#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ADD2	119	genome.wustl.edu	37	2	70905912	70905912	+	Missense_Mutation	SNP	G	G	A	rs201022450		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr2:70905912G>A	ENST00000264436.4	-	11	1751	c.1307C>T	c.(1306-1308)aCg>aTg	p.T436M	ADD2_ENST00000413157.2_Missense_Mutation_p.T436M|ADD2_ENST00000355733.3_Missense_Mutation_p.T436M|ADD2_ENST00000407644.2_Missense_Mutation_p.T436M|ADD2_ENST00000430656.1_Missense_Mutation_p.T452M	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	436	Interaction with calmodulin. {ECO:0000255}.				actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						GGTGTTGGGCGTATTGAGCCA	0.647																																																	0								G	MET/THR,MET/THR,MET/THR,MET/THR,MET/THR	1,4405	2.1+/-5.4	0,1,2202	130.0	133.0	132.0		1307,1355,1307,1307,1307	4.3	1.0	2		132	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense,missense,missense	ADD2	NM_001185054.1,NM_001185055.1,NM_001617.3,NM_017482.3,NM_017488.3	81,81,81,81,81	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	436/727,452/576,436/727,436/560,436/644	70905912	2,13004	2203	4300	6503	SO:0001583	missense	0			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.1307C>T	2.37:g.70905912G>A	ENSP00000264436:p.Thr436Met		A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.T436M	ENST00000264436.4	37	c.1307	CCDS1906.1	2	.	.	.	.	.	.	.	.	.	.	G	23.5	4.423351	0.83559	2.27E-4	1.16E-4	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000355733;ENST00000356565;ENST00000413157;ENST00000430656	T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18	5.23	4.32	0.51571	.	0.052758	0.64402	D	0.000001	T	0.40862	0.1134	M	0.61703	1.905	0.47037	D	0.999291	D;D;D;D	0.89917	0.998;0.996;0.998;1.0	P;P;P;D	0.65874	0.762;0.814;0.841;0.939	T	0.21861	-1.0233	10	0.87932	D	0	-21.8515	13.6429	0.62263	0.0:0.1676:0.8324:0.0	.	452;436;436;436	B4DM17;P35612-4;P35612;P35612-3	.;.;ADDB_HUMAN;.	M	436;436;436;436;436;452	ENSP00000264436:T436M;ENSP00000384677:T436M;ENSP00000347972:T436M;ENSP00000388072:T436M;ENSP00000398112:T452M	ENSP00000264436:T436M	T	-	2	0	ADD2	70759420	1.000000	0.71417	0.987000	0.45799	0.994000	0.84299	7.645000	0.83430	2.716000	0.92895	0.655000	0.94253	ACG	ADD2	-	NULL	ENSG00000075340		0.647	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD2	HGNC	protein_coding	OTTHUMT00000251918.4	-	0.00	59	0	G	NM_001617		70905912	-1	tier1	rs201022450	no_errors	ENST00000264436	ensembl	human	known	74_37	missense	20.00	28	7	SNP	0.990	A
ANKS1B	56899	genome.wustl.edu	37	12	100205934	100205934	+	Splice_Site	SNP	T	T	C			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr12:100205934T>C	ENST00000547776.2	-	3	370	c.371A>G	c.(370-372)cAg>cGg	p.Q124R	ANKS1B_ENST00000547010.1_Intron|ANKS1B_ENST00000329257.7_Splice_Site_p.Q124R	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	124						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		CAAGTGCACCTGTTCATTGAC	0.378																																																	0													99.0	98.0	98.0					12																	100205934		1881	4101	5982	SO:0001630	splice_region_variant	0			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.372+1A>G	12.37:g.100205934T>C			A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTB/PI_dom,pfam_SAM_2,pfam_PTB,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTB/PI_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTB/PI_dom,pfscan_SAM,prints_Ankyrin_rpt	p.Q124R	ENST00000547776.2	37	c.371	CCDS55872.1	12	.	.	.	.	.	.	.	.	.	.	T	24.4	4.532632	0.85812	.	.	ENSG00000185046	ENST00000547776;ENST00000329257;ENST00000549866	T;T;T	0.70749	0.71;0.71;-0.51	5.69	5.69	0.88448	Ankyrin repeat-containing domain (4);	0.000000	0.64402	D	0.000001	T	0.74650	0.3744	N	0.21373	0.66	0.80722	D	1	D;D	0.71674	0.996;0.998	D;D	0.85130	0.986;0.997	T	0.73839	-0.3856	9	.	.	.	-7.6547	15.94	0.79747	0.0:0.0:0.0:1.0	.	124;124	F8VVQ4;Q7Z6G8	.;ANS1B_HUMAN	R	124	ENSP00000449629:Q124R;ENSP00000331381:Q124R;ENSP00000449894:Q124R	.	Q	-	2	0	ANKS1B	98730065	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.967000	0.70403	2.156000	0.67533	0.533000	0.62120	CAG	ANKS1B	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000185046		0.378	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ANKS1B	HGNC	protein_coding	OTTHUMT00000408421.3	-	0.00	60	0	T	NM_020140	Missense_Mutation	100205934	-1	tier1	-	no_errors	ENST00000329257	ensembl	human	known	74_37	missense	6.67	70	5	SNP	1.000	C
ASCC3	10973	genome.wustl.edu	37	6	101103625	101103625	+	Missense_Mutation	SNP	G	G	A	rs371587845		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr6:101103625G>A	ENST00000369162.2	-	17	3117	c.2773C>T	c.(2773-2775)Cgg>Tgg	p.R925W		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	925					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GCTCTCATCCGTACATAAAGA	0.343																																																	0								G	TRP/ARG	0,4406		0,0,2203	108.0	103.0	105.0		2773	5.8	1.0	6		105	1,8599		0,1,4299	no	missense	ASCC3	NM_006828.2	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	925/2203	101103625	1,13005	2203	4300	6503	SO:0001583	missense	0			AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.2773C>T	6.37:g.101103625G>A	ENSP00000358159:p.Arg925Trp		E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R925W	ENST00000369162.2	37	c.2773	CCDS5046.1	6	.	.	.	.	.	.	.	.	.	.	G	34	5.302908	0.95601	0.0	1.16E-4	ENSG00000112249	ENST00000369162	T	0.46819	0.86	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.81875	0.4915	H	0.99312	4.51	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89145	0.3519	10	0.87932	D	0	.	19.9946	0.97381	0.0:0.0:1.0:0.0	.	925	Q8N3C0	HELC1_HUMAN	W	925	ENSP00000358159:R925W	ENSP00000358159:R925W	R	-	1	2	ASCC3	101210346	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.414000	0.97362	2.728000	0.93425	0.591000	0.81541	CGG	ASCC3	-	NULL	ENSG00000112249		0.343	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCC3	HGNC	protein_coding	OTTHUMT00000041632.2		0.00	17	0	G	NM_006828		101103625	-1			no_errors	ENST00000369162	ensembl	human	known	74_37	missense	12.50	14	2	SNP	1.000	A
ASPM	259266	genome.wustl.edu	37	1	197057452	197057452	+	Silent	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr1:197057452G>T	ENST00000367409.4	-	26	10351	c.10095C>A	c.(10093-10095)ggC>ggA	p.G3365G	ASPM_ENST00000367408.1_Silent_p.G1030G|ASPM_ENST00000294732.7_Silent_p.G1780G	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3365					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.G3365G(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						AAATGCTTCCGCCTTTGTCTG	0.338																																																	1	Substitution - coding silent(1)	endometrium(1)											79.0	86.0	83.0					1																	197057452		2202	4299	6501	SO:0001819	synonymous_variant	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.10095C>A	1.37:g.197057452G>T			Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.G3365	ENST00000367409.4	37	c.10095	CCDS1389.1	1																																																																																			ASPM	-	NULL	ENSG00000066279		0.338	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1		0.00	33	0	G	NM_018136		197057452	-1			no_errors	ENST00000367409	ensembl	human	known	74_37	silent	6.52	43	3	SNP	0.856	T
ATHL1	80162	genome.wustl.edu	37	11	292904	292904	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr11:292904G>T	ENST00000409548.2	+	7	1292	c.1177G>T	c.(1177-1179)Gag>Tag	p.E393*	ATHL1_ENST00000409655.1_Nonsense_Mutation_p.E216*|ATHL1_ENST00000409479.1_Nonsense_Mutation_p.E393*	NM_025092.4	NP_079368.3	Q32M88	ATHL1_HUMAN	ATH1, acid trehalase-like 1 (yeast)	393					carbohydrate metabolic process (GO:0005975)		hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|liver(1)|lung(7)|prostate(1)|skin(3)	17		all_cancers(49;1.12e-06)|all_epithelial(84;0.000375)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;5.38e-28)|Epithelial(43;3.25e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0327)|LUSC - Lung squamous cell carcinoma(625;0.122)		GCTATTTCGAGAGGCTGGTGG	0.627																																																	0													72.0	67.0	69.0					11																	292904		2203	4300	6503	SO:0001587	stop_gained	0			AK090428	CCDS31322.2	11p15.5	2005-10-27			ENSG00000142102	ENSG00000142102			26210	protein-coding gene	gene with protein product							Standard	NM_025092		Approved	FLJ22635	uc010qvu.2	Q32M88	OTTHUMG00000153218	ENST00000409548.2:c.1177G>T	11.37:g.292904G>T	ENSP00000387185:p.Glu393*		Q658X8|Q8TEG9|Q9H635	Nonsense_Mutation	SNP	pfam_Glyco_hydro_65_M,superfamily_6-hairpin_glycosidase-like	p.E393*	ENST00000409548.2	37	c.1177	CCDS31322.2	11	.	.	.	.	.	.	.	.	.	.	G	41	8.968279	0.99019	.	.	ENSG00000142102	ENST00000409548;ENST00000409655;ENST00000409479	.	.	.	4.65	3.67	0.42095	.	0.433812	0.23914	N	0.043315	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	7.3449	0.26658	0.096:0.1718:0.7322:0.0	.	.	.	.	X	393;216;393	.	ENSP00000387099:E393X	E	+	1	0	ATHL1	282904	0.989000	0.36119	0.876000	0.34364	0.857000	0.48899	2.013000	0.40942	2.130000	0.65690	0.561000	0.74099	GAG	ATHL1	-	pfam_Glyco_hydro_65_M,superfamily_6-hairpin_glycosidase-like	ENSG00000142102		0.627	ATHL1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATHL1	HGNC	protein_coding	OTTHUMT00000330164.3	-	0.00	53	0	G	NM_025092		292904	+1	tier1	-	no_errors	ENST00000409548	ensembl	human	known	74_37	nonsense	8.33	44	4	SNP	0.589	T
BMS1P17	101101776	genome.wustl.edu	37	14	19904273	19904273	+	lincRNA	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr14:19904273C>T	ENST00000552602.1	-	0	202				BMS1P18_ENST00000549877.1_lincRNA																							TGTCTTCATGCGAACTTGGTA	0.403																																																	0																																												0																															14.37:g.19904273C>T				RNA	SNP	-	NULL	ENST00000552602.1	37	NULL		14																																																																																			BMS1P18	-	-	ENSG00000215394		0.403	CTD-2314B22.3-003	KNOWN	basic	lincRNA	BMS1P18	HGNC	lincRNA	OTTHUMT00000409412.1	-	0.00	60	0	C			19904273	+1	tier1	-	no_errors	ENST00000549877	ensembl	human	known	74_37	rna	20.45	35	9	SNP	1.000	T
MALRD1	340895	genome.wustl.edu	37	10	19569057	19569057	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr10:19569057A>C	ENST00000454679.2	+	5	1049	c.1049A>C	c.(1048-1050)gAa>gCa	p.E350A				Q5VYJ5	MALR1_HUMAN		350	LDL-receptor class A 2. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						ACAGACAATGAATTTATCTGC	0.403																																																	0																																										SO:0001583	missense	0																														ENST00000454679.2:c.1049A>C	10.37:g.19569057A>C	ENSP00000412763:p.Glu350Ala		B7ZBP2	Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt,prints_MAM_dom	p.E350A	ENST00000454679.2	37	c.1049		10	.	.	.	.	.	.	.	.	.	.	A	22.0	4.229212	0.79688	.	.	ENSG00000204740	ENST00000377266;ENST00000454679	D;D	0.96136	-3.92;-3.92	5.49	5.49	0.81192	.	.	.	.	.	D	0.96457	0.8844	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.95916	0.8927	5	.	.	.	.	14.7027	0.69166	1.0:0.0:0.0:0.0	.	.	.	.	A	363;350	ENSP00000366477:E363A;ENSP00000412763:E350A	.	E	+	2	0	C10orf112	19609063	1.000000	0.71417	0.986000	0.45419	0.965000	0.64279	5.830000	0.69324	2.295000	0.77249	0.523000	0.50628	GAA	C10orf112	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000204740		0.403	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		-	0.00	30	0	A			19569057	+1	tier1	-	no_errors	ENST00000454679	ensembl	human	known	74_37	missense	51.85	13	14	SNP	1.000	C
CALM3	808	genome.wustl.edu	37	19	47112420	47112420	+	3'UTR	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr19:47112420G>A	ENST00000291295.9	+	0	659				CALM3_ENST00000594523.1_3'UTR|CALM3_ENST00000598871.1_3'UTR|CALM3_ENST00000477244.1_3'UTR|CALM3_ENST00000599839.1_3'UTR|CALM3_ENST00000597743.1_3'UTR|CALM3_ENST00000391918.2_3'UTR|CALM3_ENST00000596362.1_3'UTR|CTB-12A17.3_ENST00000597609.1_RNA	NM_005184.2	NP_005175.2	P62158	CALM_HUMAN	calmodulin 3 (phosphorylase kinase, delta)						activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|carbohydrate metabolic process (GO:0005975)|detection of calcium ion (GO:0005513)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide metabolic process (GO:0046209)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cyclic nucleotide metabolic process (GO:0030801)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of cytokinesis (GO:0032465)|regulation of heart rate (GO:0002027)|regulation of high voltage-gated calcium channel activity (GO:1901841)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|response to corticosterone (GO:0051412)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcomere (GO:0030017)|spindle microtubule (GO:0005876)|spindle pole (GO:0000922)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|N-terminal myristoylation domain binding (GO:0031997)|nitric-oxide synthase regulator activity (GO:0030235)|phospholipase binding (GO:0043274)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|protein phosphatase activator activity (GO:0072542)|protein serine/threonine kinase activator activity (GO:0043539)|thioesterase binding (GO:0031996)|titin binding (GO:0031432)			breast(1)|cervix(2)|endometrium(1)|lung(1)|ovary(1)	6		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000338)|all cancers(93;0.000683)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0341)	Aprindine(DB01429)|Bepridil(DB01244)|Chlorpromazine(DB00477)|Cinchocaine(DB00527)|Felodipine(DB01023)|Flunarizine(DB04841)|Fluphenazine(DB00623)|Isoflurane(DB00753)|Loperamide(DB00836)|Melatonin(DB01065)|Nicardipine(DB00622)|Nifedipine(DB01115)|Perphenazine(DB00850)|Phenoxybenzamine(DB00925)|Pimozide(DB01100)|Promethazine(DB01069)|Trifluoperazine(DB00831)	AAGGCCCCCCGGGCAGCTGGC	0.592																																																	0													48.0	44.0	45.0					19																	47112420		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS33061.1	19q13.2-q13.3	2013-02-25			ENSG00000160014	ENSG00000160014		"""EF-hand domain containing"", ""Endogenous ligands"""	1449	protein-coding gene	gene with protein product	"""prepro-calmodulin 3"""	114183					Standard	NM_005184		Approved	PHKD	uc002pew.3	P62158	OTTHUMG00000133517	ENST00000291295.9:c.*10G>A	19.37:g.47112420G>A			P02593|P70667|P99014|Q13942|Q53S29|Q61379|Q61380|Q96HK3	RNA	SNP	-	NULL	ENST00000291295.9	37	NULL	CCDS33061.1	19																																																																																			CALM3	-	-	ENSG00000160014		0.592	CALM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALM3	HGNC	protein_coding	OTTHUMT00000257483.2	-	0.00	61	0	G			47112420	+1	tier1	-	no_errors	ENST00000477244	ensembl	human	known	74_37	rna	43.40	30	23	SNP	1.000	A
CASP12	100506742	genome.wustl.edu	37	11	104761930	104761930	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr11:104761930G>A	ENST00000422698.2	-	4	652	c.634C>T	c.(634-636)Ccc>Tcc	p.P212S	CASP12_ENST00000508062.1_Missense_Mutation_p.P128S|CASP12_ENST00000447913.1_Intron|CASP12_ENST00000494737.1_Intron|CASP12_ENST00000433738.1_Intron|CASP12_ENST00000441710.1_Missense_Mutation_p.P212S|CASP12_ENST00000448103.1_Intron|CASP12_ENST00000446862.1_Missense_Mutation_p.P212S|CASP12_ENST00000375726.2_Missense_Mutation_p.P212S	NM_001191016.1	NP_001177945.1	Q6UXS9	CASPC_HUMAN	caspase 12 (gene/pseudogene)	212					endoplasmic reticulum unfolded protein response (GO:0030968)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)			breast(1)	1						ATGACCTTGGGTTTGTCTTTC	0.473																																																	0																																										SO:0001583	missense	0			AF464191		11q22.3	2011-02-14	2007-12-17	2006-02-17	ENSG00000204403	ENSG00000204403		"""Caspases"""	19004	protein-coding gene	gene with protein product		608633	"""caspase 12 pseudogene 1"", ""caspase 12"""	CASP12P1		12054529, 9038361, 16917906, 16532395	Standard	NM_001191016		Approved		uc031qdo.1	Q6UXS9	OTTHUMG00000154965	ENST00000422698.2:c.634C>T	11.37:g.104761930G>A	ENSP00000427128:p.Pro212Ser		D6RBN7	Missense_Mutation	SNP	pfam_Pept_C14_caspase,pfam_CARD,superfamily_DEATH-like_dom,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	p.P212S	ENST00000422698.2	37	c.634	CCDS55785.1	11	.	.	.	.	.	.	.	.	.	.	G	19.47	3.832749	0.71258	.	.	ENSG00000204403	ENST00000422698;ENST00000375726;ENST00000446862;ENST00000441710;ENST00000508062	T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69	4.25	4.25	0.50352	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (2);Peptidase C14, ICE, catalytic subunit p20 (1);	0.000000	0.85682	D	0.000000	T	0.59676	0.2211	M	0.92459	3.31	0.53688	D	0.999973	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.71045	-0.4706	10	0.87932	D	0	.	14.5333	0.67942	0.0:0.0:1.0:0.0	.	212;212	Q6UXS9;D6RBN7	CASPC_HUMAN;.	S	212;212;212;212;128	ENSP00000427128:P212S;ENSP00000424038:P212S;ENSP00000425652:P212S;ENSP00000423970:P212S;ENSP00000426566:P128S	ENSP00000424038:P212S	P	-	1	0	CASP12	104267140	1.000000	0.71417	0.998000	0.56505	0.689000	0.40095	6.430000	0.73391	2.363000	0.80096	0.603000	0.83216	CCC	CASP12	-	pfam_Pept_C14_caspase,smart_Pept_C14A_p45_core,pirsf_Caspase_IL-1_beta,pfscan_Pept_C14_ICE_p20,prints_Pept_C14A_p45_core	ENSG00000204403		0.473	CASP12-008	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CASP12	HGNC	protein_coding	OTTHUMT00000337832.2	-	0.00	63	0	G	NM_001191016		104761930	-1	tier1	-	no_errors	ENST00000375726	ensembl	human	known	74_37	missense	19.23	42	10	SNP	1.000	A
CCDC62	84660	genome.wustl.edu	37	12	123285733	123285733	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr12:123285733A>C	ENST00000253079.6	+	9	1384	c.1040A>C	c.(1039-1041)aAa>aCa	p.K347T	CCDC62_ENST00000537566.1_Missense_Mutation_p.K108T|CCDC62_ENST00000392441.4_Missense_Mutation_p.K347T|CCDC62_ENST00000392440.2_Missense_Mutation_p.K108T	NM_201435.4	NP_958843.2	Q6P9F0	CCD62_HUMAN	coiled-coil domain containing 62	347					cellular response to estradiol stimulus (GO:0071392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	20	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.51e-06)|Epithelial(86;2.65e-05)|BRCA - Breast invasive adenocarcinoma(302;0.206)		AAGAGGGAAAAAAATCAGAAG	0.368																																																	0													70.0	73.0	72.0					12																	123285733		2203	4300	6503	SO:0001583	missense	0				CCDS9238.1	12q24.31	2009-08-18			ENSG00000130783	ENSG00000130783			30723	protein-coding gene	gene with protein product	"""cancer/testis antigen 109"""	613481				18563714, 19126643	Standard	NM_201435		Approved	TSP-NY, FLJ40344, CT109, ERAP75	uc001udc.3	Q6P9F0	OTTHUMG00000168764	ENST00000253079.6:c.1040A>C	12.37:g.123285733A>C	ENSP00000253079:p.Lys347Thr		A8K8V1|B3KUP3|Q6ZVF2|Q86VJ0|Q9BYZ5	Missense_Mutation	SNP	superfamily_Prefoldin	p.K347T	ENST00000253079.6	37	c.1040	CCDS9238.1	12	.	.	.	.	.	.	.	.	.	.	A	15.93	2.978769	0.53720	.	.	ENSG00000130783	ENST00000253079;ENST00000392441;ENST00000537566;ENST00000392440	T;T;T;T	0.51574	1.3;1.29;0.7;0.7	5.19	0.159	0.14968	.	0.680080	0.13579	N	0.377518	T	0.52693	0.1750	L	0.47716	1.5	0.24795	N	0.992732	P;D;B	0.76494	0.933;0.999;0.403	P;P;B	0.61658	0.544;0.892;0.221	T	0.42699	-0.9436	10	0.62326	D	0.03	-12.1433	7.5226	0.27637	0.4313:0.0:0.5687:0.0	.	347;108;347	Q6P9F0-2;Q6P9F0-3;Q6P9F0	.;.;CCD62_HUMAN	T	347;347;108;108	ENSP00000253079:K347T;ENSP00000376236:K347T;ENSP00000445045:K108T;ENSP00000376235:K108T	ENSP00000253079:K347T	K	+	2	0	CCDC62	121851686	1.000000	0.71417	0.991000	0.47740	0.438000	0.31896	0.670000	0.25157	0.043000	0.15746	-0.250000	0.11733	AAA	CCDC62	-	NULL	ENSG00000130783		0.368	CCDC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC62	HGNC	protein_coding	OTTHUMT00000400930.1	-	0.00	32	0	A	NM_032573		123285733	+1	tier1	-	no_errors	ENST00000253079	ensembl	human	known	74_37	missense	39.47	23	15	SNP	0.994	C
CCL20	6364	genome.wustl.edu	37	2	228680154	228680154	+	Intron	DEL	T	T	-	rs34834265		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr2:228680154delT	ENST00000358813.4	+	2	134				CCL20_ENST00000409189.3_Intron|CCL20_ENST00000473642.1_3'UTR			P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20						cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemokinesis (GO:0042466)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of T cell migration (GO:2000406)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			cervix(1)|lung(2)	3		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		TACCTTTCACTTTTTTTTTTT	0.363																																																	0													49.0	57.0	55.0					2																	228680154		2201	4300	6501	SO:0001627	intron_variant	0			D86955	CCDS2469.1, CCDS46536.1	2q36.3	2013-02-25	2002-08-22	2002-08-23	ENSG00000115009	ENSG00000115009		"""Chemokine ligands"", ""Endogenous ligands"""	10619	protein-coding gene	gene with protein product		601960	"""small inducible cytokine subfamily A (Cys-Cys), member 20"""	SCYA20		9038201, 11352563	Standard	NM_004591		Approved	LARC, MIP-3a, exodus-1, ST38, CKb4	uc002vpl.2	P78556	OTTHUMG00000133189	ENST00000358813.4:c.77-16T>-	2.37:g.228680154delT			Q53S51|Q99664	RNA	DEL	-	NULL	ENST00000358813.4	37	NULL	CCDS2469.1	2																																																																																			CCL20	-	-	ENSG00000115009		0.363	CCL20-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCL20	HGNC	protein_coding	OTTHUMT00000331641.1		0.00	8	0	T	NM_004591		228680154	+1	tier1		no_errors	ENST00000473642	ensembl	human	known	74_37	rna	16.67	10	2	DEL	0.010	-
CD1B	910	genome.wustl.edu	37	1	158299185	158299185	+	Missense_Mutation	SNP	C	C	A	rs375087573		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr1:158299185C>A	ENST00000368168.3	-	4	968	c.861G>T	c.(859-861)gaG>gaT	p.E287D		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	287	Ig-like.				antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					TGTCCTGGCCCTCTAAACTGC	0.567																																																	0													79.0	76.0	77.0					1																	158299185		2203	4300	6503	SO:0001583	missense	0			M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.861G>T	1.37:g.158299185C>A	ENSP00000357150:p.Glu287Asp		Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.E287D	ENST00000368168.3	37	c.861	CCDS1176.1	1	.	.	.	.	.	.	.	.	.	.	C	6.283	0.420364	0.11928	.	.	ENSG00000158485	ENST00000368168	T	0.02944	4.1	4.26	-6.05	0.02172	MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);	0.356741	0.20498	N	0.091151	T	0.00580	0.0019	L	0.33753	1.03	0.09310	N	1	B	0.12013	0.005	B	0.19391	0.025	T	0.46693	-0.9173	10	0.36615	T	0.2	-7.4594	1.7636	0.02997	0.2154:0.4049:0.1269:0.2528	.	287	P29016	CD1B_HUMAN	D	287	ENSP00000357150:E287D	ENSP00000357150:E287D	E	-	3	2	CD1B	156565809	0.000000	0.05858	0.200000	0.23457	0.024000	0.10985	-1.206000	0.03011	-1.078000	0.03117	-0.882000	0.02950	GAG	CD1B	-	pfam_Ig_C1-set,smart_Ig_C1-set	ENSG00000158485		0.567	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1B	HGNC	protein_coding	OTTHUMT00000046350.2	-	0.00	50	0	C	NM_001764		158299185	-1	tier1	-	no_errors	ENST00000368168	ensembl	human	known	74_37	missense	22.45	38	11	SNP	0.113	A
CDH9	1007	genome.wustl.edu	37	5	26915767	26915767	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr5:26915767G>T	ENST00000231021.4	-	3	666	c.494C>A	c.(493-495)aCt>aAt	p.T165N		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	165	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						AACACTGGCAGTGTATAAGTC	0.353																																					Melanoma(8;187 585 15745 40864 52829)												0													79.0	79.0	79.0					5																	26915767		2203	4300	6503	SO:0001583	missense	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.494C>A	5.37:g.26915767G>T	ENSP00000231021:p.Thr165Asn		Q3B7I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T165N	ENST00000231021.4	37	c.494	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	G	10.96	1.498354	0.26861	.	.	ENSG00000113100	ENST00000231021	T	0.51817	0.69	4.62	4.62	0.57501	Cadherin (4);Cadherin-like (1);	0.401728	0.28933	N	0.013678	T	0.22475	0.0542	N	0.02842	-0.48	0.29244	N	0.872423	B	0.09022	0.002	B	0.18263	0.021	T	0.11108	-1.0601	9	.	.	.	.	11.6384	0.51217	0.0:0.0:0.8223:0.1777	.	165	Q9ULB4	CADH9_HUMAN	N	165	ENSP00000231021:T165N	.	T	-	2	0	CDH9	26951524	0.479000	0.25925	1.000000	0.80357	0.999000	0.98932	0.933000	0.28897	2.275000	0.75901	0.650000	0.86243	ACT	CDH9	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000113100		0.353	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	-	0.00	19	0	G	NM_016279		26915767	-1	tier1	-	no_errors	ENST00000231021	ensembl	human	known	74_37	missense	27.27	8	3	SNP	1.000	T
CLDN16	10686	genome.wustl.edu	37	3	190127745	190127745	+	Missense_Mutation	SNP	G	G	A	rs549642537	byFrequency	TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr3:190127745G>A	ENST00000264734.2	+	5	1086	c.838G>A	c.(838-840)Gcg>Acg	p.A280T	CLDN16_ENST00000456423.1_3'UTR	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	280					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)	p.A280T(1)		breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		CTATTCAGCCGCGGGTGTTTC	0.448													G|||	6	0.00119808	0.0045	0.0	5008	,	,		16362	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	endometrium(1)											84.0	87.0	86.0					3																	190127745		2203	4300	6503	SO:0001583	missense	0			AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.838G>A	3.37:g.190127745G>A	ENSP00000264734:p.Ala280Thr			Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin16,prints_Claudin	p.A280T	ENST00000264734.2	37	c.838	CCDS3296.1	3	.	.	.	.	.	.	.	.	.	.	G	6.754	0.507968	0.12883	.	.	ENSG00000113946	ENST00000264734	D	0.90444	-2.67	5.95	-2.9	0.05648	.	0.521937	0.20019	N	0.100960	T	0.82213	0.4988	L	0.38838	1.175	0.27115	N	0.962284	B	0.14805	0.011	B	0.09377	0.004	T	0.64279	-0.6445	10	0.21540	T	0.41	-41.9827	11.587	0.50925	0.5855:0.0:0.4145:0.0	.	280	Q9Y5I7	CLD16_HUMAN	T	280	ENSP00000264734:A280T	ENSP00000264734:A280T	A	+	1	0	CLDN16	191610439	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.157000	0.16402	-1.032000	0.03304	-1.723000	0.00705	GCG	CLDN16	-	NULL	ENSG00000113946		0.448	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN16	HGNC	protein_coding	OTTHUMT00000343519.1	-	0.00	63	0	G	NM_006580		190127745	+1	tier1	-	no_errors	ENST00000264734	ensembl	human	known	74_37	missense	18.97	47	11	SNP	0.000	A
COL4A5	1287	genome.wustl.edu	37	X	107802335	107802335	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chrX:107802335G>T	ENST00000361603.2	+	3	427	c.183G>T	c.(181-183)ttG>ttT	p.L61F	COL4A5_ENST00000328300.6_Missense_Mutation_p.L61F	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	61	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						ACCCAGGATTGCCTGGATTTC	0.468									Alport syndrome with Diffuse Leiomyomatosis																																								0													115.0	109.0	111.0					X																	107802335		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.183G>T	X.37:g.107802335G>T	ENSP00000354505:p.Leu61Phe		Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.L61F	ENST00000361603.2	37	c.183	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	G	2.137	-0.397730	0.04899	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.96300	-3.97;-3.97	5.6	1.57	0.23409	.	0.217738	0.33346	N	0.005018	D	0.91885	0.7431	L	0.38175	1.15	0.43084	D	0.994745	B;B	0.33345	0.409;0.409	B;B	0.38500	0.275;0.275	D	0.83722	0.0193	10	0.10111	T	0.7	.	8.4924	0.33108	0.6131:0.0:0.3869:0.0	.	61;61	E7EVY4;P29400	.;CO4A5_HUMAN	F	61	ENSP00000331902:L61F;ENSP00000354505:L61F	ENSP00000331902:L61F	L	+	3	2	COL4A5	107688991	0.996000	0.38824	0.999000	0.59377	0.848000	0.48234	0.323000	0.19593	-0.017000	0.14103	-1.195000	0.01675	TTG	COL4A5	-	NULL	ENSG00000188153		0.468	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2	-	0.00	14	0	G			107802335	+1	tier1	-	no_errors	ENST00000328300	ensembl	human	known	74_37	missense	21.74	18	5	SNP	1.000	T
CSN3	1448	genome.wustl.edu	37	4	71114982	71114982	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr4:71114982G>T	ENST00000304954.3	+	4	441	c.355G>T	c.(355-357)Gcc>Tcc	p.A119S		NM_005212.2	NP_005203.2	Q9UNS2	CSN3_HUMAN	casein kappa	0					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						ATCATTTATTGCCATCCCCCC	0.483																																																	0													122.0	111.0	114.0					4																	71114982		2203	4300	6503	SO:0001583	missense	0			U51899	CCDS3538.1	4q21.1	2014-02-19	2003-01-24	2003-01-31	ENSG00000171209	ENSG00000171209			2446	protein-coding gene	gene with protein product		601695	"""casein, kappa"""	CSN10		8863730, 9050925	Standard	NM_005212		Approved		uc003hfe.4	P07498	OTTHUMG00000129399	ENST00000304954.3:c.355G>T	4.37:g.71114982G>T	ENSP00000304822:p.Ala119Ser		B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	pfam_Casein_kappa,pirsf_Casein_kappa	p.A119S	ENST00000304954.3	37	c.355	CCDS3538.1	4	.	.	.	.	.	.	.	.	.	.	G	13.11	2.138729	0.37728	.	.	ENSG00000171209	ENST00000304954	T	0.47177	0.85	4.3	3.42	0.39159	.	0.996520	0.08134	N	0.992610	T	0.66867	0.2833	M	0.76170	2.325	0.09310	N	1	D	0.64830	0.994	D	0.66351	0.943	T	0.50857	-0.8778	10	0.87932	D	0	-3.3007	9.978	0.41795	0.0:0.2059:0.7941:0.0	.	119	P07498	CASK_HUMAN	S	119	ENSP00000304822:A119S	ENSP00000304822:A119S	A	+	1	0	CSN3	71149571	0.000000	0.05858	0.005000	0.12908	0.100000	0.18952	0.299000	0.19138	1.343000	0.45638	0.655000	0.94253	GCC	CSN3	-	pfam_Casein_kappa,pirsf_Casein_kappa	ENSG00000171209		0.483	CSN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSN3	HGNC	protein_coding	OTTHUMT00000251555.1	-	0.00	29	0	G	NM_005212		71114982	+1	tier1	-	no_errors	ENST00000304954	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.005	T
CYB5RL	606495	genome.wustl.edu	37	1	54640442	54640442	+	Silent	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr1:54640442G>A	ENST00000534324.1	-	6	797	c.798C>T	c.(796-798)ggC>ggT	p.G266G	CYB5RL_ENST00000419823.2_Silent_p.G266G|AL357673.1_ENST00000536061.1_5'Flank|RP11-446E24.4_ENST00000525949.1_5'Flank|CYB5RL_ENST00000542737.1_Silent_p.G266G|RP11-446E24.4_ENST00000311841.7_Intron|CYB5RL_ENST00000287899.8_Silent_p.G198G|CYB5RL_ENST00000401046.3_Silent_p.G118G|CYB5RL_ENST00000537208.1_Silent_p.G198G			Q6IPT4	NB5R5_HUMAN	cytochrome b5 reductase-like	266							cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|urinary_tract(1)	8						GGCCCAGGTGGCCAAAGTGGG	0.557																																																	0													41.0	42.0	42.0					1																	54640442		1894	4119	6013	SO:0001819	synonymous_variant	0				CCDS44151.1	1p32.3	2011-04-08			ENSG00000215883	ENSG00000215883			32220	protein-coding gene	gene with protein product						12477932	Standard	NM_001031672		Approved	LOC606495	uc009vzo.3	Q6IPT4	OTTHUMG00000008082	ENST00000534324.1:c.798C>T	1.37:g.54640442G>A			B7ZBS4|Q8NF25	Silent	SNP	pfam_OxRdtase_FAD-bd_dom,pfam_Oxidoreductase-like_N,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Phe_hydroxylase	p.G266	ENST00000534324.1	37	c.798	CCDS44151.1	1																																																																																			CYB5RL	-	pfam_OxRdtase_FAD/NAD-bd	ENSG00000215883		0.557	CYB5RL-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CYB5RL	HGNC	protein_coding	OTTHUMT00000388318.1	-	0.00	39	0	G	NM_001031672		54640442	-1	tier1	-	no_errors	ENST00000419823	ensembl	human	known	74_37	silent	5.13	74	4	SNP	1.000	A
CTSK	1513	genome.wustl.edu	37	1	150779260	150779260	+	Missense_Mutation	SNP	G	G	T	rs138360770		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr1:150779260G>T	ENST00000271651.3	-	2	132	c.22C>A	c.(22-24)Ctg>Atg	p.L8M	CTSK_ENST00000480670.1_5'Flank	NM_000396.3	NP_000387.1	P43235	CATK_HUMAN	cathepsin K	8					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)			cervix(1)|endometrium(1)|lung(4)|skin(1)	7	all_cancers(9;2.32e-51)|all_epithelial(9;3.89e-42)|all_lung(15;4.59e-35)|Lung NSC(24;1.7e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Colorectal(459;0.171)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0485)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACAGGTAGCAGCAGAACCTTG	0.483																																																	0													138.0	121.0	127.0					1																	150779260		2203	4300	6503	SO:0001583	missense	0			BC016058	CCDS969.1	1q21	2008-02-05	2006-12-05		ENSG00000143387	ENSG00000143387		"""Cathepsins"""	2536	protein-coding gene	gene with protein product		601105	"""cathepsin K (pycnodysostosis)"""	CTSO2, CTSO, PYCD		7818555	Standard	NM_000396		Approved	PKND	uc001evp.2	P43235	OTTHUMG00000035008	ENST00000271651.3:c.22C>A	1.37:g.150779260G>T	ENSP00000271651:p.Leu8Met		Q6FHS6	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,pfam_Prot_inhib_I29,pfam_Peptidase_C1B,smart_Prot_inhib_I29,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.L8M	ENST00000271651.3	37	c.22	CCDS969.1	1	.	.	.	.	.	.	.	.	.	.	G	14.47	2.544968	0.45280	.	.	ENSG00000143387	ENST00000271651;ENST00000443913	T;T	0.79352	-1.26;-1.02	5.66	1.18	0.20946	.	0.334562	0.29692	N	0.011445	T	0.51770	0.1694	L	0.43152	1.355	0.28083	N	0.932127	P	0.45348	0.856	B	0.41988	0.372	T	0.48896	-0.8994	10	0.72032	D	0.01	.	5.9486	0.19234	0.2631:0.137:0.5999:0.0	.	8	P43235	CATK_HUMAN	M	8;67	ENSP00000271651:L8M;ENSP00000405083:L67M	ENSP00000271651:L8M	L	-	1	2	CTSK	149045884	0.001000	0.12720	0.899000	0.35326	0.879000	0.50718	0.362000	0.20284	0.658000	0.30925	0.655000	0.94253	CTG	CTSK	-	NULL	ENSG00000143387		0.483	CTSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSK	HGNC	protein_coding	OTTHUMT00000084732.1	-	0.00	43	0	G	NM_000396		150779260	-1	tier1	-	no_errors	ENST00000271651	ensembl	human	known	74_37	missense	16.13	26	5	SNP	0.555	T
AD000091.2	0	genome.wustl.edu	37	19	15726500	15726500	+	lincRNA	SNP	G	G	C	rs574973867		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr19:15726500G>C	ENST00000589196.2	-	0	0				CYP4F8_ENST00000441682.2_RNA																							CCTGCTGGTGGTCGGGGCCTC	0.677																																																	0													31.0	36.0	34.0					19																	15726500		2201	4298	6499			0																															19.37:g.15726500G>C				RNA	SNP	-	NULL	ENST00000589196.2	37	NULL		19	.	.	.	.	.	.	.	.	.	.	g	7.513	0.655112	0.14580	.	.	ENSG00000186526	ENST00000441682	.	.	.	2.49	1.38	0.22167	.	1.423470	0.05034	U	0.475039	T	0.30293	0.0760	.	.	.	.	.	.	P;B	0.50943	0.94;0.005	P;B	0.48189	0.57;0.005	T	0.22626	-1.0211	7	0.18276	T	0.48	.	4.2852	0.10851	0.2297:0.0:0.7703:0.0	.	25;25	B4DU32;P98187	.;CP4F8_HUMAN	L	25	.	ENSP00000409702:V25L	V	+	1	0	CYP4F8	15587500	0.000000	0.05858	0.345000	0.25642	0.079000	0.17450	-0.983000	0.03759	0.531000	0.28639	0.313000	0.20887	GTC	CYP4F8	-	-	ENSG00000186526		0.677	AD000091.2-001	KNOWN	basic	lincRNA	CYP4F8	HGNC	lincRNA	OTTHUMT00000460896.2	-	0.00	78	0	G			15726500	+1	tier1	-	no_errors	ENST00000325723	ensembl	human	known	74_37	rna	25.33	56	19	SNP	0.934	C
DCC	1630	genome.wustl.edu	37	18	50961530	50961530	+	Silent	SNP	A	A	C			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr18:50961530A>C	ENST00000442544.2	+	22	3796	c.3180A>C	c.(3178-3180)ggA>ggC	p.G1060G	DCC_ENST00000581580.1_Silent_p.G695G	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1060					anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		ATGGAGATGGAGGTTATTGGC	0.303																																																	0													213.0	216.0	215.0					18																	50961530		2203	4300	6503	SO:0001819	synonymous_variant	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3180A>C	18.37:g.50961530A>C				Silent	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G1060	ENST00000442544.2	37	c.3180	CCDS11952.1	18																																																																																			DCC	-	NULL	ENSG00000187323		0.303	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	-	0.00	35	0	A	NM_005215		50961530	+1	tier1	-	no_errors	ENST00000442544	ensembl	human	known	74_37	silent	57.58	14	19	SNP	0.997	C
DENND1A	57706	genome.wustl.edu	37	9	126144060	126144060	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr9:126144060T>G	ENST00000373624.2	-	22	2882	c.2681A>C	c.(2680-2682)aAc>aCc	p.N894T	DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394219.3_Missense_Mutation_p.N905T|DENND1A_ENST00000542603.1_Missense_Mutation_p.N679T	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	894	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						GCCAAAGAGGTTGGGCATGGA	0.677																																																	0													7.0	7.0	7.0					9																	126144060		2091	4127	6218	SO:0001583	missense	0			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.2681A>C	9.37:g.126144060T>G	ENSP00000362727:p.Asn894Thr		A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.N905T	ENST00000373624.2	37	c.2714	CCDS35133.1	9	.	.	.	.	.	.	.	.	.	.	T	17.93	3.508057	0.64410	.	.	ENSG00000119522	ENST00000373624;ENST00000542603;ENST00000394219	T;T;T	0.29655	3.03;1.56;2.88	4.79	4.79	0.61399	.	0.208186	0.41097	D	0.000958	T	0.44498	0.1296	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.71674	0.998;0.998;0.997;0.993	D;D;D;P	0.78314	0.991;0.991;0.98;0.777	T	0.45234	-0.9275	10	0.87932	D	0	-23.1628	14.3632	0.66787	0.0:0.0:0.0:1.0	.	905;895;894;757	Q8TEH3-6;Q8TEH3-7;Q8TEH3;Q9HCG4	.;.;DEN1A_HUMAN;.	T	894;679;905	ENSP00000362727:N894T;ENSP00000437457:N679T;ENSP00000377766:N905T	ENSP00000362727:N894T	N	-	2	0	DENND1A	125183881	0.994000	0.37717	1.000000	0.80357	0.926000	0.56050	2.569000	0.45973	1.805000	0.52779	0.454000	0.30748	AAC	DENND1A	-	NULL	ENSG00000119522		0.677	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND1A	HGNC	protein_coding	OTTHUMT00000053997.1	-	0.00	82	0	T	NM_024820		126144060	-1	tier1	-	no_errors	ENST00000394219	ensembl	human	known	74_37	missense	12.00	66	9	SNP	0.994	G
DNA2	1763	genome.wustl.edu	37	10	70231769	70231770	+	5'Flank	INS	-	-	GT			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr10:70231769_70231770insGT	ENST00000358410.3	-	0	0				DNA2_ENST00000399179.2_5'UTR|DNA2_ENST00000399180.2_Frame_Shift_Ins_p.R37fs	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2						ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						CTGCGCCAGGCCGCCCCTCCCG	0.653																																																	0																																										SO:0001631	upstream_gene_variant	0			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352		10.37:g.70231769_70231770insGT	Exception_encountered		Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Frame_Shift_Ins	INS	pfam_DNA_replication_fac_Dna2_N,superfamily_P-loop_NTPase	p.P38fs	ENST00000358410.3	37	c.111_110		10																																																																																			DNA2	-	NULL	ENSG00000138346		0.653	DNA2-001	KNOWN	basic|appris_principal	protein_coding	DNA2	HGNC	protein_coding	OTTHUMT00000048334.2		0.00	31	0	-			70231770	-1	tier1		no_errors	ENST00000399180	ensembl	human	known	74_37	frame_shift_ins	22.22	7	2	INS	0.000:0.000	GT
DNAH9	1770	genome.wustl.edu	37	17	11757419	11757419	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr17:11757419C>T	ENST00000262442.4	+	50	9675	c.9607C>T	c.(9607-9609)Ccc>Tcc	p.P3203S	DNAH9_ENST00000454412.2_Missense_Mutation_p.P3203S	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3203	Stalk. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGGTAGGGTGCCCAAGGACCG	0.552																																																	0													81.0	77.0	78.0					17																	11757419		2203	4300	6503	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.9607C>T	17.37:g.11757419C>T	ENSP00000262442:p.Pro3203Ser		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P3203S	ENST00000262442.4	37	c.9607	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	21.8	4.201762	0.79015	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	D;D	0.81739	-1.53;-1.53	5.49	5.49	0.81192	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.91784	0.7401	M	0.89785	3.06	0.80722	D	1	D	0.67145	0.996	D	0.75020	0.985	D	0.92390	0.5920	10	0.62326	D	0.03	.	19.5721	0.95425	0.0:1.0:0.0:0.0	.	3203	Q9NYC9	DYH9_HUMAN	S	3203;3203;1785	ENSP00000262442:P3203S;ENSP00000414874:P3203S	ENSP00000262442:P3203S	P	+	1	0	DNAH9	11698144	1.000000	0.71417	0.998000	0.56505	0.689000	0.40095	7.278000	0.78587	2.857000	0.98124	0.650000	0.86243	CCC	DNAH9	-	superfamily_P-loop_NTPase	ENSG00000007174		0.552	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	44	0	C	NM_001372		11757419	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	22.22	28	8	SNP	1.000	T
DNM1P46	196968	genome.wustl.edu	37	15	100331592	100331592	+	RNA	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr15:100331592G>A	ENST00000341853.1	-	0	2599				RN7SL484P_ENST00000462651.2_RNA|AC090825.1_ENST00000408584.1_RNA	NR_003260.1		Q6ZS02	DMP46_HUMAN	DNM1 pseudogene 46							microtubule (GO:0005874)	GTPase activity (GO:0003924)										tcgactggtagtgggactatg	0.547																																																	0													3.0	4.0	4.0					15																	100331592		789	1856	2645			0			AJ576275		15q26.3	2013-04-25			ENSG00000182397	ENSG00000182397			35199	pseudogene	pseudogene			"""chromosome 15 open reading frame 51"""	DNM1DN14@, C15orf51			Standard	NR_003260		Approved	DNM1DN14.2, FLJ45937, DKFZp434I1020	uc021sxl.1	Q6ZS02	OTTHUMG00000149852		15.37:g.100331592G>A			Q3ZCN3	RNA	SNP	-	NULL	ENST00000341853.1	37	NULL		15																																																																																			DNM1P46	-	-	ENSG00000182397		0.547	DNM1P46-002	KNOWN	basic	processed_transcript	DNM1P46	HGNC	pseudogene	OTTHUMT00000313543.1	-	0.00	35	0	G	NR_003260		100331592	-1	tier1	-	no_errors	ENST00000341853	ensembl	human	known	74_37	rna	27.27	24	9	SNP	0.029	A
DYSF	8291	genome.wustl.edu	37	2	71755483	71755483	+	Silent	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr2:71755483G>A	ENST00000258104.3	+	13	1513	c.1236G>A	c.(1234-1236)aaG>aaA	p.K412K	DYSF_ENST00000409366.1_Silent_p.K413K|DYSF_ENST00000413539.2_Silent_p.K443K|DYSF_ENST00000409744.1_Silent_p.K413K|DYSF_ENST00000394120.2_Silent_p.K413K|DYSF_ENST00000409651.1_Silent_p.K444K|DYSF_ENST00000410020.3_Silent_p.K444K|DYSF_ENST00000429174.2_Silent_p.K412K|DYSF_ENST00000409582.3_Silent_p.K443K|DYSF_ENST00000410041.1_Silent_p.K444K|DYSF_ENST00000409762.1_Silent_p.K443K	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	412	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						AGAGTAACAAGAAGAACTTGG	0.557																																																	0													121.0	96.0	105.0					2																	71755483		2203	4300	6503	SO:0001819	synonymous_variant	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.1236G>A	2.37:g.71755483G>A			A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_dom,superfamily_MFS_dom_general_subst_transpt,smart_C2_dom,smart_Peroxin/Ferlin,pfscan_C2_dom	p.K443	ENST00000258104.3	37	c.1329	CCDS1918.1	2																																																																																			DYSF	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000135636		0.557	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	-	0.00	49	0	G	NM_003494		71755483	+1	tier1	-	no_errors	ENST00000413539	ensembl	human	known	74_37	silent	15.00	34	6	SNP	1.000	A
ECEL1	9427	genome.wustl.edu	37	2	233349744	233349744	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr2:233349744C>T	ENST00000304546.1	-	4	1123	c.913G>A	c.(913-915)Gct>Act	p.A305T	ECEL1_ENST00000409941.1_Missense_Mutation_p.A305T	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	305					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		TGTTCCACAGCGTCTGCACCC	0.637																																																	0													79.0	73.0	75.0					2																	233349744		2203	4300	6503	SO:0001583	missense	0			Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.913G>A	2.37:g.233349744C>T	ENSP00000302051:p.Ala305Thr		Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.A305T	ENST00000304546.1	37	c.913	CCDS2493.1	2	.	.	.	.	.	.	.	.	.	.	C	4.556	0.103212	0.08731	.	.	ENSG00000171551	ENST00000304546;ENST00000409941	T;T	0.73575	-0.76;-0.76	5.36	2.35	0.29111	Peptidase M13 (1);	0.368382	0.28908	N	0.013743	T	0.51007	0.1649	N	0.17631	0.505	0.09310	N	1	B;B	0.28378	0.209;0.197	B;B	0.26614	0.02;0.071	T	0.33599	-0.9862	10	0.36615	T	0.2	-15.6577	1.4299	0.02331	0.2691:0.2874:0.2993:0.1441	.	305;305	O95672-2;O95672	.;ECEL1_HUMAN	T	305	ENSP00000302051:A305T;ENSP00000386333:A305T	ENSP00000302051:A305T	A	-	1	0	ECEL1	233057988	0.377000	0.25106	0.004000	0.12327	0.038000	0.13279	0.816000	0.27267	0.582000	0.29556	0.462000	0.41574	GCT	ECEL1	-	pfam_Peptidase_M13_N	ENSG00000171551		0.637	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ECEL1	HGNC	protein_coding	OTTHUMT00000257039.2	-	0.00	31	0	C	NM_004826		233349744	-1	tier1	-	no_errors	ENST00000304546	ensembl	human	known	74_37	missense	26.67	22	8	SNP	0.001	T
ELF2	1998	genome.wustl.edu	37	4	140046348	140046348	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr4:140046348G>T	ENST00000394235.2	-	4	710	c.208C>A	c.(208-210)Caa>Aaa	p.Q70K	ELF2_ENST00000265495.4_Missense_Mutation_p.Q70K|ELF2_ENST00000379550.1_Missense_Mutation_p.Q70K	NM_001276458.1	NP_001263387.1			E74-like factor 2 (ets domain transcription factor)									p.Q70E(1)		endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	19	all_hematologic(180;0.162)					TCAACTTCTTGTTCTTCTGCC	0.398																																																	1	Substitution - Missense(1)	kidney(1)											203.0	192.0	196.0					4																	140046348		2203	4300	6503	SO:0001583	missense	0			AF256222	CCDS3744.1, CCDS3745.1, CCDS64062.1, CCDS64063.1	4q28	2008-02-05			ENSG00000109381	ENSG00000109381			3317	protein-coding gene	gene with protein product						8756667	Standard	NM_201999		Approved	EU32, NERF, NERF-2, NERF-1A, NERF-1B	uc003ihm.2	Q15723	OTTHUMG00000133383	ENST00000394235.2:c.208C>A	4.37:g.140046348G>T	ENSP00000377782:p.Gln70Lys			Missense_Mutation	SNP	pfam_TF_Elf_N,pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.Q70K	ENST00000394235.2	37	c.208	CCDS3744.1	4	.	.	.	.	.	.	.	.	.	.	G	28.6	4.933267	0.92458	.	.	ENSG00000109381	ENST00000394235;ENST00000379550;ENST00000265495	T;T;T	0.44482	0.92;0.92;0.92	5.88	5.88	0.94601	.	0.186259	0.47852	D	0.000214	T	0.50120	0.1597	M	0.68952	2.095	0.80722	D	1	P	0.46142	0.873	B	0.44044	0.439	T	0.46034	-0.9220	9	.	.	.	.	20.2314	0.98350	0.0:0.0:1.0:0.0	.	70	Q15723-1	.	K	70	ENSP00000377782:Q70K;ENSP00000368868:Q70K;ENSP00000265495:Q70K	.	Q	-	1	0	ELF2	140265798	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.211000	0.95120	2.789000	0.95967	0.591000	0.81541	CAA	ELF2	-	pfam_TF_Elf_N	ENSG00000109381		0.398	ELF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF2	HGNC	protein_coding	OTTHUMT00000257233.2		0.00	48	0	G	NM_006874		140046348	-1			no_errors	ENST00000379550	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
FBXO18	84893	genome.wustl.edu	37	10	5978975	5978975	+	Intron	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr10:5978975G>T	ENST00000362091.4	+	21	3076				FBXO18_ENST00000379999.5_Intron|FBXO18_ENST00000397269.3_Intron|RP11-536K7.3_ENST00000397264.4_RNA	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18						DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						CAAATGCGTTGTCCCTGGGCA	0.502																																																	0																																										SO:0001627	intron_variant	0			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.2962-98G>T	10.37:g.5978975G>T			Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	RNA	SNP	-	NULL	ENST00000362091.4	37	NULL	CCDS7072.1	10																																																																																			RP11-536K7.3	-	-	ENSG00000232807		0.502	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232807	Clone_based_vega_gene	protein_coding	OTTHUMT00000046596.1	-	0.00	84	0	G	NM_032807		5978975	-1	tier1	-	no_errors	ENST00000397264	ensembl	human	known	74_37	rna	5.48	69	4	SNP	0.000	T
ELOVL3	83401	genome.wustl.edu	37	10	103988606	103988606	+	Missense_Mutation	SNP	G	G	A	rs149375895	byFrequency	TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr10:103988606G>A	ENST00000370005.3	+	4	631	c.410G>A	c.(409-411)cGt>cAt	p.R137H		NM_152310.1	NP_689523.1	Q9HB03	ELOV3_HUMAN	ELOVL fatty acid elongase 3	137					cellular lipid metabolic process (GO:0044255)|fatty acid elongation, monounsaturated fatty acid (GO:0034625)|fatty acid elongation, polyunsaturated fatty acid (GO:0034626)|fatty acid elongation, saturated fatty acid (GO:0019367)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|very long-chain fatty acid biosynthetic process (GO:0042761)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			breast(2)|lung(10)|ovary(2)|prostate(1)|skin(1)	16		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		ATCATCCTGCGTAAGCGGCCA	0.542																																																	0								G	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	138.0	129.0	132.0		410	3.4	0.7	10	dbSNP_134	132	3,8597	3.0+/-9.4	0,3,4297	yes	missense	ELOVL3	NM_152310.1	29	0,5,6498	AA,AG,GG		0.0349,0.0454,0.0384	probably-damaging	137/271	103988606	5,13001	2203	4300	6503	SO:0001583	missense	0			AF292387	CCDS7531.1	10q24	2011-05-25	2011-05-25		ENSG00000119915	ENSG00000119915			18047	protein-coding gene	gene with protein product		611815	"""elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3"""				Standard	NM_152310		Approved	CIG-30	uc001kut.3	Q9HB03	OTTHUMG00000018951	ENST00000370005.3:c.410G>A	10.37:g.103988606G>A	ENSP00000359022:p.Arg137His		Q5VZL3|Q8N180	Missense_Mutation	SNP	pfam_GNS1_SUR4	p.R137H	ENST00000370005.3	37	c.410	CCDS7531.1	10	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604785	0.87157	4.54E-4	3.49E-4	ENSG00000119915	ENST00000370005	T	0.27890	1.64	5.24	3.39	0.38822	.	0.000000	0.64402	D	0.000015	T	0.54334	0.1852	M	0.81112	2.525	0.43287	D	0.995262	D	0.89917	1.0	D	0.79108	0.992	T	0.56420	-0.7982	10	0.72032	D	0.01	-23.3653	10.6819	0.45819	0.1576:0.0:0.8424:0.0	.	137	Q9HB03	ELOV3_HUMAN	H	137	ENSP00000359022:R137H	ENSP00000359022:R137H	R	+	2	0	ELOVL3	103978596	1.000000	0.71417	0.744000	0.31058	0.998000	0.95712	8.014000	0.88676	0.595000	0.29777	0.561000	0.74099	CGT	ELOVL3	-	pfam_GNS1_SUR4	ENSG00000119915		0.542	ELOVL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELOVL3	HGNC	protein_coding	OTTHUMT00000050030.1	-	0.00	50	0	G	NM_152310		103988606	+1	tier1	rs149375895	no_errors	ENST00000370005	ensembl	human	known	74_37	missense	28.57	20	8	SNP	0.995	A
FAM71E2	284418	genome.wustl.edu	37	19	55869940	55869940	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr19:55869940T>A	ENST00000424985.3	-	9	2489	c.2296A>T	c.(2296-2298)Aag>Tag	p.K766*	CTD-2105E13.6_ENST00000591954.3_Nonstop_Mutation_p.*315C	NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	766										NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						TTGCCCTCCTTCACCCAGGTG	0.652																																																	0													31.0	31.0	31.0					19																	55869940		692	1591	2283	SO:0001587	stop_gained	0			AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.2296A>T	19.37:g.55869940T>A	ENSP00000398617:p.Lys766*		Q8ND99	Nonsense_Mutation	SNP	pfam_DUF3699	p.K766*	ENST00000424985.3	37	c.2296		19	.	.	.	.	.	.	.	.	.	.	t	38	6.639724	0.97726	.	.	ENSG00000180043	ENST00000424985	.	.	.	3.8	1.69	0.24217	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999998	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.708	0.12858	0.0:0.2673:0.0:0.7327	.	.	.	.	X	766	.	ENSP00000398617:K766X	K	-	1	0	FAM71E2	60561752	0.003000	0.15002	0.035000	0.18076	0.042000	0.13812	0.419000	0.21247	0.617000	0.30160	0.454000	0.30748	AAG	FAM71E2	-	NULL	ENSG00000180043		0.652	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	FAM71E2	HGNC	protein_coding	OTTHUMT00000409063.4	-	0.00	61	0	T	NM_001145402		55869940	-1	tier1	-	no_errors	ENST00000424985	ensembl	human	novel	74_37	nonsense	10.39	69	8	SNP	0.023	A
FANCM	57697	genome.wustl.edu	37	14	45623962	45623962	+	Silent	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr14:45623962C>T	ENST00000267430.5	+	7	1331	c.1246C>T	c.(1246-1248)Cta>Tta	p.L416L	FANCM_ENST00000542564.2_Silent_p.L390L|FANCM_ENST00000556036.1_Silent_p.L416L	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	416					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						CTATAATCATCTAGAGTGTAT	0.328								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													75.0	77.0	76.0					14																	45623962		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.1246C>T	14.37:g.45623962C>T			B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,smart_Helicase_ATP-bd,smart_Helicase_C,smart_ERCC4_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.L416	ENST00000267430.5	37	c.1246	CCDS32070.1	14																																																																																			FANCM	-	superfamily_P-loop_NTPase	ENSG00000187790		0.328	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCM	HGNC	protein_coding	OTTHUMT00000410474.1	-	0.00	38	0	C	XM_048128		45623962	+1	tier1	-	no_errors	ENST00000267430	ensembl	human	known	74_37	silent	28.95	27	11	SNP	1.000	T
FSCN2	25794	genome.wustl.edu	37	17	79502077	79502077	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr17:79502077G>T	ENST00000417245.2	+	2	962		c.e2-1		FSCN2_ENST00000334850.7_Splice_Site	NM_001077182.2|NM_012418.3	NP_001070650.1|NP_036550.1	O14926	FSCN2_HUMAN	fascin actin-bundling protein 2, retinal						actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|anatomical structure morphogenesis (GO:0009653)|eye photoreceptor cell development (GO:0042462)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|stereocilium (GO:0032420)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			endometrium(1)|lung(1)|prostate(1)|urinary_tract(1)	4	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CCTCCCTCCAGGGGTCAACGT	0.577																																																	0													85.0	74.0	77.0					17																	79502077		692	1591	2283	SO:0001630	splice_region_variant	0			AF030165	CCDS45810.1, CCDS45811.1	17q25	2014-02-03	2014-02-03		ENSG00000186765	ENSG00000186765		"""Fascins"""	3960	protein-coding gene	gene with protein product		607643	"""fascin (Strongylocentrotus purpuratus) homolog 2 (actin-bundling protein, retinal)"", ""fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)"""			10234509	Standard	NM_012418		Approved	RP30, RFSN	uc010wuo.2	O14926	OTTHUMG00000167477	ENST00000417245.2:c.827-1G>T	17.37:g.79502077G>T			A0AVC4|A8MRA6	Splice_Site	SNP	-	e2-1	ENST00000417245.2	37	c.827-1	CCDS45811.1	17	.	.	.	.	.	.	.	.	.	.	g	22.3	4.266440	0.80358	.	.	ENSG00000186765	ENST00000417245;ENST00000334850	.	.	.	4.57	4.57	0.56435	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1183	0.86695	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FSCN2	.	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.969000	0.93411	2.364000	0.80123	0.486000	0.48141	.	FSCN2	-	-	ENSG00000186765		0.577	FSCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCN2	HGNC	protein_coding	OTTHUMT00000394746.1		0.00	14	0	G	NM_012418	Intron	79502077	+1			no_errors	ENST00000334850	ensembl	human	known	74_37	splice_site	23.53	12	4	SNP	1.000	T
GBX2	2637	genome.wustl.edu	37	2	237074959	237074959	+	Silent	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr2:237074959G>T	ENST00000306318.4	-	2	1042	c.645C>A	c.(643-645)ggC>ggA	p.G215G	AC079135.1_ENST00000415226.1_RNA|AC079135.1_ENST00000483218.1_RNA|GBX2_ENST00000465889.1_5'UTR|GBX2_ENST00000551105.1_3'UTR	NM_001485.2	NP_001476.2	P52951	GBX2_HUMAN	gastrulation brain homeobox 2	215					autonomic nervous system development (GO:0048483)|axon guidance (GO:0007411)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellum development (GO:0021549)|forebrain neuron development (GO:0021884)|inner ear morphogenesis (GO:0042472)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|patterning of blood vessels (GO:0001569)|rhombomere 2 development (GO:0021568)|thalamus development (GO:0021794)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Breast(86;0.00235)|Renal(207;0.00339)|all_hematologic(139;0.00357)|all_lung(227;0.0616)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|Lung NSC(271;0.179)		Epithelial(121;4.5e-25)|OV - Ovarian serous cystadenocarcinoma(60;5.16e-11)|BRCA - Breast invasive adenocarcinoma(100;3.4e-05)|Lung(119;0.00195)|LUSC - Lung squamous cell carcinoma(224;0.00471)		GAGCTGCCTGGCCAGTCAGAT	0.647																																																	0													63.0	61.0	61.0					2																	237074959		2203	4300	6503	SO:0001819	synonymous_variant	0			AF118452	CCDS2515.1	2q37.2	2012-03-09	2005-12-22		ENSG00000168505	ENSG00000168505		"""Homeoboxes / ANTP class : HOXL subclass"""	4186	protein-coding gene	gene with protein product		601135	"""gastrulation brain homeo box 2"""			9346236, 8838315	Standard	XM_005246071		Approved		uc002vvw.1	P52951	OTTHUMG00000133294	ENST00000306318.4:c.645C>A	2.37:g.237074959G>T			B2RPH7|O43833|Q53RX5|Q9Y5Y1	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	p.G215	ENST00000306318.4	37	c.645	CCDS2515.1	2																																																																																			GBX2	-	NULL	ENSG00000168505		0.647	GBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBX2	HGNC	protein_coding	OTTHUMT00000257078.3		0.00	32	0	G	NM_001485		237074959	-1			no_errors	ENST00000306318	ensembl	human	known	74_37	silent	17.39	19	4	SNP	1.000	T
GLIPR1L2	144321	genome.wustl.edu	37	12	75804346	75804346	+	Missense_Mutation	SNP	G	G	T	rs567529302		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr12:75804346G>T	ENST00000550916.1	+	2	414	c.367G>T	c.(367-369)Ggc>Tgc	p.G123C	GLIPR1L2_ENST00000441218.1_Missense_Mutation_p.G58C|GLIPR1L2_ENST00000435775.1_Missense_Mutation_p.G123C|GLIPR1L2_ENST00000547164.1_Missense_Mutation_p.G123C|GLIPR1L2_ENST00000378692.3_Missense_Mutation_p.G16C|GLIPR1L2_ENST00000320460.4_Missense_Mutation_p.G123C	NM_001270396.1	NP_001257325.1	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2	123	SCP.					integral component of membrane (GO:0016021)		p.G123S(2)		kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16						TATGTGGGTCGGCCCTGAAAA	0.353																																																	2	Substitution - Missense(2)	lung(2)											84.0	85.0	85.0					12																	75804346		2203	4299	6502	SO:0001583	missense	0			BC029557	CCDS9010.1, CCDS58258.1	12q21.1	2014-06-03				ENSG00000180481			28592	protein-coding gene	gene with protein product		610394				12477932	Standard	NM_001270396		Approved	MGC39497	uc001sxr.2	Q4G1C9	OTTHUMG00000169756	ENST00000550916.1:c.367G>T	12.37:g.75804346G>T	ENSP00000448248:p.Gly123Cys		Q6MZS1|Q8N6N0|Q8NA43	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	p.G123C	ENST00000550916.1	37	c.367	CCDS58258.1	12	.	.	.	.	.	.	.	.	.	.	G	19.35	3.811558	0.70797	.	.	ENSG00000180481	ENST00000550916;ENST00000435775;ENST00000378692;ENST00000320460;ENST00000547164;ENST00000441218	T;T;T;T;T;T	0.08546	3.08;3.08;3.08;3.08;3.08;3.08	4.91	4.91	0.64330	CAP domain (3);	0.132588	0.49305	D	0.000155	T	0.39091	0.1065	M	0.93150	3.385	0.36455	D	0.866352	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.996	T	0.59705	-0.7404	10	0.72032	D	0.01	.	15.1142	0.72388	0.0:0.0:1.0:0.0	.	123;123	Q4G1C9;Q4G1C9-2	GRPL2_HUMAN;.	C	123;123;16;123;123;58	ENSP00000448248:G123C;ENSP00000398328:G123C;ENSP00000367963:G16C;ENSP00000317385:G123C;ENSP00000447980:G123C;ENSP00000405273:G58C	ENSP00000317385:G123C	G	+	1	0	GLIPR1L2	74090613	0.994000	0.37717	0.998000	0.56505	0.955000	0.61496	4.395000	0.59678	2.538000	0.85594	0.484000	0.47621	GGC	GLIPR1L2	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000180481		0.353	GLIPR1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIPR1L2	HGNC	protein_coding	OTTHUMT00000405718.1		0.00	37	0	G	NM_152436		75804346	+1			no_errors	ENST00000550916	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.988	T
GON4L	54856	genome.wustl.edu	37	1	155785777	155785777	+	Intron	DEL	A	A	-			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr1:155785777delA	ENST00000368331.1	-	8	1114				GON4L_ENST00000437809.1_Intron|GON4L_ENST00000271883.5_Intron|GON4L_ENST00000361040.5_Intron|GON4L_ENST00000471341.1_5'UTR	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AGCAGGGCAGAAAAAAAAAAA	0.348																																																	0																																										SO:0001627	intron_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1066-86T>-	1.37:g.155785777delA			B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	RNA	DEL	-	NULL	ENST00000368331.1	37	NULL		1																																																																																			GON4L	-	-	ENSG00000116580		0.348	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding			0.00	16	0	A	NM_032292		155785777	-1	tier1		no_errors	ENST00000471341	ensembl	human	known	74_37	rna	18.75	26	6	DEL	0.000	-
GRIN2A	2903	genome.wustl.edu	37	16	9943750	9943750	+	Silent	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr16:9943750G>A	ENST00000396573.2	-	6	1500	c.1191C>T	c.(1189-1191)tcC>tcT	p.S397S	GRIN2A_ENST00000396575.2_Silent_p.S397S|GRIN2A_ENST00000535259.1_Silent_p.S240S|GRIN2A_ENST00000562109.1_Silent_p.S397S|GRIN2A_ENST00000330684.3_Silent_p.S397S|GRIN2A_ENST00000404927.2_Silent_p.S397S	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	397					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GCTCACAGTCGGAGAAGGACT	0.582																																																	0													135.0	111.0	119.0					16																	9943750		2197	4300	6497	SO:0001819	synonymous_variant	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1191C>T	16.37:g.9943750G>A			O00669|Q17RZ6	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S397	ENST00000396573.2	37	c.1191	CCDS10539.1	16																																																																																			GRIN2A	-	NULL	ENSG00000183454		0.582	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3		0.00	43	0	G			9943750	-1			no_errors	ENST00000330684	ensembl	human	known	74_37	silent	8.33	33	3	SNP	0.001	A
HADHA	3030	genome.wustl.edu	37	2	26437990	26437990	+	Missense_Mutation	SNP	G	G	T	rs372831713		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr2:26437990G>T	ENST00000380649.3	-	8	860	c.731C>A	c.(730-732)gCa>gAa	p.A244E	HADHA_ENST00000457468.2_Missense_Mutation_p.A157E	NM_000182.4	NP_000173.2	P40939	ECHA_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), alpha subunit	244					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|response to drug (GO:0042493)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acetyltransferase activity (GO:0003985)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)			autonomic_ganglia(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(4)|skin(1)	30	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAAAGTAATTGCAACTTCTTC	0.398																																																	0													198.0	194.0	195.0					2																	26437990		2203	4300	6503	SO:0001583	missense	0			D16480	CCDS1721.1	2p23	2014-09-17	2010-04-30		ENSG00000084754	ENSG00000084754	1.1.1.211, 4.2.1.17		4801	protein-coding gene	gene with protein product	"""gastrin-binding protein"", ""long-chain-3-hydroxyacyl-CoA dehydrogenase"", ""long-chain 2-enoyl-CoA hydratase"", ""mitochondrial trifunctional protein, alpha subunit"""	600890	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), alpha subunit"""			9605857, 7918661	Standard	NM_000182		Approved	GBP, LCEH, LCHAD, MTPA	uc002rgy.3	P40939	OTTHUMG00000096979	ENST00000380649.3:c.731C>A	2.37:g.26437990G>T	ENSP00000370023:p.Ala244Glu		B2R7L4|B4DYP2|Q16679|Q53T69|Q53TA2|Q96GT7|Q9UQC5	Missense_Mutation	SNP	pfam_Crotonase_core_superfam,pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_Fa_ox_alpha_mit	p.A244E	ENST00000380649.3	37	c.731	CCDS1721.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.078219	0.94000	.	.	ENSG00000084754	ENST00000380649;ENST00000457468	T;T	0.78707	-1.2;-1.2	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.92021	0.7472	H	0.95816	3.725	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.93535	0.6873	10	0.87932	D	0	-8.8067	18.1463	0.89656	0.0:0.0:1.0:0.0	.	157;244;244	B4DYP2;E9KL44;P40939	.;.;ECHA_HUMAN	E	244;157	ENSP00000370023:A244E;ENSP00000405344:A157E	ENSP00000370023:A244E	A	-	2	0	HADHA	26291494	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	8.811000	0.91954	2.890000	0.99128	0.585000	0.79938	GCA	HADHA	-	tigrfam_Fa_ox_alpha_mit	ENSG00000084754		0.398	HADHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HADHA	HGNC	protein_coding	OTTHUMT00000214051.1		0.00	40	0	G	NM_000182		26437990	-1			no_errors	ENST00000380649	ensembl	human	known	74_37	missense	9.38	29	3	SNP	1.000	T
HHIP	64399	genome.wustl.edu	37	4	145633170	145633171	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr4:145633170_145633171insA	ENST00000296575.3	+	8	2025_2026	c.1370_1371insA	c.(1369-1374)ggaaaafs	p.GK457fs		NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	457					carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		GACTCCAATGGAAAAAACAGAT	0.356																																																	0																																										SO:0001589	frameshift_variant	0			AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.1376dupA	4.37:g.145633176_145633176dupA	ENSP00000296575:p.Gly457fs		Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Frame_Shift_Ins	INS	pfam_Folate_rcpt-like,superfamily_Quinoprot_gluc/sorb_DH,smart_EG-like_dom,pfscan_EG-like_dom	p.N459fs	ENST00000296575.3	37	c.1370_1371	CCDS3762.1	4																																																																																			HHIP	-	NULL	ENSG00000164161		0.356	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHIP	HGNC	protein_coding	OTTHUMT00000364887.2		0.00	59	0	-			145633171	+1	tier1		no_errors	ENST00000296575	ensembl	human	known	74_37	frame_shift_ins	23.91	35	11	INS	1.000:0.998	A
HIVEP2	3097	genome.wustl.edu	37	6	143092631	143092631	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr6:143092631C>T	ENST00000367604.1	-	4	3884	c.3245G>A	c.(3244-3246)cGg>cAg	p.R1082Q	HIVEP2_ENST00000367603.2_Missense_Mutation_p.R1082Q|HIVEP2_ENST00000012134.2_Missense_Mutation_p.R1082Q			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1082					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GGAAGCTTGCCGCACCAGAAA	0.562																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0													49.0	52.0	51.0					6																	143092631		2060	4221	6281	SO:0001583	missense	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3245G>A	6.37:g.143092631C>T	ENSP00000356576:p.Arg1082Gln		Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1082Q	ENST00000367604.1	37	c.3245	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	C	27.1	4.801606	0.90538	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.58797	0.31;0.31;0.31	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.77280	0.4107	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.80144	-0.1505	10	0.87932	D	0	-19.3009	19.7763	0.96395	0.0:1.0:0.0:0.0	.	1082	P31629	ZEP2_HUMAN	Q	1082	ENSP00000356576:R1082Q;ENSP00000356575:R1082Q;ENSP00000012134:R1082Q	ENSP00000012134:R1082Q	R	-	2	0	HIVEP2	143134324	1.000000	0.71417	0.999000	0.59377	0.923000	0.55619	7.726000	0.84824	2.687000	0.91594	0.563000	0.77884	CGG	HIVEP2	-	NULL	ENSG00000010818		0.562	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	-	0.00	30	0	C			143092631	-1	tier1	-	no_errors	ENST00000012134	ensembl	human	known	74_37	missense	34.38	21	11	SNP	1.000	T
HIVEP2	3097	genome.wustl.edu	37	6	143094119	143094119	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr6:143094119G>A	ENST00000367604.1	-	4	2396	c.1757C>T	c.(1756-1758)cCt>cTt	p.P586L	HIVEP2_ENST00000367603.2_Missense_Mutation_p.P586L|HIVEP2_ENST00000012134.2_Missense_Mutation_p.P586L			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	586					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CATGCGCTGAGGGGGTATGCC	0.512																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0													85.0	85.0	85.0					6																	143094119		2003	4176	6179	SO:0001583	missense	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.1757C>T	6.37:g.143094119G>A	ENSP00000356576:p.Pro586Leu		Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P586L	ENST00000367604.1	37	c.1757	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	G	16.52	3.146993	0.57151	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.10860	2.83;2.83;2.83	5.48	5.48	0.80851	.	0.221347	0.37809	N	0.001936	T	0.08447	0.0210	L	0.44542	1.39	0.46586	D	0.999114	D	0.53619	0.961	P	0.49637	0.617	T	0.22034	-1.0228	10	0.28530	T	0.3	-0.0139	13.3905	0.60821	0.0:0.0:0.7365:0.2635	.	586	P31629	ZEP2_HUMAN	L	586	ENSP00000356576:P586L;ENSP00000356575:P586L;ENSP00000012134:P586L	ENSP00000012134:P586L	P	-	2	0	HIVEP2	143135812	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.086000	0.57664	2.566000	0.86566	0.655000	0.94253	CCT	HIVEP2	-	NULL	ENSG00000010818		0.512	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1		0.00	14	0	G			143094119	-1			no_errors	ENST00000012134	ensembl	human	known	74_37	missense	15.79	16	3	SNP	0.995	A
IRX5	10265	genome.wustl.edu	37	16	54966722	54966722	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr16:54966722G>A	ENST00000394636.4	+	2	899	c.562G>A	c.(562-564)Gag>Aag	p.E188K	IRX5_ENST00000320990.5_Missense_Mutation_p.E188K|IRX5_ENST00000558597.1_Missense_Mutation_p.E122K|CTD-3032H12.2_ENST00000560487.1_lincRNA|IRX5_ENST00000560154.1_Intron			P78411	IRX5_HUMAN	iroquois homeobox 5	188	Poly-Glu.				embryonic cranial skeleton morphogenesis (GO:0048701)|gonad development (GO:0008406)|neuron maturation (GO:0042551)|regulation of heart rate (GO:0002027)|regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retinal bipolar neuron differentiation (GO:0060040)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|vitamin D binding (GO:0005499)			kidney(3)|large_intestine(6)|lung(4)|prostate(1)	14						CAGCGAGGACGAGGAAGAGGA	0.632																																																	0													79.0	89.0	85.0					16																	54966722		2197	4300	6497	SO:0001583	missense	0			U90309	CCDS10751.1, CCDS58462.1	16q12.2	2011-06-20	2007-07-13		ENSG00000176842	ENSG00000176842		"""Homeoboxes / TALE class"""	14361	protein-coding gene	gene with protein product		606195					Standard	NM_005853		Approved	IRX-2a	uc002ehv.3	P78411	OTTHUMG00000133201	ENST00000394636.4:c.562G>A	16.37:g.54966722G>A	ENSP00000378132:p.Glu188Lys		H0YMS7|P78416|Q7Z2E1	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,smart_Iroquois_homeo,pfscan_Homeobox_dom	p.E188K	ENST00000394636.4	37	c.562	CCDS10751.1	16	.	.	.	.	.	.	.	.	.	.	G	27.9	4.874593	0.91664	.	.	ENSG00000176842	ENST00000394636;ENST00000320990	T;T	0.62105	0.09;0.05	4.14	4.14	0.48551	.	0.000000	0.85682	D	0.000000	T	0.73102	0.3544	L	0.52905	1.665	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	T	0.72527	-0.4266	10	0.36615	T	0.2	-17.0921	15.3232	0.74139	0.0:0.0:1.0:0.0	.	188	P78411	IRX5_HUMAN	K	188	ENSP00000378132:E188K;ENSP00000316250:E188K	ENSP00000316250:E188K	E	+	1	0	IRX5	53524223	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.479000	0.97929	2.123000	0.65237	0.655000	0.94253	GAG	IRX5	-	NULL	ENSG00000176842		0.632	IRX5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	IRX5	HGNC	protein_coding	OTTHUMT00000256911.2	-	0.00	71	0	G			54966722	+1	tier1	-	no_errors	ENST00000394636	ensembl	human	known	74_37	missense	26.92	38	14	SNP	1.000	A
HYDIN	54768	genome.wustl.edu	37	16	71054178	71054178	+	Missense_Mutation	SNP	T	T	C	rs6416709	byFrequency	TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr16:71054178T>C	ENST00000393567.2	-	22	3379	c.3229A>G	c.(3229-3231)Ata>Gta	p.I1077V	HYDIN_ENST00000448089.2_Missense_Mutation_p.I1029V	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	1077			I -> V (in dbSNP:rs6416709).		cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)		p.I1077V(3)|p.I1029V(3)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				ATGTTCTTTATGGCCAAGGGC	0.418													t|||	2	0.000399361	0.0	0.0029	5008	,	,		17320	0.0		0.0	False		,,,				2504	0.0																6	Substitution - Missense(6)	lung(2)|prostate(2)|endometrium(2)											129.0	123.0	125.0					16																	71054178		1855	4094	5949	SO:0001583	missense	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.3229A>G	16.37:g.71054178T>C	ENSP00000377197:p.Ile1077Val		A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Missense_Mutation	SNP	superfamily_PapD-like	p.I1029V	ENST00000393567.2	37	c.3085	CCDS59269.1	16	.	.	.	.	.	.	.	.	.	.	t	6.789	0.514533	0.12944	.	.	ENSG00000157423	ENST00000393567;ENST00000316490;ENST00000448089	T;T	0.06371	3.31;3.31	4.61	0.358	0.16084	.	0.892413	0.09073	U	0.852581	T	0.06096	0.0158	L	0.58101	1.795	0.80722	D	1	B	0.09022	0.002	B	0.10450	0.005	T	0.33059	-0.9883	10	0.18710	T	0.47	.	1.4303	0.02332	0.2901:0.0873:0.1652:0.4573	rs6416709;rs60865895	1077	F8WD23	.	V	1077;1077;1029	ENSP00000377197:I1077V;ENSP00000398544:I1029V	ENSP00000313052:I1077V	I	-	1	0	HYDIN	69611679	0.055000	0.20627	0.982000	0.44146	0.109000	0.19521	0.089000	0.15002	0.228000	0.21019	-0.676000	0.03789	ATA	HYDIN	-	NULL	ENSG00000157423		0.418	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3		0.00	47	0	T			71054178	-1			no_errors	ENST00000448089	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.589	C
ITPR2	3709	genome.wustl.edu	37	12	26551892	26551892	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr12:26551892C>T	ENST00000381340.3	-	54	8029	c.7613G>A	c.(7612-7614)gGt>gAt	p.G2538D	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2538					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)	p.G2538V(1)	ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	GATGATAACACCAAAAATCAA	0.333																																																	1	Substitution - Missense(1)	lung(1)											81.0	71.0	74.0					12																	26551892		1816	4076	5892	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7613G>A	12.37:g.26551892C>T	ENSP00000370744:p.Gly2538Asp		O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.G2538D	ENST00000381340.3	37	c.7613	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	C	28.8	4.954024	0.92660	.	.	ENSG00000123104	ENST00000381340	D	0.99060	-5.38	4.96	4.96	0.65561	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99489	0.9818	M	0.94063	3.49	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98338	1.0537	10	0.87932	D	0	.	18.4021	0.90520	0.0:1.0:0.0:0.0	.	2538	Q14571	ITPR2_HUMAN	D	2538	ENSP00000370744:G2538D	ENSP00000370744:G2538D	G	-	2	0	ITPR2	26443159	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.549000	0.82163	2.567000	0.86603	0.603000	0.83216	GGT	ITPR2	-	pfam_Ion_trans_dom	ENSG00000123104		0.333	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1		0.00	40	0	C	NM_002223		26551892	-1			no_errors	ENST00000381340	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	T
KDELC1	79070	genome.wustl.edu	37	13	103443257	103443257	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr13:103443257G>T	ENST00000376004.4	-	6	1413	c.1077C>A	c.(1075-1077)ttC>ttA	p.F359L	KDELC1_ENST00000460338.1_5'UTR	NM_024089.2	NP_076994.2	Q6UW63	KDEL1_HUMAN	KDEL (Lys-Asp-Glu-Leu) containing 1	359						endoplasmic reticulum lumen (GO:0005788)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(1)	19	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					ATACCTTGAAGAAATCAAAAA	0.338																																																	0													41.0	44.0	43.0					13																	103443257		2203	4300	6503	SO:0001583	missense	0			BC001297	CCDS9504.1	13q33	2010-11-18			ENSG00000134901	ENSG00000134901			19350	protein-coding gene	gene with protein product		611613					Standard	NM_024089		Approved	MGC5302, EP58	uc001vpq.4	Q6UW63	OTTHUMG00000017307	ENST00000376004.4:c.1077C>A	13.37:g.103443257G>T	ENSP00000365172:p.Phe359Leu		Q53HL3|Q9BVD2	Missense_Mutation	SNP	pfam_LipoPS_modifying,pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,smart_LipoPS_modifying,pfscan_Filamin/ABP280_repeat-like	p.F359L	ENST00000376004.4	37	c.1077	CCDS9504.1	13	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337341	0.81911	.	.	ENSG00000134901	ENST00000376004	T	0.21191	2.02	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.41971	0.1182	M	0.63208	1.945	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.07158	-1.0787	10	0.37606	T	0.19	.	13.0923	0.59172	0.0836:0.0:0.9163:0.0	.	359	Q6UW63	KDEL1_HUMAN	L	359	ENSP00000365172:F359L	ENSP00000365172:F359L	F	-	3	2	KDELC1	102241258	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	3.219000	0.51200	2.622000	0.88805	0.561000	0.74099	TTC	KDELC1	-	pfam_LipoPS_modifying,smart_LipoPS_modifying	ENSG00000134901		0.338	KDELC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDELC1	HGNC	protein_coding	OTTHUMT00000045699.1	-	0.00	24	0	G			103443257	-1	tier1	-	no_errors	ENST00000376004	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	T
KIF1A	547	genome.wustl.edu	37	2	241680691	241680691	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr2:241680691G>T	ENST00000320389.7	-	33	3599	c.3441C>A	c.(3439-3441)aaC>aaA	p.N1147K	KIF1A_ENST00000498729.2_Missense_Mutation_p.N1248K	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	1147					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CTCACTCGCCGTTGGCCTCCA	0.662																																																	0													29.0	35.0	33.0					2																	241680691		2110	4228	6338	SO:0001583	missense	0			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.3441C>A	2.37:g.241680691G>T	ENSP00000322791:p.Asn1147Lys		B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.N1248K	ENST00000320389.7	37	c.3744	CCDS46561.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.89|14.89	2.671563|2.671563	0.47781|0.47781	.|.	.|.	ENSG00000130294|ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283|ENST00000431776	T;T;T|.	0.73575|.	-0.61;-0.7;-0.76|.	4.44|4.44	-8.88|-8.88	0.00789|0.00789	.|.	0.056399|.	0.64402|.	U|.	0.000002|.	T|T	0.61788|0.61788	0.2375|0.2375	L|L	0.55990|0.55990	1.75|1.75	0.47511|0.47511	D|D	0.999442|0.999442	B;B;D|.	0.60160|.	0.002;0.364;0.987|.	B;B;P|.	0.48454|.	0.01;0.168;0.578|.	T|T	0.71094|0.71094	-0.4692|-0.4692	10|5	0.72032|.	D|.	0.01|.	.|.	16.039|16.039	0.80650|0.80650	0.4225:0.0:0.5775:0.0|0.4225:0.0:0.5775:0.0	.|.	1248;1248;1147|.	F5H045;Q12756-2;Q12756|.	.;.;KIF1A_HUMAN|.	K|K	1147;1248;1248;1248|71	ENSP00000322791:N1147K;ENSP00000438388:N1248K;ENSP00000384231:N1248K|.	ENSP00000322791:N1147K|.	N|T	-|-	3|2	2|0	KIF1A|KIF1A	241329364|241329364	0.000000|0.000000	0.05858|0.05858	0.561000|0.561000	0.28357|0.28357	0.969000|0.969000	0.65631|0.65631	-1.996000|-1.996000	0.01471|0.01471	-2.394000|-2.394000	0.00583|0.00583	-0.501000|-0.501000	0.04562|0.04562	AAC|ACG	KIF1A	-	NULL	ENSG00000130294		0.662	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1A	HGNC	protein_coding	OTTHUMT00000324536.3	-	0.00	22	0	G	NM_138483		241680691	-1	tier1	-	no_errors	ENST00000498729	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.652	T
KLHL32	114792	genome.wustl.edu	37	6	97512566	97512566	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr6:97512566G>T	ENST00000369261.4	+	5	738	c.375G>T	c.(373-375)ttG>ttT	p.L125F	KLHL32_ENST00000539200.1_Intron|KLHL32_ENST00000536676.1_Missense_Mutation_p.L89F|KLHL32_ENST00000544166.1_5'UTR	NM_052904.3	NP_443136.2	Q96NJ5	KLH32_HUMAN	kelch-like family member 32	125										breast(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(13)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	38		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		TACAGCTGTTGGAGCTTCTCA	0.458																																																	0													144.0	107.0	120.0					6																	97512566		2203	4300	6503	SO:0001583	missense	0			AB067487	CCDS5038.1, CCDS69154.1, CCDS69155.1, CCDS75495.1	6q16.3	2013-02-22	2013-02-22	2007-01-09	ENSG00000186231	ENSG00000186231		"""Kelch-like"", ""BTB/POZ domain containing"""	21221	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 5"", ""KIAA1900"", ""kelch-like 32 (Drosophila)"""	BKLHD5, KIAA1900			Standard	NM_052904		Approved		uc010kcm.1	Q96NJ5	OTTHUMG00000015247	ENST00000369261.4:c.375G>T	6.37:g.97512566G>T	ENSP00000358265:p.Leu125Phe		B7Z346|B7Z4E2|E1P528|Q5THT0|Q96PY7	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L125F	ENST00000369261.4	37	c.375	CCDS5038.1	6	.	.	.	.	.	.	.	.	.	.	G	21.4	4.142131	0.77775	.	.	ENSG00000186231	ENST00000369255;ENST00000369261;ENST00000536676;ENST00000369254;ENST00000447886	T;T;T;T	0.67523	-0.27;1.93;-0.27;1.83	5.54	4.68	0.58851	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.64402	D	0.000001	T	0.64746	0.2626	L	0.31578	0.945	0.80722	D	1	D;D;D	0.76494	0.995;0.995;0.999	D;D;D	0.72982	0.979;0.934;0.971	T	0.70306	-0.4908	10	0.54805	T	0.06	.	14.5577	0.68113	0.0697:0.0:0.9303:0.0	.	89;125;125	B7Z346;Q96NJ5;Q6IQ08	.;KLH32_HUMAN;.	F	51;125;89;125;21	ENSP00000358265:L125F;ENSP00000440382:L89F;ENSP00000358258:L125F;ENSP00000389310:L21F	ENSP00000358258:L125F	L	+	3	2	KLHL32	97619287	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.739000	0.68622	1.587000	0.49959	-0.145000	0.13849	TTG	KLHL32	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin	ENSG00000186231		0.458	KLHL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL32	HGNC	protein_coding	OTTHUMT00000041570.1	-	0.00	39	0	G	NM_052904		97512566	+1	tier1	-	no_errors	ENST00000369261	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
LFNG	3955	genome.wustl.edu	37	7	2565992	2565992	+	Silent	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr7:2565992C>T	ENST00000222725.5	+	6	956	c.936C>T	c.(934-936)caC>caT	p.H312H	LFNG_ENST00000359574.3_Silent_p.H312H|LFNG_ENST00000402506.1_Silent_p.H241H|LFNG_ENST00000338732.3_Silent_p.H183H|LFNG_ENST00000402045.1_Silent_p.H183H|MIR4648_ENST00000580107.1_RNA	NM_001040167.1	NP_001035257.1	Q8NES3	LFNG_HUMAN	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	312					compartment pattern specification (GO:0007386)|female meiotic division (GO:0007143)|metabolic process (GO:0008152)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|ovarian follicle development (GO:0001541)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)|regulation of Notch signaling pathway (GO:0008593)|regulation of somitogenesis (GO:0014807)|somitogenesis (GO:0001756)	extracellular region (GO:0005576)|integral component of Golgi membrane (GO:0030173)|vesicle (GO:0031982)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		GCCTCTTCCACTCCCACCTGG	0.662																																																	0													56.0	61.0	59.0					7																	2565992		2203	4300	6503	SO:0001819	synonymous_variant	0			BC014851	CCDS34586.1, CCDS34587.1, CCDS55081.1, CCDS55082.1	7p22.3	2013-02-19	2006-11-13		ENSG00000106003	ENSG00000106003	2.4.1.222	"""Beta 3-glycosyltransferases"""	6560	protein-coding gene	gene with protein product		602576	"""lunatic fringe (Drosophila) homolog"", ""lunatic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_001166355		Approved	SCDO3	uc003smf.3	Q8NES3	OTTHUMG00000152043	ENST00000222725.5:c.936C>T	7.37:g.2565992C>T			B3KTY6|B5MCR5|O00589|Q96C39|Q9UJW5	Silent	SNP	pfam_Fringe-like,pirsf_Fringe	p.H312	ENST00000222725.5	37	c.936	CCDS34587.1	7																																																																																			LFNG	-	pfam_Fringe-like,pirsf_Fringe	ENSG00000106003		0.662	LFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LFNG	HGNC	protein_coding	OTTHUMT00000325021.1	-	0.00	39	0	C	NM_002304		2565992	+1	tier1	-	no_errors	ENST00000222725	ensembl	human	known	74_37	silent	22.92	37	11	SNP	1.000	T
KMT2C	58508	genome.wustl.edu	37	7	151848559	151848559	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr7:151848559T>A	ENST00000262189.6	-	50	12852	c.12634A>T	c.(12634-12636)Aaa>Taa	p.K4212*	KMT2C_ENST00000485241.1_5'Flank|KMT2C_ENST00000355193.2_Nonsense_Mutation_p.K4269*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4212					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTGAAAGATTTCCGCACACCA	0.443																																																	0													104.0	88.0	94.0					7																	151848559		2203	4300	6503	SO:0001587	stop_gained	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.12634A>T	7.37:g.151848559T>A	ENSP00000262189:p.Lys4212*		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.K4269*	ENST00000262189.6	37	c.12805	CCDS5931.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	55|55	24.514590|24.514590	0.99961|0.99961	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000360104|ENST00000262189;ENST00000355193;ENST00000424877	.|.	.|.	.|.	5.25|5.25	5.25|5.25	0.73442|0.73442	.|.	.|0.000000	.|0.47093	.|U	.|0.000259	T|.	0.42404|.	0.1201|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.34279|.	-0.9835|.	4|.	.|0.02654	.|T	.|1	.|.	15.1642|15.1642	0.72807|0.72807	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	V|X	1772|4212;4269;829	.|.	.|ENSP00000262189:K4212X	E|K	-|-	2|1	0|0	MLL3|MLL3	151479492|151479492	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.988000|0.988000	0.76386|0.76386	7.499000|7.499000	0.81566|0.81566	1.984000|1.984000	0.57885|0.57885	0.528000|0.528000	0.53228|0.53228	GAA|AAA	KMT2C	-	NULL	ENSG00000055609		0.443	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	-	0.00	33	0	T			151848559	-1	tier1	-	no_errors	ENST00000355193	ensembl	human	known	74_37	nonsense	70.59	5	12	SNP	1.000	A
U82695.9	0	genome.wustl.edu	37	X	152752248	152752248	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chrX:152752248C>T	ENST00000428676.1	+	2	402	c.358C>T	c.(358-360)Cgg>Tgg	p.R120W	HAUS7_ENST00000370210.1_Intron|HAUS7_ENST00000421080.2_Intron																							GCCCCAGCGGCGGGGGGAGGA	0.667																																																	0																																										SO:0001583	missense	0																														ENST00000428676.1:c.358C>T	X.37:g.152752248C>T	ENSP00000398003:p.Arg120Trp			Missense_Mutation	SNP	pfam_Leu-rich_rpt	p.R120W	ENST00000428676.1	37	c.358		X																																																																																			U82695.9	-	NULL	ENSG00000224963		0.667	U82695.9-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	LOC100509091	Clone_based_vega_gene	protein_coding	OTTHUMT00000060961.2	-	0.00	24	0	C			152752248	+1	tier1	-	no_errors	ENST00000428676	ensembl	human	putative	74_37	missense	71.79	11	28	SNP	0.008	T
LRRN1	57633	genome.wustl.edu	37	3	3886551	3886551	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr3:3886551G>T	ENST00000319331.3	+	2	987	c.226G>T	c.(226-228)Gtg>Ttg	p.V76L	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	76						integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		TGACACACAAGTGCTTCTCTT	0.438																																																	0													113.0	103.0	106.0					3																	3886551		2203	4300	6503	SO:0001583	missense	0			AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.226G>T	3.37:g.3886551G>T	ENSP00000314901:p.Val76Leu		Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.V76L	ENST00000319331.3	37	c.226	CCDS33685.1	3	.	.	.	.	.	.	.	.	.	.	G	29.5	5.012684	0.93346	.	.	ENSG00000175928	ENST00000319331	T	0.39997	1.05	5.76	5.76	0.90799	Leucine-rich repeat-containing N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.35653	0.0939	L	0.37697	1.125	0.80722	D	1	B	0.29936	0.262	B	0.32149	0.141	T	0.14924	-1.0455	10	0.06891	T	0.86	.	19.9759	0.97304	0.0:0.0:1.0:0.0	.	76	Q6UXK5	LRRN1_HUMAN	L	76	ENSP00000314901:V76L	ENSP00000314901:V76L	V	+	1	0	LRRN1	3861551	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.787000	0.99055	2.713000	0.92767	0.655000	0.94253	GTG	LRRN1	-	NULL	ENSG00000175928		0.438	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN1	HGNC	protein_coding	OTTHUMT00000337704.2	-	0.00	35	0	G	NM_020873		3886551	+1	tier1	-	no_errors	ENST00000319331	ensembl	human	known	74_37	missense	33.33	20	10	SNP	1.000	T
MAP3K5	4217	genome.wustl.edu	37	6	137018434	137018434	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr6:137018434G>A	ENST00000359015.4	-	5	1258	c.898C>T	c.(898-900)Cgg>Tgg	p.R300W		NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	300					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		ACTCGCTGCCGAATTCTTGCC	0.388																																																	0													118.0	120.0	119.0					6																	137018434		2203	4300	6503	SO:0001583	missense	0			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.898C>T	6.37:g.137018434G>A	ENSP00000351908:p.Arg300Trp		A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R300W	ENST00000359015.4	37	c.898	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	G	28.5	4.923161	0.92319	.	.	ENSG00000197442	ENST00000359015;ENST00000367768	T	0.12361	2.69	5.32	4.44	0.53790	.	0.120261	0.64402	D	0.000017	T	0.24431	0.0592	M	0.64997	1.995	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.70935	0.953;0.971;0.916	T	0.03706	-1.1011	10	0.87932	D	0	.	15.5756	0.76380	0.0:0.0:0.8608:0.1392	.	380;145;300	Q59GL6;B4DF67;Q99683	.;.;M3K5_HUMAN	W	300;380	ENSP00000351908:R300W	ENSP00000351908:R300W	R	-	1	2	MAP3K5	137060127	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.508000	0.81686	1.341000	0.45600	0.591000	0.81541	CGG	MAP3K5	-	NULL	ENSG00000197442		0.388	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	HGNC	protein_coding	OTTHUMT00000042383.1	-	0.00	29	0	G			137018434	-1	tier1	-	no_errors	ENST00000359015	ensembl	human	known	74_37	missense	33.33	18	9	SNP	1.000	A
MAPK15	225689	genome.wustl.edu	37	8	144804294	144804294	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr8:144804294G>A	ENST00000338033.4	+	14	1627	c.1508G>A	c.(1507-1509)aGc>aAc	p.S503N		NM_139021.2	NP_620590.2	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	503					MAPK cascade (GO:0000165)|negative regulation of DNA replication (GO:0008156)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|response to estradiol (GO:0032355)	extracellular region (GO:0005576)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|SH3 domain binding (GO:0017124)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|stomach(1)	12	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			AGGATGTTCAGCACCTCTGCC	0.667																																																	0													54.0	63.0	60.0					8																	144804294		1918	4108	6026	SO:0001583	missense	0			AY065978	CCDS6409.2	8q24.3	2011-06-09			ENSG00000181085	ENSG00000181085		"""Mitogen-activated protein kinase cascade / Kinases"""	24667	protein-coding gene	gene with protein product	"""extracellular signal regulated kinase 8"""					11875070	Standard	XM_006716528		Approved	ERK8, ERK7	uc003yzj.3	Q8TD08	OTTHUMG00000146450	ENST00000338033.4:c.1508G>A	8.37:g.144804294G>A	ENSP00000337691:p.Ser503Asn		Q2TCF9|Q8N362	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S503N	ENST00000338033.4	37	c.1508	CCDS6409.2	8	.	.	.	.	.	.	.	.	.	.	g	0.367	-0.936149	0.02340	.	.	ENSG00000181085	ENST00000338033	T	0.72835	-0.69	3.13	1.16	0.20824	.	0.512037	0.20821	U	0.085069	T	0.40196	0.1107	N	0.14661	0.345	0.09310	N	0.999993	B	0.29716	0.255	B	0.23275	0.045	T	0.12426	-1.0548	10	0.10636	T	0.68	-7.9972	2.3783	0.04347	0.3205:0.2976:0.3819:0.0	.	503	Q8TD08	MK15_HUMAN	N	503	ENSP00000337691:S503N	ENSP00000337691:S503N	S	+	2	0	MAPK15	144876282	0.021000	0.18746	0.009000	0.14445	0.751000	0.42716	2.188000	0.42612	0.607000	0.29982	0.455000	0.32223	AGC	MAPK15	-	NULL	ENSG00000181085		0.667	MAPK15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK15	HGNC	protein_coding	OTTHUMT00000300348.1	-	0.00	35	0	G	NM_139021		144804294	+1	tier1	-	no_errors	ENST00000338033	ensembl	human	known	74_37	missense	30.77	9	4	SNP	0.012	A
MIDN	90007	genome.wustl.edu	37	19	1255011	1255011	+	Silent	SNP	C	C	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr19:1255011C>A	ENST00000591446.2	+	5	1216	c.807C>A	c.(805-807)atC>atA	p.I269I	MIDN_ENST00000300952.2_Silent_p.I269I			Q504T8	MIDN_HUMAN	midnolin	269						cytosol (GO:0005829)|nucleolus (GO:0005730)				NS(1)|endometrium(3)|kidney(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCCGTCATCGAGAGCTTTG	0.662																																																	0													63.0	68.0	66.0					19																	1255011		2203	4300	6503	SO:0001819	synonymous_variant	0			AC004221	CCDS32864.1	19p13.3	2013-09-20			ENSG00000167470	ENSG00000167470			16298	protein-coding gene	gene with protein product		606700				10974535	Standard	XM_005259671		Approved		uc002lrp.3	Q504T8	OTTHUMG00000180144	ENST00000591446.2:c.807C>A	19.37:g.1255011C>A			Q96BW8	Silent	SNP	pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.I269	ENST00000591446.2	37	c.807	CCDS32864.1	19																																																																																			MIDN	-	NULL	ENSG00000167470		0.662	MIDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIDN	HGNC	protein_coding	OTTHUMT00000449965.2	-	0.00	47	0	C			1255011	+1	tier1	-	no_errors	ENST00000300952	ensembl	human	known	74_37	silent	53.85	6	7	SNP	0.994	A
MEGF8	1954	genome.wustl.edu	37	19	42875612	42875612	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr19:42875612G>A	ENST00000251268.6	+	41	7247	c.7247G>A	c.(7246-7248)cGt>cAt	p.R2416H	MEGF8_ENST00000378073.4_Intron|MEGF8_ENST00000334370.4_Missense_Mutation_p.R2349H	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	2416	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)	p.R2349H(1)|p.R1957H(1)		breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				CCCAGTGACCGTCGAGACTGC	0.612																																																	2	Substitution - Missense(2)	large_intestine(2)											78.0	66.0	70.0					19																	42875612		2203	4300	6503	SO:0001583	missense	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.7247G>A	19.37:g.42875612G>A	ENSP00000251268:p.Arg2416His		A8KAY0|O75097	Missense_Mutation	SNP	pfam_CUB_dom,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB_dom,superfamily_Plexin-like_fold,smart_CUB_dom,smart_EG-like_dom,smart_Plexin-like_fold,smart_EGF-like_Ca-bd_dom,smart_EGF_laminin,pfscan_CUB_dom,pfscan_EG-like_dom,pfscan_EGF_laminin	p.R2416H	ENST00000251268.6	37	c.7247		19	.	.	.	.	.	.	.	.	.	.	G	22.5	4.299681	0.81136	.	.	ENSG00000105429	ENST00000334370;ENST00000251268	T;T	0.22134	1.97;1.97	4.91	4.91	0.64330	EGF-like, laminin (1);	0.000000	0.64402	D	0.000001	T	0.25531	0.0621	N	0.22421	0.69	0.80722	D	1	D;D	0.76494	0.998;0.999	P;D	0.63113	0.781;0.911	T	0.00956	-1.1501	10	0.44086	T	0.13	-28.0812	8.1771	0.31289	0.1743:0.0:0.8256:0.0	.	2416;2349	Q7Z7M0;Q7Z7M0-2	MEGF8_HUMAN;.	H	2349;2416	ENSP00000334219:R2349H;ENSP00000251268:R2416H	ENSP00000251268:R2416H	R	+	2	0	MEGF8	47567452	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.901000	0.56303	2.659000	0.90383	0.561000	0.74099	CGT	MEGF8	-	smart_EG-like_dom	ENSG00000105429		0.612	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1		0.00	39	0	G	NM_001410		42875612	+1			no_errors	ENST00000251268	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	A
MIPEP	4285	genome.wustl.edu	37	13	24444223	24444223	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr13:24444223G>A	ENST00000382172.3	-	6	813	c.715C>T	c.(715-717)Cgt>Tgt	p.R239C		NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase	239					protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		AAGTTACGACGAATGTGTTCT	0.378																																																	0													174.0	146.0	156.0					13																	24444223		2203	4300	6503	SO:0001583	missense	0				CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.715C>T	13.37:g.24444223G>A	ENSP00000371607:p.Arg239Cys		Q5JV15|Q5T9Q9|Q96G65	Missense_Mutation	SNP	pfam_Pept_M3A_M3B	p.R239C	ENST00000382172.3	37	c.715	CCDS9303.1	13	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479044	0.84747	.	.	ENSG00000027001	ENST00000382172	T	0.08458	3.09	5.92	4.2	0.49525	Neurolysin/Thimet oligopeptidase, domain 2 (1);	0.431594	0.28815	N	0.014057	T	0.15262	0.0368	M	0.62723	1.935	0.37051	D	0.897583	D	0.61697	0.99	P	0.48571	0.582	T	0.05767	-1.0865	10	0.72032	D	0.01	.	12.6171	0.56584	0.1338:0.0:0.8662:0.0	.	239	Q99797	MIPEP_HUMAN	C	239	ENSP00000371607:R239C	ENSP00000371607:R239C	R	-	1	0	MIPEP	23342223	0.642000	0.27260	0.077000	0.20336	0.419000	0.31324	3.054000	0.49908	0.837000	0.34925	0.650000	0.86243	CGT	MIPEP	-	NULL	ENSG00000027001		0.378	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIPEP	HGNC	protein_coding	OTTHUMT00000044169.1	-	0.00	57	0	G			24444223	-1	tier1	-	no_errors	ENST00000382172	ensembl	human	known	74_37	missense	16.07	47	9	SNP	0.687	A
MOV10	4343	genome.wustl.edu	37	1	113234375	113234375	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr1:113234375C>T	ENST00000413052.2	+	6	1315	c.925C>T	c.(925-927)Cag>Tag	p.Q309*	MOV10_ENST00000468624.1_3'UTR|RP11-426L16.3_ENST00000421943.1_RNA|MOV10_ENST00000357443.2_Nonsense_Mutation_p.Q309*|MOV10_ENST00000369645.1_Nonsense_Mutation_p.Q309*|MOV10_ENST00000369644.1_Nonsense_Mutation_p.Q253*	NM_001130079.1|NM_020963.3	NP_001123551.1|NP_066014.1	Q9HCE1	MOV10_HUMAN	Mov10 RISC complex RNA helicase	309					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mRNA cleavage involved in gene silencing by miRNA (GO:0035279)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(15)|ovary(5)|prostate(1)|skin(3)|urinary_tract(3)	38	Lung SC(450;0.246)	all_cancers(81;3.31e-11)|all_epithelial(167;5.69e-10)|all_lung(203;3.73e-05)|Breast(1374;0.000525)|Lung NSC(69;0.000954)|Ovarian(761;0.0367)|Lung SC(238;0.114)		OV - Ovarian serous cystadenocarcinoma(397;3.99e-67)|all cancers(265;1e-62)|Epithelial(280;4.78e-61)|Lung(183;0.0234)|Colorectal(144;0.0686)|READ - Rectum adenocarcinoma(129;0.0929)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)|BRCA - Breast invasive adenocarcinoma(282;0.24)		CATGCTTCTTCAGGGAACAAG	0.552																																																	0													121.0	116.0	118.0					1																	113234375		2203	4300	6503	SO:0001587	stop_gained	0			AL833353	CCDS853.1, CCDS65615.1	1p13.2	2014-07-02	2014-07-02		ENSG00000155363	ENSG00000155363			7200	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 113"""	610742	"""Mov10 (Moloney leukemia virus 10, mouse) homolog"", ""Mov10, Moloney leukemia virus 10, homolog (mouse)"""			12226669	Standard	NM_001286072		Approved	gb110, MGC2948, fSAP113	uc001eck.3	Q9HCE1	OTTHUMG00000011906	ENST00000413052.2:c.925C>T	1.37:g.113234375C>T	ENSP00000399797:p.Gln309*		Q5JR03|Q8TEF0|Q9BSY3|Q9BUJ9	Nonsense_Mutation	SNP	superfamily_P-loop_NTPase	p.Q309*	ENST00000413052.2	37	c.925	CCDS853.1	1	.	.	.	.	.	.	.	.	.	.	C	45	12.066145	0.99632	.	.	ENSG00000155363	ENST00000413052;ENST00000369645;ENST00000285733;ENST00000369644;ENST00000357443;ENST00000369648	.	.	.	5.01	4.03	0.46877	.	0.495684	0.24267	N	0.040034	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-14.3947	10.2025	0.43094	0.198:0.802:0.0:0.0	.	.	.	.	X	309;309;309;253;309;247	.	ENSP00000285733:Q309X	Q	+	1	0	MOV10	113035898	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.786000	0.38694	2.779000	0.95612	0.561000	0.74099	CAG	MOV10	-	NULL	ENSG00000155363		0.552	MOV10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOV10	HGNC	protein_coding	OTTHUMT00000032906.1	-	0.00	79	0	C	NM_020963		113234375	+1	tier1	-	no_errors	ENST00000357443	ensembl	human	known	74_37	nonsense	25.00	42	14	SNP	1.000	T
MT-ND1	4535	genome.wustl.edu	37	M	1204	1204	+	5'Flank	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chrM:1204C>T	ENST00000361390.2	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TL1_ENST00000386347.1_RNA			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CTCTAGAGGAGCCTGTTCTGT	0.473																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886			M.37:g.1204C>T	Exception_encountered		C0JKH6|Q37523	RNA	SNP	-	NULL	ENST00000361390.2	37	NULL		MT																																																																																			MT-RNR1	-	-	ENSG00000211459		0.473	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	MT-RNR1	HGNC	protein_coding		-	0.00	24	0	C	YP_003024026		1204	+1	tier1	-	no_errors	ENST00000389680	ensembl	human	known	74_37	rna	33.33	4	2	SNP	NULL	T
MTMR10	54893	genome.wustl.edu	37	15	31253135	31253135	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr15:31253135G>T	ENST00000435680.1	-	7	804	c.707C>A	c.(706-708)gCt>gAt	p.A236D	MTMR10_ENST00000314404.8_5'UTR|MTMR10_ENST00000425768.1_Missense_Mutation_p.L206I|MTMR10_ENST00000563714.1_Missense_Mutation_p.A154D	NM_017762.2	NP_060232.2	Q9NXD2	MTMRA_HUMAN	myotubularin related protein 10	236	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;2.81e-11)		all cancers(64;7.26e-15)|Epithelial(43;7.2e-11)|GBM - Glioblastoma multiforme(186;0.000158)|BRCA - Breast invasive adenocarcinoma(123;0.00426)|Lung(196;0.174)		CCACCCGGAAGCACCTGTCCT	0.458																																																	0													100.0	96.0	98.0					15																	31253135		1915	4133	6048	SO:0001583	missense	0			AK000320	CCDS45204.1	15q13.3	2011-06-09				ENSG00000166912		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	25999	protein-coding gene	gene with protein product						12495846	Standard	NM_017762		Approved	FLJ20313	uc001zfh.1	Q9NXD2		ENST00000435680.1:c.707C>A	15.37:g.31253135G>T	ENSP00000402537:p.Ala236Asp		Q6P4Q6	Missense_Mutation	SNP	pfam_Myotubularin_assoc,pfam_Myotubularin-like_Pase_dom	p.A236D	ENST00000435680.1	37	c.707	CCDS45204.1	15	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.5|23.5	4.420765|4.420765	0.83559|0.83559	.|.	.|.	ENSG00000166912|ENSG00000166912	ENST00000435680;ENST00000340566|ENST00000425768	D|T	0.93133|0.54479	-3.17|0.57	5.15|5.15	4.23|4.23	0.50019|0.50019	Myotubularin phosphatase domain (1);|.	0.052659|.	0.85682|.	D|.	0.000000|.	T|T	0.52224|0.52224	0.1721|0.1721	L|L	0.41492|0.41492	1.28|1.28	0.23720|0.23720	N|N	0.997027|0.997027	P;D|.	0.89917|.	0.51;1.0|.	B;D|.	0.76575|.	0.241;0.988|.	T|T	0.43376|0.43376	-0.9395|-0.9395	10|7	0.48119|0.31617	T|T	0.1|0.26	.|.	15.0864|15.0864	0.72158|0.72158	0.0:0.0:0.8572:0.1428|0.0:0.0:0.8572:0.1428	.|.	154;236|.	Q9NXD2-2;Q9NXD2|.	.;MTMRA_HUMAN|.	D|I	236;154|206	ENSP00000402537:A236D|ENSP00000412314:L206I	ENSP00000340637:A154D|ENSP00000412314:L206I	A|L	-|-	2|1	0|0	MTMR10|MTMR10	29040427|29040427	1.000000|1.000000	0.71417|0.71417	0.553000|0.553000	0.28255|0.28255	0.980000|0.980000	0.70556|0.70556	8.829000|8.829000	0.92055|0.92055	1.149000|1.149000	0.42402|0.42402	0.563000|0.563000	0.77884|0.77884	GCT|CTT	MTMR10	-	NULL	ENSG00000166912		0.458	MTMR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR10	HGNC	protein_coding	OTTHUMT00000430747.1	-	0.00	77	0	G	NM_017762		31253135	-1	tier1	-	no_errors	ENST00000435680	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9069914	9069914	+	Silent	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr19:9069914G>T	ENST00000397910.4	-	3	17735	c.17532C>A	c.(17530-17532)atC>atA	p.I5844I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5846	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGAGCCTGGTGATGGTTTCTG	0.483																																																	0													210.0	198.0	202.0					19																	9069914		1947	4131	6078	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.17532C>A	19.37:g.9069914G>T			Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.I5844	ENST00000397910.4	37	c.17532	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	106	0	G	NM_024690		9069914	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	silent	20.73	65	17	SNP	0.000	T
MUC4	4585	genome.wustl.edu	37	3	195481170	195481170	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr3:195481170G>A	ENST00000346145.4	-	18	2573	c.2534C>T	c.(2533-2535)cCg>cTg	p.P845L	MUC4_ENST00000463781.3_Missense_Mutation_p.P5081L|MUC4_ENST00000475231.1_Missense_Mutation_p.P5029L|MUC4_ENST00000349607.4_Missense_Mutation_p.P794L	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	1838	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CGGGAAGCACGGCTCCTCACA	0.682																																																	0													52.0	52.0	52.0					3																	195481170		2203	4300	6503	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.2534C>T	3.37:g.195481170G>A	ENSP00000304207:p.Pro845Leu		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P5081L	ENST00000346145.4	37	c.15242	CCDS3310.1	3	.	.	.	.	.	.	.	.	.	.	.	14.18	2.459058	0.43634	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.50277	0.75;1.12;1.17;1.09	5.46	-8.44	0.00950	.	2.287140	0.01725	N	0.028523	T	0.38054	0.1026	M	0.80183	2.485	0.09310	N	1	B;B;B;B;B;P	0.41366	0.291;0.031;0.031;0.006;0.006;0.747	B;B;B;B;B;B	0.24974	0.033;0.006;0.01;0.002;0.002;0.057	T	0.54563	-0.8275	10	0.39692	T	0.17	0.2125	7.0382	0.25004	0.0907:0.0938:0.5705:0.245	.	4953;794;845;5081;5029;1786	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	L	794;845;5081;5029;1581	ENSP00000338109:P794L;ENSP00000304207:P845L;ENSP00000417498:P5081L;ENSP00000420243:P5029L	ENSP00000304207:P845L	P	-	2	0	MUC4	196966841	0.000000	0.05858	0.034000	0.17996	0.015000	0.08874	-2.235000	0.01202	-0.569000	0.06030	-1.701000	0.00721	CCG	MUC4	-	smart_EG-like_dom	ENSG00000145113		0.682	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000341862.1	-	0.00	63	0	G	NM_018406		195481170	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	34.04	31	16	SNP	0.000	A
MUC5B	727897	genome.wustl.edu	37	11	1267550	1267550	+	Missense_Mutation	SNP	C	C	G	rs201362727	byFrequency	TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr11:1267550C>G	ENST00000529681.1	+	31	9498	c.9440C>G	c.(9439-9441)gCc>gGc	p.A3147G	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.A3150G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3147	17 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACAACTGCAGCCACTGGCCCC	0.662																																																	0													47.0	61.0	57.0					11																	1267550		2021	4131	6152	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.9440C>G	11.37:g.1267550C>G	ENSP00000436812:p.Ala3147Gly		O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.A3150G	ENST00000529681.1	37	c.9449	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	c	2.947	-0.217634	0.06101	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000538459	T;T	0.21031	2.03;2.21	1.47	-2.94	0.05581	.	.	.	.	.	T	0.12902	0.0313	L	0.43152	1.355	0.09310	N	1	B;P	0.42409	0.435;0.779	B;B	0.32393	0.101;0.145	T	0.02617	-1.1133	9	0.87932	D	0	.	6.2595	0.20891	0.0:0.545:0.134:0.321	rs61732888	3730;3150	A7Y9J9;E9PBJ0	.;.	G	3147;3150;3119;3107;37	ENSP00000436812:A3147G;ENSP00000415793:A3150G	ENSP00000343037:A3119G	A	+	2	0	MUC5B	1224126	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.402000	0.20965	-2.219000	0.00729	-0.706000	0.03657	GCC	MUC5B	-	NULL	ENSG00000117983		0.662	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2		0.00	91	0	C	XM_001126093		1267550	+1			no_errors	ENST00000447027	ensembl	human	known	74_37	missense	8.51	42	4	SNP	0.000	G
ACAA1	30	genome.wustl.edu	37	3	38180161	38180161	+	5'Flank	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr3:38180161C>T	ENST00000333167.8	-	0	0				MYD88_ENST00000443433.2_Silent_p.P3P|MYD88_ENST00000424893.1_Silent_p.P3P|MYD88_ENST00000396334.3_Silent_p.P3P|ACAA1_ENST00000444607.2_5'Flank|ACAA1_ENST00000450296.1_5'Flank|MYD88_ENST00000495303.1_Silent_p.P3P|ACAA1_ENST00000301810.7_5'Flank|MYD88_ENST00000417037.2_Silent_p.P3P|ACAA1_ENST00000544624.1_5'Flank	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1						alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		CAATGCGACCCGACCGCGCTG	0.716																																																	0													7.0	7.0	7.0					3																	38180161		1999	3947	5946	SO:0001631	upstream_gene_variant	0			X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087		3.37:g.38180161C>T	Exception_encountered		G5E935|Q96CA6	Silent	SNP	pfam_TIR_dom,pfam_Death_domain,superfamily_DEATH-like_dom,superfamily_TIR_dom,smart_Death_domain,smart_TIR_dom,pirsf_Myelin_different_resp_MyD88,pfscan_Death_domain,pfscan_TIR_dom	p.P3	ENST00000333167.8	37	c.9	CCDS2673.1	3																																																																																			MYD88	-	NULL	ENSG00000172936		0.716	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYD88	HGNC	protein_coding	OTTHUMT00000342980.1	-	0.00	33	0	C	NM_001607		38180161	+1	tier1	-	no_errors	ENST00000417037	ensembl	human	known	74_37	silent	38.46	16	10	SNP	0.000	T
MYH7	4625	genome.wustl.edu	37	14	23891482	23891482	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr14:23891482G>A	ENST00000355349.3	-	25	3314	c.3152C>T	c.(3151-3153)gCg>gTg	p.A1051V		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1051					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTTCCGCTTCGCTCGCTCCAG	0.572																																																	0													133.0	106.0	115.0					14																	23891482		2203	4300	6503	SO:0001583	missense	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.3152C>T	14.37:g.23891482G>A	ENSP00000347507:p.Ala1051Val		A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1051V	ENST00000355349.3	37	c.3152	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	G	16.08	3.020600	0.54576	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.91011	-2.77	4.64	4.64	0.57946	.	.	.	.	.	D	0.85362	0.5679	L	0.38175	1.15	0.47214	D	0.999357	B	0.10296	0.003	B	0.12156	0.007	T	0.81123	-0.1076	9	0.44086	T	0.13	.	11.5294	0.50599	0.0824:0.0:0.9176:0.0	.	1051	P12883	MYH7_HUMAN	V	1051	ENSP00000347507:A1051V	ENSP00000347507:A1051V	A	-	2	0	MYH7	22961322	1.000000	0.71417	0.956000	0.39512	0.920000	0.55202	4.331000	0.59273	2.585000	0.87301	0.655000	0.94253	GCG	MYH7	-	superfamily_Prefoldin	ENSG00000092054		0.572	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3		0.00	79	0	G	NM_000257		23891482	-1			no_errors	ENST00000355349	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.995	A
MYO1F	4542	genome.wustl.edu	37	19	8592306	8592306	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr19:8592306A>G	ENST00000338257.8	-	22	2657	c.2390T>C	c.(2389-2391)gTg>gCg	p.V797A		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	797	Myosin tail. {ECO:0000255}.			V -> M (in Ref. 1; CAC83948 and 5; CAA67058). {ECO:0000305}.	defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						TCCCTTCTTCACTTTCTCTCG	0.552																																																	0													80.0	82.0	82.0					19																	8592306		2020	4188	6208	SO:0001583	missense	0			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.2390T>C	19.37:g.8592306A>G	ENSP00000344871:p.Val797Ala		Q8WWN7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.V797A	ENST00000338257.8	37	c.2390	CCDS42494.1	19	.	.	.	.	.	.	.	.	.	.	A	26.2	4.719413	0.89205	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	T	0.37235	1.21	5.16	5.16	0.70880	Myosin tail 2 (1);	0.000000	0.64402	D	0.000001	T	0.59514	0.2199	M	0.89353	3.025	0.58432	D	0.999999	P	0.50156	0.932	P	0.54544	0.755	T	0.67662	-0.5613	10	0.56958	D	0.05	.	14.2338	0.65911	1.0:0.0:0.0:0.0	.	797	O00160	MYO1F_HUMAN	A	842;797	ENSP00000344871:V797A	ENSP00000304899:V842A	V	-	2	0	MYO1F	8498306	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.368000	0.79567	1.968000	0.57251	0.374000	0.22700	GTG	MYO1F	-	pfam_Myosin_tail_2	ENSG00000142347		0.552	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1F	HGNC	protein_coding	OTTHUMT00000342716.2	-	0.00	63	0	A			8592306	-1	tier1	-	no_errors	ENST00000338257	ensembl	human	known	74_37	missense	30.23	30	13	SNP	1.000	G
NEB	4703	genome.wustl.edu	37	2	152402931	152402931	+	Silent	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr2:152402931G>T	ENST00000172853.10	-	106	15438	c.15291C>A	c.(15289-15291)gtC>gtA	p.V5097V	NEB_ENST00000603639.1_Silent_p.V6798V|NEB_ENST00000604864.1_Silent_p.V6798V|NEB_ENST00000409198.1_Silent_p.V5097V|NEB_ENST00000397345.3_Silent_p.V6798V|NEB_ENST00000427231.2_Silent_p.V6798V			P20929	NEBU_HUMAN	nebulin	5097					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		ATCCCTTCAGGACCTGCAAGT	0.463																																																	0													121.0	128.0	126.0					2																	152402931		1956	4157	6113	SO:0001819	synonymous_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.15291C>A	2.37:g.152402931G>T			F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.V6798	ENST00000172853.10	37	c.20394		2																																																																																			NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.463	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding			0.00	19	0	G	NM_004543		152402931	-1			no_errors	ENST00000397345	ensembl	human	known	74_37	silent	7.69	36	3	SNP	1.000	T
NEDD4L	23327	genome.wustl.edu	37	18	56002725	56002725	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr18:56002725G>T	ENST00000400345.3	+	13	1364	c.1081G>T	c.(1081-1083)Ggg>Tgg	p.G361W	NEDD4L_ENST00000256832.7_Intron|NEDD4L_ENST00000431212.2_Missense_Mutation_p.G240W|NEDD4L_ENST00000356462.6_Intron|NEDD4L_ENST00000382850.4_Intron|NEDD4L_ENST00000357895.5_Missense_Mutation_p.G353W|NEDD4L_ENST00000456986.1_Missense_Mutation_p.G240W|NEDD4L_ENST00000435432.2_Intron|NEDD4L_ENST00000586263.1_Intron|NEDD4L_ENST00000256830.9_Intron|NEDD4L_ENST00000456173.2_Intron|NEDD4L_ENST00000589054.1_Intron	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	361					cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						TGCCCCAGCTGGGAGAGCGCG	0.517																																																	0													112.0	103.0	106.0					18																	56002725		1568	3582	5150	SO:0001583	missense	0			AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.1081G>T	18.37:g.56002725G>T	ENSP00000383199:p.Gly361Trp		O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	pfam_HECT,pfam_WW_dom,pfam_C2_dom,superfamily_HECT,superfamily_C2_dom,superfamily_WW_dom,smart_C2_dom,smart_WW_dom,smart_HECT,pfscan_HECT,pfscan_C2_dom,pfscan_WW_dom,prints_C2_dom	p.G361W	ENST00000400345.3	37	c.1081	CCDS45872.1	18	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337390	0.60963	.	.	ENSG00000049759	ENST00000400345;ENST00000456986;ENST00000357895;ENST00000431212	T;T;T;T	0.34859	1.34;1.86;1.75;1.86	5.87	3.38	0.38709	.	.	.	.	.	T	0.32793	0.0841	N	0.22421	0.69	0.29947	N	0.820573	B;B	0.32604	0.377;0.26	B;B	0.43701	0.428;0.246	T	0.38520	-0.9657	9	0.66056	D	0.02	.	8.671	0.34149	0.7821:0.0:0.2179:0.0	.	353;361	Q96PU5-7;Q96PU5	.;NED4L_HUMAN	W	361;240;353;240	ENSP00000383199:G361W;ENSP00000411947:G240W;ENSP00000350569:G353W;ENSP00000389406:G240W	ENSP00000350569:G353W	G	+	1	0	NEDD4L	54153705	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	3.092000	0.50207	0.515000	0.28320	-0.238000	0.12139	GGG	NEDD4L	-	NULL	ENSG00000049759		0.517	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD4L	HGNC	protein_coding	OTTHUMT00000448749.1		0.00	39	0	G			56002725	+1			no_errors	ENST00000400345	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
NKD2	85409	genome.wustl.edu	37	5	1037676	1037676	+	Intron	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr5:1037676C>T	ENST00000296849.5	+	10	1016				NKD2_ENST00000382730.2_Intron|NKD2_ENST00000537972.1_Missense_Mutation_p.H277Y|NKD2_ENST00000274150.4_Missense_Mutation_p.H277Y	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)						exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			TCCCAGGACACACAGTGGGGA	0.647																																																	0																																										SO:0001627	intron_variant	0			AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.788-244C>T	5.37:g.1037676C>T			Q96EK8|Q9BSN0	Missense_Mutation	SNP	pfscan_EF_hand_dom	p.H277Y	ENST00000296849.5	37	c.829	CCDS3859.1	5	.	.	.	.	.	.	.	.	.	.	C	2.713	-0.268441	0.05716	.	.	ENSG00000145506	ENST00000274150;ENST00000537972	T;T	0.64260	-0.09;-0.09	0.899	-0.0795	0.13710	.	.	.	.	.	T	0.36826	0.0981	.	.	.	0.09310	N	1	P	0.46706	0.883	B	0.26310	0.068	T	0.30765	-0.9967	8	0.62326	D	0.03	.	3.568	0.07907	0.0:0.6937:0.0:0.3063	.	277	Q969F2-2	.	Y	277	ENSP00000274150:H277Y;ENSP00000440925:H277Y	ENSP00000274150:H277Y	H	+	1	0	NKD2	1090676	0.002000	0.14202	0.002000	0.10522	0.018000	0.09664	0.621000	0.24418	-0.079000	0.12707	-0.657000	0.03884	CAC	NKD2	-	NULL	ENSG00000145506		0.647	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NKD2	HGNC	protein_coding	OTTHUMT00000206720.2	-	0.00	45	0	C	NM_033120		1037676	+1	tier1	-	no_errors	ENST00000537972	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.002	T
NRXN3	9369	genome.wustl.edu	37	14	80327445	80327445	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr14:80327445G>A	ENST00000557594.1	+	6	2005	c.1052G>A	c.(1051-1053)cGt>cAt	p.R351H	NRXN3_ENST00000556003.1_Intron|NRXN3_ENST00000428277.2_Intron|NRXN3_ENST00000554719.1_Intron|NRXN3_ENST00000281127.7_Intron|NRXN3_ENST00000335750.5_Intron	NM_001272020.1	NP_001258949.1	Q9HDB5	NRX3B_HUMAN	neurexin 3	351					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		ATTGCTACTCGTGCACCTTCC	0.468																																																	0																																										SO:0001583	missense	0			AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000557594.1:c.1052G>A	14.37:g.80327445G>A	ENSP00000451672:p.Arg351His		A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Neurexin-like,pfscan_Laminin_G	p.R351H	ENST00000557594.1	37	c.1052		14	.	.	.	.	.	.	.	.	.	.	G	17.82	3.482223	0.63962	.	.	ENSG00000021645	ENST00000330071;ENST00000557594	T	0.38401	1.14	5.86	5.86	0.93980	.	.	.	.	.	T	0.27933	0.0688	.	.	.	0.80722	D	1	B	0.33238	0.403	B	0.22152	0.038	T	0.03364	-1.1044	7	.	.	.	.	20.2019	0.98263	0.0:0.0:1.0:0.0	.	351	Q9HDB5	NRX3B_HUMAN	H	1357;351	ENSP00000451672:R351H	.	R	+	2	0	NRXN3	79397198	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.737000	0.68606	2.776000	0.95493	0.655000	0.94253	CGT	NRXN3	-	NULL	ENSG00000021645		0.468	NRXN3-004	NOVEL	basic	protein_coding	NRXN3	HGNC	protein_coding	OTTHUMT00000413790.1	-	0.00	69	0	G	NM_001105250		80327445	+1	tier1	-	no_errors	ENST00000557594	ensembl	human	novel	74_37	missense	6.56	57	4	SNP	1.000	A
NUP54	53371	genome.wustl.edu	37	4	77055514	77055514	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr4:77055514G>T	ENST00000264883.3	-	5	664	c.524C>A	c.(523-525)gCa>gAa	p.A175E	NUP54_ENST00000342467.6_5'UTR|NUP54_ENST00000458189.2_5'UTR|NUP54_ENST00000515460.1_5'UTR|NUP54_ENST00000514987.1_Splice_Site_p.A127E	NM_017426.2	NP_059122.2	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	175	9 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein targeting (GO:0006605)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nucleocytoplasmic transporter activity (GO:0005487)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(3)|skin(1)|stomach(1)	19						ATAACCTACTGCCTGTGGAAT	0.313																																																	0													40.0	36.0	37.0					4																	77055514		2203	4300	6503	SO:0001630	splice_region_variant	0			AF157322	CCDS3576.1, CCDS63998.1	4q21.1	2008-07-03	2002-08-29		ENSG00000138750	ENSG00000138750			17359	protein-coding gene	gene with protein product		607607	"""nucleoporin 54kD"""			8707840	Standard	NM_017426		Approved		uc003hjs.3	Q7Z3B4	OTTHUMG00000130098	ENST00000264883.3:c.523-1C>A	4.37:g.77055514G>T			B2RCK7|B4DT35|Q96EA7|Q9NVL5|Q9P0I1	Missense_Mutation	SNP	NULL	p.A175E	ENST00000264883.3	37	c.524	CCDS3576.1	4	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586160	0.66105	.	.	ENSG00000138750	ENST00000264883;ENST00000514987	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.81936	0.4928	M	0.83384	2.64	0.80722	D	1	D;D	0.64830	0.994;0.994	P;P	0.57911	0.829;0.829	D	0.83693	0.0178	9	0.72032	D	0.01	-26.0578	20.1392	0.98050	0.0:0.0:1.0:0.0	.	127;175	B4DT35;Q7Z3B4	.;NUP54_HUMAN	E	175;127	.	ENSP00000264883:A175E	A	-	2	0	NUP54	77274538	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.118000	0.94355	2.765000	0.95021	0.557000	0.71058	GCA	NUP54	-	NULL	ENSG00000138750		0.313	NUP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP54	HGNC	protein_coding	OTTHUMT00000252402.3	-	0.00	39	0	G		Missense_Mutation	77055514	-1	tier1	-	no_errors	ENST00000264883	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	T
OR10A5	144124	genome.wustl.edu	37	11	6867799	6867799	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr11:6867799A>T	ENST00000299454.4	+	1	917	c.886A>T	c.(886-888)Agc>Tgc	p.S296C	OR10A5_ENST00000379831.2_Missense_Mutation_p.S300C			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	296					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		CTTGAGAAATAGCGAGGTGAA	0.423																																					Pancreas(44;21 1072 25662 28041 45559)												0													94.0	96.0	96.0					11																	6867799		2201	4296	6497	SO:0001583	missense	0			AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.886A>T	11.37:g.6867799A>T	ENSP00000299454:p.Ser296Cys		O95223|Q52M66|Q96R21|Q96R22	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S300C	ENST00000299454.4	37	c.898	CCDS7773.1	11	.	.	.	.	.	.	.	.	.	.	.	14.64	2.596725	0.46318	.	.	ENSG00000166363	ENST00000299454;ENST00000379831	T;T	0.39997	1.05;1.05	3.59	3.59	0.41128	.	0.765111	0.12222	N	0.488301	T	0.39809	0.1092	L	0.39245	1.2	0.25691	N	0.985686	P	0.42456	0.78	B	0.43990	0.438	T	0.28170	-1.0052	10	0.87932	D	0	.	10.7772	0.46356	1.0:0.0:0.0:0.0	.	296	Q9H207	O10A5_HUMAN	C	296;300	ENSP00000299454:S296C;ENSP00000369159:S300C	ENSP00000299454:S296C	S	+	1	0	OR10A5	6824375	0.007000	0.16637	0.980000	0.43619	0.308000	0.27856	0.937000	0.28951	1.839000	0.53478	0.482000	0.46254	AGC	OR10A5	-	prints_GPCR_Rhodpsn	ENSG00000166363		0.423	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A5	HGNC	protein_coding	OTTHUMT00000385983.1	-	0.00	31	0	A	NM_178168		6867799	+1	tier1	-	no_errors	ENST00000379831	ensembl	human	known	74_37	missense	27.03	27	10	SNP	0.999	T
OR4A47	403253	genome.wustl.edu	37	11	48510925	48510925	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr11:48510925G>T	ENST00000446524.1	+	1	657	c.581G>T	c.(580-582)gGc>gTc	p.G194V		NM_001005512.2	NP_001005512.2	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A, member 47	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(18)|ovary(1)|skin(1)|urinary_tract(2)	29						CATGCTATTGGCCTCTTAGTG	0.438																																																	0													141.0	137.0	138.0					11																	48510925		2200	4297	6497	SO:0001583	missense	0			BK004380	CCDS31490.1	11p11.2	2012-08-09			ENSG00000237388	ENSG00000237388		"""GPCR / Class A : Olfactory receptors"""	31266	protein-coding gene	gene with protein product							Standard	NM_001005512		Approved		uc010rhx.2	Q6IF82	OTTHUMG00000166581	ENST00000446524.1:c.581G>T	11.37:g.48510925G>T	ENSP00000412752:p.Gly194Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G194V	ENST00000446524.1	37	c.581	CCDS31490.1	11	.	.	.	.	.	.	.	.	.	.	N	9.979	1.227703	0.22542	.	.	ENSG00000237388	ENST00000446524	T	0.00091	8.74	4.59	4.59	0.56863	GPCR, rhodopsin-like superfamily (1);	0.348806	0.24633	N	0.036865	T	0.00300	0.0009	L	0.41710	1.295	0.22858	N	0.998647	D	0.89917	1.0	D	0.79784	0.993	T	0.58853	-0.7563	10	0.87932	D	0	.	10.1905	0.43024	0.0:0.0:0.8009:0.1991	.	194	Q6IF82	O4A47_HUMAN	V	194	ENSP00000412752:G194V	ENSP00000412752:G194V	G	+	2	0	OR4A47	48467501	0.000000	0.05858	0.092000	0.20876	0.294000	0.27393	-0.004000	0.12878	2.082000	0.62665	0.205000	0.17691	GGC	OR4A47	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000237388		0.438	OR4A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A47	HGNC	protein_coding	OTTHUMT00000390559.1		0.00	65	0	G	NM_001005512		48510925	+1			no_errors	ENST00000446524	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.009	T
OR4D2	124538	genome.wustl.edu	37	17	56247408	56247408	+	Missense_Mutation	SNP	G	G	A	rs147819968		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr17:56247408G>A	ENST00000545221.1	+	1	392	c.392G>A	c.(391-393)cGc>cAc	p.R131H		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						CGGCCCCTCCGCTATGTCACC	0.567													G|||	1	0.000199681	0.0	0.0	5008	,	,		18447	0.0		0.001	False		,,,				2504	0.0																0								G	HIS/ARG	8,4398	14.3+/-33.2	0,8,2195	84.0	85.0	85.0		392	4.6	1.0	17	dbSNP_134	85	0,8600		0,0,4300	no	missense	OR4D2	NM_001004707.3	29	0,8,6495	AA,AG,GG		0.0,0.1816,0.0615	benign	131/308	56247408	8,12998	2203	4300	6503	SO:0001583	missense	0				CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.392G>A	17.37:g.56247408G>A	ENSP00000441354:p.Arg131His		Q6IFN8|Q96R75	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R131H	ENST00000545221.1	37	c.392	CCDS32688.1	17	.	.	.	.	.	.	.	.	.	.	G	2.670	-0.277682	0.05679	0.001816	0.0	ENSG00000255713	ENST00000545221	T	0.00669	5.9	5.71	4.62	0.57501	GPCR, rhodopsin-like superfamily (1);	0.000000	0.56097	N	0.000021	T	0.00384	0.0012	N	0.02158	-0.66	0.25960	N	0.982639	B	0.06786	0.001	B	0.04013	0.001	T	0.43376	-0.9395	10	0.02654	T	1	-22.3682	10.0727	0.42343	0.92:0.0:0.08:0.0	.	131	P58180	OR4D2_HUMAN	H	131	ENSP00000441354:R131H	ENSP00000441354:R131H	R	+	2	0	OR4D2	53602407	0.042000	0.20092	1.000000	0.80357	0.947000	0.59692	0.961000	0.29267	1.109000	0.41680	-0.290000	0.09829	CGC	OR4D2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000255713		0.567	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D2	HGNC	protein_coding	OTTHUMT00000443366.1	-	0.00	46	0	G			56247408	+1	tier1	rs147819968	no_errors	ENST00000545221	ensembl	human	known	74_37	missense	50.00	21	21	SNP	1.000	A
OR5M9	390162	genome.wustl.edu	37	11	56230100	56230100	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr11:56230100T>C	ENST00000279791.1	-	1	777	c.778A>G	c.(778-780)Aga>Gga	p.R260G		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	260						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					TCAGTGGGTCTCCTGAGATAC	0.498																																																	0													66.0	60.0	62.0					11																	56230100		2201	4296	6497	SO:0001583	missense	0			AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.778A>G	11.37:g.56230100T>C	ENSP00000279791:p.Arg260Gly		Q6IEW5|Q96RB9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R260G	ENST00000279791.1	37	c.778	CCDS31531.1	11	.	.	.	.	.	.	.	.	.	.	T	3.688	-0.064181	0.07273	.	.	ENSG00000150269	ENST00000279791	T	0.00099	8.73	3.87	-7.73	0.01245	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41396	D	0.000897	T	0.00109	0.0003	N	0.25890	0.77	0.09310	N	1	B	0.30973	0.302	B	0.39339	0.297	T	0.43097	-0.9412	10	0.87932	D	0	-5.5793	9.6364	0.39811	0.1509:0.0:0.1409:0.7082	.	260	Q8NGP3	OR5M9_HUMAN	G	260	ENSP00000279791:R260G	ENSP00000279791:R260G	R	-	1	2	OR5M9	55986676	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	0.047000	0.14056	-2.320000	0.00642	-0.504000	0.04507	AGA	OR5M9	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000150269		0.498	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5M9	HGNC	protein_coding	OTTHUMT00000391638.1	-	0.00	58	0	T	NM_001004743		56230100	-1	tier1	-	no_errors	ENST00000279791	ensembl	human	known	74_37	missense	18.18	35	8	SNP	0.000	C
PCDH15	65217	genome.wustl.edu	37	10	55782711	55782711	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr10:55782711T>G	ENST00000320301.6	-	19	2861	c.2467A>C	c.(2467-2469)Aca>Cca	p.T823P	PCDH15_ENST00000373965.2_Missense_Mutation_p.T830P|PCDH15_ENST00000395438.1_Missense_Mutation_p.T823P|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000373955.1_Missense_Mutation_p.T823P|PCDH15_ENST00000395433.1_Missense_Mutation_p.T801P|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395445.1_Missense_Mutation_p.T830P|PCDH15_ENST00000437009.1_Missense_Mutation_p.T752P|PCDH15_ENST00000409834.1_Missense_Mutation_p.T434P|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395432.2_Missense_Mutation_p.T786P|PCDH15_ENST00000414778.1_Missense_Mutation_p.T828P|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.T823P|PCDH15_ENST00000395430.1_Missense_Mutation_p.T823P	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	823	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ACAGTGTATGTTGAATTGGTG	0.423										HNSCC(58;0.16)																																							0													183.0	164.0	170.0					10																	55782711		2203	4300	6503	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.2467A>C	10.37:g.55782711T>G	ENSP00000322604:p.Thr823Pro		A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T823P	ENST00000320301.6	37	c.2467	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	T	16.04	3.011177	0.54361	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16	5.67	4.47	0.54385	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.38453	0.1041	N	0.17345	0.48	0.31677	N	0.64367	D;D;D;P;D;D;D;P;D;P;B;P;P;D	0.69078	0.996;0.964;0.964;0.928;0.997;0.984;0.996;0.955;0.964;0.885;0.173;0.729;0.942;0.964	D;P;P;P;D;P;D;P;P;P;B;P;P;P	0.64144	0.917;0.737;0.65;0.65;0.922;0.737;0.917;0.616;0.737;0.53;0.05;0.493;0.642;0.65	T	0.31558	-0.9939	9	0.35671	T	0.21	.	10.5258	0.44948	0.207:0.0:0.0:0.7929	.	801;823;823;828;752;786;823;823;830;830;823;828;823;823	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	P	830;828;823;823;434;830;786;823;801;823;823;828;752;823	ENSP00000363076:T830P;ENSP00000410304:T828P;ENSP00000378826:T823P;ENSP00000386693:T434P;ENSP00000378832:T830P;ENSP00000378820:T786P;ENSP00000354950:T823P;ENSP00000378821:T801P;ENSP00000322604:T823P;ENSP00000378818:T823P;ENSP00000412628:T752P;ENSP00000363066:T823P	ENSP00000322604:T823P	T	-	1	0	PCDH15	55452717	0.813000	0.29090	1.000000	0.80357	0.847000	0.48162	1.067000	0.30616	2.285000	0.76669	0.477000	0.44152	ACA	PCDH15	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000150275		0.423	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	-	0.00	56	0	T	NM_033056		55782711	-1	tier1	-	no_errors	ENST00000320301	ensembl	human	known	74_37	missense	40.00	20	14	SNP	0.954	G
PCDHAC2	56134	genome.wustl.edu	37	5	140347423	140347423	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr5:140347423G>A	ENST00000289269.5	+	1	1604	c.1072G>A	c.(1072-1074)Gtg>Atg	p.V358M	PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	358	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATCGTGGACGTGAATGACAA	0.562																																					Melanoma(190;638 2083 3390 11909 52360)												0													84.0	70.0	74.0					5																	140347423		2203	4300	6503	SO:0001583	missense	0			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1072G>A	5.37:g.140347423G>A	ENSP00000289269:p.Val358Met		Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V358M	ENST00000289269.5	37	c.1072	CCDS4242.1	5	.	.	.	.	.	.	.	.	.	.	G	18.27	3.585870	0.66105	.	.	ENSG00000243232	ENST00000289269	T	0.63580	-0.05	5.87	5.87	0.94306	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.38005	N	0.001853	T	0.80989	0.4730	M	0.86268	2.805	0.48632	D	0.999688	D;D	0.76494	0.973;0.999	P;P	0.61592	0.606;0.891	T	0.82297	-0.0527	10	0.59425	D	0.04	.	20.206	0.98277	0.0:0.0:1.0:0.0	.	358;358	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	M	358	ENSP00000289269:V358M	ENSP00000289269:V358M	V	+	1	0	PCDHAC2	140327607	0.995000	0.38212	0.997000	0.53966	0.995000	0.86356	4.095000	0.57728	2.785000	0.95823	0.655000	0.94253	GTG	PCDHAC2	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000243232		0.562	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	HGNC	protein_coding	OTTHUMT00000251802.2	-	0.00	52	0	G	NM_018899		140347423	+1	tier1	-	no_errors	ENST00000289269	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	A
PCSK2	5126	genome.wustl.edu	37	20	17462531	17462531	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr20:17462531C>G	ENST00000262545.2	+	12	2048	c.1733C>G	c.(1732-1734)gCc>gGc	p.A578G	PCSK2_ENST00000459871.1_3'UTR|PCSK2_ENST00000536609.1_Missense_Mutation_p.A543G|PCSK2_ENST00000377899.1_Missense_Mutation_p.A559G	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	578					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	GTCGGCAGCGCCCCGCAGAAG	0.617																																																	0													34.0	35.0	35.0					20																	17462531		2203	4300	6503	SO:0001583	missense	0			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1733C>G	20.37:g.17462531C>G	ENSP00000262545:p.Ala578Gly		B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53_dom,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.A578G	ENST00000262545.2	37	c.1733	CCDS13125.1	20	.	.	.	.	.	.	.	.	.	.	C	8.342	0.828934	0.16749	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.76578	-1.03;-1.03;-1.03	5.63	5.63	0.86233	Proprotein convertase, P (1);Galactose-binding domain-like (1);	0.588945	0.20101	N	0.099225	T	0.52025	0.1709	N	0.02985	-0.445	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.33777	-0.9855	10	0.19590	T	0.45	-3.3723	9.0959	0.36638	0.0:0.8448:0.0:0.1552	.	543;559;578	B4DFQ3;B1ANH9;P16519	.;.;NEC2_HUMAN	G	559;578;543	ENSP00000367131:A559G;ENSP00000262545:A578G;ENSP00000437458:A543G	ENSP00000262545:A578G	A	+	2	0	PCSK2	17410531	0.001000	0.12720	0.035000	0.18076	0.716000	0.41182	1.503000	0.35715	2.803000	0.96430	0.585000	0.79938	GCC	PCSK2	-	pfam_PrprotnconvertsP,superfamily_Galactose-bd-like	ENSG00000125851		0.617	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK2	HGNC	protein_coding	OTTHUMT00000078120.2	-	0.00	27	0	C	NM_002594		17462531	+1	tier1	-	no_errors	ENST00000262545	ensembl	human	known	74_37	missense	21.95	32	9	SNP	0.009	G
PDCD5	9141	genome.wustl.edu	37	19	33076747	33076747	+	Silent	SNP	T	T	C			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr19:33076747T>C	ENST00000590247.2	+	4	386	c.192T>C	c.(190-192)ccT>ccC	p.P64P	PDCD5_ENST00000592786.1_Intron|PDCD5_ENST00000419343.3_Silent_p.P64P|PDCD5_ENST00000379316.3_Intron|PDCD5_ENST00000586035.1_Silent_p.P26P	NM_004708.3	NP_004699.1	O14737	PDCD5_HUMAN	programmed cell death 5	64					apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|large_intestine(2)|lung(1)|ovary(1)	5	Esophageal squamous(110;0.137)					TTGTAAAGCCTGAAAAAACTA	0.313																																																	0													92.0	99.0	97.0					19																	33076747		2202	4300	6502	SO:0001819	synonymous_variant	0			AF014955	CCDS12423.1	19q13.11	2012-10-15			ENSG00000105185	ENSG00000105185			8764	protein-coding gene	gene with protein product	"""TFAR19 novel apoptosis-related"", ""TF1 cell apoptosis-related gene 19"""	604583				9920759	Standard	NM_004708		Approved	TFAR19, MGC9294	uc002ntm.3	O14737	OTTHUMG00000180224	ENST00000590247.2:c.192T>C	19.37:g.33076747T>C			B4DE64|Q53YC9|Q6IB70	Silent	SNP	pfam_PDCD5-related,superfamily_PDCD5-related,pirsf_PDCD5-related	p.P64	ENST00000590247.2	37	c.192	CCDS12423.1	19																																																																																			PDCD5	-	pfam_PDCD5-related,superfamily_PDCD5-related,pirsf_PDCD5-related	ENSG00000105185		0.313	PDCD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCD5	HGNC	protein_coding	OTTHUMT00000450320.2	-	0.00	32	0	T	NM_004708		33076747	+1	tier1	-	no_errors	ENST00000590247	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.977	C
PDDC1	347862	genome.wustl.edu	37	11	771164	771164	+	Intron	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr11:771164G>T	ENST00000319863.8	-	7	566				PDDC1_ENST00000526325.1_Intron|PDDC1_ENST00000529966.1_5'UTR|PDDC1_ENST00000442059.2_Intron|PDDC1_ENST00000397472.2_Intron|PDDC1_ENST00000524550.1_Intron	NM_182612.2	NP_872418.1	Q8NB37	PDDC1_HUMAN	Parkinson disease 7 domain containing 1							extracellular vesicular exosome (GO:0070062)				kidney(1)|lung(3)|urinary_tract(1)	5		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;3.66e-26)|Epithelial(43;2.43e-25)|OV - Ovarian serous cystadenocarcinoma(40;1.33e-19)|BRCA - Breast invasive adenocarcinoma(625;4.29e-05)|Lung(200;0.0582)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGAGAGCCTCGAACTCCAGGC	0.647																																																	0																																										SO:0001627	intron_variant	0			AK128653	CCDS7713.1	11p15.5	2005-10-26			ENSG00000177225	ENSG00000177225			26616	protein-coding gene	gene with protein product							Standard	XM_005252898		Approved	FLJ34283	uc001lrc.3	Q8NB37	OTTHUMG00000133315	ENST00000319863.8:c.545-60C>A	11.37:g.771164G>T			B7ZKW5|Q2NL76|Q6ZQY0|Q8NAE0	RNA	SNP	-	NULL	ENST00000319863.8	37	NULL	CCDS7713.1	11																																																																																			PDDC1	-	-	ENSG00000177225		0.647	PDDC1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PDDC1	HGNC	protein_coding	OTTHUMT00000258051.2	-	0.00	65	0	G	NM_182612		771164	-1	tier1	-	no_errors	ENST00000529966	ensembl	human	known	74_37	rna	7.55	49	4	SNP	0.000	T
PDXK	8566	genome.wustl.edu	37	21	45175962	45175962	+	3'UTR	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr21:45175962C>T	ENST00000291565.4	+	0	1140				PDXK_ENST00000467908.1_3'UTR|PDXK_ENST00000468090.1_3'UTR	NM_003681.4	NP_003672.1	O00764	PDXK_HUMAN	pyridoxal (pyridoxine, vitamin B6) kinase						cell proliferation (GO:0008283)|pyridoxal 5'-phosphate salvage (GO:0009443)|pyridoxal phosphate biosynthetic process (GO:0042823)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|lithium ion binding (GO:0031403)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|protein homodimerization activity (GO:0042803)|pyridoxal kinase activity (GO:0008478)|pyridoxal phosphate binding (GO:0030170)|sodium ion binding (GO:0031402)|zinc ion binding (GO:0008270)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5				Colorectal(79;0.109)|READ - Rectum adenocarcinoma(84;0.161)|STAD - Stomach adenocarcinoma(101;0.18)	Pyridoxal(DB00147)|Pyridoxine(DB00165)	GCCGCTTGCCCGTGACACGCA	0.562																																																	0													25.0	22.0	23.0					21																	45175962		2200	4296	6496	SO:0001624	3_prime_UTR_variant	0			U89606	CCDS13699.1	21q22.3	2007-05-10			ENSG00000160209	ENSG00000160209	2.7.1.35		8819	protein-coding gene	gene with protein product		179020	"""chromosome 21 open reading frame 97"", ""chromosome 21 open reading frame 124"""	C21orf97, C21orf124		9099727	Standard	NM_003681		Approved	PNK, PKH, FLJ21324, PRED79, FLJ31940, MGC15873	uc002zdm.4	O00764	OTTHUMG00000086870	ENST00000291565.4:c.*18C>T	21.37:g.45175962C>T			Q7Z2Y0|Q9BS02	RNA	SNP	-	NULL	ENST00000291565.4	37	NULL	CCDS13699.1	21																																																																																			PDXK	-	-	ENSG00000160209		0.562	PDXK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDXK	HGNC	protein_coding	OTTHUMT00000195636.1	-	0.00	70	0	C	NM_003681		45175962	+1	tier1	-	no_errors	ENST00000343528	ensembl	human	known	74_37	rna	16.67	40	8	SNP	0.000	T
PHF12	57649	genome.wustl.edu	37	17	27233372	27233372	+	Missense_Mutation	SNP	G	G	T	rs372498852		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr17:27233372G>T	ENST00000332830.4	-	15	3654	c.2844C>A	c.(2842-2844)caC>caA	p.H948Q	PHF12_ENST00000577226.1_3'UTR	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			AGCTGCCATGGTGCAGTAAGG	0.617																																																	0													53.0	55.0	54.0					17																	27233372		2203	4300	6503	SO:0001583	missense	0			AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.2844C>A	17.37:g.27233372G>T	ENSP00000329933:p.His948Gln			Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_SMAD_FHA_domain,smart_Znf_PHD,pfscan_FHA_dom,pfscan_Znf_PHD-finger	p.H948Q	ENST00000332830.4	37	c.2844	CCDS32598.1	17	.	.	.	.	.	.	.	.	.	.	g	15.41	2.826444	0.50739	.	.	ENSG00000109118	ENST00000332830	D	0.94793	-3.52	4.64	3.67	0.42095	.	0.000000	0.85682	D	0.000000	D	0.95872	0.8656	L	0.59436	1.845	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.72982	0.979;0.979	D	0.95826	0.8854	10	0.87932	D	0	-12.1602	11.8103	0.52179	0.0864:0.0:0.9136:0.0	.	930;948	B4DFE2;Q96QT6	.;PHF12_HUMAN	Q	948	ENSP00000329933:H948Q	ENSP00000329933:H948Q	H	-	3	2	PHF12	24257498	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.763000	0.62257	1.330000	0.45394	0.651000	0.88453	CAC	PHF12	-	NULL	ENSG00000109118		0.617	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF12	HGNC	protein_coding	OTTHUMT00000255941.1	-	0.00	26	0	G	NM_020889		27233372	-1	tier1	-	no_errors	ENST00000332830	ensembl	human	known	74_37	missense	21.62	29	8	SNP	1.000	T
PHRF1	57661	genome.wustl.edu	37	11	597555	597555	+	Silent	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr11:597555G>A	ENST00000264555.5	+	8	1007	c.879G>A	c.(877-879)acG>acA	p.T293T	PHRF1_ENST00000413872.2_Silent_p.T292T|PHRF1_ENST00000533464.1_Silent_p.T289T|PHRF1_ENST00000416188.2_Silent_p.T293T	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	293	Arg-rich.				mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						GGATCTCCACGGCCAGGAGGG	0.672																																																	0																																										SO:0001819	synonymous_variant	0			BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.879G>A	11.37:g.597555G>A			A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Silent	SNP	pfam_Znf_PHD-finger,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.T293	ENST00000264555.5	37	c.879		11																																																																																			PHRF1	-	NULL	ENSG00000070047		0.672	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHRF1	HGNC	protein_coding	OTTHUMT00000382133.1		0.00	37	0	G	NM_020901		597555	+1			no_errors	ENST00000264555	ensembl	human	known	74_37	silent	30.00	14	6	SNP	0.013	A
PIGQ	9091	genome.wustl.edu	37	16	630954	630954	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr16:630954C>T	ENST00000026218.5	+	9	1601	c.1513C>T	c.(1513-1515)Cgg>Tgg	p.R505W	PIGQ_ENST00000409527.2_Missense_Mutation_p.R505W|PIGQ_ENST00000321878.5_Missense_Mutation_p.R505W	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	505	Leu-rich.				C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				TCGGCTCTGCCGGCCCTACAG	0.647																																																	0													101.0	96.0	97.0					16																	630954		2201	4300	6501	SO:0001583	missense	0			AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.1513C>T	16.37:g.630954C>T	ENSP00000026218:p.Arg505Trp		A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	pfam_GlcNAc_Gpi1	p.R505W	ENST00000026218.5	37	c.1513	CCDS10411.1	16	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659805	0.67586	.	.	ENSG00000007541	ENST00000409527;ENST00000321878;ENST00000026218;ENST00000540241	T;T;T	0.49139	0.79;0.79;2.07	5.22	4.18	0.49190	.	0.109609	0.56097	D	0.000021	T	0.55273	0.1910	L	0.32530	0.975	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73708	0.974;0.974;0.981	T	0.58306	-0.7659	10	0.87932	D	0	-54.425	12.0576	0.53544	0.2231:0.7769:0.0:0.0	.	519;505;505	E7ERP4;Q9BRB3;Q9BRB3-2	.;PIGQ_HUMAN;.	W	505;505;505;63	ENSP00000386760:R505W;ENSP00000326674:R505W;ENSP00000026218:R505W	ENSP00000026218:R505W	R	+	1	2	PIGQ	570955	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	0.885000	0.28227	2.443000	0.82685	0.511000	0.50034	CGG	PIGQ	-	NULL	ENSG00000007541		0.647	PIGQ-002	KNOWN	basic|CCDS	protein_coding	PIGQ	HGNC	protein_coding	OTTHUMT00000239270.2		0.00	69	0	C	NM_004204		630954	+1			no_errors	ENST00000026218	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
PIK3R1	5295	genome.wustl.edu	37	5	67589537	67589537	+	Splice_Site	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr5:67589537G>A	ENST00000521381.1	+	11	1916	c.1300G>A	c.(1300-1302)Gat>Aat	p.D434N	PIK3R1_ENST00000396611.1_Splice_Site_p.D434N|PIK3R1_ENST00000521657.1_Splice_Site_p.D434N|PIK3R1_ENST00000274335.5_Splice_Site_p.D434N|PIK3R1_ENST00000523872.1_Splice_Site_p.D71N|PIK3R1_ENST00000320694.8_Splice_Site_p.D134N|PIK3R1_ENST00000336483.5_Splice_Site_p.D164N	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	434					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	ATCTTTCTAGGATCAAGTTGT	0.249			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																														Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)											35.0	39.0	38.0					5																	67589537		2171	4259	6430	SO:0001630	splice_region_variant	0			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1300-1G>A	5.37:g.67589537G>A			B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	pfam_SH2,pfam_RhoGAP_dom,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Guanylate-bd_C,smart_SH3_domain,smart_RhoGAP_dom,smart_SH2,pfscan_SH2,pfscan_SH3_domain,pfscan_RhoGAP_dom,prints_PI3kinase_P85,prints_SH2	p.D434N	ENST00000521381.1	37	c.1300	CCDS3993.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.202142	0.94997	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000320694;ENST00000521409;ENST00000336483;ENST00000519025;ENST00000523872	T;T;T;T;D;T;D;T;D	0.82619	-0.47;-0.47;-0.35;-0.47;-1.5;0.83;-1.51;0.42;-1.63	4.93	4.93	0.64822	SH2 motif (1);	0.000000	0.85682	D	0.000000	D	0.86360	0.5914	M	0.83953	2.67	0.80722	D	1	B;B;P;P	0.45396	0.219;0.12;0.634;0.857	B;B;B;B	0.43867	0.049;0.109;0.293;0.434	D	0.87593	0.2492	9	.	.	.	-28.1097	18.7067	0.91641	0.0:0.0:1.0:0.0	.	104;164;134;434	B7Z2N8;P27986-2;P27986-3;P27986	.;.;.;P85A_HUMAN	N	434;434;434;434;134;71;164;107;71	ENSP00000428056:D434N;ENSP00000429277:D434N;ENSP00000379855:D434N;ENSP00000274335:D434N;ENSP00000323512:D134N;ENSP00000431058:D71N;ENSP00000338554:D164N;ENSP00000429156:D107N;ENSP00000430098:D71N	.	D	+	1	0	PIK3R1	67625293	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.208000	0.95075	2.718000	0.92993	0.650000	0.86243	GAT	PIK3R1	-	superfamily_Guanylate-bd_C,prints_PI3kinase_P85	ENSG00000145675		0.249	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R1	HGNC	protein_coding	OTTHUMT00000254013.2	-	0.00	31	0	G	NM_181504	Missense_Mutation	67589537	+1	tier1	-	no_errors	ENST00000396611	ensembl	human	known	74_37	missense	24.00	19	6	SNP	1.000	A
PODNL1	79883	genome.wustl.edu	37	19	14044768	14044768	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr19:14044768G>T	ENST00000339560.5	-	7	984	c.711C>A	c.(709-711)agC>agA	p.S237R	PODNL1_ENST00000254320.3_Missense_Mutation_p.S155R|PODNL1_ENST00000538371.2_Missense_Mutation_p.S235R|PODNL1_ENST00000538517.2_Missense_Mutation_p.S146R	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	237	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			GAGTCTGGCGGCTCAGGGCTC	0.592																																																	0													45.0	44.0	45.0					19																	14044768		2203	4300	6503	SO:0001583	missense	0			AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.711C>A	19.37:g.14044768G>T	ENSP00000345175:p.Ser237Arg		B7Z564|Q9H5G9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S237R	ENST00000339560.5	37	c.711	CCDS12300.1	19	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843459	0.71488	.	.	ENSG00000132000	ENST00000538371;ENST00000538517;ENST00000339560;ENST00000545071;ENST00000254320	T;T;T;T	0.58210	0.35;0.35;0.35;0.35	4.59	3.53	0.40419	.	0.251342	0.27996	N	0.017009	T	0.51295	0.1666	N	0.13003	0.285	0.28924	N	0.891981	D;D;B;P	0.76494	0.998;0.999;0.364;0.645	D;D;B;P	0.77557	0.95;0.99;0.439;0.516	T	0.42515	-0.9447	10	0.35671	T	0.21	.	10.329	0.43812	0.0992:0.0:0.9008:0.0	.	235;155;146;237	F5H7F9;B7Z3M0;G3V1J6;Q6PEZ8	.;.;.;PONL1_HUMAN	R	235;146;237;87;155	ENSP00000442553:S235R;ENSP00000440080:S146R;ENSP00000345175:S237R;ENSP00000254320:S155R	ENSP00000254320:S155R	S	-	3	2	PODNL1	13905768	0.980000	0.34600	1.000000	0.80357	0.994000	0.84299	0.295000	0.19065	2.101000	0.63845	0.591000	0.81541	AGC	PODNL1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000132000		0.592	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	PODNL1	HGNC	protein_coding	OTTHUMT00000457967.1		0.00	61	0	G	NM_024825		14044768	-1			no_errors	ENST00000339560	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
PRNT	149830	genome.wustl.edu	37	20	4713189	4713189	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr20:4713189G>C	ENST00000326539.2	-	2	1071	c.134C>G	c.(133-135)aCa>aGa	p.T45R	PRNT_ENST00000418528.1_Missense_Mutation_p.T45R|PRNT_ENST00000423718.2_Missense_Mutation_p.T45R			Q86SH4	PRNT_HUMAN	prion protein (testis specific)	45						extracellular region (GO:0005576)				endometrium(2)|lung(5)	7						gggaagtgttgtgttagacat	0.463																																																	0													174.0	146.0	156.0					20																	4713189		2203	4300	6503	SO:0001583	missense	0			AL137296, AJ427539		20p13	2013-04-02			ENSG00000180259	ENSG00000180259			18046	other	unknown	"""M8 protein"""					12514748	Standard	NR_024267		Approved	M8	uc010zqq.2	Q86SH4	OTTHUMG00000031785	ENST00000326539.2:c.134C>G	20.37:g.4713189G>C	ENSP00000321242:p.Thr45Arg		B2RPD9|B7ZBI9	Missense_Mutation	SNP	NULL	p.T45R	ENST00000326539.2	37	c.134		20	.	.	.	.	.	.	.	.	.	.	G	7.114	0.576653	0.13686	.	.	ENSG00000180259	ENST00000418528;ENST00000326539;ENST00000423718	T;T;T	0.52754	0.65;0.65;0.65	1.92	-1.4	0.08968	.	.	.	.	.	T	0.39600	0.1084	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.39583	-0.9607	6	0.51188	T	0.08	.	5.0876	0.14691	0.5373:0.0:0.4627:0.0	.	.	.	.	R	45	ENSP00000409280:T45R;ENSP00000321242:T45R;ENSP00000404306:T45R	ENSP00000321242:T45R	T	-	2	0	PRNT	4661189	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.374000	0.07484	-0.363000	0.08101	0.514000	0.50259	ACA	PRNT	-	NULL	ENSG00000180259		0.463	PRNT-002	KNOWN	basic|appris_principal	protein_coding	PRNT	HGNC	protein_coding	OTTHUMT00000253006.2	-	0.00	89	0	G	NM_177549		4713189	-1	tier1	-	no_errors	ENST00000326539	ensembl	human	known	74_37	missense	6.02	125	8	SNP	0.000	C
PSG3	5671	genome.wustl.edu	37	19	43228177	43228177	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr19:43228177G>T	ENST00000327495.5	-	6	1428	c.1244C>A	c.(1243-1245)gCt>gAt	p.A415D	PSG3_ENST00000595140.1_Intron	NM_021016.3	NP_066296.2	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	415					defense response (GO:0006952)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36		Prostate(69;0.00682)				TCCTGAAGGAGCTGTCATGGA	0.408																																																	0													111.0	104.0	106.0					19																	43228177		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS12611.1	19q13.2	2013-01-29			ENSG00000221826	ENSG00000221826		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9520	protein-coding gene	gene with protein product		176392				2341148	Standard	NM_021016		Approved		uc002oue.3	Q16557	OTTHUMG00000151120	ENST00000327495.5:c.1244-1C>A	19.37:g.43228177G>T			Q08265|Q9BRW2|Q9UPL4|Q9UQ77	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A415D	ENST00000327495.5	37	c.1244	CCDS12611.1	19	.	.	.	.	.	.	.	.	.	.	g	0.225	-1.025470	0.02061	.	.	ENSG00000221826	ENST00000327495	T	0.20738	2.05	0.738	0.738	0.18319	Immunoglobulin-like fold (1);	.	.	.	.	T	0.18087	0.0434	L	0.33189	0.99	0.09310	N	1	B	0.33135	0.399	B	0.43478	0.421	T	0.36768	-0.9734	8	0.10377	T	0.69	.	.	.	.	.	415	Q16557	PSG3_HUMAN	D	415	ENSP00000332215:A415D	ENSP00000332215:A415D	A	-	2	0	PSG3	47920017	0.030000	0.19436	0.205000	0.23548	0.057000	0.15508	-1.365000	0.02587	0.676000	0.31285	0.174000	0.16983	GCT	PSG3	-	NULL	ENSG00000221826		0.408	PSG3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	PSG3	HGNC	protein_coding	OTTHUMT00000321423.2	-	0.00	57	0	G	NM_021016	Missense_Mutation	43228177	-1	tier1	-	no_errors	ENST00000327495	ensembl	human	known	74_37	missense	34.04	31	16	SNP	0.296	T
PXDN	7837	genome.wustl.edu	37	2	1677547	1677547	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr2:1677547A>C	ENST00000252804.4	-	9	936	c.886T>G	c.(886-888)Ttg>Gtg	p.L296V	PXDN_ENST00000483018.1_5'UTR	NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	296	Ig-like C2-type 1.				extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		TCGTCCAGCAAGTTTAGGCGG	0.502																																																	0													135.0	136.0	136.0					2																	1677547		2054	4205	6259	SO:0001583	missense	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.886T>G	2.37:g.1677547A>C	ENSP00000252804:p.Leu296Val		A8QM65|D6W4Y0|Q4KMG2	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.L296V	ENST00000252804.4	37	c.886	CCDS46221.1	2	.	.	.	.	.	.	.	.	.	.	A	8.609	0.888714	0.17540	.	.	ENSG00000130508	ENST00000252804	T	0.63417	-0.04	5.25	-9.03	0.00737	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.171345	0.39985	N	0.001202	T	0.39145	0.1067	N	0.13272	0.32	0.31233	N	0.696117	B;B	0.27700	0.095;0.186	B;B	0.33121	0.101;0.158	T	0.10941	-1.0608	10	0.23302	T	0.38	-31.9694	16.6123	0.84886	0.3584:0.0:0.6416:0.0	.	296;296	Q92626-2;Q92626	.;PXDN_HUMAN	V	296	ENSP00000252804:L296V	ENSP00000252804:L296V	L	-	1	2	PXDN	1656554	0.997000	0.39634	0.176000	0.23000	0.194000	0.23727	0.322000	0.19576	-1.992000	0.00975	-0.441000	0.05720	TTG	PXDN	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000130508		0.502	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1	-	0.00	84	0	A	XM_056455		1677547	-1	tier1	-	no_errors	ENST00000252804	ensembl	human	known	74_37	missense	29.27	58	24	SNP	0.617	C
RAF1	5894	genome.wustl.edu	37	3	12632438	12632438	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr3:12632438C>T	ENST00000251849.4	-	12	1668	c.1229G>A	c.(1228-1230)gGg>gAg	p.G410E	RAF1_ENST00000542177.1_Missense_Mutation_p.G329E|RAF1_ENST00000534997.1_Missense_Mutation_p.G195E|RAF1_ENST00000442415.2_Missense_Mutation_p.G430E	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	410	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	TGTCATGTACCCCATGAAAAG	0.532			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																															Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	0													134.0	125.0	128.0					3																	12632438		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.1229G>A	3.37:g.12632438C>T	ENSP00000251849:p.Gly410Glu		B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd	p.G430E	ENST00000251849.4	37	c.1289	CCDS2612.1	3	.	.	.	.	.	.	.	.	.	.	C	29.5	5.015374	0.93404	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46	4.75	4.75	0.60458	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.93588	0.7953	M	0.63169	1.94	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94138	0.7394	10	0.87932	D	0	.	18.3009	0.90163	0.0:1.0:0.0:0.0	.	329;195;410	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	E	410;430;289;195;329	ENSP00000251849:G410E;ENSP00000401888:G430E;ENSP00000398591:G289E;ENSP00000441186:G195E;ENSP00000443567:G329E	ENSP00000251849:G410E	G	-	2	0	RAF1	12607438	1.000000	0.71417	0.981000	0.43875	0.998000	0.95712	7.604000	0.82830	2.617000	0.88574	0.563000	0.77884	GGG	RAF1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000132155		0.532	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAF1	HGNC	protein_coding	OTTHUMT00000252015.2		0.00	65	0	C	NM_002880		12632438	-1			no_errors	ENST00000442415	ensembl	human	known	74_37	missense	5.88	64	4	SNP	1.000	T
RAI14	26064	genome.wustl.edu	37	5	34823711	34823711	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr5:34823711G>T	ENST00000265109.3	+	15	2051	c.1764G>T	c.(1762-1764)gaG>gaT	p.E588D	RAI14_ENST00000515799.1_Missense_Mutation_p.E591D|RAI14_ENST00000506376.1_Missense_Mutation_p.E580D|RAI14_ENST00000503673.1_Missense_Mutation_p.E588D|RAI14_ENST00000512629.1_Missense_Mutation_p.E559D|RAI14_ENST00000428746.2_Missense_Mutation_p.E588D|RAI14_ENST00000397449.1_Missense_Mutation_p.E581D	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	588						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.E588D(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					CTGTTATTGAGAATATGAATA	0.363																																																	1	Substitution - Missense(1)	large_intestine(1)											57.0	61.0	60.0					5																	34823711		2203	4300	6503	SO:0001583	missense	0			AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.1764G>T	5.37:g.34823711G>T	ENSP00000265109:p.Glu588Asp		E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_t-SNARE,superfamily_UBA-like,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E591D	ENST00000265109.3	37	c.1773	CCDS34142.1	5	.	.	.	.	.	.	.	.	.	.	G	9.135	1.012477	0.19277	.	.	ENSG00000039560	ENST00000265109;ENST00000512629;ENST00000428746;ENST00000503673;ENST00000515799;ENST00000506376;ENST00000397449	T;T;T;T;T;T;T	0.38722	1.18;1.12;1.18;1.18;1.18;1.22;1.21	5.42	3.65	0.41850	.	.	.	.	.	T	0.25568	0.0622	N	0.20986	0.625	0.36213	D	0.851471	B;B;B;B	0.21606	0.037;0.058;0.02;0.058	B;B;B;B	0.21151	0.024;0.017;0.033;0.017	T	0.14144	-1.0483	9	0.35671	T	0.21	-24.4833	5.1721	0.15116	0.2298:0.0:0.6159:0.1543	.	580;559;591;588	Q9P0K7-3;E9PED3;Q9P0K7-2;Q9P0K7	.;.;.;RAI14_HUMAN	D	588;559;588;588;591;580;581	ENSP00000265109:E588D;ENSP00000422377:E559D;ENSP00000388725:E588D;ENSP00000422942:E588D;ENSP00000427123:E591D;ENSP00000423854:E580D;ENSP00000380591:E581D	ENSP00000265109:E588D	E	+	3	2	RAI14	34859468	1.000000	0.71417	0.998000	0.56505	0.947000	0.59692	2.821000	0.48065	0.681000	0.31386	0.555000	0.69702	GAG	RAI14	-	NULL	ENSG00000039560		0.363	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RAI14	HGNC	protein_coding	OTTHUMT00000366786.1		0.00	27	0	G	NM_015577		34823711	+1			no_errors	ENST00000515799	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
RNASEL	6041	genome.wustl.edu	37	1	182550476	182550476	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr1:182550476G>A	ENST00000367559.3	-	5	2042	c.1789C>T	c.(1789-1791)Cgg>Tgg	p.R597W	RNASEL_ENST00000444138.1_Missense_Mutation_p.R597W|RNASEL_ENST00000539397.1_Missense_Mutation_p.R597W	NM_021133.3	NP_066956.1	Q05823	RN5A_HUMAN	ribonuclease L (2',5'-oligoisoadenylate synthetase-dependent)	597	KEN. {ECO:0000255|PROSITE- ProRule:PRU00725}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|mRNA processing (GO:0006397)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA processing (GO:0006364)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)	ATP binding (GO:0005524)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(1)	27						CCCACATTCCGAAGCGTCCTA	0.408																																																	0													204.0	194.0	198.0					1																	182550476		2203	4300	6503	SO:0001583	missense	0			L10381	CCDS1347.1	1q25	2013-01-10			ENSG00000135828	ENSG00000135828	3.1.26.-	"""Ankyrin repeat domain containing"""	10050	protein-coding gene	gene with protein product		180435	"""prostate cancer 1"""	RNS4, PRCA1		7514564	Standard	NM_021133		Approved		uc009wxz.2	Q05823	OTTHUMG00000035213	ENST00000367559.3:c.1789C>T	1.37:g.182550476G>A	ENSP00000356530:p.Arg597Trp		Q5W0L2|Q6AI46	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KEN_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Ankyrin_rpt-contain_dom,superfamily_Kinase-like_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_PUG-dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ankyrin_rpt	p.R597W	ENST00000367559.3	37	c.1789	CCDS1347.1	1	.	.	.	.	.	.	.	.	.	.	G	16.35	3.099930	0.56183	.	.	ENSG00000135828	ENST00000367559;ENST00000444138;ENST00000539397	T;T;T	0.33865	1.39;1.39;1.39	5.4	-0.93	0.10441	KEN domain, ribonuclease activator (2);	0.221665	0.29444	N	0.012140	T	0.55194	0.1905	M	0.80982	2.52	0.09310	N	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.48422	-0.9037	10	0.87932	D	0	-19.9812	9.2098	0.37311	0.0:0.1117:0.4622:0.426	.	597;597	Q6AI46;Q05823	.;RN5A_HUMAN	W	597	ENSP00000356530:R597W;ENSP00000411147:R597W;ENSP00000440844:R597W	ENSP00000356530:R597W	R	-	1	2	RNASEL	180817099	0.001000	0.12720	0.035000	0.18076	0.918000	0.54935	0.049000	0.14099	-0.119000	0.11830	-0.188000	0.12872	CGG	RNASEL	-	pfam_KEN_dom	ENSG00000135828		0.408	RNASEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEL	HGNC	protein_coding	OTTHUMT00000085189.1	-	0.00	58	0	G	NM_021133		182550476	-1	tier1	-	no_errors	ENST00000367559	ensembl	human	known	74_37	missense	31.58	26	12	SNP	0.055	A
RPL41	6171	genome.wustl.edu	37	12	56510561	56510561	+	5'UTR	SNP	A	A	G			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr12:56510561A>G	ENST00000546591.1	+	0	192				RP11-603J24.6_ENST00000550840.1_RNA|RP11-603J24.17_ENST00000548595.1_RNA|RPL41_ENST00000501597.3_5'UTR|ZC3H10_ENST00000257940.2_5'Flank	NM_001035267.1	NP_001030344.1	P62945	RL41_HUMAN	ribosomal protein L41						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)							OV - Ovarian serous cystadenocarcinoma(18;0.12)			CCCTGTAGAAACCTCTGCGCC	0.522																																																	0													190.0	191.0	191.0					12																	56510561		2010	4189	6199	SO:0001623	5_prime_UTR_variant	0			AB007186	CCDS44919.1	12q13	2011-04-06			ENSG00000229117	ENSG00000229117		"""L ribosomal proteins"""	10354	protein-coding gene	gene with protein product		613315				1326959, 9582194	Standard	NM_021104		Approved	L41	uc001sjo.3	P62945		ENST00000546591.1:c.-11A>G	12.37:g.56510561A>G			A6NG21|P28751	RNA	SNP	-	NULL	ENST00000546591.1	37	NULL	CCDS44919.1	12																																																																																			RPL41	-	-	ENSG00000229117		0.522	RPL41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL41	HGNC	protein_coding	OTTHUMT00000407819.1	-	0.00	68	0	A			56510561	+1	tier1	-	no_errors	ENST00000358888	ensembl	human	known	74_37	rna	9.38	58	6	SNP	0.034	G
RPUSD2	27079	genome.wustl.edu	37	15	40861777	40861777	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr15:40861777C>G	ENST00000315616.7	+	1	279	c.241C>G	c.(241-243)Ccg>Gcg	p.P81A	RPUSD2_ENST00000559271.1_Missense_Mutation_p.P81A	NM_152260.1	NP_689473.1	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing 2	81					pseudouridine synthesis (GO:0001522)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			kidney(4)|lung(4)|skin(3)	11		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		GGAAGTGGAGCCGGCCCCAGT	0.726																																																	0													8.0	9.0	9.0					15																	40861777		2168	4256	6424	SO:0001583	missense	0			AK055971	CCDS10061.1, CCDS66737.1	15q13.3	2013-02-11	2005-01-31	2005-02-07	ENSG00000166133	ENSG00000166133		"""RNA pseudouridylate synthase domain containing"""	24180	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 19"""	C15orf19		12477932	Standard	NM_001286407		Approved	C18B11, FLJ31409	uc001zmd.1	Q8IZ73	OTTHUMG00000130031	ENST00000315616.7:c.241C>G	15.37:g.40861777C>G	ENSP00000323288:p.Pro81Ala		B4DDD1|Q7L989|Q92939|Q96IA7|Q96N50	Missense_Mutation	SNP	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_RluC/D	p.P81A	ENST00000315616.7	37	c.241	CCDS10061.1	15	.	.	.	.	.	.	.	.	.	.	C	13.50	2.254774	0.39896	.	.	ENSG00000166133	ENST00000315616;ENST00000417769	T	0.28454	1.61	5.17	1.17	0.20885	.	1.322360	0.04874	N	0.446477	T	0.23014	0.0556	L	0.40543	1.245	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.22941	-1.0202	10	0.12103	T	0.63	0.0404	5.4946	0.16795	0.0:0.6239:0.1441:0.232	.	81	Q8IZ73	RUSD2_HUMAN	A	81	ENSP00000323288:P81A	ENSP00000323288:P81A	P	+	1	0	RPUSD2	38649069	0.000000	0.05858	0.002000	0.10522	0.102000	0.19082	0.483000	0.22292	0.067000	0.16545	0.650000	0.86243	CCG	RPUSD2	-	NULL	ENSG00000166133		0.726	RPUSD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPUSD2	HGNC	protein_coding	OTTHUMT00000252308.2	-	0.00	25	0	C	NM_152260		40861777	+1	tier1	-	no_errors	ENST00000315616	ensembl	human	known	74_37	missense	19.05	34	8	SNP	0.003	G
SCFD1	23256	genome.wustl.edu	37	14	31107338	31107338	+	Missense_Mutation	SNP	G	G	T	rs561696273		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr14:31107338G>T	ENST00000458591.2	+	5	547	c.320G>T	c.(319-321)cGa>cTa	p.R107L	SCFD1_ENST00000421551.3_Missense_Mutation_p.R48L|SCFD1_ENST00000396629.2_Missense_Mutation_p.R15L|SCFD1_ENST00000541123.1_5'UTR|SCFD1_ENST00000544052.2_Missense_Mutation_p.R40L	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	107					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		TAGGATCTTCGAAATCAACTA	0.279																																																	0													26.0	28.0	27.0					14																	31107338		2201	4298	6499	SO:0001583	missense	0			AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.320G>T	14.37:g.31107338G>T	ENSP00000390783:p.Arg107Leu		A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.R107L	ENST00000458591.2	37	c.320	CCDS9639.1	14	.	.	.	.	.	.	.	.	.	.	G	20.2	3.943076	0.73672	.	.	ENSG00000092108	ENST00000458591;ENST00000544052;ENST00000421551;ENST00000557076;ENST00000396629	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.38878	0.1057	L	0.41236	1.265	0.80722	D	1	B;P;B	0.39131	0.096;0.661;0.262	B;B;B	0.42386	0.18;0.386;0.248	T	0.07693	-1.0759	10	0.41790	T	0.15	-16.5801	18.9372	0.92590	0.0:0.0:1.0:0.0	.	48;40;107	B7Z738;B7Z4U7;Q8WVM8	.;.;SCFD1_HUMAN	L	107;40;48;82;15	ENSP00000390783:R107L;ENSP00000443010:R40L;ENSP00000388078:R48L;ENSP00000450755:R82L;ENSP00000379870:R15L	ENSP00000309417:R115L	R	+	2	0	SCFD1	30177089	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.325000	0.96381	2.706000	0.92434	0.655000	0.94253	CGA	SCFD1	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000092108		0.279	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SCFD1	HGNC	protein_coding	OTTHUMT00000276612.3		0.00	65	0	G	NM_182835		31107338	+1			no_errors	ENST00000458591	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
SGSM2	9905	genome.wustl.edu	37	17	2266394	2266394	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr17:2266394G>A	ENST00000426855.2	+	6	813	c.638G>A	c.(637-639)cGc>cAc	p.R213H	SGSM2_ENST00000268989.3_Missense_Mutation_p.R213H|SGSM2_ENST00000574563.1_Missense_Mutation_p.R213H	NM_001098509.1	NP_001091979.1	O43147	SGSM2_HUMAN	small G protein signaling modulator 2	213					late endosome to Golgi transport (GO:0034499)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		CCACCTACTCGCCAGGACTCC	0.637																																																	0													31.0	30.0	30.0					17																	2266394		2203	4300	6503	SO:0001583	missense	0			BC039204	CCDS32526.1, CCDS45570.1	17p13.3	2013-07-10	2007-08-14	2007-08-14		ENSG00000141258		"""Small G protein signaling modulators"""	29026	protein-coding gene	gene with protein product		611418	"""RUN and TBC1 domain containing 1"""	RUTBC1		9455477, 17509819, 21808068	Standard	NM_014853		Approved	KIAA0397	uc002fum.4	O43147		ENST00000426855.2:c.638G>A	17.37:g.2266394G>A	ENSP00000415107:p.Arg213His		A5LGW2|B4DH69|Q49AC2|Q6ZUY2|Q8IXU4	Missense_Mutation	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.R213H	ENST00000426855.2	37	c.638	CCDS45570.1	17	.	.	.	.	.	.	.	.	.	.	G	17.19	3.325876	0.60743	.	.	ENSG00000141258	ENST00000268989;ENST00000426855	T;T	0.13089	2.62;2.62	5.97	4.98	0.66077	.	0.232047	0.52532	D	0.000067	T	0.35885	0.0947	M	0.62723	1.935	0.43000	D	0.99451	B;D;D	0.89917	0.242;1.0;1.0	B;D;D	0.87578	0.038;0.998;0.998	T	0.14364	-1.0475	10	0.62326	D	0.03	-16.3905	16.0904	0.81088	0.0:0.134:0.866:0.0	.	213;213;213	O43147-5;O43147;O43147-2	.;SGSM2_HUMAN;.	H	213	ENSP00000268989:R213H;ENSP00000415107:R213H	ENSP00000268989:R213H	R	+	2	0	SGSM2	2213144	1.000000	0.71417	0.612000	0.29024	0.014000	0.08584	7.935000	0.87658	1.476000	0.48215	0.655000	0.94253	CGC	SGSM2	-	NULL	ENSG00000141258		0.637	SGSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSM2	HGNC	protein_coding	OTTHUMT00000438186.1	-	0.00	55	0	G	NM_014853		2266394	+1	tier1	-	no_errors	ENST00000268989	ensembl	human	known	74_37	missense	50.00	11	11	SNP	0.988	A
SIPA1L2	57568	genome.wustl.edu	37	1	232650479	232650479	+	Silent	SNP	A	A	G			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr1:232650479A>G	ENST00000366630.1	-	2	965	c.607T>C	c.(607-609)Tta>Cta	p.L203L	SIPA1L2_ENST00000262861.4_Silent_p.L203L			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	203					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TCACCAGATAAGCCTTGCCTG	0.478																																																	0													128.0	125.0	126.0					1																	232650479		1905	4120	6025	SO:0001819	synonymous_variant	0			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.607T>C	1.37:g.232650479A>G			Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Silent	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.L203	ENST00000366630.1	37	c.607	CCDS41474.1	1																																																																																			SIPA1L2	-	NULL	ENSG00000116991		0.478	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1		0.00	21	0	A	XM_045839		232650479	-1			no_errors	ENST00000262861	ensembl	human	known	74_37	silent	15.00	17	3	SNP	0.233	G
SLC35G5	83650	genome.wustl.edu	37	8	11188922	11188922	+	Missense_Mutation	SNP	T	T	C	rs76944947	byFrequency	TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr8:11188922T>C	ENST00000382435.4	+	1	526	c.307T>C	c.(307-309)Tgg>Cgg	p.W103R		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	103	EamA 1.					integral component of membrane (GO:0016021)		p.W103R(1)									CATCCGAGGCTGGGCCTGCTT	0.602																																																	1	Substitution - Missense(1)	pancreas(1)											216.0	216.0	216.0					8																	11188922		2203	4300	6503	SO:0001583	missense	0			AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.307T>C	8.37:g.11188922T>C	ENSP00000371872:p.Trp103Arg		A2RRL6	Missense_Mutation	SNP	pfam_DMT	p.W103R	ENST00000382435.4	37	c.307	CCDS5980.1	8	.	.	.	.	.	.	.	.	.	.	t	0	-2.642709	0.00112	.	.	ENSG00000177710	ENST00000382435	T	0.69306	-0.39	0.34	-0.68	0.11346	.	0.244821	0.21560	N	0.072582	T	0.30665	0.0772	N	0.01168	-0.975	0.18873	N	0.999984	B	0.02656	0.0	B	0.01281	0.0	T	0.14062	-1.0486	10	0.23891	T	0.37	-0.4591	6.793	0.23709	0.0:0.7448:0.0:0.2552	.	103	Q96KT7	S35G5_HUMAN	R	103	ENSP00000371872:W103R	ENSP00000371872:W103R	W	+	1	0	SLC35G5	11226332	0.010000	0.17322	0.030000	0.17652	0.042000	0.13812	0.106000	0.15354	-2.178000	0.00768	-2.006000	0.00442	TGG	SLC35G5	-	pfam_DMT	ENSG00000177710		0.602	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G5	HGNC	protein_coding	OTTHUMT00000207313.2	-	0.00	96	0	T	NM_054028		11188922	+1	tier1	rs76944947	no_errors	ENST00000382435	ensembl	human	known	74_37	missense	7.78	83	7	SNP	0.984	C
SMAD1	4086	genome.wustl.edu	37	4	146435831	146435831	+	Silent	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr4:146435831G>A	ENST00000515385.1	+	2	608	c.66G>A	c.(64-66)caG>caA	p.Q22Q	SMAD1_ENST00000515527.1_3'UTR|RP11-301H24.4_ENST00000513542.1_RNA|SMAD1_ENST00000302085.4_Silent_p.Q22Q|SMAD1_ENST00000394092.2_Silent_p.Q22Q			Q15797	SMAD1_HUMAN	SMAD family member 1	22	MH1. {ECO:0000255|PROSITE- ProRule:PRU00438}.				BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cardiac muscle cell proliferation (GO:0060038)|cartilage development (GO:0051216)|cellular response to BMP stimulus (GO:0071773)|embryonic pattern specification (GO:0009880)|gamete generation (GO:0007276)|hindbrain development (GO:0030902)|homeostatic process (GO:0042592)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|mesodermal cell fate commitment (GO:0001710)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|negative regulation of muscle cell apoptotic process (GO:0010656)|osteoblast fate commitment (GO:0002051)|positive regulation of cartilage development (GO:0061036)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of gene expression (GO:0010628)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|primary miRNA processing (GO:0031053)|protein phosphorylation (GO:0006468)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|signal transduction (GO:0007165)|SMAD protein complex assembly (GO:0007183)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrion (GO:0005739)|nuclear inner membrane (GO:0005637)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	co-SMAD binding (GO:0070410)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			endometrium(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	17	all_hematologic(180;0.151)					GGTGGAAACAGGGCGATGAAG	0.413																																					Pancreas(182;1287 2092 10326 35158 50562)												0													97.0	91.0	93.0					4																	146435831		2203	4300	6503	SO:0001819	synonymous_variant	0			U59423	CCDS3765.1	4q31.21	2013-10-22	2006-11-06	2004-05-26	ENSG00000170365	ENSG00000170365		"""SMADs"""	6767	protein-coding gene	gene with protein product		601595	"""MAD, mothers against decapentaplegic homolog 1 (Drosophila)"", ""SMAD, mothers against DPP homolog 1 (Drosophila)"""	MADH1		8653785, 8673135	Standard	NM_005900		Approved	MADR1, JV4-1	uc003ikc.3	Q15797	OTTHUMG00000161592	ENST00000515385.1:c.66G>A	4.37:g.146435831G>A			A8KAJ0|D3DNZ9|Q16636|Q9UFT8	Silent	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.Q22	ENST00000515385.1	37	c.66	CCDS3765.1	4																																																																																			SMAD1	-	superfamily_MAD_homology_MH1,pfscan_MAD_homology_MH1	ENSG00000170365		0.413	SMAD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD1	HGNC	protein_coding	OTTHUMT00000365467.1	-	0.00	25	0	G	NM_005900		146435831	+1	tier1	-	no_errors	ENST00000302085	ensembl	human	known	74_37	silent	13.79	25	4	SNP	1.000	A
TAF4B	6875	genome.wustl.edu	37	18	23915142	23915142	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr18:23915142C>A	ENST00000269142.5	+	13	3261	c.2263C>A	c.(2263-2265)Cgt>Agt	p.R755S	TAF4B_ENST00000578121.1_Missense_Mutation_p.R760S	NM_005640.1	NP_005631.1	Q92750	TAF4B_HUMAN	TAF4b RNA polymerase II, TATA box binding protein (TBP)-associated factor, 105kDa	755					gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|NF-kappaB binding (GO:0051059)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|prostate(1)|skin(1)	29	all_cancers(21;0.00151)|Lung NSC(5;0.000401)|all_lung(6;0.00115)|Ovarian(20;0.124)		Epithelial(2;9.57e-07)|all cancers(3;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(3;1.96e-05)|LUSC - Lung squamous cell carcinoma(2;0.00594)|Lung(2;0.0267)			TTGATAGAGTCGTTCTAATAA	0.328																																																	0													77.0	72.0	73.0					18																	23915142		1816	4081	5897	SO:0001583	missense	0			Y09321	CCDS42421.1	18q11.1	2008-08-01	2002-08-29	2001-12-07		ENSG00000141384			11538	protein-coding gene	gene with protein product	"""TATA box binding protein (TBP)-associated factor 4B"""	601689	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C2, 105kD"""	TAF2C2		8858156, 10849440	Standard	XM_005258339		Approved	TAFII105	uc002kvu.4	Q92750		ENST00000269142.5:c.2263C>A	18.37:g.23915142C>A	ENSP00000269142:p.Arg755Ser		Q29YA4|Q29YA5	Missense_Mutation	SNP	pfam_TAF4,pfam_TAFH_NHR1,superfamily_Histone-fold,smart_TAFH_NHR1,pfscan_TAFH_NHR1	p.R755S	ENST00000269142.5	37	c.2263	CCDS42421.1	18	.	.	.	.	.	.	.	.	.	.	C	9.053	0.992558	0.18966	.	.	ENSG00000141384	ENST00000418698;ENST00000269142	T	0.38722	1.12	5.64	5.64	0.86602	Transcription initiation factor TFIID component TAF4 (1);	0.000000	0.85682	D	0.000000	T	0.70979	0.3286	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.72984	-0.4125	10	0.46703	T	0.11	-5.9134	19.7012	0.96054	0.0:1.0:0.0:0.0	.	755;760	Q92750;A4PBF7	TAF4B_HUMAN;.	S	758;755	ENSP00000269142:R755S	ENSP00000269142:R755S	R	+	1	0	TAF4B	22169140	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	4.796000	0.62496	2.637000	0.89404	0.563000	0.77884	CGT	TAF4B	-	pfam_TAF4	ENSG00000141384		0.328	TAF4B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF4B	HGNC	protein_coding	OTTHUMT00000446260.3		0.00	51	0	C	NM_005640		23915142	+1			no_errors	ENST00000269142	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
TGM4	7047	genome.wustl.edu	37	3	44955211	44955211	+	Silent	SNP	C	C	G	rs79609954	byFrequency	TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr3:44955211C>G	ENST00000296125.4	+	14	2117	c.2049C>G	c.(2047-2049)acC>acG	p.T683T		NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	683					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	TTCTCATCACCAAGTAGCCTT	0.368											OREG0015520	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													131.0	132.0	132.0					3																	44955211		2203	4300	6503	SO:0001819	synonymous_variant	0			BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.2049C>G	3.37:g.44955211C>G		927	Q16707|Q96QN4	Silent	SNP	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.T683	ENST00000296125.4	37	c.2049	CCDS2723.1	3																																																																																			TGM4	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C	ENSG00000163810		0.368	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM4	HGNC	protein_coding	OTTHUMT00000256755.2	-	0.00	58	0	C	NM_003241		44955211	+1	tier1	-	no_errors	ENST00000296125	ensembl	human	known	74_37	silent	10.26	35	4	SNP	0.605	G
THOC7	80145	genome.wustl.edu	37	3	63823667	63823667	+	Silent	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr3:63823667G>T	ENST00000295899.5	-	4	449	c.337C>A	c.(337-339)Cga>Aga	p.R113R	THOC7_ENST00000498422.1_5'UTR|C3orf49_ENST00000295896.8_Intron	NM_025075.2	NP_079351.2	Q6I9Y2	THOC7_HUMAN	THO complex 7 homolog (Drosophila)	113	Interaction with NIF3L1.|Interaction with THOC5.				mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			central_nervous_system(1)|large_intestine(1)|ovary(1)|pancreas(1)	4				BRCA - Breast invasive adenocarcinoma(55;0.000439)|Kidney(15;0.00194)|KIRC - Kidney renal clear cell carcinoma(15;0.00218)		CGATTTTTTCGTATTCGTTTT	0.328																																					Colon(48;665 1127 6720 18651)												0													173.0	160.0	164.0					3																	63823667		2203	4299	6502	SO:0001819	synonymous_variant	0			BC020599	CCDS2900.1, CCDS74957.1	3p14.1	2013-02-11			ENSG00000163634	ENSG00000163634		"""THO complex subunits"""	29874	protein-coding gene	gene with protein product	"""Ngg1 interacting factor 3 like 1 binding protein 1"", ""functional spliceosome-associated protein 24"""	611965				12951069	Standard	NM_001285404		Approved	NIF3L1BP1, FLJ23445, fSAP24	uc003dlt.4	Q6I9Y2	OTTHUMG00000158767	ENST00000295899.5:c.337C>A	3.37:g.63823667G>T			Q6P1L3|Q8WUF2|Q9H5H0	Silent	SNP	pfam_THOC7/Mft1	p.R113	ENST00000295899.5	37	c.337	CCDS2900.1	3																																																																																			THOC7	-	pfam_THOC7/Mft1	ENSG00000163634		0.328	THOC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC7	HGNC	protein_coding	OTTHUMT00000352096.1	-	0.00	58	0	G	NM_025075		63823667	-1	tier1	-	no_errors	ENST00000295899	ensembl	human	known	74_37	silent	34.48	19	10	SNP	1.000	T
TMEM132D	121256	genome.wustl.edu	37	12	129569270	129569270	+	Intron	SNP	A	A	G			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr12:129569270A>G	ENST00000422113.2	-	6	1770				TMEM132D_ENST00000389441.4_Missense_Mutation_p.L12P	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D						negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GAGAGAGAAAAGGGGAGGGAA	0.517																																																	0													58.0	51.0	53.0					12																	129569270		2203	4300	6503	SO:0001627	intron_variant	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1444-23T>C	12.37:g.129569270A>G			Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.L12P	ENST00000422113.2	37	c.35	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	a	3.884	-0.025332	0.07589	.	.	ENSG00000151952	ENST00000389441	T	0.11495	2.77	3.02	-6.05	0.02172	.	.	.	.	.	T	0.04452	0.0122	.	.	.	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.35798	-0.9774	7	.	.	.	.	1.0966	0.01675	0.3397:0.0983:0.1732:0.3889	.	12	Q14C87-2	.	P	12	ENSP00000374092:L12P	.	L	-	2	0	TMEM132D	128135223	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.899000	0.04101	-2.942000	0.00296	-2.147000	0.00335	CTT	TMEM132D	-	NULL	ENSG00000151952		0.517	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	-	0.00	48	0	A	NM_133448		129569270	-1	tier1	-	no_errors	ENST00000389441	ensembl	human	known	74_37	missense	9.76	36	4	SNP	0.000	G
TMEM239	100288797	genome.wustl.edu	37	20	2797573	2797573	+	Silent	SNP	C	C	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr20:2797573C>T	ENST00000361033.1	+	2	535	c.502C>T	c.(502-504)Ctg>Ttg	p.L168L	TMEM239_ENST00000380585.1_Silent_p.L125L|TMEM239_ENST00000380593.4_Missense_Mutation_p.P215L|TMEM239_ENST00000554164.1_Missense_Mutation_p.P215L			Q8WW34	TM239_HUMAN	transmembrane protein 239	168	Leu-rich.					integral component of membrane (GO:0016021)											GGCCTCCTTCCTGCTGCTCTT	0.622																																																	0													118.0	97.0	103.0					20																	2797573		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS54444.1	20p13	2012-10-08				ENSG00000198326			40044	protein-coding gene	gene with protein product							Standard	NM_001167670		Approved		uc002wgx.2	Q8WW34	OTTHUMG00000031713	ENST00000361033.1:c.502C>T	20.37:g.2797573C>T			Q5JY54|Q6ZU23	Missense_Mutation	SNP	NULL	p.P215L	ENST00000361033.1	37	c.644		20	.	.	.	.	.	.	.	.	.	.	C	21.6	4.170301	0.78452	.	.	ENSG00000198326;ENSG00000241690	ENST00000554164;ENST00000380593	.	.	.	4.64	4.64	0.57946	.	1.121610	0.06917	N	0.808772	T	0.80358	0.4608	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72462	-0.4286	8	0.87932	D	0	-0.271	12.8724	0.57972	0.0:1.0:0.0:0.0	.	215	Q6ZPB1	.	L	215	.	ENSP00000369967:P215L	P	+	2	0	C20orf141;RP5-860F19.6	2745573	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.937000	0.40193	2.410000	0.81850	0.655000	0.94253	CCT	TMEM239	-	NULL	ENSG00000198326		0.622	TMEM239-002	PUTATIVE	basic	protein_coding	TMEM239	HGNC	protein_coding	OTTHUMT00000367615.2	-	0.00	51	0	C			2797573	+1	tier1	-	no_errors	ENST00000554164	ensembl	human	known	74_37	missense	13.21	45	7	SNP	1.000	T
TMEM30C	644444	genome.wustl.edu	37	3	99904605	99904605	+	Silent	SNP	C	C	T	rs35789954	byFrequency	TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr3:99904605C>T	ENST00000429523.2	+	1	75	c.75C>T	c.(73-75)atC>atT	p.I25I				A0ZSE6	CC50C_HUMAN	transmembrane protein 30C	25						integral component of membrane (GO:0016021)											AGTTACCCATCCACCGGCTAT	0.498																																																	0																																										SO:0001819	synonymous_variant	0					3q12.1	2013-01-16			ENSG00000235156	ENSG00000235156			30443	other	unknown		611030				15375526	Standard	NR_028357		Approved	CDC50C	uc003dtr.2	A0ZSE6	OTTHUMG00000159056	ENST00000429523.2:c.75C>T	3.37:g.99904605C>T				Silent	SNP	NULL	p.I25	ENST00000429523.2	37	c.75		3																																																																																			TMEM30C	-	NULL	ENSG00000235156		0.498	TMEM30C-201	KNOWN	basic|appris_principal	protein_coding	TMEM30C	HGNC	protein_coding		-	0.00	49	0	C	NR_028357		99904605	+1	tier1	-	no_errors	ENST00000429523	ensembl	human	known	74_37	silent	26.67	33	12	SNP	0.006	T
TMPRSS15	5651	genome.wustl.edu	37	21	19685373	19685373	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr21:19685373G>T	ENST00000284885.3	-	18	2087	c.2054C>A	c.(2053-2055)aCg>aAg	p.T685K		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	685	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						ATTGTTGTTCGTtgtgccatt	0.443																																																	0													130.0	114.0	120.0					21																	19685373		2203	4300	6503	SO:0001583	missense	0				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2054C>A	21.37:g.19685373G>T	ENSP00000284885:p.Thr685Lys		Q2NKL7	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_MAM_dom,pfam_SEA_dom,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_SRCR,superfamily_Trypsin-like_Pept_dom,superfamily_ConA-like_lec_gl_sf,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA_dom,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt	p.T685K	ENST00000284885.3	37	c.2054	CCDS13571.1	21	.	.	.	.	.	.	.	.	.	.	g	0	-2.734431	0.00089	.	.	ENSG00000154646	ENST00000284885	T	0.28666	1.6	5.71	-11.4	0.00090	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.755870	0.02854	N	0.129460	T	0.17746	0.0426	L	0.40543	1.245	0.09310	N	1	B	0.29212	0.237	B	0.28232	0.087	T	0.07366	-1.0776	9	.	.	.	.	2.6936	0.05127	0.5408:0.1996:0.0686:0.191	.	685	P98073	ENTK_HUMAN	K	685	ENSP00000284885:T685K	.	T	-	2	0	TMPRSS15	18607244	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-3.937000	0.00330	-4.286000	0.00059	-2.029000	0.00425	ACG	TMPRSS15	-	pfam_SRCR,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000154646		0.443	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	HGNC	protein_coding	OTTHUMT00000158231.2		0.00	44	0	G	NM_002772		19685373	-1			no_errors	ENST00000284885	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.000	T
TP53	7157	genome.wustl.edu	37	17	7577545	7577545	+	Missense_Mutation	SNP	T	T	C	rs483352695|rs397516437		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr17:7577545T>C	ENST00000269305.4	-	7	925	c.736A>G	c.(736-738)Atg>Gtg	p.M246V	TP53_ENST00000413465.2_Missense_Mutation_p.M246V|TP53_ENST00000445888.2_Missense_Mutation_p.M246V|TP53_ENST00000420246.2_Missense_Mutation_p.M246V|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.M246V|TP53_ENST00000455263.2_Missense_Mutation_p.M246V	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	246	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		M -> I (in sporadic cancers; somatic mutation).|M -> K (in sporadic cancers; somatic mutation).|M -> L (in sporadic cancers; somatic mutation).|M -> R (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.M246V(34)|p.0?(8)|p.?(5)|p.M246L(3)|p.G244_M246>V(3)|p.M246fs*1(2)|p.M153V(2)|p.M246_P250delMNRRP(2)|p.G151_M153>V(1)|p.G244fs*17(1)|p.C242fs*98(1)|p.G245fs*17(1)|p.C242_M246>L(1)|p.C238_M246delCNSSCMGGM(1)|p.G245fs*14(1)|p.G245fs*16(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTCCGGTTCATGCCGCCCATG	0.577		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	67	Substitution - Missense(39)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(5)|Unknown(5)|Deletion - In frame(3)	liver(8)|haematopoietic_and_lymphoid_tissue(7)|large_intestine(6)|biliary_tract(6)|lung(6)|ovary(6)|breast(5)|stomach(4)|bone(4)|upper_aerodigestive_tract(3)|urinary_tract(3)|oesophagus(3)|soft_tissue(2)|central_nervous_system(2)|pancreas(2)	GRCh37	CM942294	TP53	M							152.0	113.0	126.0					17																	7577545		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.736A>G	17.37:g.7577545T>C	ENSP00000269305:p.Met246Val		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.M246V	ENST00000269305.4	37	c.736	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	20.2	3.945888	0.73672	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99784	-6.74;-6.74;-6.74;-6.74;-6.74;-6.74;-6.74;-6.74	4.62	3.54	0.40534	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99684	0.9881	M	0.87971	2.92	0.53005	D	0.999962	D;P;P;D;P;D	0.76494	0.993;0.889;0.832;0.994;0.931;0.999	D;P;B;D;D;D	0.80764	0.972;0.545;0.403;0.984;0.947;0.994	D	0.98572	1.0646	10	0.87932	D	0	-28.5667	8.419	0.32690	0.0:0.0941:0.0:0.9059	.	246;246;153;246;246;246	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	V	246;246;246;246;246;246;235;153;114;153	ENSP00000410739:M246V;ENSP00000352610:M246V;ENSP00000269305:M246V;ENSP00000398846:M246V;ENSP00000391127:M246V;ENSP00000391478:M246V;ENSP00000425104:M114V;ENSP00000423862:M153V	ENSP00000269305:M246V	M	-	1	0	TP53	7518270	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.824000	0.86668	0.914000	0.36822	0.379000	0.24179	ATG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	271	0	T	NM_000546		7577545	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	48.56	107	101	SNP	1.000	C
TREML1	340205	genome.wustl.edu	37	6	41119038	41119038	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr6:41119038G>T	ENST00000426005.2	-	3	504	c.461C>A	c.(460-462)cCc>cAc	p.P154H	TREML1_ENST00000437044.2_Missense_Mutation_p.P43H|TREML1_ENST00000373127.4_Missense_Mutation_p.P154H	NM_178174.2	NP_835468.1	Q86YW5	TRML1_HUMAN	triggering receptor expressed on myeloid cells-like 1	154					calcium-mediated signaling (GO:0019722)|innate immune response (GO:0045087)|platelet activation (GO:0030168)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)				breast(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	13	Ovarian(28;0.0418)|Colorectal(47;0.196)					ATCCTGGCTGGGTTCCAAAGG	0.517																																																	0													133.0	123.0	126.0					6																	41119038		2203	4300	6503	SO:0001583	missense	0			AF534822	CCDS4851.1, CCDS64420.1, CCDS64421.1	6p21.1	2013-01-11			ENSG00000161911	ENSG00000161911		"""Immunoglobulin superfamily / V-set domain containing"""	20434	protein-coding gene	gene with protein product	"""TREM-like transcript 1"""	609714				12393607, 12645956	Standard	NM_178174		Approved	TLT1, dJ238O23.3	uc011duc.3	Q86YW5	OTTHUMG00000016231	ENST00000426005.2:c.461C>A	6.37:g.41119038G>T	ENSP00000402855:p.Pro154His		Q496B3|Q8IWY1|Q8IWY2	Missense_Mutation	SNP	pfam_Ig_V-set	p.P154H	ENST00000426005.2	37	c.461	CCDS4851.1	6	.	.	.	.	.	.	.	.	.	.	G	16.02	3.005162	0.54254	.	.	ENSG00000161911	ENST00000373127;ENST00000437044;ENST00000426005	T;T;T	0.52295	1.58;0.67;1.68	4.75	3.69	0.42338	.	0.510486	0.18233	N	0.147510	T	0.43077	0.1231	L	0.53249	1.67	0.09310	N	0.999996	D;D;D	0.76494	0.995;0.998;0.999	P;P;D	0.65443	0.847;0.781;0.935	T	0.29518	-1.0009	10	0.66056	D	0.02	.	6.312	0.21171	0.1842:0.0:0.8158:0.0	.	43;154;154	Q86YW5-3;Q86YW5;Q86YW5-2	.;TRML1_HUMAN;.	H	154;43;154	ENSP00000362219:P154H;ENSP00000400405:P43H;ENSP00000402855:P154H	ENSP00000362219:P154H	P	-	2	0	TREML1	41227016	0.227000	0.23707	0.289000	0.24876	0.963000	0.63663	1.580000	0.36547	0.992000	0.38840	0.650000	0.86243	CCC	TREML1	-	NULL	ENSG00000161911		0.517	TREML1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TREML1	HGNC	protein_coding	OTTHUMT00000043538.2	-	0.00	99	0	G	NM_178174		41119038	-1	tier1	-	no_errors	ENST00000426005	ensembl	human	known	74_37	missense	26.32	56	20	SNP	0.258	T
USP18	11274	genome.wustl.edu	37	22	18640567	18640567	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr22:18640567G>A	ENST00000215794.7	+	2	567	c.137G>A	c.(136-138)aGg>aAg	p.R46K		NM_017414.3	NP_059110.2	Q9UMW8	UBP18_HUMAN	ubiquitin specific peptidase 18	46					cytokine-mediated signaling pathway (GO:0019221)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytosol (GO:0005829)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|stomach(1)	10						GAGCGTCCCAGGGCCTGGGAC	0.562																																																	0													103.0	102.0	102.0					22																	18640567		2203	4300	6503	SO:0001583	missense	0			AJ243526	CCDS13752.1	22q11.2	2008-04-11	2005-08-08		ENSG00000184979	ENSG00000184979		"""Ubiquitin-specific peptidases"""	12616	protein-coding gene	gene with protein product		607057	"""ubiquitin specific protease 18"""			12838346	Standard	NM_017414		Approved		uc002zny.3	Q9UMW8	OTTHUMG00000150104	ENST00000215794.7:c.137G>A	22.37:g.18640567G>A	ENSP00000215794:p.Arg46Lys		Q53Y90|Q6IAD9|Q9NY71	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.R46K	ENST00000215794.7	37	c.137	CCDS13752.1	22	.	.	.	.	.	.	.	.	.	.	.	7.088	0.571508	0.13623	.	.	ENSG00000184979	ENST00000215794	T	0.05996	3.36	4.76	1.59	0.23543	.	1.003230	0.08027	N	0.992886	T	0.03263	0.0095	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.42982	-0.9419	10	0.02654	T	1	.	6.1843	0.20488	0.3076:0.0:0.6924:0.0	.	46	Q9UMW8	UBP18_HUMAN	K	46	ENSP00000215794:R46K	ENSP00000215794:R46K	R	+	2	0	USP18	17020567	0.000000	0.05858	0.002000	0.10522	0.043000	0.13939	0.348000	0.20031	0.729000	0.32403	0.591000	0.81541	AGG	USP18	-	NULL	ENSG00000184979		0.562	USP18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP18	HGNC	protein_coding	OTTHUMT00000316368.1	-	0.00	38	0	G			18640567	+1	tier1	-	no_errors	ENST00000215794	ensembl	human	known	74_37	missense	21.62	29	8	SNP	0.001	A
VCL	7414	genome.wustl.edu	37	10	75873970	75873970	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr10:75873970G>A	ENST00000211998.4	+	20	3072	c.2978G>A	c.(2977-2979)cGc>cAc	p.R993H	VCL_ENST00000417648.2_Missense_Mutation_p.R186H|VCL_ENST00000372755.3_Missense_Mutation_p.R925H	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	993	C-terminal tail.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GCAGCCAAGCGCATGGCTCTG	0.562																																																	0													85.0	70.0	75.0					10																	75873970		2203	4300	6503	SO:0001583	missense	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.2978G>A	10.37:g.75873970G>A	ENSP00000211998:p.Arg993His		Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.R993H	ENST00000211998.4	37	c.2978	CCDS7341.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.460829	0.96240	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000417648;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.55210	0.1906	L	0.28504	0.86	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.75484	0.982;0.986;0.936;0.976	T	0.45934	-0.9227	10	0.33940	T	0.23	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	186;852;925;993	B4DTM7;F5H7T3;P18206-2;P18206	.;.;.;VINC_HUMAN	H	925;993;186;900;852;665	ENSP00000361841:R925H;ENSP00000211998:R993H;ENSP00000411887:R186H;ENSP00000415489:R665H	ENSP00000211998:R993H	R	+	2	0	VCL	75543976	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.835000	0.97688	0.650000	0.86243	CGC	VCL	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000035403		0.562	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding			0.00	35	0	G	NM_003373, NM_014000		75873970	+1			no_errors	ENST00000211998	ensembl	human	known	74_37	missense	10.53	17	2	SNP	1.000	A
XPNPEP1	7511	genome.wustl.edu	37	10	111647946	111647946	+	Silent	SNP	A	A	G			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr10:111647946A>G	ENST00000502935.1	-	7	632	c.513T>C	c.(511-513)taT>taC	p.Y171Y	XPNPEP1_ENST00000430337.1_5'UTR|XPNPEP1_ENST00000369680.4_Silent_p.Y128Y|XPNPEP1_ENST00000322238.8_Silent_p.Y171Y|XPNPEP1_ENST00000369683.1_Silent_p.Y57Y					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		TTTTCTTCCAATAATCTGAGG	0.542																																																	0													52.0	48.0	49.0					10																	111647946		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.513T>C	10.37:g.111647946A>G				Silent	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.Y171	ENST00000502935.1	37	c.513	CCDS7560.2	10																																																																																			XPNPEP1	-	pfam_Creatinase	ENSG00000108039		0.542	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	HGNC	protein_coding	OTTHUMT00000050264.2		0.00	29	0	A			111647946	-1			no_errors	ENST00000502935	ensembl	human	known	74_37	silent	24.00	19	6	SNP	1.000	G
ZDHHC8P1	150244	genome.wustl.edu	37	22	23734897	23734897	+	RNA	SNP	A	A	G	rs555238107		TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr22:23734897A>G	ENST00000255890.4	-	0	1263									zinc finger, DHHC-type containing 8 pseudogene 1																		CACTCAGTGCAGTCCCAGAGA	0.642													.|||	1	0.000199681	0.0	0.0	5008	,	,		14788	0.0		0.0	False		,,,				2504	0.001																0																																												0					22q11.23	2010-02-25	2010-02-25	2010-02-25	ENSG00000133519	ENSG00000133519			26461	pseudogene	pseudogene			"""zinc finger, DHHC-type containing 8 pseudogene"""	ZDHHC8P			Standard	NR_003950		Approved	FLJ31568	uc002zwz.5		OTTHUMG00000150650		22.37:g.23734897A>G				RNA	SNP	-	NULL	ENST00000255890.4	37	NULL		22																																																																																			ZDHHC8P1	-	-	ENSG00000133519		0.642	ZDHHC8P1-001	KNOWN	basic	processed_transcript	ZDHHC8P1	HGNC	pseudogene	OTTHUMT00000319397.1	-	0.00	55	0	A	NR_003950		23734897	-1	tier1	-	no_errors	ENST00000456279	ensembl	human	known	74_37	rna	32.61	31	15	SNP	0.079	G
ZNF185	7739	genome.wustl.edu	37	X	152091293	152091293	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chrX:152091293G>A	ENST00000370268.4	+	11	804	c.767G>A	c.(766-768)cGg>cAg	p.R256Q	ZNF185_ENST00000324823.6_Intron|ZNF185_ENST00000535861.1_Missense_Mutation_p.R256Q|ZNF185_ENST00000370270.2_Missense_Mutation_p.R256Q|ZNF185_ENST00000318504.7_Intron|ZNF185_ENST00000449285.2_Missense_Mutation_p.R257Q|ZNF185_ENST00000318529.8_Intron|ZNF185_ENST00000539731.1_Missense_Mutation_p.R256Q			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	256						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					AAAGCGTCTCGGGCAATTTGG	0.612																																																	0													41.0	44.0	43.0					X																	152091293		2146	4226	6372	SO:0001583	missense	0			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.767G>A	X.37:g.152091293G>A	ENSP00000359291:p.Arg256Gln		A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	Missense_Mutation	SNP	smart_Znf_LIM,pfscan_Znf_LIM	p.R256Q	ENST00000370268.4	37	c.767	CCDS48184.1	X	.	.	.	.	.	.	.	.	.	.	G	3.549	-0.092033	0.07053	.	.	ENSG00000147394	ENST00000535861;ENST00000539731;ENST00000449285;ENST00000433245;ENST00000370268	T;T;T;T	0.44482	0.94;0.92;0.96;0.96	3.15	-5.38	0.02673	.	.	.	.	.	T	0.13628	0.0330	N	0.00926	-1.1	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.0;0.0;0.0;0.001;0.0	T	0.34254	-0.9836	9	0.30078	T	0.28	.	10.7026	0.45937	0.5696:0.0:0.4304:0.0	.	257;256;256;256;256	O15231-3;B8K2M0;F5GZL4;F5GXF7;O15231	.;.;.;.;ZN185_HUMAN	Q	256;256;257;122;256	ENSP00000440847:R256Q;ENSP00000444367:R256Q;ENSP00000395228:R257Q;ENSP00000359291:R256Q	ENSP00000359291:R256Q	R	+	2	0	ZNF185	151841949	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.550000	0.00929	-1.815000	0.01222	-1.412000	0.01120	CGG	ZNF185	-	NULL	ENSG00000147394		0.612	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	HGNC	protein_coding	OTTHUMT00000377480.1	-	0.00	45	0	G	NM_007150		152091293	+1	tier1	-	no_errors	ENST00000370270	ensembl	human	known	74_37	missense	33.87	41	21	SNP	0.000	A
ZNF701	55762	genome.wustl.edu	37	19	53085583	53085583	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OQ-01A-11D-A27G-09	TCGA-L5-A4OQ-11A-12D-A27G-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ef228907-c929-4e96-b91e-016838b393da	deb263ba-4437-4d37-bde6-67d28cff9bf3	g.chr19:53085583G>C	ENST00000540331.1	+	5	694	c.469G>C	c.(469-471)Gag>Cag	p.E157Q	CTD-3099C6.7_ENST00000599222.1_RNA|ZNF701_ENST00000391785.3_Missense_Mutation_p.E91Q|ZNF701_ENST00000301093.2_Missense_Mutation_p.E157Q	NM_001172655.1	NP_001166126.1	Q9NV72	ZN701_HUMAN	zinc finger protein 701	157					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(2)|lung(6)	14				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)		CCAGGAAATTGAGAAAGATAT	0.393																																					NSCLC(89;451 1475 9611 20673 52284)												0													98.0	97.0	97.0					19																	53085583		2203	4300	6503	SO:0001583	missense	0			AK001753	CCDS33092.1, CCDS54311.1	19q13.41	2013-01-08				ENSG00000167562		"""Zinc fingers, C2H2-type"", ""-"""	25597	protein-coding gene	gene with protein product							Standard	NM_018260		Approved	FLJ10891	uc021uyw.1	Q9NV72		ENST00000540331.1:c.469G>C	19.37:g.53085583G>C	ENSP00000444339:p.Glu157Gln		A2RRM8|B9EGF2|F5GZM6|Q66K42	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E157Q	ENST00000540331.1	37	c.469	CCDS54311.1	19	.	.	.	.	.	.	.	.	.	.	G	7.337	0.620087	0.14193	.	.	ENSG00000167562	ENST00000391785;ENST00000301093;ENST00000540331	T;T;T	0.05025	3.51;3.55;3.55	2.11	-4.23	0.03789	.	.	.	.	.	T	0.03520	0.0101	N	0.25890	0.77	0.09310	N	1	B;P	0.36974	0.363;0.576	B;B	0.40410	0.328;0.127	T	0.40308	-0.9570	9	0.10377	T	0.69	.	1.7682	0.03006	0.1767:0.2929:0.3855:0.1448	.	157;91	F5GZM6;Q9NV72	.;ZN701_HUMAN	Q	91;157;157	ENSP00000375662:E91Q;ENSP00000301093:E157Q;ENSP00000444339:E157Q	ENSP00000301093:E157Q	E	+	1	0	ZNF701	57777395	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-1.874000	0.01636	-0.332000	0.08489	0.306000	0.20318	GAG	ZNF701	-	NULL	ENSG00000167562		0.393	ZNF701-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF701	HGNC	protein_coding	OTTHUMT00000463467.1	-	0.00	93	0	G	NM_018260		53085583	+1	tier1	-	no_errors	ENST00000301093	ensembl	human	known	74_37	missense	23.17	62	19	SNP	0.000	C
