.22109	T	0.4	.	20.0529	0.97634	0.0:1.0:0.0:0.0	.	609	O75096	LRP4_HUMAN	R	609	ENSP00000367888:G609R	ENSP00000367888:G609R	G	-	1	0	LRP4	46868494	0.998000	0.40836	0.958000	0.39756	0.992000	0.81027	3.798000	0.55522	2.814000	0.96858	0.591000	0.81541	GGG	LRP4	-	superfamily_Growth_fac_rcpt_N_dom,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000134569		0.592	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	HGNC	protein_coding	OTTHUMT00000391133.1	-	0.00	35	0	C	NM_002334		46911918	-1	tier1	-	no_errors	ENST00000378623	ensembl	human	known	74_37	missense	28.30	38	15	SNP	0.994	T
LZTS1	11178	genome.wustl.edu	37	8	20107396	20107396	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:20107396T>C	ENST00000381569.1	-	4	1985	c.1628A>G	c.(1627-1629)cAg>cGg	p.Q543R	LZTS1_ENST00000522290.1_Missense_Mutation_p.Q484R|LZTS1_ENST00000265801.6_Missense_Mutation_p.Q543R			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	543					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		CAGCTGTTTCTGGTACTGAAT	0.642																																																	0													119.0	118.0	118.0					8																	20107396		2203	4300	6503	SO:0001583	missense	0			AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.1628A>G	8.37:g.20107396T>C	ENSP00000370981:p.Gln543Arg		D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Missense_Mutation	SNP	NULL	p.Q543R	ENST00000381569.1	37	c.1628	CCDS6015.1	8	.	.	.	.	.	.	.	.	.	.	t	14.68	2.607320	0.46527	.	.	ENSG00000061337	ENST00000381569;ENST00000265801;ENST00000522290;ENST00000360248	T;T;T	0.59772	0.24;0.24;0.24	5.17	4.01	0.46588	.	0.133515	0.52532	D	0.000074	T	0.72566	0.3476	M	0.86651	2.83	0.58432	D	0.999999	P;P	0.48294	0.888;0.908	P;P	0.55508	0.669;0.777	T	0.75274	-0.3375	10	0.66056	D	0.02	-41.2275	10.4873	0.44731	0.1455:0.0:0.0:0.8545	.	484;543	Q9Y250-4;Q9Y250	.;LZTS1_HUMAN	R	543;543;484;520	ENSP00000370981:Q543R;ENSP00000265801:Q543R;ENSP00000429263:Q484R	ENSP00000265801:Q543R	Q	-	2	0	LZTS1	20151676	1.000000	0.71417	1.000000	0.80357	0.332000	0.28634	6.225000	0.72271	0.817000	0.34445	-0.386000	0.06593	CAG	LZTS1	-	NULL	ENSG00000061337		0.642	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZTS1	HGNC	protein_coding	OTTHUMT00000214122.1	-	0.00	37	0	T	NM_021020		20107396	-1	tier1	-	no_errors	ENST00000265801	ensembl	human	known	74_37	missense	47.73	23	21	SNP	1.000	C
MATN1	4146	genome.wustl.edu	37	1	31191941	31191941	+	Intron	SNP	C	C	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:31191941C>G	ENST00000373765.4	-	3	477				MATN1_ENST00000477320.1_5'UTR|MATN1-AS1_ENST00000454613.1_RNA|MATN1-AS1_ENST00000414532.2_RNA|MATN1-AS1_ENST00000414763.1_RNA	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein						extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		GAGGACCCGGCTGGCCGAAGA	0.692																																																	0																																										SO:0001627	intron_variant	0			M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.442-137G>C	1.37:g.31191941C>G			B2R7E3|Q5TBB9	RNA	SNP	-	NULL	ENST00000373765.4	37	NULL	CCDS336.1	1																																																																																			MATN1-AS1	-	-	ENSG00000186056		0.692	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN1-AS1	HGNC	protein_coding	OTTHUMT00000010458.1	-	0.00	9	0	C	NM_002379		31191941	+1	tier1	-	no_errors	ENST00000414532	ensembl	human	known	74_37	rna	75.00	2	6	SNP	0.000	G
MED12L	116931	genome.wustl.edu	37	3	151095844	151095844	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:151095844C>T	ENST00000474524.1	+	29	4294	c.4256C>T	c.(4255-4257)gCc>gTc	p.A1419V	MED12L_ENST00000273432.4_Missense_Mutation_p.A1279V|P2RY12_ENST00000302632.3_Intron	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1419						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			CCCCTCATCGCCAGGTTGCCA	0.537																																																	0													93.0	90.0	91.0					3																	151095844		2203	4300	6503	SO:0001583	missense	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.4256C>T	3.37:g.151095844C>T	ENSP00000417235:p.Ala1419Val		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.A1419V	ENST00000474524.1	37	c.4256	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890597	0.91889	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.62639	0.01;0.01	5.28	5.28	0.74379	.	0.061586	0.64402	D	0.000004	T	0.78553	0.4301	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;0.988;0.99	D;P;P	0.75484	0.986;0.783;0.815	T	0.80730	-0.1252	10	0.87932	D	0	-17.6452	18.5258	0.90971	0.0:1.0:0.0:0.0	.	1279;1418;1419	F8WAE6;Q86YW9-4;Q86YW9	.;.;MD12L_HUMAN	V	1419;1279	ENSP00000417235:A1419V;ENSP00000273432:A1279V	ENSP00000273432:A1279V	A	+	2	0	MED12L	152578534	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.151000	0.77411	2.469000	0.83416	0.655000	0.94253	GCC	MED12L	-	NULL	ENSG00000144893		0.537	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	-	0.00	51	0	C	NM_053002		151095844	+1	tier1	-	no_errors	ENST00000474524	ensembl	human	known	74_37	missense	8.62	53	5	SNP	1.000	T
MLIP	90523	genome.wustl.edu	37	6	54095682	54095682	+	Silent	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:54095682T>G	ENST00000274897.5	+	11	1397	c.1284T>G	c.(1282-1284)tcT>tcG	p.S428S	MLIP_ENST00000358276.5_Intron|MLIP_ENST00000509997.1_Intron|MLIP_ENST00000502396.1_Silent_p.S963S|MLIP_ENST00000370876.2_Intron|MLIP_ENST00000370877.2_Intron	NM_138569.2	NP_612636.2	Q5VWP3	MLIP_HUMAN	muscular LMNA-interacting protein	428						nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|PML body (GO:0016605)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(16)|ovary(8)|skin(4)|stomach(1)|urinary_tract(1)	34						AGGAGAATTCTCACACCCTCC	0.478																																																	0													188.0	165.0	173.0					6																	54095682		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055530	CCDS4954.1, CCDS64448.1, CCDS64449.1	6p12.2-p12.1	2011-04-29	2011-04-29	2011-04-29	ENSG00000146147	ENSG00000146147			21355	protein-coding gene	gene with protein product	"""muscle-enriched A-type lamin interacting protein"""	614106	"""chromosome 6 open reading frame 142"""	C6orf142		21498514	Standard	NM_138569		Approved	MGC18257	uc011dxa.2	Q5VWP3	OTTHUMG00000014891	ENST00000274897.5:c.1284T>G	6.37:g.54095682T>G			B7Z2N0|D6RE05|Q96H08|Q96NF7	Silent	SNP	NULL	p.S428	ENST00000274897.5	37	c.1284	CCDS4954.1	6																																																																																			MLIP	-	NULL	ENSG00000146147		0.478	MLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLIP	HGNC	protein_coding	OTTHUMT00000040979.3	-	0.00	50	0	T	NM_138569		54095682	+1	tier1	-	no_errors	ENST00000274897	ensembl	human	known	74_37	silent	42.11	33	24	SNP	0.983	G
MMP10	4319	genome.wustl.edu	37	11	102642785	102642785	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:102642785G>T	ENST00000279441.4	-	9	1324	c.1288C>A	c.(1288-1290)Cca>Aca	p.P430T		NM_002425.2	NP_002416.1	P09238	MMP10_HUMAN	matrix metallopeptidase 10 (stromelysin 2)	430					collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(2)|lung(6)	22	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	Marimastat(DB00786)	TCAACTCCTGGAAAGTCATCA	0.393																																																	0													112.0	98.0	103.0					11																	102642785		2203	4299	6502	SO:0001583	missense	0			X07820	CCDS8321.1	11q22.3	2008-02-05	2005-08-08		ENSG00000166670	ENSG00000166670	3.4.24.22		7156	protein-coding gene	gene with protein product		185260	"""matrix metalloproteinase 10 (stromelysin 2)"""	STMY2			Standard	NM_002425		Approved		uc001phg.2	P09238	OTTHUMG00000168083	ENST00000279441.4:c.1288C>A	11.37:g.102642785G>T	ENSP00000279441:p.Pro430Thr		B2R9X9|Q53HH9	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.P430T	ENST00000279441.4	37	c.1288	CCDS8321.1	11	.	.	.	.	.	.	.	.	.	.	G	14.46	2.540941	0.45280	.	.	ENSG00000166670	ENST00000279441	T	0.03635	3.86	4.1	3.18	0.36537	Hemopexin/matrixin (2);	0.320648	0.22649	N	0.057347	T	0.16896	0.0406	M	0.77712	2.385	0.53688	D	0.999979	D	0.76494	0.999	D	0.83275	0.996	T	0.00581	-1.1660	10	0.66056	D	0.02	.	12.5028	0.55966	0.0826:0.0:0.9174:0.0	.	430	P09238	MMP10_HUMAN	T	430	ENSP00000279441:P430T	ENSP00000279441:P430T	P	-	1	0	MMP10	102147995	1.000000	0.71417	0.977000	0.42913	0.316000	0.28119	3.922000	0.56462	1.034000	0.39945	0.650000	0.86243	CCA	MMP10	-	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat	ENSG00000166670		0.393	MMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP10	HGNC	protein_coding	OTTHUMT00000398014.1	-	0.00	123	0	G			102642785	-1	tier1	-	no_errors	ENST00000279441	ensembl	human	known	74_37	missense	29.00	71	29	SNP	1.000	T
MMP16	4325	genome.wustl.edu	37	8	89068446	89068446	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:89068446A>T	ENST00000286614.6	-	8	1564	c.1283T>A	c.(1282-1284)aTa>aAa	p.I428K		NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	428					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	TCCAAGGGTTATCAAGTCATG	0.398																																																	0													103.0	98.0	100.0					8																	89068446		2203	4300	6503	SO:0001583	missense	0			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1283T>A	8.37:g.89068446A>T	ENSP00000286614:p.Ile428Lys		B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.I428K	ENST00000286614.6	37	c.1283	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	A	8.137	0.784402	0.16189	.	.	ENSG00000156103	ENST00000286614	T	0.02236	4.38	5.81	5.81	0.92471	Hemopexin/matrixin (2);	0.300736	0.40385	N	0.001117	T	0.01092	0.0036	N	0.00677	-1.265	0.58432	D	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.64871	-0.6305	10	0.21540	T	0.41	.	16.1773	0.81862	1.0:0.0:0.0:0.0	.	428	P51512	MMP16_HUMAN	K	428	ENSP00000286614:I428K	ENSP00000286614:I428K	I	-	2	0	MMP16	89137562	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.444000	0.80532	2.217000	0.71921	0.482000	0.46254	ATA	MMP16	-	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat	ENSG00000156103		0.398	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	-	0.00	69	0	A	NM_005941		89068446	-1	tier1	-	no_errors	ENST00000286614	ensembl	human	known	74_37	missense	24.71	64	21	SNP	0.999	T
MRGPRF	116535	genome.wustl.edu	37	11	68773591	68773591	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:68773591C>T	ENST00000309099.6	-	3	569	c.187G>A	c.(187-189)Ggg>Agg	p.G63R	MRGPRF_ENST00000441623.1_Missense_Mutation_p.G63R|RP11-554A11.5_ENST00000562506.1_RNA	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	63						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			AGGACCAGCCCGTTGCCCACC	0.607																																																	0													37.0	45.0	43.0					11																	68773591		2200	4294	6494	SO:0001583	missense	0			AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.187G>A	11.37:g.68773591C>T	ENSP00000309782:p.Gly63Arg		B3KV43|Q8NBK8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.G63R	ENST00000309099.6	37	c.187	CCDS8188.1	11	.	.	.	.	.	.	.	.	.	.	C	18.07	3.540717	0.65085	.	.	ENSG00000172935	ENST00000441623;ENST00000309099;ENST00000421543	T;T	0.12984	2.63;2.63	4.97	4.05	0.47172	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45606	D	0.000353	T	0.26846	0.0657	M	0.84683	2.71	0.32003	N	0.603157	P	0.52316	0.952	P	0.49226	0.603	T	0.45848	-0.9233	10	0.87932	D	0	-26.4265	9.7849	0.40670	0.0:0.9013:0.0:0.0987	.	63	Q96AM1	MRGRF_HUMAN	R	63	ENSP00000403660:G63R;ENSP00000309782:G63R	ENSP00000309782:G63R	G	-	1	0	MRGPRF	68530167	0.908000	0.30866	1.000000	0.80357	0.998000	0.95712	0.668000	0.25127	2.309000	0.77851	0.561000	0.74099	GGG	MRGPRF	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172935		0.607	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRF	HGNC	protein_coding	OTTHUMT00000396875.1	-	0.00	46	0	C	NM_145015		68773591	-1	tier1	-	no_errors	ENST00000309099	ensembl	human	known	74_37	missense	45.83	26	22	SNP	1.000	T
MT-ATP8	4509	genome.wustl.edu	37	M	8485	8485	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chrM:8485G>C	ENST00000361851.1	+	1	120	c.120G>C	c.(118-120)aaG>aaC	p.K40N	MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-ND4_ENST00000361381.2_5'Flank|MT-CO3_ENST00000362079.2_5'Flank|MT-TA_ENST00000387392.1_RNA			P03928	ATP8_HUMAN	mitochondrially encoded ATP synthase 8	40					ATP catabolic process (GO:0006200)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)										CCCTCACCAAAGCCCATAAAA	0.423																																																	0																																										SO:0001583	missense	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000228253	ENSG00000228253		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	7415	protein-coding gene	gene with protein product		516070	"""ATP synthase 8"""	MTATP8			Standard			Approved	ATP8, A6L		P03928		ENST00000361851.1:c.120G>C	M.37:g.8485G>C	ENSP00000355265:p.Lys40Asn		Q34771	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_su8_mt_metazoan	p.K40N	ENST00000361851.1	37	c.120		MT																																																																																			MT-ATP8	-	pfam_ATPase_F0-cplx_su8_mt_metazoan	ENSG00000228253		0.423	MT-ATP8-201	KNOWN	basic|appris_principal	protein_coding	MT-ATP8	HGNC	protein_coding		-	0.00	14	0	G	YP_003024030		8485	+1	tier1	-	no_errors	ENST00000361851	ensembl	human	known	74_37	missense	100.00	0	10	SNP	NULL	C
MUC16	94025	genome.wustl.edu	37	19	9070131	9070131	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:9070131A>C	ENST00000397910.4	-	3	17518	c.17315T>G	c.(17314-17316)aTt>aGt	p.I5772S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5774	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTCAGTCTGAATTCTAGTCTC	0.463																																																	0													162.0	151.0	155.0					19																	9070131		1985	4177	6162	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.17315T>G	19.37:g.9070131A>C	ENSP00000381008:p.Ile5772Ser		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.I5772S	ENST00000397910.4	37	c.17315	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	2.194	-0.384604	0.04966	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.55	0.504	0.16946	.	.	.	.	.	T	0.02767	0.0083	L	0.43152	1.355	.	.	.	B	0.22983	0.078	B	0.15052	0.012	T	0.34004	-0.9846	8	0.87932	D	0	.	3.3096	0.07013	0.7616:0.0:0.2384:0.0	.	5772	B5ME49	.	S	5772	ENSP00000381008:I5772S	ENSP00000381008:I5772S	I	-	2	0	MUC16	8931131	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-2.328000	0.01112	0.112000	0.17975	0.241000	0.17934	ATT	MUC16	-	NULL	ENSG00000181143		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	98	0	A	NM_024690		9070131	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	36.00	48	27	SNP	0.000	C
MUC19	283463	genome.wustl.edu	37	12	40821237	40821237	+	Silent	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr12:40821237T>C	ENST00000454784.4	+	12	1192	c.459T>C	c.(457-459)acT>acC	p.T153T	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	153					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						ACCCTGCAACTTGTTCTAATG	0.408																																																	0																																										SO:0001819	synonymous_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.459T>C	12.37:g.40821237T>C			Q8NA85	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich	p.T153	ENST00000454784.4	37	c.459		12																																																																																			MUC19	-	pfam_TIL_dom,superfamily_TIL_dom	ENSG00000205592		0.408	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	-	0.00	87	0	T	XM_003403524		40821237	+1	tier1	-	no_errors	ENST00000454784	ensembl	human	novel	74_37	silent	68.52	17	37	SNP	0.993	C
NAA15	80155	genome.wustl.edu	37	4	140297560	140297560	+	Silent	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:140297560G>A	ENST00000296543.5	+	16	2312	c.1989G>A	c.(1987-1989)ccG>ccA	p.P663P	NAA15_ENST00000398947.1_Silent_p.P663P	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	663	Interaction with HYPK.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						TTTTAACACCGTTGAAGAACT	0.338																																																	0													107.0	100.0	102.0					4																	140297560		1816	4075	5891	SO:0001819	synonymous_variant	0			AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.1989G>A	4.37:g.140297560G>A			D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Silent	SNP	pfam_NatA_aux_su,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P663	ENST00000296543.5	37	c.1989	CCDS43270.1	4																																																																																			NAA15	-	pfam_NatA_aux_su,pirsf_NatA_aux_su	ENSG00000164134		0.338	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAA15	HGNC	protein_coding	OTTHUMT00000267839.2	-	0.00	36	0	G	NM_057175		140297560	+1	tier1	-	no_errors	ENST00000296543	ensembl	human	known	74_37	silent	36.67	19	11	SNP	0.130	A
NAV1	89796	genome.wustl.edu	37	1	201618309	201618309	+	Silent	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:201618309G>T	ENST00000367296.4	+	1	933	c.513G>T	c.(511-513)ccG>ccT	p.P171P	NAV1_ENST00000367297.4_Silent_p.P171P|NAV1_ENST00000367300.3_Silent_p.P171P|NAV1_ENST00000295624.6_Silent_p.P171P|NAV1_ENST00000367302.1_Silent_p.P184P	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	171					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						TGGGAAAGCCGAGCCGGATCC	0.687																																																	0													17.0	22.0	20.0					1																	201618309		2193	4297	6490	SO:0001819	synonymous_variant	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.513G>T	1.37:g.201618309G>T			A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Silent	SNP	superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P171	ENST00000367296.4	37	c.513	CCDS1414.2	1																																																																																			NAV1	-	NULL	ENSG00000134369		0.687	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAV1	HGNC	protein_coding	OTTHUMT00000087013.1	-	0.00	25	0	G	NM_020443		201618309	+1	tier1	-	no_errors	ENST00000367296	ensembl	human	known	74_37	silent	48.00	26	24	SNP	0.962	T
NAV3	89795	genome.wustl.edu	37	12	78444720	78444720	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr12:78444720G>T	ENST00000397909.2	+	11	2482	c.2309G>T	c.(2308-2310)cGa>cTa	p.R770L	NAV3_ENST00000536525.2_Missense_Mutation_p.R770L|NAV3_ENST00000266692.7_Missense_Mutation_p.R770L|NAV3_ENST00000228327.6_Missense_Mutation_p.R770L|RP11-136F16.1_ENST00000549103.1_RNA			Q8IVL0	NAV3_HUMAN	neuron navigator 3	770						membrane (GO:0016020)|nuclear envelope (GO:0005635)		p.R770Q(2)		NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GGTACCAGTCGATTCATCCAC	0.592										HNSCC(70;0.22)																																							2	Substitution - Missense(2)	prostate(1)|pancreas(1)											70.0	71.0	71.0					12																	78444720		2074	4207	6281	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.2309G>T	12.37:g.78444720G>T	ENSP00000381007:p.Arg770Leu		Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,superfamily_P-loop_NTPase,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.R770L	ENST00000397909.2	37	c.2309		12	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285764	0.80803	.	.	ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T	0.32988	1.55;1.55;1.55;1.43	5.79	5.79	0.91817	.	0.000000	0.34411	U	0.003996	T	0.54727	0.1876	L	0.58101	1.795	0.80722	D	1	P;P;D	0.89917	0.956;0.713;1.0	P;B;D	0.87578	0.563;0.163;0.998	T	0.45600	-0.9250	10	0.42905	T	0.14	-12.0344	20.031	0.97536	0.0:0.0:1.0:0.0	.	770;770;770	E7EUC6;Q8IVL0;Q8IVL0-2	.;NAV3_HUMAN;.	L	770	ENSP00000446132:R770L;ENSP00000381007:R770L;ENSP00000228327:R770L;ENSP00000266692:R770L	ENSP00000228327:R770L	R	+	2	0	NAV3	76968851	1.000000	0.71417	0.162000	0.22713	0.370000	0.29829	9.345000	0.97053	2.735000	0.93741	0.655000	0.94253	CGA	NAV3	-	NULL	ENSG00000067798		0.592	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1		0.00	42	0	G	NM_001024383		78444720	+1			no_errors	ENST00000397909	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	T
NBEAL2	23218	genome.wustl.edu	37	3	47044771	47044771	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:47044771G>A	ENST00000450053.3	+	35	5871	c.5692G>A	c.(5692-5694)Gag>Aag	p.E1898K	NBEAL2_ENST00000383740.2_Missense_Mutation_p.E177K|NBEAL2_ENST00000292309.5_Missense_Mutation_p.E1714K	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1898					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CCAGCTCGGCGAGGACGAGCT	0.647																																																	0													28.0	34.0	32.0					3																	47044771		1964	4139	6103	SO:0001583	missense	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.5692G>A	3.37:g.47044771G>A	ENSP00000415034:p.Glu1898Lys		O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1898K	ENST00000450053.3	37	c.5692	CCDS46817.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.25|19.25	3.792186|3.792186	0.70452|0.70452	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000383740;ENST00000450053|ENST00000443829	T;T;T|.	0.59906|.	0.27;0.93;0.23|.	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	0.600314|.	0.17168|.	N|.	0.184382|.	T|T	0.68686|0.68686	0.3028|0.3028	L|L	0.54323|0.54323	1.7|1.7	0.48975|0.48975	D|D	0.999733|0.999733	D;P|.	0.89917|.	1.0;0.794|.	D;B|.	0.64506|.	0.926;0.143|.	T|T	0.66296|0.66296	-0.5959|-0.5959	10|5	0.38643|.	T|.	0.18|.	.|.	15.19|15.19	0.73035|0.73035	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1714;1898|.	Q6ZNJ1-2;Q6ZNJ1|.	.;NBEL2_HUMAN|.	K|Q	1714;177;1898|266	ENSP00000292309:E1714K;ENSP00000373246:E177K;ENSP00000415034:E1898K|.	ENSP00000292309:E1714K|.	E|R	+|+	1|2	0|0	NBEAL2|NBEAL2	47019775|47019775	1.000000|1.000000	0.71417|0.71417	0.241000|0.241000	0.24154|0.24154	0.005000|0.005000	0.04900|0.04900	7.899000|7.899000	0.87370|0.87370	2.610000|2.610000	0.88304|0.88304	0.655000|0.655000	0.94253|0.94253	GAG|CGA	NBEAL2	-	NULL	ENSG00000160796		0.647	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	-	0.00	34	0	G	XM_291064		47044771	+1	tier1	-	no_errors	ENST00000450053	ensembl	human	known	74_37	missense	38.24	21	13	SNP	0.996	A
NCAM2	4685	genome.wustl.edu	37	21	22664538	22664538	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr21:22664538G>A	ENST00000400546.1	+	5	845	c.596G>A	c.(595-597)cGt>cAt	p.R199H	NCAM2_ENST00000284894.7_Missense_Mutation_p.R57H|NCAM2_ENST00000535285.1_Missense_Mutation_p.R224H	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	199	Ig-like C2-type 2.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R199H(1)		breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		ATTGACTTCCGTGATATCATT	0.333																																																	1	Substitution - Missense(1)	endometrium(1)											158.0	157.0	158.0					21																	22664538		1837	4094	5931	SO:0001583	missense	0				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.596G>A	21.37:g.22664538G>A	ENSP00000383392:p.Arg199His		A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom,prints_Neural_cell_adh	p.R199H	ENST00000400546.1	37	c.596	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509330	0.85282	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.77750	1.66;-1.12;1.66	5.48	5.48	0.80851	.	0.112824	0.64402	D	0.000011	D	0.88138	0.6356	M	0.80422	2.495	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	P;P;D	0.65323	0.908;0.882;0.934	D	0.89136	0.3513	10	0.72032	D	0.01	-14.6449	18.2691	0.90062	0.0:0.0:1.0:0.0	.	224;57;199	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	H	199;57;224	ENSP00000383392:R199H;ENSP00000284894:R57H;ENSP00000441887:R224H	ENSP00000284894:R57H	R	+	2	0	NCAM2	21586409	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.509000	0.60448	2.733000	0.93635	0.655000	0.94253	CGT	NCAM2	-	smart_Ig_sub,prints_Neural_cell_adh	ENSG00000154654		0.333	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1	-	0.00	80	0	G	NM_004540		22664538	+1	tier1	-	no_errors	ENST00000400546	ensembl	human	known	74_37	missense	25.49	38	13	SNP	1.000	A
NDST4	64579	genome.wustl.edu	37	4	115997687	115997687	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:115997687T>C	ENST00000264363.2	-	2	1184	c.506A>G	c.(505-507)gAg>gGg	p.E169G		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	169	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		TAAGCTGTTCTCATTGGCTTT	0.363																																																	0													71.0	72.0	72.0					4																	115997687		2203	4300	6503	SO:0001583	missense	0			AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.506A>G	4.37:g.115997687T>C	ENSP00000264363:p.Glu169Gly		Q2KHM8	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.E169G	ENST00000264363.2	37	c.506	CCDS3706.1	4	.	.	.	.	.	.	.	.	.	.	T	20.7	4.041771	0.75732	.	.	ENSG00000138653	ENST00000264363	T	0.40756	1.02	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.68504	0.3008	M	0.90759	3.145	0.80722	D	1	D	0.56521	0.976	P	0.62298	0.9	T	0.76586	-0.2905	10	0.72032	D	0.01	.	15.1781	0.72931	0.0:0.0:0.0:1.0	.	169	Q9H3R1	NDST4_HUMAN	G	169	ENSP00000264363:E169G	ENSP00000264363:E169G	E	-	2	0	NDST4	116217136	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.988000	0.88194	1.974000	0.57490	0.482000	0.46254	GAG	NDST4	-	pfam_Heparan_SO4_deacetylase	ENSG00000138653		0.363	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST4	HGNC	protein_coding	OTTHUMT00000256427.1	-	0.00	51	0	T	NM_022569		115997687	-1	tier1	-	no_errors	ENST00000264363	ensembl	human	known	74_37	missense	53.66	19	22	SNP	1.000	C
NETO2	81831	genome.wustl.edu	37	16	47156609	47156609	+	Missense_Mutation	SNP	C	C	A	rs139362451	byFrequency	TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr16:47156609C>A	ENST00000562435.1	-	6	997	c.613G>T	c.(613-615)Gtt>Ttt	p.V205F	NETO2_ENST00000303155.5_Missense_Mutation_p.V198F|snoU13_ENST00000458876.1_RNA	NM_018092.4	NP_060562.3	Q8NC67	NETO2_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 2	205	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				regulation of kainate selective glutamate receptor activity (GO:2000312)	kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)				breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	29		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)				ATGCAATCAACGGCTTGGCCT	0.433										HNSCC(25;0.065)																																							0													170.0	137.0	148.0					16																	47156609		2203	4300	6503	SO:0001583	missense	0			AK001292	CCDS10727.1, CCDS58460.1	16q11.2	2008-08-04			ENSG00000171208	ENSG00000171208			14644	protein-coding gene	gene with protein product		607974				11943477	Standard	NM_018092		Approved	FLJ10430, NEOT2	uc002eer.2	Q8NC67	OTTHUMG00000133101	ENST00000562435.1:c.613G>T	16.37:g.47156609C>A	ENSP00000455169:p.Val205Phe		J3KNF1|Q7Z381|Q8ND51|Q96SP4|Q9NVY8	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt	p.V205F	ENST00000562435.1	37	c.613	CCDS10727.1	16	.	.	.	.	.	.	.	.	.	.	C	15.34	2.804413	0.50315	.	.	ENSG00000171208	ENST00000303155	.	.	.	5.64	4.69	0.59074	CUB (5);	0.142201	0.48286	D	0.000195	T	0.72859	0.3513	M	0.73598	2.24	0.49130	D	0.999751	P;P;P	0.43885	0.796;0.681;0.82	P;P;P	0.55345	0.774;0.493;0.574	T	0.75141	-0.3422	9	0.66056	D	0.02	.	10.2973	0.43631	0.0:0.7946:0.1346:0.0709	.	62;198;205	B7Z4I7;Q32NC3;Q8NC67	.;.;NETO2_HUMAN	F	205	.	ENSP00000306726:V205F	V	-	1	0	NETO2	45714110	0.656000	0.27385	0.865000	0.33974	0.134000	0.20937	1.205000	0.32308	1.391000	0.46566	-0.157000	0.13467	GTT	NETO2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000171208		0.433	NETO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NETO2	HGNC	protein_coding	OTTHUMT00000256766.2		0.00	24	0	C	NM_018092		47156609	-1			no_errors	ENST00000562435	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.970	A
NLGN1	22871	genome.wustl.edu	37	3	173996812	173996812	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:173996812G>T	ENST00000457714.1	+	6	1450	c.1021G>T	c.(1021-1023)Gaa>Taa	p.E341*	NLGN1_ENST00000466350.1_3'UTR|NLGN1_ENST00000545397.1_Nonsense_Mutation_p.E341*|NLGN1_ENST00000401917.3_Nonsense_Mutation_p.E381*|NLGN1_ENST00000361589.4_Nonsense_Mutation_p.E341*	NM_014932.2	NP_055747.1	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	358					alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|calcium-dependent cell-cell adhesion (GO:0016339)|cytoskeletal matrix organization at active zone (GO:0048789)|establishment of protein localization (GO:0045184)|heterophilic cell-cell adhesion (GO:0007157)|N-methyl-D-aspartate receptor clustering (GO:0097114)|nervous system development (GO:0007399)|neurexin clustering (GO:0097115)|neuron cell-cell adhesion (GO:0007158)|neuronal signal transduction (GO:0023041)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of ruffle assembly (GO:1900029)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of synaptic vesicle endocytosis (GO:1900244)|positive regulation of synaptic vesicle exocytosis (GO:2000302)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|protein homooligomerization (GO:0051260)|protein localization to synapse (GO:0035418)|protein targeting (GO:0006605)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuron differentiation (GO:0045664)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|synapse assembly (GO:0007416)|synaptic vesicle clustering (GO:0097091)|synaptic vesicle targeting (GO:0016080)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|filopodium tip (GO:0032433)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|PDZ domain binding (GO:0030165)|protein dimerization activity (GO:0046983)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(2)|lung(54)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	83	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			GCCTTACAAAGAACTTGTTGA	0.418																																																	0													207.0	186.0	193.0					3																	173996812		2203	4300	6503	SO:0001587	stop_gained	0			AB028993	CCDS3222.1	3q26.32	2008-07-18			ENSG00000169760	ENSG00000169760			14291	protein-coding gene	gene with protein product		600568				10767552, 10819331	Standard	NM_014932		Approved	KIAA1070	uc003fio.1	Q8N2Q7	OTTHUMG00000157005	ENST00000457714.1:c.1021G>T	3.37:g.173996812G>T	ENSP00000392500:p.Glu341*		Q9UPT2	Nonsense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.E381*	ENST00000457714.1	37	c.1141	CCDS3222.1	3	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187086	0.78789	.	.	ENSG00000169760	ENST00000457714;ENST00000361589;ENST00000545397;ENST00000401917	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.9765	0.97312	0.0:0.0:1.0:0.0	.	.	.	.	X	341;341;341;381	.	ENSP00000354541:E341X	E	+	1	0	NLGN1	175479506	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.733000	0.93635	0.467000	0.42956	GAA	NLGN1	-	pfam_CarbesteraseB	ENSG00000169760		0.418	NLGN1-001	KNOWN	basic|CCDS	protein_coding	NLGN1	HGNC	protein_coding	OTTHUMT00000347054.3	-	0.00	96	0	G	NM_014932		173996812	+1	tier1	-	no_errors	ENST00000401917	ensembl	human	known	74_37	nonsense	45.68	44	37	SNP	1.000	T
NOTCH2	4853	genome.wustl.edu	37	1	120464920	120464920	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:120464920G>A	ENST00000256646.2	-	28	5371	c.5152C>T	c.(5152-5154)Cgc>Tgc	p.R1718C	NOTCH2_ENST00000493703.1_5'Flank	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1718					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCATCTCGGCGAAGAGTGAAA	0.483			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																															Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													86.0	84.0	85.0					1																	120464920		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.5152C>T	1.37:g.120464920G>A	ENSP00000256646:p.Arg1718Cys		Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.R1718C	ENST00000256646.2	37	c.5152	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700762	0.88924	.	.	ENSG00000134250	ENST00000256646	D	0.82433	-1.61	5.65	5.65	0.86999	.	0.000000	0.38005	U	0.001850	T	0.81029	0.4738	M	0.72118	2.19	0.47094	D	0.999318	D	0.63880	0.993	B	0.44315	0.446	T	0.82041	-0.0654	10	0.45353	T	0.12	.	19.0765	0.93165	0.0:0.0:1.0:0.0	.	1718	Q04721	NOTC2_HUMAN	C	1718	ENSP00000256646:R1718C	ENSP00000256646:R1718C	R	-	1	0	NOTCH2	120266443	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.496000	0.60360	2.825000	0.97269	0.655000	0.94253	CGC	NOTCH2	-	pirsf_Notch	ENSG00000134250		0.483	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	-	0.00	36	0	G	NM_024408		120464920	-1	tier1	-	no_errors	ENST00000256646	ensembl	human	known	74_37	missense	17.50	33	7	SNP	0.999	A
NOX3	50508	genome.wustl.edu	37	6	155764536	155764536	+	Silent	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:155764536C>T	ENST00000159060.2	-	5	459	c.357G>A	c.(355-357)gcG>gcA	p.A119A		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	119	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TGAAGAAATGCGCCACGATGT	0.537																																																	0													87.0	77.0	80.0					6																	155764536		2203	4300	6503	SO:0001819	synonymous_variant	0			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.357G>A	6.37:g.155764536C>T			Q9HBJ9	Silent	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.A119	ENST00000159060.2	37	c.357	CCDS5250.1	6																																																																																			NOX3	-	pfam_Fe3_Rdtase_TM_dom,prints_Cyt_b245_heavy_chain	ENSG00000074771		0.537	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX3	HGNC	protein_coding	OTTHUMT00000042819.1	-	0.00	51	0	C			155764536	-1	tier1	-	no_errors	ENST00000159060	ensembl	human	known	74_37	silent	12.50	56	8	SNP	0.015	T
NRG1	3084	genome.wustl.edu	37	8	32505698	32505698	+	Intron	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:32505698A>G	ENST00000405005.3	+	5	502				NRG1_ENST00000341377.5_Intron|NRG1_ENST00000521670.1_Intron|NRG1_ENST00000287842.3_Intron|NRG1_ENST00000523079.1_Intron|NRG1_ENST00000520407.1_Intron|NRG1_ENST00000287845.5_Intron|NRG1_ENST00000520502.2_Silent_p.Q154Q|NRG1_ENST00000519301.1_Intron|NRG1_ENST00000338921.4_Intron|NRG1_ENST00000356819.4_Intron			Q02297	NRG1_HUMAN	neuregulin 1						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GTGAGGTTCAAGTTACAGTGC	0.493																																																	0													195.0	164.0	175.0					8																	32505698		2203	4300	6503	SO:0001627	intron_variant	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.502+31295A>G	8.37:g.32505698A>G			A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Silent	SNP	smart_EG-like_dom,pfscan_EG-like_dom	p.Q154	ENST00000405005.3	37	c.462	CCDS6085.1	8																																																																																			NRG1	-	NULL	ENSG00000157168		0.493	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	-	0.00	84	0	A			32505698	+1	tier1	-	no_errors	ENST00000520502	ensembl	human	known	74_37	silent	42.48	88	65	SNP	0.996	G
NRSN2	80023	genome.wustl.edu	37	20	330345	330345	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr20:330345G>A	ENST00000382291.3	+	3	298	c.58G>A	c.(58-60)Ggc>Agc	p.G20S	NRSN2_ENST00000492242.1_Intron|NRSN2_ENST00000382285.2_Missense_Mutation_p.G20S|NRSN2_ENST00000608736.1_Missense_Mutation_p.G20S|RP5-1103G7.4_ENST00000442637.1_RNA	NM_024958.2	NP_079234.1	Q9GZP1	NRSN2_HUMAN	neurensin 2	20						integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				endometrium(1)|large_intestine(2)|lung(4)|urinary_tract(1)	8		all_cancers(10;0.0834)				CGTGGAGGATGGCAAGTGGTA	0.652																																																	0													55.0	51.0	52.0					20																	330345		2203	4300	6503	SO:0001583	missense	0			AL136915	CCDS12996.1	20p13	2008-02-04	2006-07-04	2006-07-04	ENSG00000125841	ENSG00000125841			16229	protein-coding gene	gene with protein product		610666	"""chromosome 20 open reading frame 98"""	C20orf98		16527258	Standard	NM_024958		Approved	dJ1103G7.6	uc002wdi.4	Q9GZP1	OTTHUMG00000031628	ENST00000382291.3:c.58G>A	20.37:g.330345G>A	ENSP00000371728:p.Gly20Ser		A8K3B2|Q6FII5|Q9NUD3	Missense_Mutation	SNP	NULL	p.G20S	ENST00000382291.3	37	c.58	CCDS12996.1	20	.	.	.	.	.	.	.	.	.	.	G	13.08	2.130340	0.37630	.	.	ENSG00000125841	ENST00000382291;ENST00000382285	T;T	0.16073	2.37;2.37	4.31	3.35	0.38373	.	0.495294	0.18679	N	0.134205	T	0.13586	0.0329	L	0.43152	1.355	0.25646	N	0.98615	P	0.51351	0.944	B	0.41894	0.369	T	0.11494	-1.0585	10	0.30078	T	0.28	-19.2106	7.1266	0.25475	0.1258:0.0:0.8742:0.0	.	20	Q9GZP1	NRSN2_HUMAN	S	20	ENSP00000371728:G20S;ENSP00000371722:G20S	ENSP00000371722:G20S	G	+	1	0	NRSN2	278345	0.994000	0.37717	0.975000	0.42487	0.856000	0.48823	2.468000	0.45102	0.984000	0.38629	0.643000	0.83706	GGC	NRSN2	-	NULL	ENSG00000125841		0.652	NRSN2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	NRSN2	HGNC	protein_coding	OTTHUMT00000077446.1	-	0.00	27	0	G	NM_024958		330345	+1	tier1	-	no_errors	ENST00000382285	ensembl	human	known	74_37	missense	38.98	36	23	SNP	0.985	A
NSUN7	79730	genome.wustl.edu	37	4	40792670	40792670	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:40792670G>A	ENST00000381782.2	+	8	1583	c.1088G>A	c.(1087-1089)aGg>aAg	p.R363K	NSUN7_ENST00000316607.5_Missense_Mutation_p.R363K	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	363							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						AAGGATCACAGGTTACAGAAA	0.294																																																	0													73.0	79.0	77.0					4																	40792670		2203	4295	6498	SO:0001583	missense	0			BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.1088G>A	4.37:g.40792670G>A	ENSP00000371201:p.Arg363Lys		C9JI19|Q8N9K8|Q9H815	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p	p.R363K	ENST00000381782.2	37	c.1088	CCDS3461.2	4	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356460	0.82243	.	.	ENSG00000179299	ENST00000381782;ENST00000316607	T;T	0.40756	1.02;1.02	5.86	5.86	0.93980	.	0.301301	0.33712	N	0.004626	T	0.42177	0.1191	L	0.34521	1.04	0.39092	D	0.961119	P;P	0.41978	0.767;0.566	P;B	0.49561	0.615;0.138	T	0.19160	-1.0314	10	0.27082	T	0.32	-18.653	12.9808	0.58562	0.0777:0.0:0.9223:0.0	.	363;363	Q8NE18;Q8NE18-2	NSUN7_HUMAN;.	K	363	ENSP00000371201:R363K;ENSP00000319127:R363K	ENSP00000319127:R363K	R	+	2	0	NSUN7	40487427	1.000000	0.71417	0.920000	0.36463	0.962000	0.63368	3.802000	0.55553	2.774000	0.95407	0.585000	0.79938	AGG	NSUN7	-	NULL	ENSG00000179299		0.294	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN7	HGNC	protein_coding	OTTHUMT00000250454.2	-	0.00	52	0	G	NM_024677		40792670	+1	tier1	-	no_errors	ENST00000381782	ensembl	human	known	74_37	missense	15.00	50	9	SNP	0.985	A
NTM	50863	genome.wustl.edu	37	11	132205042	132205042	+	3'UTR	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:132205042G>A	ENST00000374786.1	+	0	1516				NTM_ENST00000425719.2_3'UTR|NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374791.3_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						AAATTTTGATGTGAGTGCCAC	0.577																																																	0													79.0	74.0	76.0					11																	132205042		2201	4297	6498	SO:0001624	3_prime_UTR_variant	0			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*2G>A	11.37:g.132205042G>A			A0MTT2|Q6UXJ3|Q86VJ9	Splice_Site	SNP	-	NULL	ENST00000374786.1	37	c.NULL	CCDS8491.1	11																																																																																			NTM	-	-	ENSG00000182667		0.577	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	HGNC	protein_coding	OTTHUMT00000141937.1	-	0.00	28	0	G	NM_016522		132205042	+1	tier1	-	no_errors	ENST00000483174	ensembl	human	putative	74_37	splice_site	33.33	12	6	SNP	1.000	A
NXF2B	728343	genome.wustl.edu	37	X	101624588	101624588	+	Silent	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chrX:101624588C>T	ENST00000372750.1	-	9	1102	c.303G>A	c.(301-303)acG>acA	p.T101T	NXF2B_ENST00000372749.1_Silent_p.T101T|NXF2B_ENST00000412230.2_Silent_p.T101T|NXF2B_ENST00000372752.1_Silent_p.T13T|NXF2B_ENST00000457521.2_Silent_p.T101T			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2B	101					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|kidney(1)|lung(4)|ovary(1)	7						TATTTCTCCACGTGGTAATAC	0.463																																																	0													4.0	6.0	6.0					X																	101624588		409	969	1378	SO:0001819	synonymous_variant	0				CCDS43979.1	Xq22.1	2013-05-14			ENSG00000185945	ENSG00000269437			23984	protein-coding gene	gene with protein product						16382448	Standard	NM_001099686		Approved	bA353J17.1		Q9GZY0	OTTHUMG00000154920	ENST00000372750.1:c.303G>A	X.37:g.101624588C>T			Q9BXU4|Q9NSS1|Q9NX66	Silent	SNP	pfam_Tap_RNA-bd,pfam_TAP_C_dom,pfam_NTF2,superfamily_UBA-like,smart_TAP_C_dom,pfscan_Nuclear_transport_factor_2_euk	p.T101	ENST00000372750.1	37	c.303	CCDS43979.1	X																																																																																			NXF2B	-	NULL	ENSG00000185945		0.463	NXF2B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF2B	HGNC	protein_coding	OTTHUMT00000058979.1	-	0.00	78	0	C			101624588	-1	tier1	-	no_errors	ENST00000372749	ensembl	human	known	74_37	silent	41.53	69	49	SNP	0.000	T
NXPE2	120406	genome.wustl.edu	37	11	114550457	114550457	+	Silent	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:114550457T>C	ENST00000389586.4	+	2	295	c.105T>C	c.(103-105)atT>atC	p.I35I	NXPE2_ENST00000375475.5_Silent_p.I35I	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	35						integral component of membrane (GO:0016021)											TCTGGATCATTTACTTGGCTT	0.363																																																	0													145.0	113.0	123.0					11																	114550457		692	1590	2282	SO:0001819	synonymous_variant	0			AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.105T>C	11.37:g.114550457T>C			Q2NKI8	Silent	SNP	pfam_NXPH/NXPE,superfamily_Ig_E-set	p.I35	ENST00000389586.4	37	c.105	CCDS44738.1	11																																																																																			NXPE2	-	NULL	ENSG00000204361		0.363	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	NXPE2	HGNC	protein_coding	OTTHUMT00000399181.1	-	0.00	62	0	T	NM_182495		114550457	+1	tier1	-	no_errors	ENST00000389586	ensembl	human	known	74_37	silent	78.79	14	52	SNP	0.008	C
OLFML2B	25903	genome.wustl.edu	37	1	161953713	161953713	+	Missense_Mutation	SNP	G	G	A	rs368291911		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:161953713G>A	ENST00000294794.3	-	8	2428	c.2005C>T	c.(2005-2007)Cgg>Tgg	p.R669W	OLFML2B_ENST00000367938.1_Missense_Mutation_p.R152W|OLFML2B_ENST00000367940.2_Missense_Mutation_p.R670W	NM_015441.1	NP_056256.1	Q68BL8	OLM2B_HUMAN	olfactomedin-like 2B	669	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				extracellular matrix organization (GO:0030198)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48	all_hematologic(112;0.156)		BRCA - Breast invasive adenocarcinoma(70;0.0172)			AAATTCCTCCGGAGCCCCGTG	0.577																																																	0								G	TRP/ARG	0,4406		0,0,2203	151.0	137.0	142.0		2005	3.4	0.8	1		142	1,8599	1.2+/-3.3	0,1,4299	no	missense	OLFML2B	NM_015441.1	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	669/751	161953713	1,13005	2203	4300	6503	SO:0001583	missense	0			BX648975	CCDS1236.1, CCDS72966.1	1q23.1	2008-02-05			ENSG00000162745	ENSG00000162745			24558	protein-coding gene	gene with protein product							Standard	XM_005245075		Approved	DKFZP586L151	uc001gbu.3	Q68BL8	OTTHUMG00000024047	ENST00000294794.3:c.2005C>T	1.37:g.161953713G>A	ENSP00000294794:p.Arg669Trp		B7ZA39|Q5VU96|Q6NX46|Q86X11|Q9Y3X6	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_NA-bd_OB-fold,smart_Olfac-like,pfscan_Olfac-like	p.R669W	ENST00000294794.3	37	c.2005	CCDS1236.1	1	.	.	.	.	.	.	.	.	.	.	G	16.60	3.167646	0.57476	0.0	1.16E-4	ENSG00000162745	ENST00000294794;ENST00000367940;ENST00000367938	D;D;D	0.90197	-2.63;-2.63;-2.63	5.36	3.39	0.38822	Olfactomedin-like (3);	.	.	.	.	D	0.93680	0.7981	M	0.84948	2.725	0.46874	D	0.999236	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.93987	0.7263	8	0.87932	D	0	.	11.2474	0.49004	0.0:0.0:0.5171:0.4829	.	670;669	F2Z3N3;Q68BL8	.;OLM2B_HUMAN	W	669;670;152	ENSP00000294794:R669W;ENSP00000356917:R670W;ENSP00000356915:R152W	ENSP00000294794:R669W	R	-	1	2	OLFML2B	160220337	1.000000	0.71417	0.846000	0.33378	0.949000	0.60115	3.591000	0.53986	0.552000	0.29026	0.561000	0.74099	CGG	OLFML2B	-	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000162745		0.577	OLFML2B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	OLFML2B	HGNC	protein_coding	OTTHUMT00000060552.2	-	0.00	100	0	G	NM_015441		161953713	-1	tier1	-	no_errors	ENST00000294794	ensembl	human	known	74_37	missense	47.02	80	71	SNP	0.699	A
OLIG3	167826	genome.wustl.edu	37	6	137815138	137815138	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:137815138G>A	ENST00000367734.2	-	1	393	c.170C>T	c.(169-171)tCg>tTg	p.S57L		NM_175747.2	NP_786923.1	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3	57					spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron migration (GO:0097476)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	11	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		GCCAGCCCGCGAGAGGCTTTC	0.612																																																	0													85.0	87.0	86.0					6																	137815138		2203	4300	6503	SO:0001583	missense	0			AK096362	CCDS5186.1	6q23.3	2013-05-21			ENSG00000177468	ENSG00000177468		"""Basic helix-loop-helix proteins"""	18003	protein-coding gene	gene with protein product		609323					Standard	NM_175747		Approved	Bhlhb7, bHLHe20	uc003qhp.1	Q7RTU3	OTTHUMG00000015657	ENST00000367734.2:c.170C>T	6.37:g.137815138G>A	ENSP00000356708:p.Ser57Leu		Q8N8Q0	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.S57L	ENST00000367734.2	37	c.170	CCDS5186.1	6	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315061	0.40996	.	.	ENSG00000177468	ENST00000367734	D	0.99470	-5.96	5.55	5.55	0.83447	.	0.203077	0.33753	N	0.004588	D	0.96510	0.8861	N	0.14661	0.345	0.40336	D	0.97898	B	0.02656	0.0	B	0.01281	0.0	D	0.93059	0.6472	10	0.32370	T	0.25	-5.2808	19.4938	0.95064	0.0:0.0:1.0:0.0	.	57	Q7RTU3	OLIG3_HUMAN	L	57	ENSP00000356708:S57L	ENSP00000356708:S57L	S	-	2	0	OLIG3	137856831	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.751000	0.68720	2.594000	0.87642	0.591000	0.81541	TCG	OLIG3	-	NULL	ENSG00000177468		0.612	OLIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLIG3	HGNC	protein_coding	OTTHUMT00000042405.1	-	0.00	26	0	G	NM_175747		137815138	-1	tier1	-	no_errors	ENST00000367734	ensembl	human	known	74_37	missense	42.86	12	9	SNP	0.998	A
OR10H4	126541	genome.wustl.edu	37	19	16060211	16060211	+	Missense_Mutation	SNP	C	C	T	rs140667599		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:16060211C>T	ENST00000322107.1	+	1	394	c.394C>T	c.(394-396)Cgt>Tgt	p.R132C		NM_001004465.1	NP_001004465.1	Q8NGA5	O10H4_HUMAN	olfactory receptor, family 10, subfamily H, member 4	132						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|urinary_tract(1)	17						CCACCCACTGCGTTACAATGT	0.532																																																	0								C	CYS/ARG	6,4400	12.9+/-30.5	0,6,2197	235.0	200.0	212.0		394	0.4	0.5	19	dbSNP_134	212	0,8600		0,0,4300	yes	missense	OR10H4	NM_001004465.1	180	0,6,6497	TT,TC,CC		0.0,0.1362,0.0461	benign	132/317	16060211	6,13000	2203	4300	6503	SO:0001583	missense	0			AC011517	CCDS32941.1	19p13.12	2013-09-24			ENSG00000176231	ENSG00000176231		"""GPCR / Class A : Olfactory receptors"""	15388	protein-coding gene	gene with protein product							Standard	NM_001004465		Approved		uc010xov.2	Q8NGA5	OTTHUMG00000182268	ENST00000322107.1:c.394C>T	19.37:g.16060211C>T	ENSP00000318834:p.Arg132Cys		Q6IFJ2|Q96R57	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R132C	ENST00000322107.1	37	c.394	CCDS32941.1	19	.	.	.	.	.	.	.	.	.	.	c	6.938	0.542926	0.13250	0.001362	0.0	ENSG00000176231	ENST00000322107	T	0.01584	4.75	1.53	0.443	0.16587	GPCR, rhodopsin-like superfamily (1);	0.353956	0.20425	U	0.092583	T	0.03263	0.0095	M	0.84846	2.72	0.35954	D	0.83412	B	0.15719	0.014	B	0.11329	0.006	T	0.09122	-1.0689	10	0.66056	D	0.02	.	5.4472	0.16541	0.0:0.7809:0.0:0.2191	.	132	Q8NGA5	O10H4_HUMAN	C	132	ENSP00000318834:R132C	ENSP00000318834:R132C	R	+	1	0	OR10H4	15921211	0.739000	0.28196	0.456000	0.27044	0.314000	0.28054	1.475000	0.35409	0.828000	0.34709	0.471000	0.43371	CGT	OR10H4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000176231		0.532	OR10H4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10H4	HGNC	protein_coding	OTTHUMT00000460311.1	-	0.00	143	0	C			16060211	+1	tier1	rs140667599	no_errors	ENST00000322107	ensembl	human	known	74_37	missense	32.48	106	51	SNP	0.994	T
OR13C2	392376	genome.wustl.edu	37	9	107367310	107367310	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr9:107367310A>G	ENST00000542196.1	-	1	641	c.599T>C	c.(598-600)cTt>cCt	p.L200P		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						TGTGGCCACAAGCATGATGAA	0.403																																																	0													154.0	147.0	149.0					9																	107367310		2201	4300	6501	SO:0001583	missense	0				CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.599T>C	9.37:g.107367310A>G	ENSP00000438815:p.Leu200Pro		B9EGV8|Q6IF54	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L200P	ENST00000542196.1	37	c.599	CCDS35092.1	9	.	.	.	.	.	.	.	.	.	.	A	5.703	0.314216	0.10789	.	.	ENSG00000257019	ENST00000542196	T	0.00235	8.48	3.53	3.53	0.40419	GPCR, rhodopsin-like superfamily (1);	0.700134	0.10552	U	0.661382	T	0.00412	0.0013	M	0.88570	2.965	0.09310	N	0.999998	P	0.45428	0.858	P	0.46419	0.516	T	0.41770	-0.9490	10	0.54805	T	0.06	.	10.0804	0.42386	1.0:0.0:0.0:0.0	.	200	Q8NGS9	O13C2_HUMAN	P	200	ENSP00000438815:L200P	ENSP00000438815:L200P	L	-	2	0	OR13C2	106407131	0.003000	0.15002	0.025000	0.17156	0.054000	0.15201	1.936000	0.40183	1.475000	0.48197	0.379000	0.24179	CTT	OR13C2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000257019		0.403	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C2	HGNC	protein_coding	OTTHUMT00000053489.2	-	0.00	66	0	A	NM_001004481		107367310	-1	tier1	-	no_errors	ENST00000542196	ensembl	human	known	74_37	missense	38.89	44	28	SNP	0.001	G
OR2AJ1	127608	genome.wustl.edu	37	1	248097885	248097885	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:248097885A>G	ENST00000318244.3	+	1	815	c.815A>G	c.(814-816)aAg>aGg	p.K272R	OR2L13_ENST00000366478.2_5'Flank			Q8NGZ0	O2AJ1_HUMAN	olfactory receptor, family 2, subfamily AJ, member 1	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(1)|pancreas(1)	2						GGCCAGGATAAGTTCCTGGCA	0.413																																																	0																																										SO:0001583	missense	0					1q44	2013-03-27	2004-03-04	2004-03-05	ENSG00000177275	ENSG00000177275		"""GPCR / Class A : Olfactory receptors"""	15001	other	unknown			"""olfactory receptor, family 2, subfamily AJ, member 1 pseudogene"""	OR2AJ1P			Standard	NG_004652		Approved	OR2AJ1Q		Q8NGZ0	OTTHUMG00000040206	ENST00000318244.3:c.815A>G	1.37:g.248097885A>G	ENSP00000325078:p.Lys272Arg			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K272R	ENST00000318244.3	37	c.815		1	.	.	.	.	.	.	.	.	.	.	A	14.31	2.496771	0.44352	.	.	ENSG00000177275	ENST00000318244	T	0.00188	8.59	3.89	1.4	0.22301	.	0.224683	0.22272	U	0.062255	T	0.00178	0.0005	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34925	-0.9809	7	0.66056	D	0.02	.	5.0113	0.14313	0.5227:0.1624:0.0:0.3149	.	.	.	.	R	272	ENSP00000325078:K272R	ENSP00000325078:K272R	K	+	2	0	OR2AJ1	246164508	0.000000	0.05858	0.078000	0.20375	0.992000	0.81027	0.037000	0.13840	0.067000	0.16545	0.477000	0.44152	AAG	OR2AJ1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000177275		0.413	OR2AJ1-001	KNOWN	basic|appris_principal	protein_coding	OR2AJ1	HGNC	protein_coding	OTTHUMT00000096863.1	-	0.00	60	0	A	NG_004652		248097885	+1	tier1	-	no_errors	ENST00000318244	ensembl	human	known	74_37	missense	37.50	45	27	SNP	0.000	G
OR2D3	120775	genome.wustl.edu	37	11	6942312	6942312	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:6942312A>C	ENST00000317834.3	+	1	108	c.80A>C	c.(79-81)aAg>aCg	p.K27T		NM_001004684.1	NP_001004684.1	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D, member 3	27						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|large_intestine(7)|lung(12)|prostate(3)|skin(1)|stomach(1)	27		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTTGTGTCCAAGTTTATCTTC	0.413																																																	0													91.0	94.0	93.0					11																	6942312		2201	4296	6497	SO:0001583	missense	0			BK004294	CCDS31417.1	11p15.4	2012-08-09			ENSG00000178358	ENSG00000178358		"""GPCR / Class A : Olfactory receptors"""	15146	protein-coding gene	gene with protein product							Standard	NM_001004684		Approved		uc010rav.2	Q8NGH3	OTTHUMG00000165742	ENST00000317834.3:c.80A>C	11.37:g.6942312A>C	ENSP00000320560:p.Lys27Thr		B2RP06|Q6IFG8|Q96R51	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K27T	ENST00000317834.3	37	c.80	CCDS31417.1	11	.	.	.	.	.	.	.	.	.	.	A	13.16	2.154224	0.38021	.	.	ENSG00000178358	ENST00000317834	T	0.01084	5.36	5.16	4.02	0.46733	.	0.693153	0.12367	N	0.475162	T	0.00845	0.0028	N	0.04260	-0.245	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49881	-0.8892	10	0.46703	T	0.11	-23.7213	9.8623	0.41123	0.8469:0.0:0.0:0.1531	.	27	Q8NGH3	OR2D3_HUMAN	T	27	ENSP00000320560:K27T	ENSP00000320560:K27T	K	+	2	0	OR2D3	6898888	0.967000	0.33354	0.004000	0.12327	0.115000	0.19883	3.797000	0.55514	1.070000	0.40811	0.533000	0.62120	AAG	OR2D3	-	NULL	ENSG00000178358		0.413	OR2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2D3	HGNC	protein_coding	OTTHUMT00000385987.1	-	0.00	55	0	A	NM_001004684		6942312	+1	tier1	-	no_errors	ENST00000317834	ensembl	human	known	74_37	missense	64.10	14	25	SNP	0.021	C
OR2L2	26246	genome.wustl.edu	37	1	248202353	248202353	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:248202353A>G	ENST00000366479.2	+	1	880	c.784A>G	c.(784-786)Aga>Gga	p.R262G	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TGTACGTCCAAGATCCCTGCG	0.493																																																	0													145.0	131.0	136.0					1																	248202353		2203	4300	6503	SO:0001583	missense	0			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.784A>G	1.37:g.248202353A>G	ENSP00000355435:p.Arg262Gly		Q2M3T5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R262G	ENST00000366479.2	37	c.784	CCDS31103.1	1	.	.	.	.	.	.	.	.	.	.	.	6.342	0.431141	0.12045	.	.	ENSG00000203663	ENST00000366479	T	0.00137	8.68	1.9	0.589	0.17452	GPCR, rhodopsin-like superfamily (1);	0.373938	0.15930	U	0.237735	T	0.00109	0.0003	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.10405	-1.0631	10	0.39692	T	0.17	.	6.4831	0.22073	0.6547:0.3453:0.0:0.0	.	262	Q8NH16	OR2L2_HUMAN	G	262	ENSP00000355435:R262G	ENSP00000355435:R262G	R	+	1	2	OR2L2	246268976	0.000000	0.05858	0.007000	0.13788	0.157000	0.22087	-0.563000	0.05943	0.746000	0.32786	0.163000	0.16589	AGA	OR2L2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000203663		0.493	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L2	HGNC	protein_coding	OTTHUMT00000096871.1	-	0.00	127	0	A	NM_001004686		248202353	+1	tier1	-	no_errors	ENST00000366479	ensembl	human	known	74_37	missense	42.05	102	74	SNP	0.000	G
OR4K13	390433	genome.wustl.edu	37	14	20502358	20502358	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr14:20502358A>G	ENST00000315693.2	-	1	561	c.560T>C	c.(559-561)cTt>cCt	p.L187P	AL359218.1_ENST00000580563.1_RNA	NM_001004714.1	NP_001004714.1	Q8NH42	OR4KD_HUMAN	olfactory receptor, family 4, subfamily K, member 13	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(3)|skin(4)	24	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		CTTGCAGGCAAGTTTAATCAC	0.488																																																	0													121.0	116.0	118.0					14																	20502358		2203	4300	6503	SO:0001583	missense	0				CCDS32028.1	14q11.2	2013-09-23			ENSG00000176253	ENSG00000176253		"""GPCR / Class A : Olfactory receptors"""	15351	protein-coding gene	gene with protein product							Standard	NM_001004714		Approved		uc010tkz.2	Q8NH42	OTTHUMG00000170781	ENST00000315693.2:c.560T>C	14.37:g.20502358A>G	ENSP00000319322:p.Leu187Pro		Q6IF13	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L187P	ENST00000315693.2	37	c.560	CCDS32028.1	14	.	.	.	.	.	.	.	.	.	.	.	13.53	2.265888	0.40095	.	.	ENSG00000176253	ENST00000315693	T	0.00411	7.53	3.46	3.46	0.39613	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34777	U	0.003700	T	0.02230	0.0069	H	0.98664	4.295	0.58432	D	0.999993	D	0.89917	1.0	D	0.91635	0.999	T	0.02893	-1.1097	10	0.87932	D	0	.	11.0505	0.47884	1.0:0.0:0.0:0.0	.	187	Q8NH42	OR4KD_HUMAN	P	187	ENSP00000319322:L187P	ENSP00000319322:L187P	L	-	2	0	OR4K13	19572198	0.996000	0.38824	0.994000	0.49952	0.157000	0.22087	7.777000	0.85628	1.434000	0.47414	0.421000	0.28195	CTT	OR4K13	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000176253		0.488	OR4K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K13	HGNC	protein_coding	OTTHUMT00000410344.1	-	0.00	51	0	A			20502358	-1	tier1	-	no_errors	ENST00000315693	ensembl	human	known	74_37	missense	62.50	15	25	SNP	0.983	G
OR4M2	390538	genome.wustl.edu	37	15	22368885	22368885	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr15:22368885T>G	ENST00000332663.2	+	1	408	c.310T>G	c.(310-312)Tta>Gta	p.L104V	RP11-69H14.6_ENST00000558896.1_RNA	NM_001004719.2	NP_001004719.2	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M, member 2	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(4)|large_intestine(6)|lung(38)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)	63		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		GCTCTTCTTCTTACACTTTGC	0.453																																																	0													299.0	251.0	267.0					15																	22368885		2203	4300	6503	SO:0001583	missense	0			AC060768	CCDS32172.1	15q11.2	2013-09-23			ENSG00000182974	ENSG00000182974		"""GPCR / Class A : Olfactory receptors"""	15373	protein-coding gene	gene with protein product							Standard	NM_001004719		Approved		uc010tzu.2	Q8NGB6	OTTHUMG00000171738	ENST00000332663.2:c.310T>G	15.37:g.22368885T>G	ENSP00000329467:p.Leu104Val		B9EH16|Q6IEY2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L104V	ENST00000332663.2	37	c.310	CCDS32172.1	15	.	.	.	.	.	.	.	.	.	.	.	9.585	1.124499	0.20959	.	.	ENSG00000182974	ENST00000332663	T	0.00481	7.11	2.5	0.115	0.14643	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37530	N	0.002049	T	0.00271	0.0008	N	0.14661	0.345	0.09310	N	1	P	0.44478	0.836	P	0.48227	0.571	T	0.40270	-0.9572	10	0.05959	T	0.93	-10.155	5.6261	0.17482	0.0:0.2915:0.0:0.7085	.	104	Q8NGB6	OR4M2_HUMAN	V	104	ENSP00000329467:L104V	ENSP00000329467:L104V	L	+	1	2	OR4M2	19870249	0.000000	0.05858	0.973000	0.42090	0.815000	0.46073	-0.267000	0.08619	0.220000	0.20860	0.368000	0.22195	TTA	OR4M2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000182974		0.453	OR4M2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	OR4M2	HGNC	protein_coding	OTTHUMT00000414921.1	-	0.00	291	0	T			22368885	+1	tier1	-	no_errors	ENST00000332663	ensembl	human	putative	74_37	missense	8.10	261	23	SNP	0.049	G
OR52E2	119678	genome.wustl.edu	37	11	5080572	5080572	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:5080572A>C	ENST00000321522.2	-	1	285	c.286T>G	c.(286-288)Ttt>Gtt	p.F96V		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		CAGGCTTCAAAGATGATCCCT	0.488																																																	0													79.0	74.0	76.0					11																	5080572		2201	4298	6499	SO:0001583	missense	0			AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.286T>G	11.37:g.5080572A>C	ENSP00000322088:p.Phe96Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.F96V	ENST00000321522.2	37	c.286	CCDS31371.1	11	.	.	.	.	.	.	.	.	.	.	A	11.21	1.572320	0.28092	.	.	ENSG00000176787	ENST00000321522	T	0.05925	3.37	3.77	3.77	0.43336	GPCR, rhodopsin-like superfamily (1);	0.114638	0.39020	N	0.001484	T	0.18964	0.0455	M	0.85099	2.735	0.09310	N	1	D	0.54601	0.967	P	0.53224	0.721	T	0.04607	-1.0939	10	0.87932	D	0	.	11.1617	0.48520	1.0:0.0:0.0:0.0	.	96	Q8NGJ4	O52E2_HUMAN	V	96	ENSP00000322088:F96V	ENSP00000322088:F96V	F	-	1	0	OR52E2	5037148	0.011000	0.17503	0.744000	0.31058	0.013000	0.08279	2.718000	0.47236	1.966000	0.57179	0.529000	0.55759	TTT	OR52E2	-	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176787		0.488	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E2	HGNC	protein_coding	OTTHUMT00000142815.1	-	0.00	52	0	A	NM_001005164		5080572	-1	tier1	-	no_errors	ENST00000321522	ensembl	human	known	74_37	missense	81.48	10	44	SNP	0.112	C
OR52J3	119679	genome.wustl.edu	37	11	5068582	5068582	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:5068582T>G	ENST00000380370.1	+	1	827	c.827T>G	c.(826-828)cTt>cGt	p.L276R		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	276						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATTCACATTCTTGTTGCCAAT	0.423																																																	0													176.0	158.0	164.0					11																	5068582		2201	4298	6499	SO:0001583	missense	0			AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.827T>G	11.37:g.5068582T>G	ENSP00000369728:p.Leu276Arg		Q6IFE4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L276R	ENST00000380370.1	37	c.827	CCDS31370.1	11	.	.	.	.	.	.	.	.	.	.	T	11.50	1.656121	0.29425	.	.	ENSG00000205495	ENST00000380370	T	0.00188	8.59	4.19	4.19	0.49359	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41823	D	0.000805	T	0.00784	0.0026	H	0.97023	3.925	0.33349	D	0.570876	D	0.76494	0.999	D	0.77004	0.989	T	0.02877	-1.1099	10	0.87932	D	0	.	7.1995	0.25873	0.0:0.1013:0.0:0.8987	.	276	Q8NH60	O52J3_HUMAN	R	276	ENSP00000369728:L276R	ENSP00000369728:L276R	L	+	2	0	OR52J3	5025158	0.185000	0.23213	0.998000	0.56505	0.100000	0.18952	3.875000	0.56108	1.742000	0.51746	0.533000	0.62120	CTT	OR52J3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000205495		0.423	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52J3	HGNC	protein_coding	OTTHUMT00000142807.1	-	0.00	101	0	T	NM_001001916		5068582	+1	tier1	-	no_errors	ENST00000380370	ensembl	human	known	74_37	missense	77.61	15	52	SNP	0.908	G
OR52E4	390081	genome.wustl.edu	37	11	5905821	5905821	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:5905821T>G	ENST00000316987.2	+	1	321	c.299T>G	c.(298-300)cTt>cGt	p.L100R		NM_001005165.1	NP_001005165.1	Q8NGH9	O52E4_HUMAN	olfactory receptor, family 52, subfamily E, member 4	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(2)|prostate(1)|skin(2)	30		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;1.24e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGGGATGCCTTCTTCAGATG	0.463																																																	0													109.0	97.0	101.0					11																	5905821		2201	4296	6497	SO:0001583	missense	0			AB065817	CCDS31401.1	11p15.4	2012-08-09			ENSG00000180974	ENSG00000180974		"""GPCR / Class A : Olfactory receptors"""	15213	protein-coding gene	gene with protein product							Standard	NM_001005165		Approved		uc010qzs.2	Q8NGH9	OTTHUMG00000168804	ENST00000316987.2:c.299T>G	11.37:g.5905821T>G	ENSP00000321426:p.Leu100Arg		Q6IFG0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.L100R	ENST00000316987.2	37	c.299	CCDS31401.1	11	.	.	.	.	.	.	.	.	.	.	T	13.58	2.279627	0.40294	.	.	ENSG00000180974	ENST00000316987	T	0.21932	1.98	5.04	5.04	0.67666	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44285	D	0.000470	T	0.54983	0.1892	M	0.93594	3.435	0.39385	D	0.966324	D	0.65815	0.995	D	0.67900	0.954	T	0.69390	-0.5158	10	0.87932	D	0	.	13.727	0.62765	0.0:0.0:0.0:1.0	.	100	Q8NGH9	O52E4_HUMAN	R	100	ENSP00000321426:L100R	ENSP00000321426:L100R	L	+	2	0	OR52E4	5862397	0.117000	0.22190	0.340000	0.25575	0.047000	0.14425	2.976000	0.49289	2.106000	0.64143	0.523000	0.50628	CTT	OR52E4	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000180974		0.463	OR52E4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E4	HGNC	protein_coding	OTTHUMT00000401146.1	-	0.00	96	0	T	NM_001005165		5905821	+1	tier1	-	no_errors	ENST00000316987	ensembl	human	known	74_37	missense	56.67	26	34	SNP	0.781	G
OR5H6	79295	genome.wustl.edu	37	3	97983517	97983517	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:97983517T>C	ENST00000383696.2	+	1	430	c.389T>C	c.(388-390)cTc>cCc	p.L130P	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005479.1	NP_001005479.1	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H, member 6 (gene/pseudogene)	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(2)|endometrium(1)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						GAATGTTTTCTCTTGGCAACA	0.368																																																	0													99.0	87.0	91.0					3																	97983517		2202	4298	6500	SO:0001583	missense	0			BK004374	CCDS33800.1	3q12.1	2013-10-10	2013-10-10		ENSG00000230301	ENSG00000230301		"""GPCR / Class A : Olfactory receptors"""	14767	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily H, member 6"""				Standard	NM_001005479		Approved		uc003dsi.1	Q8NGV6	OTTHUMG00000160078	ENST00000383696.2:c.389T>C	3.37:g.97983517T>C	ENSP00000373196:p.Leu130Pro		Q6IF88	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L130P	ENST00000383696.2	37	c.389	CCDS33800.1	3	.	.	.	.	.	.	.	.	.	.	-	11.56	1.675418	0.29783	.	.	ENSG00000230301	ENST00000383696	T	0.00594	6.33	2.19	2.19	0.27852	GPCR, rhodopsin-like superfamily (1);	0.170613	0.28140	N	0.016443	T	0.03739	0.0106	H	0.96048	3.76	0.09310	N	1	D	0.89917	1.0	D	0.73380	0.98	T	0.09640	-1.0665	10	0.87932	D	0	.	7.9658	0.30098	0.0:0.0:0.0:1.0	.	130	Q8NGV6	OR5H6_HUMAN	P	130	ENSP00000373196:L130P	ENSP00000373196:L130P	L	+	2	0	OR5H6	99466207	0.030000	0.19436	0.050000	0.19076	0.008000	0.06430	2.343000	0.44001	1.006000	0.39211	0.163000	0.16589	CTC	OR5H6	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000230301		0.368	OR5H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H6	HGNC	protein_coding	OTTHUMT00000359111.2	-	0.00	78	0	T			97983517	+1	tier1	-	no_errors	ENST00000383696	ensembl	human	known	74_37	missense	20.79	80	21	SNP	0.006	C
OTOG	340990	genome.wustl.edu	37	11	17615272	17615272	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:17615272C>T	ENST00000399391.2	+	26	3293	c.3293C>T	c.(3292-3294)aCa>aTa	p.T1098I	OTOG_ENST00000399397.1_Missense_Mutation_p.T1025I|OTOG_ENST00000342528.2_Missense_Mutation_p.T113I	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	1098	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						CAGAGAACCACAGTGCACGTC	0.572																																																	0																																										SO:0001583	missense	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.3293C>T	11.37:g.17615272C>T	ENSP00000382323:p.Thr1098Ile		A8MTX6|A8MUJ0|B7WPC4	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.T1098I	ENST00000399391.2	37	c.3293	CCDS59225.1	11	.	.	.	.	.	.	.	.	.	.	C	26.9	4.784541	0.90282	.	.	ENSG00000188162	ENST00000399391;ENST00000399397;ENST00000342528	T;T;T	0.59224	0.28;0.28;0.28	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.79125	0.4393	M	0.87381	2.88	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.76027	-0.3109	10	0.22706	T	0.39	.	19.2627	0.93974	0.0:1.0:0.0:0.0	.	113	Q6ZRI0-2	.	I	1098;1025;113	ENSP00000382323:T1098I;ENSP00000382329:T1025I;ENSP00000341666:T113I	ENSP00000341666:T113I	T	+	2	0	OTOG	17571848	1.000000	0.71417	0.996000	0.52242	0.918000	0.54935	7.296000	0.78790	2.778000	0.95560	0.655000	0.94253	ACA	OTOG	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000188162		0.572	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		-	0.00	33	0	C			17615272	+1	tier1	-	no_errors	ENST00000399391	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	T
PADI6	353238	genome.wustl.edu	37	1	17707635	17707635	+	RNA	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:17707635A>C	ENST00000434762.2	+	0	579							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	GGACAAGAAAACCAAGAAAGT	0.502																																																	0													76.0	81.0	79.0					1																	17707635		1956	4153	6109			0			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17707635A>C			Q330K5|Q70SX3	RNA	SNP	-	NULL	ENST00000434762.2	37	NULL		1																																																																																			PADI6	-	-	ENSG00000256049		0.502	PADI6-001	KNOWN	basic	processed_transcript	PADI6	HGNC	processed_transcript	OTTHUMT00000006804.4	-	0.00	54	0	A	NM_207421		17707635	+1	tier1	-	no_errors	ENST00000358481	ensembl	human	known	74_37	rna	14.58	41	7	SNP	0.000	C
PAFAH1B2	5049	genome.wustl.edu	37	11	117045611	117045611	+	Silent	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:117045611G>A	ENST00000419197.2	+	6	538	c.396G>A	c.(394-396)gcG>gcA	p.A132A	PAFAH1B2_ENST00000526888.1_Intron|PAFAH1B2_ENST00000529887.2_Intron|PAFAH1B2_ENST00000530272.1_Intron	NM_001184748.1	NP_001171677.1	P68402	PA1B2_HUMAN	platelet-activating factor acetylhydrolase 1b, catalytic subunit 2 (30kDa)	132					brain development (GO:0007420)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|positive regulation of macroautophagy (GO:0016239)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)			kidney(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;1.68e-05)|Epithelial(105;0.000162)|all cancers(92;0.00111)		gattacaggcgtgagtcaccg	0.532			T	IGH@	MLCLS																																			Dom	yes		11	11q23	5049	"""platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDa"""		L	0																																										SO:0001819	synonymous_variant	0			D63390	CCDS8380.1, CCDS53713.1, CCDS53714.1, CCDS53715.1	11q23	2011-10-24	2010-02-10			ENSG00000168092			8575	protein-coding gene	gene with protein product	"""PAF-AH1b alpha 2 subunit"""	602508	"""platelet-activating factor acetylhydrolase, isoform Ib, beta subunit 30kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 2 (30kDa)"""			9144386, 9693049	Standard	NM_002572		Approved		uc001pqe.2	P68402		ENST00000419197.2:c.396G>A	11.37:g.117045611G>A			A8DPS5|A8DPS6|A8DPS7|E9PEJ5|E9PLP3|O00687|Q29459|Q6IBR6	Silent	SNP	NULL	p.A132	ENST00000419197.2	37	c.396	CCDS53713.1	11																																																																																			PAFAH1B2	-	NULL	ENSG00000168092		0.532	PAFAH1B2-201	KNOWN	basic|CCDS	protein_coding	PAFAH1B2	HGNC	protein_coding		-	0.00	35	0	G	NM_002572		117045611	+1	tier1	-	no_errors	ENST00000419197	ensembl	human	known	74_37	silent	43.75	9	7	SNP	0.002	A
PALD1	27143	genome.wustl.edu	37	10	72298759	72298759	+	Missense_Mutation	SNP	G	G	A	rs141972259		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr10:72298759G>A	ENST00000263563.6	+	13	1832	c.1564G>A	c.(1564-1566)Gcc>Acc	p.A522T		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	522						cytosol (GO:0005829)											CCAGCCCAGCGCCAAGGTGAC	0.706																																																	0								G	THR/ALA	1,4401	2.1+/-5.4	0,1,2200	39.0	45.0	43.0		1564	0.8	1.0	10	dbSNP_134	43	0,8596		0,0,4298	no	missense	KIAA1274	NM_014431.2	58	0,1,6498	AA,AG,GG		0.0,0.0227,0.0077	benign	522/857	72298759	1,12997	2201	4298	6499	SO:0001583	missense	0			AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.1564G>A	10.37:g.72298759G>A	ENSP00000263563:p.Ala522Thr		B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	smart_Tyr_Pase_cat	p.A522T	ENST00000263563.6	37	c.1564	CCDS31215.1	10	.	.	.	.	.	.	.	.	.	.	g	13.54	2.267238	0.40095	2.27E-4	0.0	ENSG00000107719	ENST00000263563;ENST00000373214	T	0.43688	0.94	5.01	0.795	0.18643	.	0.315608	0.35615	N	0.003084	T	0.24431	0.0592	L	0.37561	1.115	0.31688	N	0.64223	B	0.18166	0.026	B	0.16722	0.016	T	0.15435	-1.0437	10	0.15952	T	0.53	-10.1664	4.0514	0.09796	0.2689:0.0:0.434:0.2971	.	522	Q9ULE6	PALD_HUMAN	T	522	ENSP00000263563:A522T	ENSP00000263563:A522T	A	+	1	0	KIAA1274	71968765	0.987000	0.35691	0.973000	0.42090	0.797000	0.45037	1.742000	0.38248	0.159000	0.19401	-0.284000	0.09977	GCC	PALD1	-	NULL	ENSG00000107719		0.706	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALD1	HGNC	protein_coding	OTTHUMT00000048515.2	-	0.00	30	0	G	NM_014431		72298759	+1	tier1	rs141972259	no_errors	ENST00000263563	ensembl	human	known	74_37	missense	37.84	23	14	SNP	0.998	A
PCDH17	27253	genome.wustl.edu	37	13	58207948	58207948	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr13:58207948C>T	ENST00000377918.3	+	1	1294	c.1268C>T	c.(1267-1269)aCg>aTg	p.T423M		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	423	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		AACTTCTACACGGTGGTGACT	0.682																																					Melanoma(72;952 1291 1619 12849 33676)												0													27.0	20.0	22.0					13																	58207948		2193	4281	6474	SO:0001583	missense	0			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1268C>T	13.37:g.58207948C>T	ENSP00000367151:p.Thr423Met		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T423M	ENST00000377918.3	37	c.1268	CCDS31986.1	13	.	.	.	.	.	.	.	.	.	.	C	13.45	2.242237	0.39598	.	.	ENSG00000118946	ENST00000377918	T	0.20598	2.06	5.7	5.7	0.88788	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.44623	0.1302	L	0.55834	1.745	0.54753	D	0.999989	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.06481	-1.0824	9	.	.	.	.	19.8478	0.96722	0.0:1.0:0.0:0.0	.	423;423	O14917-2;O14917	.;PCD17_HUMAN	M	423	ENSP00000367151:T423M	.	T	+	2	0	PCDH17	57105949	1.000000	0.71417	0.979000	0.43373	0.174000	0.22865	6.086000	0.71352	2.704000	0.92352	0.650000	0.86243	ACG	PCDH17	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000118946		0.682	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	HGNC	protein_coding	OTTHUMT00000045139.1	-	0.00	37	0	C	NM_001040429		58207948	+1	tier1	-	no_errors	ENST00000377918	ensembl	human	known	74_37	missense	22.92	37	11	SNP	1.000	T
PCDH17	27253	genome.wustl.edu	37	13	58209240	58209240	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr13:58209240A>C	ENST00000377918.3	+	1	2586	c.2560A>C	c.(2560-2562)Att>Ctt	p.I854L		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	854					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		GATGTCCATAATTCAGGTAGG	0.542																																					Melanoma(72;952 1291 1619 12849 33676)												0													37.0	40.0	39.0					13																	58209240		2203	4299	6502	SO:0001583	missense	0			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.2560A>C	13.37:g.58209240A>C	ENSP00000367151:p.Ile854Leu		A8K1R5|Q5VVW9|Q5VVX0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I854L	ENST00000377918.3	37	c.2560	CCDS31986.1	13	.	.	.	.	.	.	.	.	.	.	A	3.948	-0.012906	0.07727	.	.	ENSG00000118946	ENST00000377918	T	0.42513	0.97	6.08	6.08	0.98989	.	0.044306	0.85682	D	0.000000	T	0.29190	0.0726	N	0.16790	0.44	0.58432	D	0.99999	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.09818	-1.0657	9	.	.	.	.	16.6512	0.85203	1.0:0.0:0.0:0.0	.	854;854	O14917-2;O14917	.;PCD17_HUMAN	L	854	ENSP00000367151:I854L	.	I	+	1	0	PCDH17	57107241	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.850000	0.92190	2.333000	0.79357	0.482000	0.46254	ATT	PCDH17	-	NULL	ENSG00000118946		0.542	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	HGNC	protein_coding	OTTHUMT00000045139.1	-	0.00	85	0	A	NM_001040429		58209240	+1	tier1	-	no_errors	ENST00000377918	ensembl	human	known	74_37	missense	31.71	56	26	SNP	1.000	C
PCDHA4	56144	genome.wustl.edu	37	5	140188585	140188585	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr5:140188585G>A	ENST00000530339.1	+	1	1813	c.1813G>A	c.(1813-1815)Gcg>Acg	p.A605T	PCDHA4_ENST00000356878.4_Missense_Mutation_p.A605T|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Missense_Mutation_p.A605T|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	605	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCTACAACGCGTGGCTTTC	0.677																																																	0													119.0	109.0	113.0					5																	140188585		2203	4299	6502	SO:0001583	missense	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1813G>A	5.37:g.140188585G>A	ENSP00000435300:p.Ala605Thr		O75285|Q2M253	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A605T	ENST00000530339.1	37	c.1813	CCDS54916.1	5	.	.	.	.	.	.	.	.	.	.	g	21.3	4.135947	0.77662	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.40225	1.04;1.04;1.04	4.08	4.08	0.47627	Cadherin (4);Cadherin-like (1);	0.192677	0.24838	U	0.035189	T	0.74749	0.3757	H	0.95294	3.65	0.31192	N	0.700837	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.994;0.996;0.999	T	0.82585	-0.0384	10	0.87932	D	0	.	16.6588	0.85236	0.0:0.0:1.0:0.0	.	605;605;605	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	T	605	ENSP00000423470:A605T;ENSP00000349344:A605T;ENSP00000435300:A605T	ENSP00000349344:A605T	A	+	1	0	PCDHA4	140168769	0.938000	0.31826	1.000000	0.80357	0.855000	0.48748	3.001000	0.49488	2.006000	0.58801	0.484000	0.47621	GCG	PCDHA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204967		0.677	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	-	0.00	112	0	G	NM_018907		140188585	+1	tier1	-	no_errors	ENST00000530339	ensembl	human	known	74_37	missense	71.93	31	82	SNP	1.000	A
PCDHA12	56137	genome.wustl.edu	37	5	140257124	140257124	+	Silent	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr5:140257124C>T	ENST00000398631.2	+	1	2067	c.2067C>T	c.(2065-2067)ccC>ccT	p.P689P	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA9_ENST00000532602.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	689					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTGGATCCCGAAGCGGCTC	0.647																																					Pancreas(113;759 1672 13322 24104 50104)												0													38.0	42.0	41.0					5																	140257124		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.2067C>T	5.37:g.140257124C>T			O75278|Q2M1N8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P689	ENST00000398631.2	37	c.2067	CCDS47285.1	5																																																																																			PCDHA12	-	NULL	ENSG00000251664		0.647	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	-	0.00	66	0	C	NM_018903		140257124	+1	tier1	-	no_errors	ENST00000398631	ensembl	human	known	74_37	silent	38.71	38	24	SNP	0.000	T
PCNXL3	399909	genome.wustl.edu	37	11	65391694	65391694	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:65391694G>T	ENST00000355703.3	+	14	3112	c.2573G>T	c.(2572-2574)cGt>cTt	p.R858L		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	858						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						GCGTACAGCCGTCCTGTCTAC	0.627																																																	0													58.0	65.0	62.0					11																	65391694		2182	4276	6458	SO:0001583	missense	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.2573G>T	11.37:g.65391694G>T	ENSP00000347931:p.Arg858Leu		Q6MZN8	Missense_Mutation	SNP	pfam_Pecanex	p.R858L	ENST00000355703.3	37	c.2573	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.201051	0.94997	.	.	ENSG00000197136	ENST00000355703	T	0.80214	-1.35	4.75	4.75	0.60458	.	.	.	.	.	D	0.89312	0.6679	M	0.82823	2.61	0.52099	D	0.999948	D	0.60160	0.987	D	0.65010	0.931	D	0.91148	0.4951	9	0.87932	D	0	.	15.2199	0.73303	0.0:0.0:1.0:0.0	.	858	Q9H6A9	PCX3_HUMAN	L	858	ENSP00000347931:R858L	ENSP00000347931:R858L	R	+	2	0	PCNXL3	65148270	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.972000	0.93424	2.199000	0.70637	0.462000	0.41574	CGT	PCNXL3	-	NULL	ENSG00000197136		0.627	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1		0.00	40	0	G	NM_032223		65391694	+1			no_errors	ENST00000355703	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	T
PCNXL3	399909	genome.wustl.edu	37	11	65396307	65396307	+	Missense_Mutation	SNP	G	G	C	rs111942806	byFrequency	TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:65396307G>C	ENST00000355703.3	+	24	4368	c.3829G>C	c.(3829-3831)Gtc>Ctc	p.V1277L		NM_032223.2	NP_115599.2	Q9H6A9	PCX3_HUMAN	pecanex-like 3 (Drosophila)	1277						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)	13						CATGCTGTTCGTCCAGGCCCT	0.667																																																	0													33.0	36.0	35.0					11																	65396307		2116	4214	6330	SO:0001583	missense	0			BX640978	CCDS44650.1	11q12.1	2008-07-21			ENSG00000197136	ENSG00000197136			18760	protein-coding gene	gene with protein product						15146197	Standard	NM_032223		Approved	FLJ22427	uc001oey.2	Q9H6A9	OTTHUMG00000166539	ENST00000355703.3:c.3829G>C	11.37:g.65396307G>C	ENSP00000347931:p.Val1277Leu		Q6MZN8	Missense_Mutation	SNP	pfam_Pecanex	p.V1277L	ENST00000355703.3	37	c.3829	CCDS44650.1	11	.	.	.	.	.	.	.	.	.	.	G	14.41	2.525925	0.44969	.	.	ENSG00000197136	ENST00000355703	T	0.07216	3.21	5.25	1.24	0.21308	.	0.215967	0.39407	N	0.001378	T	0.03390	0.0098	N	0.10972	0.075	0.30932	N	0.726802	B;B	0.23490	0.086;0.004	B;B	0.24541	0.054;0.008	T	0.42378	-0.9455	10	0.11794	T	0.64	.	5.6279	0.17492	0.2511:0.1492:0.5997:0.0	.	164;1277	Q9H6A9-3;Q9H6A9	.;PCX3_HUMAN	L	1277	ENSP00000347931:V1277L	ENSP00000347931:V1277L	V	+	1	0	PCNXL3	65152883	1.000000	0.71417	0.519000	0.27824	0.898000	0.52572	3.215000	0.51169	-0.015000	0.14150	-0.136000	0.14681	GTC	PCNXL3	-	NULL	ENSG00000197136		0.667	PCNXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL3	HGNC	protein_coding	OTTHUMT00000390321.1	-	0.00	20	0	G	NM_032223		65396307	+1	tier1	-	no_errors	ENST00000355703	ensembl	human	known	74_37	missense	17.95	32	7	SNP	0.986	C
PDE11A	50940	genome.wustl.edu	37	2	178936681	178936681	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:178936681T>C	ENST00000286063.6	-	1	801	c.484A>G	c.(484-486)Agc>Ggc	p.S162G	PDE11A_ENST00000358450.4_Intron	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	162					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	GGCAGGGAGCTTGCCTTCCGG	0.592									Primary Pigmented Nodular Adrenocortical Disease, Familial																																								0													73.0	71.0	72.0					2																	178936681		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.484A>G	2.37:g.178936681T>C	ENSP00000286063:p.Ser162Gly		Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.S162G	ENST00000286063.6	37	c.484	CCDS33334.1	2	.	.	.	.	.	.	.	.	.	.	T	15.46	2.839451	0.51057	.	.	ENSG00000128655	ENST00000286063	T	0.69926	-0.44	4.92	4.92	0.64577	.	0.354502	0.37761	N	0.001943	T	0.61825	0.2378	L	0.54323	1.7	0.80722	D	1	P	0.47409	0.895	B	0.41236	0.351	T	0.63839	-0.6546	10	0.37606	T	0.19	.	13.7407	0.62847	0.0:0.0:0.0:1.0	.	162	Q9HCR9	PDE11_HUMAN	G	162	ENSP00000286063:S162G	ENSP00000286063:S162G	S	-	1	0	PDE11A	178644927	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.527000	0.81931	1.850000	0.53721	0.533000	0.62120	AGC	PDE11A	-	NULL	ENSG00000128655		0.592	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE11A	HGNC	protein_coding	OTTHUMT00000334313.2		0.00	36	0	T			178936681	-1			no_errors	ENST00000286063	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	C
PERP	64065	genome.wustl.edu	37	6	138413370	138413370	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:138413370C>T	ENST00000421351.3	-	3	561	c.391G>A	c.(391-393)Gtg>Atg	p.V131M		NM_022121.4	NP_071404.2	Q96FX8	PERP_HUMAN	PERP, TP53 apoptosis effector	131					activation of cysteine-type endopeptidase activity (GO:0097202)|amelogenesis (GO:0097186)|desmosome organization (GO:0002934)|heterotypic cell-cell adhesion (GO:0034113)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of proteolysis (GO:0045862)	cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(1)|lung(1)|prostate(1)	5	Breast(32;0.0799)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000878)|OV - Ovarian serous cystadenocarcinoma(155;0.000997)		GTGTACTTCACGGGGTAAATT	0.458																																																	0													84.0	84.0	84.0					6																	138413370		2203	4300	6503	SO:0001583	missense	0			AF317550	CCDS5188.1	6q24	2014-04-29			ENSG00000112378	ENSG00000112378			17637	protein-coding gene	gene with protein product	"""keratinocyte associated protein 1"""	609301				11062687	Standard	NM_022121		Approved	PIGPC1, dJ496H19.1, KCP1, THW, KRTCAP1	uc003qht.2	Q96FX8	OTTHUMG00000015668	ENST00000421351.3:c.391G>A	6.37:g.138413370C>T	ENSP00000397157:p.Val131Met		B2RB73|E1P590|Q8IWS3|Q8N1J6|Q8NC16|Q9H1C5|Q9H230	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin	p.V131M	ENST00000421351.3	37	c.391	CCDS5188.1	6	.	.	.	.	.	.	.	.	.	.	C	29.4	5.004227	0.93287	.	.	ENSG00000112378	ENST00000421351;ENST00000265603	D	0.88896	-2.44	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.93259	0.7852	M	0.64404	1.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93382	0.6744	10	0.87932	D	0	-33.8676	19.7782	0.96405	0.0:1.0:0.0:0.0	.	131	Q96FX8	PERP_HUMAN	M	131;113	ENSP00000397157:V131M	ENSP00000265603:V113M	V	-	1	0	PERP	138455063	0.999000	0.42202	0.960000	0.40013	0.986000	0.74619	4.343000	0.59348	2.667000	0.90743	0.561000	0.74099	GTG	PERP	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000112378		0.458	PERP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PERP	HGNC	protein_coding	OTTHUMT00000042423.2	-	0.00	60	0	C	NM_022121		138413370	-1	tier1	-	no_errors	ENST00000421351	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
PIEZO1	9780	genome.wustl.edu	37	16	88801445	88801445	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr16:88801445C>G	ENST00000301015.9	-	14	1932	c.1686G>C	c.(1684-1686)caG>caC	p.Q562H	RP5-1142A6.2_ENST00000440406.2_RNA|RP5-1142A6.2_ENST00000567968.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	562					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						GCAACAGCGTCTGCGTCCGCG	0.667																																																	0													86.0	80.0	82.0					16																	88801445		692	1590	2282	SO:0001583	missense	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.1686G>C	16.37:g.88801445C>G	ENSP00000301015:p.Gln562His		A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	pfam_Piezo	p.Q562H	ENST00000301015.9	37	c.1686	CCDS54058.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.459|2.459	-0.324465|-0.324465	0.05350|0.05350	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015	.|D	.|0.84298	.|-1.83	4.13|4.13	2.02|2.02	0.26589|0.26589	.|.	.|0.874505	.|0.09707	.|N	.|0.766189	T|T	0.82116|0.82116	0.4967|0.4967	L|L	0.61218|0.61218	1.895|1.895	0.18873|0.18873	N|N	0.999983|0.999983	.|B	.|0.06786	.|0.001	.|B	.|0.04013	.|0.001	T|T	0.68017|0.68017	-0.5520|-0.5520	5|10	.|0.38643	.|T	.|0.18	-10.1314|-10.1314	9.7115|9.7115	0.40247|0.40247	0.1473:0.6587:0.194:0.0|0.1473:0.6587:0.194:0.0	.|.	.|562	.|Q92508	.|PIEZ1_HUMAN	H|H	508|562	.|ENSP00000301015:Q562H	.|ENSP00000301015:Q562H	D|Q	-|-	1|3	0|2	FAM38A|FAM38A	87328946|87328946	0.000000|0.000000	0.05858|0.05858	0.013000|0.013000	0.15412|0.15412	0.100000|0.100000	0.18952|0.18952	0.556000|0.556000	0.23438|0.23438	0.255000|0.255000	0.21593|0.21593	-0.656000|-0.656000	0.03901|0.03901	GAC|CAG	PIEZO1	-	NULL	ENSG00000103335		0.667	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	-	0.00	65	0	C	NM_014745		88801445	-1	tier1	-	no_errors	ENST00000301015	ensembl	human	novel	74_37	missense	13.43	58	9	SNP	0.034	G
PKHD1	5314	genome.wustl.edu	37	6	51524480	51524480	+	Missense_Mutation	SNP	G	G	A	rs148617572		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:51524480G>A	ENST00000371117.3	-	61	10719	c.10444C>T	c.(10444-10446)Cgc>Tgc	p.R3482C		NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3482			R -> C (in ARPKD). {ECO:0000269|PubMed:12506140, ECO:0000269|PubMed:15108281}.		cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.R3482C(1)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGAAAAAAGCGCAAAACTTGA	0.443																																																	1	Substitution - Missense(1)	large_intestine(1)	GRCh37	CM032336	PKHD1	M	rs148617572	G	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	76.0	78.0	78.0		10444	3.9	0.5	6	dbSNP_134	78	0,8600		0,0,4300	no	missense	PKHD1	NM_138694.3	180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	3482/4075	51524480	1,13005	2203	4300	6503	SO:0001583	missense	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.10444C>T	6.37:g.51524480G>A	ENSP00000360158:p.Arg3482Cys		Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.R3482C	ENST00000371117.3	37	c.10444	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201621	0.58234	2.27E-4	0.0	ENSG00000170927	ENST00000371117	D	0.94184	-3.37	5.72	3.89	0.44902	.	0.341409	0.25765	N	0.028456	D	0.90045	0.6891	L	0.34521	1.04	0.29128	N	0.879818	D	0.89917	1.0	P	0.57846	0.828	D	0.86300	0.1679	10	0.66056	D	0.02	.	13.3409	0.60545	0.0:0.0:0.4578:0.5422	.	3482	P08F94	PKHD1_HUMAN	C	3482	ENSP00000360158:R3482C	ENSP00000360158:R3482C	R	-	1	0	PKHD1	51632439	0.999000	0.42202	0.472000	0.27241	0.911000	0.54048	2.559000	0.45888	0.717000	0.32145	0.655000	0.94253	CGC	PKHD1	-	NULL	ENSG00000170927		0.443	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1		0.00	38	0	G	NM_138694		51524480	-1			no_errors	ENST00000371117	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.533	A
PLCH2	9651	genome.wustl.edu	37	1	2433603	2433603	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:2433603G>A	ENST00000419816.2	+	21	2988	c.2714G>A	c.(2713-2715)gGc>gAc	p.G905D	PLCH2_ENST00000378486.3_Missense_Mutation_p.G905D|PLCH2_ENST00000288766.5_Missense_Mutation_p.G193D|PLCH2_ENST00000449969.1_Missense_Mutation_p.G878D|PLCH2_ENST00000378488.3_Missense_Mutation_p.G869D			O75038	PLCH2_HUMAN	phospholipase C, eta 2	905					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		CCAAAGCCCGGCTCGCTGGAC	0.687																																																	0													9.0	10.0	10.0					1																	2433603		1352	2806	4158	SO:0001583	missense	0			AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.2714G>A	1.37:g.2433603G>A	ENSP00000389803:p.Gly905Asp		A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,smart_Pleckstrin_homology,smart_EF_hand_dom,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.G905D	ENST00000419816.2	37	c.2714		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.36|14.36	2.513316|2.513316	0.44660|0.44660	.|.	.|.	ENSG00000149527|ENSG00000149527	ENST00000419816|ENST00000449969;ENST00000378486;ENST00000378488;ENST00000288766;ENST00000378483;ENST00000343889;ENST00000278878	.|T;T;T;T	.|0.24723	.|2.0;1.98;1.84;1.84	3.45|3.45	2.47|2.47	0.30058|0.30058	.|.	.|1.580920	.|0.05604	.|N	.|0.576960	T|T	0.30039|0.30039	0.0752|0.0752	L|L	0.47716|0.47716	1.5|1.5	0.37400|0.37400	D|D	0.912803|0.912803	.|P;P;P;P	.|0.44627	.|0.839;0.616;0.804;0.514	.|B;B;P;B	.|0.45681	.|0.298;0.199;0.49;0.165	T|T	0.34329|0.34329	-0.9833|-0.9833	5|10	.|0.35671	.|T	.|0.21	.|.	9.5117|9.5117	0.39080|0.39080	0.0:0.462:0.538:0.0|0.0:0.462:0.538:0.0	.|.	.|752;657;878;905	.|B9DI81;B9DI82;O75038-2;O75038	.|.;.;.;PLCH2_HUMAN	T|D	200|878;905;869;193;191;752;657	.|ENSP00000397289:G878D;ENSP00000367747:G905D;ENSP00000367749:G869D;ENSP00000288766:G193D	.|ENSP00000278878:G657D	A|G	+|+	1|2	0|0	PLCH2|PLCH2	2423463|2423463	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.905000|0.905000	0.53344|0.53344	5.957000|5.957000	0.70323|0.70323	1.759000|1.759000	0.51996|0.51996	0.491000|0.491000	0.48974|0.48974	GCT|GGC	PLCH2	-	NULL	ENSG00000149527		0.687	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	PLCH2	HGNC	protein_coding	OTTHUMT00000467514.1		0.00	28	0	G	NM_014638		2433603	+1			no_errors	ENST00000378486	ensembl	human	known	74_37	missense	15.79	15	3	SNP	1.000	A
PLXND1	23129	genome.wustl.edu	37	3	129288771	129288771	+	Silent	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:129288771G>A	ENST00000324093.4	-	20	3958	c.3780C>T	c.(3778-3780)atC>atT	p.I1260I	PLXND1_ENST00000393239.1_Silent_p.I1260I	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1260					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						GCAGTGTGGCGATGGTCTGGT	0.587																																					Ovarian(97;366 1484 3738 22084 39045)												0													87.0	74.0	79.0					3																	129288771		2203	4300	6503	SO:0001819	synonymous_variant	0			AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.3780C>T	3.37:g.129288771G>A			A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.I1260	ENST00000324093.4	37	c.3780	CCDS33854.1	3																																																																																			PLXND1	-	superfamily_Ig_E-set	ENSG00000004399		0.587	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXND1	HGNC	protein_coding	OTTHUMT00000356132.4	-	0.00	25	0	G	NM_015103		129288771	-1	tier1	-	no_errors	ENST00000324093	ensembl	human	known	74_37	silent	30.00	14	6	SNP	0.934	A
POLR2A	5430	genome.wustl.edu	37	17	7402772	7402772	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr17:7402772G>A	ENST00000322644.6	+	10	2032	c.1633G>A	c.(1633-1635)Gtg>Atg	p.V545M	POLR2A_ENST00000572844.1_Missense_Mutation_p.V545M	NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	545					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				ACTCACAGCAGTGCGCAAATT	0.577																																																	0													107.0	94.0	98.0					17																	7402772		2203	4300	6503	SO:0001583	missense	0					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.1633G>A	17.37:g.7402772G>A	ENSP00000314949:p.Val545Met		A6NN93|B9EH88|Q6NX41	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_Rpb1_6,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_7,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_II_repeat_euk,smart_RNA_pol_N	p.V545M	ENST00000322644.6	37	c.1633	CCDS32548.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.143956	0.94603	.	.	ENSG00000181222	ENST00000535204;ENST00000322644	T	0.79247	-1.25	6.04	6.04	0.98038	RNA polymerase Rpb1, domain 3 (1);RNA polymerase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.90642	0.7065	M	0.92367	3.3	0.80722	D	1	P;D	0.59767	0.889;0.986	P;P	0.62885	0.643;0.908	D	0.91960	0.5578	10	0.87932	D	0	-11.2144	19.3663	0.94464	0.0:0.0:1.0:0.0	.	545;545	P24928;Q6NX41	RPB1_HUMAN;.	M	501;545	ENSP00000314949:V545M	ENSP00000314949:V545M	V	+	1	0	SLC35G6	7343496	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	9.165000	0.94761	2.873000	0.98535	0.563000	0.77884	GTG	POLR2A	-	pfam_RNA_pol_Rpb1_3,smart_RNA_pol_N	ENSG00000181222		0.577	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2A	HGNC	protein_coding	OTTHUMT00000437967.1	-	0.00	26	0	G	NM_000937		7402772	+1	tier1	-	no_errors	ENST00000322644	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	A
PPP3CA	5530	genome.wustl.edu	37	4	102004363	102004363	+	Silent	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:102004363G>T	ENST00000394854.3	-	7	1523	c.840C>A	c.(838-840)gcC>gcA	p.A280A	PPP3CA_ENST00000323055.6_Silent_p.A280A|PPP3CA_ENST00000394853.4_Silent_p.A280A|PPP3CA_ENST00000523694.2_Silent_p.A213A|PPP3CA_ENST00000512215.1_Intron|PPP3CA_ENST00000507176.1_Silent_p.A182A	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	280	Catalytic.				calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)	p.A280A(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		GGGCTTCGTGGGCTCGGAGTA	0.433																																																	1	Substitution - coding silent(1)	ovary(1)											274.0	286.0	282.0					4																	102004363		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.840C>A	4.37:g.102004363G>T			A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Silent	SNP	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.A280	ENST00000394854.3	37	c.840	CCDS34037.1	4																																																																																			PPP3CA	-	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000138814		0.433	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PPP3CA	HGNC	protein_coding	OTTHUMT00000258379.2		0.00	48	0	G	NM_000944		102004363	-1			no_errors	ENST00000394854	ensembl	human	known	74_37	silent	5.36	53	3	SNP	1.000	T
POU4F2	5458	genome.wustl.edu	37	4	147561598	147561598	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:147561598G>A	ENST00000281321.3	+	2	1116	c.868G>A	c.(868-870)Ggc>Agc	p.G290S	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	290	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					CAAGATCCCCGGCGTGGGCTC	0.617																																																	0													51.0	53.0	52.0					4																	147561598		2203	4300	6503	SO:0001583	missense	0			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.868G>A	4.37:g.147561598G>A	ENSP00000281321:p.Gly290Ser		B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeobox_dom,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_POU_specific,prints_POU	p.G290S	ENST00000281321.3	37	c.868	CCDS34074.1	4	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102192	0.76983	.	.	ENSG00000151615	ENST00000281321	D	0.82803	-1.65	5.37	5.37	0.77165	POU-specific (3);Lambda repressor-like, DNA-binding (2);	0.000000	0.85682	D	0.000000	D	0.92805	0.7712	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93859	0.7152	10	0.87932	D	0	.	19.1135	0.93328	0.0:0.0:1.0:0.0	.	290	Q12837	PO4F2_HUMAN	S	290	ENSP00000281321:G290S	ENSP00000281321:G290S	G	+	1	0	POU4F2	147781048	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.841000	0.99482	2.528000	0.85240	0.561000	0.74099	GGC	POU4F2	-	pfam_POU_specific,superfamily_Lambda_DNA-bd_dom,smart_POU_specific,pfscan_POU_specific	ENSG00000151615		0.617	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F2	HGNC	protein_coding	OTTHUMT00000367020.1	-	0.00	59	0	G	NM_004575		147561598	+1	tier1	-	no_errors	ENST00000281321	ensembl	human	known	74_37	missense	38.81	41	26	SNP	1.000	A
PRKDC	5591	genome.wustl.edu	37	8	48739330	48739330	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:48739330G>C	ENST00000314191.2	-	64	8723	c.8667C>G	c.(8665-8667)atC>atG	p.I2889M	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.I2889M	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2890	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CTAGCAGGCGGATGCCCACGG	0.657								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0													15.0	19.0	18.0					8																	48739330		2016	4178	6194	SO:0001583	missense	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.8667C>G	8.37:g.48739330G>C	ENSP00000313420:p.Ile2889Met		P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.I2889M	ENST00000314191.2	37	c.8667		8	.	.	.	.	.	.	.	.	.	.	G	14.93	2.682864	0.47991	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.03553	3.97;3.89	5.55	0.425	0.16473	PIK-related kinase (1);	0.304122	0.29853	N	0.011039	T	0.10252	0.0251	M	0.76328	2.33	0.46044	D	0.998834	D;B	0.63046	0.992;0.437	D;B	0.63283	0.913;0.263	T	0.09100	-1.0690	10	0.72032	D	0.01	.	2.1951	0.03909	0.2659:0.12:0.4902:0.1238	.	2889;2890	E7EUY0;P78527	.;PRKDC_HUMAN	M	2889	ENSP00000313420:I2889M;ENSP00000345182:I2889M	ENSP00000313420:I2889M	I	-	3	3	PRKDC	48901883	1.000000	0.71417	0.006000	0.13384	0.894000	0.52154	1.658000	0.37376	-0.229000	0.09854	-0.137000	0.14449	ATC	PRKDC	-	pfscan_PIK_FAT	ENSG00000253729		0.657	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		-	0.00	51	0	G	NM_001081640		48739330	-1	tier1	-	no_errors	ENST00000314191	ensembl	human	known	74_37	missense	39.13	28	18	SNP	1.000	C
PRSS36	146547	genome.wustl.edu	37	16	31155123	31155123	+	Silent	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr16:31155123G>A	ENST00000268281.4	-	7	814	c.756C>T	c.(754-756)ggC>ggT	p.G252G	PRSS36_ENST00000418068.2_Silent_p.G252G|PRSS36_ENST00000569305.1_Silent_p.G252G	NM_001258290.1|NM_173502.4	NP_001245219.1|NP_775773.2	Q5K4E3	POLS2_HUMAN	protease, serine, 36	252	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	serine-type endopeptidase activity (GO:0004252)			kidney(2)|large_intestine(4)|lung(8)|ovary(3)	17						ACCAGCGGCCGCCTTCCTCAC	0.597																																																	0													38.0	42.0	41.0					16																	31155123		2197	4299	6496	SO:0001819	synonymous_variant	0			AK075142	CCDS32436.1, CCDS58452.1, CCDS58453.1	16p11.2	2014-09-04			ENSG00000178226			"""Serine peptidases / Serine peptidases"""	26906	protein-coding gene	gene with protein product	"""polyserase 2"""	610560				15536082	Standard	NM_173502		Approved	FLJ90661	uc002ebd.4	Q5K4E3	OTTHUMG00000176751	ENST00000268281.4:c.756C>T	16.37:g.31155123G>A			A8K2P5|B4DW80|B7ZMK8|E7EX56|Q8NBY4	Silent	SNP	pirsf_Pept_S1A_polyserase-2,pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.G252	ENST00000268281.4	37	c.756	CCDS32436.1	16																																																																																			PRSS36	-	pirsf_Pept_S1A_polyserase-2,pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000178226		0.597	PRSS36-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRSS36	HGNC	protein_coding	OTTHUMT00000433542.1	-	0.00	37	0	G	NM_173502		31155123	-1	tier1	-	no_errors	ENST00000268281	ensembl	human	known	74_37	silent	24.32	28	9	SNP	0.000	A
PSG3	5671	genome.wustl.edu	37	19	43237052	43237052	+	Missense_Mutation	SNP	T	T	G	rs16976174		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:43237052T>G	ENST00000327495.5	-	3	777	c.593A>C	c.(592-594)aAc>aCc	p.N198T	PSG3_ENST00000595140.1_Missense_Mutation_p.N198T|PSG3_ENST00000490592.1_5'Flank	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	198	Ig-like C2-type 1.		N -> T (in dbSNP:rs16976174).		defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				GGTCCTTTTGTTTTTGGACAA	0.507																																																	0													243.0	246.0	245.0					19																	43237052		2203	4300	6503	SO:0001583	missense	0				CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.593A>C	19.37:g.43237052T>G	ENSP00000332215:p.Asn198Thr		Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.N198T	ENST00000327495.5	37	c.593	CCDS12611.1	19	.	.	.	.	.	.	.	.	.	.	-	0.078	-1.188417	0.01607	.	.	ENSG00000221826	ENST00000327495	T	0.10668	2.85	1.59	-1.21	0.09524	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.06005	0.0156	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.40534	-0.9558	9	0.29301	T	0.29	.	6.0173	0.19611	0.0:0.0:0.274:0.726	rs16976174;rs17173154	176;198	Q08266;Q16557	.;PSG3_HUMAN	T	198	ENSP00000332215:N198T	ENSP00000332215:N198T	N	-	2	0	PSG3	47928892	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.565000	0.05929	-0.678000	0.05224	-2.490000	0.00194	AAC	PSG3	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000221826		0.507	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	PSG3	HGNC	protein_coding	OTTHUMT00000321423.2	-	0.00	244	0	T	NM_021016		43237052	-1	tier1	rs16976174	no_errors	ENST00000327495	ensembl	human	known	74_37	missense	38.42	117	73	SNP	0.000	G
RALYL	138046	genome.wustl.edu	37	8	85774633	85774633	+	Silent	SNP	C	C	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:85774633C>A	ENST00000521268.1	+	6	1621	c.516C>A	c.(514-516)gtC>gtA	p.V172V	RALYL_ENST00000522455.1_Silent_p.V172V|RALYL_ENST00000518566.1_Silent_p.V161V|RALYL_ENST00000523850.1_Silent_p.V99V|RALYL_ENST00000517638.1_Silent_p.V185V|RALYL_ENST00000521695.1_Silent_p.V172V|RALYL_ENST00000521376.1_Silent_p.V83V	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	172							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						GGAAAGGAGTCTTTTCCATGA	0.483																																																	0													68.0	72.0	71.0					8																	85774633		1929	4143	6072	SO:0001819	synonymous_variant	0				CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.516C>A	8.37:g.85774633C>A			B3KTH2|G3V129|Q6ZW87|Q8N1C2	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.V172	ENST00000521268.1	37	c.516	CCDS55253.1	8																																																																																			RALYL	-	pirsf_hnRNP_C_Raly	ENSG00000184672		0.483	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALYL	HGNC	protein_coding	OTTHUMT00000379448.1	-	0.00	55	0	C			85774633	+1	tier1	-	no_errors	ENST00000521268	ensembl	human	known	74_37	silent	29.23	46	19	SNP	1.000	A
RBM5	10181	genome.wustl.edu	37	3	50144468	50144468	+	Intron	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:50144468C>T	ENST00000347869.3	+	11	1128				RBM5_ENST00000441812.2_3'UTR	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5						apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCCCTACTGTCCTGTGTAACC	0.473																																																	0																																										SO:0001627	intron_variant	0			U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.953+171C>T	3.37:g.50144468C>T			B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	RNA	SNP	-	NULL	ENST00000347869.3	37	NULL	CCDS2810.1	3																																																																																			RBM5	-	-	ENSG00000003756		0.473	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM5	HGNC	protein_coding	OTTHUMT00000345797.3	-	0.00	39	0	C	NM_005778		50144468	+1	tier1	-	no_errors	ENST00000441812	ensembl	human	known	74_37	rna	25.00	27	9	SNP	0.000	T
REXO1	57455	genome.wustl.edu	37	19	1828022	1828022	+	Missense_Mutation	SNP	C	C	T	rs375966236	byFrequency	TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:1828022C>T	ENST00000170168.4	-	2	860	c.766G>A	c.(766-768)Gcc>Acc	p.A256T	REXO1_ENST00000587524.1_5'UTR	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	256						nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCGCTTGGCGGCCCGCTCA	0.657													.|||	3	0.000599042	0.0023	0.0	5008	,	,		11348	0.0		0.0	False		,,,				2504	0.0																0													17.0	24.0	22.0					19																	1828022		2195	4290	6485	SO:0001583	missense	0			AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.766G>A	19.37:g.1828022C>T	ENSP00000170168:p.Ala256Thr		Q9ULT2	Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.A256T	ENST00000170168.4	37	c.766	CCDS32866.1	19	.	.	.	.	.	.	.	.	.	.	C	0.007	-2.012672	0.00422	.	.	ENSG00000079313	ENST00000170168;ENST00000413153	T	0.10477	2.87	3.83	-4.62	0.03370	.	1.621800	0.03786	N	0.262050	T	0.02012	0.0063	N	0.00483	-1.445	0.09310	N	1	B;B	0.15930	0.015;0.0	B;B	0.08055	0.003;0.0	T	0.40572	-0.9556	10	0.02654	T	1	-6.2268	2.7457	0.05267	0.0949:0.1908:0.2397:0.4746	.	210;256	F5H016;Q8N1G1	.;REXO1_HUMAN	T	256;210	ENSP00000170168:A256T	ENSP00000170168:A256T	A	-	1	0	REXO1	1779022	0.002000	0.14202	0.612000	0.29024	0.002000	0.02628	-0.512000	0.06313	-0.388000	0.07797	-1.191000	0.01696	GCC	REXO1	-	NULL	ENSG00000079313		0.657	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO1	HGNC	protein_coding	OTTHUMT00000449200.1	-	0.00	61	0	C	NM_020695		1828022	-1	tier1	-	no_errors	ENST00000170168	ensembl	human	known	74_37	missense	48.61	37	35	SNP	0.002	T
RIN3	79890	genome.wustl.edu	37	14	93154538	93154540	+	In_Frame_Del	DEL	GGC	GGC	-	rs71461983|rs570458246|rs68153141|rs71698059	byFrequency	TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	GGC	GGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr14:93154538_93154540delGGC	ENST00000216487.7	+	10	3058_3060	c.2899_2901delGGC	c.(2899-2901)ggcdel	p.G972del	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	972	Poly-Gly.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				GGACGGTGGTGGCGGCGGCGGCG	0.739																																																	0										2780,766		1192,396,185							0.4		dbSNP_130	12	4625,2291		1742,1141,575	no	coding	RIN3	NM_024832.3		2934,1537,760	A1A1,A1R,RR		33.1261,21.6018,29.22				7405,3057				SO:0001651	inframe_deletion	0			BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.2899_2901delGGC	14.37:g.93154547_93154549delGGC	ENSP00000216487:p.Gly972del		Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	In_Frame_Del	DEL	pfam_VPS9,smart_SH2,smart_VPS9_subgr,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.G970in_frame_del	ENST00000216487.7	37	c.2899_2901	CCDS32144.1	14																																																																																			RIN3	-	NULL	ENSG00000100599		0.739	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN3	HGNC	protein_coding	OTTHUMT00000412269.1		0.00	8	0	GGC			93154540	+1	tier1		no_errors	ENST00000216487	ensembl	human	known	74_37	in_frame_del	44.44	5	4	DEL	0.984:0.981:0.979	-
RNF150	57484	genome.wustl.edu	37	4	142053867	142053867	+	Silent	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:142053867G>A	ENST00000515673.2	-	1	129	c.96C>T	c.(94-96)acC>acT	p.T32T	RNF150_ENST00000306799.3_Silent_p.T32T|RNF150_ENST00000420921.2_Intron|RNF150_ENST00000507500.1_Silent_p.T32T			Q9ULK6	RN150_HUMAN	ring finger protein 150	32						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					TCTCGGCCACGGTAAAGTCCA	0.632																																																	0													77.0	63.0	68.0					4																	142053867		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.96C>T	4.37:g.142053867G>A			Q3T1D0|Q6ZNW6	Silent	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.T32	ENST00000515673.2	37	c.96	CCDS34065.1	4																																																																																			RNF150	-	NULL	ENSG00000170153		0.632	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF150	HGNC	protein_coding	OTTHUMT00000364739.2	-	0.00	11	0	G	XM_291090		142053867	-1	tier1	-	no_errors	ENST00000515673	ensembl	human	known	74_37	silent	38.10	13	8	SNP	0.959	A
RNF43	54894	genome.wustl.edu	37	17	56435892	56435892	+	Silent	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr17:56435892G>T	ENST00000584437.1	-	8	3200	c.1245C>A	c.(1243-1245)ggC>ggA	p.G415G	BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000581868.1_Silent_p.G288G|RNF43_ENST00000407977.2_Silent_p.G415G|RNF43_ENST00000500597.2_Silent_p.G374G|RNF43_ENST00000577625.1_Silent_p.G288G|RNF43_ENST00000583753.1_Silent_p.G374G|RNF43_ENST00000577716.1_Silent_p.G415G			Q68DV7	RNF43_HUMAN	ring finger protein 43	415					negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCAGTCCCCAGCCTTGTGCAT	0.672																																																	0													30.0	32.0	31.0					17																	56435892		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.1245C>A	17.37:g.56435892G>T			A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Silent	SNP	pfam_Znf_C3HC4_RING-type,superfamily_PAS,smart_Znf_RING,pfscan_Znf_RING	p.G415	ENST00000584437.1	37	c.1245	CCDS11607.1	17																																																																																			RNF43	-	NULL	ENSG00000108375		0.672	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF43	HGNC	protein_coding	OTTHUMT00000444713.1	-	0.00	65	0	G	NM_017763		56435892	-1	tier1	-	no_errors	ENST00000407977	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.924	T
SCAPER	49855	genome.wustl.edu	37	15	76958128	76958128	+	Silent	SNP	C	C	T	rs202054995		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr15:76958128C>T	ENST00000563290.1	-	21	2606	c.2511G>A	c.(2509-2511)gaG>gaA	p.E837E	SCAPER_ENST00000538941.2_Silent_p.E591E|SCAPER_ENST00000324767.7_Silent_p.E837E			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	837						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						AGGAAAGATGCTCCTGCAAGa	0.303													C|||	1	0.000199681	0.0	0.0	5008	,	,		15431	0.0		0.001	False		,,,				2504	0.0																0								C	,	0,3408		0,0,1704	22.0	18.0	19.0		1773,2511	2.5	1.0	15		19	3,7651		0,3,3824	no	coding-synonymous,coding-synonymous	SCAPER	NM_001145923.1,NM_020843.2	,	0,3,5528	TT,TC,CC		0.0392,0.0,0.0271	,	591/1155,837/1401	76958128	3,11059	1704	3827	5531	SO:0001819	synonymous_variant	0			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.2511G>A	15.37:g.76958128C>T			F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Silent	SNP	smart_Znf_U1	p.E837	ENST00000563290.1	37	c.2511	CCDS53962.1	15																																																																																			SCAPER	-	NULL	ENSG00000140386		0.303	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	HGNC	protein_coding	OTTHUMT00000419698.1	-	0.00	27	0	C	NM_020843		76958128	-1	tier1	rs202054995	no_errors	ENST00000324767	ensembl	human	known	74_37	silent	38.89	11	7	SNP	1.000	T
SCN1A	6323	genome.wustl.edu	37	2	166868761	166868761	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:166868761T>G	ENST00000303395.4	-	19	3736	c.3737A>C	c.(3736-3738)aAg>aCg	p.K1246T	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.K1218T|SCN1A_ENST00000375405.3_Missense_Mutation_p.K1235T|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.K1246T			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1246					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTTAATCGTCTTTCGCTGATC	0.289																																																	0													65.0	62.0	63.0					2																	166868761		2202	4299	6501	SO:0001583	missense	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.3737A>C	2.37:g.166868761T>G	ENSP00000303540:p.Lys1246Thr		E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.K1246T	ENST00000303395.4	37	c.3737	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	T	27.2	4.806805	0.90623	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.97430	-4.38;-4.38;-4.38;-4.38	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000006	D	0.97879	0.9303	L	0.59912	1.85	0.58432	D	0.999999	D;D;P	0.71674	0.993;0.998;0.94	P;D;P	0.78314	0.851;0.991;0.694	D	0.98891	1.0773	10	0.72032	D	0.01	.	15.87	0.79108	0.0:0.0:0.0:1.0	.	1235;1218;1246	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	T	1246;1246;1235;1218	ENSP00000407030:K1246T;ENSP00000303540:K1246T;ENSP00000364554:K1235T;ENSP00000386312:K1218T	ENSP00000303540:K1246T	K	-	2	0	SCN1A	166577007	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.232000	0.72313	2.137000	0.66172	0.455000	0.32223	AAG	SCN1A	-	NULL	ENSG00000144285		0.289	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	-	0.00	53	0	T	NM_006920		166868761	-1	tier1	-	no_errors	ENST00000303395	ensembl	human	known	74_37	missense	35.71	27	15	SNP	1.000	G
SDK1	221935	genome.wustl.edu	37	7	4051763	4051763	+	Silent	SNP	G	G	A	rs375976550		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr7:4051763G>A	ENST00000404826.2	+	16	2455	c.2316G>A	c.(2314-2316)ccG>ccA	p.P772P	SDK1_ENST00000389531.3_Silent_p.P772P	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	772	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GTGCTCCCCCGAAAAATATAG	0.522																																																	0								G		1,4405	2.1+/-5.4	0,1,2202	143.0	160.0	154.0		2316	-10.6	0.0	7		154	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SDK1	NM_152744.3		0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154		772/2214	4051763	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2316G>A	7.37:g.4051763G>A			Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P772	ENST00000404826.2	37	c.2316	CCDS34590.1	7																																																																																			SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.522	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	-	0.00	55	0	G	NM_152744		4051763	+1	tier1	-	no_errors	ENST00000404826	ensembl	human	known	74_37	silent	19.74	61	15	SNP	0.000	A
SEC16B	89866	genome.wustl.edu	37	1	177905467	177905467	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:177905467G>A	ENST00000308284.6	-	20	2626	c.2537C>T	c.(2536-2538)cCt>cTt	p.P846L	SEC16B_ENST00000495165.1_5'UTR|RP4-798P15.3_ENST00000354921.3_RNA	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	846					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						GCCATCAGGAGGCTGGGAAGT	0.463																																																	0													145.0	140.0	142.0					1																	177905467		2001	4190	6191	SO:0001583	missense	0			AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2537C>T	1.37:g.177905467G>A	ENSP00000308339:p.Pro846Leu		A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Missense_Mutation	SNP	NULL	p.P846L	ENST00000308284.6	37	c.2537	CCDS44281.1	1	.	.	.	.	.	.	.	.	.	.	G	6.024	0.372870	0.11409	.	.	ENSG00000120341	ENST00000308284;ENST00000414025;ENST00000239472	T	0.13901	2.55	4.88	2.53	0.30540	.	1.233150	0.05444	N	0.548156	T	0.08492	0.0211	N	0.22421	0.69	0.09310	N	1	B;B;B;B	0.24092	0.01;0.007;0.097;0.045	B;B;B;B	0.18871	0.006;0.006;0.023;0.01	T	0.37888	-0.9686	10	0.08599	T	0.76	1.9974	5.1414	0.14961	0.0:0.0977:0.2241:0.6782	.	401;847;846;543	B1AM07;B1AM08;Q96JE7;Q96PW0	.;.;SC16B_HUMAN;.	L	846;530;561	ENSP00000308339:P846L	ENSP00000239472:P561L	P	-	2	0	AL359075.1	176172090	0.005000	0.15991	0.000000	0.03702	0.063000	0.16089	0.776000	0.26704	0.422000	0.26005	-0.274000	0.10170	CCT	SEC16B	-	NULL	ENSG00000120341		0.463	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC16B	HGNC	protein_coding	OTTHUMT00000084773.16	-	0.00	94	0	G	NM_033127		177905467	-1	tier1	-	no_errors	ENST00000308284	ensembl	human	known	74_37	missense	18.00	82	18	SNP	0.000	A
SEL1L2	80343	genome.wustl.edu	37	20	13856704	13856704	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr20:13856704A>C	ENST00000284951.5	-	12	1158	c.1084T>G	c.(1084-1086)Ttt>Gtt	p.F362V	SEL1L2_ENST00000378072.5_Missense_Mutation_p.F362V|SEL1L2_ENST00000486903.1_5'UTR			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	362						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						GCCATGGAAAAGTACTTGAAG	0.388																																																	0													184.0	178.0	180.0					20																	13856704		1932	4145	6077	SO:0001583	missense	0			AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.1084T>G	20.37:g.13856704A>C	ENSP00000284951:p.Phe362Val		B4DXX5	Missense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.F362V	ENST00000284951.5	37	c.1084		20	.	.	.	.	.	.	.	.	.	.	A	19.62	3.861268	0.71949	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	T;T	0.55588	0.51;0.51	6.04	6.04	0.98038	Tetratricopeptide-like helical (1);	0.087641	0.50627	D	0.000117	T	0.75568	0.3867	H	0.96430	3.82	0.50313	D	0.999868	P;B	0.52316	0.952;0.295	P;B	0.52189	0.692;0.218	D	0.83859	0.0267	10	0.87932	D	0	-9.3153	14.5796	0.68278	1.0:0.0:0.0:0.0	.	362;362	B4DXX5;Q5TEA6	.;SE1L2_HUMAN	V	362	ENSP00000367312:F362V;ENSP00000284951:F362V	ENSP00000284951:F362V	F	-	1	0	SEL1L2	13804704	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.721000	0.84768	2.330000	0.79161	0.529000	0.55759	TTT	SEL1L2	-	pfam_Sel1-like,smart_Sel1-like	ENSG00000101251		0.388	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	HGNC	protein_coding	OTTHUMT00000078067.3	-	0.00	74	0	A	NM_025229		13856704	-1	tier1	-	no_errors	ENST00000284951	ensembl	human	known	74_37	missense	43.85	72	57	SNP	1.000	C
SEPT11	55752	genome.wustl.edu	37	4	77926840	77926840	+	Missense_Mutation	SNP	G	G	A	rs368053703		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:77926840G>A	ENST00000264893.6	+	3	430	c.229G>A	c.(229-231)Ggt>Agt	p.G77S	SEPT11_ENST00000510515.1_Missense_Mutation_p.G87S|SEPT11_ENST00000512575.1_Intron|SEPT11_ENST00000541121.1_Missense_Mutation_p.G87S|SEPT11_ENST00000502584.1_Missense_Mutation_p.G77S|SEPT11_ENST00000505788.1_Missense_Mutation_p.G77S	NM_018243.2	NP_060713.1	Q9NVA2	SEP11_HUMAN	septin 11	77	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)|protein heterooligomerization (GO:0051291)	cell junction (GO:0030054)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|septin complex (GO:0031105)|stress fiber (GO:0001725)|synapse (GO:0045202)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|stomach(1)	11						CAATGAACCAGGTGTTCGGTT	0.423																																																	0								G	SER/GLY	0,4406		0,0,2203	144.0	138.0	140.0		229	5.4	1.0	4		140	1,8599	1.2+/-3.3	0,1,4299	no	missense	SEPT11	NM_018243.2	56	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	77/430	77926840	1,13005	2203	4300	6503	SO:0001583	missense	0			AK001711	CCDS34018.1	4q21.1	2013-01-21			ENSG00000138758	ENSG00000138758		"""Septins"""	25589	protein-coding gene	gene with protein product		612887				14999297, 15140406	Standard	NM_018243		Approved	FLJ10849	uc003hkj.3	Q9NVA2	OTTHUMG00000160854	ENST00000264893.6:c.229G>A	4.37:g.77926840G>A	ENSP00000264893:p.Gly77Ser		B7Z7Z6|E9KL32|Q4W5G1|Q7L4N1|Q96SP1|Q9UFY9	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	p.G87S	ENST00000264893.6	37	c.259	CCDS34018.1	4	.	.	.	.	.	.	.	.	.	.	G	16.68	3.190846	0.58017	0.0	1.16E-4	ENSG00000138758	ENST00000264893;ENST00000502584;ENST00000510641;ENST00000505788;ENST00000510515;ENST00000504637;ENST00000512778;ENST00000541121	T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.38	5.38	0.77491	.	0.075253	0.56097	D	0.000031	T	0.42223	0.1193	L	0.37697	1.125	0.54753	D	0.999983	B;B	0.17038	0.013;0.02	B;B	0.18871	0.008;0.023	T	0.17137	-1.0379	10	0.30078	T	0.28	.	19.1464	0.93471	0.0:0.0:1.0:0.0	.	87;77	Q9NVA2-2;Q9NVA2	.;SEP11_HUMAN	S	77;77;69;77;87;87;87;87	ENSP00000264893:G77S;ENSP00000426344:G77S;ENSP00000420839:G69S;ENSP00000424925:G77S;ENSP00000422896:G87S;ENSP00000425262:G87S;ENSP00000422047:G87S;ENSP00000443701:G87S	ENSP00000264893:G77S	G	+	1	0	SEPT11	78145864	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.471000	0.97696	2.494000	0.84150	0.557000	0.71058	GGT	SEPT11	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	ENSG00000138758		0.423	SEPT11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEPT11	HGNC	protein_coding	OTTHUMT00000362676.1	-	0.00	40	0	G	NM_018243		77926840	+1	tier1	-	no_errors	ENST00000541121	ensembl	human	known	74_37	missense	58.33	24	35	SNP	1.000	A
SERPINA1	5265	genome.wustl.edu	37	14	94844884	94844885	+	Frame_Shift_Ins	INS	-	-	G	rs143329723|rs121912712	byFrequency	TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr14:94844884_94844885insG	ENST00000448921.1	-	7	1730_1731	c.1158_1159insC	c.(1156-1161)cccgagfs	p.E387fs	SERPINA1_ENST00000393087.4_Frame_Shift_Ins_p.E387fs|SERPINA1_ENST00000449399.3_Frame_Shift_Ins_p.E387fs|SERPINA1_ENST00000355814.4_Frame_Shift_Ins_p.E387fs|SERPINA1_ENST00000404814.4_Frame_Shift_Ins_p.E387fs|SERPINA1_ENST00000393088.4_Frame_Shift_Ins_p.E387fs|SERPINA1_ENST00000437397.1_Frame_Shift_Ins_p.E387fs|SERPINA1_ENST00000440909.1_Frame_Shift_Ins_p.E387fs	NM_001002236.2|NM_001127701.1|NM_001127703.1|NM_001127704.1|NM_001127705.1	NP_001002236.1|NP_001121173.1|NP_001121175.1|NP_001121176.1|NP_001121177.1	P01009	A1AT_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1	387	RCL.		E -> K (in Christchurch; dbSNP:rs121912712).		acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of proteolysis (GO:0030162)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)	glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|skin(6)|stomach(1)	24		all_cancers(154;0.0649)|all_epithelial(191;0.223)		Epithelial(152;0.135)|COAD - Colon adenocarcinoma(157;0.207)|all cancers(159;0.221)		AACTTGACCTCGGGGGGGATAG	0.49																																																	0			GRCh37	CD890162|CI941951	SERPINA1	D|I	rs121912712|rs143329723																																			SO:0001589	frameshift_variant	0			X01683	CCDS9925.1	14q32.1	2014-02-18	2005-08-18		ENSG00000197249	ENSG00000197249		"""Serine (or cysteine) peptidase inhibitors"""	8941	protein-coding gene	gene with protein product	"""protease inhibitor 1 (anti-elastase), alpha-1-antitrypsin"""	107400	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1"""	PI		24172014	Standard	NM_000295		Approved	AAT, A1A, PI1, alpha-1-antitrypsin, A1AT, alpha1AT	uc010aux.3	P01009	OTTHUMG00000150355	ENST00000448921.1:c.1159dupC	14.37:g.94844891_94844891dupG	ENSP00000416066:p.Glu387fs		A6PX14|B2RDQ8|Q0PVP5|Q13672|Q53XB8|Q5U0M1|Q7M4R2|Q86U18|Q86U19|Q96BF9|Q96ES1|Q9P1P0|Q9UCE6|Q9UCM3	Frame_Shift_Ins	INS	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.E386fs	ENST00000448921.1	37	c.1159_1158	CCDS9925.1	14																																																																																			SERPINA1	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000197249		0.490	SERPINA1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA1	HGNC	protein_coding	OTTHUMT00000317768.2		0.00	54	0	-	NM_001002235		94844885	-1	tier1		no_errors	ENST00000355814	ensembl	human	known	74_37	frame_shift_ins	43.59	22	17	INS	0.000:0.000	G
SHISA9	729993	genome.wustl.edu	37	16	13297270	13297270	+	Silent	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr16:13297270C>T	ENST00000424107.3	+	3	1156	c.711C>T	c.(709-711)aaC>aaT	p.N237N	SHISA9_ENST00000558583.1_Silent_p.N278N|AC009134.1_ENST00000571939.1_RNA			B4DS77	SHSA9_HUMAN	shisa family member 9	237					regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)				breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						AGATGAACAACGCAGTGCCCA	0.557																																																	0													166.0	146.0	152.0					16																	13297270		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.711C>T	16.37:g.13297270C>T			C9J314|C9JCE9	Silent	SNP	NULL	p.N278	ENST00000424107.3	37	c.834	CCDS45417.2	16																																																																																			SHISA9	-	NULL	ENSG00000237515		0.557	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHISA9	HGNC	protein_coding	OTTHUMT00000334564.5	-	0.00	59	0	C	NM_001145204		13297270	+1	tier1	-	no_errors	ENST00000558583	ensembl	human	known	74_37	silent	11.32	47	6	SNP	0.994	T
SI	6476	genome.wustl.edu	37	3	164724661	164724661	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:164724661A>C	ENST00000264382.3	-	37	4411	c.4349T>G	c.(4348-4350)gTt>gGt	p.V1450G		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1450	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GTAATGCAAAACTGATGTTCC	0.358										HNSCC(35;0.089)																																							0													128.0	114.0	119.0					3																	164724661		2203	4300	6503	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4349T>G	3.37:g.164724661A>C	ENSP00000264382:p.Val1450Gly		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.V1450G	ENST00000264382.3	37	c.4349	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	A	15.83	2.950345	0.53186	.	.	ENSG00000090402	ENST00000264382	D	0.92752	-3.1	5.62	5.62	0.85841	Glycoside hydrolase, superfamily (1);	0.000000	0.64402	D	0.000001	D	0.95765	0.8622	M	0.78637	2.42	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	D	0.96230	0.9167	10	0.87932	D	0	.	14.7915	0.69846	1.0:0.0:0.0:0.0	.	1450	P14410	SUIS_HUMAN	G	1450	ENSP00000264382:V1450G	ENSP00000264382:V1450G	V	-	2	0	SI	166207355	1.000000	0.71417	0.581000	0.28614	0.107000	0.19398	6.566000	0.73978	2.139000	0.66308	0.397000	0.26171	GTT	SI	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000090402		0.358	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	-	0.00	50	0	A	NM_001041		164724661	-1	tier1	-	no_errors	ENST00000264382	ensembl	human	known	74_37	missense	25.37	50	17	SNP	0.995	C
SLC22A31	146429	genome.wustl.edu	37	16	89265964	89265964	+	Missense_Mutation	SNP	C	C	T	rs76283034		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr16:89265964C>T	ENST00000562855.2	-	4	469	c.470G>A	c.(469-471)cGg>cAg	p.R157Q				A6NKX4	S22AV_HUMAN	solute carrier family 22, member 31	157					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)										AAAAACTGCCCGGCGTCCAAA	0.647																																																	0																																										SO:0001583	missense	0				CCDS73927.1	16q24.3	2014-02-12	2011-07-12		ENSG00000259803	ENSG00000259803		"""Solute carriers"""	27091	protein-coding gene	gene with protein product							Standard	NM_001242757		Approved		uc021tmr.1	A6NKX4	OTTHUMG00000175615	ENST00000562855.2:c.470G>A	16.37:g.89265964C>T	ENSP00000474621:p.Arg157Gln			Missense_Mutation	SNP	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R157Q	ENST00000562855.2	37	c.470		16																																																																																			SLC22A31	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000259803		0.647	SLC22A31-006	NOVEL	basic|appris_principal	protein_coding	SLC22A31	HGNC	protein_coding	OTTHUMT00000469767.1	-	0.00	67	0	C	NM_001242757		89265964	-1	tier1	rs76283034	no_errors	ENST00000562855	ensembl	human	novel	74_37	missense	52.63	27	30	SNP	0.250	T
SLC30A9	10463	genome.wustl.edu	37	4	42080286	42080286	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:42080286G>T	ENST00000264451.7	+	17	1786	c.1606G>T	c.(1606-1608)Gaa>Taa	p.E536*		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	536					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E536*(1)		central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TAAACATGGAGAAAATATTAT	0.284																																																	1	Substitution - Nonsense(1)	large_intestine(1)											53.0	59.0	57.0					4																	42080286		2201	4298	6499	SO:0001587	stop_gained	0			AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.1606G>T	4.37:g.42080286G>T	ENSP00000264451:p.Glu536*		Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Nonsense_Mutation	SNP	pfam_Cation_efflux,superfamily_DNA-bd_dom_put,tigrfam_Cation_efflux	p.E536*	ENST00000264451.7	37	c.1606	CCDS3465.1	4	.	.	.	.	.	.	.	.	.	.	G	39	7.594098	0.98378	.	.	ENSG00000014824	ENST00000264451;ENST00000536881	.	.	.	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-23.428	19.8737	0.96861	0.0:0.0:1.0:0.0	.	.	.	.	X	536;364	.	ENSP00000264451:E536X	E	+	1	0	SLC30A9	41775043	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.185000	0.94900	2.693000	0.91896	0.650000	0.86243	GAA	SLC30A9	-	NULL	ENSG00000014824		0.284	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A9	HGNC	protein_coding	OTTHUMT00000216842.3	-	0.00	44	0	G			42080286	+1	tier1	-	no_errors	ENST00000264451	ensembl	human	known	74_37	nonsense	23.44	49	15	SNP	1.000	T
SLC25A4	291	genome.wustl.edu	37	4	186066045	186066045	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:186066045G>A	ENST00000281456.6	+	2	371	c.239G>A	c.(238-240)cGt>cAt	p.R80H		NM_001151.3	NP_001142.2	P12235	ADT1_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	80					adenine transport (GO:0015853)|apoptotic mitochondrial changes (GO:0008637)|energy reserve metabolic process (GO:0006112)|generation of precursor metabolites and energy (GO:0006091)|mitochondrial genome maintenance (GO:0000002)|negative regulation of necroptotic process (GO:0060546)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	AACGTGATCCGTTACTTCCCC	0.522																																																	0													159.0	154.0	156.0					4																	186066045		2203	4300	6503	SO:0001583	missense	0			BC008664	CCDS34114.1	4q35	2014-09-17			ENSG00000151729	ENSG00000151729		"""Solute carriers"""	10990	protein-coding gene	gene with protein product		103220		PEO3, PEO2, ANT1		1582253	Standard	NM_001151		Approved	T1	uc003ixd.3	P12235	OTTHUMG00000134299	ENST00000281456.6:c.239G>A	4.37:g.186066045G>A	ENSP00000281456:p.Arg80His		D3DP59	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Aden_trnslctor,prints_Mit_uncoupling	p.R80H	ENST00000281456.6	37	c.239	CCDS34114.1	4	.	.	.	.	.	.	.	.	.	.	G	33	5.214622	0.95104	.	.	ENSG00000151729	ENST00000281456	D	0.81659	-1.52	5.37	5.37	0.77165	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.89079	0.6613	H	0.95437	3.67	0.80722	D	1	D	0.54397	0.966	P	0.46339	0.513	D	0.92406	0.5933	10	0.87932	D	0	1.2813	19.3071	0.94167	0.0:0.0:1.0:0.0	.	80	P12235	ADT1_HUMAN	H	80	ENSP00000281456:R80H	ENSP00000281456:R80H	R	+	2	0	SLC25A4	186303039	1.000000	0.71417	0.983000	0.44433	0.995000	0.86356	9.657000	0.98554	2.793000	0.96121	0.563000	0.77884	CGT	SLC25A4	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	ENSG00000151729		0.522	SLC25A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A4	HGNC	protein_coding	OTTHUMT00000259170.3	-	0.00	40	0	G	NM_001151		186066045	+1	tier1	-	no_errors	ENST00000281456	ensembl	human	known	74_37	missense	43.75	18	14	SNP	1.000	A
SNHG14	104472715	genome.wustl.edu	37	15	25425543	25425543	+	RNA	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr15:25425543A>C	ENST00000424208.1	+	0	0				SNORD115-5_ENST00000363633.1_RNA|SNHG14_ENST00000441592.2_RNA|SNORD115-6_ENST00000363942.1_RNA|SNHG14_ENST00000365306.1_RNA	NR_003305.1				small nucleolar RNA host gene 14 (non-protein coding)																		GGTGAGCTGAAGCTCAGGCCC	0.622																																																	0																																												0					15q11.2	2014-01-17	2011-08-22	2011-08-22	ENSG00000224078	ENSG00000224078		"""Long non-coding RNAs"""	37462	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 214"""		"""UBE3A antisense RNA 1 (non-protein coding)"""	UBE3A-AS1		23771028	Standard			Approved	NCRNA00214, UBE3A-AS			OTTHUMG00000056661		15.37:g.25425543A>C				RNA	SNP	-	NULL	ENST00000424208.1	37	NULL		15																																																																																			SNHG14	-	-	ENSG00000224078		0.622	SNHG14-002	KNOWN	basic	antisense	SNHG14	HGNC	processed_transcript	OTTHUMT00000126729.2	-	0.00	41	0	A			25425543	+1	tier1	-	no_errors	ENST00000441592	ensembl	human	known	74_37	rna	35.71	27	15	SNP	0.000	C
SORBS2	8470	genome.wustl.edu	37	4	186532968	186532968	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:186532968G>A	ENST00000284776.7	-	18	3559	c.3050C>T	c.(3049-3051)tCt>tTt	p.S1017F	SORBS2_ENST00000449407.2_Missense_Mutation_p.S561F|SORBS2_ENST00000437304.2_Missense_Mutation_p.S741F|SORBS2_ENST00000355634.5_Missense_Mutation_p.S1117F|SORBS2_ENST00000448662.2_Missense_Mutation_p.S578F|SORBS2_ENST00000393528.3_Missense_Mutation_p.S583F|SORBS2_ENST00000498125.1_5'UTR|SORBS2_ENST00000431808.1_Missense_Mutation_p.S1017F|SORBS2_ENST00000319471.9_Missense_Mutation_p.S648F|SORBS2_ENST00000418609.1_Missense_Mutation_p.S921F	NM_021069.4	NP_066547.1	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2	1017					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|cell migration (GO:0016477)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(21)|ovary(2)|prostate(2)|skin(4)|urinary_tract(1)	53		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		CCTATCACTAGAATAGCTGTG	0.428																																					Esophageal Squamous(153;41 2433 9491 36028)												0													204.0	189.0	194.0					4																	186532968		2203	4300	6503	SO:0001583	missense	0				CCDS3845.1, CCDS43289.2, CCDS47173.1, CCDS47174.1, CCDS47175.1, CCDS47176.1, CCDS54825.1, CCDS59482.1	4q35.1	2008-02-05			ENSG00000154556	ENSG00000154556			24098	protein-coding gene	gene with protein product	"""Arg/Abl interacting protein"""					9211900, 9872452	Standard	NM_021069		Approved	ARGBP2, KIAA0777	uc003iym.3	O94875	OTTHUMG00000157215	ENST00000284776.7:c.3050C>T	4.37:g.186532968G>A	ENSP00000284776:p.Ser1017Phe		A6NEK9|B3KPQ7|B7Z1G5|B7Z3X6|C9JKV9|D3DP62|D3DP63|E9PAS5|E9PAW4|G3XAI0|H7BXR4|J3KNZ5|O60592|O60593|Q96EX0	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.S1017F	ENST00000284776.7	37	c.3050	CCDS3845.1	4	.	.	.	.	.	.	.	.	.	.	G	19.02	3.745447	0.69418	.	.	ENSG00000154556	ENST00000284776;ENST00000448662;ENST00000431808;ENST00000418609;ENST00000437304;ENST00000319471;ENST00000449407;ENST00000355634;ENST00000393528;ENST00000319454	T;T;T;T;T;T;T;T;T;T	0.37584	1.3;1.49;1.3;1.19;1.49;1.49;1.49;1.29;1.49;1.49	5.46	5.46	0.80206	Src homology-3 domain (1);	0.191025	0.46442	D	0.000290	T	0.49457	0.1558	N	0.24115	0.695	0.54753	D	0.999985	D;D;D;D;D;D;D;D;D;D;P;P;D;D	0.76494	0.998;0.997;0.999;0.997;0.998;0.999;0.999;0.999;0.994;0.996;0.935;0.533;0.998;0.998	D;D;D;D;D;D;D;D;P;P;P;B;D;D	0.85130	0.992;0.972;0.996;0.988;0.992;0.997;0.993;0.993;0.795;0.823;0.746;0.242;0.992;0.992	T	0.52403	-0.8580	10	0.87932	D	0	-14.0269	19.5125	0.95148	0.0:0.0:1.0:0.0	.	583;578;921;409;466;608;1117;1017;561;741;578;608;562;583	G3XAI0;C9JKV9;B7Z3X6;B7Z997;B3KPU4;O94875-4;B3KPQ7;O94875;E9PAS5;E9PAW4;B7Z1G5;O94875-5;O94875-3;O94875-2	.;.;.;.;.;.;.;SRBS2_HUMAN;.;.;.;.;.;.	F	1017;578;1017;921;741;648;561;1117;583;608	ENSP00000284776:S1017F;ENSP00000409158:S578F;ENSP00000411764:S1017F;ENSP00000397482:S921F;ENSP00000396008:S741F;ENSP00000322182:S648F;ENSP00000397262:S561F;ENSP00000347852:S1117F;ENSP00000377162:S583F;ENSP00000321983:S608F	ENSP00000284776:S1017F	S	-	2	0	SORBS2	186769962	1.000000	0.71417	0.998000	0.56505	0.906000	0.53458	5.608000	0.67654	2.840000	0.97914	0.655000	0.94253	TCT	SORBS2	-	superfamily_SH3_domain	ENSG00000154556		0.428	SORBS2-001	KNOWN	basic|CCDS	protein_coding	SORBS2	HGNC	protein_coding	OTTHUMT00000347944.3	-	0.00	160	0	G	NM_003603		186532968	-1	tier1	-	no_errors	ENST00000284776	ensembl	human	known	74_37	missense	57.35	28	39	SNP	1.000	A
SPAST	6683	genome.wustl.edu	37	2	32361662	32361662	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:32361662C>G	ENST00000315285.3	+	10	1401	c.1276C>G	c.(1276-1278)Ctt>Gtt	p.L426V	SPAST_ENST00000345662.1_Missense_Mutation_p.L394V	NM_014946.3	NP_055761.2			spastin									p.L426V(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GGTGAGGGCTCTTTTTGCTGT	0.323																																																	1	Substitution - Missense(1)	lung(1)	GRCh37	CD052507|CM000436	SPAST	D|M							126.0	130.0	129.0					2																	32361662		2203	4300	6503	SO:0001583	missense	0			AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.1276C>G	2.37:g.32361662C>G	ENSP00000320885:p.Leu426Val			Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_MIT,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_MIT,smart_AAA+_ATPase,pirsf_Spastin	p.L426V	ENST00000315285.3	37	c.1276	CCDS1778.1	2	.	.	.	.	.	.	.	.	.	.	C	23.2	4.391705	0.83011	.	.	ENSG00000021574	ENST00000345662;ENST00000315285	D;D	0.95272	-3.66;-3.66	5.62	5.62	0.85841	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.95978	0.8690	L	0.43701	1.375	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.76575	0.975;0.988	D	0.96388	0.9287	10	0.87932	D	0	-26.1356	17.4494	0.87588	0.0:1.0:0.0:0.0	.	394;426	E5KRP6;Q9UBP0	.;SPAST_HUMAN	V	394;426	ENSP00000340817:L394V;ENSP00000320885:L426V	ENSP00000320885:L426V	L	+	1	0	SPAST	32215166	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.502000	0.73695	2.660000	0.90430	0.655000	0.94253	CTT	SPAST	-	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pirsf_Spastin	ENSG00000021574		0.323	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAST	HGNC	protein_coding	OTTHUMT00000250253.1	-	0.00	132	0	C	NM_199436		32361662	+1	tier1	-	no_errors	ENST00000315285	ensembl	human	known	74_37	missense	9.72	130	14	SNP	1.000	G
SPATA31A3	727830	genome.wustl.edu	37	9	40705717	40705717	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr9:40705717T>A	ENST00000356699.5	+	4	3403	c.3374T>A	c.(3373-3375)cTt>cAt	p.L1125H	RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	1125					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GAAGAAAGGCTTGAAGGATTG	0.468																																																	0													52.0	46.0	48.0					9																	40705717		1507	3027	4534	SO:0001583	missense	0					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.3374T>A	9.37:g.40705717T>A	ENSP00000349132:p.Leu1125His			Missense_Mutation	SNP	NULL	p.L1125H	ENST00000356699.5	37	c.3374	CCDS47969.1	9	.	.	.	.	.	.	.	.	.	.	T	5.198	0.222051	0.09863	.	.	ENSG00000147926	ENST00000356699	T	0.06687	3.27	1.9	1.9	0.25705	.	2.609370	0.01177	N	0.006997	T	0.15003	0.0362	L	0.39898	1.24	0.09310	N	1	P	0.50272	0.933	P	0.54401	0.751	T	0.18304	-1.0341	10	0.28530	T	0.3	.	5.8481	0.18677	0.0:0.0:0.0:1.0	.	1125	Q5VYP0	F75A3_HUMAN	H	1125	ENSP00000349132:L1125H	ENSP00000349132:L1125H	L	+	2	0	FAM75A3	40695717	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.206000	0.09398	1.140000	0.42260	0.327000	0.21459	CTT	SPATA31A3	-	NULL	ENSG00000147926		0.468	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A3	HGNC	protein_coding	OTTHUMT00000036919.1	-	0.00	92	0	T	NM_001083124		40705717	+1	tier1	-	no_errors	ENST00000356699	ensembl	human	known	74_37	missense	60.56	28	43	SNP	0.001	A
SPHK2	56848	genome.wustl.edu	37	19	49132801	49132801	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:49132801C>T	ENST00000245222.4	+	7	2102	c.1736C>T	c.(1735-1737)gCg>gTg	p.A579V	SPHK2_ENST00000599029.1_Missense_Mutation_p.A543V|SPHK2_ENST00000443164.1_Missense_Mutation_p.A641V|SPHK2_ENST00000600537.1_Missense_Mutation_p.A520V|SPHK2_ENST00000598088.1_Missense_Mutation_p.A579V|SPHK2_ENST00000599748.1_Missense_Mutation_p.A543V|SPHK2_ENST00000340932.3_Missense_Mutation_p.A541V	NM_001204158.2|NM_001243876.1|NM_020126.4	NP_001191087.1|NP_001230805.1|NP_064511.2	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	579					blood vessel development (GO:0001568)|brain development (GO:0007420)|cell proliferation (GO:0008283)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell proliferation (GO:0008284)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphinganine-1-phosphate biosynthetic process (GO:0006669)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	ATP binding (GO:0005524)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|Ras GTPase binding (GO:0017016)|sphinganine kinase activity (GO:0008481)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	19		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		TCGCGGGCTGCGCTGCTGCGC	0.701																																																	0													24.0	21.0	22.0					19																	49132801		2197	4294	6491	SO:0001583	missense	0			AF245447	CCDS12727.1, CCDS59404.1, CCDS59405.1, CCDS74414.1	19q13.33	2013-09-20			ENSG00000063176	ENSG00000063176			18859	protein-coding gene	gene with protein product		607092				10751414, 17895250	Standard	NM_020126		Approved		uc002pjs.3	Q9NRA0	OTTHUMG00000183318	ENST00000245222.4:c.1736C>T	19.37:g.49132801C>T	ENSP00000245222:p.Ala579Val		A0T4C8|B4DU87|Q9BRN1|Q9H0Q2|Q9NWU7	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.A641V	ENST00000245222.4	37	c.1922	CCDS12727.1	19	.	.	.	.	.	.	.	.	.	.	C	7.922	0.738754	0.15642	.	.	ENSG00000063176	ENST00000245222;ENST00000406269;ENST00000340932;ENST00000443164	T;T;T	0.14766	2.48;2.48;2.48	4.68	0.0523	0.14301	.	0.390351	0.28016	N	0.016922	T	0.10637	0.0260	M	0.71036	2.16	0.09310	N	1	B;P;P	0.42203	0.012;0.773;0.646	B;B;B	0.33960	0.005;0.173;0.124	T	0.21245	-1.0251	10	0.30078	T	0.28	0.128	4.6524	0.12601	0.1534:0.5854:0.0:0.2612	.	520;641;579	B4DU87;A0T4C8;Q9NRA0	.;.;SPHK2_HUMAN	V	579;552;541;641	ENSP00000245222:A579V;ENSP00000341091:A541V;ENSP00000413369:A641V	ENSP00000245222:A579V	A	+	2	0	SPHK2	53824613	0.001000	0.12720	0.000000	0.03702	0.047000	0.14425	1.338000	0.33873	0.031000	0.15407	0.555000	0.69702	GCG	SPHK2	-	NULL	ENSG00000063176		0.701	SPHK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHK2	HGNC	protein_coding	OTTHUMT00000466153.1	-	0.00	41	0	C			49132801	+1	tier1	-	no_errors	ENST00000443164	ensembl	human	known	74_37	missense	43.75	18	14	SNP	0.002	T
SPTA1	6708	genome.wustl.edu	37	1	158637764	158637764	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:158637764T>C	ENST00000368147.4	-	15	2102	c.1922A>G	c.(1921-1923)cAg>cGg	p.Q641R		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	641					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.Q641R(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GCCAGTTTTCTGTATGTTTTC	0.468																																																	1	Substitution - Missense(1)	prostate(1)											172.0	166.0	168.0					1																	158637764		1863	4099	5962	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1922A>G	1.37:g.158637764T>C	ENSP00000357129:p.Gln641Arg		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.Q641R	ENST00000368147.4	37	c.1922	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	T	11.03	1.519401	0.27211	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.50813	0.73;0.73	4.95	4.95	0.65309	.	1.390910	0.05520	N	0.561957	T	0.25901	0.0631	L	0.46157	1.445	0.29970	N	0.818626	B	0.06786	0.001	B	0.11329	0.006	T	0.17531	-1.0366	10	0.19147	T	0.46	.	13.6072	0.62054	0.0:0.0:0.0:1.0	.	641	P02549	SPTA1_HUMAN	R	641	ENSP00000357130:Q641R;ENSP00000357129:Q641R	ENSP00000357129:Q641R	Q	-	2	0	SPTA1	156904388	1.000000	0.71417	0.312000	0.25196	0.300000	0.27592	6.793000	0.75130	2.080000	0.62538	0.528000	0.53228	CAG	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.468	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	-	0.00	126	0	T	NM_003126		158637764	-1	tier1	-	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	50.59	84	86	SNP	0.992	C
SPTA1	6708	genome.wustl.edu	37	1	158654936	158654936	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:158654936A>C	ENST00000368147.4	-	2	406	c.226T>G	c.(226-228)Tta>Gta	p.L76V		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	76					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTATCGGTTAAGATATTGACT	0.438																																																	0													118.0	113.0	115.0					1																	158654936		1921	4140	6061	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.226T>G	1.37:g.158654936A>C	ENSP00000357129:p.Leu76Val		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.L76V	ENST00000368147.4	37	c.226	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	A	6.664	0.491042	0.12702	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.59638	0.25;0.25	5.18	0.936	0.19488	.	0.929378	0.08717	N	0.904125	T	0.11452	0.0279	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.34601	-0.9822	10	0.07325	T	0.83	.	8.3407	0.32241	0.4046:0.5225:0.0:0.0729	.	76	P02549	SPTA1_HUMAN	V	76	ENSP00000357130:L76V;ENSP00000357129:L76V	ENSP00000357129:L76V	L	-	1	2	SPTA1	156921560	0.977000	0.34250	0.000000	0.03702	0.001000	0.01503	2.194000	0.42668	0.015000	0.14971	-0.644000	0.03951	TTA	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.438	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	-	0.00	82	0	A	NM_003126		158654936	-1	tier1	-	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	45.69	63	53	SNP	0.008	C
SPTBN4	57731	genome.wustl.edu	37	19	41078333	41078333	+	Intron	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:41078333C>T	ENST00000352632.3	+	35	7622				SPTBN4_ENST00000598249.1_Intron|SPTBN4_ENST00000392025.1_Intron|SPTBN4_ENST00000593816.1_3'UTR			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4						actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CAGTAATGACCTGGCTGTCTG	0.557																																																	0													120.0	99.0	106.0					19																	41078333		2203	4300	6503	SO:0001627	intron_variant	0			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.7536+47C>T	19.37:g.41078333C>T			E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	RNA	SNP	-	NULL	ENST00000352632.3	37	NULL	CCDS12559.1	19																																																																																			SPTBN4	-	-	ENSG00000160460		0.557	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2	-	0.00	64	0	C			41078333	+1	tier1	-	no_errors	ENST00000593816	ensembl	human	known	74_37	rna	40.98	36	25	SNP	0.001	T
SSTR5	6755	genome.wustl.edu	37	16	1129924	1129924	+	Silent	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr16:1129924C>T	ENST00000293897.4	+	1	1144	c.1056C>T	c.(1054-1056)cgC>cgT	p.R352R	SSTR5_ENST00000562758.1_Intron|SSTR5_ENST00000397547.2_Silent_p.R352R|SSTR5-AS1_ENST00000569832.1_RNA	NM_001053.3	NP_001044.1	P35346	SSR5_HUMAN	somatostatin receptor 5	352				PPAHR -> RPRT (in Ref. 1; AAA20828). {ECO:0000305}.	G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cytokinesis (GO:0032467)|regulation of insulin secretion (GO:0050796)|somatostatin signaling pathway (GO:0038170)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			endometrium(2)|lung(5)|prostate(1)|skin(1)	9		Hepatocellular(780;0.00369)			Octreotide(DB00104)|Pasireotide(DB06663)|Vapreotide(DB04894)	CCGCGCACCGCGCCGCAGCCA	0.711																																																	0													14.0	14.0	14.0					16																	1129924		2162	4262	6424	SO:0001819	synonymous_variant	0			D16827	CCDS10429.1	16p13.3	2012-08-08			ENSG00000162009	ENSG00000162009		"""GPCR / Class A : Somatostatin receptors"""	11334	protein-coding gene	gene with protein product		182455				7607700	Standard	NM_001053		Approved		uc021taf.1	P35346	OTTHUMG00000047842	ENST00000293897.4:c.1056C>T	16.37:g.1129924C>T			P34988|Q541E0|Q9UJI5	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Somatstn_rcpt_5,prints_Somatstn_rcpt,prints_Opioid_rcpt,prints_NPY_rcpt	p.R352	ENST00000293897.4	37	c.1056	CCDS10429.1	16																																																																																			SSTR5	-	NULL	ENSG00000162009		0.711	SSTR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSTR5	HGNC	protein_coding	OTTHUMT00000420836.1	-	0.00	31	0	C			1129924	+1	tier1	-	no_errors	ENST00000293897	ensembl	human	known	74_37	silent	46.00	27	23	SNP	0.000	T
STAG1	10274	genome.wustl.edu	37	3	136221515	136221515	+	Silent	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:136221515C>T	ENST00000383202.2	-	8	1039	c.783G>A	c.(781-783)aaG>aaA	p.K261K	STAG1_ENST00000434713.2_Silent_p.K35K|STAG1_ENST00000236698.5_Silent_p.K261K	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	261					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						CATTGGCTCTCTTCCCAATCA	0.378																																																	0													175.0	166.0	169.0					3																	136221515		2203	4300	6503	SO:0001819	synonymous_variant	0			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.783G>A	3.37:g.136221515C>T			O00539|Q6P275	Silent	SNP	pfam_STAG,superfamily_ARM-type_fold	p.K261	ENST00000383202.2	37	c.783	CCDS3090.1	3																																																																																			STAG1	-	pfam_STAG,superfamily_ARM-type_fold	ENSG00000118007		0.378	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	HGNC	protein_coding	OTTHUMT00000357366.1	-	0.00	61	0	C	NM_005862		136221515	-1	tier1	-	no_errors	ENST00000383202	ensembl	human	known	74_37	silent	52.00	36	39	SNP	1.000	T
STK32B	55351	genome.wustl.edu	37	4	5469797	5469797	+	Splice_Site	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:5469797A>C	ENST00000282908.5	+	11	1528	c.1106A>C	c.(1105-1107)aAg>aCg	p.K369T	STK32B_ENST00000512636.1_Splice_Site_p.K292T|STK32B_ENST00000510398.1_Splice_Site_p.K322T|STK32B_ENST00000508728.1_3'UTR	NM_018401.1	NP_060871.1			serine/threonine kinase 32B											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						AACAGAGAGAAGTAAGTCCTT	0.517																																																	0													137.0	132.0	134.0					4																	5469797		2203	4300	6503	SO:0001630	splice_region_variant	0			AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.1106+1A>C	4.37:g.5469797A>C				Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.K369T	ENST00000282908.5	37	c.1106	CCDS3380.1	4	.	.	.	.	.	.	.	.	.	.	A	15.77	2.931975	0.52866	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.68903	-0.28;-0.02;-0.36	4.75	3.56	0.40772	.	0.000000	0.44688	U	0.000428	T	0.77512	0.4141	M	0.80616	2.505	0.53688	D	0.999979	D	0.64830	0.994	P	0.60173	0.87	T	0.77913	-0.2410	10	0.72032	D	0.01	.	9.2107	0.37318	0.9123:0.0:0.0877:0.0	.	369	Q9NY57	ST32B_HUMAN	T	369;292;322	ENSP00000282908:K369T;ENSP00000423209:K292T;ENSP00000420984:K322T	ENSP00000282908:K369T	K	+	2	0	STK32B	5520698	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	4.971000	0.63749	0.672000	0.31204	0.460000	0.39030	AAG	STK32B	-	NULL	ENSG00000152953		0.517	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK32B	HGNC	protein_coding	OTTHUMT00000206854.4		0.00	27	0	A	NM_018401	Missense_Mutation	5469797	+1			no_errors	ENST00000282908	ensembl	human	known	74_37	missense	15.38	33	6	SNP	1.000	C
STX6	10228	genome.wustl.edu	37	1	180962536	180962536	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:180962536G>A	ENST00000258301.5	-	4	563	c.326C>T	c.(325-327)tCa>tTa	p.S109L	STX6_ENST00000542060.1_Missense_Mutation_p.S8L	NM_005819.4	NP_005810.1	O43752	STX6_HUMAN	syntaxin 6	109					endosome organization (GO:0007032)|Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|SNARE complex (GO:0031201)|trans-Golgi network membrane (GO:0032588)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)	10						CTGCACAGATGAAGTTGACAT	0.299																																																	0													121.0	114.0	116.0					1																	180962536		2202	4300	6502	SO:0001583	missense	0			AJ002078	CCDS1341.1, CCDS65738.1	1q25.3	2008-02-05			ENSG00000135823	ENSG00000135823			11441	protein-coding gene	gene with protein product		603944				10080545	Standard	XM_005244824		Approved		uc021pfr.1	O43752	OTTHUMG00000035179	ENST00000258301.5:c.326C>T	1.37:g.180962536G>A	ENSP00000258301:p.Ser109Leu		B2R652|B4DR17|Q5VY08|Q6FH83	Missense_Mutation	SNP	pfam_Syntaxin-6_N,pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.S109L	ENST00000258301.5	37	c.326	CCDS1341.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.035051	0.75617	.	.	ENSG00000135823	ENST00000258301;ENST00000542060	.	.	.	5.61	5.61	0.85477	t-SNARE (1);	0.065701	0.64402	D	0.000006	T	0.50069	0.1594	L	0.36672	1.1	0.32980	D	0.523589	B;B	0.30763	0.294;0.016	B;B	0.24974	0.057;0.01	T	0.53767	-0.8392	8	0.41790	T	0.15	-6.5908	19.2323	0.93845	0.0:0.0:1.0:0.0	.	8;109	B4DR17;O43752	.;STX6_HUMAN	L	109;8	.	ENSP00000258301:S109L	S	-	2	0	STX6	179229159	1.000000	0.71417	0.995000	0.50966	0.977000	0.68977	8.101000	0.89546	2.636000	0.89361	0.655000	0.94253	TCA	STX6	-	superfamily_t-SNARE	ENSG00000135823		0.299	STX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX6	HGNC	protein_coding	OTTHUMT00000085143.1	-	0.00	67	0	G	NM_005819		180962536	-1	tier1	-	no_errors	ENST00000258301	ensembl	human	known	74_37	missense	7.61	85	7	SNP	1.000	A
TANC1	85461	genome.wustl.edu	37	2	160050795	160050795	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:160050795G>A	ENST00000263635.6	+	17	3007	c.2770G>A	c.(2770-2772)Gcc>Acc	p.A924T	TANC1_ENST00000454300.1_Missense_Mutation_p.A818T	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	924					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						TTTGGGAGGGGCCAACGTGAA	0.498																																																	0													76.0	76.0	76.0					2																	160050795		1962	4144	6106	SO:0001583	missense	0			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.2770G>A	2.37:g.160050795G>A	ENSP00000263635:p.Ala924Thr		C9JD88|Q49AI8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.A924T	ENST00000263635.6	37	c.2770	CCDS42766.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.702194	0.96812	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.27256	1.68;1.68	5.64	5.64	0.86602	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.59891	0.2227	M	0.87456	2.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.998;1.0	T	0.65713	-0.6101	10	0.87932	D	0	.	19.7763	0.96395	0.0:0.0:1.0:0.0	.	916;818;924	B9EK39;Q9C0D5-2;Q9C0D5	.;.;TANC1_HUMAN	T	818;924	ENSP00000396339:A818T;ENSP00000263635:A924T	ENSP00000263635:A924T	A	+	1	0	TANC1	159759041	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.865000	0.99609	2.685000	0.91497	0.650000	0.86243	GCC	TANC1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000115183		0.498	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANC1	HGNC	protein_coding	OTTHUMT00000333135.1	-	0.00	53	0	G			160050795	+1	tier1	-	no_errors	ENST00000263635	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	A
TBCEL	219899	genome.wustl.edu	37	11	120916423	120916423	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr11:120916423T>G	ENST00000529397.1	+	2	124	c.24T>G	c.(22-24)agT>agG	p.S8R	TBCEL_ENST00000422003.2_Missense_Mutation_p.S8R	NM_001130047.1	NP_001123519.1	Q5QJ74	TBCEL_HUMAN	tubulin folding cofactor E-like	8						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)			TECTA/TBCEL(2)	endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14		Breast(109;0.00526)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.89e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.121)		GTGGAAGAAGTTTCATGCAAG	0.383																																																	0													53.0	60.0	58.0					11																	120916423		2203	4298	6501	SO:0001583	missense	0			BC020501	CCDS31692.1	11q23.3	2008-02-05	2006-11-21	2006-11-21		ENSG00000154114			28115	protein-coding gene	gene with protein product		610451	"""leucine rich repeat containing 35"", ""tubulin-specific chaperone e-like"""	LRRC35		15728251	Standard	NM_152715		Approved	MGC10233	uc001pxo.3	Q5QJ74		ENST00000529397.1:c.24T>G	11.37:g.120916423T>G	ENSP00000437184:p.Ser8Arg		Q0VAN6	Missense_Mutation	SNP	pfscan_Ubiquitin_supergroup	p.S8R	ENST00000529397.1	37	c.24	CCDS31692.1	11	.	.	.	.	.	.	.	.	.	.	T	19.31	3.802133	0.70682	.	.	ENSG00000154114	ENST00000529397;ENST00000528512;ENST00000422003;ENST00000524726	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.61	2.11	0.27256	.	0.137442	0.64402	D	0.000005	T	0.38348	0.1037	L	0.54323	1.7	0.44677	D	0.997669	P	0.52061	0.95	P	0.45099	0.469	T	0.32402	-0.9908	10	0.87932	D	0	-7.003	7.979	0.30172	0.0:0.3761:0.0:0.6239	.	8	Q5QJ74	TBCEL_HUMAN	R	8	ENSP00000437184:S8R;ENSP00000431803:S8R;ENSP00000403925:S8R;ENSP00000432783:S8R	ENSP00000284259:S8R	S	+	3	2	TBCEL	120421633	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.583000	0.23849	0.957000	0.37930	0.528000	0.53228	AGT	TBCEL	-	NULL	ENSG00000154114		0.383	TBCEL-005	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TBCEL	HGNC	protein_coding	OTTHUMT00000387688.1	-	0.00	83	0	T	NM_152715		120916423	+1	tier1	-	no_errors	ENST00000422003	ensembl	human	known	74_37	missense	82.76	10	48	SNP	1.000	G
TBX18	9096	genome.wustl.edu	37	6	85398374	85398374	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:85398374A>C	ENST00000606784.1	-	8	848	c.637T>G	c.(637-639)Ttg>Gtg	p.L213V	RP11-132M7.3_ENST00000591225.1_RNA|RP11-132M7.3_ENST00000592681.1_RNA|RP11-132M7.3_ENST00000589304.1_RNA|RP11-132M7.3_ENST00000587281.1_RNA|RP11-132M7.3_ENST00000586398.1_RNA|RP11-132M7.3_ENST00000423086.1_RNA|RP11-132M7.3_ENST00000590270.1_RNA			O95935	TBX18_HUMAN	T-box 18	0					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		TCTGTCTTCAAGTCCCTGTAT	0.468																																																	0																																										SO:0001583	missense	0			AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000606784.1:c.637T>G	6.37:g.85398374A>C	ENSP00000475873:p.Leu213Val		A2RU13|Q7Z6U4|Q9UJI6	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.L213V	ENST00000606784.1	37	c.637		6	.	.	.	.	.	.	.	.	.	.	A	15.81	2.943466	0.53079	.	.	ENSG00000112837	ENST00000416980	.	.	.	5.13	1.21	0.21127	.	.	.	.	.	T	0.08179	0.0204	.	.	.	.	.	.	B	0.06786	0.001	B	0.04013	0.001	T	0.27020	-1.0086	6	0.26408	T	0.33	.	1.6771	0.02823	0.5542:0.1624:0.0906:0.1929	.	287	Q8IW86	.	V	286	.	ENSP00000415771:L286V	L	-	1	2	TBX18	85455093	0.320000	0.24616	0.009000	0.14445	0.881000	0.50899	0.716000	0.25836	0.028000	0.15324	0.455000	0.32223	TTG	TBX18	-	NULL	ENSG00000112837		0.468	TBX18-006	PUTATIVE	basic	protein_coding	TBX18	HGNC	protein_coding	OTTHUMT00000470364.1	-	0.00	41	0	A	NM_001080508		85398374	-1	tier1	-	no_errors	ENST00000606784	ensembl	human	putative	74_37	missense	42.86	20	15	SNP	0.013	C
TDRD15	100129278	genome.wustl.edu	37	2	21360458	21360458	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:21360458A>G	ENST00000405799.1	+	4	449	c.119A>G	c.(118-120)gAg>gGg	p.E40G				B5MCY1	TDR15_HUMAN	tudor domain containing 15	40							hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)										AATGAATGTGAGTTTGACTAC	0.318																																																	0																																										SO:0001583	missense	0					2p24.1	2013-01-23	2013-01-23	2013-01-23	ENSG00000218819	ENSG00000218819		"""Tudor domain containing"""	45037	protein-coding gene	gene with protein product							Standard	XR_425376		Approved			B5MCY1	OTTHUMG00000151795	ENST00000405799.1:c.119A>G	2.37:g.21360458A>G	ENSP00000384376:p.Glu40Gly			Missense_Mutation	SNP	pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Tudor,pfscan_Tudor	p.E40G	ENST00000405799.1	37	c.119		2	.	.	.	.	.	.	.	.	.	.	A	15.70	2.911982	0.52439	.	.	ENSG00000218819	ENST00000405799	T	0.10099	2.91	5.24	4.05	0.47172	.	.	.	.	.	T	0.17323	0.0416	.	.	.	.	.	.	.	.	.	.	.	.	T	0.14144	-1.0483	5	0.36615	T	0.2	-3.3554	12.0188	0.53331	0.8552:0.1448:0.0:0.0	.	.	.	.	G	40	ENSP00000384376:E40G	ENSP00000384376:E40G	E	+	2	0	AC010872.2	21213963	1.000000	0.71417	0.998000	0.56505	0.366000	0.29705	4.756000	0.62205	0.792000	0.33850	0.445000	0.29226	GAG	TDRD15	-	pfam_Tudor	ENSG00000218819		0.318	TDRD15-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TDRD15	HGNC	protein_coding	OTTHUMT00000323948.1	-	0.00	46	0	A			21360458	+1	tier1	-	no_errors	ENST00000405799	ensembl	human	novel	74_37	missense	64.58	17	31	SNP	1.000	G
TGM6	343641	genome.wustl.edu	37	20	2375225	2375225	+	Silent	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr20:2375225C>T	ENST00000202625.2	+	2	196	c.135C>T	c.(133-135)agC>agT	p.S45S	TGM6_ENST00000381423.1_Silent_p.S45S|TGM6_ENST00000477505.1_3'UTR	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	45					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	TGGAGCTGAGCAGAGCCCTGG	0.622																																																	0													48.0	36.0	40.0					20																	2375225		2203	4300	6503	SO:0001819	synonymous_variant	0			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.135C>T	20.37:g.2375225C>T			Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Silent	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.S45	ENST00000202625.2	37	c.135	CCDS13025.1	20																																																																																			TGM6	-	pfam_Transglutaminase_N,superfamily_Ig_E-set	ENSG00000166948		0.622	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM6	HGNC	protein_coding	OTTHUMT00000077581.2	-	0.00	24	0	C	NM_198994		2375225	+1	tier1	-	no_errors	ENST00000202625	ensembl	human	known	74_37	silent	40.82	29	20	SNP	0.015	T
TIAM1	7074	genome.wustl.edu	37	21	32537342	32537342	+	Silent	SNP	G	G	A	rs557120271		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr21:32537342G>A	ENST00000286827.3	-	17	3399	c.2928C>T	c.(2926-2928)acC>acT	p.T976T	TIAM1_ENST00000541036.1_Silent_p.T916T	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	976					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.T976T(2)		autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CCTCTGGAGCGGTCTCAGCAC	0.502																																																	2	Substitution - coding silent(2)	lung(2)											78.0	74.0	75.0					21																	32537342		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.2928C>T	21.37:g.32537342G>A			B7ZLR6|F5GZ53|Q17RT7	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.T976	ENST00000286827.3	37	c.2928	CCDS13609.1	21																																																																																			TIAM1	-	NULL	ENSG00000156299		0.502	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	-	0.00	36	0	G	NM_003253		32537342	-1	tier1	-	no_errors	ENST00000286827	ensembl	human	known	74_37	silent	23.26	33	10	SNP	0.000	A
TIGD7	91151	genome.wustl.edu	37	16	3350227	3350227	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr16:3350227G>A	ENST00000396862.1	-	2	2216	c.388C>T	c.(388-390)Cga>Tga	p.R130*	TIGD7_ENST00000268674.2_Nonsense_Mutation_p.R130*|TIGD7_ENST00000574598.1_5'Flank	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	130	HTH CENPB-type. {ECO:0000255|PROSITE- ProRule:PRU00583}.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						TGCCGATTTCGAAATCTAAAA	0.458																																																	0													100.0	98.0	99.0					16																	3350227		2197	4300	6497	SO:0001587	stop_gained	0			AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.388C>T	16.37:g.3350227G>A	ENSP00000380071:p.Arg130*		Q9BXZ0	Nonsense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.R130*	ENST00000396862.1	37	c.388	CCDS10500.1	16	.	.	.	.	.	.	.	.	.	.	G	9.900	1.206659	0.22205	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	.	.	.	4.59	3.63	0.41609	.	0.228496	0.22254	U	0.062517	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	8.4314	0.32759	0.1091:0.0:0.8909:0.0	.	.	.	.	X	130	.	ENSP00000268674:R130X	R	-	1	2	TIGD7	3290228	0.991000	0.36638	1.000000	0.80357	0.997000	0.91878	-0.034000	0.12225	0.918000	0.36919	0.655000	0.94253	CGA	TIGD7	-	pfam_HTH_CenpB_DNA-bd_dom,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom	ENSG00000140993		0.458	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	HGNC	protein_coding	OTTHUMT00000251465.1	-	0.00	38	0	G	NM_033208		3350227	-1	tier1	-	no_errors	ENST00000268674	ensembl	human	known	74_37	nonsense	12.82	34	5	SNP	1.000	A
TLL1	7092	genome.wustl.edu	37	4	166795097	166795097	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:166795097T>C	ENST00000061240.2	+	1	688	c.41T>C	c.(40-42)cTg>cCg	p.L14P	TLL1_ENST00000507499.1_Missense_Mutation_p.L14P|TLL1_ENST00000513213.1_Missense_Mutation_p.L14P	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	14					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CTCGTGTGGCTGGTGGCCTCG	0.587																																																	0													155.0	158.0	157.0					4																	166795097		2203	4300	6503	SO:0001583	missense	0			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.41T>C	4.37:g.166795097T>C	ENSP00000061240:p.Leu14Pro		B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Peptidase_M12A	p.L14P	ENST00000061240.2	37	c.41	CCDS3811.1	4	.	.	.	.	.	.	.	.	.	.	T	14.19	2.461613	0.43736	.	.	ENSG00000038295	ENST00000061240;ENST00000507499;ENST00000513213	T;T;T	0.51071	0.72;0.72;0.72	4.29	4.29	0.51040	.	0.000000	0.56097	U	0.000030	T	0.53465	0.1798	L	0.52573	1.65	0.80722	D	1	D;P	0.55172	0.97;0.948	P;P	0.54499	0.754;0.754	T	0.57636	-0.7777	10	0.87932	D	0	.	11.1509	0.48458	0.0:0.0:0.0:1.0	.	14;14	E9PD25;O43897	.;TLL1_HUMAN	P	14	ENSP00000061240:L14P;ENSP00000426082:L14P;ENSP00000422937:L14P	ENSP00000061240:L14P	L	+	2	0	TLL1	167014547	1.000000	0.71417	1.000000	0.80357	0.312000	0.27988	5.198000	0.65147	1.550000	0.49438	0.379000	0.24179	CTG	TLL1	-	pirsf_BMP_1/tolloid-like	ENSG00000038295		0.587	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	HGNC	protein_coding	OTTHUMT00000363821.1	-	0.00	71	0	T			166795097	+1	tier1	-	no_errors	ENST00000061240	ensembl	human	known	74_37	missense	28.26	66	26	SNP	1.000	C
TMEM67	91147	genome.wustl.edu	37	8	94822043	94822043	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr8:94822043G>C	ENST00000453321.3	+	26	2750	c.2692G>C	c.(2692-2694)Gat>Cat	p.D898H	TMEM67_ENST00000409623.3_Missense_Mutation_p.D817H	NM_153704.5	NP_714915.3	Q5HYA8	MKS3_HUMAN	transmembrane protein 67	898					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|negative regulation of centrosome duplication (GO:0010826)	centrosome (GO:0005813)|ciliary membrane (GO:0060170)|cytoplasmic vesicle membrane (GO:0030659)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)	filamin binding (GO:0031005)|unfolded protein binding (GO:0051082)			breast(3)|endometrium(8)|kidney(5)|large_intestine(4)|liver(2)|lung(15)|ovary(2)|skin(1)|urinary_tract(1)	41	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.00896)			CTTTATAAAAGATAAGTTGCT	0.289																																																	0													42.0	47.0	45.0					8																	94822043		2203	4281	6484	SO:0001583	missense	0			BX648768	CCDS6258.2, CCDS47893.1	8q22.1	2014-09-17			ENSG00000164953	ENSG00000164953			28396	protein-coding gene	gene with protein product	"""Meckelin"""	609884	"""Meckel syndrome, type 3"""	MKS3		12384791, 16415887, 19508969	Standard	NM_153704		Approved	MGC26979, JBTS6, NPHP11	uc011lgk.2	Q5HYA8	OTTHUMG00000153119	ENST00000453321.3:c.2692G>C	8.37:g.94822043G>C	ENSP00000389998:p.Asp898His		B3KRU5|B3KT47|G5E9H2|Q3ZCX3|Q7Z5T8|Q8IZ06	Missense_Mutation	SNP	pfam_Meckelin,superfamily_Growth_fac_rcpt_N_dom	p.D898H	ENST00000453321.3	37	c.2692	CCDS6258.2	8	.	.	.	.	.	.	.	.	.	.	G	25.4	4.634435	0.87660	.	.	ENSG00000164953	ENST00000453321;ENST00000409623	D;D	0.97089	-4.24;-4.24	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	D	0.98582	0.9526	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.996	D;D;D	0.91635	0.999;0.981;0.947	D	0.99239	1.0884	10	0.72032	D	0.01	-22.1956	19.9569	0.97222	0.0:0.0:1.0:0.0	.	898;817;817	Q5HYA8;B3KRU5;G5E9H2	MKS3_HUMAN;.;.	H	898;817	ENSP00000389998:D898H;ENSP00000386966:D817H	ENSP00000314488:D888H	D	+	1	0	TMEM67	94891219	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.382000	0.97209	2.729000	0.93468	0.460000	0.39030	GAT	TMEM67	-	pfam_Meckelin	ENSG00000164953		0.289	TMEM67-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM67	HGNC	protein_coding	OTTHUMT00000329641.2	-	0.00	72	0	G	NM_153704		94822043	+1	tier1	-	no_errors	ENST00000453321	ensembl	human	known	74_37	missense	12.93	101	15	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343						65.0	56.0	59.0					17																	7577121		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273C	ENST00000269305.4	37	c.817	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	416	0	G	NM_000546		7577121	-1	tier1	rs121913343	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	72.41	79	210	SNP	0.830	A
TRIM71	131405	genome.wustl.edu	37	3	32931919	32931919	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:32931919T>C	ENST00000383763.5	+	4	1286	c.1223T>C	c.(1222-1224)cTc>cCc	p.L408P		NM_001039111.1	NP_001034200.1	Q2Q1W2	LIN41_HUMAN	tripartite motif containing 71, E3 ubiquitin protein ligase	408					fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|miRNA metabolic process (GO:0010586)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|positive regulation of gene silencing by miRNA (GO:2000637)|protein autoubiquitination (GO:0051865)|regulation of gene silencing by miRNA (GO:0060964)|regulation of neural precursor cell proliferation (GO:2000177)|stem cell proliferation (GO:0072089)	cytoplasmic mRNA processing body (GO:0000932)	ligase activity (GO:0016874)|miRNA binding (GO:0035198)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CGGCAAAACCTCAACAAGCTT	0.567																																																	0													70.0	77.0	75.0					3																	32931919		2070	4199	6269	SO:0001583	missense	0				CCDS43060.1	3p22.3	2014-02-17	2012-02-29		ENSG00000206557	ENSG00000206557		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	32669	protein-coding gene	gene with protein product			"""tripartite motif-containing 71"", ""tripartite motif containing 71"""				Standard	NM_001039111		Approved	LIN41, LIN-41	uc003cff.3	Q2Q1W2	OTTHUMG00000155778	ENST00000383763.5:c.1223T>C	3.37:g.32931919T>C	ENSP00000373272:p.Leu408Pro			Missense_Mutation	SNP	pfam_NHL_repeat,pfam_Filamin/ABP280_repeat-like,pfam_Znf_B-box,superfamily_Ig_E-set,smart_Znf_RING,smart_Znf_B-box,smart_Filamin,pfscan_Filamin/ABP280_repeat-like,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.L408P	ENST00000383763.5	37	c.1223	CCDS43060.1	3	.	.	.	.	.	.	.	.	.	.	T	16.30	3.085678	0.55861	.	.	ENSG00000206557	ENST00000383763	D	0.86097	-2.07	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.87861	0.6284	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86685	0.1919	10	0.33141	T	0.24	-35.9861	14.7087	0.69211	0.0:0.0:0.0:1.0	.	408	Q2Q1W2	LIN41_HUMAN	P	408	ENSP00000373272:L408P	ENSP00000373272:L408P	L	+	2	0	TRIM71	32906923	1.000000	0.71417	0.992000	0.48379	0.979000	0.70002	6.287000	0.72671	2.169000	0.68431	0.528000	0.53228	CTC	TRIM71	-	NULL	ENSG00000206557		0.567	TRIM71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM71	HGNC	protein_coding	OTTHUMT00000341565.3	-	0.00	67	0	T	NM_001039111		32931919	+1	tier1	-	no_errors	ENST00000383763	ensembl	human	known	74_37	missense	6.67	168	12	SNP	1.000	C
TRIM42	287015	genome.wustl.edu	37	3	140406766	140406766	+	Silent	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:140406766T>C	ENST00000286349.3	+	3	1433	c.1242T>C	c.(1240-1242)taT>taC	p.Y414Y		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	414						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						AATATGTGTATGTTACAACCA	0.463																																																	0													102.0	97.0	99.0					3																	140406766		2203	4300	6503	SO:0001819	synonymous_variant	0			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1242T>C	3.37:g.140406766T>C			A1L4B4|Q8N832|Q8NDL3	Silent	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.Y414	ENST00000286349.3	37	c.1242	CCDS3113.1	3																																																																																			TRIM42	-	NULL	ENSG00000155890		0.463	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	-	0.00	33	0	T	NM_152616		140406766	+1	tier1	-	no_errors	ENST00000286349	ensembl	human	known	74_37	silent	25.00	27	9	SNP	0.000	C
TRPM6	140803	genome.wustl.edu	37	9	77370357	77370357	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr9:77370357G>C	ENST00000360774.1	-	28	5055	c.4818C>G	c.(4816-4818)gaC>gaG	p.D1606E	TRPM6_ENST00000361255.3_Missense_Mutation_p.D1601E|TRPM6_ENST00000449912.2_Missense_Mutation_p.D1601E|TRPM6_ENST00000451710.3_Missense_Mutation_p.D1606E|TRPM6_ENST00000376864.4_Missense_Mutation_p.D1606E|TRPM6_ENST00000376872.3_Missense_Mutation_p.D557E|TRPM6_ENST00000376871.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1606					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GATTCAACTGGTCACTCTGAG	0.433																																																	0													167.0	147.0	154.0					9																	77370357		2203	4300	6503	SO:0001583	missense	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.4818C>G	9.37:g.77370357G>C	ENSP00000354006:p.Asp1606Glu		Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.D1606E	ENST00000360774.1	37	c.4818	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	G	3.483	-0.105400	0.06967	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000376872;ENST00000449912;ENST00000361255;ENST00000376864	T;T;T;T;T;T	0.52526	0.75;0.75;0.68;0.75;0.75;0.66	5.13	-1.78	0.07957	.	0.559053	0.20416	N	0.092771	T	0.42359	0.1199	L	0.60455	1.87	0.09310	N	1	D;B;B;B	0.57257	0.979;0.02;0.161;0.034	P;B;B;B	0.50405	0.64;0.024;0.079;0.053	T	0.33599	-0.9862	10	0.52906	T	0.07	.	2.0444	0.03557	0.3336:0.2033:0.3597:0.1034	.	557;1606;1601;1601	Q9BX84-5;Q9BX84;Q9BX84-3;Q9BX84-2	.;TRPM6_HUMAN;.;.	E	1606;1606;557;1601;1601;1606	ENSP00000354006:D1606E;ENSP00000407341:D1606E;ENSP00000366068:D557E;ENSP00000396672:D1601E;ENSP00000354962:D1601E;ENSP00000366060:D1606E	ENSP00000354006:D1606E	D	-	3	2	TRPM6	76560177	0.431000	0.25546	0.057000	0.19452	0.001000	0.01503	-0.098000	0.11024	-0.199000	0.10317	-0.793000	0.03317	GAC	TRPM6	-	NULL	ENSG00000119121		0.433	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	-	0.00	57	0	G	NM_017662		77370357	-1	tier1	-	no_errors	ENST00000451710	ensembl	human	known	74_37	missense	30.00	28	12	SNP	0.048	C
TXNRD2	10587	genome.wustl.edu	37	22	19902752	19902752	+	Silent	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr22:19902752C>T	ENST00000400521.1	-	7	582	c.576G>A	c.(574-576)ccG>ccA	p.P192P	TXNRD2_ENST00000334363.9_Silent_p.P192P|TXNRD2_ENST00000400518.1_Silent_p.P162P|TXNRD2_ENST00000535882.1_Silent_p.P191P|TXNRD2_ENST00000542719.1_Silent_p.P162P|TXNRD2_ENST00000491939.1_5'UTR|TXNRD2_ENST00000400519.1_Silent_p.P191P	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	192					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					TGGGGTATCTCGGCCGCCCTC	0.572																																																	0													54.0	64.0	61.0					22																	19902752		2054	4190	6244	SO:0001819	synonymous_variant	0			AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.576G>A	22.37:g.19902752C>T			O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Silent	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,pfam_GIDA-rel,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,tigrfam_Thioredoxin/glutathione_Rdtase	p.P191	ENST00000400521.1	37	c.573	CCDS42981.1	22																																																																																			TXNRD2	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_FAD_pyr_nucl-diS_OxRdtase,tigrfam_Thioredoxin/glutathione_Rdtase	ENSG00000184470		0.572	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	TXNRD2	HGNC	protein_coding	OTTHUMT00000314903.3	-	0.00	24	0	C	NM_006440		19902752	-1	tier1	-	no_errors	ENST00000535882	ensembl	human	known	74_37	silent	54.17	11	13	SNP	0.011	T
TMPRSS11F	389208	genome.wustl.edu	37	4	68928467	68928467	+	Intron	SNP	A	A	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:68928467A>C	ENST00000356291.2	-	8	1075				UBA6-AS1_ENST00000500538.2_RNA|UBA6-AS1_ENST00000499180.2_RNA|UBA6-AS1_ENST00000511571.1_RNA|RP11-35D5.1_ENST00000600441.1_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F							extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						TGAAAACAAAAGTTTCCTTGT	0.408																																																	0													135.0	139.0	138.0					4																	68928467		2196	4300	6496	SO:0001627	intron_variant	0			AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.1015+1935T>G	4.37:g.68928467A>C			A8MXX2	RNA	SNP	-	NULL	ENST00000356291.2	37	NULL	CCDS3520.1	4																																																																																			UBA6-AS1	-	-	ENSG00000248049		0.408	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA6-AS1	HGNC	protein_coding	OTTHUMT00000251439.1	-	0.00	56	0	A	NM_207407		68928467	+1	tier1	-	no_errors	ENST00000500538	ensembl	human	known	74_37	rna	23.44	49	15	SNP	0.999	C
ULK4P2	100288380	genome.wustl.edu	37	15	30875162	30875162	+	RNA	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr15:30875162T>C	ENST00000569682.1	+	0	173				U8_ENST00000384699.1_RNA					ULK4 pseudogene 2																		CATTTTCAGGTAGGATCATAA	0.299																																																	0																																												0					15q13.2	2013-09-12	2013-09-12	2011-11-25	ENSG00000260128	ENSG00000260128			15776	pseudogene	pseudogene			"""family with sequence similarity 7, member A2"", ""unc-51-like kinase 4 (C. elegans) pseudogene 2"""	FAM7A2		11829490	Standard	NR_027470		Approved	D-X			OTTHUMG00000175653		15.37:g.30875162T>C				Splice_Site	SNP	-	NULL	ENST00000569682.1	37	c.NULL		15	.	.	.	.	.	.	.	.	.	.	.	5.569	0.289816	0.10567	.	.	ENSG00000175344	ENST00000437966;ENST00000399994	.	.	.	0.852	0.852	0.18995	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.9136	0.19041	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CHRNA7	28662454	1.000000	0.71417	0.694000	0.30210	0.073000	0.16967	2.826000	0.48104	0.632000	0.30432	0.163000	0.16589	.	ULK4P2	-	-	ENSG00000260128		0.299	ULK4P2-002	PUTATIVE	basic	processed_transcript	ULK4P2	HGNC	pseudogene	OTTHUMT00000430722.1		0.00	145	0	T			30875162	+1			no_errors	ENST00000561753	ensembl	human	putative	74_37	splice_site	5.49	86	5	SNP	0.985	C
VNN1	8876	genome.wustl.edu	37	6	133015257	133015257	+	Missense_Mutation	SNP	C	C	A	rs45610032	byFrequency	TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:133015257C>A	ENST00000367928.4	-	3	419	c.406G>T	c.(406-408)Gtg>Ttg	p.V136L		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	136	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.		V -> L (in dbSNP:rs45610032). {ECO:0000269|Ref.4}.		acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)			NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		ATATTTGCCACAACATAGATA	0.438																																																	0													155.0	139.0	144.0					6																	133015257		2203	4300	6503	SO:0001583	missense	0			AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.406G>T	6.37:g.133015257C>A	ENSP00000356905:p.Val136Leu		A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	p.V136L	ENST00000367928.4	37	c.406	CCDS5159.1	6	.	.	.	.	.	.	.	.	.	.	C	26.3	4.721626	0.89298	.	.	ENSG00000112299	ENST00000367928	D	0.89485	-2.52	6.07	6.07	0.98685	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.000000	0.64402	D	0.000004	D	0.90140	0.6919	M	0.76002	2.32	0.58432	D	0.999999	P	0.37141	0.584	B	0.44044	0.439	D	0.89290	0.3618	10	0.52906	T	0.07	-8.8184	20.6439	0.99570	0.0:1.0:0.0:0.0	.	136	O95497	VNN1_HUMAN	L	136	ENSP00000356905:V136L	ENSP00000356905:V136L	V	-	1	0	VNN1	133056950	1.000000	0.71417	0.969000	0.41365	0.874000	0.50279	6.622000	0.74233	2.890000	0.99128	0.650000	0.86243	GTG	VNN1	-	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	ENSG00000112299		0.438	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VNN1	HGNC	protein_coding	OTTHUMT00000042263.1	-	0.00	65	0	C			133015257	-1	tier1	-	no_errors	ENST00000367928	ensembl	human	known	74_37	missense	26.19	31	11	SNP	0.999	A
WASF3	10810	genome.wustl.edu	37	13	27250861	27250862	+	Splice_Site	INS	-	-	GT			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr13:27250861_27250862insGT	ENST00000335327.5	+	7	894	c.716_716insGT	c.(715-717)agg>aGTgg	p.R239fs	WASF3_ENST00000361042.4_Intron	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	239					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)				breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		CCAGATACTAGGTGTGTGTGTG	0.475																																																	0																																										SO:0001630	splice_region_variant	0			AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.716+1->GT	13.37:g.27250870_27250871dupGT			O94974|Q86VQ2	Frame_Shift_Ins	INS	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.S240fs	ENST00000335327.5	37	c.716_717	CCDS9318.1	13																																																																																			WASF3	-	NULL	ENSG00000132970		0.475	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF3	HGNC	protein_coding	OTTHUMT00000044258.1		0.00	83	0	-		Frame_Shift_Ins	27250862	+1	tier1		no_errors	ENST00000335327	ensembl	human	known	74_37	frame_shift_ins	20.00	44	11	INS	1.000:1.000	GT
WDR12	55759	genome.wustl.edu	37	2	203745605	203745605	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr2:203745605G>A	ENST00000261015.4	-	13	1999	c.1250C>T	c.(1249-1251)aCc>aTc	p.T417I		NM_018256.3	NP_060726.3			WD repeat domain 12											endometrium(3)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)	13						ATGGGAAGTGGTAGGTGAATA	0.333																																																	0													67.0	63.0	65.0					2																	203745605		2203	4298	6501	SO:0001583	missense	0			AF242546	CCDS2356.1	2q33.1	2013-01-09			ENSG00000138442	ENSG00000138442		"""WD repeat domain containing"""	14098	protein-coding gene	gene with protein product						16043514, 17353269	Standard	NM_018256		Approved	YTM1, FLJ10881	uc002uzl.3	Q9GZL7	OTTHUMG00000132855	ENST00000261015.4:c.1250C>T	2.37:g.203745605G>A	ENSP00000261015:p.Thr417Ile			Missense_Mutation	SNP	pfam_WD40_repeat,pfam_NLE,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T417I	ENST00000261015.4	37	c.1250	CCDS2356.1	2	.	.	.	.	.	.	.	.	.	.	G	16.43	3.122083	0.56613	.	.	ENSG00000138442	ENST00000261015	T	0.56611	0.45	4.82	4.82	0.62117	WD40-repeat-containing domain (1);	0.258920	0.36482	N	0.002572	T	0.44871	0.1314	L	0.36672	1.1	0.38873	D	0.956746	B	0.30482	0.281	B	0.27170	0.077	T	0.45026	-0.9289	10	0.36615	T	0.2	-5.2831	17.9391	0.89021	0.0:0.0:1.0:0.0	.	417	Q9GZL7	WDR12_HUMAN	I	417	ENSP00000261015:T417I	ENSP00000261015:T417I	T	-	2	0	WDR12	203453850	1.000000	0.71417	0.997000	0.53966	0.915000	0.54546	7.155000	0.77445	2.402000	0.81655	0.650000	0.86243	ACC	WDR12	-	pfscan_WD40_repeat_dom	ENSG00000138442		0.333	WDR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR12	HGNC	protein_coding	OTTHUMT00000256329.4	-	0.00	45	0	G	NM_018256		203745605	-1	tier1	-	no_errors	ENST00000261015	ensembl	human	known	74_37	missense	40.00	12	8	SNP	0.943	A
WDR17	116966	genome.wustl.edu	37	4	177094487	177094487	+	Missense_Mutation	SNP	G	G	T	rs201308930		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr4:177094487G>T	ENST00000280190.4	+	27	3587	c.3431G>T	c.(3430-3432)cGt>cTt	p.R1144L	WDR17_ENST00000393643.2_Missense_Mutation_p.R1120L|WDR17_ENST00000507824.2_Missense_Mutation_p.R1119L|WDR17_ENST00000508596.1_Missense_Mutation_p.R1105L			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	1144										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		AGCTATATTCGTACTGAAAAA	0.333																																																	0													89.0	84.0	86.0					4																	177094487		2203	4300	6503	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.3431G>T	4.37:g.177094487G>T	ENSP00000280190:p.Arg1144Leu		E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R1144L	ENST00000280190.4	37	c.3431	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210385	0.79240	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.60299	0.22;0.26;0.2	5.58	4.74	0.60224	.	0.217098	0.38837	N	0.001557	T	0.64757	0.2627	M	0.71581	2.175	0.58432	D	0.999998	P;P;P	0.50710	0.938;0.895;0.895	P;B;B	0.48454	0.578;0.343;0.343	T	0.70278	-0.4916	10	0.72032	D	0.01	-6.1945	14.4419	0.67323	0.0713:0.0:0.9287:0.0	.	1120;1105;1144	E7EP77;E7EQX0;Q8IZU2	.;.;WDR17_HUMAN	L	1105;1120;1144;1120	ENSP00000422763:R1105L;ENSP00000377258:R1120L;ENSP00000280190:R1144L	ENSP00000280190:R1144L	R	+	2	0	WDR17	177331481	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	5.862000	0.69560	1.359000	0.45940	0.585000	0.79938	CGT	WDR17	-	NULL	ENSG00000150627		0.333	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	-	0.00	75	0	G			177094487	+1	tier1	-	no_errors	ENST00000280190	ensembl	human	known	74_37	missense	45.95	20	17	SNP	1.000	T
XPC	7508	genome.wustl.edu	37	3	14219966	14219968	+	Splice_Site	DEL	CCT	CCT	-	rs72561774	byFrequency	TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:14219966_14219968delCCT	ENST00000285021.7	-	1	315_317	c.101_103delAGG	c.(100-105)gaggat>gat	p.E34del	XPC_ENST00000449060.2_Splice_Site_p.E34del|LSM3_ENST00000306024.3_5'UTR	NM_001145769.1|NM_004628.4	NP_001139241.1|NP_004619.3	Q01831	XPC_HUMAN	xeroderma pigmentosum, complementation group C	34	Glu-rich (acidic).|Poly-Glu.				DNA repair (GO:0006281)|intra-S DNA damage checkpoint (GO:0031573)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|regulation of mitotic cell cycle phase transition (GO:1901990)|response to drug (GO:0042493)|response to UV-B (GO:0010224)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|XPC complex (GO:0071942)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|heteroduplex DNA loop binding (GO:0000404)|single-stranded DNA binding (GO:0003697)	p.E34delE(1)		NS(1)|breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCGCTCTCACCCTCCTCCTCCTC	0.734			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (C)	3	3p25	7508	"""xeroderma pigmentosum, complementation group C"""		E	1	Deletion - In frame(1)	upper_aerodigestive_tract(1)							,	315,1,3348		29,0,257,0,1,1545					,	5.2	1.0			23	706,1,7113		33,0,640,0,1,3236	no	codingComplex-near-splice,codingComplex-near-splice	XPC	NM_004628.4,NM_001145769.1	,	62,0,897,0,2,4781	A1A1,A1A2,A1R,A2A2,A2R,RR		9.0409,8.6245,8.908	,	,		1021,2,10461				SO:0001630	splice_region_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS46763.1	3p25.1	2014-09-17			ENSG00000154767	ENSG00000154767			12816	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group C protein"""	613208				1522891	Standard	NM_004628		Approved	XPCC, RAD4	uc011ave.2	Q01831	OTTHUMG00000155526	ENST00000285021.7:c.103+1AGG>-	3.37:g.14219975_14219977delCCT			B4DIP3|E9PB96|E9PH69|Q53GT7|Q96AX0	In_Frame_Del	DEL	pfam_Rad4/PNGase_transGLS-fold,pfam_Rad4_beta-hairpin_dom3,pfam_Rad4_beta-hairpin_dom2,pfam_Rad4_beta-hairpin_dom1,tigrfam_DNA_repair_Rad4_subgr	p.E34in_frame_del	ENST00000285021.7	37	c.103_101	CCDS46763.1	3																																																																																			XPC	-	NULL	ENSG00000154767		0.734	XPC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XPC	HGNC	protein_coding	OTTHUMT00000340517.3		0.00	11	0	CCT	NM_004628	In_Frame_Del	14219968	-1	tier1		no_errors	ENST00000285021	ensembl	human	known	74_37	in_frame_del	15.79	16	3	DEL	0.927:0.902:0.864	-
ZBBX	79740	genome.wustl.edu	37	3	167039988	167039988	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:167039988T>A	ENST00000392766.2	-	12	1240	c.900A>T	c.(898-900)aaA>aaT	p.K300N	ZBBX_ENST00000307529.5_Missense_Mutation_p.K300N|ZBBX_ENST00000392767.2_Missense_Mutation_p.K300N|ZBBX_ENST00000455345.2_Missense_Mutation_p.K300N|ZBBX_ENST00000469220.1_Intron|ZBBX_ENST00000392764.1_Missense_Mutation_p.K271N	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	300						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CTCTCCAAATTTTCAGATTAG	0.279																																																	0													75.0	70.0	71.0					3																	167039988		1789	4041	5830	SO:0001583	missense	0			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.900A>T	3.37:g.167039988T>A	ENSP00000376519:p.Lys300Asn		A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	pfam_Znf_B-box	p.K300N	ENST00000392766.2	37	c.900	CCDS3199.2	3	.	.	.	.	.	.	.	.	.	.	T	20.6	4.021021	0.75275	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.11712	2.93;2.93;2.92;2.92;2.75	5.86	5.86	0.93980	.	0.000000	0.34025	U	0.004322	T	0.28433	0.0703	M	0.61703	1.905	0.38539	D	0.94917	D;D	0.76494	0.999;0.999	D;P	0.68039	0.955;0.902	T	0.03423	-1.1038	10	0.66056	D	0.02	-12.8314	12.6425	0.56716	0.0:0.0:0.0:1.0	.	300;300	A8MT70-2;A8MT70	.;ZBBX_HUMAN	N	300;300;300;300;271	ENSP00000376519:K300N;ENSP00000376520:K300N;ENSP00000390232:K300N;ENSP00000305065:K300N;ENSP00000376517:K271N	ENSP00000305065:K300N	K	-	3	2	ZBBX	168522682	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	2.863000	0.48396	2.237000	0.73441	0.528000	0.53228	AAA	ZBBX	-	NULL	ENSG00000169064		0.279	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	HGNC	protein_coding	OTTHUMT00000257657.3	-	0.00	67	0	T	NM_024687		167039988	-1	tier1	-	no_errors	ENST00000307529	ensembl	human	known	74_37	missense	47.22	38	34	SNP	1.000	A
ZFP14	57677	genome.wustl.edu	37	19	36831221	36831221	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:36831221T>C	ENST00000270001.7	-	5	1622	c.1507A>G	c.(1507-1509)Act>Gct	p.T503A		NM_020917.2	NP_065968.1	Q9HCL3	ZFP14_HUMAN	ZFP14 zinc finger protein	503					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	26	Esophageal squamous(110;0.162)					TTCTCACCAGTATGAATTCTC	0.373																																																	0													70.0	69.0	69.0					19																	36831221		2203	4300	6503	SO:0001583	missense	0			AB046779	CCDS33002.1	19q13.13	2013-01-08	2012-11-27			ENSG00000142065		"""Zinc fingers, C2H2-type"", ""-"""	29312	protein-coding gene	gene with protein product			"""zinc finger protein 14 homolog (mouse)"""			10997877	Standard	NM_020917		Approved	KIAA1559, ZNF531	uc010eex.2	Q9HCL3		ENST00000270001.7:c.1507A>G	19.37:g.36831221T>C	ENSP00000270001:p.Thr503Ala		A7MD23	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T503A	ENST00000270001.7	37	c.1507	CCDS33002.1	19	.	.	.	.	.	.	.	.	.	.	t	12.97	2.096921	0.37048	.	.	ENSG00000142065	ENST00000270001;ENST00000392172	T	0.26518	1.73	3.93	3.93	0.45458	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45361	D	0.000367	T	0.27933	0.0688	M	0.66378	2.025	0.80722	D	1	B;P	0.35923	0.086;0.528	B;B	0.38985	0.117;0.287	T	0.09443	-1.0674	10	0.59425	D	0.04	.	7.1937	0.25841	0.0:0.1053:0.0:0.8947	.	503;503	A8KAN8;Q9HCL3	.;ZFP14_HUMAN	A	503	ENSP00000270001:T503A	ENSP00000270001:T503A	T	-	1	0	ZFP14	41523061	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	1.553000	0.36255	1.767000	0.52121	0.450000	0.29827	ACT	ZFP14	-	pfscan_Znf_C2H2	ENSG00000142065		0.373	ZFP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP14	HGNC	protein_coding	OTTHUMT00000452528.1	-	0.00	45	0	T	NM_020917		36831221	-1	tier1	-	no_errors	ENST00000270001	ensembl	human	known	74_37	missense	38.71	38	24	SNP	0.988	C
ZIC4	84107	genome.wustl.edu	37	3	147106563	147106563	+	3'UTR	SNP	C	C	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr3:147106563C>T	ENST00000383075.3	-	0	1600				ZIC4_ENST00000473123.1_3'UTR|ZIC4_ENST00000491672.1_3'UTR|ZIC4_ENST00000472749.2_5'UTR|ZIC4-AS1_ENST00000462168.1_RNA|ZIC4_ENST00000525172.2_3'UTR|ZIC4_ENST00000425731.3_3'UTR|ZIC4_ENST00000484399.1_3'UTR	NM_032153.5	NP_115529.2	Q8N9L1	ZIC4_HUMAN	Zic family member 4							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(34)|upper_aerodigestive_tract(4)	57						GCTTTGTGCGCGGGCCCTTTG	0.542																																																	0													28.0	26.0	27.0					3																	147106563		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			AF332509	CCDS43160.1, CCDS54652.1, CCDS54653.1, CCDS58857.1	3q24	2013-01-08	2003-02-21		ENSG00000174963	ENSG00000174963		"""Zinc fingers, C2H2-type"""	20393	protein-coding gene	gene with protein product		608948	"""zinc finger protein of the cerebellum 4"""				Standard	NM_001168378		Approved		uc011bno.2	Q8N9L1	OTTHUMG00000037281	ENST00000383075.3:c.*83G>A	3.37:g.147106563C>T			A0AVA2|B2RMQ8|B4DF89|B7Z2L2|C9J7D5|J3KQG1|Q4G157|Q9BZ94	RNA	SNP	-	NULL	ENST00000383075.3	37	NULL	CCDS43160.1	3																																																																																			ZIC4	-	-	ENSG00000174963		0.542	ZIC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC4	HGNC	protein_coding	OTTHUMT00000355504.1	-	0.00	37	0	C			147106563	-1	tier1	-	no_errors	ENST00000472749	ensembl	human	known	74_37	rna	66.10	20	39	SNP	0.957	T
ZNF192P1	651302	genome.wustl.edu	37	6	28134976	28134976	+	RNA	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr6:28134976T>C	ENST00000440790.2	+	0	1079					NR_103448.1				zinc finger protein 192 pseudogene 1																		GCCCTATGAGTGTGGAGAGTG	0.443																																																	0													64.0	65.0	65.0					6																	28134976		692	1591	2283			0					6p22.1	2012-10-05	2011-08-31	2011-08-31	ENSG00000226314	ENSG00000226314			18777	pseudogene	pseudogene	"""zinc finger protein 389, pseudogene"""		"""zinc finger protein 389"""	ZNF389			Standard	NR_103448		Approved	dJ265C24.4, ZNF389P	uc021yrq.2		OTTHUMG00000014513		6.37:g.28134976T>C				RNA	SNP	-	NULL	ENST00000440790.2	37	NULL		6																																																																																			ZNF192P1	-	-	ENSG00000226314		0.443	ZNF192P1-001	KNOWN	basic	processed_transcript	ZNF192P1	HGNC	pseudogene	OTTHUMT00000040181.1	-	0.00	57	0	T			28134976	+1	tier1	-	no_errors	ENST00000440790	ensembl	human	known	74_37	rna	11.36	39	5	SNP	0.997	C
ZNF43	7594	genome.wustl.edu	37	19	21990665	21990665	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:21990665T>G	ENST00000354959.4	-	4	2343	c.2174A>C	c.(2173-2175)aAg>aCg	p.K725T	ZNF43_ENST00000595461.1_Missense_Mutation_p.K719T|ZNF43_ENST00000598381.1_Missense_Mutation_p.K719T|ZNF43_ENST00000594012.1_Missense_Mutation_p.K719T	NM_003423.3	NP_003414.2	P17038	ZNF43_HUMAN	zinc finger protein 43	725					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	51		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		ATGAATTTTCTTATGTTCAAT	0.343																																																	0													57.0	61.0	60.0					19																	21990665		2202	4299	6501	SO:0001583	missense	0			X59244	CCDS12413.2, CCDS59367.1, CCDS74321.1	19p13.1-p12	2013-01-08	2006-05-11		ENSG00000198521	ENSG00000198521		"""Zinc fingers, C2H2-type"", ""-"""	13109	protein-coding gene	gene with protein product		603972	"""zinc finger protein 39-like 1 (KOX 27)"", ""zinc finger protein 43 (HTF6)"""	ZNF39L1		1711675	Standard	NM_001256649		Approved	HTF6, KOX27	uc031rka.1	P17038	OTTHUMG00000128543	ENST00000354959.4:c.2174A>C	19.37:g.21990665T>G	ENSP00000347045:p.Lys725Thr		A8K5N8|P28160|Q53XQ2|Q5H9T3|Q96DG1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K725T	ENST00000354959.4	37	c.2174	CCDS12413.2	19	.	.	.	.	.	.	.	.	.	.	T	11.33	1.608092	0.28623	.	.	ENSG00000198521	ENST00000397148;ENST00000354959	T	0.51817	0.69	1.76	0.534	0.17127	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48786	0.1519	L	0.39514	1.22	0.21802	N	0.99954	D	0.60160	0.987	P	0.62089	0.898	T	0.35276	-0.9795	9	0.72032	D	0.01	.	2.1576	0.03816	0.2548:0.1649:0.0:0.5803	.	725	P17038	ZNF43_HUMAN	T	724;725	ENSP00000347045:K725T	ENSP00000347045:K725T	K	-	2	0	ZNF43	21782505	0.000000	0.05858	0.001000	0.08648	0.808000	0.45660	-0.583000	0.05807	-0.062000	0.13088	0.254000	0.18369	AAG	ZNF43	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198521		0.343	ZNF43-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF43	HGNC	protein_coding	OTTHUMT00000250380.2	-	0.00	49	0	T	NM_003423		21990665	-1	tier1	-	no_errors	ENST00000354959	ensembl	human	known	74_37	missense	22.45	38	11	SNP	0.682	G
ZNF496	84838	genome.wustl.edu	37	1	247464406	247464406	+	Silent	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr1:247464406G>A	ENST00000294753.4	-	9	1643	c.1179C>T	c.(1177-1179)acC>acT	p.T393T	ZNF496_ENST00000366498.2_Silent_p.T429T|ZNF496_ENST00000462139.1_5'UTR	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	393					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			CTCCGGCCTCGGTGCTGCTCC	0.642																																																	0													33.0	36.0	35.0					1																	247464406		2203	4300	6503	SO:0001819	synonymous_variant	0			BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.1179C>T	1.37:g.247464406G>A			Q8TBS2	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.T429	ENST00000294753.4	37	c.1287	CCDS1631.1	1																																																																																			ZNF496	-	NULL	ENSG00000162714		0.642	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF496	HGNC	protein_coding	OTTHUMT00000098655.2	-	0.00	59	0	G	NM_032752		247464406	-1	tier1	-	no_errors	ENST00000366498	ensembl	human	known	74_37	silent	42.35	49	36	SNP	0.000	A
ZNF667	63934	genome.wustl.edu	37	19	56981328	56981328	+	Intron	SNP	C	C	G			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:56981328C>G	ENST00000504904.3	-	3	661				ZNF667_ENST00000589652.1_Intron|ZNF667_ENST00000591790.1_Intron|ZNF667_ENST00000342634.3_Missense_Mutation_p.V33L|ZNF667_ENST00000292069.6_Intron			Q5HYK9	ZN667_HUMAN	zinc finger protein 667						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		TCAGGTGCCACTTCTTCACAG	0.438																																																	0													17.0	15.0	16.0					19																	56981328		876	1989	2865	SO:0001627	intron_variant	0				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.58+1739G>C	19.37:g.56981328C>G			B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V33L	ENST00000504904.3	37	c.97	CCDS12944.1	19	.	.	.	.	.	.	.	.	.	.	C	5.832	0.337772	0.11013	.	.	ENSG00000198046	ENST00000342634	T	0.05649	3.41	0.788	-1.58	0.08479	.	.	.	.	.	T	0.04770	0.0129	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.42982	-0.9419	6	0.30854	T	0.27	.	3.9781	0.09483	0.0:0.4614:0.0:0.5386	.	.	.	.	L	33	ENSP00000344699:V33L	ENSP00000344699:V33L	V	-	1	0	ZNF667	61673140	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	-0.682000	0.05185	-0.660000	0.05352	-1.185000	0.01705	GTG	ZNF667	-	NULL	ENSG00000198046		0.438	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF667	HGNC	protein_coding	OTTHUMT00000458394.1	-	0.00	55	0	C	NM_022103		56981328	-1	tier1	-	no_errors	ENST00000342634	ensembl	human	known	74_37	missense	78.72	10	37	SNP	0.003	G
ZNF680	340252	genome.wustl.edu	37	7	63981863	63981863	+	Silent	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr7:63981863T>C	ENST00000309683.6	-	4	1420	c.1269A>G	c.(1267-1269)cgA>cgG	p.R423R	ZNF680_ENST00000476563.1_5'Flank	NM_178558.4	NP_848653.2	Q8NEM1	ZN680_HUMAN	zinc finger protein 680	423					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	27		Lung NSC(55;0.118)|all_lung(88;0.243)				TTCTCTTATGTCGAGTAAGGC	0.368																																																	0													33.0	34.0	34.0					7																	63981863		2201	4298	6499	SO:0001819	synonymous_variant	0			AK074911	CCDS34644.1, CCDS47594.1	7q11.21	2013-01-08			ENSG00000173041	ENSG00000173041		"""Zinc fingers, C2H2-type"", ""-"""	26897	protein-coding gene	gene with protein product	"""hypothetical protein FLJ90430"""					12477932	Standard	NM_178558		Approved	FLJ90430	uc003tta.2	Q8NEM1	OTTHUMG00000156542	ENST00000309683.6:c.1269A>G	7.37:g.63981863T>C			B3KVJ4|Q6ZNF3|Q8NC79	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R423	ENST00000309683.6	37	c.1269	CCDS34644.1	7																																																																																			ZNF680	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000173041		0.368	ZNF680-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF680	HGNC	protein_coding	OTTHUMT00000344568.1	-	0.00	47	0	T	NM_178558		63981863	-1	tier1	-	no_errors	ENST00000309683	ensembl	human	known	74_37	silent	21.28	37	10	SNP	0.255	C
ZNF829	374899	genome.wustl.edu	37	19	37383030	37383030	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:37383030A>T	ENST00000391711.3	-	6	1027	c.663T>A	c.(661-663)ttT>ttA	p.F221L	ZNF345_ENST00000526123.1_Intron|ZNF829_ENST00000520965.1_Missense_Mutation_p.F302L|ZNF345_ENST00000432005.2_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AACTACAACTAAAAGCCTTGC	0.403																																																	0													65.0	68.0	67.0					19																	37383030		2198	4297	6495	SO:0001583	missense	0			BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.663T>A	19.37:g.37383030A>T	ENSP00000429266:p.Phe221Leu		Q3KNS7|Q6ZNN0|Q7Z657	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F302L	ENST00000391711.3	37	c.906	CCDS42557.1	19	.	.	.	.	.	.	.	.	.	.	A	18.03	3.531551	0.64972	.	.	ENSG00000185869	ENST00000520965;ENST00000391711	T	0.46063	0.88	3.3	-0.127	0.13510	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.64549	0.2608	M	0.89163	3.01	0.25554	N	0.987056	D	0.89917	1.0	D	0.77557	0.99	T	0.53746	-0.8395	9	0.87932	D	0	.	7.7966	0.29150	0.5826:0.0:0.4174:0.0	.	221	Q3KNS6	ZN829_HUMAN	L	221	ENSP00000429266:F221L	ENSP00000429266:F221L	F	-	3	2	ZNF829	42074870	0.001000	0.12720	0.997000	0.53966	0.998000	0.95712	-0.180000	0.09754	-0.112000	0.11979	0.528000	0.53228	TTT	ZNF829	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185869		0.403	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF829	HGNC	protein_coding	OTTHUMT00000109575.3	-	0.00	60	0	A	NM_001037232		37383030	-1	tier1	-	no_errors	ENST00000520965	ensembl	human	known	74_37	missense	40.54	22	15	SNP	0.930	T
ZNF83	55769	genome.wustl.edu	37	19	53117750	53117750	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:53117750G>A	ENST00000597597.1	-	2	2321	c.68C>T	c.(67-69)tCa>tTa	p.S23L	ZNF83_ENST00000545872.1_Missense_Mutation_p.S23L|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000541777.2_Missense_Mutation_p.S23L|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000301096.3_Missense_Mutation_p.S23L|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000544146.1_Missense_Mutation_p.S23L|ZNF83_ENST00000391789.4_Missense_Mutation_p.S23L|ZNF83_ENST00000536937.1_Missense_Mutation_p.S23L			P51522	ZNF83_HUMAN	zinc finger protein 83	23					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		TGGTAGATGTGACTGCGGGTT	0.403																																																	0													61.0	66.0	64.0					19																	53117750		2203	4300	6503	SO:0001583	missense	0			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.68C>T	19.37:g.53117750G>A	ENSP00000472619:p.Ser23Leu		A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S23L	ENST00000597597.1	37	c.68	CCDS12854.1	19	.	.	.	.	.	.	.	.	.	.	g	10.25	1.298216	0.23650	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.09073	3.05;3.05;3.05;3.05;3.05;3.02	1.66	0.526	0.17078	.	.	.	.	.	T	0.12008	0.0292	M	0.63428	1.95	0.09310	N	1	B;P	0.51791	0.349;0.948	B;P	0.49528	0.026;0.614	T	0.17471	-1.0368	9	0.56958	D	0.05	.	2.7862	0.05374	0.343:0.2494:0.4076:0.0	.	23;23	P51522-2;P51522	.;ZNF83_HUMAN	L	23	ENSP00000445993:S23L;ENSP00000301096:S23L;ENSP00000445470:S23L;ENSP00000440713:S23L;ENSP00000439681:S23L;ENSP00000375666:S23L	ENSP00000301096:S23L	S	-	2	0	ZNF83	57809562	0.055000	0.20627	0.007000	0.13788	0.004000	0.04260	0.923000	0.28757	0.025000	0.15241	-0.384000	0.06662	TCA	ZNF83	-	NULL	ENSG00000167766		0.403	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	HGNC	protein_coding	OTTHUMT00000463700.1		0.00	39	0	G	NM_018300		53117750	-1			no_errors	ENST00000301096	ensembl	human	known	74_37	missense	11.11	24	3	SNP	0.003	A
ZNF831	128611	genome.wustl.edu	37	20	57766158	57766158	+	Silent	SNP	T	T	C			TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr20:57766158T>C	ENST00000371030.2	+	1	84	c.84T>C	c.(82-84)ggT>ggC	p.G28G		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	28	Pro-rich.						metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					GGGCCCCAGGTGGCCAGGCCT	0.692																																																	0													24.0	28.0	27.0					20																	57766158		1927	4127	6054	SO:0001819	synonymous_variant	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.84T>C	20.37:g.57766158T>C			Q5TDR4|Q8TCP0	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G28	ENST00000371030.2	37	c.84	CCDS42894.1	20																																																																																			ZNF831	-	NULL	ENSG00000124203		0.692	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	-	0.00	35	0	T	NM_178457		57766158	+1	tier1	-	no_errors	ENST00000371030	ensembl	human	novel	74_37	silent	9.86	64	7	SNP	0.002	C
ZNRF4	148066	genome.wustl.edu	37	19	5455945	5455945	+	Missense_Mutation	SNP	C	C	T	rs374695381		TCGA-L5-A4ON-01A-11D-A27G-09	TCGA-L5-A4ON-11A-21D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	5037c10c-48fe-4a49-9a26-2f0d2ebac3f5	05dd77a6-c3a2-44e5-b6aa-a69f9a88ffc1	g.chr19:5455945C>T	ENST00000222033.4	+	1	520	c.443C>T	c.(442-444)cCg>cTg	p.P148L		NM_181710.3	NP_859061.3	Q8WWF5	ZNRF4_HUMAN	zinc and ring finger 4	148	PA.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			NS(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;0.0002)		ATCGAGGCCCCGCGACTGGGC	0.692																																																	0								C	LEU/PRO	0,4256		0,0,2128	32.0	38.0	36.0		443	4.7	0.3	19		36	1,8443		0,1,4221	no	missense	ZNRF4	NM_181710.3	98	0,1,6349	TT,TC,CC		0.0118,0.0,0.0079	probably-damaging	148/430	5455945	1,12699	2128	4222	6350	SO:0001583	missense	0			AK098722	CCDS42475.1	19p13.3	2013-01-09				ENSG00000105428		"""RING-type (C3HC4) zinc fingers"""	17726	protein-coding gene	gene with protein product		612063					Standard	NM_181710		Approved	spzn, Ssrzf1, RNF204	uc002mca.4	Q8WWF5		ENST00000222033.4:c.443C>T	19.37:g.5455945C>T	ENSP00000222033:p.Pro148Leu		A8K886|O75866	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.P148L	ENST00000222033.4	37	c.443	CCDS42475.1	19	.	.	.	.	.	.	.	.	.	.	C	13.74	2.326991	0.41197	0.0	1.18E-4	ENSG00000105428	ENST00000222033	T	0.06142	3.34	4.65	4.65	0.58169	.	0.000000	0.85682	U	0.000000	T	0.27419	0.0673	M	0.84948	2.725	0.52501	D	0.999958	D	0.89917	1.0	D	0.71870	0.975	T	0.05533	-1.0879	10	0.87932	D	0	.	14.2204	0.65823	0.0:1.0:0.0:0.0	.	148	Q8WWF5	ZNRF4_HUMAN	L	148	ENSP00000222033:P148L	ENSP00000222033:P148L	P	+	2	0	ZNRF4	5406945	0.806000	0.28996	0.282000	0.24776	0.109000	0.19521	4.908000	0.63307	2.140000	0.66376	0.491000	0.48974	CCG	ZNRF4	-	NULL	ENSG00000105428		0.692	ZNRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNRF4	HGNC	protein_coding	OTTHUMT00000450924.1	-	0.00	43	0	C	NM_181710		5455945	+1	tier1	-	no_errors	ENST00000222033	ensembl	human	known	74_37	missense	44.68	26	21	SNP	0.631	T
