#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
A2M	2	genome.wustl.edu	37	12	9265954	9265954	+	Splice_Site	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:9265954A>C	ENST00000318602.7	-	2	578		c.e2+1			NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin						blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	AGCCACACTCACAGCGAAGGC	0.493																																																	0													94.0	95.0	95.0					12																	9265954		2203	4300	6503	SO:0001630	splice_region_variant	0			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.270+1T>G	12.37:g.9265954A>C			Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Splice_Site	SNP	-	e2+2	ENST00000318602.7	37	c.270+2	CCDS44827.1	12	.	.	.	.	.	.	.	.	.	.	A	11.21	1.570784	0.28003	.	.	ENSG00000175899	ENST00000318602;ENST00000540099;ENST00000404455	.	.	.	5.02	5.02	0.67125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4161	0.49954	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	A2M	9157221	1.000000	0.71417	0.996000	0.52242	0.171000	0.22731	5.319000	0.65835	2.028000	0.59812	0.528000	0.53228	.	A2M	-	-	ENSG00000175899		0.493	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	HGNC	protein_coding	OTTHUMT00000317233.2	-	0.00	34	0	A	NM_000014	Intron	9265954	-1	tier1	-	no_errors	ENST00000318602	ensembl	human	known	74_37	splice_site	47.92	25	23	SNP	1.000	C
A3GALT2	127550	genome.wustl.edu	37	1	33778163	33778163	+	Missense_Mutation	SNP	C	C	T	rs372318855		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:33778163C>T	ENST00000442999.3	-	3	135	c.136G>A	c.(136-138)Gtc>Atc	p.V46I	RP11-415J8.3_ENST00000457957.2_RNA|A3GALT2_ENST00000330379.5_5'Flank|RP11-415J8.3_ENST00000587696.1_RNA|RP11-415J8.3_ENST00000588828.1_RNA	NM_001080438.1	NP_001073907.1			alpha 1,3-galactosyltransferase 2														Myeloproliferative disorder(586;0.0393)				GAAGGGCAGACGCCCATGGGG	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		18051	0.001		0.0	False		,,,				2504	0.0																0								C		0,3972		0,0,1986	79.0	84.0	83.0			-3.7	0.0	1		83	4,8354		0,4,4175	no	intergenic				0,4,6161	TT,TC,CC		0.0479,0.0,0.0324			33778163	4,12326	1986	4179	6165	SO:0001583	missense	0				CCDS60080.1	1p35.1	2013-09-05	2013-03-11	2013-03-11	ENSG00000184389	ENSG00000184389		"""Glycosyltransferase family 6 domain containing"""	30005	protein-coding gene	gene with protein product	"""iGb3 synthase"", ""isoglobotriaosylceramide synthase"""		"""alpha 1,3-galactosyltransferase 2, pseudogene"""	A3GALT2P		10854427, 18630988	Standard	NM_001080438		Approved	IGBS3S	uc031plq.1		OTTHUMG00000004125	ENST00000442999.3:c.136G>A	1.37:g.33778163C>T	ENSP00000475261:p.Val46Ile			Missense_Mutation	SNP	pfam_Glyco_trans_6	p.V46I	ENST00000442999.3	37	c.136		1																																																																																			A3GALT2	-	NULL	ENSG00000184389		0.647	A3GALT2-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	A3GALT2	HGNC	protein_coding	OTTHUMT00000011861.3	-	0.00	28	0	C	NM_001080438		33778163	-1	tier1	-	no_errors	ENST00000442999	ensembl	human	novel	74_37	missense	9.09	50	5	SNP	0.000	T
ABCA12	26154	genome.wustl.edu	37	2	215884502	215884502	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:215884502A>C	ENST00000272895.7	-	12	1525	c.1306T>G	c.(1306-1308)Ttg>Gtg	p.L436V	ABCA12_ENST00000389661.4_Missense_Mutation_p.L118V|AC072062.3_ENST00000602182.1_RNA|AC072062.3_ENST00000437897.3_RNA|AC072062.3_ENST00000595058.1_RNA|AC072062.3_ENST00000419251.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	436					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AGTTCGGTCAAGTTTCGAAGT	0.368																																					Ovarian(66;664 1488 5121 34295)												0													46.0	47.0	46.0					2																	215884502		2203	4298	6501	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.1306T>G	2.37:g.215884502A>C	ENSP00000272895:p.Leu436Val		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L436V	ENST00000272895.7	37	c.1306	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	A	11.55	1.671463	0.29693	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.52983	0.64;0.64	6.03	-0.69	0.11309	.	0.244029	0.28754	N	0.014258	T	0.24198	0.0586	N	0.14661	0.345	0.58432	D	0.999999	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.002	T	0.02837	-1.1104	10	0.48119	T	0.1	.	5.6404	0.17561	0.422:0.2766:0.3013:0.0	.	436;118	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	V	436;118	ENSP00000272895:L436V;ENSP00000374312:L118V	ENSP00000272895:L436V	L	-	1	2	ABCA12	215592747	0.980000	0.34600	0.993000	0.49108	0.998000	0.95712	0.570000	0.23653	0.156000	0.19299	0.533000	0.62120	TTG	ABCA12	-	NULL	ENSG00000144452		0.368	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	-	0.00	10	0	A	NM_173076		215884502	-1	tier1	-	no_errors	ENST00000272895	ensembl	human	known	74_37	missense	33.33	8	4	SNP	0.750	C
ABCC8	6833	genome.wustl.edu	37	11	17415923	17415923	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:17415923C>T	ENST00000389817.3	-	37	4503	c.4435G>A	c.(4435-4437)Gag>Aag	p.E1479K	ABCC8_ENST00000302539.4_Missense_Mutation_p.E1480K			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	1479	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	CTGAAATTCTCCCCGCCTTCT	0.562																																																	0													67.0	66.0	66.0					11																	17415923		2200	4293	6493	SO:0001583	missense	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.4435G>A	11.37:g.17415923C>T	ENSP00000374467:p.Glu1479Lys		A6NMX8|E3UYX6|O75948|Q16583	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.E1480K	ENST00000389817.3	37	c.4438	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	C	28.4	4.918429	0.92249	.	.	ENSG00000006071	ENST00000389817;ENST00000302539	D;D	0.93488	-3.23;-3.23	5.12	4.21	0.49690	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.280522	0.33938	N	0.004409	D	0.89364	0.6694	N	0.16790	0.44	0.54753	D	0.999985	P	0.38148	0.62	B	0.43754	0.43	D	0.89652	0.3870	10	0.72032	D	0.01	.	13.4174	0.60976	0.0:0.9238:0.0:0.0762	.	1479	Q09428	ABCC8_HUMAN	K	1479;1480	ENSP00000374467:E1479K;ENSP00000303960:E1480K	ENSP00000303960:E1480K	E	-	1	0	ABCC8	17372499	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	7.759000	0.85235	1.147000	0.42369	0.557000	0.71058	GAG	ABCC8	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000006071		0.562	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	-	0.00	58	0	C	NM_000352		17415923	-1	tier1	-	no_errors	ENST00000302539	ensembl	human	known	74_37	missense	7.58	61	5	SNP	1.000	T
ACSM2A	123876	genome.wustl.edu	37	16	20489909	20489909	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr16:20489909T>A	ENST00000573854.1	+	10	1305	c.1191T>A	c.(1189-1191)gaT>gaA	p.D397E	ACSM2A_ENST00000417235.2_Missense_Mutation_p.D318E|ACSM2A_ENST00000219054.6_Missense_Mutation_p.D397E|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000536134.1_Missense_Mutation_p.D169E|ACSM2A_ENST00000575690.1_Missense_Mutation_p.D397E|ACSM2A_ENST00000396104.2_Missense_Mutation_p.D397E	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	397					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						TCATAGATGATAAGGGCAACG	0.478																																																	0													100.0	83.0	89.0					16																	20489909		2203	4300	6503	SO:0001583	missense	0			AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1191T>A	16.37:g.20489909T>A	ENSP00000459451:p.Asp397Glu		B3KTT9|O75202	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.D397E	ENST00000573854.1	37	c.1191	CCDS32401.1	16	.	.	.	.	.	.	.	.	.	.	T	0.014	-1.573976	0.00887	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	3.33	-2.09	0.07232	AMP-dependent synthetase/ligase (1);	0.991612	0.08187	N	0.984560	T	0.14056	0.0340	N	0.10733	0.035	0.35116	D	0.766605	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.49457	-0.8938	10	0.02654	T	1	-1.6187	0.2125	0.00158	0.2873:0.2754:0.168:0.2692	.	318;397	B7Z8R0;Q08AH3	.;ACS2A_HUMAN	E	318;397;169;397	ENSP00000392169:D318E;ENSP00000219054:D397E;ENSP00000445082:D169E;ENSP00000379411:D397E	ENSP00000219054:D397E	D	+	3	2	ACSM2A	20397410	0.000000	0.05858	0.388000	0.26195	0.237000	0.25408	-7.001000	0.00047	-0.141000	0.11374	0.240000	0.17902	GAT	ACSM2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000183747		0.478	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2A	HGNC	protein_coding	OTTHUMT00000436764.1	-	0.00	45	0	T	NM_001010845		20489909	+1	tier1	-	no_errors	ENST00000219054	ensembl	human	known	74_37	missense	14.04	49	8	SNP	0.037	A
ADAMDEC1	27299	genome.wustl.edu	37	8	24261565	24261565	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:24261565G>T	ENST00000256412.4	+	13	1590	c.1370G>T	c.(1369-1371)gGa>gTa	p.G457V	RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|ADAMDEC1_ENST00000522298.1_Missense_Mutation_p.G378V|ADAMDEC1_ENST00000538205.1_Missense_Mutation_p.G378V	NM_014479.3	NP_055294.1	O15204	ADEC1_HUMAN	ADAM-like, decysin 1	457	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				immune response (GO:0006955)|negative regulation of cell adhesion (GO:0007162)	extracellular region (GO:0005576)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|large_intestine(4)|skin(2)|stomach(1)	9		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)		CTGAAGCCTGGAACTGATTGC	0.413																																					Ovarian(147;687 1849 3699 25981 31337)												0													222.0	200.0	208.0					8																	24261565		2203	4300	6503	SO:0001583	missense	0			Y13323	CCDS6044.1, CCDS55212.1	8p12	2008-08-07			ENSG00000134028	ENSG00000134028			16299	protein-coding gene	gene with protein product		606393				9271581, 12037602	Standard	NM_001145271		Approved	M12.219	uc003xdz.2	O15204	OTTHUMG00000097858	ENST00000256412.4:c.1370G>T	8.37:g.24261565G>T	ENSP00000256412:p.Gly457Val		B7ZAK5	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.G457V	ENST00000256412.4	37	c.1370	CCDS6044.1	8	.	.	.	.	.	.	.	.	.	.	G	11.54	1.669833	0.29693	.	.	ENSG00000134028	ENST00000256412;ENST00000538205;ENST00000522298	T;T;T	0.14144	2.53;2.53;2.53	5.6	-5.69	0.02428	Blood coagulation inhibitor, Disintegrin (3);	1.710180	0.02656	N	0.107038	T	0.35008	0.0917	M	0.85197	2.74	0.09310	N	0.999999	D	0.61697	0.99	P	0.61275	0.886	T	0.55405	-0.8146	10	0.62326	D	0.03	0.2257	8.8094	0.34959	0.6592:0.1133:0.2275:0.0	.	457	O15204	ADEC1_HUMAN	V	457;378;378	ENSP00000256412:G457V;ENSP00000442592:G378V;ENSP00000428993:G378V	ENSP00000256412:G457V	G	+	2	0	ADAMDEC1	24317510	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.201000	0.09464	-0.903000	0.03881	-0.455000	0.05494	GGA	ADAMDEC1	-	pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin	ENSG00000134028		0.413	ADAMDEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMDEC1	HGNC	protein_coding	OTTHUMT00000215149.2	-	0.00	67	0	G	NM_014479		24261565	+1	tier1	-	no_errors	ENST00000256412	ensembl	human	known	74_37	missense	6.09	108	7	SNP	0.000	T
ADAMTS16	170690	genome.wustl.edu	37	5	5235215	5235215	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:5235215T>G	ENST00000274181.7	+	13	2077	c.1939T>G	c.(1939-1941)Ttc>Gtc	p.F647V	ADAMTS16_ENST00000513709.1_3'UTR	NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	647	Cys-rich.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						CAGTGTTGACTTCCGTGCTGC	0.532																																																	0													78.0	81.0	80.0					5																	5235215		1950	4148	6098	SO:0001583	missense	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.1939T>G	5.37:g.5235215T>G	ENSP00000274181:p.Phe647Val		C6G490|Q8IVE2	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.F647V	ENST00000274181.7	37	c.1939	CCDS43299.1	5	.	.	.	.	.	.	.	.	.	.	T	19.80	3.895652	0.72639	.	.	ENSG00000145536	ENST00000274181;ENST00000536857	T	0.05996	3.36	4.67	4.67	0.58626	.	0.129273	0.53938	D	0.000057	T	0.36690	0.0976	H	0.96833	3.89	0.58432	D	0.999998	P;D	0.71674	0.842;0.998	B;D	0.70016	0.321;0.967	T	0.56469	-0.7974	10	0.87932	D	0	.	13.417	0.60974	0.0:0.0:0.0:1.0	.	647;647	Q8TE57;Q8TE57-2	ATS16_HUMAN;.	V	647	ENSP00000274181:F647V	ENSP00000274181:F647V	F	+	1	0	ADAMTS16	5288215	1.000000	0.71417	0.998000	0.56505	0.520000	0.34377	7.610000	0.82949	1.888000	0.54679	0.533000	0.62120	TTC	ADAMTS16	-	NULL	ENSG00000145536		0.532	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	-	0.00	27	0	T	NM_139056		5235215	+1	tier1	-	no_errors	ENST00000274181	ensembl	human	known	74_37	missense	45.95	20	17	SNP	1.000	G
ADAMTS12	81792	genome.wustl.edu	37	5	33534969	33534969	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:33534969T>G	ENST00000504830.1	-	23	4910	c.4575A>C	c.(4573-4575)aaA>aaC	p.K1525N	ADAMTS12_ENST00000352040.3_Missense_Mutation_p.K1440N	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	1525	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GCTGGTTGCATTTTTTGAATT	0.468										HNSCC(64;0.19)																																							0													149.0	140.0	143.0					5																	33534969		2203	4300	6503	SO:0001583	missense	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.4575A>C	5.37:g.33534969T>G	ENSP00000422554:p.Lys1525Asn		A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.K1525N	ENST00000504830.1	37	c.4575	CCDS34140.1	5	.	.	.	.	.	.	.	.	.	.	T	8.398	0.841213	0.16891	.	.	ENSG00000151388	ENST00000504830;ENST00000352040	T;T	0.55588	0.51;0.51	5.13	-10.3	0.00346	.	0.516980	0.21671	N	0.070861	T	0.29321	0.0730	L	0.28649	0.875	0.41980	D	0.990791	B;B	0.06786	0.0;0.001	B;B	0.10450	0.003;0.005	T	0.29912	-0.9996	10	0.19590	T	0.45	.	12.0999	0.53776	0.0:0.462:0.4105:0.1275	.	1440;1525	P58397-3;P58397	.;ATS12_HUMAN	N	1525;1440	ENSP00000422554:K1525N;ENSP00000344847:K1440N	ENSP00000344847:K1440N	K	-	3	2	ADAMTS12	33570726	0.711000	0.27906	0.001000	0.08648	0.902000	0.53008	-0.715000	0.04997	-2.639000	0.00430	-0.371000	0.07208	AAA	ADAMTS12	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000151388		0.468	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	-	0.00	64	0	T	NM_030955		33534969	-1	tier1	-	no_errors	ENST00000504830	ensembl	human	known	74_37	missense	35.79	61	34	SNP	0.002	G
ADAMTS3	9508	genome.wustl.edu	37	4	73185073	73185073	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:73185073C>T	ENST00000286657.4	-	9	1364	c.1328G>A	c.(1327-1329)gGt>gAt	p.G443D		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	443	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CAGTTCTTGACCACTGCATCG	0.453																																					NSCLC(168;1941 2048 2918 13048 43078)												0													148.0	121.0	130.0					4																	73185073		2203	4300	6503	SO:0001583	missense	0			AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.1328G>A	4.37:g.73185073C>T	ENSP00000286657:p.Gly443Asp		A1L3U9|Q9BXZ8	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.G443D	ENST00000286657.4	37	c.1328	CCDS3553.1	4	.	.	.	.	.	.	.	.	.	.	C	20.7	4.040796	0.75732	.	.	ENSG00000156140	ENST00000286657	D	0.86432	-2.12	5.61	5.61	0.85477	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.85682	D	0.000000	D	0.89653	0.6777	L	0.27053	0.805	0.58432	D	0.999999	D	0.63880	0.993	D	0.66497	0.944	D	0.90518	0.4486	10	0.72032	D	0.01	.	20.0016	0.97412	0.0:1.0:0.0:0.0	.	443	O15072	ATS3_HUMAN	D	443	ENSP00000286657:G443D	ENSP00000286657:G443D	G	-	2	0	ADAMTS3	73403937	0.948000	0.32251	1.000000	0.80357	0.877000	0.50540	3.298000	0.51818	2.802000	0.96397	0.655000	0.94253	GGT	ADAMTS3	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000156140		0.453	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS3	HGNC	protein_coding	OTTHUMT00000252164.2	-	0.00	65	0	C			73185073	-1	tier1	-	no_errors	ENST00000286657	ensembl	human	known	74_37	missense	14.71	58	10	SNP	1.000	T
AK7	122481	genome.wustl.edu	37	14	96871175	96871175	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr14:96871175A>C	ENST00000267584.4	+	3	420	c.376A>C	c.(376-378)Atg>Ctg	p.M126L	AK7_ENST00000554313.1_3'UTR	NM_152327.3	NP_689540.2	Q96M32	KAD7_HUMAN	adenylate kinase 7	126					axoneme assembly (GO:0035082)|brain development (GO:0007420)|epithelial cilium movement (GO:0003351)|inflammatory response to antigenic stimulus (GO:0002437)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|cytidylate kinase activity (GO:0004127)|nucleoside diphosphate kinase activity (GO:0004550)			breast(2)|cervix(2)|endometrium(3)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		CTCACAGCAAATGGAGGAAGC	0.448																																																	0													89.0	82.0	84.0					14																	96871175		2203	4300	6503	SO:0001583	missense	0			AK057426	CCDS9945.1	14q32.31	2012-08-15			ENSG00000140057	ENSG00000140057		"""Adenylate kinases"""	20091	protein-coding gene	gene with protein product		615364					Standard	NM_152327		Approved	FLJ32864	uc001yfn.3	Q96M32	OTTHUMG00000171421	ENST00000267584.4:c.376A>C	14.37:g.96871175A>C	ENSP00000267584:p.Met126Leu		Q8IYP6	Missense_Mutation	SNP	pfam_Dpy-30_motif,pfam_Adenylate_kin,superfamily_P-loop_NTPase	p.M126L	ENST00000267584.4	37	c.376	CCDS9945.1	14	.	.	.	.	.	.	.	.	.	.	A	1.671	-0.509099	0.04231	.	.	ENSG00000140057	ENST00000267584	T	0.26810	1.71	5.35	3.52	0.40303	.	0.634926	0.16363	N	0.217691	T	0.06962	0.0177	N	0.01048	-1.04	0.25883	N	0.983566	B	0.02656	0.0	B	0.01281	0.0	T	0.29458	-1.0011	10	0.18710	T	0.47	-7.0093	4.2578	0.10726	0.2498:0.1755:0.5746:0.0	.	126	Q96M32	KAD7_HUMAN	L	126	ENSP00000267584:M126L	ENSP00000267584:M126L	M	+	1	0	AK7	95940928	0.868000	0.29978	0.573000	0.28510	0.011000	0.07611	2.083000	0.41615	1.272000	0.44329	-0.375000	0.07067	ATG	AK7	-	NULL	ENSG00000140057		0.448	AK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK7	HGNC	protein_coding	OTTHUMT00000413340.1	-	0.00	57	0	A			96871175	+1	tier1	-	no_errors	ENST00000267584	ensembl	human	known	74_37	missense	38.18	34	21	SNP	0.391	C
AKAP12	9590	genome.wustl.edu	37	6	151674115	151674116	+	In_Frame_Ins	INS	-	-	GGA	rs200313814|rs34338625|rs3842128|rs200691212|rs113116275|rs34737819	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:151674115_151674116insGGA	ENST00000253332.1	+	3	4778_4779	c.4589_4590insGGA	c.(4588-4593)attgag>atGGAtgag	p.1530_1530I>MD	AKAP12_ENST00000354675.6_In_Frame_Ins_p.1432_1432I>MD|AKAP12_ENST00000402676.2_In_Frame_Ins_p.1530_1530I>MD|AKAP12_ENST00000359755.5_In_Frame_Ins_p.1425_1425I>MD			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1530					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		AGTGTAGCAATTGAGGATTTAG	0.45																																					Melanoma(141;1616 1805 10049 24534 51979)												0																																										SO:0001652	inframe_insertion	0			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	Exception_encountered	6.37:g.151674115_151674116insGGA	ENSP00000253332:p.Ile1530delinsMetAsp		O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	In_Frame_Ins	INS	pfam_Pkinase-A_anch_WSK-motif,pfam_RII_binding_1	p.I1530in_frame_insMD	ENST00000253332.1	37	c.4589_4590	CCDS5229.1	6																																																																																			AKAP12	-	NULL	ENSG00000131016		0.450	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP12	HGNC	protein_coding	OTTHUMT00000042712.1		0.00	45	0	-			151674116	+1	tier1		no_errors	ENST00000253332	ensembl	human	known	74_37	in_frame_ins	38.96	47	30	INS	0.000:0.000	GGA
AKR1D1	6718	genome.wustl.edu	37	7	137801463	137801463	+	3'UTR	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr7:137801463A>C	ENST00000242375.3	+	0	1078				AKR1D1_ENST00000468877.2_3'UTR|AKR1D1_ENST00000411726.2_3'UTR|AKR1D1_ENST00000432161.1_3'UTR	NM_005989.3	NP_005980.1	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1						androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|C21-steroid hormone metabolic process (GO:0008207)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|steroid binding (GO:0005496)			endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	23					Azelaic Acid(DB00548)|Finasteride(DB01216)	AGACGGTGCAATGGGTAGTCC	0.438																																																	0													88.0	73.0	78.0					7																	137801463		692	1591	2283	SO:0001624	3_prime_UTR_variant	0			Z28339	CCDS5846.1, CCDS55169.1, CCDS55170.1	7q32-q33	2012-12-04	2012-12-04		ENSG00000122787	ENSG00000122787	1.3.99.6	"""Aldo-keto reductases"""	388	protein-coding gene	gene with protein product	"""delta 4-3-ketosteroid-5-beta-reductase"""	604741	"""aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)"""	SRD5B1		7508385, 10343119	Standard	NM_005989		Approved		uc003vtz.3	P51857	OTTHUMG00000155787	ENST00000242375.3:c.*55A>C	7.37:g.137801463A>C			A1L4P6|A8K060|B4DPN3|B4DPN8	RNA	SNP	-	NULL	ENST00000242375.3	37	NULL	CCDS5846.1	7																																																																																			AKR1D1	-	-	ENSG00000122787		0.438	AKR1D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1D1	HGNC	protein_coding	OTTHUMT00000341637.1	-	0.00	31	0	A	NM_005989		137801463	+1	tier1	-	no_errors	ENST00000468877	ensembl	human	known	74_37	rna	36.62	45	26	SNP	0.000	C
ALOX12P2	245	genome.wustl.edu	37	17	6801973	6801973	+	RNA	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:6801973T>C	ENST00000574727.1	+	0	1559									arachidonate 12-lipoxygenase pseudogene 2											endometrium(1)	1						TGAAATCTTCTTTTTATGGCT	0.542																																																	0																																												0			AF020774		17p13.1	2014-03-18			ENSG00000262943	ENSG00000262943			432	pseudogene	pseudogene						9691181	Standard	NR_002710		Approved		uc002gdv.3		OTTHUMG00000177324		17.37:g.6801973T>C				RNA	SNP	-	NULL	ENST00000574727.1	37	NULL		17																																																																																			ALOX12P2	-	-	ENSG00000262943		0.542	ALOX12P2-003	KNOWN	basic	processed_transcript	ALOX12P2	HGNC	pseudogene	OTTHUMT00000436284.1	-	0.00	77	0	T			6801973	+1	tier1	-	no_errors	ENST00000570890	ensembl	human	known	74_37	rna	7.00	93	7	SNP	0.121	C
DPH6	89978	genome.wustl.edu	37	15	35530031	35530031	+	Intron	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:35530031G>A	ENST00000560386.1	-	4	200				ANP32AP1_ENST00000560832.1_RNA			Q7L8W6	DPH6_HUMAN	diphthamine biosynthesis 6						peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)		ATP binding (GO:0005524)|diphthine-ammonia ligase activity (GO:0017178)										GGGCCTggaggaggaggagga	0.572																																																	0																																										SO:0001627	intron_variant	0				CCDS10043.1, CCDS45213.1	15q14	2013-06-19	2013-06-19	2013-05-02	ENSG00000134146	ENSG00000134146	6.3.1.14		30543	protein-coding gene	gene with protein product	"""diphthine--ammonia ligase"""		"""ATP binding domain 4"", ""DPH6 homolog (S. cerevisiae)"""	ATPBD4		23169644, 23468660	Standard	NM_080650		Approved	MGC14798		Q7L8W6	OTTHUMG00000129759	ENST00000560386.1:c.3239-17248C>T	15.37:g.35530031G>A			B3KWG1|Q96HJ6	RNA	SNP	-	NULL	ENST00000560386.1	37	NULL		15																																																																																			ANP32AP1	-	-	ENSG00000259516		0.572	DPH6-003	KNOWN	basic	processed_transcript	ANP32AP1	HGNC	protein_coding	OTTHUMT00000417824.1	-	0.00	102	0	G	NM_080650		35530031	+1	tier1	-	no_errors	ENST00000560832	ensembl	human	known	74_37	rna	44.19	72	57	SNP	0.999	A
ARMCX4	100131755	genome.wustl.edu	37	X	100746753	100746753	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:100746753A>C	ENST00000423738.3	+	2	3379	c.3177A>C	c.(3175-3177)gaA>gaC	p.E1059D		NM_001256155.1	NP_001243084.1	Q5H9R4	ARMX4_HUMAN	armadillo repeat containing, X-linked 4	277						integral component of membrane (GO:0016021)				lung(1)	1						CCACAGCAGAAGATGAGGCCT	0.577																																																	0																																										SO:0001583	missense	0			AK096955	CCDS59170.1	Xq22	2014-03-21	2009-11-26		ENSG00000196440	ENSG00000196440		"""Armadillo repeat containing"""	28615	protein-coding gene	gene with protein product			"""chromosome X open reading frame 35"", ""armadillo repeat containing, X-linked 4 pseudogene"""	CXorf35		16221301, 22569362	Standard	NR_028407		Approved	MGC40053, GASP4	uc031tkc.1	Q5H9R4	OTTHUMG00000022030	ENST00000423738.3:c.3177A>C	X.37:g.100746753A>C	ENSP00000404304:p.Glu1059Asp		A8K928|B3KXA4|Q5H9K8|Q8N8D6	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.E1059D	ENST00000423738.3	37	c.3177	CCDS59170.1	X	.	.	.	.	.	.	.	.	.	.	.	8.383	0.838008	0.16891	.	.	ENSG00000196440	ENST00000423738	.	.	.	3.82	-6.17	0.02091	.	.	.	.	.	T	0.15522	0.0374	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23332	-1.0191	4	.	.	.	.	0.7144	0.00929	0.1642:0.2343:0.1933:0.4081	.	.	.	.	D	1163	.	.	E	+	3	2	ARMCX4	100633409	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-0.552000	0.06020	-1.498000	0.01824	-0.462000	0.05337	GAA	ARMCX4	-	NULL	ENSG00000196440		0.577	ARMCX4-010	PUTATIVE	upstream_ATG|upstream_uORF|basic|appris_principal|CCDS	protein_coding	ARMCX4	HGNC	protein_coding	OTTHUMT00000370455.2	-	0.00	51	0	A	NM_001256155		100746753	+1	tier1	-	no_errors	ENST00000423738	ensembl	human	putative	74_37	missense	29.82	40	17	SNP	0.000	C
ATG2A	23130	genome.wustl.edu	37	11	64677211	64677211	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:64677211G>T	ENST00000377264.3	-	14	2161	c.2049C>A	c.(2047-2049)agC>agA	p.S683R	ATG2A_ENST00000421419.2_Missense_Mutation_p.S683R	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	683					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CAGGCCCACTGCTAAGCTCTG	0.687																																																	0													40.0	45.0	43.0					11																	64677211		2201	4296	6497	SO:0001583	missense	0				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.2049C>A	11.37:g.64677211G>T	ENSP00000366475:p.Ser683Arg		O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.S683R	ENST00000377264.3	37	c.2049	CCDS31602.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.58|10.58	1.390205|1.390205	0.25118|0.25118	.|.	.|.	ENSG00000110046|ENSG00000110046	ENST00000418259|ENST00000421419;ENST00000377264	.|T;T	.|0.07114	.|3.22;3.22	4.28|4.28	3.36|3.36	0.38483|0.38483	.|.	.|0.253934	.|0.38326	.|N	.|0.001740	T|T	0.04815|0.04815	0.0130|0.0130	N|N	0.22421|0.22421	0.69|0.69	0.24589|0.24589	N|N	0.993836|0.993836	.|B	.|0.16802	.|0.019	.|B	.|0.19391	.|0.025	T|T	0.42430|0.42430	-0.9452|-0.9452	5|10	.|0.10377	.|T	.|0.69	.|.	7.3888|7.3888	0.26899|0.26899	0.1155:0.0:0.8845:0.0|0.1155:0.0:0.8845:0.0	.|.	.|683	.|Q2TAZ0	.|ATG2A_HUMAN	K|R	485|683	.|ENSP00000410522:S683R;ENSP00000366475:S683R	.|ENSP00000366475:S683R	Q|S	-|-	1|3	0|2	ATG2A|ATG2A	64433787|64433787	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.910000|0.910000	0.53928|0.53928	3.314000|3.314000	0.51943|0.51943	2.386000|2.386000	0.81285|0.81285	0.561000|0.561000	0.74099|0.74099	CAG|AGC	ATG2A	-	NULL	ENSG00000110046		0.687	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	HGNC	protein_coding	OTTHUMT00000143224.1		0.00	52	0	G	NM_015104		64677211	-1			no_errors	ENST00000421419	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.988	T
ATP10A	57194	genome.wustl.edu	37	15	25940173	25940173	+	Missense_Mutation	SNP	A	A	C	rs200374453		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:25940173A>C	ENST00000356865.6	-	14	2992	c.2881T>G	c.(2881-2883)Tcc>Gcc	p.S961A		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	961					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GTGGACGTGGAGGGTGGGCAG	0.587																																																	0													118.0	109.0	112.0					15																	25940173		2203	4300	6503	SO:0001583	missense	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2881T>G	15.37:g.25940173A>C	ENSP00000349325:p.Ser961Ala		Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.S961A	ENST00000356865.6	37	c.2881	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	A	11.24	1.579445	0.28180	.	.	ENSG00000206190	ENST00000356865	D	0.82526	-1.62	4.91	-3.3	0.05003	HAD-like domain (1);	1.104200	0.06869	N	0.800577	T	0.68035	0.2957	L	0.45285	1.41	0.09310	N	1	B	0.24258	0.1	B	0.22880	0.042	T	0.52793	-0.8528	10	0.07030	T	0.85	-3.7425	1.9176	0.03300	0.4743:0.1254:0.2794:0.1208	.	961	O60312	AT10A_HUMAN	A	961	ENSP00000349325:S961A	ENSP00000349325:S961A	S	-	1	0	ATP10A	23491266	1.000000	0.71417	0.000000	0.03702	0.023000	0.10783	1.971000	0.40530	-0.860000	0.04099	-0.376000	0.06991	TCC	ATP10A	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000206190		0.587	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	-	0.00	70	0	A	NM_024490		25940173	-1	tier1	-	no_errors	ENST00000356865	ensembl	human	known	74_37	missense	36.84	47	28	SNP	0.001	C
ATP10A	57194	genome.wustl.edu	37	15	25959021	25959021	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:25959021A>G	ENST00000356865.6	-	10	2255	c.2144T>C	c.(2143-2145)gTg>gCg	p.V715A		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	715					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CAGCCGCTCCACAAGCACGCA	0.647																																																	0													63.0	59.0	60.0					15																	25959021		2203	4300	6503	SO:0001583	missense	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2144T>C	15.37:g.25959021A>G	ENSP00000349325:p.Val715Ala		Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.V715A	ENST00000356865.6	37	c.2144	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	A	8.624	0.892202	0.17613	.	.	ENSG00000206190	ENST00000356865	T	0.65732	-0.17	4.5	0.868	0.19090	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.062472	0.64402	N	0.000005	T	0.53850	0.1822	L	0.61218	1.895	0.47737	D	0.999506	B	0.18013	0.025	B	0.21151	0.033	T	0.46541	-0.9184	10	0.38643	T	0.18	-18.9937	8.2885	0.31943	0.7637:0.0:0.2363:0.0	.	715	O60312	AT10A_HUMAN	A	715	ENSP00000349325:V715A	ENSP00000349325:V715A	V	-	2	0	ATP10A	23510114	1.000000	0.71417	0.471000	0.27229	0.080000	0.17528	4.979000	0.63806	0.220000	0.20860	0.459000	0.35465	GTG	ATP10A	-	superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000206190		0.647	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	-	0.00	70	0	A	NM_024490		25959021	-1	tier1	-	no_errors	ENST00000356865	ensembl	human	known	74_37	missense	22.09	67	19	SNP	0.995	G
ATP10B	23120	genome.wustl.edu	37	5	160029694	160029694	+	Missense_Mutation	SNP	C	C	T	rs528980708	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:160029694C>T	ENST00000327245.5	-	21	4099	c.3253G>A	c.(3253-3255)Gac>Aac	p.D1085N		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1085					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATGGCAAAGTCGCTGGACATG	0.557													C|||	2	0.000399361	0.0	0.0029	5008	,	,		20585	0.0		0.0	False		,,,				2504	0.0																0													76.0	80.0	78.0					5																	160029694		2105	4241	6346	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.3253G>A	5.37:g.160029694C>T	ENSP00000313600:p.Asp1085Asn		Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.D1085N	ENST00000327245.5	37	c.3253	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.821689	0.96989	.	.	ENSG00000118322	ENST00000327245	T	0.11063	2.81	5.62	5.62	0.85841	HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.52289	0.1725	H	0.97829	4.085	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.71213	-0.4659	9	.	.	.	.	18.6782	0.91537	0.0:1.0:0.0:0.0	.	1085	O94823	AT10B_HUMAN	N	1085	ENSP00000313600:D1085N	.	D	-	1	0	ATP10B	159962272	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	7.726000	0.84824	2.648000	0.89879	0.650000	0.86243	GAC	ATP10B	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000118322		0.557	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1		0.00	25	0	C	NM_025153		160029694	-1			no_errors	ENST00000327245	ensembl	human	known	74_37	missense	23.53	26	8	SNP	1.000	T
ATP6V0D1	9114	genome.wustl.edu	37	16	67487538	67487538	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr16:67487538C>T	ENST00000290949.3	-	2	361	c.211G>A	c.(211-213)Gat>Aat	p.D71N	ATP6V0D1_ENST00000540149.1_Missense_Mutation_p.D71N|ATP6V0D1_ENST00000602876.1_5'UTR	NM_004691.4	NP_004682.2	P61421	VA0D1_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1	71					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP hydrolysis coupled proton transport (GO:0015991)|brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|cellular protein metabolic process (GO:0044267)|cilium assembly (GO:0042384)|endoplasmic reticulum unfolded protein response (GO:0030968)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|axon terminus (GO:0043679)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)|synaptic vesicle (GO:0008021)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)			large_intestine(3)|lung(3)|urinary_tract(2)	8		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0439)|Epithelial(162;0.101)		AGCCGGTCATCGATGACTGAC	0.532																																																	0													179.0	136.0	150.0					16																	67487538		2198	4300	6498	SO:0001583	missense	0			X71490	CCDS10838.1	16q22	2010-04-21	2006-01-20	2002-05-10	ENSG00000159720	ENSG00000159720		"""ATPases / V-type"""	13724	protein-coding gene	gene with protein product		607028	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), member D"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d isoform 1"", ""ATPase, H+ transporting, lysosomal 38kDa, V0 subunit D1"""	ATP6D		8250920	Standard	NM_004691		Approved	ATP6DV, VATX, VPATPD, P39, Vma6	uc002ete.1	P61421	OTTHUMG00000137515	ENST00000290949.3:c.211G>A	16.37:g.67487538C>T	ENSP00000290949:p.Asp71Asn		P12953|Q02547	Missense_Mutation	SNP	pfam_ATPase_V0-cplx_csu/dsu,superfamily_ATPase_V0-cplx_csu/dsu,pirsf_ATPase_V0-cplx_dsu	p.D71N	ENST00000290949.3	37	c.211	CCDS10838.1	16	.	.	.	.	.	.	.	.	.	.	C	17.31	3.358536	0.61403	.	.	ENSG00000159720	ENST00000290949;ENST00000540149	T;T	0.35789	1.29;1.29	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.65575	0.2704	M	0.87900	2.915	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.79108	0.992;0.989	T	0.65216	-0.6222	10	0.31617	T	0.26	-20.5435	18.2282	0.89926	0.0:1.0:0.0:0.0	.	71;71	F5GYQ1;P61421	.;VA0D1_HUMAN	N	71	ENSP00000290949:D71N;ENSP00000441282:D71N	ENSP00000290949:D71N	D	-	1	0	ATP6V0D1	66045039	1.000000	0.71417	0.917000	0.36280	0.004000	0.04260	6.088000	0.71371	2.637000	0.89404	0.563000	0.77884	GAT	ATP6V0D1	-	pfam_ATPase_V0-cplx_csu/dsu,superfamily_ATPase_V0-cplx_csu/dsu,pirsf_ATPase_V0-cplx_dsu	ENSG00000159720		0.532	ATP6V0D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V0D1	HGNC	protein_coding	OTTHUMT00000268835.1		0.00	51	0	C	NM_004691		67487538	-1			no_errors	ENST00000290949	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
BCL11A	53335	genome.wustl.edu	37	2	60780615	60780617	+	5'UTR	DEL	AGC	AGC	-	rs374130140		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	AGC	AGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:60780615_60780617delAGC	ENST00000335712.6	-	0	16_18				BCL11A_ENST00000538214.1_5'Flank|BCL11A_ENST00000358510.4_5'Flank|BCL11A_ENST00000356842.4_5'UTR|BCL11A_ENST00000359629.5_5'UTR|BCL11A_ENST00000537768.1_5'UTR	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)						B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			CTTTTTTTTAAGCaaaaaaaaaa	0.365			T	IGH@	B-CLL																																			Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	0																																										SO:0001623	5_prime_UTR_variant	0			AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.-212GCT>-	2.37:g.60780615_60780617delAGC			D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	RNA	DEL	-	NULL	ENST00000335712.6	37	NULL	CCDS1862.1	2																																																																																			BCL11A	-	-	ENSG00000119866		0.365	BCL11A-001	KNOWN	basic|CCDS	protein_coding	BCL11A	HGNC	protein_coding	OTTHUMT00000251579.2		0.00	10	0	AGC	NM_022893		60780617	-1	tier1		no_errors	ENST00000409351	ensembl	human	putative	74_37	rna	44.44	5	4	DEL	0.909:0.897:0.883	-
BCR	613	genome.wustl.edu	37	22	23651720	23651720	+	Intron	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr22:23651720G>A	ENST00000305877.8	+	17	3823				BCR_ENST00000436990.2_3'UTR|BCR_ENST00000359540.3_Intron	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	AGAAGGATAGGGTGGCCTCTG	0.602			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0													20.0	12.0	15.0					22																	23651720		2198	4259	6457	SO:0001627	intron_variant	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3072+50G>A	22.37:g.23651720G>A			P78501|Q12842|Q4LE80|Q6NZI3	RNA	SNP	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																			BCR	-	-	ENSG00000186716		0.602	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	-	0.00	106	0	G	NM_004327		23651720	+1	tier1	-	no_errors	ENST00000436990	ensembl	human	known	74_37	rna	18.49	119	27	SNP	0.000	A
BICC1	80114	genome.wustl.edu	37	10	60562964	60562964	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr10:60562964G>A	ENST00000373886.3	+	15	2147	c.2143G>A	c.(2143-2145)Gcc>Acc	p.A715T	BICC1_ENST00000263103.1_Missense_Mutation_p.A341T	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	715					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						CTCCGAAAGGGCCCACCTTGC	0.507																																																	0													49.0	48.0	48.0					10																	60562964		2203	4300	6503	SO:0001583	missense	0			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.2143G>A	10.37:g.60562964G>A	ENSP00000362993:p.Ala715Thr			Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_KH_dom,smart_SAM,pfscan_SAM,pfscan_KH_dom_type_1	p.A715T	ENST00000373886.3	37	c.2143	CCDS31206.1	10	.	.	.	.	.	.	.	.	.	.	G	16.05	3.013461	0.54468	.	.	ENSG00000122870	ENST00000373886;ENST00000263103	T;T	0.46451	1.66;0.87	5.96	5.96	0.96718	.	0.154732	0.64402	D	0.000018	T	0.36524	0.0970	L	0.36672	1.1	0.43242	D	0.995154	P;B	0.35433	0.501;0.181	B;B	0.28139	0.086;0.024	T	0.16158	-1.0412	10	0.52906	T	0.07	-14.4593	20.4008	0.98991	0.0:0.0:1.0:0.0	.	635;715	E7EU62;Q9H694	.;BICC1_HUMAN	T	715;341	ENSP00000362993:A715T;ENSP00000263103:A341T	ENSP00000263103:A341T	A	+	1	0	BICC1	60232970	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.247000	0.65416	2.826000	0.97356	0.655000	0.94253	GCC	BICC1	-	NULL	ENSG00000122870		0.507	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	HGNC	protein_coding	OTTHUMT00000048150.2	-	0.00	15	0	G	NM_025044		60562964	+1	tier1	-	no_errors	ENST00000373886	ensembl	human	known	74_37	missense	25.00	24	8	SNP	1.000	A
BMP3	651	genome.wustl.edu	37	4	81952653	81952653	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:81952653C>T	ENST00000282701.2	+	1	535	c.215C>T	c.(214-216)gCg>gTg	p.A72V		NM_001201.2	NP_001192.2	P12645	BMP3_HUMAN	bone morphogenetic protein 3	72					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|growth (GO:0040007)|ossification (GO:0001503)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	BMP receptor binding (GO:0070700)|receptor binding (GO:0005102)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	29						ACGGTCCAGGCGGCCCGGACA	0.692																																																	0													19.0	22.0	21.0					4																	81952653		2198	4298	6496	SO:0001583	missense	0			M22491	CCDS3588.1	4q21	2013-02-06	2008-05-22		ENSG00000152785	ENSG00000152785		"""Bone morphogenetic proteins"""	1070	protein-coding gene	gene with protein product	"""osteogenin"""	112263	"""bone morphogenetic protein 3 (osteogenic)"""				Standard	NM_001201		Approved		uc003hmg.4	P12645	OTTHUMG00000130292	ENST00000282701.2:c.215C>T	4.37:g.81952653C>T	ENSP00000282701:p.Ala72Val		Q4VAS5	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,pirsf_BMP3/GDF10	p.A72V	ENST00000282701.2	37	c.215	CCDS3588.1	4	.	.	.	.	.	.	.	.	.	.	C	12.31	1.899340	0.33535	.	.	ENSG00000152785	ENST00000282701	T	0.65549	-0.16	3.53	0.816	0.18768	Transforming growth factor-beta, N-terminal (1);	0.442914	0.16765	N	0.200446	T	0.31513	0.0799	N	0.08118	0	0.09310	N	1	B	0.27559	0.181	B	0.18871	0.023	T	0.09751	-1.0660	10	0.27082	T	0.32	.	3.2403	0.06778	0.2094:0.574:0.0:0.2166	.	72	P12645	BMP3_HUMAN	V	72	ENSP00000282701:A72V	ENSP00000282701:A72V	A	+	2	0	BMP3	82171677	0.000000	0.05858	0.004000	0.12327	0.026000	0.11368	-0.207000	0.09384	0.136000	0.18733	0.561000	0.74099	GCG	BMP3	-	pfam_TGF-b_N,pirsf_BMP3/GDF10	ENSG00000152785		0.692	BMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP3	HGNC	protein_coding	OTTHUMT00000252634.1	-	0.00	45	0	C			81952653	+1	tier1	-	no_errors	ENST00000282701	ensembl	human	known	74_37	missense	32.73	37	18	SNP	0.006	T
Unknown	0	genome.wustl.edu	37	16	33490018	33490018	+	IGR	SNP	T	T	C	rs28645082	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr16:33490018T>C								RP11-23E10.4 (123205 upstream) : BMS1P8 (7144 downstream)																							TCCAGCAGTGTGAGGATCTGA	0.507																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.33490018T>C				RNA	SNP	-	NULL		37	NULL		16																																																																																			BMS1P8	-	-	ENSG00000260518	0	0.507					BMS1P8	HGNC			-	0.00	14	0	T			33490018	-1	tier1	rs28645082	no_errors	ENST00000567036	ensembl	human	known	74_37	rna	45.00	11	9	SNP	0.977	C
BOD1L1	259282	genome.wustl.edu	37	4	13592067	13592067	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:13592067C>G	ENST00000040738.5	-	14	8287	c.8152G>C	c.(8152-8154)Gaa>Caa	p.E2718Q		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	2718						nucleus (GO:0005634)	DNA binding (GO:0003677)										CCTGAATTTTCAACCTAAATA	0.259																																																	0													16.0	18.0	17.0					4																	13592067		2168	4248	6416	SO:0001583	missense	0			AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.8152G>C	4.37:g.13592067C>G	ENSP00000040738:p.Glu2718Gln		Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Missense_Mutation	SNP	NULL	p.E2718Q	ENST00000040738.5	37	c.8152	CCDS3411.2	4	.	.	.	.	.	.	.	.	.	.	C	4.951	0.176759	0.09443	.	.	ENSG00000038219	ENST00000040738	T	0.07327	3.2	5.23	-1.45	0.08828	.	0.860272	0.10090	N	0.717309	T	0.05273	0.0140	N	0.24115	0.695	0.09310	N	0.999999	B	0.18013	0.025	B	0.16722	0.016	T	0.40156	-0.9578	10	0.48119	T	0.1	-2.5586	5.1609	0.15060	0.0:0.3424:0.1551:0.5025	.	2718	Q8NFC6	BOD1L_HUMAN	Q	2718	ENSP00000040738:E2718Q	ENSP00000040738:E2718Q	E	-	1	0	BOD1L	13201165	0.110000	0.22057	0.855000	0.33649	0.117000	0.20001	0.052000	0.14163	-0.021000	0.14009	0.650000	0.86243	GAA	BOD1L1	-	NULL	ENSG00000038219		0.259	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L1	HGNC	protein_coding	OTTHUMT00000207321.1		0.00	41	0	C	NM_148894		13592067	-1			no_errors	ENST00000040738	ensembl	human	known	74_37	missense	7.89	35	3	SNP	0.191	G
BPTF	2186	genome.wustl.edu	37	17	65941986	65941986	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:65941986C>T	ENST00000321892.4	+	23	7601	c.7540C>T	c.(7540-7542)Caa>Taa	p.Q2514*	BPTF_ENST00000335221.5_Nonsense_Mutation_p.Q2514*|BPTF_ENST00000424123.3_Nonsense_Mutation_p.Q2375*|BPTF_ENST00000306378.6_Nonsense_Mutation_p.Q2388*			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2514					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GATACCTTCCCAAGGCCAGCC	0.463																																																	0													143.0	127.0	133.0					17																	65941986		2203	4300	6503	SO:0001587	stop_gained	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.7540C>T	17.37:g.65941986C>T	ENSP00000315454:p.Gln2514*		Q6NX67|Q7Z7D6|Q9UIG2	Nonsense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.Q2514*	ENST00000321892.4	37	c.7540		17	.	.	.	.	.	.	.	.	.	.	C	47	13.275483	0.99731	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892;ENST00000424123	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-4.9271	15.5636	0.76269	0.1378:0.8622:0.0:0.0	.	.	.	.	X	2388;2514;2514;185	.	ENSP00000307208:Q2388X	Q	+	1	0	BPTF	63372448	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.342000	0.65970	2.937000	0.99478	0.650000	0.86243	CAA	BPTF	-	NULL	ENSG00000171634		0.463	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		-	0.00	46	0	C	NM_182641, NM_004459		65941986	+1	tier1	-	no_errors	ENST00000321892	ensembl	human	known	74_37	nonsense	38.30	58	36	SNP	1.000	T
C10orf71	118461	genome.wustl.edu	37	10	50533184	50533184	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr10:50533184C>T	ENST00000374144.3	+	3	2882	c.2594C>T	c.(2593-2595)aCc>aTc	p.T865I	C10orf71_ENST00000323868.4_Intron			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	865										endometrium(1)	1						CTCAGAGCTACCCCCGTAATT	0.507																																																	0													191.0	173.0	178.0					10																	50533184		692	1591	2283	SO:0001583	missense	0			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.2594C>T	10.37:g.50533184C>T	ENSP00000363259:p.Thr865Ile		A0AVL8	Missense_Mutation	SNP	NULL	p.T865I	ENST00000374144.3	37	c.2594	CCDS44387.1	10	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041514	0.55003	.	.	ENSG00000177354	ENST00000374144	T	0.05855	3.38	5.17	5.17	0.71159	.	0.000000	0.33980	U	0.004362	T	0.12475	0.0303	L	0.32530	0.975	0.80722	D	1	.	.	.	.	.	.	T	0.01889	-1.1253	8	0.59425	D	0.04	.	16.8381	0.85961	0.0:1.0:0.0:0.0	.	.	.	.	I	865	ENSP00000363259:T865I	ENSP00000363259:T865I	T	+	2	0	C10orf71	50203190	0.934000	0.31675	1.000000	0.80357	0.087000	0.18053	5.726000	0.68515	2.416000	0.81992	0.491000	0.48974	ACC	C10orf71	-	NULL	ENSG00000177354		0.507	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	HGNC	protein_coding	OTTHUMT00000047984.2	-	0.00	55	0	C	NM_199459		50533184	+1	tier1	-	no_errors	ENST00000374144	ensembl	human	known	74_37	missense	39.13	28	18	SNP	1.000	T
C14orf80	283643	genome.wustl.edu	37	14	105959065	105959065	+	Silent	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr14:105959065G>T	ENST00000392523.4	+	4	700	c.579G>T	c.(577-579)ctG>ctT	p.L193L	C14orf80_ENST00000392527.1_Silent_p.L152L|C14orf80_ENST00000329886.7_Silent_p.L154L|C14orf80_ENST00000450383.1_Intron|C14orf80_ENST00000392522.3_Silent_p.L193L|C14orf80_ENST00000354560.6_Silent_p.L193L|C14orf80_ENST00000334656.7_Silent_p.L152L|C14orf80_ENST00000551054.1_3'UTR			Q86SX3	CN080_HUMAN	chromosome 14 open reading frame 80	193										central_nervous_system(1)	1		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.239)		GCGCCCTCCTGAGCAAGGTAG	0.672																																																	0													24.0	27.0	26.0					14																	105959065		692	1590	2282	SO:0001819	synonymous_variant	0				CCDS45180.1, CCDS45181.1, CCDS45182.1, CCDS55955.1	14q32.33	2012-09-25			ENSG00000185347	ENSG00000185347			20127	protein-coding gene	gene with protein product							Standard	NM_001134875		Approved		uc001yrn.3	Q86SX3	OTTHUMG00000170426	ENST00000392523.4:c.579G>T	14.37:g.105959065G>T			B5MDG3|E9PAQ4|Q86TT3|Q86TT4|Q86TT5|Q96B41|Q9H7H4	Silent	SNP	NULL	p.L193	ENST00000392523.4	37	c.579		14																																																																																			C14orf80	-	NULL	ENSG00000185347		0.672	C14orf80-017	KNOWN	basic	protein_coding	C14orf80	HGNC	protein_coding	OTTHUMT00000409090.1		0.00	20	0	G	NM_001134875		105959065	+1			no_errors	ENST00000392523	ensembl	human	known	74_37	silent	19.05	16	4	SNP	0.999	T
PQLC2L	152078	genome.wustl.edu	37	3	157363570	157363570	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:157363570T>C	ENST00000461040.1	+	3	245	c.97T>C	c.(97-99)Tct>Cct	p.S33P				A1A4F0	CC055_HUMAN		0										breast(1)|lung(1)	2			Lung(72;0.0215)|LUSC - Lung squamous cell carcinoma(72;0.037)			gatgaagaaatctttacatgg	0.378																																																	0																																										SO:0001583	missense	0																														ENST00000461040.1:c.97T>C	3.37:g.157363570T>C	ENSP00000417372:p.Ser33Pro		C9JP04|C9JXB5|Q8N6Q6	Missense_Mutation	SNP	NULL	p.S33P	ENST00000461040.1	37	c.97		3	.	.	.	.	.	.	.	.	.	.	T	2.132	-0.398820	0.04865	.	.	ENSG00000174899	ENST00000461040	T	0.56941	0.43	3.05	-6.1	0.02138	.	.	.	.	.	T	0.41442	0.1159	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.46735	-0.9170	6	0.56958	D	0.05	.	4.3927	0.11348	0.2683:0.2458:0.0:0.4859	.	.	.	.	P	33	ENSP00000417372:S33P	ENSP00000417372:S33P	S	+	1	0	C3orf55	158846264	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.175000	0.01263	-1.878000	0.01128	-1.744000	0.00683	TCT	C3orf55	-	NULL	ENSG00000174899		0.378	C3orf55-007	PUTATIVE	basic	protein_coding	C3orf55	HGNC	protein_coding	OTTHUMT00000352022.1	-	0.00	43	0	T			157363570	+1	tier1	-	no_errors	ENST00000461040	ensembl	human	putative	74_37	missense	9.62	94	10	SNP	0.000	C
IGF2BP2	10644	genome.wustl.edu	37	3	185434228	185434228	+	Intron	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:185434228G>T	ENST00000382199.2	-	3	335				IGF2BP2_ENST00000421047.2_Intron|IGF2BP2_ENST00000346192.3_Intron|C3orf65_ENST00000296270.1_Splice_Site|IGF2BP2_ENST00000457616.2_Intron	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2						anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TCCATATTCAGCAGAAACAAA	0.383																																																	0													83.0	87.0	86.0					3																	185434228		1811	4067	5878	SO:0001627	intron_variant	0			BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.240-18093C>A	3.37:g.185434228G>T			A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Splice_Site	SNP	-	e2-1	ENST00000382199.2	37	c.62-1	CCDS3273.2	3	.	.	.	.	.	.	.	.	.	.	G	5.581	0.292082	0.10567	.	.	ENSG00000163915	ENST00000296270	.	.	.	3.01	0.606	0.17559	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.9266	0.13896	0.729:0.0:0.271:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C3orf65	186916922	0.001000	0.12720	0.000000	0.03702	0.219000	0.24729	0.798000	0.27014	0.116000	0.18110	-0.383000	0.06682	.	C3orf65	-	-	ENSG00000163915		0.383	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C3orf65	HGNC	protein_coding	OTTHUMT00000157087.2	-	0.00	24	0	G	NM_006548		185434228	+1	tier1	-	no_errors	ENST00000296270	ensembl	human	known	74_37	splice_site	11.76	30	4	SNP	0.001	T
C9orf152	401546	genome.wustl.edu	37	9	112969817	112969817	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr9:112969817A>G	ENST00000400613.4	-	1	652	c.43T>C	c.(43-45)Tgg>Cgg	p.W15R	C9orf152_ENST00000473442.1_5'Flank	NM_001012993.2	NP_001013011.2	Q5JTZ5	CI152_HUMAN	chromosome 9 open reading frame 152	15										NS(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						CTAAGCTGCCAGAAGTGGGGC	0.642																																																	0													28.0	32.0	31.0					9																	112969817		2203	4300	6503	SO:0001583	missense	0			BX648620	CCDS35102.2	9q31.3	2012-04-03			ENSG00000188959	ENSG00000188959			31455	protein-coding gene	gene with protein product							Standard	NM_001012993		Approved	bA470J20.2	uc011lwk.2	Q5JTZ5	OTTHUMG00000020478	ENST00000400613.4:c.43T>C	9.37:g.112969817A>G	ENSP00000383456:p.Trp15Arg		A8MWT6	Missense_Mutation	SNP	NULL	p.W15R	ENST00000400613.4	37	c.43	CCDS35102.2	9	.	.	.	.	.	.	.	.	.	.	A	12.75	2.030625	0.35797	.	.	ENSG00000188959	ENST00000400613	.	.	.	3.14	1.95	0.26073	.	.	.	.	.	T	0.26702	0.0653	N	0.24115	0.695	0.21416	N	0.999691	P	0.43701	0.815	P	0.45681	0.49	T	0.08743	-1.0707	7	.	.	.	-0.0722	6.4868	0.22093	0.7512:0.2488:0.0:0.0	.	15	Q5JTZ5	CI152_HUMAN	R	15	.	.	W	-	1	0	C9orf152	112009638	0.987000	0.35691	0.813000	0.32504	0.691000	0.40173	0.552000	0.23376	0.553000	0.29044	0.383000	0.25322	TGG	C9orf152	-	NULL	ENSG00000188959		0.642	C9orf152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf152	HGNC	protein_coding	OTTHUMT00000053602.2		0.00	20	0	A	NM_001012993		112969817	-1			no_errors	ENST00000400613	ensembl	human	known	74_37	missense	10.34	26	3	SNP	0.852	G
CACNA1A	773	genome.wustl.edu	37	19	13319692	13319694	+	In_Frame_Del	DEL	GAT	GAT	-	rs16051	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	GAT	GAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:13319692_13319694delGAT	ENST00000360228.5	-	46	6655_6657	c.6656_6658delATC	c.(6655-6660)catccc>ccc	p.H2219del	CACNA1A_ENST00000573710.2_In_Frame_Del_p.H2220del	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	2220	Poly-His.				adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGGGCGGGGGAtggtggtggtg	0.734																																																	0																																										SO:0001651	inframe_deletion	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.6656_6658delATC	19.37:g.13319692_13319694delGAT	ENSP00000353362:p.His2219del		J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	In_Frame_Del	DEL	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.H2219in_frame_del	ENST00000360228.5	37	c.6658_6656	CCDS45998.1	19																																																																																			CACNA1A	-	NULL	ENSG00000141837		0.734	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2		0.00	15	0	GAT	NM_000068		13319694	-1	tier1		no_errors	ENST00000360228	ensembl	human	known	74_37	in_frame_del	16.67	20	4	DEL	1.000:1.000:1.000	-
CACNA2D3	55799	genome.wustl.edu	37	3	54798378	54798378	+	Splice_Site	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:54798378T>C	ENST00000474759.1	+	13	1428	c.1380T>C	c.(1378-1380)acT>acC	p.T460T	CACNA2D3_ENST00000415676.2_Splice_Site_p.T460T|CACNA2D3_ENST00000288197.5_Splice_Site_p.T460T|CACNA2D3_ENST00000490478.1_Splice_Site_p.T366T	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	460	Cache.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	TTGACAGCACTGTGAGTCCAC	0.483																																																	0													90.0	87.0	88.0					3																	54798378		2014	4175	6189	SO:0001630	splice_region_variant	0			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.1380+1T>C	3.37:g.54798378T>C			B2RPL6|Q9NY16|Q9NY18	Silent	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.T460	ENST00000474759.1	37	c.1380	CCDS54598.1	3																																																																																			CACNA2D3	-	pfam_Cache_domain	ENSG00000157445		0.483	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1	-	0.00	44	0	T		Silent	54798378	+1	tier1	-	no_errors	ENST00000288197	ensembl	human	known	74_37	silent	40.00	30	20	SNP	0.990	C
CAPN12	147968	genome.wustl.edu	37	19	39229076	39229076	+	Missense_Mutation	SNP	G	G	A	rs565486508		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:39229076G>A	ENST00000328867.4	-	7	1180	c.872C>T	c.(871-873)aCg>aTg	p.T291M	CTD-2540F13.2_ENST00000602255.1_RNA|CAPN12_ENST00000601953.1_Missense_Mutation_p.T142M	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	291	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			CCAGGCCCCCGTCCACTCCAC	0.697													G|||	1	0.000199681	0.0	0.0	5008	,	,		14738	0.0		0.0	False		,,,				2504	0.001																0													30.0	33.0	32.0					19																	39229076		2200	4299	6499	SO:0001583	missense	0			BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.872C>T	19.37:g.39229076G>A	ENSP00000331636:p.Thr291Met			Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.T291M	ENST00000328867.4	37	c.872	CCDS12519.1	19	.	.	.	.	.	.	.	.	.	.	G	14.58	2.578251	0.45902	.	.	ENSG00000182472	ENST00000328867	D	0.88201	-2.35	4.91	-4.19	0.03835	Peptidase C2, calpain, catalytic domain (3);	1.080950	0.07111	N	0.842205	D	0.89220	0.6653	M	0.73753	2.245	0.09310	N	0.999991	D	0.63880	0.993	P	0.48677	0.586	T	0.83328	-0.0014	10	0.87932	D	0	.	10.0946	0.42466	0.0:0.111:0.3281:0.5609	.	291	Q6ZSI9	CAN12_HUMAN	M	291	ENSP00000331636:T291M	ENSP00000331636:T291M	T	-	2	0	CAPN12	43920916	0.002000	0.14202	0.509000	0.27700	0.534000	0.34807	-0.122000	0.10627	-0.107000	0.12088	0.462000	0.41574	ACG	CAPN12	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat	ENSG00000182472		0.697	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN12	HGNC	protein_coding	OTTHUMT00000462151.1	-	0.00	74	0	G			39229076	-1	tier1	-	no_errors	ENST00000328867	ensembl	human	known	74_37	missense	28.89	64	26	SNP	0.030	A
CCDC37	348807	genome.wustl.edu	37	3	126135332	126135332	+	Missense_Mutation	SNP	G	G	T	rs142615985	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:126135332G>T	ENST00000352312.1	+	5	498	c.399G>T	c.(397-399)tgG>tgT	p.W133C	CCDC37_ENST00000393425.1_Missense_Mutation_p.W133C|CCDC37_ENST00000505024.1_Missense_Mutation_p.W133C	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	133										NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		ACACGACCTGGAAGCTCACCT	0.716																																																	0													13.0	15.0	14.0					3																	126135332		2192	4287	6479	SO:0001583	missense	0			AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.399G>T	3.37:g.126135332G>T	ENSP00000344749:p.Trp133Cys		D3DNA8|Q494V1|Q494V4|Q8N838	Missense_Mutation	SNP	superfamily_SuperAg_toxin_C	p.W133C	ENST00000352312.1	37	c.399	CCDS3037.1	3	.	.	.	.	.	.	.	.	.	.	G	12.11	1.840649	0.32513	.	.	ENSG00000163885	ENST00000352312;ENST00000393425;ENST00000505024	T;T;T	0.33216	1.42;1.42;1.42	4.07	4.07	0.47477	.	0.161638	0.44483	D	0.000460	T	0.36468	0.0968	M	0.63843	1.955	0.80722	D	1	D;P	0.53885	0.963;0.938	P;B	0.48368	0.575;0.371	T	0.13764	-1.0497	10	0.37606	T	0.19	-4.0694	11.5991	0.50993	0.0:0.0:1.0:0.0	.	133;133	Q494V2-2;Q494V2	.;CCD37_HUMAN	C	133	ENSP00000344749:W133C;ENSP00000377076:W133C;ENSP00000423046:W133C	ENSP00000344749:W133C	W	+	3	0	CCDC37	127618022	1.000000	0.71417	0.994000	0.49952	0.030000	0.12068	5.205000	0.65186	2.102000	0.63906	0.491000	0.48974	TGG	CCDC37	-	NULL	ENSG00000163885		0.716	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	CCDC37	HGNC	protein_coding	OTTHUMT00000370099.4		0.00	27	0	G	NM_182628		126135332	+1			no_errors	ENST00000393425	ensembl	human	known	74_37	missense	23.08	30	9	SNP	0.998	T
CCDC86	79080	genome.wustl.edu	37	11	60609946	60609946	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:60609946C>T	ENST00000227520.5	+	1	403	c.349C>T	c.(349-351)Cag>Tag	p.Q117*	RP11-804A23.4_ENST00000538705.1_RNA|RP11-804A23.2_ENST00000539897.1_RNA	NM_024098.3	NP_077003.1	Q9H6F5	CCD86_HUMAN	coiled-coil domain containing 86	117	Pro-rich.				viral process (GO:0016032)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(2)|liver(2)|lung(2)|urinary_tract(3)	10						CCCACGATGTCAGCCGAAGCC	0.627																																																	0													74.0	70.0	71.0					11																	60609946		2203	4299	6502	SO:0001587	stop_gained	0			AK025974	CCDS7993.1	11q12.2	2006-03-16			ENSG00000110104	ENSG00000110104			28359	protein-coding gene	gene with protein product		611293					Standard	NM_024098		Approved	MGC2574	uc001nqa.2	Q9H6F5	OTTHUMG00000167706	ENST00000227520.5:c.349C>T	11.37:g.60609946C>T	ENSP00000227520:p.Gln117*		B4DY99	Nonsense_Mutation	SNP	NULL	p.Q117*	ENST00000227520.5	37	c.349	CCDS7993.1	11	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564172	0.65651	.	.	ENSG00000110104	ENST00000227520	.	.	.	3.17	3.17	0.36434	.	0.657220	0.14223	N	0.333269	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-4.6305	12.1679	0.54141	0.0:1.0:0.0:0.0	.	.	.	.	X	117	.	ENSP00000227520:Q117X	Q	+	1	0	CCDC86	60366522	0.054000	0.20591	0.063000	0.19743	0.047000	0.14425	0.404000	0.20999	1.768000	0.52137	0.561000	0.74099	CAG	CCDC86	-	NULL	ENSG00000110104		0.627	CCDC86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC86	HGNC	protein_coding	OTTHUMT00000395743.1	-	0.00	23	0	C	NM_024098		60609946	+1	tier1	-	no_errors	ENST00000227520	ensembl	human	known	74_37	nonsense	42.42	19	14	SNP	0.470	T
CD1E	913	genome.wustl.edu	37	1	158324300	158324300	+	Silent	SNP	T	T	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:158324300T>A	ENST00000368167.3	+	2	431	c.192T>A	c.(190-192)acT>acA	p.T64T	CD1E_ENST00000464822.1_Intron|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368161.3_Silent_p.T64T|CD1E_ENST00000434258.1_Silent_p.T62T|CD1E_ENST00000368156.1_Silent_p.T64T|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368160.3_Silent_p.T64T|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368155.3_Silent_p.T64T|CD1E_ENST00000368165.3_Silent_p.T64T|CD1E_ENST00000444681.2_Intron|CD1E_ENST00000368163.3_Silent_p.T64T|CD1E_ENST00000368154.1_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	64					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					ACCTGCAGACTCATGGCTGGG	0.562																																																	0													68.0	72.0	71.0					1																	158324300		2181	4299	6480	SO:0001819	synonymous_variant	0			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.192T>A	1.37:g.158324300T>A			B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Silent	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.T64	ENST00000368167.3	37	c.192	CCDS41417.1	1																																																																																			CD1E	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000158488		0.562	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	-	0.00	31	0	T	NM_030893		158324300	+1	tier1	-	no_errors	ENST00000368167	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.600	A
CDH12	1010	genome.wustl.edu	37	5	21783502	21783502	+	Missense_Mutation	SNP	G	G	A	rs143124599		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:21783502G>A	ENST00000382254.1	-	11	2444	c.1358C>T	c.(1357-1359)gCg>gTg	p.A453V	CDH12_ENST00000504376.2_Missense_Mutation_p.A453V|CDH12_ENST00000522262.1_Missense_Mutation_p.A413V|CDH12_ENST00000521384.1_5'UTR	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	453	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A453V(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						ATTATACTGCGCAGTGCTTTC	0.368										HNSCC(59;0.17)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		18838	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	endometrium(1)											190.0	184.0	186.0					5																	21783502		2203	4300	6503	SO:0001583	missense	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.1358C>T	5.37:g.21783502G>A	ENSP00000371689:p.Ala453Val		B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A453V	ENST00000382254.1	37	c.1358	CCDS3890.1	5	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	15.40	2.821838	0.50633	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.61859	0.07;0.07;0.07	5.54	5.54	0.83059	Cadherin (4);Cadherin-like (1);	0.201945	0.51477	D	0.000091	T	0.59824	0.2222	M	0.68952	2.095	0.52099	D	0.999944	B;B	0.25235	0.028;0.121	B;B	0.24701	0.055;0.035	T	0.56378	-0.7989	10	0.35671	T	0.21	.	19.4807	0.95008	0.0:0.0:1.0:0.0	.	413;453	B7Z2U6;P55289	.;CAD12_HUMAN	V	453;453;413	ENSP00000423577:A453V;ENSP00000371689:A453V;ENSP00000428786:A413V	ENSP00000371689:A453V	A	-	2	0	CDH12	21819259	1.000000	0.71417	0.040000	0.18447	0.993000	0.82548	9.360000	0.97119	2.597000	0.87782	0.655000	0.94253	GCG	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000154162		0.368	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1		0.00	47	0	G	NM_004061		21783502	-1			no_errors	ENST00000382254	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.738	A
CELP	1057	genome.wustl.edu	37	9	135962487	135962487	+	RNA	SNP	G	G	C	rs371110017|rs76117078|rs386739105|rs386739104|rs370277311	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr9:135962487G>C	ENST00000411440.2	+	0	994					NR_001275.2				carboxyl ester lipase pseudogene																		AAGTGACTCTGAGGCTGCCCC	0.677													G|||	366	0.0730831	0.0083	0.0562	5008	,	,		14974	0.0883		0.1024	False		,,,				2504	0.1268																0																																												0			L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962487G>C				RNA	SNP	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			CELP	-	-	ENSG00000170827		0.677	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1	-	0.00	9	0	G	NM_001808		135962487	+1	tier1	rs76117078	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	61.11	7	11	SNP	0.001	C
CELP	1057	genome.wustl.edu	37	9	135962494	135962494	+	RNA	DEL	C	C	-	rs371110017|rs386739105|rs386739104|rs370277311		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr9:135962494delC	ENST00000411440.2	+	0	1001					NR_001275.2				carboxyl ester lipase pseudogene																		TCTGAGGCTGCCCCCGTGTCC	0.677																																																	0																																												0			L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135962494delC				RNA	DEL	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			CELP	-	-	ENSG00000170827		0.677	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1		0.00	9	0	C	NM_001808		135962494	+1			no_errors	ENST00000411440	ensembl	human	known	74_37	rna	70.59	5	12	DEL	0.000	0
CENPF	1063	genome.wustl.edu	37	1	214813616	214813616	+	Silent	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:214813616T>C	ENST00000366955.3	+	12	2103	c.1935T>C	c.(1933-1935)aaT>aaC	p.N645N		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		GTAAAATTAATCACTTGGAAA	0.353																																					Colon(80;575 1284 11000 14801 43496)												0													39.0	40.0	40.0					1																	214813616		2203	4299	6502	SO:0001819	synonymous_variant	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.1935T>C	1.37:g.214813616T>C			Q13171|Q13246|Q5VVM7	Silent	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_CenpF/LEK1_Rb-prot-bd	p.N645	ENST00000366955.3	37	c.1935	CCDS31023.1	1																																																																																			CENPF	-	NULL	ENSG00000117724		0.353	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1		0.00	20	0	T	NM_016343		214813616	+1			no_errors	ENST00000366955	ensembl	human	known	74_37	silent	11.11	24	3	SNP	0.004	C
CHD2	1106	genome.wustl.edu	37	15	93522467	93522467	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:93522467G>T	ENST00000394196.4	+	22	3898	c.2830G>T	c.(2830-2832)Gac>Tac	p.D944Y	CHD2_ENST00000557381.1_Missense_Mutation_p.D944Y	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	944	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TCAGCGCATGGACACCACTGG	0.458																																																	0													175.0	166.0	169.0					15																	93522467		2197	4298	6495	SO:0001583	missense	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.2830G>T	15.37:g.93522467G>T	ENSP00000377747:p.Asp944Tyr		C6G482|Q96IP5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D944Y	ENST00000394196.4	37	c.2830	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	G	35	5.420504	0.96111	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.95342	-3.68;-3.68	5.78	5.78	0.91487	Helicase, C-terminal (1);	0.000000	0.34986	U	0.003528	D	0.97551	0.9198	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	1.0;0.965;1.0	D;P;D	0.91635	0.993;0.74;0.999	D	0.97665	1.0163	10	0.72032	D	0.01	-26.6266	20.0983	0.97858	0.0:0.0:1.0:0.0	.	944;944;944	A8K9Y5;O14647;O14647-2	.;CHD2_HUMAN;.	Y	944	ENSP00000377747:D944Y;ENSP00000451366:D944Y	ENSP00000377747:D944Y	D	+	1	0	CHD2	91323471	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.755000	0.98912	2.755000	0.94549	0.552000	0.68991	GAC	CHD2	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000173575		0.458	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	-	0.00	32	0	G	NM_001271		93522467	+1	tier1	-	no_errors	ENST00000557381	ensembl	human	putative	74_37	missense	8.16	45	4	SNP	1.000	T
CHD8	57680	genome.wustl.edu	37	14	21899011	21899011	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr14:21899011G>A	ENST00000557364.1	-	2	1055	c.792C>T	c.(790-792)gcC>gcT	p.A264A	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000399982.2_Silent_p.A264A|RN7SL650P_ENST00000583681.1_RNA|CHD8_ENST00000430710.3_Intron			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	264					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GGGGCCCTGTGGCCCCAGGGT	0.577																																																	0													23.0	24.0	24.0					14																	21899011		1568	3582	5150	SO:0001819	synonymous_variant	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.792C>T	14.37:g.21899011G>A			Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Silent	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.A264	ENST00000557364.1	37	c.792	CCDS53885.1	14																																																																																			CHD8	-	NULL	ENSG00000100888		0.577	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1		0.00	22	0	G	NM_020920		21899011	-1			no_errors	ENST00000399982	ensembl	human	known	74_37	silent	8.82	31	3	SNP	0.975	A
CHST7	56548	genome.wustl.edu	37	X	46433545	46433545	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:46433545C>T	ENST00000276055.3	+	1	327	c.179C>T	c.(178-180)gCg>gTg	p.A60V		NM_019886.2	NP_063939.2	Q9NS84	CHST7_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7	60					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|N-acetylglucosamine metabolic process (GO:0006044)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			breast(3)|endometrium(2)|kidney(1)|lung(2)	8						CTGGAGGCGGCGGCGGCCGGC	0.751																																																	0													3.0	3.0	3.0					X																	46433545		1478	2913	4391	SO:0001583	missense	0			AB040711	CCDS14268.1	Xp11.3	2008-02-05			ENSG00000147119	ENSG00000147119		"""Sulfotransferases, membrane-bound"""	13817	protein-coding gene	gene with protein product		300375				10781596	Standard	NM_019886		Approved	C6ST-2, C6ST2	uc004dgt.3	Q9NS84	OTTHUMG00000021423	ENST00000276055.3:c.179C>T	X.37:g.46433545C>T	ENSP00000276055:p.Ala60Val		O75667	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.A60V	ENST00000276055.3	37	c.179	CCDS14268.1	X	.	.	.	.	.	.	.	.	.	.	c	22.4	4.285691	0.80803	.	.	ENSG00000147119	ENST00000276055	D	0.98090	-4.71	4.25	4.25	0.50352	.	0.000000	0.34178	N	0.004197	D	0.96614	0.8895	N	0.19112	0.55	0.30469	N	0.773497	D	0.76494	0.999	D	0.70716	0.97	D	0.93624	0.6950	10	0.27082	T	0.32	-23.7093	12.9133	0.58192	0.0:1.0:0.0:0.0	.	60	Q9NS84	CHST7_HUMAN	V	60	ENSP00000276055:A60V	ENSP00000276055:A60V	A	+	2	0	CHST7	46318489	0.999000	0.42202	1.000000	0.80357	0.946000	0.59487	0.741000	0.26202	2.093000	0.63338	0.509000	0.49947	GCG	CHST7	-	pirsf_Carbohydrate_sulfotransferase	ENSG00000147119		0.751	CHST7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST7	HGNC	protein_coding	OTTHUMT00000056362.1	-	0.00	33	0	C	NM_019886		46433545	+1	tier1	-	no_errors	ENST00000276055	ensembl	human	known	74_37	missense	34.21	25	13	SNP	1.000	T
CHM	1121	genome.wustl.edu	37	X	85233730	85233730	+	Intron	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:85233730A>C	ENST00000357749.2	-	4	344				CHM_ENST00000537751.1_Intron|CHM_ENST00000358786.4_Intron|CHM_ENST00000467744.2_Intron	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)						blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				AGAGTGAAAAAGTCATTAATT	0.338																																																	0													55.0	53.0	54.0					X																	85233730		2203	4298	6501	SO:0001627	intron_variant	0			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.314+40T>G	X.37:g.85233730A>C			A1L4D2|O43732	RNA	SNP	-	NULL	ENST00000357749.2	37	NULL	CCDS14454.1	X																																																																																			CHM	-	-	ENSG00000188419		0.338	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3	-	0.00	25	0	A	NM_000390		85233730	-1	tier1	-	no_errors	ENST00000487515	ensembl	human	known	74_37	rna	28.57	25	10	SNP	0.005	C
CIDEA	1149	genome.wustl.edu	37	18	12254815	12254815	+	Intron	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr18:12254815G>A	ENST00000320477.9	+	1	103				CIDEA_ENST00000521296.1_3'UTR	NM_001279.3	NP_001270.1	O60543	CIDEA_HUMAN	cell death-inducing DFFA-like effector a						apoptotic process (GO:0006915)|cell death (GO:0008219)|lipid metabolic process (GO:0006629)|lipid storage (GO:0019915)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of execution phase of apoptosis (GO:1900118)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of sequestering of triglyceride (GO:0010890)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|response to stilbenoid (GO:0035634)|temperature homeostasis (GO:0001659)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|mitochondrial envelope (GO:0005740)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)	13						AAGCTTCCGCGATGCGAGGGG	0.692																																																	0													4.0	6.0	5.0					18																	12254815		2072	4130	6202	SO:0001627	intron_variant	0			AF041378	CCDS11856.1	18p11.21	2008-08-01			ENSG00000176194	ENSG00000176194			1976	protein-coding gene	gene with protein product		604440				9564035, 18509062	Standard	NM_001279		Approved	CIDE-A	uc002kqt.4	O60543	OTTHUMG00000131691	ENST00000320477.9:c.38+395G>A	18.37:g.12254815G>A			B0YIY7|Q6UPR7	Missense_Mutation	SNP	NULL	p.D145N	ENST00000320477.9	37	c.433	CCDS11856.1	18																																																																																			CIDEA	-	NULL	ENSG00000176194		0.692	CIDEA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CIDEA	HGNC	protein_coding	OTTHUMT00000254599.2	-	0.00	52	0	G	NM_001279		12254815	+1	tier1	-	no_errors	ENST00000522713	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.000	A
CIRBP	1153	genome.wustl.edu	37	19	1268245	1268245	+	Intron	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:1268245C>T	ENST00000588030.1	+	2	254				CIRBP_ENST00000591935.1_Intron|CIRBP_ENST00000587323.1_5'Flank|CIRBP_ENST00000585630.1_5'Flank|CIRBP_ENST00000586472.1_5'Flank|CIRBP_ENST00000588090.1_Intron|CIRBP_ENST00000413636.2_5'Flank|CIRBP_ENST00000589710.1_5'Flank|CIRBP_ENST00000587896.1_5'Flank|CIRBP_ENST00000444172.2_5'Flank|CIRBP_ENST00000588230.1_5'Flank|CIRBP_ENST00000589660.1_Intron|CIRBP_ENST00000589686.1_5'Flank|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000586773.1_5'Flank|CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000320936.5_5'Flank|CIRBP_ENST00000589235.1_5'Flank			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein						mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GACTCCTGGGCGAGGAGCAAG	0.647																																																	0																																										SO:0001627	intron_variant	0			D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.-6-2682C>T	19.37:g.1268245C>T			B3KT17|B4E2X2	RNA	SNP	-	NULL	ENST00000588030.1	37	NULL	CCDS12059.1	19																																																																																			CIRBP-AS1	-	-	ENSG00000267493		0.647	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CIRBP-AS1	HGNC	protein_coding	OTTHUMT00000449969.1	-	0.00	48	0	C	NM_001280		1268245	-1	tier1	-	no_errors	ENST00000585832	ensembl	human	known	74_37	rna	24.07	41	13	SNP	0.000	T
CNGB3	54714	genome.wustl.edu	37	8	87755756	87755756	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:87755756T>G	ENST00000320005.5	-	1	147	c.100A>C	c.(100-102)Agt>Cgt	p.S34R	CNGB3_ENST00000519777.1_5'UTR|RP11-386D6.1_ENST00000519041.1_RNA	NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	34					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						GACTGATTACTTGGGTGAGAG	0.398																																																	0													326.0	272.0	291.0					8																	87755756		2203	4300	6503	SO:0001583	missense	0			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.100A>C	8.37:g.87755756T>G	ENSP00000316605:p.Ser34Arg		C9JA51|Q9NRE9	Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.S34R	ENST00000320005.5	37	c.100	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	T	12.39	1.922325	0.33908	.	.	ENSG00000170289	ENST00000320005	T	0.30182	1.54	5.96	-0.955	0.10356	.	0.166402	0.29699	N	0.011432	T	0.19685	0.0473	L	0.43152	1.355	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.12553	-1.0543	10	0.35671	T	0.21	.	5.571	0.17196	0.0:0.1779:0.477:0.3451	.	34	Q9NQW8	CNGB3_HUMAN	R	34	ENSP00000316605:S34R	ENSP00000316605:S34R	S	-	1	0	CNGB3	87824872	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.241000	0.18065	0.140000	0.18849	0.528000	0.53228	AGT	CNGB3	-	NULL	ENSG00000170289		0.398	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	HGNC	protein_coding	OTTHUMT00000375107.1	-	0.00	71	0	T	NM_019098		87755756	-1	tier1	-	no_errors	ENST00000320005	ensembl	human	known	74_37	missense	14.08	122	20	SNP	0.000	G
CNTN1	1272	genome.wustl.edu	37	12	41337803	41337803	+	Missense_Mutation	SNP	C	C	T	rs556601462		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:41337803C>T	ENST00000551295.2	+	14	1631	c.1514C>T	c.(1513-1515)aCg>aTg	p.T505M	CNTN1_ENST00000360099.3_Missense_Mutation_p.T505M|CNTN1_ENST00000547849.1_Missense_Mutation_p.T505M|CNTN1_ENST00000347616.1_Missense_Mutation_p.T505M|CNTN1_ENST00000547702.1_Missense_Mutation_p.T505M|CNTN1_ENST00000348761.2_Missense_Mutation_p.T494M	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	505	Ig-like C2-type 6.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.T505M(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				ATAGATCCTACGCGAATTATA	0.333																																																	1	Substitution - Missense(1)	prostate(1)											84.0	75.0	78.0					12																	41337803		2203	4299	6502	SO:0001583	missense	0			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.1514C>T	12.37:g.41337803C>T	ENSP00000447006:p.Thr505Met		A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.T505M	ENST00000551295.2	37	c.1514	CCDS8737.1	12	.	.	.	.	.	.	.	.	.	.	C	15.41	2.826087	0.50739	.	.	ENSG00000018236	ENST00000547702;ENST00000551295;ENST00000547849;ENST00000347616;ENST00000360099;ENST00000348761	T;T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67;1.67	4.72	4.72	0.59763	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.63355	0.2504	M	0.89478	3.035	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.977;0.998;0.999	T	0.70741	-0.4789	10	0.62326	D	0.03	.	18.2484	0.89995	0.0:1.0:0.0:0.0	.	505;494;505	Q12860-3;Q12860-2;Q12860	.;.;CNTN1_HUMAN	M	505;505;505;505;505;494	ENSP00000448004:T505M;ENSP00000447006:T505M;ENSP00000448653:T505M;ENSP00000325660:T505M;ENSP00000353213:T505M;ENSP00000261160:T494M	ENSP00000325660:T505M	T	+	2	0	CNTN1	39624070	1.000000	0.71417	0.982000	0.44146	0.049000	0.14656	7.114000	0.77103	2.625000	0.88918	0.511000	0.50034	ACG	CNTN1	-	pfscan_Ig-like_dom	ENSG00000018236		0.333	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2	-	0.00	19	0	C	NM_001843		41337803	+1	tier1	-	no_errors	ENST00000347616	ensembl	human	known	74_37	missense	65.52	10	19	SNP	1.000	T
COLEC12	81035	genome.wustl.edu	37	18	347200	347200	+	Missense_Mutation	SNP	G	G	A	rs373113347		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr18:347200G>A	ENST00000400256.3	-	5	629	c.422C>T	c.(421-423)gCg>gTg	p.A141V		NM_130386.2	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	141					carbohydrate mediated signaling (GO:0009756)|defense response (GO:0006952)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|protein homooligomerization (GO:0051260)|receptor-mediated endocytosis (GO:0006898)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	galactose binding (GO:0005534)|low-density lipoprotein particle binding (GO:0030169)|metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	46		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				ATCCCCGCTCGCCTGTAACTT	0.463													G|||	1	0.000199681	0.0	0.0	5008	,	,		20283	0.001		0.0	False		,,,				2504	0.0																0								G	VAL/ALA	1,4405	2.1+/-5.4	0,1,2202	128.0	111.0	117.0		422	3.1	0.8	18		117	1,8599	1.2+/-3.3	0,1,4299	no	missense	COLEC12	NM_130386.2	64	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign	141/743	347200	2,13004	2203	4300	6503	SO:0001583	missense	0			AB038518	CCDS32782.1	18p11.32	2013-09-19			ENSG00000158270	ENSG00000158270		"""Collectins"""	16016	protein-coding gene	gene with protein product		607621				11162630	Standard	NM_130386		Approved	SRCL, CL-P1, SCARA4	uc002kkm.3	Q5KU26	OTTHUMG00000178145	ENST00000400256.3:c.422C>T	18.37:g.347200G>A	ENSP00000383115:p.Ala141Val		Q6P9F2|Q8TCR2|Q8WZA4|Q9BY85|Q9BYH7	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.A141V	ENST00000400256.3	37	c.422	CCDS32782.1	18	.	.	.	.	.	.	.	.	.	.	G	12.46	1.944193	0.34283	2.27E-4	1.16E-4	ENSG00000158270	ENST00000400256	T	0.46451	0.87	6.06	3.08	0.35506	.	0.291251	0.43110	D	0.000601	T	0.19565	0.0470	N	0.08118	0	0.27093	N	0.962809	B	0.02656	0.0	B	0.01281	0.0	T	0.09574	-1.0668	10	0.38643	T	0.18	-10.9155	5.5298	0.16978	0.169:0.0:0.5123:0.3187	.	141	Q5KU26	COL12_HUMAN	V	141	ENSP00000383115:A141V	ENSP00000383115:A141V	A	-	2	0	COLEC12	337200	0.993000	0.37304	0.761000	0.31378	0.922000	0.55478	2.263000	0.43293	0.910000	0.36722	0.655000	0.94253	GCG	COLEC12	-	NULL	ENSG00000158270		0.463	COLEC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC12	HGNC	protein_coding	OTTHUMT00000440746.1	-	0.00	75	0	G			347200	-1	tier1	-	no_errors	ENST00000400256	ensembl	human	known	74_37	missense	24.37	90	29	SNP	0.874	A
CPS1	1373	genome.wustl.edu	37	2	211512630	211512630	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:211512630A>C	ENST00000233072.5	+	26	3381	c.3185A>C	c.(3184-3186)aAc>aCc	p.N1062T	CPS1_ENST00000430249.2_Missense_Mutation_p.N1068T|CPS1_ENST00000497121.1_3'UTR|CPS1_ENST00000451903.2_Missense_Mutation_p.N611T	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1062					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CAGATTCCAAACAACCTGGCA	0.478																																																	0			GRCh37	CD064534	CPS1	D							98.0	92.0	94.0					2																	211512630		2203	4300	6503	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3185A>C	2.37:g.211512630A>C	ENSP00000233072:p.Asn1062Thr		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.N1068T	ENST00000233072.5	37	c.3203	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	A	22.0	4.236723	0.79800	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.97378	-4.36;-4.36;-4.36	5.59	5.59	0.84812	Pre-ATP-grasp fold (1);PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.98921	0.9634	H	0.95437	3.67	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.99643	1.0989	10	0.87932	D	0	-12.1503	16.07	0.80919	1.0:0.0:0.0:0.0	.	1072;1062	Q59HF8;P31327	.;CPSM_HUMAN	T	1068;1070;1062;611	ENSP00000402608:N1068T;ENSP00000233072:N1062T;ENSP00000406136:N611T	ENSP00000233072:N1062T	N	+	2	0	CPS1	211220875	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	8.910000	0.92685	2.254000	0.74563	0.533000	0.62120	AAC	CPS1	-	pfam_CarbamoylP_synth_lsu_N,superfamily_PreATP-grasp_dom,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.478	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	-	0.00	80	0	A			211512630	+1	tier1	-	no_errors	ENST00000430249	ensembl	human	known	74_37	missense	16.28	72	14	SNP	1.000	C
CPS1	1373	genome.wustl.edu	37	2	211542621	211542621	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:211542621T>G	ENST00000233072.5	+	38	4611	c.4415T>G	c.(4414-4416)cTt>cGt	p.L1472R	CPS1_ENST00000430249.2_Missense_Mutation_p.L1478R|CPS1_ENST00000451903.2_Missense_Mutation_p.L1021R	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1472					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	GTGACCAAACTTTTTGCTGAA	0.428																																																	0													220.0	232.0	228.0					2																	211542621		2203	4300	6503	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.4415T>G	2.37:g.211542621T>G	ENSP00000233072:p.Leu1472Arg		B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_dom,superfamily_MGS-like_dom,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.L1478R	ENST00000233072.5	37	c.4433	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	T	22.5	4.292209	0.80914	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.87334	-2.24;-2.24;-2.24	5.58	5.58	0.84498	Methylglyoxal synthase-like domain (2);	0.000000	0.85682	D	0.000000	T	0.80602	0.4654	N	0.08118	0	0.53688	D	0.999973	P;P	0.51449	0.945;0.945	P;P	0.47206	0.541;0.541	D	0.85259	0.1049	10	0.87932	D	0	-9.5405	15.7349	0.77834	0.0:0.0:0.0:1.0	.	1482;1472	Q59HF8;P31327	.;CPSM_HUMAN	R	1478;1480;1472;1021	ENSP00000402608:L1478R;ENSP00000233072:L1472R;ENSP00000406136:L1021R	ENSP00000233072:L1472R	L	+	2	0	CPS1	211250866	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.174000	0.77620	2.112000	0.64535	0.533000	0.62120	CTT	CPS1	-	superfamily_MGS-like_dom,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.428	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	-	0.00	23	0	T			211542621	+1	tier1	-	no_errors	ENST00000430249	ensembl	human	known	74_37	missense	39.29	34	22	SNP	1.000	G
CPSF1	29894	genome.wustl.edu	37	8	145624696	145624696	+	Silent	SNP	C	C	G	rs370872969		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:145624696C>G	ENST00000349769.3	-	14	1456	c.1362G>C	c.(1360-1362)tcG>tcC	p.S454S	MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	454					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GCTGTGTTCCCGACTGGGCCT	0.657																																					NSCLC(133;1088 1848 27708 34777 35269)												0													42.0	37.0	39.0					8																	145624696		2202	4300	6502	SO:0001819	synonymous_variant	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.1362G>C	8.37:g.145624696C>G			Q96AF0	Silent	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.S454	ENST00000349769.3	37	c.1362	CCDS34966.1	8																																																																																			CPSF1	-	NULL	ENSG00000071894		0.657	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	-	0.00	48	0	C	NM_013291		145624696	-1	tier1	-	no_errors	ENST00000349769	ensembl	human	known	74_37	silent	5.00	76	4	SNP	0.017	G
CR1	1378	genome.wustl.edu	37	1	207755263	207755263	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:207755263G>T	ENST00000367049.4	+	32	5217	c.5217G>T	c.(5215-5217)ggG>ggT	p.G1739G	CR1_ENST00000367052.1_Splice_Site_p.G1289G|RP11-78B10.2_ENST00000597497.1_RNA|CR1_ENST00000400960.2_Splice_Site_p.G1289G|CR1_ENST00000367053.1_Splice_Site_p.G1289G|RP11-78B10.2_ENST00000596003.1_RNA|CR1_ENST00000367051.1_Splice_Site_p.G1289G	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1289	Sushi 27. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TGTTCTTTAGGTTTCGCTTAA	0.433																																																	0													182.0	185.0	184.0					1																	207755263		1971	4155	6126	SO:0001630	splice_region_variant	0			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.5217-1G>T	1.37:g.207755263G>T			Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.G1739	ENST00000367049.4	37	c.5217	CCDS44308.1	1																																																																																			CR1	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000203710		0.433	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	HGNC	protein_coding	OTTHUMT00000382527.1	-	0.00	149	0	G	NM_000573	Silent	207755263	+1	tier1	-	no_errors	ENST00000367049	ensembl	human	known	74_37	silent	14.51	165	28	SNP	0.998	T
CRHR1	1394	genome.wustl.edu	37	17	43718893	43718893	+	Intron	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:43718893C>T	ENST00000293493.7	+	2	396				RP11-105N13.4_ENST00000587305.1_RNA|CRHR1_ENST00000339069.5_Intron	NM_001256299.1	NP_001243228.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1						activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		ttgctggaggccacatggctg	0.483																																					Ovarian(110;57 1568 10207 38216 49865)												0																																										SO:0001627	intron_variant	0			L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000293493.7:c.-493+11369C>T	17.37:g.43718893C>T			B4DIE9|Q13008|Q4QRJ1|Q9UK64	RNA	SNP	-	NULL	ENST00000293493.7	37	NULL	CCDS58556.1	17	.	.	.	.	.	.	.	.	.	.	.	6.499	0.460224	0.12342	.	.	ENSG00000167159	ENST00000300525	.	.	.	1.96	1.96	0.26148	.	.	.	.	.	T	0.47488	0.1448	.	.	.	0.29814	N	0.831391	.	.	.	.	.	.	T	0.51545	-0.8692	5	0.87932	D	0	.	7.4216	0.27075	0.0:1.0:0.0:0.0	.	.	.	.	S	49	.	ENSP00000300525:P49S	P	+	1	0	C17orf69	41074676	0.003000	0.15002	0.352000	0.25734	0.097000	0.18754	0.496000	0.22499	1.426000	0.47256	0.407000	0.27541	CCA	CRHR1-IT1	-	-	ENSG00000204650		0.483	CRHR1-201	KNOWN	basic|CCDS	protein_coding	CRHR1-IT1	HGNC	protein_coding		-	0.00	22	0	C			43718893	+1	tier1	-	no_errors	ENST00000578000	ensembl	human	known	74_37	rna	32.35	23	11	SNP	0.395	T
CSMD1	64478	genome.wustl.edu	37	8	3855585	3855585	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:3855585A>C	ENST00000520002.1	-	5	1213	c.658T>G	c.(658-660)Tcc>Gcc	p.S220A	CSMD1_ENST00000542608.1_Missense_Mutation_p.S220A|CSMD1_ENST00000400186.3_Missense_Mutation_p.S220A|CSMD1_ENST00000602557.1_Missense_Mutation_p.S220A|CSMD1_ENST00000539096.1_Missense_Mutation_p.S220A|CSMD1_ENST00000537824.1_Missense_Mutation_p.S220A|CSMD1_ENST00000602723.1_Missense_Mutation_p.S220A			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	220	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGCGGGCTGGAGATGGAGCTG	0.567																																																	0													41.0	43.0	42.0					8																	3855585		2101	4258	6359	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.658T>G	8.37:g.3855585A>C	ENSP00000430733:p.Ser220Ala		Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.S220A	ENST00000520002.1	37	c.658		8	.	.	.	.	.	.	.	.	.	.	A	13.51	2.259441	0.39995	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608;ENST00000539096	T;T;T;T;T	0.18174	2.23;2.23;2.23;2.23;2.23	5.45	5.45	0.79879	.	0.000000	0.27336	U	0.019839	T	0.16854	0.0405	L	0.44542	1.39	0.25763	N	0.984926	B	0.23735	0.09	B	0.27715	0.082	T	0.16482	-1.0401	10	0.17369	T	0.5	-25.9043	14.6967	0.69126	1.0:0.0:0.0:0.0	.	220	E5RIG2	.	A	220;220;82;220;220;220	ENSP00000383047:S220A;ENSP00000430733:S220A;ENSP00000441462:S220A;ENSP00000446243:S220A;ENSP00000441675:S220A	ENSP00000320445:S82A	S	-	1	0	CSMD1	3842993	0.984000	0.35163	0.985000	0.45067	0.931000	0.56810	2.434000	0.44802	2.063000	0.61619	0.533000	0.62120	TCC	CSMD1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000183117		0.567	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	-	0.00	55	0	A	NM_033225		3855585	-1	tier1	-	no_errors	ENST00000520002	ensembl	human	known	74_37	missense	33.33	44	22	SNP	0.985	C
CSMD3	114788	genome.wustl.edu	37	8	113249528	113249528	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:113249528A>C	ENST00000297405.5	-	67	10762	c.10518T>G	c.(10516-10518)aaT>aaG	p.N3506K	CSMD3_ENST00000343508.3_Missense_Mutation_p.N3466K|CSMD3_ENST00000352409.3_Missense_Mutation_p.N3436K|CSMD3_ENST00000455883.2_Missense_Mutation_p.N3337K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3506						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTCCTTTGAAATTGTAAGAGC	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													162.0	148.0	153.0					8																	113249528		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10518T>G	8.37:g.113249528A>C	ENSP00000297405:p.Asn3506Lys		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.N3506K	ENST00000297405.5	37	c.10518	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	A	13.16	2.153785	0.38021	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.23950	2.2;2.2;2.21;1.88;2.21	4.77	2.38	0.29361	.	0.152378	0.42548	D	0.000693	T	0.14830	0.0358	L	0.29908	0.895	0.36294	D	0.856563	B;B;B	0.33883	0.43;0.19;0.178	B;B;B	0.33454	0.164;0.05;0.108	T	0.17745	-1.0359	10	0.10636	T	0.68	.	8.75	0.34609	0.7707:0.0:0.2293:0.0	.	3337;3506;3466	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	K	3466;3506;2776;3337;3436	ENSP00000345799:N3466K;ENSP00000297405:N3506K;ENSP00000341558:N2776K;ENSP00000412263:N3337K;ENSP00000343124:N3436K	ENSP00000297405:N3506K	N	-	3	2	CSMD3	113318704	1.000000	0.71417	1.000000	0.80357	0.689000	0.40095	0.863000	0.27913	0.330000	0.23485	0.383000	0.25322	AAT	CSMD3	-	NULL	ENSG00000164796		0.358	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	58	0	A	NM_052900		113249528	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	32.86	47	23	SNP	1.000	C
CSTF1	1477	genome.wustl.edu	37	20	54978617	54978617	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr20:54978617G>A	ENST00000217109.4	+	6	1482	c.1130G>A	c.(1129-1131)aGt>aAt	p.S377N	CSTF1_ENST00000493039.1_3'UTR	NM_001033521.1|NM_001324.2	NP_001028693.1|NP_001315.1	Q05048	CSTF1_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kDa	377					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|skin(1)	15			Colorectal(105;0.202)			AGGACGATCAGTCTTTGCTGC	0.592																																																	0													123.0	97.0	106.0					20																	54978617		2203	4300	6503	SO:0001583	missense	0				CCDS13452.1	20q13.31	2013-01-10	2002-08-29		ENSG00000101138	ENSG00000101138		"""WD repeat domain containing"""	2483	protein-coding gene	gene with protein product		600369	"""cleavage stimulation factor, 3' pre-RNA, subunit 1, 50kD"""			1358884, 11257228	Standard	NM_001033521		Approved		uc002xxl.1	Q05048	OTTHUMG00000032791	ENST00000217109.4:c.1130G>A	20.37:g.54978617G>A	ENSP00000217109:p.Ser377Asn		Q5QPD8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S377N	ENST00000217109.4	37	c.1130	CCDS13452.1	20	.	.	.	.	.	.	.	.	.	.	G	19.23	3.787156	0.70337	.	.	ENSG00000101138	ENST00000217109;ENST00000425890	D	0.81821	-1.54	5.45	5.45	0.79879	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.82651	0.5083	M	0.79475	2.455	0.80722	D	1	B	0.22746	0.074	B	0.21360	0.034	T	0.80020	-0.1557	10	0.59425	D	0.04	-18.0584	19.7157	0.96119	0.0:0.0:1.0:0.0	.	377	Q05048	CSTF1_HUMAN	N	377;364	ENSP00000217109:S377N	ENSP00000217109:S377N	S	+	2	0	CSTF1	54412024	1.000000	0.71417	0.999000	0.59377	0.895000	0.52256	7.569000	0.82380	2.723000	0.93209	0.650000	0.86243	AGT	CSTF1	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000101138		0.592	CSTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF1	HGNC	protein_coding	OTTHUMT00000079794.2	-	0.00	53	0	G	NM_001033521		54978617	+1	tier1	-	no_errors	ENST00000217109	ensembl	human	known	74_37	missense	10.13	71	8	SNP	1.000	A
CXXC4	80319	genome.wustl.edu	37	4	105393329	105393330	+	IGR	INS	-	-	T	rs71600293|rs34493088	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:105393329_105393330insT	ENST00000426831.1	-	0	746				CXXC4_ENST00000466963.1_5'UTR|CXXC4_ENST00000394767.2_3'UTR			Q9H2H0	CXXC4_HUMAN	CXXC finger protein 4						negative regulation of Wnt signaling pathway (GO:0030178)|Wnt signaling pathway (GO:0016055)|zygotic specification of dorsal/ventral axis (GO:0007352)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic vesicle (GO:0031410)	DNA binding (GO:0003677)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				OV - Ovarian serous cystadenocarcinoma(123;3.05e-08)		ttcttttcctcttttttttttt	0.282														2229	0.445088	0.4743	0.4352	5008	,	,		18537	0.3641		0.4612	False		,,,				2504	0.4796																0																																										SO:0001628	intergenic_variant	0				CCDS3665.1, CCDS3665.2	4q22-q24	2014-02-18	2011-12-01		ENSG00000168772	ENSG00000168772			24593	protein-coding gene	gene with protein product	"""Dvl-binding protein IDAX (inhibition of the Dvl and Axin complex)"""	611645				11113207	Standard	NM_025212		Approved	IDAX	uc003hxf.2	Q9H2H0	OTTHUMG00000131121		4.37:g.105393340_105393340dupT				RNA	INS	-	NULL	ENST00000426831.1	37	NULL		4																																																																																			CXXC4	-	-	ENSG00000168772		0.282	CXXC4-201	KNOWN	basic	protein_coding	CXXC4	HGNC	protein_coding			0.00	26	0	-	NM_025212		105393330	-1	tier1		no_errors	ENST00000466963	ensembl	human	known	74_37	rna	24.39	31	10	INS	0.000:0.073	T
CYLC1	1538	genome.wustl.edu	37	X	83124910	83124910	+	Missense_Mutation	SNP	C	C	T	rs547571553		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:83124910C>T	ENST00000329312.4	+	2	92	c.55C>T	c.(55-57)Cca>Tca	p.P19S		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	19					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						TAATTCCATTCCAAGTAAGAA	0.229																																																	0													9.0	9.0	9.0					X																	83124910		1925	3910	5835	SO:0001583	missense	0			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.55C>T	X.37:g.83124910C>T	ENSP00000331556:p.Pro19Ser		A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	NULL	p.P19S	ENST00000329312.4	37	c.55	CCDS35341.1	X	.	.	.	.	.	.	.	.	.	.	c	7.278	0.608532	0.14002	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.47177	0.85	4.85	0.867	0.19085	.	.	.	.	.	T	0.29061	0.0722	L	0.35644	1.08	0.09310	N	1	P;P	0.36392	0.551;0.551	B;B	0.31751	0.135;0.135	T	0.16660	-1.0395	9	0.10636	T	0.68	0.047	7.0333	0.24979	0.0:0.5632:0.0:0.4368	.	19;19	P35663;F5H4V5	CYLC1_HUMAN;.	S	19	ENSP00000331556:P19S	ENSP00000331556:P19S	P	+	1	0	CYLC1	83011566	0.032000	0.19561	0.057000	0.19452	0.526000	0.34562	-0.283000	0.08433	-0.087000	0.12528	0.513000	0.50165	CCA	CYLC1	-	NULL	ENSG00000183035		0.229	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYLC1	HGNC	protein_coding	OTTHUMT00000057371.1	-	0.00	143	0	C	NM_021118		83124910	+1	tier1	-	no_errors	ENST00000329312	ensembl	human	known	74_37	missense	6.51	158	11	SNP	0.084	T
DBT	1629	genome.wustl.edu	37	1	100681541	100681541	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:100681541T>G	ENST00000370132.4	-	6	783	c.770A>C	c.(769-771)aAa>aCa	p.K257T	DBT_ENST00000370131.3_Missense_Mutation_p.K257T	NM_001918.3	NP_001909.3	P11182	ODB2_HUMAN	dihydrolipoamide branched chain transacylase E2	257					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	dihydrolipoyllysine-residue (2-methylpropanoyl)transferase activity (GO:0043754)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|pancreas(1)|prostate(1)|skin(1)	19		all_epithelial(167;5.4e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.0739)|all cancers(265;0.123)|COAD - Colon adenocarcinoma(174;0.154)|Lung(183;0.199)		ATCATTACCTTTTATGGGTTC	0.348																																																	0													152.0	153.0	153.0					1																	100681541		2203	4300	6503	SO:0001583	missense	0			BC016675	CCDS767.1	1p31	2008-02-05	2004-11-15		ENSG00000137992	ENSG00000137992			2698	protein-coding gene	gene with protein product		248610	"""dihydrolipoamide branched chain transacylase (E2 component of branched chain keto acid dehydrogenase complex; maple syrup urine disease)"""			1420314, 1429740	Standard	NM_001918		Approved		uc001dta.3	P11182	OTTHUMG00000010921	ENST00000370132.4:c.770A>C	1.37:g.100681541T>G	ENSP00000359151:p.Lys257Thr		B2R811|Q5VVL8	Missense_Mutation	SNP	pfam_2-oxoacid_DH_actylTfrase,pfam_Biotin_lipoyl,pfam_E3-bd,superfamily_Single_hybrid_motif,superfamily_E3-bd,pfscan_Biotin_lipoyl	p.K257T	ENST00000370132.4	37	c.770	CCDS767.1	1	.	.	.	.	.	.	.	.	.	.	t	11.89	1.772464	0.31411	.	.	ENSG00000137992	ENST00000543138;ENST00000370132;ENST00000370131	T;T	0.40225	1.04;1.04	5.66	1.63	0.23807	2-oxoacid dehydrogenase acyltransferase, catalytic domain (1);Chloramphenicol acetyltransferase-like domain (1);	0.241085	0.47852	N	0.000209	T	0.09730	0.0239	N	0.04508	-0.205	0.52099	D	0.999949	B;B	0.02656	0.0;0.0	B;B	0.11329	0.002;0.006	T	0.05818	-1.0862	10	0.29301	T	0.29	-11.982	14.8904	0.70604	0.0:0.0:0.5837:0.4163	.	76;257	F5H1F9;P11182	.;ODB2_HUMAN	T	76;257;257	ENSP00000359151:K257T;ENSP00000359150:K257T	ENSP00000359150:K257T	K	-	2	0	DBT	100454129	1.000000	0.71417	0.949000	0.38748	0.991000	0.79684	2.466000	0.45084	0.482000	0.27582	0.524000	0.50904	AAA	DBT	-	pfam_2-oxoacid_DH_actylTfrase	ENSG00000137992		0.348	DBT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBT	HGNC	protein_coding	OTTHUMT00000030101.2	-	0.00	67	0	T	NM_001918		100681541	-1	tier1	-	no_errors	ENST00000370132	ensembl	human	known	74_37	missense	51.22	40	42	SNP	1.000	G
DEFB118	117285	genome.wustl.edu	37	20	29960724	29960724	+	Silent	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr20:29960724A>T	ENST00000253381.2	+	2	156	c.123A>T	c.(121-123)ggA>ggT	p.G41G		NM_054112.2	NP_473453.1	Q96PH6	DB118_HUMAN	defensin, beta 118	41					cell-matrix adhesion (GO:0007160)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				breast(1)|endometrium(1)|lung(7)|ovary(3)|pancreas(1)|prostate(1)	14	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GCAAAGATGGAGAAGCAGTGA	0.438																																																	0													123.0	111.0	115.0					20																	29960724		2203	4300	6503	SO:0001819	synonymous_variant	0			AF347073	CCDS13177.1	20q11.21	2008-02-01	2002-05-09	2002-05-10	ENSG00000131068	ENSG00000131068		"""Defensins, beta"""	16196	protein-coding gene	gene with protein product		607650	"""chromosome 20 open reading frame 63"""	C20orf63		11564719, 15033915	Standard	NM_054112		Approved	dJ1018D12.3, DEFB-18, ESC42	uc002wvr.3	Q96PH6	OTTHUMG00000032161	ENST00000253381.2:c.123A>T	20.37:g.29960724A>T			Q17RC4|Q8N691|Q9NUH0	Silent	SNP	NULL	p.G41	ENST00000253381.2	37	c.123	CCDS13177.1	20																																																																																			DEFB118	-	NULL	ENSG00000131068		0.438	DEFB118-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB118	HGNC	protein_coding	OTTHUMT00000078501.2	-	0.00	37	0	A	NM_054112		29960724	+1	tier1	-	no_errors	ENST00000253381	ensembl	human	known	74_37	silent	20.73	65	17	SNP	0.000	T
DGCR14	8220	genome.wustl.edu	37	22	19121821	19121821	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr22:19121821C>T	ENST00000252137.6	-	10	1362	c.1319G>A	c.(1318-1320)aGc>aAc	p.S440N		NM_022719.2	NP_073210.1	Q96DF8	DGC14_HUMAN	DiGeorge syndrome critical region gene 14	440					mRNA splicing, via spliceosome (GO:0000398)|nervous system development (GO:0007399)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)	16	Colorectal(54;0.0993)					CGCCGGTGTGCTTGTGGGGGT	0.682																																																	0													66.0	61.0	63.0					22																	19121821		2203	4299	6502	SO:0001583	missense	0			L77566	CCDS13756.1	22q11.21	2007-02-20			ENSG00000100056	ENSG00000100056			16817	protein-coding gene	gene with protein product		601755	"""DiGeorge syndrome critical region gene 13"""	DGCR13		8776594, 9063747	Standard	NM_022719		Approved	DGSI, Es2el, ES2, DGS-H	uc002zou.3	Q96DF8	OTTHUMG00000150119	ENST00000252137.6:c.1319G>A	22.37:g.19121821C>T	ENSP00000252137:p.Ser440Asn		Q49AH7|Q9BTZ4	Missense_Mutation	SNP	pfam_Nuclear_protein_DGCR14	p.S440N	ENST00000252137.6	37	c.1319	CCDS13756.1	22	.	.	.	.	.	.	.	.	.	.	C	12.48	1.949342	0.34377	.	.	ENSG00000100056	ENST00000252137	T	0.24350	1.86	4.57	4.57	0.56435	.	0.410909	0.27469	N	0.019226	T	0.11024	0.0269	N	0.03608	-0.345	0.38272	D	0.942185	B	0.14438	0.01	B	0.15870	0.014	T	0.19976	-1.0289	10	0.17369	T	0.5	-7.3885	11.3407	0.49531	0.3053:0.6947:0.0:0.0	.	440	Q96DF8	DGC14_HUMAN	N	440	ENSP00000252137:S440N	ENSP00000252137:S440N	S	-	2	0	DGCR14	17501821	0.982000	0.34865	0.994000	0.49952	0.851000	0.48451	2.498000	0.45363	2.374000	0.81015	0.591000	0.81541	AGC	DGCR14	-	NULL	ENSG00000100056		0.682	DGCR14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGCR14	HGNC	protein_coding	OTTHUMT00000316432.2	-	0.00	156	0	C			19121821	-1	tier1	-	no_errors	ENST00000252137	ensembl	human	known	74_37	missense	7.73	178	15	SNP	0.993	T
DGUOK	1716	genome.wustl.edu	37	2	74184313	74184313	+	Missense_Mutation	SNP	A	A	T	rs137902450	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:74184313A>T	ENST00000264093.4	+	5	738	c.653A>T	c.(652-654)tAt>tTt	p.Y218F	DGUOK_ENST00000356837.6_Missense_Mutation_p.Y196F|DGUOK-AS1_ENST00000413452.1_RNA|DGUOK-AS1_ENST00000453103.1_RNA|DGUOK_ENST00000348222.1_Intron|DGUOK-AS1_ENST00000439192.1_RNA|DGUOK_ENST00000462685.1_Intron	NM_080916.2	NP_550438.1	Q16854	DGUOK_HUMAN	deoxyguanosine kinase	218					deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|dGTP metabolic process (GO:0046070)|guanosine metabolic process (GO:0008617)|negative regulation of neuron projection development (GO:0010977)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide biosynthetic process (GO:0009165)|protein phosphorylation (GO:0006468)|purine deoxyribonucleoside metabolic process (GO:0046122)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|deoxyguanosine kinase activity (GO:0004138)|nucleoside kinase activity (GO:0019206)			endometrium(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	8					Nelarabine(DB01280)	GAGCTGGCCTATCTAGAGCAG	0.507																																																	0													91.0	78.0	83.0					2																	74184313		2203	4300	6503	SO:0001583	missense	0			U41668	CCDS1931.1, CCDS1932.1	2p13	2008-02-05			ENSG00000114956	ENSG00000114956	2.7.1.113		2858	protein-coding gene	gene with protein product		601465					Standard	NM_080916		Approved	dGK	uc002sjx.3	Q16854	OTTHUMG00000129819	ENST00000264093.4:c.653A>T	2.37:g.74184313A>T	ENSP00000264093:p.Tyr218Phe		P78532|Q16759|Q4ZG09|Q7L1W9|Q96BC1	Missense_Mutation	SNP	pfam_Deoxynucleoside_kinase,superfamily_P-loop_NTPase	p.Y218F	ENST00000264093.4	37	c.653	CCDS1931.1	2	.	.	.	.	.	.	.	.	.	.	A	24.4	4.529436	0.85706	.	.	ENSG00000114956	ENST00000264093;ENST00000356837;ENST00000347161	D;D	0.99851	-7.17;-7.17	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.99862	0.9935	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96356	0.9262	10	0.87932	D	0	-13.1969	13.9466	0.64089	1.0:0.0:0.0:0.0	.	218	Q16854	DGUOK_HUMAN	F	218;196;180	ENSP00000264093:Y218F;ENSP00000349294:Y196F	ENSP00000264093:Y218F	Y	+	2	0	DGUOK	74037821	1.000000	0.71417	0.987000	0.45799	0.913000	0.54294	7.686000	0.84128	1.952000	0.56665	0.459000	0.35465	TAT	DGUOK	-	pfam_Deoxynucleoside_kinase,superfamily_P-loop_NTPase	ENSG00000114956		0.507	DGUOK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGUOK	HGNC	protein_coding	OTTHUMT00000252050.1	-	0.00	26	0	A			74184313	+1	tier1	-	no_errors	ENST00000264093	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
DKC1	1736	genome.wustl.edu	37	X	154002914	154002914	+	Missense_Mutation	SNP	T	T	C	rs199422253		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:154002914T>C	ENST00000369550.5	+	12	1403	c.1193T>C	c.(1192-1194)cTg>cCg	p.L398P	DKC1_ENST00000475966.1_3'UTR|SNORA56_ENST00000383966.1_RNA	NM_001142463.1|NM_001363.3	NP_001135935.1|NP_001354.1	O60832	DKC1_HUMAN	dyskeratosis congenita 1, dyskerin	398					cell proliferation (GO:0008283)|pseudouridine synthesis (GO:0001522)|RNA processing (GO:0006396)|rRNA processing (GO:0006364)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)|telomerase activity (GO:0003720)			breast(2)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)	15	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CAGGGCCTTCTGGACAAGCAT	0.537									Congenital Dyskeratosis																																								0													94.0	70.0	78.0					X																	154002914		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AJ224481	CCDS14761.1, CCDS76062.1	Xq28	2014-09-17			ENSG00000130826	ENSG00000130826			2890	protein-coding gene	gene with protein product		300126		DKC		9590285, 9888995	Standard	NM_001142463		Approved	XAP101, dyskerin, NAP57, NOLA4	uc004fmm.3	O60832	OTTHUMG00000024242	ENST00000369550.5:c.1193T>C	X.37:g.154002914T>C	ENSP00000358563:p.Leu398Pro		F5BSB3|O43845|Q96G67|Q9Y505	Missense_Mutation	SNP	pfam_Dyskerin-like,pfam_PsdUridine_synth,pfam_PUA,superfamily_PsdUridine_synth_cat_dom,superfamily_PUA-like_domain,smart_PUA,pfscan_PUA,tigrfam_tRNA_PsdUridine_synth_B_fam,tigrfam_Uncharacterised_CHP00451	p.L398P	ENST00000369550.5	37	c.1193	CCDS14761.1	X	.	.	.	.	.	.	.	.	.	.	T	20.5	4.007315	0.75046	.	.	ENSG00000130826	ENST00000369550	D	0.96491	-4.03	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.98298	0.9436	M	0.89840	3.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.99282	1.0896	10	0.87932	D	0	-15.6068	13.441	0.61112	0.0:0.0:0.0:1.0	.	398;398	A8MUT5;O60832	.;DKC1_HUMAN	P	398	ENSP00000358563:L398P	ENSP00000358563:L398P	L	+	2	0	DKC1	153656108	1.000000	0.71417	0.998000	0.56505	0.817000	0.46193	7.618000	0.83043	1.853000	0.53794	0.486000	0.48141	CTG	DKC1	-	NULL	ENSG00000130826		0.537	DKC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKC1	HGNC	protein_coding	OTTHUMT00000061180.5	-	0.00	30	0	T	NM_001363		154002914	+1	tier1	rs199422253	no_errors	ENST00000369550	ensembl	human	known	74_37	missense	15.15	56	10	SNP	1.000	C
DLGAP2	9228	genome.wustl.edu	37	8	1497818	1497818	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:1497818A>C	ENST00000421627.2	+	2	1093	c.959A>C	c.(958-960)aAg>aCg	p.K320T		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	399					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CAGGACGCCAAGCCCGCCCTG	0.627																																																	0													6.0	6.0	6.0					8																	1497818		2015	4090	6105	SO:0001583	missense	0			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.959A>C	8.37:g.1497818A>C	ENSP00000400258:p.Lys320Thr		A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	pfam_GKAP	p.K320T	ENST00000421627.2	37	c.959	CCDS47760.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.39|13.39	2.223952|2.223952	0.39300|0.39300	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	D|.	0.89050|.	-2.46|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.77922|0.77922	0.4203|0.4203	M|M	0.84219|0.84219	2.685|2.685	0.36299|0.36299	D|D	0.856885|0.856885	D;D|.	0.76494|.	0.999;0.999|.	D;P|.	0.66847|.	0.947;0.886|.	D|D	0.84277|0.84277	0.0492|0.0492	10|5	0.22706|.	T|.	0.39|.	-16.3948|-16.3948	15.4486|15.4486	0.75253|0.75253	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	399;399|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	T|R	365;320|337	ENSP00000400258:K320T|.	ENSP00000348366:K365T|.	K|S	+|+	2|1	0|0	DLGAP2|DLGAP2	1485225|1485225	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.176000|0.176000	0.22953|0.22953	6.660000|6.660000	0.74417|0.74417	2.040000|2.040000	0.60383|0.60383	0.533000|0.533000	0.62120|0.62120	AAG|AGC	DLGAP2	-	NULL	ENSG00000198010		0.627	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP2	HGNC	protein_coding	OTTHUMT00000374478.1	-	0.00	43	0	A	NM_004745		1497818	+1	tier1	-	no_errors	ENST00000421627	ensembl	human	known	74_37	missense	10.42	43	5	SNP	1.000	C
DNAH5	1767	genome.wustl.edu	37	5	13717530	13717530	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:13717530T>C	ENST00000265104.4	-	73	12703	c.12599A>G	c.(12598-12600)aAg>aGg	p.K4200R		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4200	AAA 6. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K4200T(1)		NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGCACCGAACTTGCGCCTCTC	0.552									Kartagener syndrome																																								1	Substitution - Missense(1)	pancreas(1)											70.0	64.0	66.0					5																	13717530		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.12599A>G	5.37:g.13717530T>C	ENSP00000265104:p.Lys4200Arg		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.K4200R	ENST00000265104.4	37	c.12599	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	T	26.7	4.759950	0.89932	.	.	ENSG00000039139	ENST00000265104	T	0.08984	3.03	5.45	5.45	0.79879	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.35711	0.0941	M	0.89478	3.035	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.35375	-0.9791	10	0.62326	D	0.03	.	15.5182	0.75842	0.0:0.0:0.0:1.0	.	4200	Q8TE73	DYH5_HUMAN	R	4200	ENSP00000265104:K4200R	ENSP00000265104:K4200R	K	-	2	0	DNAH5	13770530	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	8.020000	0.88740	2.067000	0.61834	0.533000	0.62120	AAG	DNAH5	-	pfam_Dynein_heavy_dom	ENSG00000039139		0.552	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	30	0	T	NM_001369		13717530	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	54.17	11	13	SNP	1.000	C
DRD3	1814	genome.wustl.edu	37	3	113850244	113850244	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:113850244G>A	ENST00000460779.1	-	7	1016	c.727C>T	c.(727-729)Ctc>Ttc	p.L243F	DRD3_ENST00000467632.1_Missense_Mutation_p.L243F|DRD3_ENST00000295881.7_Missense_Mutation_p.L243F|DRD3_ENST00000383673.2_Missense_Mutation_p.L243F	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	243					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	TCAGGAGAGAGGGTCTGCAGG	0.507																																																	0													91.0	96.0	94.0					3																	113850244		2203	4300	6503	SO:0001583	missense	0				CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.727C>T	3.37:g.113850244G>A	ENSP00000419402:p.Leu243Phe		A1A4V5|Q4VBM8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Dopamine_D3_rcpt,prints_GPCR_Rhodpsn,prints_Dopamine_rcpt	p.L243F	ENST00000460779.1	37	c.727	CCDS2978.1	3	.	.	.	.	.	.	.	.	.	.	G	7.475	0.647438	0.14516	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673;ENST00000281274;ENST00000295881	T;T;T;T	0.73363	-0.74;-0.74;-0.74;-0.67	5.64	4.7	0.59300	GPCR, rhodopsin-like superfamily (1);	1.695290	0.02965	N	0.143709	T	0.70185	0.3195	L	0.31371	0.925	0.28314	N	0.922552	B;P;B;B	0.36144	0.089;0.539;0.283;0.406	B;B;B;B	0.36766	0.116;0.232;0.226;0.232	T	0.61715	-0.7006	10	0.54805	T	0.06	.	13.6703	0.62420	0.0:0.0:0.8079:0.1921	.	243;243;243;243	A1A4V4;A8K8E4;P35462;E9PCM4	.;.;DRD3_HUMAN;.	F	243	ENSP00000419402:L243F;ENSP00000420662:L243F;ENSP00000373169:L243F;ENSP00000295881:L243F	ENSP00000281274:L243F	L	-	1	0	DRD3	115332934	1.000000	0.71417	0.997000	0.53966	0.934000	0.57294	3.349000	0.52217	2.937000	0.99478	0.650000	0.86243	CTC	DRD3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000151577		0.507	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD3	HGNC	protein_coding	OTTHUMT00000354699.1	-	0.00	62	0	G	NM_000796.3		113850244	-1	tier1	-	no_errors	ENST00000383673	ensembl	human	known	74_37	missense	8.33	76	7	SNP	0.620	A
DSEL	92126	genome.wustl.edu	37	18	65179356	65179356	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr18:65179356T>G	ENST00000310045.7	-	2	3993	c.2520A>C	c.(2518-2520)aaA>aaC	p.K840N	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	830					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				TCCTTGTCCATTTTGCACAAA	0.428																																																	0													145.0	140.0	142.0					18																	65179356		2203	4300	6503	SO:0001583	missense	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.2520A>C	18.37:g.65179356T>G	ENSP00000310565:p.Lys840Asn		Q17RH1|Q6P5Z3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,superfamily_Chondroitin_lyas	p.K840N	ENST00000310045.7	37	c.2520	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	T	18.58	3.653942	0.67472	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.22743	1.94	4.99	-1.99	0.07457	.	0.257709	0.31747	U	0.007136	T	0.13586	0.0329	L	0.34521	1.04	0.39453	D	0.967439	B	0.20550	0.046	B	0.14578	0.011	T	0.07443	-1.0772	10	0.45353	T	0.12	.	10.8467	0.46746	0.0:0.4838:0.0:0.5162	.	830	Q8IZU8	DSEL_HUMAN	N	840;830	ENSP00000310565:K840N	ENSP00000310565:K840N	K	-	3	2	DSEL	63330336	0.160000	0.22878	0.965000	0.40720	0.895000	0.52256	-0.529000	0.06186	-0.354000	0.08212	0.379000	0.24179	AAA	DSEL	-	NULL	ENSG00000171451		0.428	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	-	0.00	36	0	T	NM_032160		65179356	-1	tier1	-	no_errors	ENST00000310045	ensembl	human	known	74_37	missense	22.03	46	13	SNP	0.963	G
EDA2R	60401	genome.wustl.edu	37	X	65824292	65824293	+	Nonsense_Mutation	DNP	GT	GT	TA	rs186691097		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G|T	G|T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:65824292_65824293GT>TA	ENST00000374719.3	-	4	378_379	c.322_323AC>TA	c.(322-324)ACg>TAg	p.T108*	EDA2R_ENST00000253392.5_Nonsense_Mutation_p.T108*|EDA2R_ENST00000451436.2_Intron|EDA2R_ENST00000450752.1_Nonsense_Mutation_p.T108*|EDA2R_ENST00000396050.1_Nonsense_Mutation_p.T108*|EDA2R_ENST00000456230.2_Nonsense_Mutation_p.T108*	NM_021783.3	NP_068555	Q9HAV5	TNR27_HUMAN	ectodysplasin A2 receptor	108					cell differentiation (GO:0030154)|embryo development (GO:0009790)|epidermis development (GO:0008544)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						GGTCTGCTTCGTGCACGGGATG	0.515																																																	0																																										SO:0001587	stop_gained	0			AF298812	CCDS14386.1, CCDS56603.1	Xq11.1	2013-05-22			ENSG00000131080	ENSG00000131080		"""Tumor necrosis factor receptor superfamily"""	17756	protein-coding gene	gene with protein product		300276				11039935	Standard	NM_021783		Approved	XEDAR, EDA-A2R, EDAA2R, TNFRSF27	uc004dwt.2	Q9HAV5	OTTHUMG00000021736	ENST00000374719.3:c.322_323delinsTA	X.37:g.65824292_65824293delinsTA	ENSP00000363851:p.Thr108*		Q5VYX9|Q5VYY0|Q6UWM2|Q8IZA6	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_27	p.T108K|p.T108S	ENST00000374719.3	37	c.323|c.322	CCDS14386.1	X																																																																																			EDA2R	-	NULL	ENSG00000131080		0.515	EDA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDA2R	HGNC	protein_coding	OTTHUMT00000057002.1	-	0.00	126	0	G|T	NM_021783		65824292|65824293	-1	tier1	-	no_errors	ENST00000253392	ensembl	human	known	74_37	missense	5.92|5.96	143|142	9	SNP	0.715|0.921	T|A
EIF4ENIF1	56478	genome.wustl.edu	37	22	31859732	31859732	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr22:31859732C>T	ENST00000397525.1	-	5	743	c.520G>A	c.(520-522)Gat>Aat	p.D174N	RP11-247I13.11_ENST00000464523.1_RNA|RP11-247I13.11_ENST00000483736.1_RNA|EIF4ENIF1_ENST00000397523.1_Missense_Mutation_p.D174N|RP11-247I13.8_ENST00000439588.1_RNA|EIF4ENIF1_ENST00000344710.5_Intron|EIF4ENIF1_ENST00000330125.5_Missense_Mutation_p.D174N	NM_001164501.1	NP_001157973.1	Q9NRA8	4ET_HUMAN	eukaryotic translation initiation factor 4E nuclear import factor 1	174	Arg-rich.					cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						AGGTCCTTATCGCTAAGACGG	0.458																																																	0													78.0	76.0	76.0					22																	31859732		2203	4300	6503	SO:0001583	missense	0			AF240775	CCDS13898.1, CCDS54520.1	22q11.2	2007-01-16			ENSG00000184708	ENSG00000184708			16687	protein-coding gene	gene with protein product		607445				10856257	Standard	NM_019843		Approved	4E-T, FLJ21601, Clast4, 2610509L04Rik	uc003akz.2	Q9NRA8	OTTHUMG00000030793	ENST00000397525.1:c.520G>A	22.37:g.31859732C>T	ENSP00000380659:p.Asp174Asn		B1AKL2|B1AKL3|B2RBF1|Q8NCF2|Q9H708	Missense_Mutation	SNP	pfam_eIF4E_transporter	p.D174N	ENST00000397525.1	37	c.520	CCDS13898.1	22	.	.	.	.	.	.	.	.	.	.	C	26.8	4.771193	0.90108	.	.	ENSG00000184708	ENST00000397525;ENST00000330125;ENST00000397523;ENST00000420671;ENST00000423097	.	.	.	5.56	5.56	0.83823	.	0.309562	0.39407	N	0.001373	T	0.53367	0.1792	L	0.41824	1.3	0.80722	D	1	P	0.35844	0.524	B	0.39562	0.303	T	0.44065	-0.9352	9	0.18276	T	0.48	-7.0444	18.8921	0.92408	0.0:1.0:0.0:0.0	.	174	Q9NRA8	4ET_HUMAN	N	174	.	ENSP00000328103:D174N	D	-	1	0	EIF4ENIF1	30189732	0.997000	0.39634	0.994000	0.49952	0.996000	0.88848	4.855000	0.62925	2.792000	0.96026	0.557000	0.71058	GAT	EIF4ENIF1	-	pfam_eIF4E_transporter	ENSG00000184708		0.458	EIF4ENIF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4ENIF1	HGNC	protein_coding	OTTHUMT00000127926.1	-	0.00	75	0	C	NM_019843		31859732	-1	tier1	-	no_errors	ENST00000330125	ensembl	human	known	74_37	missense	10.71	75	9	SNP	1.000	T
ELL	8178	genome.wustl.edu	37	19	18557181	18557181	+	Silent	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:18557181G>T	ENST00000262809.4	-	10	1713	c.1642C>A	c.(1642-1644)Cgg>Agg	p.R548R	ELL_ENST00000596124.3_Silent_p.R415R|CTD-3137H5.1_ENST00000594590.2_RNA	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II	548					gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		GTGAACCGCCGCGTGATGCGC	0.652			T	MLL	AL																																			Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	0													46.0	40.0	42.0					19																	18557181		2202	4299	6501	SO:0001819	synonymous_variant	0			U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.1642C>A	19.37:g.18557181G>T				Silent	SNP	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.R548	ENST00000262809.4	37	c.1642	CCDS12380.1	19																																																																																			ELL	-	pfam_Occludin_RNApol2_elong_fac_ELL	ENSG00000105656		0.652	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL	HGNC	protein_coding	OTTHUMT00000466362.1		0.00	15	0	G	NM_006532		18557181	-1			no_errors	ENST00000262809	ensembl	human	known	74_37	silent	12.50	14	2	SNP	0.836	T
EMP1	2012	genome.wustl.edu	37	12	13364407	13364408	+	5'UTR	INS	-	-	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:13364407_13364408insT	ENST00000256951.5	+	0	162_163				EMP1_ENST00000542289.1_3'UTR|EMP1_ENST00000544053.1_Intron|EMP1_ENST00000431267.2_Intron|EMP1_ENST00000537612.1_5'Flank|EMP1_ENST00000396301.3_5'UTR	NM_001423.2	NP_001414.1	P54849	EMP1_HUMAN	epithelial membrane protein 1						cell growth (GO:0016049)|cell proliferation (GO:0008283)|epidermis development (GO:0008544)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)							Prostate(47;0.194)		BRCA - Breast invasive adenocarcinoma(232;0.153)		TTTCAGAACTCTCTTTGCTCAC	0.401																																																	0																																										SO:0001623	5_prime_UTR_variant	0			U43916	CCDS8660.1	12p12.3	2008-08-04				ENSG00000134531			3333	protein-coding gene	gene with protein product		602333				8996089, 9126480	Standard	NM_001423		Approved	TMP, CL-20	uc001rbr.3	P54849		ENST00000256951.5:c.-37->T	12.37:g.13364408_13364408dupT			B2R5N1|B4DRR1|O00681|Q13481|Q13834	RNA	INS	-	NULL	ENST00000256951.5	37	NULL	CCDS8660.1	12																																																																																			EMP1	-	-	ENSG00000134531		0.401	EMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMP1	HGNC	protein_coding	OTTHUMT00000401019.1		0.00	30	0	-	NM_001423		13364408	+1	tier1		no_errors	ENST00000542289	ensembl	human	known	74_37	rna	52.38	20	22	INS	0.990:0.991	T
ZNF273	10793	genome.wustl.edu	37	7	64350004	64350004	+	Intron	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr7:64350004G>T	ENST00000527278.1	+	2	293				RP11-797H7.5_ENST00000340779.3_RNA			Q14593	ZN273_HUMAN	zinc finger protein 273						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				AAGCAGCGGGGCTGCTGCTGA	0.687																																					Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)												0																																										SO:0001627	intron_variant	0			X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000527278.1:c.294-3786G>T	7.37:g.64350004G>T			B3KQZ5|Q6P3V4	RNA	SNP	-	NULL	ENST00000527278.1	37	NULL		7																																																																																			RP11-797H7.5	-	-	ENSG00000189316		0.687	ZNF273-002	KNOWN	basic	processed_transcript	ENSG00000189316	Clone_based_vega_gene	protein_coding	OTTHUMT00000313503.2	-	0.00	64	0	G			64350004	-1	tier1	-	no_errors	ENST00000340779	ensembl	human	known	74_37	rna	24.07	41	13	SNP	0.135	T
LOC101927209	101927209	genome.wustl.edu	37	1	142716704	142716704	+	lincRNA	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:142716704G>T	ENST00000610091.1	-	0	340																											TGGTTAATCTGTCAGCAGCAG	0.348																																																	0																																												0																															1.37:g.142716704G>T				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.6	-	-	ENSG00000203849		0.348	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	-	0.00	57	0	G			142716704	-1	tier1	-	no_errors	ENST00000595144	ensembl	human	known	74_37	rna	16.46	66	13	SNP	0.001	T
DPP9	91039	genome.wustl.edu	37	19	4682879	4682880	+	Intron	DEL	AG	AG	-	rs148398571		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:4682879_4682880delAG	ENST00000598800.1	-	21	2750				DPP9_ENST00000601173.1_5'Flank|AC005594.3_ENST00000381796.1_RNA|DPP9_ENST00000262960.9_Intron|DPP9_ENST00000594671.1_Intron			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9							cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		AGATGGGGGCAGAGAGAGAGAG	0.663																																																	0																																										SO:0001627	intron_variant	0			AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.2245-29CT>-	19.37:g.4682889_4682890delAG			O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	RNA	DEL	-	NULL	ENST00000598800.1	37	NULL		19																																																																																			AC005594.3	-	-	ENSG00000205790		0.663	DPP9-026	NOVEL	basic	protein_coding	ENSG00000205790	Clone_based_vega_gene	protein_coding	OTTHUMT00000459343.2		0.00	35	0	AG			4682880	+1	tier1		no_errors	ENST00000381796	ensembl	human	known	74_37	rna	10.26	35	4	DEL	0.000:0.006	-
ZNF971P	100419895	genome.wustl.edu	37	16	34682216	34682216	+	RNA	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr16:34682216A>G	ENST00000568619.1	-	0	263																											CATTGGGAAAATCAAAGGCTT	0.388																																																	0																																												0																															16.37:g.34682216A>G				RNA	SNP	-	NULL	ENST00000568619.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	a	1.650	-0.514286	0.04200	.	.	ENSG00000214581	ENST00000398617	.	.	.	0.253	0.253	0.15551	.	.	.	.	.	T	0.27134	0.0665	.	.	.	.	.	.	.	.	.	.	.	.	T	0.29640	-1.0005	3	.	.	.	.	2.4143	0.04432	0.5381:1.0E-4:0.0:0.4618	.	.	.	.	T	14	.	.	I	-	2	0	AC018558.1	34539717	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-1.444000	0.02403	0.324000	0.23333	0.318000	0.21364	ATT	RP11-80F22.10	-	-	ENSG00000214581		0.388	RP11-80F22.10-002	KNOWN	basic	processed_transcript	ENSG00000214581	Clone_based_vega_gene	pseudogene	OTTHUMT00000431371.1	-	0.00	96	0	A			34682216	-1	tier1	-	no_errors	ENST00000568619	ensembl	human	known	74_37	rna	17.27	115	24	SNP	0.000	G
LOC100507461	100507461	genome.wustl.edu	37	3	147798632	147798632	+	lincRNA	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:147798632G>A	ENST00000490465.1	+	0	99				AC092958.1_ENST00000408530.2_RNA																							CTAttatattggtgcaaaagt	0.284																																																	0																																												0																															3.37:g.147798632G>A				RNA	SNP	-	NULL	ENST00000490465.1	37	NULL		3																																																																																			AC092958.1	-	-	ENSG00000221457		0.284	RP11-639B1.1-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000221457	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000355805.1	-	0.00	33	0	G			147798632	-1	tier1	-	no_errors	ENST00000408530	ensembl	human	novel	74_37	rna	54.72	24	29	SNP	0.000	A
SGMS1-AS1	104355295	genome.wustl.edu	37	10	52390895	52390895	+	RNA	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr10:52390895C>A	ENST00000443374.2	+	0	2084				RP11-50E11.3_ENST00000609579.1_RNA																							GCATAGTAGTCTAGGCCGACC	0.547																																																	0																																												0																															10.37:g.52390895C>A				RNA	SNP	-	NULL	ENST00000443374.2	37	NULL		10																																																																																			RP11-50E11.3	-	-	ENSG00000226200		0.547	RP11-50E11.3-001	KNOWN	basic	antisense	ENSG00000226200	Clone_based_vega_gene	antisense	OTTHUMT00000048071.2	-	0.00	73	0	C			52390895	+1	tier1	-	no_errors	ENST00000443374	ensembl	human	known	74_37	rna	15.74	90	17	SNP	0.741	A
RP11-255H23.4	0	genome.wustl.edu	37	19	24014646	24014646	+	lincRNA	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:24014646A>T	ENST00000599944.1	-	0	150				RP11-255H23.2_ENST00000471224.1_RNA																							ATAAATTTTTAAATTCAAACA	0.289																																																	0																																												0																															19.37:g.24014646A>T				RNA	SNP	-	NULL	ENST00000599944.1	37	NULL		19																																																																																			RP11-255H23.2	-	-	ENSG00000233836		0.289	RP11-255H23.4-001	KNOWN	basic	lincRNA	ENSG00000233836	Clone_based_vega_gene	lincRNA	OTTHUMT00000466442.1	-	0.00	17	0	A			24014646	+1	tier1	-	no_errors	ENST00000471224	ensembl	human	known	74_37	rna	26.47	25	9	SNP	0.002	T
FAM86EP	348926	genome.wustl.edu	37	4	3948525	3948525	+	RNA	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:3948525G>T	ENST00000313946.8	-	0	1232				AC226119.5_ENST00000281228.8_RNA					family with sequence similarity 86, member E, pseudogene																		TGGCACGTCTGTGGGTTGTGG	0.652																																																	0																																												0					4p16.3	2011-07-01			ENSG00000251669	ENSG00000251669			28017	pseudogene	pseudogene						12477932	Standard	NR_024253		Approved		uc011bvu.2		OTTHUMG00000159867		4.37:g.3948525G>T				RNA	SNP	-	NULL	ENST00000313946.8	37	NULL		4																																																																																			AC226119.5	-	-	ENSG00000253917		0.652	FAM86EP-002	KNOWN	basic	processed_transcript	ENSG00000253917	Clone_based_vega_gene	pseudogene	OTTHUMT00000357822.1	-	0.00	167	0	G			3948525	-1	tier1	-	no_errors	ENST00000281228	ensembl	human	known	74_37	rna	10.62	143	17	SNP	0.823	T
EPHA7	2045	genome.wustl.edu	37	6	93956601	93956601	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:93956601C>T	ENST00000369303.4	-	15	2819	c.2635G>A	c.(2635-2637)Gaa>Aaa	p.E879K		NM_004440.3	NP_004431.1	Q15375	EPHA7_HUMAN	EPH receptor A7	879	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				brain development (GO:0007420)|branching morphogenesis of a nerve (GO:0048755)|ephrin receptor signaling pathway (GO:0048013)|negative chemotaxis (GO:0050919)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of cell-cell adhesion (GO:0022407)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of protein autophosphorylation (GO:0031952)|retinal ganglion cell axon guidance (GO:0031290)	dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|chemorepellent activity (GO:0045499)|GPI-linked ephrin receptor activity (GO:0005004)|protein tyrosine kinase activity (GO:0004713)	p.E879K(2)		NS(1)|breast(1)|central_nervous_system(7)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|lung(43)|ovary(8)|pancreas(1)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(13)|urinary_tract(1)	112		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TTTGGCCTTTCAGCACGCTCC	0.418																																																	2	Substitution - Missense(2)	lung(2)											119.0	114.0	116.0					6																	93956601		2203	4300	6503	SO:0001583	missense	0			L36642	CCDS5031.1, CCDS75494.1	6q16.3	2013-02-11	2004-10-28		ENSG00000135333	ENSG00000135333		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3390	protein-coding gene	gene with protein product		602190	"""EphA7"""			9267020	Standard	NM_004440		Approved	Hek11	uc003poe.3	Q15375	OTTHUMG00000015228	ENST00000369303.4:c.2635G>A	6.37:g.93956601C>T	ENSP00000358309:p.Glu879Lys		A0AUX7|B2R8W1|B7ZLJ9|B7ZLK0|Q59G40|Q5VTU0|Q8N368|Q9H124	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.E879K	ENST00000369303.4	37	c.2635	CCDS5031.1	6	.	.	.	.	.	.	.	.	.	.	C	24.4	4.531789	0.85706	.	.	ENSG00000135333	ENST00000369303	D	0.82344	-1.6	5.74	5.74	0.90152	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.050665	0.85682	D	0.000000	T	0.67878	0.2940	N	0.13003	0.285	0.80722	D	1	B;P;P	0.42961	0.069;0.756;0.795	B;B;B	0.44278	0.025;0.317;0.445	T	0.68945	-0.5275	10	0.22706	T	0.39	.	19.9265	0.97104	0.0:1.0:0.0:0.0	.	875;874;879	Q15375-4;Q15375-2;Q15375	.;.;EPHA7_HUMAN	K	879	ENSP00000358309:E879K	ENSP00000358309:E879K	E	-	1	0	EPHA7	94013322	1.000000	0.71417	0.960000	0.40013	0.988000	0.76386	4.842000	0.62831	2.723000	0.93209	0.591000	0.81541	GAA	EPHA7	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000135333		0.418	EPHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA7	HGNC	protein_coding	OTTHUMT00000041545.1	-	0.00	60	0	C			93956601	-1	tier1	-	no_errors	ENST00000369303	ensembl	human	known	74_37	missense	10.00	63	7	SNP	1.000	T
EPHX3	79852	genome.wustl.edu	37	19	15342188	15342188	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:15342188G>T	ENST00000221730.3	-	3	569	c.349C>A	c.(349-351)Ctc>Atc	p.L117I	EPHX3_ENST00000435261.1_Missense_Mutation_p.L117I|EPHX3_ENST00000602233.1_Missense_Mutation_p.L117I	NM_024794.2	NP_079070.1	Q9H6B9	EPHX3_HUMAN	epoxide hydrolase 3	117						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(1)	7						AACTCCCGGAGCTGGTAACGC	0.627																																																	0													45.0	41.0	42.0					19																	15342188		2203	4300	6503	SO:0001583	missense	0			AK026061	CCDS12327.1	19p13.13	2011-10-05	2009-04-06	2009-04-06	ENSG00000105131	ENSG00000105131		"""Abhydrolase domain containing"""	23760	protein-coding gene	gene with protein product			"""abhydrolase domain containing 9"""	ABHD9			Standard	NM_024794		Approved	FLJ22408	uc002nap.3	Q9H6B9		ENST00000221730.3:c.349C>A	19.37:g.15342188G>T	ENSP00000221730:p.Leu117Ile		A3KMR3	Missense_Mutation	SNP	pfam_AB_hydrolase_1,prints_Epox_hydrolase-like,prints_AB_hydrolase_1	p.L117I	ENST00000221730.3	37	c.349	CCDS12327.1	19	.	.	.	.	.	.	.	.	.	.	G	16.20	3.055403	0.55325	.	.	ENSG00000105131	ENST00000221730;ENST00000435261	T;T	0.66280	-0.2;-0.2	4.24	4.24	0.50183	.	0.000000	0.50627	D	0.000116	T	0.46639	0.1403	N	0.25957	0.775	0.54753	D	0.999987	B	0.18013	0.025	B	0.26864	0.074	T	0.33292	-0.9874	10	0.11794	T	0.64	-34.304	12.0149	0.53309	0.0:0.0:1.0:0.0	.	117	Q9H6B9	EPHX3_HUMAN	I	117	ENSP00000221730:L117I;ENSP00000410323:L117I	ENSP00000221730:L117I	L	-	1	0	EPHX3	15203188	1.000000	0.71417	0.999000	0.59377	0.928000	0.56348	2.791000	0.47829	2.203000	0.70933	0.462000	0.41574	CTC	EPHX3	-	prints_Epox_hydrolase-like	ENSG00000105131		0.627	EPHX3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EPHX3	HGNC	protein_coding	OTTHUMT00000465797.1		0.00	10	0	G	NM_024794		15342188	-1			no_errors	ENST00000221730	ensembl	human	known	74_37	missense	16.00	21	4	SNP	1.000	T
EPN2	22905	genome.wustl.edu	37	17	19216546	19216546	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:19216546C>T	ENST00000314728.5	+	7	1585	c.1101C>T	c.(1099-1101)ggC>ggT	p.G367G	EPN2_ENST00000347697.2_Silent_p.G310G|EPN2_ENST00000575595.1_Silent_p.G75G|EPN2_ENST00000571254.1_Silent_p.G303G|EPN2_ENST00000395620.2_Silent_p.G310G|EPN2_ENST00000395618.3_Silent_p.G82G|EPN2_ENST00000395626.1_Silent_p.G367G	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	367	6 X 3 AA repeats of [DE]-P-W.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					ACCCCTGGGGCGGGCCAGCGG	0.637																																																	0													31.0	39.0	36.0					17																	19216546		2201	4295	6496	SO:0001819	synonymous_variant	0			AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.1101C>T	17.37:g.19216546C>T			A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Silent	SNP	pfam_Epsin_dom_N,pfam_ANTH_dom,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.G367	ENST00000314728.5	37	c.1101	CCDS11203.1	17																																																																																			EPN2	-	NULL	ENSG00000072134		0.637	EPN2-001	KNOWN	basic|CCDS	protein_coding	EPN2	HGNC	protein_coding	OTTHUMT00000132283.3	-	0.00	61	0	C	NM_014964		19216546	+1	tier1	-	no_errors	ENST00000314728	ensembl	human	known	74_37	silent	53.33	34	40	SNP	0.017	T
EVC2	132884	genome.wustl.edu	37	4	5624676	5624676	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:5624676A>G	ENST00000344408.5	-	14	2142	c.2089T>C	c.(2089-2091)Ttc>Ctc	p.F697L	EVC2_ENST00000344938.1_Missense_Mutation_p.F697L|EVC2_ENST00000310917.2_Missense_Mutation_p.F617L	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	697					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						ACCGTTCGGAAGGCCTCGCCG	0.617																																																	0													47.0	52.0	50.0					4																	5624676		2203	4300	6503	SO:0001583	missense	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2089T>C	4.37:g.5624676A>G	ENSP00000342144:p.Phe697Leu		Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_Limbin	p.F697L	ENST00000344408.5	37	c.2089	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	A	0.012	-1.671247	0.00758	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.73047	-0.71;-0.7;-0.71	5.0	-1.63	0.08345	.	0.649045	0.15872	N	0.240469	T	0.37073	0.0990	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.19745	-1.0296	10	0.08599	T	0.76	-1.258	2.4074	0.04416	0.5346:0.2225:0.0882:0.1547	.	697	Q86UK5	LBN_HUMAN	L	697;617;697	ENSP00000339954:F697L;ENSP00000311683:F617L;ENSP00000342144:F697L	ENSP00000311683:F617L	F	-	1	0	EVC2	5675577	0.006000	0.16342	0.016000	0.15963	0.026000	0.11368	0.308000	0.19314	-0.070000	0.12908	0.260000	0.18958	TTC	EVC2	-	NULL	ENSG00000173040		0.617	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2		0.00	23	0	A	NM_147127		5624676	-1			no_errors	ENST00000344408	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.001	G
F8	2157	genome.wustl.edu	37	X	154158672	154158672	+	Silent	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:154158672A>T	ENST00000360256.4	-	14	3593	c.3393T>A	c.(3391-3393)acT>acA	p.T1131T		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1131	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TCTTTCCATGAGTCCTTTGTA	0.438																																																	0													64.0	64.0	64.0					X																	154158672		2203	4298	6501	SO:0001819	synonymous_variant	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.3393T>A	X.37:g.154158672A>T			Q14286|Q5HY69	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.T1131	ENST00000360256.4	37	c.3393	CCDS35457.1	X																																																																																			F8	-	NULL	ENSG00000185010		0.438	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	-	0.00	25	0	A			154158672	-1	tier1	-	no_errors	ENST00000360256	ensembl	human	known	74_37	silent	21.74	36	10	SNP	0.000	T
FAM19A1	407738	genome.wustl.edu	37	3	68466475	68466475	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:68466475A>G	ENST00000478136.1	+	3	654	c.164A>G	c.(163-165)aAg>aGg	p.K55R	FAM19A1_ENST00000491017.1_3'UTR|FAM19A1_ENST00000496687.1_Missense_Mutation_p.K55R	NM_213609.3	NP_998774.2	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A1	55						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	7		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		TGTTGTAACAAGAATCGCATT	0.473																																																	0													132.0	128.0	129.0					3																	68466475		1955	4137	6092	SO:0001583	missense	0			AY325114	CCDS54606.1	3p14.1	2005-01-20			ENSG00000183662	ENSG00000183662			21587	protein-coding gene	gene with protein product						15028294	Standard	NM_213609		Approved	TAFA-1	uc003dnd.3	Q7Z5A9	OTTHUMG00000158745	ENST00000478136.1:c.164A>G	3.37:g.68466475A>G	ENSP00000418575:p.Lys55Arg		A8K0V3|Q8TCL8	Missense_Mutation	SNP	pfam_Chemokine-like_FAM19A2	p.K55R	ENST00000478136.1	37	c.164	CCDS54606.1	3	.	.	.	.	.	.	.	.	.	.	A	21.2	4.111645	0.77210	.	.	ENSG00000183662	ENST00000478136;ENST00000496687	.	.	.	5.67	4.52	0.55395	.	0.000000	0.85682	D	0.000000	T	0.51618	0.1685	L	0.31065	0.9	0.36620	D	0.875703	D	0.59767	0.986	P	0.56612	0.802	T	0.53885	-0.8375	9	0.22706	T	0.39	.	11.7609	0.51903	0.9311:0.0:0.0689:0.0	.	55	Q7Z5A9	F19A1_HUMAN	R	55	.	ENSP00000418575:K55R	K	+	2	0	FAM19A1	68549165	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.283000	0.95860	1.085000	0.41206	0.482000	0.46254	AAG	FAM19A1	-	pfam_Chemokine-like_FAM19A2	ENSG00000183662		0.473	FAM19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM19A1	HGNC	protein_coding	OTTHUMT00000352004.1	-	0.00	28	0	A	NM_213609		68466475	+1	tier1	-	no_errors	ENST00000478136	ensembl	human	known	74_37	missense	20.00	24	6	SNP	1.000	G
FAM47A	158724	genome.wustl.edu	37	X	34149455	34149455	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:34149455C>T	ENST00000346193.3	-	1	992	c.941G>A	c.(940-942)cGc>cAc	p.R314H		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	314										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AGGCTCCTGGCGGAGATGGGA	0.612																																																	0													19.0	22.0	21.0					X																	34149455		2192	4292	6484	SO:0001583	missense	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.941G>A	X.37:g.34149455C>T	ENSP00000345029:p.Arg314His		A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.R314H	ENST00000346193.3	37	c.941	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	c	0.194	-1.050799	0.01981	.	.	ENSG00000185448	ENST00000346193	T	0.15834	2.39	0.15	-0.299	0.12808	.	.	.	.	.	T	0.08626	0.0214	N	0.19112	0.55	0.09310	N	1	B	0.14012	0.009	B	0.08055	0.003	T	0.33599	-0.9862	8	0.40728	T	0.16	.	.	.	.	.	314	Q5JRC9	FA47A_HUMAN	H	314	ENSP00000345029:R314H	ENSP00000345029:R314H	R	-	2	0	FAM47A	34059376	0.923000	0.31300	0.001000	0.08648	0.001000	0.01503	0.581000	0.23819	-1.099000	0.03034	-1.097000	0.02148	CGC	FAM47A	-	NULL	ENSG00000185448		0.612	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	HGNC	protein_coding	OTTHUMT00000056205.1	-	0.00	98	0	C	NM_203408		34149455	-1	tier1	-	no_errors	ENST00000346193	ensembl	human	known	74_37	missense	5.88	96	6	SNP	0.025	T
FANCI	55215	genome.wustl.edu	37	15	89811630	89811630	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:89811630G>T	ENST00000310775.7	+	10	842	c.756G>T	c.(754-756)gaG>gaT	p.E252D	FANCI_ENST00000300027.8_Splice_Site_p.E252D	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	252					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					AATCTTTTAGGCTATTGGATG	0.463								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													176.0	153.0	161.0					15																	89811630		2200	4299	6499	SO:0001630	splice_region_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.756-1G>T	15.37:g.89811630G>T			A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	NULL	p.E252D	ENST00000310775.7	37	c.756	CCDS45346.1	15	.	.	.	.	.	.	.	.	.	.	G	11.15	1.555286	0.27739	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.43688	0.94;0.94;0.94	4.68	0.222	0.15288	.	0.373522	0.27327	N	0.019865	T	0.27663	0.0680	L	0.50919	1.6	0.47819	D	0.999523	B;B;B	0.11235	0.002;0.004;0.004	B;B;B	0.13407	0.009;0.004;0.004	T	0.08764	-1.0706	9	.	.	.	.	2.3419	0.04262	0.2846:0.1267:0.4597:0.129	.	252;252;252	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	D	252	ENSP00000300027:E252D;ENSP00000310842:E252D;ENSP00000413249:E252D	.	E	+	3	2	FANCI	87612634	0.703000	0.27826	0.180000	0.23079	0.218000	0.24690	0.841000	0.27613	0.964000	0.38108	0.561000	0.74099	GAG	FANCI	-	NULL	ENSG00000140525		0.463	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCI	HGNC	protein_coding	OTTHUMT00000421140.1	-	0.00	47	0	G	NM_018193	Missense_Mutation	89811630	+1	tier1	-	no_errors	ENST00000310775	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.048	T
FARP1	10160	genome.wustl.edu	37	13	99047715	99047715	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr13:99047715C>G	ENST00000319562.6	+	13	1664	c.1399C>G	c.(1399-1401)Ccg>Gcg	p.P467A	FARP1_ENST00000595437.1_Missense_Mutation_p.P467A|FARP1_ENST00000376586.2_Missense_Mutation_p.P467A	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	467					dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			ACCTCAGCCCCCGCAGCCAAG	0.607																																																	0													39.0	46.0	44.0					13																	99047715		2053	4121	6174	SO:0001583	missense	0			AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.1399C>G	13.37:g.99047715C>G	ENSP00000322926:p.Pro467Ala		Q5JVI9|Q6IQ29	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM-adjacent,pfam_FERM_central,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.P467A	ENST00000319562.6	37	c.1399	CCDS9487.1	13	.	.	.	.	.	.	.	.	.	.	C	3.090	-0.187162	0.06299	.	.	ENSG00000152767	ENST00000376586;ENST00000376584;ENST00000319562	T;T	0.77877	-1.13;-0.96	4.8	4.8	0.61643	.	1.302880	0.04940	N	0.458473	T	0.72574	0.3477	L	0.36672	1.1	0.29235	N	0.87304	B;B	0.12013	0.005;0.0	B;B	0.09377	0.004;0.001	T	0.51748	-0.8666	10	0.08179	T	0.78	.	17.8675	0.88800	0.0:1.0:0.0:0.0	.	467;467	Q9Y4F1;C9JME2	FARP1_HUMAN;.	A	467;172;467	ENSP00000365771:P467A;ENSP00000322926:P467A	ENSP00000322926:P467A	P	+	1	0	FARP1	97845716	1.000000	0.71417	0.997000	0.53966	0.679000	0.39708	3.979000	0.56888	2.208000	0.71279	0.462000	0.41574	CCG	FARP1	-	NULL	ENSG00000152767		0.607	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP1	HGNC	protein_coding	OTTHUMT00000045541.3	-	0.00	26	0	C	NM_005766		99047715	+1	tier1	-	no_errors	ENST00000376586	ensembl	human	known	74_37	missense	12.50	35	5	SNP	1.000	G
FAT4	79633	genome.wustl.edu	37	4	126240637	126240637	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:126240637A>G	ENST00000394329.3	+	1	3084	c.3071A>G	c.(3070-3072)gAt>gGt	p.D1024G		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1024	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TCTGATAAGGATTCAGGAGCA	0.388																																																	0													96.0	88.0	91.0					4																	126240637		1845	4098	5943	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.3071A>G	4.37:g.126240637A>G	ENSP00000377862:p.Asp1024Gly		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.D1024G	ENST00000394329.3	37	c.3071	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	A	13.85	2.360985	0.41801	.	.	ENSG00000196159	ENST00000394329	T	0.74632	-0.86	5.0	5.0	0.66597	Cadherin (4);Cadherin-like (1);	0.000000	0.35378	U	0.003259	D	0.91192	0.7225	H	0.97983	4.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94331	0.7562	10	0.87932	D	0	.	14.9061	0.70721	1.0:0.0:0.0:0.0	.	1024	Q6V0I7	FAT4_HUMAN	G	1024	ENSP00000377862:D1024G	ENSP00000377862:D1024G	D	+	2	0	FAT4	126460087	1.000000	0.71417	1.000000	0.80357	0.260000	0.26232	8.949000	0.93012	2.100000	0.63781	0.533000	0.62120	GAT	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.388	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	24	0	A	NM_024582		126240637	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	21.95	32	9	SNP	1.000	G
FAT4	79633	genome.wustl.edu	37	4	126373295	126373295	+	Silent	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:126373295A>C	ENST00000394329.3	+	9	11137	c.11124A>C	c.(11122-11124)acA>acC	p.T3708T	FAT4_ENST00000335110.5_Silent_p.T2006T	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	3708					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCAATGCCACAGTGGATAACA	0.458																																																	0													177.0	166.0	170.0					4																	126373295		2203	4300	6503	SO:0001819	synonymous_variant	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.11124A>C	4.37:g.126373295A>C			A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.T3708	ENST00000394329.3	37	c.11124	CCDS3732.3	4																																																																																			FAT4	-	NULL	ENSG00000196159		0.458	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	76	0	A	NM_024582		126373295	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	silent	20.39	82	21	SNP	0.003	C
FAT4	79633	genome.wustl.edu	37	4	126411990	126411990	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:126411990T>G	ENST00000394329.3	+	17	14026	c.14013T>G	c.(14011-14013)agT>agG	p.S4671R	FAT4_ENST00000335110.5_Missense_Mutation_p.S2912R	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4671					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GAGCAAGCAGTTTGACTTACC	0.532																																																	0													104.0	103.0	103.0					4																	126411990		2203	4300	6503	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.14013T>G	4.37:g.126411990T>G	ENSP00000377862:p.Ser4671Arg		A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S4671R	ENST00000394329.3	37	c.14013	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	T	7.843	0.722342	0.15439	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.75704	-0.78;-0.96	4.46	-3.11	0.05299	.	0.000000	0.39985	U	0.001214	T	0.72423	0.3458	L	0.43152	1.355	0.44908	D	0.997922	P;P;D	0.55385	0.948;0.952;0.971	P;P;P	0.58454	0.779;0.694;0.839	T	0.68758	-0.5324	10	0.22706	T	0.39	.	12.0441	0.53469	0.0:0.5682:0.0:0.4318	.	2912;4671;4670	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	R	4671;2912	ENSP00000377862:S4671R;ENSP00000335169:S2912R	ENSP00000335169:S2912R	S	+	3	2	FAT4	126631440	0.968000	0.33430	0.603000	0.28903	0.870000	0.49936	0.087000	0.14958	-0.761000	0.04670	0.459000	0.35465	AGT	FAT4	-	NULL	ENSG00000196159		0.532	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	40	0	T	NM_024582		126411990	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	missense	20.37	43	11	SNP	0.899	G
FBN3	84467	genome.wustl.edu	37	19	8161451	8161451	+	Missense_Mutation	SNP	G	G	A	rs370586224		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:8161451G>A	ENST00000600128.1	-	44	5830	c.5416C>T	c.(5416-5418)Cgg>Tgg	p.R1806W	FBN3_ENST00000270509.2_Missense_Mutation_p.R1806W|FBN3_ENST00000601739.1_Missense_Mutation_p.R1806W			Q75N90	FBN3_HUMAN	fibrillin 3	1806	EGF-like 28. {ECO:0000255|PROSITE- ProRule:PRU00076}.		R -> Q (in dbSNP:rs3829817). {ECO:0000269|PubMed:11347906}.			proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(9)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(15)|lung(53)|ovary(7)|pancreas(2)|prostate(3)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	132						CACTCATTCCGTCCTGGGGGT	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		19440	0.001		0.0	False		,,,				2504	0.0																0								G	TRP/ARG	0,4406		0,0,2203	98.0	75.0	83.0		5416	3.4	0.3	19		83	1,8599	1.2+/-3.3	0,1,4299	no	missense	FBN3	NM_032447.3	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1806/2810	8161451	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS12196.1	19p13	2008-02-05							18794	protein-coding gene	gene with protein product		608529					Standard	NM_032447		Approved		uc002mjf.3	Q75N90		ENST00000600128.1:c.5416C>T	19.37:g.8161451G>A	ENSP00000470498:p.Arg1806Trp		Q75N91|Q75N92|Q75N93|Q86SJ5|Q96JP8	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pirsf_FBN,pfscan_EG-like_dom	p.R1806W	ENST00000600128.1	37	c.5416	CCDS12196.1	19	.	.	.	.	.	.	.	.	.	.	G	16.34	3.096339	0.56075	0.0	1.16E-4	ENSG00000142449	ENST00000270509	D	0.87491	-2.26	3.4	3.4	0.38934	Epidermal growth factor-like, type 3 (1);	0.135938	0.50627	U	0.000110	D	0.89684	0.6786	M	0.64170	1.965	0.58432	D	0.999997	D	0.67145	0.996	P	0.54815	0.761	D	0.91085	0.4902	10	0.66056	D	0.02	.	15.1341	0.72549	0.0:0.0:1.0:0.0	.	1806	Q75N90	FBN3_HUMAN	W	1806	ENSP00000270509:R1806W	ENSP00000270509:R1806W	R	-	1	2	FBN3	8067451	1.000000	0.71417	0.258000	0.24420	0.164000	0.22412	5.841000	0.69409	1.566000	0.49654	0.655000	0.94253	CGG	FBN3	-	smart_EGF-like_Ca-bd_dom,pirsf_FBN	ENSG00000142449		0.562	FBN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN3	HGNC	protein_coding	OTTHUMT00000461428.2	-	0.00	31	0	G	NM_032447		8161451	-1	tier1	-	no_errors	ENST00000270509	ensembl	human	known	74_37	missense	28.57	25	10	SNP	1.000	A
FLVCR2	55640	genome.wustl.edu	37	14	76091048	76091048	+	Missense_Mutation	SNP	C	C	T	rs183200579	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr14:76091048C>T	ENST00000238667.4	+	3	1261	c.905C>T	c.(904-906)gCc>gTc	p.A302V	FLVCR2_ENST00000556241.1_3'UTR|FLVCR2_ENST00000539311.1_Missense_Mutation_p.A97V|FLVCR2_ENST00000556856.1_Missense_Mutation_p.A50V|FLVCR2_ENST00000553587.1_Missense_Mutation_p.A50V	NM_017791.2	NP_060261.2	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular receptor family, member 2	302					heme transport (GO:0015886)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	heme binding (GO:0020037)|heme transporter activity (GO:0015232)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	15				BRCA - Breast invasive adenocarcinoma(234;0.029)		GGTTCCATCGCCCGGCTCTTC	0.473																																																	0													116.0	111.0	113.0					14																	76091048		2203	4300	6503	SO:0001583	missense	0			AK000378	CCDS9844.1, CCDS55933.1	14q24.3	2013-05-22	2007-05-01	2007-05-01	ENSG00000119686	ENSG00000119686		"""Solute carriers"""	20105	protein-coding gene	gene with protein product		610865	"""chromosome 14 open reading frame 58"", ""feline leukemia virus subgroup C cellular receptor 2"""	C14orf58		16439531, 20206334	Standard	NM_017791		Approved	FLJ20371, MFSD7C	uc001xrs.2	Q9UPI3	OTTHUMG00000171487	ENST00000238667.4:c.905C>T	14.37:g.76091048C>T	ENSP00000238667:p.Ala302Val		B7Z485|Q53ZT9|Q96JY3|Q9NX90	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,superfamily_Trimer_LpxA-like,pfscan_MFS_dom	p.A302V	ENST00000238667.4	37	c.905	CCDS9844.1	14	.	.	.	.	.	.	.	.	.	.	C	7.822	0.717901	0.15372	.	.	ENSG00000119686	ENST00000238667;ENST00000539311;ENST00000555058;ENST00000553587;ENST00000556856	T;T;T;T;T	0.58652	0.39;0.39;0.32;0.32;0.32	6.02	-1.68	0.08212	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.825819	0.11265	N	0.582155	T	0.28001	0.0690	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.10450	0.001;0.005	T	0.20338	-1.0278	10	0.15066	T	0.55	-22.6271	4.4665	0.11691	0.1008:0.1277:0.1037:0.6678	.	97;302	B7Z485;Q9UPI3	.;FLVC2_HUMAN	V	302;97;50;50;50	ENSP00000238667:A302V;ENSP00000443439:A97V;ENSP00000451104:A50V;ENSP00000451603:A50V;ENSP00000452468:A50V	ENSP00000238667:A302V	A	+	2	0	AC007182.1	75160801	0.000000	0.05858	0.669000	0.29828	0.711000	0.40976	-0.161000	0.10026	0.161000	0.19458	-1.090000	0.02178	GCC	FLVCR2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000119686		0.473	FLVCR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLVCR2	HGNC	protein_coding	OTTHUMT00000413672.1	-	0.00	57	0	C	NM_017791		76091048	+1	tier1	-	no_errors	ENST00000238667	ensembl	human	known	74_37	missense	29.49	55	23	SNP	0.001	T
FMNL2	114793	genome.wustl.edu	37	2	153482063	153482063	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:153482063A>T	ENST00000475377.2	+	3	274	c.74A>T	c.(73-75)gAg>gTg	p.E25V	FMNL2_ENST00000497192.1_3'UTR|FMNL2_ENST00000288670.9_Missense_Mutation_p.E650V			Q96PY5	FMNL2_HUMAN	formin-like 2	650	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				cortical actin cytoskeleton organization (GO:0030866)|cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)				central_nervous_system(2)|endometrium(3)|large_intestine(5)|liver(2)|lung(3)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	23						ATTGATGATGAGCGAATTCTG	0.443																																																	0													122.0	115.0	117.0					2																	153482063		1859	4097	5956	SO:0001583	missense	0			AB067489	CCDS46429.1	2q23.3	2008-02-05	2003-12-02	2003-12-03	ENSG00000157827	ENSG00000157827			18267	protein-coding gene	gene with protein product			"""formin homology 2 domain containing 2"""	FHOD2			Standard	XM_005246263		Approved	KIAA1902	uc002tye.3	Q96PY5	OTTHUMG00000154035	ENST00000475377.2:c.74A>T	2.37:g.153482063A>T	ENSP00000418959:p.Glu25Val		B2RZH5|Q14CC9|Q4ZG52|Q8N3E0	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin,prints_Wilms_tumour	p.E650V	ENST00000475377.2	37	c.1949		2	.	.	.	.	.	.	.	.	.	.	A	21.4	4.145030	0.77888	.	.	ENSG00000157827	ENST00000288670;ENST00000421344;ENST00000475377	T;T	0.18657	2.2;2.2	6.17	6.17	0.99709	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.53867	0.1823	M	0.87456	2.885	0.80722	D	1	D;D;D	0.76494	0.999;0.984;0.997	D;D;D	0.85130	0.997;0.959;0.963	T	0.60031	-0.7342	10	0.62326	D	0.03	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	650;131;650	Q96PY5;Q6ZN96;Q96PY5-3	FMNL2_HUMAN;.;.	V	650;131;25	ENSP00000288670:E650V;ENSP00000418959:E25V	ENSP00000288670:E650V	E	+	2	0	FMNL2	153190309	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.371000	0.80710	0.533000	0.62120	GAG	FMNL2	-	pfam_FH2_Formin,smart_FH2_Formin	ENSG00000157827		0.443	FMNL2-002	NOVEL	basic|exp_conf	protein_coding	FMNL2	HGNC	protein_coding	OTTHUMT00000333583.3	-	0.00	23	0	A	NM_052905		153482063	+1	tier1	-	no_errors	ENST00000288670	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	T
FMR1NB	158521	genome.wustl.edu	37	X	147088344	147088344	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:147088344T>C	ENST00000370467.3	+	3	594	c.520T>C	c.(520-522)Ttt>Ctt	p.F174L	5S_rRNA_ENST00000364415.1_RNA	NM_152578.2	NP_689791.1	Q8N0W7	FMR1N_HUMAN	fragile X mental retardation 1 neighbor	174	P-type.					integral component of membrane (GO:0016021)|nucleolus (GO:0005730)				breast(2)|cervix(1)|endometrium(3)|large_intestine(7)|lung(10)|ovary(1)|skin(1)	25	Acute lymphoblastic leukemia(192;6.56e-05)					CTTCAAATGTTTTGCTCCATT	0.353																																																	0													167.0	139.0	149.0					X																	147088344		2203	4300	6503	SO:0001583	missense	0				CCDS14683.1	Xq28	2009-03-25			ENSG00000176988	ENSG00000176988			26372	protein-coding gene	gene with protein product	"""cancer/testis antigen 37"""					12601173	Standard	NM_152578		Approved	FLJ25736, NY-SAR-35, CT37	uc004fcm.3	Q8N0W7	OTTHUMG00000022608	ENST00000370467.3:c.520T>C	X.37:g.147088344T>C	ENSP00000359498:p.Phe174Leu		D3DWT3	Missense_Mutation	SNP	superfamily_P_trefoil	p.F174L	ENST00000370467.3	37	c.520	CCDS14683.1	X	.	.	.	.	.	.	.	.	.	.	T	15.44	2.833248	0.50951	.	.	ENSG00000176988	ENST00000370467	T	0.56776	0.44	5.32	4.12	0.48240	P-type trefoil (1);	0.935815	0.08845	N	0.885357	T	0.52917	0.1764	L	0.27053	0.805	0.09310	N	1	D	0.54207	0.965	P	0.55615	0.78	T	0.38286	-0.9668	10	0.59425	D	0.04	-6.7034	7.4036	0.26977	0.0:0.1022:0.0:0.8978	.	174	Q8N0W7	FMR1N_HUMAN	L	174	ENSP00000359498:F174L	ENSP00000359498:F174L	F	+	1	0	FMR1NB	146896036	0.190000	0.23276	0.001000	0.08648	0.004000	0.04260	2.373000	0.44266	0.637000	0.30526	0.446000	0.29264	TTT	FMR1NB	-	superfamily_P_trefoil	ENSG00000176988		0.353	FMR1NB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMR1NB	HGNC	protein_coding	OTTHUMT00000058667.1	-	0.00	68	0	T	NM_152578		147088344	+1	tier1	-	no_errors	ENST00000370467	ensembl	human	known	74_37	missense	18.39	71	16	SNP	0.003	C
FOLH1	2346	genome.wustl.edu	37	11	49208204	49208204	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:49208204C>A	ENST00000256999.2	-	5	891	c.631G>T	c.(631-633)Gga>Tga	p.G211*	FOLH1_ENST00000356696.3_Nonsense_Mutation_p.G211*|FOLH1_ENST00000343844.4_De_novo_Start_InFrame|FOLH1_ENST00000340334.7_Nonsense_Mutation_p.G196*|FOLH1_ENST00000533034.1_Nonsense_Mutation_p.G196*	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	211					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	ACCTTATTTCCTCTGAAAACT	0.318																																																	0													67.0	71.0	69.0					11																	49208204		2200	4298	6498	SO:0001587	stop_gained	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.631G>T	11.37:g.49208204C>A	ENSP00000256999:p.Gly211*		A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Nonsense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.G211*	ENST00000256999.2	37	c.631	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	38	7.099013	0.98063	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	.	.	.	3.05	3.05	0.35203	.	0.000000	0.50627	D	0.000112	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.9601	0.53003	0.0:1.0:0.0:0.0	.	.	.	.	X	211;211;196;196;211	.	ENSP00000256999:G211X	G	-	1	0	FOLH1	49164780	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.933000	0.75874	1.746000	0.51805	0.430000	0.28490	GGA	FOLH1	-	pfam_Protease-assoc_domain	ENSG00000086205		0.318	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	-	0.00	40	0	C	NM_004476		49208204	-1	tier1	-	no_errors	ENST00000256999	ensembl	human	known	74_37	nonsense	12.16	65	9	SNP	1.000	A
FOXL2	668	genome.wustl.edu	37	3	138665331	138665331	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:138665331G>A	ENST00000330315.3	-	1	651	c.234C>T	c.(232-234)tcC>tcT	p.S78S	RP11-548O1.3_ENST00000495287.1_lincRNA|C3orf72_ENST00000383165.3_5'Flank	NM_023067.3	NP_075555.1	P58012	FOXL2_HUMAN	forkhead box L2	78					apoptotic DNA fragmentation (GO:0006309)|cell differentiation (GO:0030154)|embryonic eye morphogenesis (GO:0048048)|extraocular skeletal muscle development (GO:0002074)|female somatic sex determination (GO:0019101)|granulosa cell differentiation (GO:0060014)|menstruation (GO:0042703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	cysteine-type endopeptidase regulator activity involved in apoptotic process (GO:0043028)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin conjugating enzyme binding (GO:0031624)			large_intestine(1)|lung(1)|ovary(333)|skin(1)	336						GGTAGATGCCGGACAGCGTGA	0.607			Mis		granulosa-cell tumour of the ovary		"""Blepharophimosis, ptosis and epicanthus inversus Types I, II; Premature ovarian failure type III"""																																	Dom	yes		3	3q23	668	forkhead box L2	yes	O	0													61.0	68.0	66.0					3																	138665331		2203	4300	6503	SO:0001819	synonymous_variant	0			AF301906	CCDS3105.1	3q23	2008-04-10			ENSG00000183770	ENSG00000183770		"""Forkhead boxes"""	1092	protein-coding gene	gene with protein product		605597		BPES		1941972	Standard	NM_023067		Approved	BPES1	uc003esw.3	P58012	OTTHUMG00000159889	ENST00000330315.3:c.234C>T	3.37:g.138665331G>A			Q4ZGJ3	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S78	ENST00000330315.3	37	c.234	CCDS3105.1	3																																																																																			FOXL2	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000183770		0.607	FOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXL2	HGNC	protein_coding	OTTHUMT00000357999.1	-	0.00	48	0	G			138665331	-1	tier1	-	no_errors	ENST00000330315	ensembl	human	known	74_37	silent	28.57	50	20	SNP	0.993	A
FUT9	10690	genome.wustl.edu	37	6	96651724	96651724	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:96651724G>T	ENST00000302103.5	+	3	1019	c.693G>T	c.(691-693)ttG>ttT	p.L231F		NM_006581.3	NP_006572.2	Q9Y231	FUT9_HUMAN	fucosyltransferase 9 (alpha (1,3) fucosyltransferase)	231					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|liver(2)|lung(10)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	34		all_cancers(76;4.77e-07)|Acute lymphoblastic leukemia(125;4.01e-09)|all_hematologic(75;1.25e-06)|all_epithelial(107;0.00279)|Colorectal(196;0.0356)		BRCA - Breast invasive adenocarcinoma(108;0.08)		ATAAAAATTTGATTCCTACCA	0.358																																					Melanoma(98;1369 1476 6592 22940 26587)												0													44.0	44.0	44.0					6																	96651724		2203	4300	6503	SO:0001583	missense	0			AB023021	CCDS5033.1	6q16	2013-02-26			ENSG00000172461	ENSG00000172461		"""Fucosyltransferases"""	4020	protein-coding gene	gene with protein product		606865				10386598, 10575236	Standard	NM_006581		Approved	Fuc-TIX	uc003pop.4	Q9Y231	OTTHUMG00000015236	ENST00000302103.5:c.693G>T	6.37:g.96651724G>T	ENSP00000302599:p.Leu231Phe		Q5T0W4	Missense_Mutation	SNP	pfam_Glyco_trans_10	p.L231F	ENST00000302103.5	37	c.693	CCDS5033.1	6	.	.	.	.	.	.	.	.	.	.	G	6.312	0.425720	0.11987	.	.	ENSG00000172461	ENST00000302103	T	0.26067	1.76	5.66	2.95	0.34219	.	0.277734	0.36034	N	0.002838	T	0.05960	0.0155	L	0.31420	0.93	0.36851	D	0.88791	B	0.12630	0.006	B	0.18263	0.021	T	0.22695	-1.0209	10	0.10902	T	0.67	-11.1932	9.9714	0.41757	0.2824:0.0:0.7176:0.0	.	231	Q9Y231	FUT9_HUMAN	F	231	ENSP00000302599:L231F	ENSP00000302599:L231F	L	+	3	2	FUT9	96758445	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.933000	0.28897	0.345000	0.23873	-0.216000	0.12614	TTG	FUT9	-	pfam_Glyco_trans_10	ENSG00000172461		0.358	FUT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT9	HGNC	protein_coding	OTTHUMT00000041554.2		0.00	29	0	G	NM_006581		96651724	+1			no_errors	ENST00000302103	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
FZD1	8321	genome.wustl.edu	37	7	90895993	90895993	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr7:90895993T>G	ENST00000287934.2	+	1	2211	c.1798T>G	c.(1798-1800)Ttc>Gtc	p.F600V		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	600					autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			GAGCCCGGACTTCACGGTCTT	0.632																																																	0													25.0	28.0	27.0					7																	90895993		2203	4300	6503	SO:0001583	missense	0			AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.1798T>G	7.37:g.90895993T>G	ENSP00000287934:p.Phe600Val		A4D1E8|O94815|Q549T8	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.F600V	ENST00000287934.2	37	c.1798	CCDS5620.1	7	.	.	.	.	.	.	.	.	.	.	T	18.12	3.553790	0.65425	.	.	ENSG00000157240	ENST00000287934	T	0.80824	-1.42	4.91	4.91	0.64330	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000001	D	0.86539	0.5957	L	0.53671	1.685	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.85767	0.1353	10	0.38643	T	0.18	.	14.997	0.71439	0.0:0.0:0.0:1.0	.	600	Q9UP38	FZD1_HUMAN	V	600	ENSP00000287934:F600V	ENSP00000287934:F600V	F	+	1	0	FZD1	90733929	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.857000	0.86963	2.187000	0.69744	0.533000	0.62120	TTC	FZD1	-	pfam_Frizzled,pfscan_GPCR_2-like	ENSG00000157240		0.632	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD1	HGNC	protein_coding	OTTHUMT00000059367.2	-	0.00	31	0	T	NM_003505		90895993	+1	tier1	-	no_errors	ENST00000287934	ensembl	human	known	74_37	missense	27.06	62	23	SNP	1.000	G
GALNT9	50614	genome.wustl.edu	37	12	132683738	132683738	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:132683738C>G	ENST00000328957.8	-	9	1477	c.1478G>C	c.(1477-1479)tGc>tCc	p.C493S	GALNT9_ENST00000541995.1_Missense_Mutation_p.C127S|GALNT9_ENST00000397325.2_Missense_Mutation_p.C127S|GALNT9_ENST00000535228.1_Missense_Mutation_p.C244S	NM_001122636.1	NP_001116108.1	Q9HCQ5	GALT9_HUMAN	polypeptide N-acetylgalactosaminyltransferase 9	493	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		CATCCCGTGGCAGGGGTAGAG	0.662																																					Colon(186;2147 2752 13553 41466)												0													45.0	53.0	50.0					12																	132683738		2027	4165	6192	SO:0001583	missense	0			AB040672	CCDS41866.1	12q24.33	2014-03-13	2014-03-13		ENSG00000182870	ENSG00000182870	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4131	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 9"""	606251	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)"""			10978536, 12407114	Standard	NM_021808		Approved	GALNAC-T9	uc001ukc.4	Q9HCQ5	OTTHUMG00000168256	ENST00000328957.8:c.1478G>C	12.37:g.132683738C>G	ENSP00000329846:p.Cys493Ser		Q52LR8|Q6NT54|Q8NFR1	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.C493S	ENST00000328957.8	37	c.1478		12	.	.	.	.	.	.	.	.	.	.	c	26.3	4.722232	0.89298	.	.	ENSG00000182870	ENST00000397325;ENST00000328957;ENST00000535228;ENST00000541995	T;T;T;T	0.48522	0.81;0.81;0.81;0.81	4.49	4.49	0.54785	Ricin B-related lectin (1);Ricin B lectin (3);	0.178593	0.64402	D	0.000006	T	0.75568	0.3867	M	0.93978	3.48	0.80722	D	1	P;D;D	0.57899	0.952;0.981;0.981	P;D;D	0.64877	0.886;0.93;0.91	D	0.84098	0.0394	10	0.87932	D	0	.	17.1692	0.86825	0.0:1.0:0.0:0.0	.	244;493;350	B3KNR7;Q9HCQ5;B3KP58	.;GALT9_HUMAN;.	S	127;493;244;127	ENSP00000380488:C127S;ENSP00000329846:C493S;ENSP00000439745:C244S;ENSP00000440544:C127S	ENSP00000329846:C493S	C	-	2	0	GALNT9	131249691	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	7.558000	0.82253	2.025000	0.59659	0.563000	0.77884	TGC	GALNT9	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000182870		0.662	GALNT9-009	KNOWN	basic|appris_principal	protein_coding	GALNT9	HGNC	protein_coding	OTTHUMT00000402967.1	-	0.00	161	0	C	NM_001122636		132683738	-1	tier1	-	no_errors	ENST00000328957	ensembl	human	known	74_37	missense	10.18	150	17	SNP	1.000	G
GHDC	84514	genome.wustl.edu	37	17	40343180	40343180	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:40343180A>C	ENST00000301671.8	-	5	1379	c.938T>G	c.(937-939)cTt>cGt	p.L313R	GHDC_ENST00000587427.1_Missense_Mutation_p.L313R|GHDC_ENST00000414034.3_Missense_Mutation_p.L313R|GHDC_ENST00000590520.1_5'Flank|GHDC_ENST00000593209.1_Missense_Mutation_p.L313R|GHDC_ENST00000436923.2_Missense_Mutation_p.L313R|GHDC_ENST00000428494.2_Missense_Mutation_p.L274R			Q8N2G8	GHDC_HUMAN	GH3 domain containing	313						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		all_cancers(22;0.000229)|Breast(137;0.00104)|all_epithelial(22;0.00304)		BRCA - Breast invasive adenocarcinoma(366;0.124)		AGGGGGCAGAAGGTAGAGCCC	0.637																																																	0													41.0	47.0	45.0					17																	40343180		2203	4300	6503	SO:0001583	missense	0			AF316997, BC011056	CCDS11422.1, CCDS45682.1	17q21.2	2006-08-02				ENSG00000167925			24438	protein-coding gene	gene with protein product		608587				11161808, 11735219	Standard	NR_024573		Approved	LGP1	uc002hzf.4	Q8N2G8		ENST00000301671.8:c.938T>G	17.37:g.40343180A>C	ENSP00000301671:p.Leu313Arg		B4DQS4|E9PDB5|Q9BXM6	Missense_Mutation	SNP	pfam_GH3	p.L313R	ENST00000301671.8	37	c.938	CCDS11422.1	17	.	.	.	.	.	.	.	.	.	.	A	13.49	2.252130	0.39797	.	.	ENSG00000167925	ENST00000393854;ENST00000428494;ENST00000414034;ENST00000301671;ENST00000436923	.	.	.	4.27	4.27	0.50696	.	0.270973	0.30565	N	0.009345	T	0.71443	0.3340	M	0.67953	2.075	0.35080	D	0.763327	D;P;D	0.89917	0.999;0.868;1.0	D;P;D	0.80764	0.987;0.729;0.994	T	0.80160	-0.1498	9	0.62326	D	0.03	-3.4226	11.294	0.49267	1.0:0.0:0.0:0.0	.	274;313;313	E9PDB5;Q8N2G8-2;Q8N2G8	.;.;GHDC_HUMAN	R	257;274;313;313;313	.	ENSP00000301671:L313R	L	-	2	0	GHDC	37596706	0.985000	0.35326	0.425000	0.26659	0.007000	0.05969	3.245000	0.51407	1.789000	0.52484	0.459000	0.35465	CTT	GHDC	-	pfam_GH3	ENSG00000167925		0.637	GHDC-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	GHDC	HGNC	protein_coding	OTTHUMT00000449794.1	-	0.00	9	0	A	NM_032484		40343180	-1	tier1	-	no_errors	ENST00000301671	ensembl	human	known	74_37	missense	20.83	19	5	SNP	0.584	C
GJA5	2702	genome.wustl.edu	37	1	147230991	147230991	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:147230991C>A	ENST00000271348.2	-	2	517	c.356G>T	c.(355-357)gGc>gTc	p.G119V	GJA5_ENST00000369237.1_Missense_Mutation_p.G119V|RP11-433J22.2_ENST00000428911.1_RNA	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	119					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			AGAGCCAGAGCCCCGGACCTC	0.622																																																	0													68.0	67.0	67.0					1																	147230991		2203	4300	6503	SO:0001583	missense	0				CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.356G>T	1.37:g.147230991C>A	ENSP00000271348:p.Gly119Val		Q5T3B6|Q5U0N6	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin40	p.G119V	ENST00000271348.2	37	c.356	CCDS929.1	1	.	.	.	.	.	.	.	.	.	.	C	0.917	-0.717031	0.03206	.	.	ENSG00000143140	ENST00000271348;ENST00000369237;ENST00000430508	D;D;D	0.97752	-4.46;-4.46;-4.52	4.84	1.83	0.25207	.	1.543310	0.03392	N	0.202019	D	0.93612	0.7960	M	0.69823	2.125	0.19300	N	0.999976	B	0.34264	0.446	B	0.35182	0.197	D	0.86708	0.1934	10	0.33141	T	0.24	.	6.115	0.20122	0.1299:0.5497:0.251:0.0693	.	119	P36382	CXA5_HUMAN	V	119	ENSP00000271348:G119V;ENSP00000358240:G119V;ENSP00000407645:G119V	ENSP00000271348:G119V	G	-	2	0	GJA5	145697615	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.048000	0.14078	0.304000	0.22809	-0.175000	0.13238	GGC	GJA5	-	NULL	ENSG00000143140		0.622	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA5	HGNC	protein_coding	OTTHUMT00000039422.2	-	0.00	31	0	C	NM_181703		147230991	-1	tier1	-	no_errors	ENST00000271348	ensembl	human	known	74_37	missense	23.08	20	6	SNP	0.002	A
GJE1	100126572	genome.wustl.edu	37	6	142455173	142455173	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:142455173A>C	ENST00000450456.2	+	2	295	c.226A>C	c.(226-228)Agt>Cgt	p.S76R				Q8NFK1	CXG3_HUMAN	gap junction protein, epsilon 1, 23kDa	75					cell communication (GO:0007154)|myelination (GO:0042552)|sensory perception of sound (GO:0007605)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)											TCCACAAGTAAGTTTTTCTGT	0.343																																																	0																																										SO:0001583	missense	0					6q24.1	2013-01-16			ENSG00000203733	ENSG00000203733		"""Ion channels / Gap junction proteins (connexins)"""	33251	other	unknown						18849090	Standard	NG_033968		Approved	CX23		A6NN92	OTTHUMG00000015706	ENST00000450456.2:c.226A>C	6.37:g.142455173A>C	ENSP00000455469:p.Ser76Arg		A4D296|Q86XI9	Missense_Mutation	SNP	pfam_Connexin_CCC,pfam_Connexin_N	p.S76R	ENST00000450456.2	37	c.226		6																																																																																			GJE1	-	pfam_Connexin_N	ENSG00000203733		0.343	GJE1-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	GJE1	HGNC	protein_coding	OTTHUMT00000042482.2	-	0.00	43	0	A			142455173	+1	tier1	-	no_errors	ENST00000450456	ensembl	human	known	74_37	missense	42.86	40	30	SNP	0.989	C
GPR113	165082	genome.wustl.edu	37	2	26534262	26534262	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:26534262C>A	ENST00000311519.1	-	11	2333	c.2334G>T	c.(2332-2334)ttG>ttT	p.L778F	GPR113_ENST00000541401.1_Missense_Mutation_p.L381F|GPR113_ENST00000421160.2_Missense_Mutation_p.L709F|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000333478.6_Missense_Mutation_p.L579F	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	778					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGAAGCTCCCAAGCCCACTT	0.612																																																	0													96.0	99.0	98.0					2																	26534262		2203	4300	6503	SO:0001583	missense	0			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.2334G>T	2.37:g.26534262C>A	ENSP00000307831:p.Leu778Phe		B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.L579F	ENST00000311519.1	37	c.1737	CCDS46239.1	2	.	.	.	.	.	.	.	.	.	.	C	17.33	3.362400	0.61403	.	.	ENSG00000173567	ENST00000541401;ENST00000333478;ENST00000421160;ENST00000311519	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.85	2.93	0.34026	GPCR, family 2-like (1);	.	.	.	.	T	0.67411	0.2890	M	0.88105	2.93	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.80764	0.993;0.988;0.994;0.991	T	0.67090	-0.5758	9	0.87932	D	0	-1.4714	5.2145	0.15334	0.0:0.5937:0.1493:0.257	.	709;579;778;381	E9PEV1;Q8IZF5-2;Q8IZF5;F5H1E4	.;.;GP113_HUMAN;.	F	381;579;709;778	ENSP00000445729:L381F;ENSP00000327396:L579F;ENSP00000388537:L709F;ENSP00000307831:L778F	ENSP00000307831:L778F	L	-	3	2	GPR113	26387766	0.001000	0.12720	0.465000	0.27155	0.925000	0.55904	-0.254000	0.08781	0.743000	0.32719	0.650000	0.86243	TTG	GPR113	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000173567		0.612	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	GPR113	HGNC	protein_coding	OTTHUMT00000316892.1	-	0.00	27	0	C	NM_153835		26534262	-1	tier1	-	no_errors	ENST00000333478	ensembl	human	known	74_37	missense	17.39	38	8	SNP	0.953	A
GRID2	2895	genome.wustl.edu	37	4	93511341	93511341	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:93511341G>A	ENST00000282020.4	+	2	406	c.148G>A	c.(148-150)Gac>Aac	p.D50N	GRID2_ENST00000510992.1_Missense_Mutation_p.D50N|GRID2_ENST00000505687.1_3'UTR	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	50					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TGCGGTTGGTGACCTTAACCA	0.373																																																	0													138.0	131.0	133.0					4																	93511341		2203	4300	6503	SO:0001583	missense	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.148G>A	4.37:g.93511341G>A	ENSP00000282020:p.Asp50Asn		E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.D50N	ENST00000282020.4	37	c.148	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	G	19.84	3.902274	0.72754	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	D;D	0.86627	-2.15;-2.15	5.83	5.83	0.93111	Extracellular ligand-binding receptor (1);	0.165520	0.39274	N	0.001405	D	0.90448	0.7009	L	0.34521	1.04	0.41711	D	0.989455	D;D	0.69078	0.993;0.997	D;D	0.83275	0.971;0.996	D	0.88684	0.3204	10	0.33141	T	0.24	.	20.1162	0.97934	0.0:0.0:1.0:0.0	.	50;50	E9PH24;O43424	.;GRID2_HUMAN	N	50	ENSP00000282020:D50N;ENSP00000421257:D50N	ENSP00000282020:D50N	D	+	1	0	GRID2	93730364	1.000000	0.71417	0.967000	0.41034	0.946000	0.59487	9.869000	0.99810	2.757000	0.94681	0.563000	0.77884	GAC	GRID2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000152208		0.373	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	-	0.00	55	0	G			93511341	+1	tier1	-	no_errors	ENST00000282020	ensembl	human	known	74_37	missense	13.73	44	7	SNP	1.000	A
GRID2	2895	genome.wustl.edu	37	4	94137897	94137897	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:94137897C>T	ENST00000282020.4	+	6	1056	c.798C>T	c.(796-798)aaC>aaT	p.N266N	GRID2_ENST00000510992.1_Silent_p.N171N|GRID2_ENST00000505687.1_3'UTR	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	266					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		AGGAAATAAACGATGTGGACG	0.373																																																	0													107.0	104.0	105.0					4																	94137897		2203	4300	6503	SO:0001819	synonymous_variant	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.798C>T	4.37:g.94137897C>T			E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.N266	ENST00000282020.4	37	c.798	CCDS3637.1	4																																																																																			GRID2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000152208		0.373	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	-	0.00	56	0	C			94137897	+1	tier1	-	no_errors	ENST00000282020	ensembl	human	known	74_37	silent	19.23	42	10	SNP	0.972	T
GRIPAP1	56850	genome.wustl.edu	37	X	48834841	48834841	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:48834841T>C	ENST00000376441.1	-	22	1971	c.1937A>G	c.(1936-1938)gAg>gGg	p.E646G	GRIPAP1_ENST00000376425.3_Missense_Mutation_p.E615G|GRIPAP1_ENST00000376423.4_Missense_Mutation_p.E567G|GRIPAP1_ENST00000473581.1_5'UTR|GRIPAP1_ENST00000376444.3_Missense_Mutation_p.E601G	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	646						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						AACCAGCTCCTCAAGGCCTGG	0.557																																																	0													35.0	28.0	31.0					X																	48834841		2203	4300	6503	SO:0001583	missense	0			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.1937A>G	X.37:g.48834841T>C	ENSP00000365624:p.Glu646Gly		A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	superfamily_Prefoldin	p.E646G	ENST00000376441.1	37	c.1937	CCDS35248.1	X	.	.	.	.	.	.	.	.	.	.	T	20.2	3.943763	0.73672	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291;ENST00000376423	T	0.52057	0.68	3.33	3.33	0.38152	.	0.331825	0.23727	U	0.045170	T	0.61324	0.2338	M	0.64997	1.995	0.40583	D	0.981419	P;D;B	0.76494	0.821;0.999;0.0	P;D;B	0.75484	0.647;0.986;0.0	T	0.63589	-0.6603	10	0.66056	D	0.02	-5.3999	8.7443	0.34575	0.0:0.0:0.0:1.0	.	567;536;646	Q4V328-2;Q4V328-3;Q4V328	.;.;GRAP1_HUMAN	G	615;601;646;615;567	ENSP00000365608:E615G	ENSP00000365606:E567G	E	-	2	0	GRIPAP1	48719785	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	6.442000	0.73443	1.232000	0.43678	0.376000	0.23039	GAG	GRIPAP1	-	NULL	ENSG00000068400		0.557	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIPAP1	HGNC	protein_coding	OTTHUMT00000080970.2		0.00	39	0	T	NM_207672		48834841	-1			no_errors	ENST00000376441	ensembl	human	known	74_37	missense	22.03	46	13	SNP	1.000	C
GRM3	2913	genome.wustl.edu	37	7	86493638	86493638	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr7:86493638G>A	ENST00000361669.2	+	6	3706	c.2607G>A	c.(2605-2607)cgG>cgA	p.R869R	GRM3_ENST00000546348.1_Silent_p.R461R|GRM3_ENST00000536043.1_Silent_p.R741R|GRM3_ENST00000394720.2_Missense_Mutation_p.G512R|GRM3_ENST00000439827.1_Missense_Mutation_p.G514R	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	869					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.R869R(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					GCAATGGGCGGGAAGTCCTCG	0.473																																					GBM(52;969 1098 3139 52280)												1	Substitution - coding silent(1)	skin(1)											287.0	234.0	252.0					7																	86493638		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.2607G>A	7.37:g.86493638G>A			Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt	p.G512R	ENST00000361669.2	37	c.1534	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	G	16.08	3.022761	0.54683	.	.	ENSG00000198822	ENST00000439827;ENST00000394720	D;D	0.88896	-2.44;-2.44	5.99	2.14	0.27477	.	.	.	.	.	T	0.76955	0.4060	.	.	.	0.23381	N	0.997792	B	0.02656	0.0	B	0.08055	0.003	T	0.59568	-0.7430	7	.	.	.	.	2.4788	0.04582	0.2055:0.1294:0.5308:0.1342	.	514	G5E9K2	.	R	514;512	ENSP00000398767:G514R;ENSP00000378209:G512R	.	G	+	1	0	GRM3	86331574	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	1.030000	0.30153	0.115000	0.18071	0.655000	0.94253	GGA	GRM3	-	NULL	ENSG00000198822		0.473	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2		0.00	36	0	G			86493638	+1			no_errors	ENST00000394720	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	A
GSDMC	56169	genome.wustl.edu	37	8	130762254	130762254	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:130762254G>C	ENST00000276708.4	-	12	2076	c.1195C>G	c.(1195-1197)Ctc>Gtc	p.L399V		NM_031415.2	NP_113603.1	Q9BYG8	GSDMC_HUMAN	gasdermin C	399						cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|mitochondrion (GO:0005739)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	26						GCTTCAAGGAGATAAAGAATG	0.458																																																	0													43.0	43.0	43.0					8																	130762254		2203	4300	6503	SO:0001583	missense	0			AB042405	CCDS6360.1	8q24.21	2014-05-14	2008-07-31	2008-07-31	ENSG00000147697	ENSG00000147697			7151	protein-coding gene	gene with protein product		608384	"""melanoma-derived leucine zipper, extra-nuclear factor"""	MLZE		17350798	Standard	NM_031415		Approved		uc003ysr.3	Q9BYG8	OTTHUMG00000164851	ENST00000276708.4:c.1195C>G	8.37:g.130762254G>C	ENSP00000276708:p.Leu399Val		Q5XKF3|Q6P494	Missense_Mutation	SNP	pfam_Gasdermin	p.L399V	ENST00000276708.4	37	c.1195	CCDS6360.1	8	.	.	.	.	.	.	.	.	.	.	G	8.723	0.914871	0.17907	.	.	ENSG00000147697	ENST00000276708	T	0.32988	1.43	4.54	1.26	0.21427	.	0.532223	0.17067	N	0.188305	T	0.43122	0.1233	M	0.64567	1.98	0.09310	N	1	D	0.71674	0.998	D	0.66716	0.946	T	0.13683	-1.0500	10	0.42905	T	0.14	.	5.1866	0.15187	0.1039:0.0:0.4164:0.4797	.	399	Q9BYG8	GSDMC_HUMAN	V	399	ENSP00000276708:L399V	ENSP00000276708:L399V	L	-	1	0	GSDMC	130831436	0.169000	0.23002	0.038000	0.18304	0.044000	0.14063	0.179000	0.16840	0.429000	0.26202	0.591000	0.81541	CTC	GSDMC	-	pfam_Gasdermin	ENSG00000147697		0.458	GSDMC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSDMC	HGNC	protein_coding	OTTHUMT00000380586.1	-	0.00	39	0	G			130762254	-1	tier1	-	no_errors	ENST00000276708	ensembl	human	known	74_37	missense	9.80	46	5	SNP	0.171	C
GSN	2934	genome.wustl.edu	37	9	124080951	124080951	+	Silent	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr9:124080951C>A	ENST00000373818.4	+	9	1206	c.1137C>A	c.(1135-1137)gtC>gtA	p.V379V	GSN_ENST00000412819.1_Silent_p.V328V|GSN_ENST00000394353.2_Silent_p.V339V|GSN_ENST00000373807.1_Silent_p.V110V|GSN_ENST00000373808.2_Silent_p.V328V|GSN_ENST00000436847.1_Silent_p.V339V|GSN_ENST00000341272.2_Silent_p.V328V|GSN_ENST00000449733.1_Silent_p.V328V|GSN_ENST00000545652.1_Silent_p.V336V|GSN_ENST00000373823.3_Silent_p.V328V	NM_000177.4|NM_001258029.1	NP_000168.1|NP_001244958.1	P06396	GELS_HUMAN	gelsolin	379					actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|aging (GO:0007568)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to cadmium ion (GO:0071276)|cilium morphogenesis (GO:0060271)|oligodendrocyte development (GO:0014003)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of cell adhesion (GO:0030155)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|tissue regeneration (GO:0042246)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)	21						AGGTCTCGGTCCTTCCTGAGG	0.637																																																	0													36.0	39.0	38.0					9																	124080951		2203	4300	6503	SO:0001819	synonymous_variant	0			X04412	CCDS6828.1, CCDS6829.1, CCDS48011.1, CCDS65118.1, CCDS75890.1, CCDS75891.1	9q33	2010-04-27	2010-04-27		ENSG00000148180	ENSG00000148180			4620	protein-coding gene	gene with protein product	"""amyloidosis, Finnish type"""	137350	"""gelsolin (amyloidosis, Finnish type)"""			1652889	Standard	NM_001127662		Approved	DKFZp313L0718	uc004blf.1	P06396	OTTHUMG00000020584	ENST00000373818.4:c.1137C>A	9.37:g.124080951C>A			A2A418|A8MUD1|A8MYN7|B7Z373|B7Z5V1|F5H1A8|Q5T0I2|Q8WVV7	Silent	SNP	pfam_Gelsolin_dom,smart_Villin/Gelsolin,prints_Villin/Gelsolin	p.V379	ENST00000373818.4	37	c.1137	CCDS6828.1	9																																																																																			GSN	-	pfam_Gelsolin_dom,smart_Villin/Gelsolin,prints_Villin/Gelsolin	ENSG00000148180		0.637	GSN-001	KNOWN	basic|CCDS	protein_coding	GSN	HGNC	protein_coding	OTTHUMT00000053861.1	-	0.00	67	0	C	NM_000177		124080951	+1	tier1	-	no_errors	ENST00000373818	ensembl	human	known	74_37	silent	6.35	59	4	SNP	0.674	A
H2BFM	286436	genome.wustl.edu	37	X	103294940	103294940	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:103294940G>A	ENST00000355016.3	+	1	425	c.397G>A	c.(397-399)Gcc>Acc	p.A133T	H2BFM_ENST00000243297.5_Missense_Mutation_p.A236T	NM_001164416.1	NP_001157888.1	P0C1H6	H2BFM_HUMAN	H2B histone family, member M	133						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(1)|ovary(1)	3						GGGCAAGCTCGCCGAGGCCCA	0.627																																																	0													5.0	6.0	6.0					X																	103294940		687	1550	2237	SO:0001583	missense	0			AK093522	CCDS55468.1	Xq22.2	2011-01-27			ENSG00000101812	ENSG00000101812		"""Histones / Replication-independent"""	27867	protein-coding gene	gene with protein product							Standard	NM_001164416		Approved		uc004els.2	P0C1H6	OTTHUMG00000022122	ENST00000355016.3:c.397G>A	X.37:g.103294940G>A	ENSP00000347119:p.Ala133Thr		A6NP82	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.A236T	ENST00000355016.3	37	c.706	CCDS55468.1	X	.	.	.	.	.	.	.	.	.	.	.	17.51	3.407376	0.62399	.	.	ENSG00000101812	ENST00000243297;ENST00000355016;ENST00000417637	T;T;T	0.36340	1.26;1.26;1.26	2.66	1.77	0.24775	Histone-fold (2);	0.151282	0.21743	U	0.069794	T	0.39410	0.1077	N	0.24115	0.695	0.41849	D	0.990163	D	0.76494	0.999	D	0.75020	0.985	T	0.24154	-1.0168	10	0.72032	D	0.01	.	7.1128	0.25401	0.1497:0.0:0.8503:0.0	.	236	P0C1H6	H2BFM_HUMAN	T	236;133;31	ENSP00000243297:A236T;ENSP00000347119:A133T;ENSP00000402466:A31T	ENSP00000243297:A236T	A	+	1	0	H2BFM	103181596	1.000000	0.71417	0.002000	0.10522	0.000000	0.00434	5.991000	0.70602	0.383000	0.24910	-0.312000	0.09012	GCC	H2BFM	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000101812		0.627	H2BFM-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	H2BFM	HGNC	protein_coding	OTTHUMT00000057758.2	-	0.00	52	0	G	XM_210048		103294940	+1	tier1	-	no_errors	ENST00000243297	ensembl	human	known	74_37	missense	23.33	45	14	SNP	1.000	A
HBB	3043	genome.wustl.edu	37	11	5247854	5247854	+	Missense_Mutation	SNP	T	T	C	rs35351128		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:5247854T>C	ENST00000335295.4	-	2	317	c.268A>G	c.(268-270)Agt>Ggt	p.S90G	CoTC_ribozyme_ENST00000408104.1_RNA	NM_000518.4	NP_000509.1	P68871	HBB_HUMAN	hemoglobin, beta	90			S -> N (in Creteil; O(2) affinity up).|S -> R (in Vanderbilt; O(2) affinity up).		bicarbonate transport (GO:0015701)|blood coagulation (GO:0007596)|hydrogen peroxide catabolic process (GO:0042744)|nitric oxide transport (GO:0030185)|oxidation-reduction process (GO:0055114)|oxygen transport (GO:0015671)|platelet aggregation (GO:0070527)|positive regulation of cell death (GO:0010942)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein heterooligomerization (GO:0051291)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|renal absorption (GO:0070293)|response to hydrogen peroxide (GO:0042542)|small molecule metabolic process (GO:0044281)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|haptoglobin-hemoglobin complex (GO:0031838)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|hemoglobin binding (GO:0030492)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)	15		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)	Iron Dextran(DB00893)	TGCAGCTCACTCAGTGTGGCA	0.522									Sickle Cell Trait																																								0													131.0	110.0	117.0					11																	5247854		2201	4298	6499	SO:0001583	missense	0	Familial Cancer Database		J00173	CCDS7753.1	11p15.5	2014-05-19			ENSG00000244734	ENSG00000244734			4827	protein-coding gene	gene with protein product		141900				2649166	Standard	NM_000518		Approved	CD113t-C, HBD, beta-globin	uc001mae.1	P68871	OTTHUMG00000066678	ENST00000335295.4:c.268A>G	11.37:g.5247854T>C	ENSP00000333994:p.Ser90Gly		A4GX73|B2ZUE0|P02023|Q13852|Q14481|Q14510|Q45KT0|Q549N7|Q6FI08|Q6R7N2|Q8IZI1|Q9BX96|Q9UCD6|Q9UCP8|Q9UCP9	Missense_Mutation	SNP	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b	p.S90G	ENST00000335295.4	37	c.268	CCDS7753.1	11	.	.	.	.	.	.	.	.	.	.	t	18.36	3.607568	0.66558	.	.	ENSG00000244734	ENST00000335295;ENST00000380315	D;D	0.92647	-3.08;-3.08	5.24	5.24	0.73138	Globin-like (1);Globin, structural domain (1);	.	.	.	.	D	0.96188	0.8757	M	0.92604	3.325	0.58432	D	0.999991	D	0.65815	0.995	D	0.63703	0.917	D	0.96546	0.9404	9	0.87932	D	0	-14.8612	10.2825	0.43548	0.1479:0.0:0.0:0.852	.	90	P68871	HBB_HUMAN	G	90	ENSP00000333994:S90G;ENSP00000369671:S90G	ENSP00000333994:S90G	S	-	1	0	HBB	5204430	1.000000	0.71417	0.993000	0.49108	0.461000	0.32589	3.416000	0.52707	2.323000	0.78572	0.528000	0.53228	AGT	HBB	-	pfam_Globin,superfamily_Globin-like,pfscan_Globin	ENSG00000244734		0.522	HBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBB	HGNC	protein_coding	OTTHUMT00000142977.2	-	0.00	85	0	T	NM_000518		5247854	-1	tier1	-	no_errors	ENST00000335295	ensembl	human	known	74_37	missense	26.88	68	25	SNP	1.000	C
HDLBP	3069	genome.wustl.edu	37	2	242179451	242179451	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:242179451C>A	ENST00000391975.1	-	18	2483	c.2256G>T	c.(2254-2256)aaG>aaT	p.K752N	HDLBP_ENST00000427183.2_Missense_Mutation_p.K719N|HDLBP_ENST00000310931.4_Missense_Mutation_p.K752N|HDLBP_ENST00000391976.2_Missense_Mutation_p.K752N	NM_203346.3	NP_976221	Q00341	VIGLN_HUMAN	high density lipoprotein binding protein	752	KH 9. {ECO:0000255|PROSITE- ProRule:PRU00117}.				cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)	cytoplasm (GO:0005737)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)			breast(7)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_cancers(19;7.77e-41)|all_epithelial(40;1.74e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.0121)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;8.13e-34)|all cancers(36;4.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;2.34e-15)|Kidney(56;3.72e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.76e-08)|BRCA - Breast invasive adenocarcinoma(100;3.38e-06)|Lung(119;0.000109)|LUSC - Lung squamous cell carcinoma(224;0.000964)|Colorectal(34;0.0132)|COAD - Colon adenocarcinoma(134;0.0928)		TGTCGCGCACCTTGCGAATTT	0.557																																																	0													170.0	158.0	162.0					2																	242179451		2203	4300	6503	SO:0001583	missense	0				CCDS2547.1, CCDS58760.1	2q37.3	2008-07-18	2008-07-18		ENSG00000115677	ENSG00000115677			4857	protein-coding gene	gene with protein product		142695	"""vigilin"""	VGL		1318310, 8390966	Standard	NM_005336		Approved	HBP	uc002waz.3	Q00341	OTTHUMG00000133391	ENST00000391975.1:c.2256G>T	2.37:g.242179451C>A	ENSP00000375836:p.Lys752Asn		B4DTQ2|E7EM71|Q53QU2|Q9UCY3	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.K752N	ENST00000391975.1	37	c.2256	CCDS2547.1	2	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	17.29|17.29|17.29	3.351051|3.351051|3.351051	0.61183|0.61183|0.61183	.|.|.	.|.|.	ENSG00000115677|ENSG00000115677|ENSG00000115677	ENST00000373292|ENST00000391975;ENST00000391976;ENST00000310931;ENST00000427183;ENST00000452931|ENST00000427487	.|T;T;T;T;T|.	.|0.30448|.	.|1.53;1.53;1.53;1.53;1.77|.	5.59|5.59|5.59	0.606|0.606|0.606	0.17559|0.17559|0.17559	.|K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);|.	.|0.000000|.	.|0.85682|.	.|D|.	.|0.000000|.	T|T|T	0.62270|0.62270|0.62270	0.2414|0.2414|0.2414	M|M|M	0.68593|0.68593|0.68593	2.085|2.085|2.085	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D;P|.	.|0.76494|.	.|0.999;0.925|.	.|D;P|.	.|0.78314|.	.|0.991;0.891|.	T|T|T	0.57112|0.57112|0.57112	-0.7867|-0.7867|-0.7867	5|10|5	.|0.59425|.	.|D|.	.|0.04|.	-24.3532|-24.3532|-24.3532	10.1125|10.1125|10.1125	0.42572|0.42572|0.42572	0.0:0.4837:0.0:0.5163|0.0:0.4837:0.0:0.5163|0.0:0.4837:0.0:0.5163	.|.|.	.|719;752|.	.|E7EM71;Q00341|.	.|.;VIGLN_HUMAN|.	C|N|M	561|752;752;752;719;261|154	.|ENSP00000375836:K752N;ENSP00000375837:K752N;ENSP00000312042:K752N;ENSP00000399139:K719N;ENSP00000388876:K261N|.	.|ENSP00000312042:K752N|.	G|K|R	-|-|-	1|3|2	0|2|0	HDLBP|HDLBP|HDLBP	241828124|241828124|241828124	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.037000|0.037000|0.037000	0.18230|0.18230|0.18230	0.614000|0.614000|0.614000	0.37383|0.37383|0.37383	2.156000|2.156000|2.156000	0.42310|0.42310|0.42310	-0.168000|-0.168000|-0.168000	0.10853|0.10853|0.10853	-0.145000|-0.145000|-0.145000	0.13849|0.13849|0.13849	GGT|AAG|AGG	HDLBP	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000115677		0.557	HDLBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDLBP	HGNC	protein_coding	OTTHUMT00000257245.5		0.00	26	0	C	NM_203346		242179451	-1			no_errors	ENST00000310931	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	A
HEPH	9843	genome.wustl.edu	37	X	65413355	65413355	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:65413355A>C	ENST00000343002.2	+	7	1908	c.1244A>C	c.(1243-1245)aAg>aCg	p.K415T	HEPH_ENST00000336279.5_Missense_Mutation_p.K148T|HEPH_ENST00000374727.3_Missense_Mutation_p.K418T|HEPH_ENST00000441993.2_Missense_Mutation_p.K418T|HEPH_ENST00000419594.1_Missense_Mutation_p.K418T|HEPH_ENST00000519389.1_Missense_Mutation_p.K469T			Q9BQS7	HEPH_HUMAN	hephaestin	415	Plastocyanin-like 3.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						ATCTCAGATAAGTTTTTCCAG	0.383																																																	0													36.0	34.0	34.0					X																	65413355		2203	4300	6503	SO:0001583	missense	0			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.1244A>C	X.37:g.65413355A>C	ENSP00000343939:p.Lys415Thr		B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.K469T	ENST00000343002.2	37	c.1406		X	.	.	.	.	.	.	.	.	.	.	A	9.403	1.078567	0.20227	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D;D	0.98849	-5.18;-5.18;-5.18;-5.18;-5.18;-5.18;-5.18	5.39	2.95	0.34219	Cupredoxin (2);	0.635577	0.16844	N	0.197239	D	0.94355	0.8185	N	0.17872	0.535	0.31408	N	0.675906	B;B;B	0.27559	0.001;0.181;0.003	B;B;B	0.29267	0.003;0.1;0.007	D	0.89920	0.4058	10	0.12103	T	0.63	.	5.8753	0.18826	0.7682:0.0:0.0826:0.1491	.	469;418;415	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	T	469;418;148;418;418;415;415	ENSP00000430620:K469T;ENSP00000363859:K418T;ENSP00000337418:K148T;ENSP00000411687:K418T;ENSP00000413211:K418T;ENSP00000343939:K415T;ENSP00000398078:K415T	ENSP00000337418:K148T	K	+	2	0	HEPH	65330080	0.991000	0.36638	0.973000	0.42090	0.733000	0.41908	0.622000	0.24433	0.210000	0.20664	0.481000	0.45027	AAG	HEPH	-	superfamily_Cupredoxin	ENSG00000089472		0.383	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	HGNC	protein_coding	OTTHUMT00000056995.1	-	0.00	45	0	A	NM_138737		65413355	+1	tier1	-	no_errors	ENST00000519389	ensembl	human	known	74_37	missense	20.00	44	11	SNP	1.000	C
HERC1	8925	genome.wustl.edu	37	15	64066901	64066901	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:64066901G>A	ENST00000443617.2	-	2	1009	c.922C>T	c.(922-924)Cgt>Tgt	p.R308C		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	308					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						ACCAAAGAACGCCTCATCTGC	0.368																																																	0													63.0	58.0	59.0					15																	64066901		1900	4123	6023	SO:0001583	missense	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.922C>T	15.37:g.64066901G>A	ENSP00000390158:p.Arg308Cys		Q8IW65	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.R308C	ENST00000443617.2	37	c.922	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	G	19.15	3.771575	0.69992	.	.	ENSG00000103657	ENST00000443617;ENST00000425434	T	0.25912	1.77	5.43	4.5	0.54988	.	0.000000	0.64402	U	0.000001	T	0.34571	0.0902	L	0.44542	1.39	0.80722	D	1	B;D;B	0.63880	0.014;0.993;0.008	B;P;B	0.58577	0.006;0.841;0.003	T	0.09509	-1.0671	10	0.72032	D	0.01	.	8.5508	0.33451	0.0794:0.0:0.7706:0.1499	.	308;308;308	B4DKS2;C9JUT5;Q15751	.;.;HERC1_HUMAN	C	308	ENSP00000390158:R308C	ENSP00000389613:R308C	R	-	1	0	HERC1	61853954	1.000000	0.71417	0.993000	0.49108	0.992000	0.81027	5.348000	0.66004	1.383000	0.46405	0.655000	0.94253	CGT	HERC1	-	NULL	ENSG00000103657		0.368	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	-	0.00	39	0	G	NM_003922		64066901	-1	tier1	-	no_errors	ENST00000443617	ensembl	human	known	74_37	missense	14.06	55	9	SNP	0.999	A
HERC4	26091	genome.wustl.edu	37	10	69716603	69716603	+	Intron	DEL	A	A	-	rs78135151		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr10:69716603delA	ENST00000395198.3	-	18	2297				HERC4_ENST00000277817.6_Intron|HERC4_ENST00000480158.1_5'UTR|HERC4_ENST00000412272.2_Intron|HERC4_ENST00000373700.4_Intron|HERC4_ENST00000395187.2_Intron	NM_022079.2	NP_071362.1	Q5GLZ8	HERC4_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase 4						cell differentiation (GO:0030154)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	27						AGAAACAATTAAAAAAAAAAA	0.328																																																	0													37.0	43.0	41.0					10																	69716603		2202	4297	6499	SO:0001627	intron_variant	0			AY221963	CCDS7274.1, CCDS41533.1, CCDS60541.1, CCDS60542.1	10q21.3	2013-09-20	2012-02-23		ENSG00000148634	ENSG00000148634			24521	protein-coding gene	gene with protein product		609248	"""hect domain and RLD 4"""			10997877	Standard	NM_022079		Approved	DKFZP564G092, KIAA1593	uc001jng.4	Q5GLZ8	OTTHUMG00000018343	ENST00000395198.3:c.2049+31T>-	10.37:g.69716603delA			Q5GC98|Q5GC99|Q5GCA0|Q8IXP9|Q9HCH9	RNA	DEL	-	NULL	ENST00000395198.3	37	NULL	CCDS41533.1	10																																																																																			HERC4	-	-	ENSG00000148634		0.328	HERC4-009	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC4	HGNC	protein_coding	OTTHUMT00000359262.1		0.00	12	0	A	NM_015601		69716603	-1	tier1		no_errors	ENST00000480158	ensembl	human	known	74_37	rna	13.04	20	3	DEL	0.000	-
HIST1H1E	3008	genome.wustl.edu	37	6	26156794	26156795	+	Frame_Shift_Del	DEL	TG	TG	-	rs374200136		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:26156794_26156795delTG	ENST00000304218.3	+	1	236_237	c.176_177delTG	c.(175-177)ttgfs	p.L59fs	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	59	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)	p.L59L(1)		NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						GGCGTATCTTTGGCCGCTCTCA	0.614																																																	1	Substitution - coding silent(1)	central_nervous_system(1)																																								SO:0001589	frameshift_variant	0			M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.176_177delTG	6.37:g.26156794_26156795delTG	ENSP00000307705:p.Leu59fs		Q4VB25	Frame_Shift_Del	DEL	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.L59fs	ENST00000304218.3	37	c.176_177	CCDS4586.1	6																																																																																			HIST1H1E	-	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	ENSG00000168298		0.614	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1E	HGNC	protein_coding	OTTHUMT00000040084.1		0.00	67	0	TG	NM_005321		26156795	+1	tier1		no_errors	ENST00000304218	ensembl	human	known	74_37	frame_shift_del	26.87	49	18	DEL	0.756:0.761	-
HIST1H1E	3008	genome.wustl.edu	37	6	26156799	26156800	+	Frame_Shift_Ins	INS	-	-	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:26156799_26156800insC	ENST00000304218.3	+	1	241_242	c.181_182insC	c.(181-183)gctfs	p.A61fs	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	61	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						ATCTTTGGCCGCTCTCAAGAAA	0.619																																																	0																																										SO:0001589	frameshift_variant	0			M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.182dupC	6.37:g.26156800_26156800dupC	ENSP00000307705:p.Ala61fs		Q4VB25	Frame_Shift_Ins	INS	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.L62fs	ENST00000304218.3	37	c.181_182	CCDS4586.1	6																																																																																			HIST1H1E	-	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	ENSG00000168298		0.619	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1E	HGNC	protein_coding	OTTHUMT00000040084.1		0.00	69	0	-	NM_005321		26156800	+1	tier1		no_errors	ENST00000304218	ensembl	human	known	74_37	frame_shift_ins	32.39	48	23	INS	1.000:1.000	C
HIST1H2BO	8348	genome.wustl.edu	37	6	27861281	27861281	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:27861281G>A	ENST00000303806.4	+	1	79	c.41G>A	c.(40-42)gGc>gAc	p.G14D	HIST1H3J_ENST00000479986.1_5'Flank|HIST1H3J_ENST00000359303.2_5'Flank|HIST1H2AM_ENST00000359611.2_5'Flank	NM_003527.4	NP_003518.2	P23527	H2B1O_HUMAN	histone cluster 1, H2bo	14					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)										CCCAAAAAGGGCTCCAAGAAA	0.532																																																	0													62.0	65.0	64.0					6																	27861281		2203	4300	6503	SO:0001583	missense	0			X57138	CCDS4640.1	6p22.1	2011-01-27	2006-10-11	2003-02-21	ENSG00000196331			"""Histones / Replication-dependent"""	4758	protein-coding gene	gene with protein product		602808	"""H2B histone family, member N"", ""histone 1, H2bo"""	H2BFN		1768865, 12408966	Standard	NM_003527		Approved	H2B/n, H2B.2	uc003nkc.1	P23527	OTTHUMG00000014493	ENST00000303806.4:c.41G>A	6.37:g.27861281G>A	ENSP00000303408:p.Gly14Asp		Q3KPI7|Q8TCV6	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.G14D	ENST00000303806.4	37	c.41	CCDS4640.1	6	.	.	.	.	.	.	.	.	.	.	G	13.32	2.200901	0.38905	.	.	ENSG00000196331	ENST00000303806	T	0.24538	1.85	3.7	3.7	0.42460	Histone-fold (2);	.	.	.	.	T	0.46171	0.1379	M	0.86953	2.85	0.39749	D	0.97185	D	0.61080	0.989	D	0.63957	0.92	T	0.57516	-0.7798	9	0.87932	D	0	.	15.2409	0.73468	0.0:0.0:1.0:0.0	.	14	P23527	H2B1O_HUMAN	D	14	ENSP00000303408:G14D	ENSP00000303408:G14D	G	+	2	0	HIST1H2BO	27969260	1.000000	0.71417	0.998000	0.56505	0.078000	0.17371	6.066000	0.71185	2.356000	0.79943	0.561000	0.74099	GGC	HIST1H2BO	-	superfamily_Histone-fold	ENSG00000196331		0.532	HIST1H2BO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BO	HGNC	protein_coding	OTTHUMT00000040161.1	-	0.00	45	0	G	NM_003527		27861281	+1	tier1	-	no_errors	ENST00000303806	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	A
HIVEP3	59269	genome.wustl.edu	37	1	42049977	42049977	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:42049977G>A	ENST00000372583.1	-	4	1377	c.492C>T	c.(490-492)ttC>ttT	p.F164F	HIVEP3_ENST00000372584.1_Silent_p.F164F|HIVEP3_ENST00000247584.5_Silent_p.F164F|HIVEP3_ENST00000429157.2_Silent_p.F164F	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	164					positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F164F(1)		NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				GACGAGGCACGAAGACTTTGG	0.597																																																	1	Substitution - coding silent(1)	large_intestine(1)											90.0	96.0	94.0					1																	42049977		2203	4300	6503	SO:0001819	synonymous_variant	0			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.492C>T	1.37:g.42049977G>A			A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F164	ENST00000372583.1	37	c.492	CCDS463.1	1																																																																																			HIVEP3	-	NULL	ENSG00000127124		0.597	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1	-	0.00	31	0	G	NM_024503		42049977	-1	tier1	-	no_errors	ENST00000247584	ensembl	human	known	74_37	silent	37.50	30	18	SNP	0.266	A
HOXB8	3218	genome.wustl.edu	37	17	46690707	46690707	+	Silent	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:46690707G>T	ENST00000239144.4	-	2	823	c.589C>A	c.(589-591)Cgg>Agg	p.R197R	HOXB7_ENST00000567101.2_Intron|HOXB7_ENST00000239165.7_5'Flank|HOXB8_ENST00000576562.1_Silent_p.R196R	NM_024016.3	NP_076921.1	P17481	HXB8_HUMAN	homeobox B8	197					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|dorsal spinal cord development (GO:0021516)|embryonic skeletal system morphogenesis (GO:0048704)|grooming behavior (GO:0007625)|negative regulation of myeloid cell differentiation (GO:0045638)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(8)|urinary_tract(2)	11						TTCATCCTCCGGTTCTGGAAC	0.522																																																	0													123.0	114.0	117.0					17																	46690707		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11533.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120068	ENSG00000120068		"""Homeoboxes / ANTP class : HOXL subclass"""	5119	protein-coding gene	gene with protein product		142963	"""homeo box B8"""	HOX2, HOX2D		1973146, 1358459	Standard	XM_005257286		Approved		uc002inw.3	P17481	OTTHUMG00000159904	ENST00000239144.4:c.589C>A	17.37:g.46690707G>T			Q9H1I2	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_HTH_motif	p.R197	ENST00000239144.4	37	c.589	CCDS11533.1	17																																																																																			HOXB8	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_HTH_motif	ENSG00000120068		0.522	HOXB8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HOXB8	HGNC	protein_coding	OTTHUMT00000358092.3	-	0.00	43	0	G			46690707	-1	tier1	-	no_errors	ENST00000239144	ensembl	human	known	74_37	silent	6.58	71	5	SNP	1.000	T
HP1BP3	50809	genome.wustl.edu	37	1	21076257	21076257	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:21076257T>A	ENST00000312239.5	-	10	1239	c.1100A>T	c.(1099-1101)tAt>tTt	p.Y367F	HP1BP3_ENST00000375003.2_Missense_Mutation_p.Y215F	NM_016287.3	NP_057371.2	Q5SSJ5	HP1B3_HUMAN	heterochromatin protein 1, binding protein 3	367	H15 3. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(2)|skin(2)|urinary_tract(1)	16		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		CTCTAGGACATACTTCTTCAG	0.428																																																	0													124.0	119.0	121.0					1																	21076257		2203	4300	6503	SO:0001583	missense	0			BC053327	CCDS30621.1	1p36.12	2008-02-05			ENSG00000127483	ENSG00000127483			24973	protein-coding gene	gene with protein product						12477932	Standard	NM_016287		Approved	HP1-BP74	uc001bdw.1	Q5SSJ5	OTTHUMG00000002622	ENST00000312239.5:c.1100A>T	1.37:g.21076257T>A	ENSP00000312625:p.Tyr367Phe		A6NI71|A8K5D7|B3KMZ8|B4E210|Q05BI0|Q5SSJ6|Q5SWC6|Q6PIM9|Q8NDF0|Q9UHY0	Missense_Mutation	SNP	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15	p.Y367F	ENST00000312239.5	37	c.1100	CCDS30621.1	1	.	.	.	.	.	.	.	.	.	.	T	19.48	3.835912	0.71373	.	.	ENSG00000127483	ENST00000312239;ENST00000375004;ENST00000375003;ENST00000419948	T;T;T	0.27720	1.65;1.65;1.65	5.85	5.85	0.93711	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.108369	0.64402	D	0.000003	T	0.46210	0.1381	L	0.37697	1.125	0.80722	D	1	D	0.63046	0.992	D	0.76071	0.987	T	0.26950	-1.0088	10	0.36615	T	0.2	-7.3698	16.2473	0.82450	0.0:0.0:0.0:1.0	.	367	Q5SSJ5	HP1B3_HUMAN	F	367;329;215;226	ENSP00000312625:Y367F;ENSP00000364142:Y215F;ENSP00000391721:Y226F	ENSP00000312625:Y367F	Y	-	2	0	HP1BP3	20948844	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	3.660000	0.54496	2.238000	0.73509	0.533000	0.62120	TAT	HP1BP3	-	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15	ENSG00000127483		0.428	HP1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HP1BP3	HGNC	protein_coding	OTTHUMT00000007457.2	-	0.00	35	0	T	NM_016287		21076257	-1	tier1	-	no_errors	ENST00000312239	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	A
HRNR	388697	genome.wustl.edu	37	1	152188213	152188213	+	Silent	SNP	G	G	A	rs141147625	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:152188213G>A	ENST00000368801.2	-	3	5967	c.5892C>T	c.(5890-5892)taC>taT	p.Y1964Y	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1964					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATATGGGCCGTAGCTGGAAG	0.612																																																	0								A		157,4207	800.0+/-415.5	4,149,2029	391.0	658.0	568.0		5892	-6.8	0.0	1	dbSNP_134	568	1,8583		0,1,4291	no	coding-synonymous	HRNR	NM_001009931.1		4,150,6320	AA,AG,GG		0.0116,3.5976,1.2203		1964/2851	152188213	158,12790	2182	4292	6474	SO:0001819	synonymous_variant	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5892C>T	1.37:g.152188213G>A			Q5DT20|Q5U1F4	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.Y1964	ENST00000368801.2	37	c.5892	CCDS30859.1	1																																																																																			HRNR	-	NULL	ENSG00000197915		0.612	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	-	0.00	411	0	G	XM_373868		152188213	-1	tier1	rs141147625	no_errors	ENST00000368801	ensembl	human	known	74_37	silent	6.36	633	43	SNP	0.000	A
HSP90AA4P	3323	genome.wustl.edu	37	4	190396094	190396094	+	RNA	DEL	A	A	-			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:190396094delA	ENST00000378770.1	+	0	1005							Q58FG1	HS904_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 4, pseudogene						protein folding (GO:0006457)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)										ACCTTAAGGCAAAAGGCAGAG	0.463																																																	0																																												0					4q35.2	2011-04-15	2011-04-15	2006-02-24	ENSG00000205100	ENSG00000205100			5255	pseudogene	pseudogene			"""heat shock 90kD protein 1, alpha-like 2"", ""heat shock 90kDa protein 1, alpha-like 2"""	HSPCAL2		1740332, 16269234	Standard	NG_003014		Approved			Q58FG1	OTTHUMG00000160204		4.37:g.190396094delA				RNA	DEL	-	NULL	ENST00000378770.1	37	NULL		4																																																																																			HSP90AA4P	-	-	ENSG00000205100		0.463	HSP90AA4P-002	KNOWN	basic	processed_transcript	HSP90AA4P	HGNC	pseudogene	OTTHUMT00000359634.1		0.00	102	0	A	NG_003014		190396094	+1	tier1		no_errors	ENST00000378770	ensembl	human	known	74_37	rna	9.92	109	12	DEL	1.000	-
HUWE1	10075	genome.wustl.edu	37	X	53602122	53602122	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:53602122T>A	ENST00000342160.3	-	45	6547	c.6090A>T	c.(6088-6090)caA>caT	p.Q2030H	HUWE1_ENST00000262854.6_Missense_Mutation_p.Q2030H			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2030					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TACCCTCTCCTTGGGAGGTCC	0.438																																																	0													49.0	42.0	45.0					X																	53602122		2203	4300	6503	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.6090A>T	X.37:g.53602122T>A	ENSP00000340648:p.Gln2030His		O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.Q2030H	ENST00000342160.3	37	c.6090	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.96|14.96	2.690628|2.690628	0.48097|0.48097	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052	T;T|.	0.37752|.	1.18;1.18|.	4.89|4.89	4.89|4.89	0.63831|0.63831	.|.	0.524332|.	0.18710|.	N|.	0.133320|.	T|T	0.44180|0.44180	0.1281|0.1281	N|N	0.24115|0.24115	0.695|0.695	0.45415|0.45415	D|D	0.998395|0.998395	D;D|.	0.59767|.	0.976;0.986|.	P;P|.	0.59703|.	0.644;0.862|.	T|T	0.32903|0.32903	-0.9889|-0.9889	10|5	0.52906|.	T|.	0.07|.	.|.	11.1819|11.1819	0.48633|0.48633	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2030;2030|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	H|W	2030|1064	ENSP00000340648:Q2030H;ENSP00000262854:Q2030H|.	ENSP00000262854:Q2030H|.	Q|R	-|-	3|1	2|2	HUWE1|HUWE1	53618847|53618847	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	1.308000|1.308000	0.33528|0.33528	1.619000|1.619000	0.50296|0.50296	0.486000|0.486000	0.48141|0.48141	CAA|AGG	HUWE1	-	NULL	ENSG00000086758		0.438	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	43	0	T	XM_497119		53602122	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	missense	43.64	31	24	SNP	1.000	A
HYPK	25764	genome.wustl.edu	37	15	44093677	44093677	+	Intron	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:44093677G>A	ENST00000406925.1	+	4	4353				SERF2_ENST00000594896.1_Intron|SERF2_ENST00000600633.1_Intron|HYPK_ENST00000442995.2_Intron|HYPK_ENST00000498605.1_3'UTR|RP11-296A16.1_ENST00000417761.2_5'Flank|HYPK_ENST00000458412.1_Intron|SERINC4_ENST00000299969.6_5'Flank|SERINC4_ENST00000319327.6_5'Flank|SERINC4_ENST00000249714.3_5'Flank			Q9NX55	HYPK_HUMAN	huntingtin interacting protein K							cytoplasm (GO:0005737)|nucleus (GO:0005634)							all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		GBM - Glioblastoma multiforme(94;8.1e-07)		TATGGTGTTGGTTGAGAATGA	0.373																																																	0													42.0	45.0	44.0					15																	44093677		2197	4295	6492	SO:0001627	intron_variant	0			AF049613	CCDS10104.1	15q14	2012-10-08	2012-10-08	2012-10-08	ENSG00000242028	ENSG00000242028			18418	protein-coding gene	gene with protein product	"""Huntingtin yeast partner K"""	612784	"""chromosome 15 open reading frame 63"""	C15orf63		9700202, 20154145	Standard	NM_016400		Approved	HSPC136, FLJ20431	uc001ztf.3	Q9NX55	OTTHUMG00000060146	ENST00000406925.1:c.243-39G>A	15.37:g.44093677G>A			C9JKJ0|O75408|Q8WUW8|Q9P024	RNA	SNP	-	NULL	ENST00000406925.1	37	NULL	CCDS10104.1	15																																																																																			HYPK	-	-	ENSG00000242028		0.373	HYPK-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	HYPK	HGNC	protein_coding	OTTHUMT00000133876.3	-	0.00	38	0	G	NM_016400		44093677	+1	tier1	-	no_errors	ENST00000498605	ensembl	human	known	74_37	rna	52.78	17	19	SNP	0.001	A
IFI6	2537	genome.wustl.edu	37	1	27994770	27994770	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:27994770C>T	ENST00000361157.6	-	4	392	c.265G>A	c.(265-267)Gcc>Acc	p.A89T	IFI6_ENST00000362020.4_Missense_Mutation_p.A93T|IFI6_ENST00000339145.4_Missense_Mutation_p.A97T|RP11-288L9.4_ENST00000430683.1_RNA	NM_002038.3|NM_022872.2|NM_022873.2	NP_002029.3|NP_075010.1|NP_075011.1	P09912	IFI6_HUMAN	interferon, alpha-inducible protein 6	89					cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of mitochondrial depolarization (GO:0051902)|release of cytochrome c from mitochondria (GO:0001836)|type I interferon signaling pathway (GO:0060337)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)				lung(1)|ovary(1)	2		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;7.75e-05)|Renal(390;0.00121)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00244)|KIRC - Kidney renal clear cell carcinoma(1967;0.0027)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		AGCCCCCCGGCGGGCACGCCG	0.667																																																	0													5.0	6.0	6.0					1																	27994770		2046	4041	6087	SO:0001583	missense	0			BC015603	CCDS306.1, CCDS307.1, CCDS308.1	1p35	2008-02-05	2006-04-21	2006-04-21	ENSG00000126709	ENSG00000126709			4054	protein-coding gene	gene with protein product		147572	"""interferon, alpha-inducible protein (clone IFI-6-16)"""	G1P3			Standard	NM_002038		Approved	IFI616, FAM14C, 6-16, IFI-6-16	uc001bon.1	P09912	OTTHUMG00000003518	ENST00000361157.6:c.265G>A	1.37:g.27994770C>T	ENSP00000354736:p.Ala89Thr		Q13141|Q13142|Q5VVR2|Q5VVR3|Q6IE95|Q969M8	Missense_Mutation	SNP	pfam_IFI6/IFI27	p.A97T	ENST00000361157.6	37	c.289	CCDS306.1	1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.027354	0.75390	.	.	ENSG00000126709	ENST00000361157;ENST00000339145;ENST00000362020	T;T;T	0.42513	0.97;0.97;0.97	3.59	3.59	0.41128	.	0.192052	0.45126	D	0.000382	T	0.62962	0.2471	M	0.79693	2.465	0.36933	D	0.891976	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.87578	0.935;0.998;0.921	T	0.71520	-0.4568	10	0.56958	D	0.05	.	10.8944	0.47015	0.0:1.0:0.0:0.0	.	93;89;97	Q5VVR2;P09912;P09912-3	.;IFI6_HUMAN;.	T	89;97;93	ENSP00000354736:A89T;ENSP00000342513:A97T;ENSP00000355152:A93T	ENSP00000342513:A97T	A	-	1	0	IFI6	27867357	0.011000	0.17503	0.042000	0.18584	0.066000	0.16364	0.694000	0.25512	2.015000	0.59207	0.655000	0.94253	GCC	IFI6	-	pfam_IFI6/IFI27	ENSG00000126709		0.667	IFI6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IFI6	HGNC	protein_coding	OTTHUMT00000009780.1		0.00	8	0	C	NM_022873		27994770	-1			no_errors	ENST00000339145	ensembl	human	known	74_37	missense	75.00	1	3	SNP	0.577	T
IFI44	10561	genome.wustl.edu	37	1	79125009	79125009	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:79125009G>A	ENST00000370747.4	+	6	938	c.853G>A	c.(853-855)Gaa>Aaa	p.E285K	IFI44_ENST00000545124.1_Missense_Mutation_p.E2K|IFI44_ENST00000495254.1_3'UTR	NM_006417.4	NP_006408.3	Q8TCB0	IFI44_HUMAN	interferon-induced protein 44	285					response to virus (GO:0009615)	cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	21						TAATCCCATGGAATCAATCAA	0.343																																																	0													100.0	96.0	98.0					1																	79125009		2203	4300	6503	SO:0001583	missense	0			D28915	CCDS688.1	1p31.1	2013-03-14			ENSG00000137965	ENSG00000137965			16938	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 5"""	610468				7925411	Standard	NM_006417		Approved	MTAP44, p44, TLDC5	uc001dip.4	Q8TCB0	OTTHUMG00000009723	ENST00000370747.4:c.853G>A	1.37:g.79125009G>A	ENSP00000359783:p.Glu285Lys		B7ZAG3|D3DQ80|Q14496	Missense_Mutation	SNP	pfam_TLDc,superfamily_P-loop_NTPase	p.E285K	ENST00000370747.4	37	c.853	CCDS688.1	1	.	.	.	.	.	.	.	.	.	.	G	0.032	-1.330808	0.01298	.	.	ENSG00000137965	ENST00000370747;ENST00000438486;ENST00000545124	T;T	0.40225	1.04;1.04	3.8	-1.32	0.09201	.	0.857641	0.10432	N	0.675430	T	0.01627	0.0052	N	0.00162	-1.95	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.04013	0.001;0.0;0.0	T	0.43048	-0.9415	10	0.02654	T	1	.	4.4311	0.11527	0.3359:0.3495:0.3146:0.0	.	285;285;285	B4DYN8;B7ZB11;Q8TCB0	.;.;IFI44_HUMAN	K	285;161;2	ENSP00000359783:E285K;ENSP00000399477:E161K	ENSP00000359783:E285K	E	+	1	0	IFI44	78897597	0.000000	0.05858	0.001000	0.08648	0.133000	0.20885	0.090000	0.15025	-0.248000	0.09583	-0.524000	0.04348	GAA	IFI44	-	superfamily_P-loop_NTPase	ENSG00000137965		0.343	IFI44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFI44	HGNC	protein_coding	OTTHUMT00000026825.1	-	0.00	26	0	G	NM_006417		79125009	+1	tier1	-	no_errors	ENST00000370747	ensembl	human	known	74_37	missense	35.29	11	6	SNP	0.001	A
IFIH1	64135	genome.wustl.edu	37	2	163128830	163128830	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:163128830A>T	ENST00000263642.2	-	13	2917	c.2522T>A	c.(2521-2523)aTc>aAc	p.I841N		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	841	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						CTCATGTTCGATAACTCCTGA	0.413																																																	0													102.0	89.0	93.0					2																	163128830		2203	4300	6503	SO:0001583	missense	0			AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.2522T>A	2.37:g.163128830A>T	ENSP00000263642:p.Ile841Asn		Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_CARD,superfamily_P-loop_NTPase,superfamily_DEATH-like_dom,superfamily_ARM-type_fold,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.I841N	ENST00000263642.2	37	c.2522	CCDS2217.1	2	.	.	.	.	.	.	.	.	.	.	A	14.32	2.498935	0.44455	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.04809	3.55	5.76	4.62	0.57501	Helicase, C-terminal (1);	0.566473	0.20670	N	0.087850	T	0.04543	0.0124	L	0.51422	1.61	0.09310	N	0.999999	P	0.40266	0.71	B	0.32624	0.149	T	0.38394	-0.9663	10	0.17832	T	0.49	-0.6111	9.03	0.36254	0.85:0.0:0.15:0.0	.	841	Q9BYX4	IFIH1_HUMAN	N	841	ENSP00000263642:I841N	ENSP00000263642:I841N	I	-	2	0	IFIH1	162837076	0.988000	0.35896	0.256000	0.24389	0.952000	0.60782	3.343000	0.52167	1.021000	0.39600	0.528000	0.53228	ATC	IFIH1	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000115267		0.413	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIH1	HGNC	protein_coding	OTTHUMT00000255078.2		0.00	45	0	A	NM_022168		163128830	-1			no_errors	ENST00000263642	ensembl	human	known	74_37	missense	6.82	41	3	SNP	0.253	T
IGLL1	3543	genome.wustl.edu	37	22	23917190	23917190	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr22:23917190G>T	ENST00000330377.2	-	2	403	c.286C>A	c.(286-288)Cat>Aat	p.H96N	IGLL1_ENST00000249053.3_Intron|AP000345.2_ENST00000458318.1_RNA|AP000345.2_ENST00000454863.1_RNA	NM_020070.3	NP_064455.1	P15814	IGLL1_HUMAN	immunoglobulin lambda-like polypeptide 1	96					immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				kidney(1)|large_intestine(1)|lung(5)|skin(4)|stomach(1)	12						CCAAACACATGCGTCACTGAG	0.582																																																	0													73.0	64.0	67.0					22																	23917190		2203	4300	6503	SO:0001583	missense	0			X52204	CCDS13809.1, CCDS13810.1	22q11.23	2014-09-17			ENSG00000128322	ENSG00000128322		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	5870	protein-coding gene	gene with protein product		146770		IGLL		3139558, 2511029	Standard	NM_020070		Approved	IGVPB, IGL5, 14.1, CD179B	uc002zxd.3	P15814	OTTHUMG00000150673	ENST00000330377.2:c.286C>A	22.37:g.23917190G>T	ENSP00000329312:p.His96Asn		Q0P681	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like_dom	p.H96N	ENST00000330377.2	37	c.286	CCDS13809.1	22	.	.	.	.	.	.	.	.	.	.	-	6.172	0.399887	0.11696	.	.	ENSG00000128322	ENST00000330377;ENST00000438703	T;T	0.00912	6.85;5.55	1.58	-3.16	0.05217	.	2.456860	0.01694	N	0.026781	T	0.00906	0.0030	N	0.22421	0.69	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.48581	-0.9023	10	0.52906	T	0.07	.	4.3566	0.11181	0.0:0.4626:0.3048:0.2325	.	96	P15814	IGLL1_HUMAN	N	96;97	ENSP00000329312:H96N;ENSP00000403391:H97N	ENSP00000329312:H96N	H	-	1	0	IGLL1	22247190	0.000000	0.05858	0.010000	0.14722	0.000000	0.00434	-1.404000	0.02494	-0.549000	0.06191	0.000000	0.15137	CAT	IGLL1	-	NULL	ENSG00000128322		0.582	IGLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGLL1	HGNC	protein_coding	OTTHUMT00000319569.1	-	0.00	61	0	G	NM_020070		23917190	-1	tier1	-	no_errors	ENST00000330377	ensembl	human	known	74_37	missense	7.50	74	6	SNP	0.029	T
IGSF22	283284	genome.wustl.edu	37	11	18737090	18737090	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:18737090C>G	ENST00000513874.1	-	11	1559	c.1420G>C	c.(1420-1422)Gag>Cag	p.E474Q	RP11-1081L13.4_ENST00000527285.1_RNA	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	474	Ig-like 3.									NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						ATGATCAGCTCTGCTCGCTTG	0.532																																																	0													133.0	130.0	131.0					11																	18737090		2197	4289	6486	SO:0001583	missense	0			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.1420G>C	11.37:g.18737090C>G	ENSP00000421191:p.Glu474Gln		A6NNA0|D6RGV7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E474Q	ENST00000513874.1	37	c.1420	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	C	13.81	2.349026	0.41599	.	.	ENSG00000179057	ENST00000513874	T	0.67345	-0.26	4.79	3.85	0.44370	.	0.184738	0.25954	N	0.027240	T	0.66587	0.2804	N	0.16708	0.43	0.25060	N	0.99107	D	0.69078	0.997	D	0.79108	0.992	T	0.59490	-0.7445	10	0.27785	T	0.31	.	12.5038	0.55970	0.1673:0.8327:0.0:0.0	.	474	D6RGV7	.	Q	474	ENSP00000421191:E474Q	ENSP00000322422:E474Q	E	-	1	0	IGSF22	18693666	0.999000	0.42202	0.558000	0.28319	0.454000	0.32378	3.724000	0.54962	0.963000	0.38082	0.455000	0.32223	GAG	IGSF22	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000179057		0.532	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000360850.2	-	0.00	63	0	C	NM_173588		18737090	-1	tier1	-	no_errors	ENST00000513874	ensembl	human	known	74_37	missense	5.61	101	6	SNP	0.998	G
IL12RB2	3595	genome.wustl.edu	37	1	67796382	67796382	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:67796382G>A	ENST00000262345.1	+	7	1487	c.847G>A	c.(847-849)Gat>Aat	p.D283N	IL12RB2_ENST00000544434.1_Missense_Mutation_p.D283N|IL12RB2_ENST00000371000.1_Missense_Mutation_p.D283N|IL12RB2_ENST00000541374.1_Missense_Mutation_p.D283N	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	283	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						TGATTTGCTGGATCTGAAACC	0.328																																																	0													100.0	106.0	104.0					1																	67796382		2203	4300	6503	SO:0001583	missense	0			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.847G>A	1.37:g.67796382G>A	ENSP00000262345:p.Asp283Asn		B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_IgC2-like_lig-bd,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.D283N	ENST00000262345.1	37	c.847	CCDS638.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.85|10.85	1.466953|1.466953	0.26335|0.26335	.|.	.|.	ENSG00000081985|ENSG00000081985	ENST00000262345;ENST00000371000;ENST00000541374;ENST00000544434|ENST00000441640	T;T;T;T|.	0.55052|.	0.65;0.65;0.65;0.54|.	5.51|5.51	2.08|2.08	0.27032|0.27032	Fibronectin, type III (3);Immunoglobulin-like fold (1);|.	0.654431|.	0.16581|.	N|.	0.208218|.	T|T	0.22437|0.22437	0.0541|0.0541	L|L	0.50919|0.50919	1.6|1.6	0.09310|0.09310	N|N	0.999997|0.999997	B;B;P;B|.	0.34462|.	0.223;0.234;0.454;0.126|.	B;B;B;B|.	0.35813|.	0.143;0.061;0.211;0.031|.	T|T	0.16217|0.16217	-1.0410|-1.0410	10|5	0.24483|.	T|.	0.36|.	-9.0912|-9.0912	7.673|7.673	0.28470|0.28470	0.1781:0.1434:0.6786:0.0|0.1781:0.1434:0.6786:0.0	.|.	283;283;283;283|.	B4DGA4;F5H7L6;Q99665-2;Q99665|.	.;.;.;I12R2_HUMAN|.	N|E	283|150	ENSP00000262345:D283N;ENSP00000360039:D283N;ENSP00000445276:D283N;ENSP00000442443:D283N|.	ENSP00000262345:D283N|.	D|G	+|+	1|2	0|0	IL12RB2|IL12RB2	67568970|67568970	0.425000|0.425000	0.25498|0.25498	0.882000|0.882000	0.34594|0.34594	0.863000|0.863000	0.49368|0.49368	1.333000|1.333000	0.33816|0.33816	0.670000|0.670000	0.31165|0.31165	0.563000|0.563000	0.77884|0.77884	GAT|GGA	IL12RB2	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000081985		0.328	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB2	HGNC	protein_coding	OTTHUMT00000025202.2	-	0.00	37	0	G	NM_001559		67796382	+1	tier1	-	no_errors	ENST00000262345	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.185	A
IQSEC2	23096	genome.wustl.edu	37	X	53349734	53349734	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:53349734C>T	ENST00000375368.5	-	1	788	c.588G>A	c.(586-588)ccG>ccA	p.P196P	IQSEC2_ENST00000396435.3_Silent_p.P196P			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	196					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						GCGGTGGCCGCGGCCCCACGC	0.791																																																	0													4.0	5.0	4.0					X																	53349734		644	1441	2085	SO:0001819	synonymous_variant	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.588G>A	X.37:g.53349734C>T			B3KT97|C7SDG1|O60275|Q5JUX1	Silent	SNP	pfam_Sec7_dom,superfamily_Sec7_dom,superfamily_P-loop_NTPase,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7_dom	p.P196	ENST00000375368.5	37	c.588		X																																																																																			IQSEC2	-	NULL	ENSG00000124313		0.791	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		-	0.00	16	0	C	XM_291345		53349734	-1	tier1	-	no_errors	ENST00000396435	ensembl	human	known	74_37	silent	35.29	11	6	SNP	0.993	T
IRAK1	3654	genome.wustl.edu	37	X	153281953	153281953	+	Missense_Mutation	SNP	G	G	C	rs373743090		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:153281953G>C	ENST00000369980.3	-	9	1338	c.1171C>G	c.(1171-1173)Ctg>Gtg	p.L391V	IRAK1_ENST00000429936.2_Missense_Mutation_p.L417V|IRAK1_ENST00000393682.1_Missense_Mutation_p.L417V|IRAK1_ENST00000393687.2_Missense_Mutation_p.L391V|IRAK1_ENST00000477274.1_5'UTR|IRAK1_ENST00000369974.2_Missense_Mutation_p.L391V	NM_001025242.1|NM_001569.3	NP_001020413.1|NP_001560.2	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	391	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cellular response to hypoxia (GO:0071456)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|interleukin-1 receptor complex (GO:0045323)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|NF-kappaB-inducing kinase activity (GO:0004704)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(15)|ovary(2)	25	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCCTCGGGCAGGTAGGCCAGG	0.657																																																	0								G	VAL/LEU,VAL/LEU,VAL/LEU	1,3834		0,1,1631,571	58.0	51.0	53.0		1171,1171,1171	3.0	1.0	X		53	0,6728		0,0,2428,1872	no	missense,missense,missense	IRAK1	NM_001025242.1,NM_001025243.1,NM_001569.3	32,32,32	0,1,4059,2443	CC,CG,GG,G		0.0,0.0261,0.0095	probably-damaging,probably-damaging,probably-damaging	391/683,391/634,391/713	153281953	1,10562	2203	4300	6503	SO:0001583	missense	0			L76191	CCDS14740.1, CCDS35443.1, CCDS35444.1	Xq28	2011-07-08			ENSG00000184216	ENSG00000184216			6112	protein-coding gene	gene with protein product		300283				9374458, 8599092	Standard	XM_005274668		Approved	IRAK, pelle	uc004fjs.1	P51617	OTTHUMG00000024228	ENST00000369980.3:c.1171C>G	X.37:g.153281953G>C	ENSP00000358997:p.Leu391Val		D3DWW3|D3DWW4|Q7Z5V4|Q96C06|Q96RL2	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death_domain,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.L391V	ENST00000369980.3	37	c.1171	CCDS14740.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	15.43|15.43	2.831690|2.831690	0.50845|0.50845	2.61E-4|2.61E-4	0.0|0.0	ENSG00000184216|ENSG00000184216	ENST00000369980;ENST00000369974;ENST00000393682;ENST00000393687;ENST00000429936|ENST00000443220	T;D;D;T;T|.	0.93811|.	1.29;-3.29;-3.29;1.29;1.29|.	4.85|4.85	3.03|3.03	0.35002|0.35002	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);|.	0.000000|.	0.40144|.	N|.	0.001179|.	T|T	0.53722|0.53722	0.1814|0.1814	L|L	0.41027|0.41027	1.25|1.25	0.58432|0.58432	D|D	0.999993|0.999993	P;D;D|.	0.59357|.	0.897;0.985;0.981|.	B;P;P|.	0.60415|.	0.307;0.874;0.801|.	T|T	0.40553|0.40553	-0.9557|-0.9557	10|5	0.66056|.	D|.	0.02|.	-15.3078|-15.3078	10.431|10.431	0.44407|0.44407	0.1534:0.0:0.8466:0.0|0.1534:0.0:0.8466:0.0	.|.	391;391;391|.	P51617-4;P51617;P51617-2|.	.;IRAK1_HUMAN;.|.	V|R	391;391;417;391;417|161	ENSP00000358997:L391V;ENSP00000358991:L391V;ENSP00000377287:L417V;ENSP00000377291:L391V;ENSP00000392662:L417V|.	ENSP00000358991:L391V|.	L|P	-|-	1|2	2|0	IRAK1|IRAK1	152935147|152935147	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.403000|0.403000	0.30841|0.30841	4.782000|4.782000	0.62396|0.62396	0.300000|0.300000	0.22699|0.22699	0.529000|0.529000	0.55759|0.55759	CTG|CCT	IRAK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000184216		0.657	IRAK1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK1	HGNC	protein_coding	OTTHUMT00000061143.3	-	0.00	92	0	G			153281953	-1	tier1	-	no_errors	ENST00000369980	ensembl	human	known	74_37	missense	50.35	71	72	SNP	1.000	C
ITGB5	3693	genome.wustl.edu	37	3	124483298	124483298	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:124483298G>A	ENST00000296181.4	-	14	2540	c.2244C>T	c.(2242-2244)atC>atT	p.I748I	ITGB5_ENST00000461306.1_5'Flank	NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	748					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		TCCGGTCGTGGATGGTGACAA	0.562																																																	0													75.0	67.0	70.0					3																	124483298		2203	4300	6503	SO:0001819	synonymous_variant	0			J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.2244C>T	3.37:g.124483298G>A			B0LPF8|B2RD70	Silent	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,smart_VWF_A,prints_Integrin_bsu	p.I748	ENST00000296181.4	37	c.2244	CCDS3030.1	3																																																																																			ITGB5	-	pirsf_Integrin_bsu,pfam_Integrin_bsu_cyt_dom,prints_Integrin_bsu	ENSG00000082781		0.562	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB5	HGNC	protein_coding	OTTHUMT00000355286.3	-	0.00	28	0	G	NM_002213		124483298	-1	tier1	-	no_errors	ENST00000296181	ensembl	human	known	74_37	silent	22.22	42	12	SNP	1.000	A
KAT5	10524	genome.wustl.edu	37	11	65486590	65486590	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:65486590C>T	ENST00000377046.3	+	14	1752	c.1480C>T	c.(1480-1482)Cgg>Tgg	p.R494W	KAT5_ENST00000341318.4_Missense_Mutation_p.R527W|RNASEH2C_ENST00000308418.4_3'UTR|KAT5_ENST00000352980.4_Missense_Mutation_p.R442W|KAT5_ENST00000534650.1_Missense_Mutation_p.R283W|KAT5_ENST00000530446.1_Missense_Mutation_p.R475W	NM_006388.3	NP_006379.2	Q92993	KAT5_HUMAN	K(lysine) acetyltransferase 5	494	Interaction with ATF2.|MYST-type HAT.				androgen receptor signaling pathway (GO:0030521)|cellular response to estradiol stimulus (GO:0071392)|chromatin organization (GO:0006325)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|double-strand break repair (GO:0006302)|histone acetylation (GO:0016573)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of growth (GO:0040008)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)|Swr1 complex (GO:0000812)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|repressing transcription factor binding (GO:0070491)|transcription coactivator activity (GO:0003713)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)	21						GCGGCTCCTGCGGATCGACTC	0.607																																																	0													71.0	56.0	61.0					11																	65486590		2201	4297	6498	SO:0001583	missense	0			U74667	CCDS8109.1, CCDS8110.1, CCDS31610.1, CCDS55771.1	11q13	2013-01-10	2008-07-04	2008-07-04	ENSG00000172977	ENSG00000172977		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	5275	protein-coding gene	gene with protein product	"""Tat interacting protein, 60kDa"", ""K-acetyltransferase 5"""	601409	"""HIV-1 Tat interactive protein, 60kDa"""	HTATIP		8607265	Standard	NM_006388		Approved	TIP60, PLIP, cPLA2, HTATIP1, ESA1, ZC2HC5	uc001ofk.3	Q92993	OTTHUMG00000166617	ENST00000377046.3:c.1480C>T	11.37:g.65486590C>T	ENSP00000366245:p.Arg494Trp		B4E3C7|C9JL99|O95624|Q13430|Q17RW5|Q561W3|Q6GSE8|Q9BWK7	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Tudor-knot,superfamily_Acyl_CoA_acyltransferase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow	p.R527W	ENST00000377046.3	37	c.1579	CCDS31610.1	11	.	.	.	.	.	.	.	.	.	.	C	21.2	4.120789	0.77436	.	.	ENSG00000172977	ENST00000377046;ENST00000352980;ENST00000341318;ENST00000530446;ENST00000534650	T;T;T;T	0.48201	0.83;0.85;0.82;0.84	4.5	3.58	0.41010	Acyl-CoA N-acyltransferase (1);	0.000000	0.85682	D	0.000000	T	0.70072	0.3182	M	0.88842	2.985	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.999;0.999;0.996	T	0.73911	-0.3833	10	0.87932	D	0	-13.1665	9.6417	0.39844	0.3797:0.6203:0.0:0.0	.	475;527;442;494	B4E3C7;Q92993-3;Q92993-2;Q92993	.;.;.;KAT5_HUMAN	W	494;442;527;475;283	ENSP00000366245:R494W;ENSP00000344955:R442W;ENSP00000340330:R527W;ENSP00000434765:R475W	ENSP00000340330:R527W	R	+	1	2	KAT5	65243166	1.000000	0.71417	0.642000	0.29436	0.965000	0.64279	4.216000	0.58540	1.095000	0.41419	0.555000	0.69702	CGG	KAT5	-	superfamily_Acyl_CoA_acyltransferase	ENSG00000172977		0.607	KAT5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT5	HGNC	protein_coding	OTTHUMT00000390866.2	-	0.00	33	0	C	NM_006388		65486590	+1	tier1	-	no_errors	ENST00000341318	ensembl	human	known	74_37	missense	19.51	33	8	SNP	1.000	T
KAT6A	7994	genome.wustl.edu	37	8	41798620	41798620	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:41798620G>A	ENST00000396930.3	-	16	3322	c.2779C>T	c.(2779-2781)Cca>Tca	p.P927S	KAT6A_ENST00000265713.2_Missense_Mutation_p.P927S|KAT6A_ENST00000406337.1_Missense_Mutation_p.P927S	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	927					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TCCTGGCTTGGCTGCTCCTCA	0.537																																																	0													81.0	78.0	79.0					8																	41798620		2203	4300	6503	SO:0001583	missense	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.2779C>T	8.37:g.41798620G>A	ENSP00000380136:p.Pro927Ser		Q76L81	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5_H15,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.P927S	ENST00000396930.3	37	c.2779	CCDS6124.1	8	.	.	.	.	.	.	.	.	.	.	G	2.506	-0.314094	0.05422	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721	T;T;T	0.58210	0.35;0.35;0.35	5.19	1.95	0.26073	.	0.902446	0.09541	N	0.788339	T	0.24928	0.0605	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.28744	-1.0034	10	0.05833	T	0.94	-0.2712	0.2094	0.00154	0.2952:0.2101:0.2812:0.2134	.	927	Q92794	KAT6A_HUMAN	S	927;927;927;507	ENSP00000265713:P927S;ENSP00000385888:P927S;ENSP00000380136:P927S	ENSP00000265713:P927S	P	-	1	0	KAT6A	41917777	0.472000	0.25870	0.337000	0.25536	0.001000	0.01503	0.768000	0.26590	0.575000	0.29434	0.655000	0.94253	CCA	KAT6A	-	NULL	ENSG00000083168		0.537	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6A	HGNC	protein_coding	OTTHUMT00000318163.1		0.00	43	0	G	NM_006766		41798620	-1			no_errors	ENST00000265713	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.126	A
KCNA5	3741	genome.wustl.edu	37	12	5154236	5154236	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:5154236C>T	ENST00000252321.3	+	1	1152	c.923C>T	c.(922-924)tCt>tTt	p.S308F		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	308					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	GCCCCGCCCTCTGGCCCTACG	0.706																																																	0													34.0	37.0	36.0					12																	5154236		2202	4294	6496	SO:0001583	missense	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.923C>T	12.37:g.5154236C>T	ENSP00000252321:p.Ser308Phe		Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.S308F	ENST00000252321.3	37	c.923	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	C	6.602	0.479385	0.12581	.	.	ENSG00000130037	ENST00000252321	D	0.97688	-4.49	4.77	2.85	0.33270	.	7739.210000	0.00166	N	0.000000	D	0.94761	0.8309	N	0.14661	0.345	0.09310	N	1	B	0.17268	0.021	B	0.17722	0.019	D	0.86574	0.1849	10	0.59425	D	0.04	.	11.1406	0.48400	0.3214:0.6786:0.0:0.0	.	308	P22460	KCNA5_HUMAN	F	308	ENSP00000252321:S308F	ENSP00000252321:S308F	S	+	2	0	KCNA5	5024497	0.018000	0.18449	0.018000	0.16275	0.200000	0.23975	1.180000	0.32005	0.555000	0.29079	0.561000	0.74099	TCT	KCNA5	-	NULL	ENSG00000130037		0.706	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	-	0.00	16	0	C	NM_002234		5154236	+1	tier1	-	no_errors	ENST00000252321	ensembl	human	known	74_37	missense	26.32	14	5	SNP	0.062	T
KCNC3	3748	genome.wustl.edu	37	19	50826891	50826891	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:50826891G>A	ENST00000477616.1	-	2	1613	c.1319C>T	c.(1318-1320)aCg>aTg	p.T440M	KCNC3_ENST00000474951.1_Intron|KCNC3_ENST00000376959.2_Missense_Mutation_p.T440M|KCNC3_ENST00000391818.2_Intron	NM_004977.2	NP_004968.2	Q14003	KCNC3_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 3	440					cell death (GO:0008219)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axolemma (GO:0030673)|axon terminus (GO:0043679)|dendrite membrane (GO:0032590)|neuromuscular junction (GO:0031594)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)	13		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)	Dalfampridine(DB06637)	GGCGCGGAGCGTGTGTCCCAG	0.627																																					Melanoma(91;1496 2324 50908)												0													67.0	67.0	67.0					19																	50826891		2203	4300	6503	SO:0001583	missense	0			AB208930	CCDS12793.1	19q13.33	2014-09-17			ENSG00000131398	ENSG00000131398		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6235	protein-coding gene	gene with protein product		176264	"""spinocerebellar ataxia 13"""	SCA13		1740329, 8111118, 16382104	Standard	NM_004977		Approved	Kv3.3	uc002pru.1	Q14003	OTTHUMG00000044580	ENST00000477616.1:c.1319C>T	19.37:g.50826891G>A	ENSP00000434241:p.Thr440Met			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,pfam_K_chnl_volt-dep_Kv3_ID,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3.3,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv	p.T440M	ENST00000477616.1	37	c.1319	CCDS12793.1	19	.	.	.	.	.	.	.	.	.	.	g	21.6	4.179299	0.78564	.	.	ENSG00000131398	ENST00000376959;ENST00000477616;ENST00000443843	D;D	0.98437	-4.93;-4.93	3.19	3.19	0.36642	Ion transport (1);	0.000000	0.64402	U	0.000001	D	0.98773	0.9587	M	0.83692	2.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99204	1.0874	10	0.87932	D	0	.	13.6416	0.62255	0.0:0.0:1.0:0.0	.	440;440	Q14003;E7ETH1	KCNC3_HUMAN;.	M	440;440;254	ENSP00000366158:T440M;ENSP00000434241:T440M	ENSP00000366158:T440M	T	-	2	0	KCNC3	55518703	1.000000	0.71417	0.947000	0.38551	0.963000	0.63663	9.464000	0.97655	1.809000	0.52856	0.486000	0.48141	ACG	KCNC3	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000131398		0.627	KCNC3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNC3	HGNC	protein_coding	OTTHUMT00000314288.2	-	0.00	46	0	G	NM_004977		50826891	-1	tier1	-	no_errors	ENST00000477616	ensembl	human	known	74_37	missense	6.58	71	5	SNP	1.000	A
KCNJ12	3768	genome.wustl.edu	37	17	21319654	21319654	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:21319654G>A	ENST00000583088.1	+	3	1895	c.1000G>A	c.(1000-1002)Gag>Aag	p.E334K	KCNJ12_ENST00000331718.5_Missense_Mutation_p.E334K	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	334				Missing (in Ref. 2; AAC50615). {ECO:0000305}.	muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GCTCTTCGAGGAGAAGAACCA	0.577										Prostate(3;0.18)																																							0													153.0	154.0	154.0					17																	21319654		2203	4300	6503	SO:0001583	missense	0			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.1000G>A	17.37:g.21319654G>A	ENSP00000463778:p.Glu334Lys		O43401|Q15756|Q8NG63	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	p.E334K	ENST00000583088.1	37	c.1000	CCDS11219.1	17	.	.	.	.	.	.	.	.	.	.	G	19.64	3.866216	0.71949	.	.	ENSG00000184185	ENST00000331718	D	0.91686	-2.89	5.76	5.76	0.90799	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.89884	0.6844	L	0.41632	1.29	0.80722	D	1	B	0.16603	0.018	B	0.17098	0.017	D	0.85181	0.1004	10	0.66056	D	0.02	.	19.9738	0.97296	0.0:0.0:1.0:0.0	.	334	Q14500	IRK12_HUMAN	K	334	ENSP00000328150:E334K	ENSP00000328150:E334K	E	+	1	0	KCNJ12	21260247	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.698000	0.98700	2.732000	0.93576	0.655000	0.94253	GAG	KCNJ12	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000184185		0.577	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	HGNC	protein_coding	OTTHUMT00000255060.2		0.00	101	0	G	NM_021012		21319654	+1			no_errors	ENST00000331718	ensembl	human	known	74_37	missense	5.83	96	6	SNP	1.000	A
KDM2A	22992	genome.wustl.edu	37	11	67012683	67012683	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:67012683G>A	ENST00000529006.2	+	14	2033	c.1587G>A	c.(1585-1587)aaG>aaA	p.K529K	KDM2A_ENST00000308783.5_De_novo_Start_InFrame|KDM2A_ENST00000530342.1_Silent_p.K90K|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000398645.2_Silent_p.K529K	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	529					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						CTCGGCCAAAGGTGCGGGTTC	0.498																																																	0													159.0	163.0	162.0					11																	67012683		1924	4112	6036	SO:0001819	synonymous_variant	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.1587G>A	11.37:g.67012683G>A			D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Silent	SNP	pfam_Znf_CXXC,pfam_F-box_dom,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.K529	ENST00000529006.2	37	c.1587	CCDS44657.1	11																																																																																			KDM2A	-	NULL	ENSG00000173120		0.498	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	-	0.00	36	0	G	NM_012308		67012683	+1	tier1	-	no_errors	ENST00000529006	ensembl	human	known	74_37	silent	41.07	33	23	SNP	1.000	A
KIAA0195	9772	genome.wustl.edu	37	17	73494368	73494368	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:73494368G>A	ENST00000314256.7	+	28	3996	c.3602G>A	c.(3601-3603)cGc>cAc	p.R1201H	KIAA0195_ENST00000579208.1_Missense_Mutation_p.R852H|AC100787.1_ENST00000579379.1_RNA|KIAA0195_ENST00000375248.5_Missense_Mutation_p.R1211H	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	1201						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			TCCCGGGACCGCAACCTCACC	0.622																																																	0													92.0	75.0	81.0					17																	73494368		2203	4300	6503	SO:0001583	missense	0				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.3602G>A	17.37:g.73494368G>A	ENSP00000313885:p.Arg1201His		O75536|Q86XF1	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-transptr_C	p.R1201H	ENST00000314256.7	37	c.3602	CCDS32732.1	17	.	.	.	.	.	.	.	.	.	.	G	5.113	0.206475	0.09704	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	D;D	0.95724	-3.79;-3.79	5.71	2.67	0.31697	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.435806	0.25509	N	0.030182	D	0.86944	0.6055	N	0.03608	-0.345	0.09310	N	1	B;B;D;B	0.64830	0.001;0.002;0.994;0.002	B;B;P;B	0.47470	0.001;0.001;0.548;0.001	T	0.80763	-0.1237	10	0.23891	T	0.37	-25.417	5.8167	0.18495	0.2254:0.0:0.6065:0.1681	.	1211;1211;1201;1201	B4DGC6;C9JL75;Q12767-2;Q12767	.;.;.;K0195_HUMAN	H	1201;1211	ENSP00000313885:R1201H;ENSP00000364397:R1211H	ENSP00000313885:R1201H	R	+	2	0	KIAA0195	71005963	0.262000	0.24073	0.432000	0.26747	0.055000	0.15305	1.205000	0.32308	0.772000	0.33382	-0.444000	0.05651	CGC	KIAA0195	-	pfam_ATPase_P-typ_cation-transptr_C	ENSG00000177728		0.622	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	HGNC	protein_coding	OTTHUMT00000447303.1	-	0.00	54	0	G	NM_014738		73494368	+1	tier1	-	no_errors	ENST00000314256	ensembl	human	known	74_37	missense	39.62	32	21	SNP	0.000	A
KIAA0922	23240	genome.wustl.edu	37	4	154523312	154523312	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:154523312G>C	ENST00000409663.3	+	22	2324	c.2272G>C	c.(2272-2274)Gac>Cac	p.D758H	KIAA0922_ENST00000409959.3_Missense_Mutation_p.D759H|KIAA0922_ENST00000440693.1_Missense_Mutation_p.D675H	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	758						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				AGAACTGAAAGACAGTAAGCA	0.254																																																	0													41.0	43.0	43.0					4																	154523312		2196	4299	6495	SO:0001583	missense	0			AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.2272G>C	4.37:g.154523312G>C	ENSP00000386574:p.Asp758His		B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.D759H	ENST00000409663.3	37	c.2275	CCDS3783.2	4	.	.	.	.	.	.	.	.	.	.	G	12.43	1.936644	0.34189	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.19250	2.43;2.16;2.43;2.17	5.81	5.81	0.92471	.	0.309545	0.39909	N	0.001237	T	0.42131	0.1189	L	0.46157	1.445	0.40846	D	0.983718	D;D;P	0.89917	1.0;0.998;0.521	D;D;B	0.78314	0.991;0.922;0.2	T	0.03121	-1.1070	10	0.33940	T	0.23	-27.9891	20.0804	0.97772	0.0:0.0:1.0:0.0	.	675;759;758	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	H	758;675;759;536	ENSP00000386574:D758H;ENSP00000409663:D675H;ENSP00000386787:D759H;ENSP00000240487:D536H	ENSP00000240487:D536H	D	+	1	0	KIAA0922	154742762	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	5.277000	0.65586	2.738000	0.93877	0.655000	0.94253	GAC	KIAA0922	-	NULL	ENSG00000121210		0.254	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0922	HGNC	protein_coding	OTTHUMT00000330370.1	-	0.00	29	0	G	NM_015196		154523312	+1	tier1	-	no_errors	ENST00000409959	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	C
KIAA1191	57179	genome.wustl.edu	37	5	175777628	175777628	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:175777628G>A	ENST00000298569.4	-	6	980	c.447C>T	c.(445-447)gcC>gcT	p.A149A	KIAA1191_ENST00000393728.2_Intron|KIAA1191_ENST00000533553.1_Intron|KIAA1191_ENST00000510164.1_Silent_p.A149A|RP11-843P14.2_ENST00000508187.1_RNA|KIAA1191_ENST00000393725.2_Silent_p.A130A	NM_020444.3	NP_065177.2	Q96A73	P33MX_HUMAN	KIAA1191	149						cytoplasm (GO:0005737)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6	all_cancers(89;0.00575)|Renal(175;0.000269)|Lung NSC(126;0.0105)|all_lung(126;0.0168)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.101)		GGAGTGCTTCGGCCACTCGAA	0.493																																																	0													119.0	110.0	113.0					5																	175777628		2203	4300	6503	SO:0001819	synonymous_variant	0			BC010448	CCDS4399.1, CCDS43402.1, CCDS75373.1	5q35.2	2008-02-05			ENSG00000122203	ENSG00000122203			29209	protein-coding gene	gene with protein product						10574461, 10565538	Standard	XM_005265941		Approved	FLJ21022	uc003mdy.3	Q96A73	OTTHUMG00000130656	ENST00000298569.4:c.447C>T	5.37:g.175777628G>A			B2RD69|B8K1S6|Q6IA24|Q8NDU3|Q9BRE5|Q9H7D5|Q9ULM9	Silent	SNP	NULL	p.A149	ENST00000298569.4	37	c.447	CCDS4399.1	5																																																																																			KIAA1191	-	NULL	ENSG00000122203		0.493	KIAA1191-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1191	HGNC	protein_coding	OTTHUMT00000253146.2	-	0.00	86	0	G	NM_020444		175777628	-1	tier1	-	no_errors	ENST00000298569	ensembl	human	known	74_37	silent	45.45	42	35	SNP	0.995	A
KIAA1210	57481	genome.wustl.edu	37	X	118222391	118222391	+	Silent	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:118222391A>C	ENST00000402510.2	-	11	2801	c.2802T>G	c.(2800-2802)acT>acG	p.T934T		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	934										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						GTTTTATAGAAGTGCCCACTG	0.493																																																	0													61.0	53.0	56.0					X																	118222391		1902	4111	6013	SO:0001819	synonymous_variant	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.2802T>G	X.37:g.118222391A>C			B7ZCI8|Q5JPN4	Silent	SNP	NULL	p.T934	ENST00000402510.2	37	c.2802	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	A	4.063	0.009471	0.07912	.	.	ENSG00000248857	ENST00000440399	.	.	.	4.56	-1.05	0.10036	.	.	.	.	.	T	0.28928	0.0718	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.29212	-1.0019	4	.	.	.	.	6.4255	0.21768	0.3403:0.4965:0.0:0.1631	.	.	.	.	V	341	.	.	F	-	1	0	KIAA1210	118106419	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.838000	0.04372	-0.270000	0.09285	0.486000	0.48141	TTC	KIAA1210	-	NULL	ENSG00000250423		0.493	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	-	0.00	28	0	A	NM_020721		118222391	-1	tier1	-	no_errors	ENST00000402510	ensembl	human	known	74_37	silent	42.86	20	15	SNP	0.000	C
KIAA1210	57481	genome.wustl.edu	37	X	118222580	118222580	+	Silent	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:118222580T>C	ENST00000402510.2	-	11	2612	c.2613A>G	c.(2611-2613)gaA>gaG	p.E871E		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	871										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						GAGGCAGGTCTTCCTCTGAGC	0.463																																																	0													49.0	47.0	48.0					X																	118222580		1943	4114	6057	SO:0001819	synonymous_variant	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.2613A>G	X.37:g.118222580T>C			B7ZCI8|Q5JPN4	Silent	SNP	NULL	p.E871	ENST00000402510.2	37	c.2613	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	T	3.058	-0.193970	0.06259	.	.	ENSG00000248857	ENST00000440399	.	.	.	4.43	0.249	0.15531	.	.	.	.	.	T	0.21347	0.0514	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23154	-1.0196	4	.	.	.	.	2.5076	0.04649	0.208:0.2787:0.0:0.5133	.	.	.	.	G	278	.	.	R	-	1	2	KIAA1210	118106608	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.027000	0.12371	-0.054000	0.13266	-0.438000	0.05819	AGA	KIAA1210	-	NULL	ENSG00000250423		0.463	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	-	0.00	30	0	T	NM_020721		118222580	-1	tier1	-	no_errors	ENST00000402510	ensembl	human	known	74_37	silent	20.41	39	10	SNP	0.000	C
KIAA1804	84451	genome.wustl.edu	37	1	233512219	233512219	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:233512219T>A	ENST00000366624.3	+	8	2131	c.1870T>A	c.(1870-1872)Tta>Ata	p.L624I	MLK4_ENST00000366622.1_Missense_Mutation_p.L70I	NM_032435.2	NP_115811.2																					GTCAACTATCTTAATAAAAAA	0.413																																																	0													114.0	114.0	114.0					1																	233512219		2203	4300	6503	SO:0001583	missense	0																														ENST00000366624.3:c.1870T>A	1.37:g.233512219T>A	ENSP00000355583:p.Leu624Ile			Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.L624I	ENST00000366624.3	37	c.1870	CCDS1598.1	1	.	.	.	.	.	.	.	.	.	.	T	13.66	2.302486	0.40795	.	.	ENSG00000143674	ENST00000366624;ENST00000366622	T;T	0.78364	-1.17;2.84	5.11	-2.14	0.07123	.	0.543594	0.17419	N	0.174905	T	0.59810	0.2221	L	0.46819	1.47	0.23653	N	0.997199	P;B	0.35628	0.513;0.002	B;B	0.29524	0.103;0.009	T	0.53358	-0.8450	10	0.62326	D	0.03	.	2.0164	0.03499	0.3439:0.0677:0.2367:0.3517	.	71;624	Q5TCX8-3;Q5TCX8	.;M3KL4_HUMAN	I	624;70	ENSP00000355583:L624I;ENSP00000355581:L70I	ENSP00000355581:L70I	L	+	1	2	RP5-862P8.2	231578842	0.999000	0.42202	0.086000	0.20670	0.978000	0.69477	0.760000	0.26475	-0.185000	0.10550	0.533000	0.62120	TTA	MLK4	-	pirsf_MAPKKK9/10/11	ENSG00000143674		0.413	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1804	Uniprot_gn	protein_coding	OTTHUMT00000092495.1	-	0.00	44	0	T			233512219	+1	tier1	-	no_errors	ENST00000366624	ensembl	human	known	74_37	missense	17.28	67	14	SNP	0.022	A
KIAA2022	340533	genome.wustl.edu	37	X	73961267	73961267	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:73961267T>A	ENST00000055682.6	-	3	3736	c.3125A>T	c.(3124-3126)gAg>gTg	p.E1042V		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1042					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						TGGTGCTATCTCATCAATGCT	0.493																																																	0													83.0	77.0	79.0					X																	73961267		2203	4300	6503	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3125A>T	X.37:g.73961267T>A	ENSP00000055682:p.Glu1042Val		A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.E1042V	ENST00000055682.6	37	c.3125	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	T	19.40	3.820554	0.71028	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.37235	1.21;1.21	5.48	5.48	0.80851	.	0.101427	0.64402	D	0.000003	T	0.52240	0.1722	L	0.47716	1.5	0.50039	D	0.999848	D	0.76494	0.999	D	0.67382	0.951	T	0.55062	-0.8199	10	0.87932	D	0	-15.6273	14.6114	0.68519	0.0:0.0:0.0:1.0	.	1042	Q5QGS0	K2022_HUMAN	V	1042	ENSP00000362567:E1042V;ENSP00000055682:E1042V	ENSP00000055682:E1042V	E	-	2	0	KIAA2022	73877992	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	6.144000	0.71762	1.830000	0.53286	0.486000	0.48141	GAG	KIAA2022	-	NULL	ENSG00000050030		0.493	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	-	0.00	48	0	T	NM_001008537		73961267	-1	tier1	-	no_errors	ENST00000055682	ensembl	human	known	74_37	missense	15.09	45	8	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	GL000209.1	75590	75591	+	IGR	INS	-	-	TC			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrGL000209.1:75590_75591insTC								None (None upstream) : None (None downstream)																							ATGAGAAACCTTCTCTCTCAGC	0.559																																																	0																																										SO:0001628	intergenic_variant	0																															GL000209.1.37:g.75597_75598dupTC				Frame_Shift_Ins	INS	pfam_Immunoglobulin,smart_Ig_sub	p.A227fs		37	c.672_673		GL000209.1																																																																																			KIR2DL2	-	NULL	ENSG00000215764	0	0.559					KIR2DL2	HGNC				0.00	115	0	-			75591	+1	tier1		no_errors	ENST00000400847	ensembl	human	known	74_37	frame_shift_ins	23.27	122	37	INS	NULL	TC
KLK4	9622	genome.wustl.edu	37	19	51410265	51410265	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:51410265T>G	ENST00000324041.1	-	5	689	c.690A>C	c.(688-690)caA>caC	p.Q230H	KLK4_ENST00000597441.1_5'Flank|KLK4_ENST00000431178.2_3'UTR	NM_004917.3	NP_004908.3	Q9Y5K2	KLK4_HUMAN	kallikrein-related peptidase 4	230	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amelogenesis (GO:0097186)|extracellular matrix disassembly (GO:0022617)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(8)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00624)|GBM - Glioblastoma multiforme(134;0.00878)		GCACGCCAACTTGGCCACACG	0.557																																																	0													96.0	94.0	95.0					19																	51410265		2203	4300	6503	SO:0001583	missense	0			AF113141	CCDS12809.1	19q13.41	2014-09-04	2006-10-27		ENSG00000167749	ENSG00000167749		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6365	protein-coding gene	gene with protein product		603767	"""kallikrein 4 (prostase, enamel matrix, prostate)"""	PRSS17		10077646, 10438493, 16800724, 10863090, 9465170	Standard	XM_005259441		Approved	EMSP, EMSP1, PSTS, KLK-L1	uc002pua.1	Q9Y5K2	OTTHUMG00000182964	ENST00000324041.1:c.690A>C	19.37:g.51410265T>G	ENSP00000326159:p.Gln230His		Q4VB16|Q96RU5|Q9GZL6|Q9UBJ6	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.Q230H	ENST00000324041.1	37	c.690	CCDS12809.1	19	.	.	.	.	.	.	.	.	.	.	t	12.95	2.091504	0.36952	.	.	ENSG00000167749	ENST00000324041	D	0.89050	-2.46	3.63	-3.73	0.04398	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.920246	0.08857	N	0.883654	D	0.89104	0.6620	L	0.49640	1.575	0.09310	N	1	D	0.71674	0.998	P	0.58820	0.846	T	0.81276	-0.1006	10	0.39692	T	0.17	.	9.2264	0.37410	0.0:0.6899:0.1519:0.1582	.	230	Q9Y5K2	KLK4_HUMAN	H	230	ENSP00000326159:Q230H	ENSP00000326159:Q230H	Q	-	3	2	KLK4	56102077	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	-1.683000	0.01934	-0.546000	0.06216	-0.296000	0.09543	CAA	KLK4	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000167749		0.557	KLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK4	HGNC	protein_coding	OTTHUMT00000464449.1	-	0.00	43	0	T	NM_004917		51410265	-1	tier1	-	no_errors	ENST00000324041	ensembl	human	known	74_37	missense	22.03	46	13	SNP	0.005	G
KLK4	9622	genome.wustl.edu	37	19	51411862	51411862	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:51411862C>T	ENST00000324041.1	-	3	447	c.448G>A	c.(448-450)Gtt>Att	p.V150I	KLK4_ENST00000597441.1_5'Flank|KLK4_ENST00000431178.2_Missense_Mutation_p.V101I	NM_004917.3	NP_004908.3	Q9Y5K2	KLK4_HUMAN	kallikrein-related peptidase 4	150	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				amelogenesis (GO:0097186)|extracellular matrix disassembly (GO:0022617)|protein catabolic process (GO:0030163)|proteolysis (GO:0006508)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(8)	19		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00624)|GBM - Glioblastoma multiforme(134;0.00878)		CAGCCAGAAACGAGGCAAGAG	0.617																																																	0													95.0	76.0	83.0					19																	51411862		2203	4300	6503	SO:0001583	missense	0			AF113141	CCDS12809.1	19q13.41	2014-09-04	2006-10-27		ENSG00000167749	ENSG00000167749		"""Kallikreins"", ""Serine peptidases / Serine peptidases"""	6365	protein-coding gene	gene with protein product		603767	"""kallikrein 4 (prostase, enamel matrix, prostate)"""	PRSS17		10077646, 10438493, 16800724, 10863090, 9465170	Standard	XM_005259441		Approved	EMSP, EMSP1, PSTS, KLK-L1	uc002pua.1	Q9Y5K2	OTTHUMG00000182964	ENST00000324041.1:c.448G>A	19.37:g.51411862C>T	ENSP00000326159:p.Val150Ile		Q4VB16|Q96RU5|Q9GZL6|Q9UBJ6	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.V150I	ENST00000324041.1	37	c.448	CCDS12809.1	19	.	.	.	.	.	.	.	.	.	.	c	12.59	1.983540	0.35036	.	.	ENSG00000167749	ENST00000324041;ENST00000431178	D;D	0.94280	-3.39;-3.39	3.99	1.76	0.24704	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.35805	N	0.002974	D	0.92024	0.7473	L	0.41124	1.26	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.82450	-0.0451	10	0.13470	T	0.59	.	4.2071	0.10493	0.0:0.5923:0.1937:0.214	.	101;150	Q96JD7;Q9Y5K2	.;KLK4_HUMAN	I	150;101	ENSP00000326159:V150I;ENSP00000399448:V101I	ENSP00000326159:V150I	V	-	1	0	KLK4	56103674	0.001000	0.12720	0.002000	0.10522	0.004000	0.04260	-0.015000	0.12634	0.429000	0.26202	-0.258000	0.10820	GTT	KLK4	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000167749		0.617	KLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK4	HGNC	protein_coding	OTTHUMT00000464449.1	-	0.00	39	0	C	NM_004917		51411862	-1	tier1	-	no_errors	ENST00000324041	ensembl	human	known	74_37	missense	29.31	41	17	SNP	0.006	T
KLRF1	51348	genome.wustl.edu	37	12	9994450	9994450	+	Missense_Mutation	SNP	G	G	A	rs3052097|rs111928232		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:9994450G>A	ENST00000279544.3	+	4	441	c.377G>A	c.(376-378)tGt>tAt	p.C126Y	KLRF1_ENST00000354855.3_Intron|KLRF1_ENST00000537723.1_Intron|KLRF1_ENST00000324214.4_Missense_Mutation_p.C76Y	NM_016523.1	NP_057607	Q9NZS2	KLRF1_HUMAN	killer cell lectin-like receptor subfamily F, member 1	126	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|MHC class I receptor activity (GO:0032393)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)	13						GGGAAGTGTTGTTATTGGTTC	0.323																																																	0													142.0	134.0	136.0					12																	9994450		1842	4083	5925	SO:0001583	missense	0			AF175206	CCDS41750.1	12p13.31	2011-08-30			ENSG00000150045	ENSG00000150045		"""Killer cell lectin-like receptors"", ""C-type lectin domain containing"""	13342	protein-coding gene	gene with protein product		605029				10671213	Standard	NM_001291823		Approved	CLEC5C, NKp80	uc021qux.1	Q9NZS2		ENST00000279544.3:c.377G>A	12.37:g.9994450G>A	ENSP00000279544:p.Cys126Tyr		Q4KMT5|Q96PR2|Q96PR3|Q9NZS1	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.C126Y	ENST00000279544.3	37	c.377	CCDS41750.1	12	.	.	.	.	.	.	.	.	.	.	-	4.237	0.042890	0.08196	.	.	ENSG00000150045	ENST00000324214;ENST00000279544	T;T	0.38401	1.14;1.14	.	.	.	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	.	.	.	.	T	0.62708	0.2450	M	0.91090	3.175	0.80722	D	1	D;D	0.89917	1.0;0.988	D;D	0.87578	0.998;0.983	T	0.65162	-0.6235	6	.	.	.	.	.	.	.	.	126;76	Q9NZS2;Q9NZS2-2	KLRF1_HUMAN;.	Y	76;126	ENSP00000322487:C76Y;ENSP00000279544:C126Y	.	C	+	2	0	KLRF1	9885717	1.000000	0.71417	0.998000	0.56505	0.846000	0.48090	0.000000	0.12993	0.000000	0.14550	0.000000	0.15137	TGT	KLRF1	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000150045		0.323	KLRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRF1	HGNC	protein_coding	OTTHUMT00000399535.1		0.00	34	0	G	NM_016523		9994450	+1			no_errors	ENST00000279544	ensembl	human	known	74_37	missense	12.77	41	6	SNP	0.999	A
KRT14	3861	genome.wustl.edu	37	17	39739836	39739836	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:39739836G>C	ENST00000167586.6	-	5	1106	c.1020C>G	c.(1018-1020)aaC>aaG	p.N340K		NM_000526.4	NP_000517	P02533	K1C14_HUMAN	keratin 14	340	Coil 2.|Rod.				aging (GO:0007568)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|hair cycle (GO:0042633)|hemidesmosome assembly (GO:0031581)|intermediate filament bundle assembly (GO:0045110)|response to ionizing radiation (GO:0010212)|response to zinc ion (GO:0010043)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	keratin filament binding (GO:1990254)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(3)|lung(7)|ovary(1)|prostate(5)|skin(1)|stomach(1)	25		Breast(137;0.000307)				CAATCTCCAGGTTCTGCATGG	0.602																																																	0													82.0	75.0	77.0					17																	39739836		2203	4300	6503	SO:0001583	missense	0			BC002690	CCDS11400.1	17q21.2	2013-06-20	2008-09-19		ENSG00000186847	ENSG00000186847		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6416	protein-coding gene	gene with protein product	"""epidermolysis bullosa simplex, Dowling-Meara, Koebner"""	148066	"""keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner)"""	EBS3, EBS4		1717157, 16831889	Standard	NM_000526		Approved		uc002hxf.2	P02533	OTTHUMG00000133426	ENST00000167586.6:c.1020C>G	17.37:g.39739836G>C	ENSP00000167586:p.Asn340Lys		Q14715|Q53XY3|Q9BUE3|Q9UBN2|Q9UBN3|Q9UCY4	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.N340K	ENST00000167586.6	37	c.1020	CCDS11400.1	17	.	.	.	.	.	.	.	.	.	.	G	18.75	3.689904	0.68271	.	.	ENSG00000186847	ENST00000167586	T	0.75260	-0.92	5.22	5.22	0.72569	Prefoldin (1);Filament (1);	0.100019	0.44097	D	0.000488	T	0.69305	0.3096	L	0.41824	1.3	0.40178	D	0.977257	P	0.38110	0.618	B	0.36030	0.216	T	0.74512	-0.3641	10	0.72032	D	0.01	.	19.1487	0.93479	0.0:0.0:1.0:0.0	.	340	P02533	K1C14_HUMAN	K	340	ENSP00000167586:N340K	ENSP00000167586:N340K	N	-	3	2	KRT14	36993362	0.943000	0.32029	1.000000	0.80357	0.926000	0.56050	1.294000	0.33365	2.586000	0.87340	0.655000	0.94253	AAC	KRT14	-	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	ENSG00000186847		0.602	KRT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT14	HGNC	protein_coding	OTTHUMT00000257289.1	-	0.00	56	0	G	NM_000526		39739836	-1	tier1	-	no_errors	ENST00000167586	ensembl	human	known	74_37	missense	20.00	444	111	SNP	1.000	C
KRTAP4-9	100132386	genome.wustl.edu	37	17	39262065	39262065	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:39262065C>G	ENST00000391415.1	+	1	482	c.425C>G	c.(424-426)tCt>tGt	p.S142C		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	142	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						tgctgccagtctgtgtgctgc	0.662																																																	0													5.0	10.0	8.0					17																	39262065		662	1538	2200	SO:0001583	missense	0			AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.425C>G	17.37:g.39262065C>G	ENSP00000375234:p.Ser142Cys			Missense_Mutation	SNP	pfam_Keratin-assoc	p.S142C	ENST00000391415.1	37	c.425	CCDS54124.1	17	.	.	.	.	.	.	.	.	.	.	.	10.50	1.367576	0.24771	.	.	ENSG00000212722	ENST00000377734;ENST00000391415;ENST00000333994	T	0.00619	6.18	3.13	3.13	0.36017	.	.	.	.	.	T	0.01421	0.0046	L	0.55481	1.735	0.09310	N	1	D	0.69078	0.997	P	0.49561	0.615	T	0.52548	-0.8561	9	0.87932	D	0	.	12.0926	0.53736	0.0:1.0:0.0:0.0	.	142	Q9BYQ8	KRA49_HUMAN	C	130;142;133	ENSP00000375234:S142C	ENSP00000334461:S133C	S	+	2	0	KRTAP4-9	36515591	0.014000	0.17966	0.004000	0.12327	0.091000	0.18340	3.032000	0.49736	1.452000	0.47756	0.306000	0.20318	TCT	KRTAP4-9	-	NULL	ENSG00000212722		0.662	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-9	HGNC	protein_coding	OTTHUMT00000257688.1	-	0.00	193	0	C	NM_001146041		39262065	+1	tier1	-	no_errors	ENST00000391415	ensembl	human	known	74_37	missense	5.64	184	11	SNP	0.014	G
KRTAP4-9	100132386	genome.wustl.edu	37	17	39262140	39262140	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:39262140C>T	ENST00000391415.1	+	1	557	c.500C>T	c.(499-501)tCc>tTc	p.S167F		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	167	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						tgctgtgaatccagctgctgc	0.657																																																	0													11.0	15.0	14.0					17																	39262140		686	1584	2270	SO:0001583	missense	0			AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.500C>T	17.37:g.39262140C>T	ENSP00000375234:p.Ser167Phe			Missense_Mutation	SNP	pfam_Keratin-assoc	p.S167F	ENST00000391415.1	37	c.500	CCDS54124.1	17	.	.	.	.	.	.	.	.	.	.	.	9.294	1.051373	0.19827	.	.	ENSG00000212722	ENST00000377734;ENST00000391415;ENST00000333994	T	0.00601	6.29	2.68	2.68	0.31781	.	0.784192	0.10453	U	0.672864	T	0.02727	0.0082	M	0.87269	2.87	0.23464	N	0.997629	D	0.59357	0.985	P	0.60682	0.878	T	0.31888	-0.9927	10	0.72032	D	0.01	.	11.0545	0.47909	0.0:1.0:0.0:0.0	.	167	Q9BYQ8	KRA49_HUMAN	F	155;167;158	ENSP00000375234:S167F	ENSP00000334461:S158F	S	+	2	0	KRTAP4-9	36515666	.	.	0.386000	0.26170	0.350000	0.29205	.	.	1.192000	0.43071	0.313000	0.20887	TCC	KRTAP4-9	-	NULL	ENSG00000212722		0.657	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-9	HGNC	protein_coding	OTTHUMT00000257688.1	-	0.00	175	0	C	NM_001146041		39262140	+1	tier1	-	no_errors	ENST00000391415	ensembl	human	known	74_37	missense	5.65	167	10	SNP	0.896	T
KRT14	3861	genome.wustl.edu	37	17	39742711	39742711	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:39742711G>A	ENST00000167586.6	-	1	462	c.376C>T	c.(376-378)Ctg>Ttg	p.L126L		NM_000526.4	NP_000517	P02533	K1C14_HUMAN	keratin 14	126	Coil 1A.|Rod.				aging (GO:0007568)|cell junction assembly (GO:0034329)|epidermis development (GO:0008544)|epithelial cell differentiation (GO:0030855)|hair cycle (GO:0042633)|hemidesmosome assembly (GO:0031581)|intermediate filament bundle assembly (GO:0045110)|response to ionizing radiation (GO:0010212)|response to zinc ion (GO:0010043)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	keratin filament binding (GO:1990254)|structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(3)|lung(7)|ovary(1)|prostate(5)|skin(1)|stomach(1)	25		Breast(137;0.000307)				TAGGAGGCCAGGCGGTCATTG	0.607																																																	0													140.0	147.0	145.0					17																	39742711		2203	4296	6499	SO:0001819	synonymous_variant	0			BC002690	CCDS11400.1	17q21.2	2013-06-20	2008-09-19		ENSG00000186847	ENSG00000186847		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6416	protein-coding gene	gene with protein product	"""epidermolysis bullosa simplex, Dowling-Meara, Koebner"""	148066	"""keratin 14 (epidermolysis bullosa simplex, Dowling-Meara, Koebner)"""	EBS3, EBS4		1717157, 16831889	Standard	NM_000526		Approved		uc002hxf.2	P02533	OTTHUMG00000133426	ENST00000167586.6:c.376C>T	17.37:g.39742711G>A			Q14715|Q53XY3|Q9BUE3|Q9UBN2|Q9UBN3|Q9UCY4	Silent	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_I	p.L126	ENST00000167586.6	37	c.376	CCDS11400.1	17																																																																																			KRT14	-	pfam_IF	ENSG00000186847		0.607	KRT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT14	HGNC	protein_coding	OTTHUMT00000257289.1	-	0.00	167	0	G	NM_000526		39742711	-1	tier1	-	no_errors	ENST00000167586	ensembl	human	known	74_37	silent	21.27	1273	344	SNP	1.000	A
LAMA1	284217	genome.wustl.edu	37	18	6950865	6950865	+	Silent	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr18:6950865G>T	ENST00000389658.3	-	58	8406	c.8313C>A	c.(8311-8313)ggC>ggA	p.G2771G		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2771	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AGTGGAGGCGGCCCCCGTGCA	0.572																																																	0													101.0	85.0	91.0					18																	6950865		2203	4300	6503	SO:0001819	synonymous_variant	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.8313C>A	18.37:g.6950865G>T				Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.G2771	ENST00000389658.3	37	c.8313	CCDS32787.1	18																																																																																			LAMA1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000101680		0.572	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	49	0	G	NM_005559		6950865	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	silent	8.47	54	5	SNP	0.793	T
LAMA1	284217	genome.wustl.edu	37	18	6961752	6961752	+	Missense_Mutation	SNP	G	G	A	rs372517307		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr18:6961752G>A	ENST00000389658.3	-	53	7552	c.7459C>T	c.(7459-7461)Cgg>Tgg	p.R2487W		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	2487	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CTAACACTCCGGATGGGCTGG	0.517																																																	0								G	TRP/ARG	0,4406		0,0,2203	54.0	49.0	51.0		7459	5.8	1.0	18		51	1,8599	1.2+/-3.3	0,1,4299	no	missense	LAMA1	NM_005559.3	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	2487/3076	6961752	1,13005	2203	4300	6503	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.7459C>T	18.37:g.6961752G>A	ENSP00000374309:p.Arg2487Trp			Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.R2487W	ENST00000389658.3	37	c.7459	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618770	0.66787	0.0	1.16E-4	ENSG00000101680	ENST00000389658	T	0.22539	1.95	5.75	5.75	0.90469	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.266199	0.31566	N	0.007427	T	0.40719	0.1128	M	0.74881	2.28	0.40536	D	0.980974	D	0.76494	0.999	P	0.55999	0.789	T	0.34153	-0.9840	10	0.87932	D	0	.	14.1384	0.65303	0.0711:0.0:0.9289:0.0	.	2487	P25391	LAMA1_HUMAN	W	2487	ENSP00000374309:R2487W	ENSP00000374309:R2487W	R	-	1	2	LAMA1	6951752	1.000000	0.71417	0.964000	0.40570	0.547000	0.35210	3.955000	0.56715	2.725000	0.93324	0.655000	0.94253	CGG	LAMA1	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000101680		0.517	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	-	0.00	31	0	G	NM_005559		6961752	-1	tier1	-	no_errors	ENST00000389658	ensembl	human	known	74_37	missense	13.89	31	5	SNP	0.986	A
LARP1B	55132	genome.wustl.edu	37	4	128999117	128999117	+	Splice_Site	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:128999117G>T	ENST00000326639.6	+	4	428	c.217G>T	c.(217-219)Gct>Tct	p.A73S	LARP1B_ENST00000394288.3_Splice_Site_p.A73S|LARP1B_ENST00000432347.2_Splice_Site_p.A73S|LARP1B_ENST00000264584.5_Splice_Site_p.G73C|LARP1B_ENST00000427266.1_Splice_Site_p.A73S|LARP1B_ENST00000441387.1_Splice_Site_p.A73S|LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000512292.1_Splice_Site_p.A73S	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	73						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						ACGTAAGAGAGGTCAGTTTGT	0.343																																																	0													107.0	101.0	103.0					4																	128999117		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.217+1G>T	4.37:g.128999117G>T			Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.A73S	ENST00000326639.6	37	c.217	CCDS3738.1	4	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	14.02|14.02|14.02	2.410607|2.410607|2.410607	0.42715|0.42715|0.42715	.|.|.	.|.|.	ENSG00000138709|ENSG00000138709|ENSG00000138709	ENST00000326639;ENST00000512292;ENST00000394288;ENST00000432347;ENST00000441387;ENST00000427266|ENST00000508819;ENST00000264584|ENST00000507377	T;T;T;T;T;T|T;T|.	0.43688|0.34072|.	1.97;1.56;0.95;0.94;1.96;1.56|1.38;1.82|.	3.9|3.9|3.9	3.9|3.9|3.9	0.45041|0.45041|0.45041	.|.|.	0.169599|.|.	0.39834|.|.	N|.|.	0.001244|.|.	T|T|T	0.57917|0.57917|0.57917	0.2086|0.2086|0.2086	L|L|L	0.40543|0.40543|0.40543	1.245|1.245|1.245	0.80722|0.80722|0.80722	D|D|D	1|1|1	P;P;P;P|.|.	0.36837|.|.	0.488;0.571;0.571;0.571|.|.	B;B;B;B|.|.	0.33392|.|.	0.155;0.163;0.121;0.163|.|.	T|T|T	0.55198|0.55198|0.55198	-0.8178|-0.8178|-0.8178	10|7|5	0.29301|0.49607|.	T|T|.	0.29|0.09|.	.|.|.	14.2027|14.2027|14.2027	0.65714|0.65714|0.65714	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	73;73;73;73|.|.	Q659C4;G3XAJ5;Q659C4-3;G3V0E9|.|.	LAR1B_HUMAN;.;.;.|.|.	S|C|I	73|73|41	ENSP00000321997:A73S;ENSP00000422850:A73S;ENSP00000377829:A73S;ENSP00000390395:A73S;ENSP00000396521:A73S;ENSP00000403586:A73S|ENSP00000427281:G73C;ENSP00000264584:G73C|.	ENSP00000321997:A73S|ENSP00000264584:G73C|.	A|G|S	+|+|+	1|1|2	0|0|0	LARP1B|LARP1B|LARP1B	129218567|129218567|129218567	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.879000|0.879000|0.879000	0.50718|0.50718|0.50718	5.164000|5.164000|5.164000	0.64954|0.64954|0.64954	2.186000|2.186000|2.186000	0.69663|0.69663|0.69663	0.448000|0.448000|0.448000	0.29417|0.29417|0.29417	GCT|GGT|AGC	LARP1B	-	NULL	ENSG00000138709		0.343	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LARP1B	HGNC	protein_coding	OTTHUMT00000257173.2	-	0.00	34	0	G	NM_018078	Missense_Mutation	128999117	+1	tier1	-	no_errors	ENST00000326639	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
LETM2	137994	genome.wustl.edu	37	8	38250325	38250325	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:38250325C>A	ENST00000379957.4	+	3	440	c.313C>A	c.(313-315)Cct>Act	p.P105T	LETM2_ENST00000519476.2_Missense_Mutation_p.P105T|LETM2_ENST00000297720.5_Missense_Mutation_p.P58T|LETM2_ENST00000523983.2_Missense_Mutation_p.P58T|LETM2_ENST00000524874.1_Missense_Mutation_p.P105T	NM_001199659.1	NP_001186588.1	Q2VYF4	LETM2_HUMAN	leucine zipper-EF-hand containing transmembrane protein 2	105						integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				NS(1)|large_intestine(1)|lung(3)|prostate(2)	7	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)			GGTGACAAGCCCTCAGGCCAC	0.403																																																	0													54.0	53.0	53.0					8																	38250325		2203	4300	6503	SO:0001583	missense	0			AK058138	CCDS6106.1, CCDS56534.1, CCDS69466.1, CCDS75731.1	8p12	2013-01-11						"""EF-hand domain containing"""	14648	protein-coding gene	gene with protein product						11549311	Standard	NM_001286821		Approved	FLJ25409	uc003xlm.2	Q2VYF4		ENST00000379957.4:c.313C>A	8.37:g.38250325C>A	ENSP00000369291:p.Pro105Thr		A6NMG3|Q8NCR2|Q96LL1	Missense_Mutation	SNP	pfam_LETM1	p.P105T	ENST00000379957.4	37	c.313		8	.	.	.	.	.	.	.	.	.	.	C	11.12	1.546029	0.27652	.	.	ENSG00000165046	ENST00000527334;ENST00000519476;ENST00000297720;ENST00000524874;ENST00000379957;ENST00000523983;ENST00000526356	.	.	.	5.75	1.69	0.24217	.	0.231039	0.44902	N	0.000419	T	0.28863	0.0716	M	0.68952	2.095	0.09310	N	0.999997	P;B;P	0.38922	0.544;0.007;0.651	B;B;B	0.37387	0.162;0.008;0.248	T	0.14144	-1.0483	9	0.35671	T	0.21	.	2.3698	0.04328	0.2291:0.4253:0.2051:0.1406	.	105;105;105	Q2VYF4;E9PMA4;A8K1M9	LETM2_HUMAN;.;.	T	105;105;58;105;105;58;105	.	ENSP00000297720:P58T	P	+	1	0	LETM2	38369482	0.000000	0.05858	0.655000	0.29622	0.026000	0.11368	0.041000	0.13927	0.340000	0.23745	-0.140000	0.14226	CCT	LETM2	-	NULL	ENSG00000165046		0.403	LETM2-013	KNOWN	basic|appris_candidate_longest	protein_coding	LETM2	HGNC	protein_coding	OTTHUMT00000381816.1		0.00	16	0	C	NM_144652		38250325	+1			no_errors	ENST00000379957	ensembl	human	known	74_37	missense	10.64	42	5	SNP	0.002	A
LEUTX	342900	genome.wustl.edu	37	19	40276514	40276514	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:40276514C>T	ENST00000396841.4	+	3	410	c.246C>T	c.(244-246)gaC>gaT	p.D82D		NM_001143832.1	NP_001137304.1	A8MZ59	LEUTX_HUMAN	leucine twenty homeobox	82					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|breast(1)|kidney(1)|skin(2)	5						ATGCAAATGACCATGATCTAC	0.483																																																	0													74.0	69.0	71.0					19																	40276514		692	1591	2283	SO:0001819	synonymous_variant	0					19q13.2	2011-06-20			ENSG00000213921	ENSG00000213921		"""Homeoboxes / PRD class"""	31953	protein-coding gene	gene with protein product							Standard	NM_001143832		Approved		uc010xvg.2	A8MZ59		ENST00000396841.4:c.246C>T	19.37:g.40276514C>T				Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,pfscan_Homeobox_dom	p.D82	ENST00000396841.4	37	c.246		19	.	.	.	.	.	.	.	.	.	.	.	2.605	-0.292122	0.05568	.	.	ENSG00000213921	ENST00000556180	.	.	.	2.66	-1.3	0.09259	.	.	.	.	.	T	0.18882	0.0453	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.24476	-1.0159	4	.	.	.	.	1.0269	0.01529	0.2093:0.3926:0.239:0.1591	.	.	.	.	I	137	.	.	T	+	2	0	LEUTX	44968354	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.471000	0.06631	-0.156000	0.11079	0.650000	0.86243	ACC	LEUTX	-	NULL	ENSG00000213921		0.483	LEUTX-001	NOVEL	basic|appris_principal	protein_coding	LEUTX	HGNC	protein_coding	OTTHUMT00000410828.3		0.00	20	0	C	XM_001129035		40276514	+1			no_errors	ENST00000396841	ensembl	human	novel	74_37	silent	6.98	40	3	SNP	0.000	T
LILRB2	10288	genome.wustl.edu	37	19	54784144	54784147	+	Frame_Shift_Del	DEL	CAGA	CAGA	-			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	CAGA	CAGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:54784144_54784147delCAGA	ENST00000391749.4	-	3	313_316	c.42_45delTCTG	c.(40-45)agtctgfs	p.SL14fs	MIR4752_ENST00000579672.1_RNA|LILRB2_ENST00000471216.1_5'UTR|LILRB2_ENST00000314446.5_Frame_Shift_Del_p.SL14fs|LILRB2_ENST00000391748.1_Frame_Shift_Del_p.SL14fs|LILRB2_ENST00000391746.1_Frame_Shift_Del_p.SL14fs|LILRB2_ENST00000434421.1_Intron	NM_001278406.1	NP_001265335.1	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2	14					cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|cellular response to lipopolysaccharide (GO:0071222)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|negative regulation of antigen processing and presentation (GO:0002578)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of dendritic cell differentiation (GO:2001198)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|inhibitory MHC class I receptor activity (GO:0032396)|MHC class I protein binding (GO:0042288)|MHC class Ib protein binding (GO:0023029)|protein phosphatase 1 binding (GO:0008157)|receptor activity (GO:0004872)	p.L15M(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(30)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	44	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCCTGGGGCCCAGACTCAGCCCTG	0.642																																																	1	Substitution - Missense(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0			AF000574	CCDS12886.1, CCDS42612.1, CCDS62791.1, CCDS62792.1	19q13.4	2013-01-11			ENSG00000131042	ENSG00000131042		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6606	protein-coding gene	gene with protein product		604815				9151699, 9079806	Standard	XM_006722966		Approved	LIR-2, ILT4, MIR-10, LIR2, CD85d, MIR10	uc002qfb.3	Q8N423	OTTHUMG00000064896	ENST00000391749.4:c.42_45delTCTG	19.37:g.54784144_54784147delCAGA	ENSP00000375629:p.Ser14fs		A8MU67|C9JF29|O75017|Q8NHJ7|Q8NHJ8	Frame_Shift_Del	DEL	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S14fs	ENST00000391749.4	37	c.45_42	CCDS12886.1	19																																																																																			LILRB2	-	NULL	ENSG00000131042		0.642	LILRB2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LILRB2	HGNC	protein_coding	OTTHUMT00000139510.1		0.00	109	0	CAGA			54784147	-1			no_errors	ENST00000391749	ensembl	human	known	74_37	frame_shift_del	7.25	179	14	DEL	0.003:0.001:0.005:0.023	0
LINGO3	645191	genome.wustl.edu	37	19	2291315	2291315	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:2291315C>T	ENST00000585527.1	-	1	708	c.461G>A	c.(460-462)cGg>cAg	p.R154Q	LINGO3_ENST00000404279.1_Missense_Mutation_p.R154Q			P0C6S8	LIGO3_HUMAN	leucine rich repeat and Ig domain containing 3	154						integral component of membrane (GO:0016021)				lung(1)|urinary_tract(1)	2						CACTTCCAGCCGGCGCAGGCT	0.647																																																	0													31.0	37.0	35.0					19																	2291315		2167	4259	6426	SO:0001583	missense	0			AK091795	CCDS45905.1	19p13.3	2013-01-11	2007-02-01	2007-02-01		ENSG00000220008		"""Immunoglobulin superfamily / I-set domain containing"""	21206	protein-coding gene	gene with protein product		609792	"""leucine rich repeat neuronal 6B"""	LRRN6B		14686891	Standard	NM_001101391		Approved	LERN2	uc010dsx.1	P0C6S8		ENST00000585527.1:c.461G>A	19.37:g.2291315C>T	ENSP00000467753:p.Arg154Gln			Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R154Q	ENST00000585527.1	37	c.461	CCDS45905.1	19	.	.	.	.	.	.	.	.	.	.	c	3.054	-0.194778	0.06259	.	.	ENSG00000220008	ENST00000404279	T	0.58506	0.33	4.19	1.96	0.26148	.	.	.	.	.	T	0.40448	0.1117	L	0.35593	1.075	0.09310	N	1	B	0.20164	0.042	B	0.14023	0.01	T	0.24404	-1.0161	9	0.11794	T	0.64	.	8.1492	0.31130	0.0:0.7514:0.159:0.0896	.	154	P0C6S8	LIGO3_HUMAN	Q	154	ENSP00000384979:R154Q	ENSP00000384979:R154Q	R	-	2	0	LINGO3	2242315	0.023000	0.18921	0.009000	0.14445	0.385000	0.30292	0.650000	0.24858	0.216000	0.20781	0.462000	0.41574	CGG	LINGO3	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000220008		0.647	LINGO3-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	LINGO3	HGNC	protein_coding	OTTHUMT00000451291.2	-	0.00	56	0	C	NM_001101391		2291315	-1	tier1	-	no_errors	ENST00000404279	ensembl	human	known	74_37	missense	18.64	48	11	SNP	0.206	T
CADM3	57863	genome.wustl.edu	37	1	159166613	159166613	+	Intron	DEL	T	T	-	rs533935187		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:159166613delT	ENST00000368125.4	+	7	939				CADM3_ENST00000368124.4_Intron|CTA-134P22.2_ENST00000415675.2_RNA	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CTCCCAGTTATTTTTTTTTTT	0.527											OREG0013913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.783-68T>-	1.37:g.159166613delT		1799	Q8IZQ9|Q9NVJ5|Q9UJP1	RNA	DEL	-	NULL	ENST00000368125.4	37	NULL	CCDS44251.1	1																																																																																			CTA-134P22.2	-	-	ENSG00000225670		0.527	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100131825	Clone_based_vega_gene	protein_coding	OTTHUMT00000090330.1		0.00	16	0	T	NM_021189		159166613	-1	tier1		no_errors	ENST00000415675	ensembl	human	known	74_37	rna	25.00	12	4	DEL	0.000	-
LMOD1	25802	genome.wustl.edu	37	1	201869675	201869675	+	Missense_Mutation	SNP	G	G	A	rs369116037		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:201869675G>A	ENST00000367288.4	-	2	712	c.466C>T	c.(466-468)Cgg>Tgg	p.R156W	RP11-307B6.3_ENST00000414927.1_RNA|RP11-307B6.3_ENST00000458139.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	156					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TCAATGCCCCGGATGATCTTC	0.557																																																	0								G	TRP/ARG	0,4024		0,0,2012	77.0	81.0	80.0		466	-5.4	0.7	1		80	2,8328		0,2,4163	no	missense	LMOD1	NM_012134.2	101	0,2,6175	AA,AG,GG		0.024,0.0,0.0162	probably-damaging	156/601	201869675	2,12352	2012	4165	6177	SO:0001583	missense	0			X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.466C>T	1.37:g.201869675G>A	ENSP00000356257:p.Arg156Trp		B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	pfam_Tropomodulin,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.R156W	ENST00000367288.4	37	c.466	CCDS53457.1	1	.	.	.	.	.	.	.	.	.	.	G	16.86	3.239036	0.58995	0.0	2.4E-4	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	T	0.12879	2.64	5.77	-5.38	0.02673	.	0.000000	0.43416	D	0.000569	T	0.27866	0.0686	M	0.67953	2.075	0.25074	N	0.990974	D;D	0.89917	1.0;0.999	D;P	0.70935	0.971;0.893	T	0.06991	-1.0796	10	0.72032	D	0.01	-43.2051	13.6656	0.62393	0.0:0.063:0.6521:0.2849	.	105;156	B4E3S9;P29536	.;LMOD1_HUMAN	W	156;156;105	ENSP00000356257:R156W	ENSP00000356257:R156W	R	-	1	2	LMOD1	200136298	0.914000	0.31030	0.668000	0.29813	0.949000	0.60115	0.409000	0.21082	-1.344000	0.02216	-1.014000	0.02459	CGG	LMOD1	-	NULL	ENSG00000163431		0.557	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	LMOD1	HGNC	protein_coding	OTTHUMT00000087085.2		0.00	33	0	G			201869675	-1			no_errors	ENST00000367288	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.263	A
APELA	100506013	genome.wustl.edu	37	4	165798450	165798450	+	RNA	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:165798450G>A	ENST00000507152.1	+	0	295					NR_038825.1																						GGTTTACATTGAGAGTCATTG	0.383																																																	0																																												0																															4.37:g.165798450G>A				RNA	SNP	-	NULL	ENST00000507152.1	37	NULL		4																																																																																			RP11-366M4.3	-	-	ENSG00000248329		0.383	RP11-366M4.3-001	KNOWN	basic	lincRNA	LOC100506013	Clone_based_vega_gene	processed_transcript	OTTHUMT00000364313.1	-	0.00	40	0	G			165798450	+1	tier1	-	no_errors	ENST00000507152	ensembl	human	known	74_37	rna	17.14	29	6	SNP	0.001	A
RP11-435B5.5	0	genome.wustl.edu	37	1	143391544	143391544	+	lincRNA	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:143391544A>T	ENST00000428624.1	+	0	1783				RP11-435B5.4_ENST00000423249.1_lincRNA																							TTCATTATCAAGTTATACTAT	0.308																																																	0																																												0																															1.37:g.143391544A>T				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.308	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	187	0	A			143391544	+1	tier1	-	no_errors	ENST00000412492	ensembl	human	known	74_37	rna	10.39	207	24	SNP	0.024	T
LOC441666	441666	genome.wustl.edu	37	10	42832803	42832803	+	RNA	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr10:42832803T>C	ENST00000609841.1	-	0	1100					NR_024380.1																						CCACAATCTTTATATTTGTAG	0.358																																																	0																																												0																															10.37:g.42832803T>C				RNA	SNP	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			RP11-313J2.1	-	-	ENSG00000215146		0.358	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	-	0.00	36	0	T			42832803	-1	tier1	-	no_errors	ENST00000609841	ensembl	human	known	74_37	rna	28.57	45	18	SNP	0.021	C
LOXL2	4017	genome.wustl.edu	37	8	23190975	23190975	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:23190975A>T	ENST00000389131.3	-	5	1274	c.905T>A	c.(904-906)gTg>gAg	p.V302E	RP11-177H13.2_ENST00000519692.1_RNA|LOXL2_ENST00000518472.1_5'UTR	NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	302	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		CTGCCCAGGCACACAACTCAC	0.627																																																	0													115.0	100.0	105.0					8																	23190975		2203	4300	6503	SO:0001583	missense	0			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.905T>A	8.37:g.23190975A>T	ENSP00000373783:p.Val302Glu		B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Missense_Mutation	SNP	pfam_Lysyl_oxidase,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_Lysyl_oxidase,prints_SRCR	p.V302E	ENST00000389131.3	37	c.905	CCDS34864.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	25.8|25.8	4.676445|4.676445	0.88445|0.88445	.|.	.|.	ENSG00000134013|ENSG00000134013	ENST00000520349|ENST00000389131	.|T	.|0.61158	.|0.13	5.93|5.93	5.93|5.93	0.95920|0.95920	.|Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	.|0.221390	.|0.47455	.|D	.|0.000222	T|T	0.66742|0.66742	0.2820|0.2820	M|M	0.82716|0.82716	2.605|2.605	0.45747|0.45747	D|D	0.998641|0.998641	.|B	.|0.22480	.|0.07	.|B	.|0.39339	.|0.297	T|T	0.66456|0.66456	-0.5919|-0.5919	5|10	.|0.41790	.|T	.|0.15	.|.	9.7009|9.7009	0.40187|0.40187	0.9225:0.0:0.0775:0.0|0.9225:0.0:0.0775:0.0	.|.	.|302	.|Q9Y4K0	.|LOXL2_HUMAN	S|E	12|302	.|ENSP00000373783:V302E	.|ENSP00000373783:V302E	C|V	-|-	1|2	0|0	LOXL2|LOXL2	23246920|23246920	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	6.267000|6.267000	0.72546|0.72546	2.282000|2.282000	0.76494|0.76494	0.525000|0.525000	0.51046|0.51046	TGC|GTG	LOXL2	-	superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000134013		0.627	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL2	HGNC	protein_coding	OTTHUMT00000375603.1		0.00	30	0	A			23190975	-1			no_errors	ENST00000389131	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	T
LPCAT1	79888	genome.wustl.edu	37	5	1489926	1489926	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:1489926C>G	ENST00000283415.3	-	4	673	c.541G>C	c.(541-543)Gat>Cat	p.D181H		NM_024830.3	NP_079106.3	Q8NF37	PCAT1_HUMAN	lysophosphatidylcholine acyltransferase 1	181					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|negative regulation of phosphatidylcholine biosynthetic process (GO:2001246)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|positive regulation of protein catabolic process (GO:0045732)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|surfactant homeostasis (GO:0043129)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphocholine O-acyltransferase activity (GO:0047159)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|1-alkylglycerophosphocholine O-acyltransferase activity (GO:0047191)|calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(19;0.0274)|all cancers(22;0.0534)	GBM - Glioblastoma multiforme(108;0.156)		CTGCGAGAATCCTGGTCTGAC	0.552																																																	0													216.0	216.0	216.0					5																	1489926		2203	4300	6503	SO:0001583	missense	0			BC020166	CCDS3864.1	5p15.33	2013-01-10	2007-12-17	2007-12-17	ENSG00000153395	ENSG00000153395		"""EF-hand domain containing"""	25718	protein-coding gene	gene with protein product		610472	"""acyltransferase like 2"""	AYTL2		8619474, 16704971	Standard	NM_024830		Approved	FLJ12443	uc003jcm.3	Q8NF37	OTTHUMG00000131017	ENST00000283415.3:c.541G>C	5.37:g.1489926C>G	ENSP00000283415:p.Asp181His		Q1HAQ1|Q7Z4G6|Q8N3U7|Q8WUL8|Q9GZW6	Missense_Mutation	SNP	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase,smart_EF_hand_dom,pfscan_EF_hand_dom	p.D181H	ENST00000283415.3	37	c.541	CCDS3864.1	5	.	.	.	.	.	.	.	.	.	.	C	15.65	2.896446	0.52121	.	.	ENSG00000153395	ENST00000283415	D	0.97404	-4.37	4.49	4.49	0.54785	Phospholipid/glycerol acyltransferase (2);	0.097899	0.64402	D	0.000002	D	0.95825	0.8641	L	0.50919	1.6	0.58432	D	0.999997	P	0.43231	0.801	B	0.43251	0.413	D	0.96249	0.9182	10	0.56958	D	0.05	-11.0866	17.1769	0.86844	0.0:1.0:0.0:0.0	.	181	Q8NF37	PCAT1_HUMAN	H	181	ENSP00000283415:D181H	ENSP00000283415:D181H	D	-	1	0	LPCAT1	1542926	1.000000	0.71417	0.991000	0.47740	0.598000	0.36846	2.903000	0.48711	2.050000	0.60909	0.561000	0.74099	GAT	LPCAT1	-	pfam_Plipid/glycerol_acylTrfase,smart_Plipid/glycerol_acylTrfase	ENSG00000153395		0.552	LPCAT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT1	HGNC	protein_coding	OTTHUMT00000304032.1	-	0.00	94	0	C	NM_024830		1489926	-1	tier1	-	no_errors	ENST00000283415	ensembl	human	known	74_37	missense	11.80	314	42	SNP	1.000	G
LRP1B	53353	genome.wustl.edu	37	2	141458111	141458111	+	Silent	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:141458111A>C	ENST00000389484.3	-	41	7478	c.6507T>G	c.(6505-6507)gcT>gcG	p.A2169A		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2169	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATGGGCACAAGCACAAGTTC	0.403										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													101.0	101.0	101.0					2																	141458111		2203	4299	6502	SO:0001819	synonymous_variant	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6507T>G	2.37:g.141458111A>C			Q8WY29|Q8WY30|Q8WY31	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.A2169	ENST00000389484.3	37	c.6507	CCDS2182.1	2																																																																																			LRP1B	-	smart_EG-like_dom	ENSG00000168702		0.403	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	32	0	A	NM_018557		141458111	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	silent	37.78	28	17	SNP	1.000	C
LRRC7	57554	genome.wustl.edu	37	1	70446102	70446102	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:70446102G>T	ENST00000035383.5	+	7	668	c.638G>T	c.(637-639)tGg>tTg	p.W213L	LRRC7_ENST00000310961.5_Missense_Mutation_p.W218L|LRRC7_ENST00000415775.2_5'UTR	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	213						cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						AGGGAGTTATGGATGGATAAT	0.323																																																	0													179.0	185.0	183.0					1																	70446102		2203	4300	6503	SO:0001583	missense	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.638G>T	1.37:g.70446102G>T	ENSP00000035383:p.Trp213Leu		Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.W213L	ENST00000035383.5	37	c.638	CCDS645.1	1	.	.	.	.	.	.	.	.	.	.	G	24.6	4.554332	0.86231	.	.	ENSG00000033122	ENST00000310961;ENST00000035383;ENST00000370957	T;T	0.56275	1.92;0.47	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.49012	0.1532	N	0.21583	0.68	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.41197	-0.9522	10	0.24483	T	0.36	.	16.3726	0.83370	0.0:0.0:1.0:0.0	.	213	Q96NW7	LRRC7_HUMAN	L	218;213;36	ENSP00000309245:W218L;ENSP00000035383:W213L	ENSP00000035383:W213L	W	+	2	0	LRRC7	70218690	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.147000	0.94646	2.608000	0.88229	0.650000	0.86243	TGG	LRRC7	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000033122		0.323	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC7	HGNC	protein_coding	OTTHUMT00000131261.1	-	0.00	53	0	G	NM_020794		70446102	+1	tier1	-	no_errors	ENST00000035383	ensembl	human	known	74_37	missense	29.17	34	14	SNP	1.000	T
LRRFIP2	9209	genome.wustl.edu	37	3	37100291	37100291	+	Silent	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:37100291G>T	ENST00000336686.4	-	25	1940	c.1860C>A	c.(1858-1860)atC>atA	p.I620I	LRRFIP2_ENST00000396428.2_Silent_p.I402I|MLH1_ENST00000536378.1_Intron|LRRFIP2_ENST00000421307.1_Silent_p.I620I|LRRFIP2_ENST00000440230.1_Silent_p.I323I|LRRFIP2_ENST00000354379.4_Silent_p.I299I|LRRFIP2_ENST00000421276.2_Silent_p.I323I			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	620					Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						TCTGCATTTCGATGAACTGCA	0.512																																																	1	Whole gene deletion(1)	ovary(1)											138.0	117.0	124.0					3																	37100291		2203	4300	6503	SO:0001819	synonymous_variant	0			AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.1860C>A	3.37:g.37100291G>T			A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Silent	SNP	pfam_Leu-rich_rep_flightless-int_pr,superfamily_bHLH_dom,superfamily_Prefoldin	p.I620	ENST00000336686.4	37	c.1860	CCDS2664.1	3																																																																																			LRRFIP2	-	pfam_Leu-rich_rep_flightless-int_pr,superfamily_Prefoldin	ENSG00000093167		0.512	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	LRRFIP2	HGNC	protein_coding	OTTHUMT00000253335.3		0.00	32	0	G	NM_006309		37100291	-1			no_errors	ENST00000336686	ensembl	human	known	74_37	silent	9.09	40	4	SNP	1.000	T
LTBP1	4052	genome.wustl.edu	37	2	33622241	33622241	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:33622241G>A	ENST00000404816.2	+	33	5229	c.4876G>A	c.(4876-4878)Ggc>Agc	p.G1626S	LTBP1_ENST00000390003.4_Missense_Mutation_p.G1301S|LTBP1_ENST00000402934.1_Missense_Mutation_p.G1245S|LTBP1_ENST00000418533.2_Missense_Mutation_p.G1258S|LTBP1_ENST00000272273.5_Missense_Mutation_p.G524S|LTBP1_ENST00000407925.1_Missense_Mutation_p.G1300S|LTBP1_ENST00000354476.3_Missense_Mutation_p.G1627S|LTBP1_ENST00000404525.1_Missense_Mutation_p.G1247S			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	1626	EGF-like 17. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TGAGGAATGCGGCATCCTCAA	0.453																																																	0													166.0	152.0	157.0					2																	33622241		2203	4300	6503	SO:0001583	missense	0				CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.4876G>A	2.37:g.33622241G>A	ENSP00000386043:p.Gly1626Ser		A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.G1627S	ENST00000404816.2	37	c.4879	CCDS33177.2	2	.	.	.	.	.	.	.	.	.	.	G	35	5.573938	0.96553	.	.	ENSG00000049323	ENST00000404816;ENST00000354476;ENST00000390003;ENST00000418533;ENST00000402934;ENST00000404525;ENST00000407925;ENST00000272273	D;D;D;D;D;D;D;D	0.86562	-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14;-2.14	5.49	5.49	0.81192	Matrix fibril-associated (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.91240	0.7239	L	0.41492	1.28	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0;1.0;1.0	D	0.91246	0.5025	9	0.56958	D	0.05	.	19.7433	0.96241	0.0:0.0:1.0:0.0	.	524;1626;1258;1247;1300;1301;1627	E7EUU6;Q14766;E7EV71;Q14766-3;Q14766-2;Q14766-5;Q14766-4	.;LTBP1_HUMAN;.;.;.;.;.	S	1626;1627;1301;1258;1245;1247;1300;524	ENSP00000386043:G1626S;ENSP00000346467:G1627S;ENSP00000374653:G1301S;ENSP00000393057:G1258S;ENSP00000384373:G1245S;ENSP00000385359:G1247S;ENSP00000384091:G1300S;ENSP00000272273:G524S	ENSP00000272273:G524S	G	+	1	0	LTBP1	33475745	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.813000	0.99286	2.733000	0.93635	0.655000	0.94253	GGC	LTBP1	-	superfamily_TB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom	ENSG00000049323		0.453	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	LTBP1	HGNC	protein_coding	OTTHUMT00000326227.2	-	0.00	68	0	G	NM_206943		33622241	+1	tier1	-	no_errors	ENST00000354476	ensembl	human	known	74_37	missense	33.66	67	34	SNP	1.000	A
MACF1	23499	genome.wustl.edu	37	1	39734616	39734617	+	Intron	INS	-	-	C	rs551385795		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:39734616_39734617insC	ENST00000372915.3	+	5	630				MACF1_ENST00000564288.1_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000536367.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1						ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGTAGAGCATACCCCCCCAGAT	0.52																																																	0																																										SO:0001627	intron_variant	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.543+10916->C	1.37:g.39734623_39734623dupC			B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Frame_Shift_Ins	INS	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain	p.D86fs	ENST00000372915.3	37	c.247_248		1																																																																																			MACF1	-	NULL	ENSG00000127603		0.520	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1		0.00	30	0	-	NM_033044		39734617	+1	tier1		no_errors	ENST00000496804	ensembl	human	known	74_37	frame_shift_ins	13.64	57	9	INS	0.002:0.001	C
MAF1	84232	genome.wustl.edu	37	8	145160670	145160670	+	Splice_Site	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:145160670G>A	ENST00000322428.5	+	2	487		c.e2+1		MAF1_ENST00000534585.1_Splice_Site|SHARPIN_ENST00000533948.1_5'Flank|MAF1_ENST00000532522.1_Splice_Site|KIAA1875_ENST00000323662.8_5'Flank|SHARPIN_ENST00000398712.2_5'Flank	NM_032272.4	NP_115648.2	Q9H063	MAF1_HUMAN	MAF1 homolog (S. cerevisiae)						negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|transcription, DNA-templated (GO:0006351)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)			central_nervous_system(1)|lung(8)|urinary_tract(1)	10	all_cancers(97;2.87e-11)|all_epithelial(106;2.16e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.1e-42)|Epithelial(56;1.23e-40)|all cancers(56;4.84e-36)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TCATTGGCAGGTGAGGCAGGC	0.562																																																	0													66.0	64.0	65.0					8																	145160670		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS6416.1	8q24.3	2012-10-29			ENSG00000179632	ENSG00000179632			24966	protein-coding gene	gene with protein product		610210				11230166, 11438659	Standard	NM_032272		Approved	DKFZp586G1123	uc003zbc.1	Q9H063	OTTHUMG00000165244	ENST00000322428.5:c.83+1G>A	8.37:g.145160670G>A			D3DWL4	Splice_Site	SNP	-	e1+1	ENST00000322428.5	37	c.83+1	CCDS6416.1	8	.	.	.	.	.	.	.	.	.	.	G	13.30	2.195121	0.38806	.	.	ENSG00000179632	ENST00000322428;ENST00000534585;ENST00000532522;ENST00000527572;ENST00000527058	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6671	0.62403	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAF1	145232658	1.000000	0.71417	1.000000	0.80357	0.302000	0.27658	4.285000	0.58989	2.285000	0.76669	0.462000	0.41574	.	MAF1	-	-	ENSG00000179632		0.562	MAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAF1	HGNC	protein_coding	OTTHUMT00000382910.1	-	0.00	22	0	G	NM_032272	Intron	145160670	+1	tier1	-	no_errors	ENST00000322428	ensembl	human	known	74_37	splice_site	29.63	37	16	SNP	1.000	A
MAGEB5	347541	genome.wustl.edu	37	X	26235715	26235715	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:26235715A>C	ENST00000602297.1	+	2	544	c.297A>C	c.(295-297)gaA>gaC	p.E99D	MAGEB5_ENST00000379029.2_Missense_Mutation_p.E99D	NM_001271752.1	NP_001258681.1	Q9BZ81	MAGB5_HUMAN	melanoma antigen family B, 5	99	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									lung(1)|ovary(1)	2						ACTTGAAGGAAGTCAACCCAA	0.448																																																	0																																										SO:0001583	missense	0			AF333705	CCDS65233.1	Xp22	2012-04-20			ENSG00000188408	ENSG00000188408			23795	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 3"""	300466				10861452	Standard	NM_001271752		Approved	MAGE-B5, CT3.3	uc031thc.1	Q9BZ81	OTTHUMG00000021288	ENST00000602297.1:c.297A>C	X.37:g.26235715A>C	ENSP00000473493:p.Glu99Asp			Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.E99D	ENST00000602297.1	37	c.297		X	.	.	.	.	.	.	.	.	.	.	A	13.82	2.351179	0.41700	.	.	ENSG00000188408	ENST00000379029	T	0.08720	3.06	4.06	0.349	0.16032	.	0.000000	0.85682	U	0.000000	T	0.20659	0.0497	M	0.92268	3.29	0.09310	N	1	.	.	.	.	.	.	T	0.12400	-1.0549	8	0.72032	D	0.01	.	2.3973	0.04393	0.55:0.0:0.2383:0.2117	.	.	.	.	D	99	ENSP00000368315:E99D	ENSP00000368315:E99D	E	+	3	2	MAGEB5	26145636	0.535000	0.26370	0.001000	0.08648	0.000000	0.00434	1.177000	0.31969	-0.045000	0.13468	-1.438000	0.01074	GAA	MAGEB5	-	pfam_MAGE,pfscan_MAGE	ENSG00000188408		0.448	MAGEB5-001	KNOWN	basic|appris_principal	protein_coding	MAGEB5	HGNC	protein_coding	OTTHUMT00000056126.2	-	0.00	28	0	A	XM_293407		26235715	+1	tier1	-	no_errors	ENST00000379029	ensembl	human	known	74_37	missense	35.90	25	14	SNP	0.001	C
MAGED1	9500	genome.wustl.edu	37	X	51644982	51644982	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:51644982T>G	ENST00000375722.1	+	12	2545	c.2293T>G	c.(2293-2295)Ttc>Gtc	p.F765V	MAGED1_ENST00000326587.7_Missense_Mutation_p.F765V|MAGED1_ENST00000375772.3_Missense_Mutation_p.F765V|MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000375695.2_Missense_Mutation_p.F821V			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	765					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					CAGTGCCAACTTCGCTGCCAA	0.517										Multiple Myeloma(10;0.10)																																							0													86.0	74.0	78.0					X																	51644982		2203	4300	6503	SO:0001583	missense	0			AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.2293T>G	X.37:g.51644982T>G	ENSP00000364874:p.Phe765Val		Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.F821V	ENST00000375722.1	37	c.2461	CCDS14337.1	X	.	.	.	.	.	.	.	.	.	.	T	7.872	0.728291	0.15507	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	T;T;T;T	0.05199	3.58;3.58;3.58;3.48	3.72	3.72	0.42706	.	0.000000	0.45867	D	0.000326	T	0.06690	0.0171	N	0.08118	0	0.35941	D	0.833228	D;D	0.61080	0.989;0.967	D;P	0.70487	0.969;0.879	T	0.36890	-0.9729	10	0.06365	T	0.9	.	7.982	0.30190	0.0:0.0:0.0:1.0	.	821;765	Q9Y5V3-2;Q9Y5V3	.;MAGD1_HUMAN	V	765;765;765;821	ENSP00000364927:F765V;ENSP00000364874:F765V;ENSP00000325333:F765V;ENSP00000364847:F821V	ENSP00000325333:F765V	F	+	1	0	MAGED1	51661722	1.000000	0.71417	0.998000	0.56505	0.325000	0.28411	2.854000	0.48325	1.700000	0.51204	0.430000	0.28490	TTC	MAGED1	-	NULL	ENSG00000179222		0.517	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	HGNC	protein_coding	OTTHUMT00000056593.1	-	0.00	24	0	T	NM_001005332		51644982	+1	tier1	-	no_errors	ENST00000375695	ensembl	human	known	74_37	missense	25.00	36	12	SNP	0.998	G
MAN2B2	23324	genome.wustl.edu	37	4	6596426	6596426	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:6596426C>T	ENST00000285599.3	+	7	1060	c.1024C>T	c.(1024-1026)Cgc>Tgc	p.R342C	MAN2B2_ENST00000504248.1_Missense_Mutation_p.R291C	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	342					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						CTGGCGTGTCCGCGACCACCA	0.617																																																	0													89.0	69.0	76.0					4																	6596426		2203	4300	6503	SO:0001583	missense	0			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.1024C>T	4.37:g.6596426C>T	ENSP00000285599:p.Arg342Cys		Q66MP2|Q86T67	Missense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.R342C	ENST00000285599.3	37	c.1024	CCDS33951.1	4	.	.	.	.	.	.	.	.	.	.	C	12.93	2.086804	0.36855	.	.	ENSG00000013288	ENST00000285599;ENST00000504248	T;T	0.74947	-0.89;-0.89	4.43	3.59	0.41128	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.494387	0.18823	N	0.130186	D	0.84547	0.5496	M	0.86178	2.8	0.09310	N	0.999991	D;D;D	0.89917	1.0;0.999;0.999	D;D;P	0.74674	0.984;0.943;0.785	T	0.74432	-0.3667	10	0.87932	D	0	-3.4131	6.5413	0.22382	0.2974:0.6134:0.0:0.0892	.	291;342;342	E9PCD7;Q9Y2E5;Q9Y2E5-2	.;MA2B2_HUMAN;.	C	342;291	ENSP00000285599:R342C;ENSP00000423129:R291C	ENSP00000285599:R342C	R	+	1	0	MAN2B2	6647327	0.000000	0.05858	0.002000	0.10522	0.449000	0.32228	0.810000	0.27183	0.859000	0.35456	0.472000	0.43445	CGC	MAN2B2	-	pfam_Glyco_hydro_38_N,superfamily_Glyco_hydro/deAcase_b/a-brl	ENSG00000013288		0.617	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2B2	HGNC	protein_coding	OTTHUMT00000359106.2	-	0.00	55	0	C	NM_015274		6596426	+1	tier1	-	no_errors	ENST00000285599	ensembl	human	known	74_37	missense	14.89	40	7	SNP	0.002	T
MBTPS2	51360	genome.wustl.edu	37	X	21869646	21869646	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:21869646C>T	ENST00000379484.5	+	4	557	c.458C>T	c.(457-459)cCc>cTc	p.P153L	MBTPS2_ENST00000465888.1_3'UTR|MBTPS2_ENST00000365779.2_Missense_Mutation_p.P153L	NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	153					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						ATAAATTTACCCGTCAATCAA	0.423																																																	0													196.0	173.0	181.0					X																	21869646		2203	4300	6503	SO:0001583	missense	0			AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.458C>T	X.37:g.21869646C>T	ENSP00000368798:p.Pro153Leu		Q9UM70|Q9UMD3	Missense_Mutation	SNP	pfam_Peptidase_M50,superfamily_PDZ,prints_MBTPS2	p.P153L	ENST00000379484.5	37	c.458	CCDS14201.1	X	.	.	.	.	.	.	.	.	.	.	C	26.2	4.710628	0.89112	.	.	ENSG00000012174	ENST00000379484;ENST00000365779	D;D	0.95554	-3.74;-2.53	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.97701	0.9246	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.988;0.984	D	0.98287	1.0511	10	0.62326	D	0.03	-22.5594	17.8193	0.88645	0.0:1.0:0.0:0.0	.	153;153;153	A8KA68;O43462;B9ZVQ3	.;MBTP2_HUMAN;.	L	153	ENSP00000368798:P153L;ENSP00000368796:P153L	ENSP00000368796:P153L	P	+	2	0	MBTPS2	21779567	1.000000	0.71417	0.968000	0.41197	0.992000	0.81027	7.138000	0.77305	2.396000	0.81511	0.513000	0.50165	CCC	MBTPS2	-	prints_MBTPS2	ENSG00000012174		0.423	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS2	HGNC	protein_coding	OTTHUMT00000056026.1	-	0.00	40	0	C			21869646	+1	tier1	-	no_errors	ENST00000379484	ensembl	human	known	74_37	missense	30.56	50	22	SNP	1.000	T
MERTK	10461	genome.wustl.edu	37	2	112722829	112722829	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:112722829C>T	ENST00000295408.4	+	5	1076	c.819C>T	c.(817-819)tcC>tcT	p.S273S	MERTK_ENST00000409780.1_Silent_p.S97S|MERTK_ENST00000421804.2_Silent_p.S273S			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	273	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						TGACCGTGTCCAAGGGAGTGC	0.557																																																	0													125.0	98.0	107.0					2																	112722829		2203	4300	6503	SO:0001819	synonymous_variant	0			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.819C>T	2.37:g.112722829C>T			Q9HBB4	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Rhodanese-like_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S273	ENST00000295408.4	37	c.819	CCDS2094.1	2																																																																																			MERTK	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000153208		0.557	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MERTK	HGNC	protein_coding	OTTHUMT00000254046.2	-	0.00	41	0	C			112722829	+1	tier1	-	no_errors	ENST00000295408	ensembl	human	known	74_37	silent	45.07	39	32	SNP	1.000	T
MGAT5	4249	genome.wustl.edu	37	2	135199370	135199370	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:135199370C>T	ENST00000409645.1	+	16	2163	c.1911C>T	c.(1909-1911)gcC>gcT	p.A637A	MGAT5_ENST00000281923.2_Silent_p.A637A			Q09328	MGT5A_HUMAN	mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase	637					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase activity (GO:0030144)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|pancreas(1)|skin(3)	36				BRCA - Breast invasive adenocarcinoma(221;0.0964)		CCCTCAGCGCCCTACAGGTCA	0.592																																																	0													80.0	76.0	77.0					2																	135199370		2203	4300	6503	SO:0001819	synonymous_variant	0			D17716	CCDS2171.1	2q21	2013-02-25			ENSG00000152127	ENSG00000152127	2.4.1.155	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7049	protein-coding gene	gene with protein product		601774				8292036	Standard	NM_002410		Approved	GNT-V	uc002ttw.4	Q09328	OTTHUMG00000131681	ENST00000409645.1:c.1911C>T	2.37:g.135199370C>T			D3DP70	Silent	SNP	NULL	p.A637	ENST00000409645.1	37	c.1911	CCDS2171.1	2																																																																																			MGAT5	-	NULL	ENSG00000152127		0.592	MGAT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT5	HGNC	protein_coding	OTTHUMT00000254584.3	-	0.00	47	0	C	NM_002410		135199370	+1	tier1	-	no_errors	ENST00000281923	ensembl	human	known	74_37	silent	23.88	51	16	SNP	1.000	T
MIR129-2	406918	genome.wustl.edu	37	11	43603026	43603026	+	RNA	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:43603026G>A	ENST00000362207.1	+	0	83					NR_029697.1				microRNA 129-2																		AAGCATTTGCGGAGGGCGCAC	0.592																																																	0													30.0	31.0	31.0					11																	43603026		1567	3580	5147			0					11p11.2	2011-09-12		2008-12-18	ENSG00000199077	ENSG00000199077		"""ncRNAs / Micro RNAs"""	31513	non-coding RNA	RNA, micro				MIRN129-2			Standard	NR_029697		Approved	hsa-mir-129-2	uc001mxo.1				11.37:g.43603026G>A				RNA	SNP	-	NULL	ENST00000362207.1	37	NULL		11																																																																																			MIR129-2	-	-	ENSG00000199077		0.592	MIR129-2-201	KNOWN	basic	miRNA	MIR129-2	HGNC	miRNA		-	0.00	15	0	G	NR_029697		43603026	+1	tier1	-	no_errors	ENST00000362207	ensembl	human	known	74_37	rna	23.08	30	9	SNP	1.000	A
MIR487A	619555	genome.wustl.edu	37	14	101521822	101521823	+	RNA	DEL	TT	TT	-			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	TT	TT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr14:101521822_101521823delTT	ENST00000384827.1	+	0	80				MIR382_ENST00000385009.2_RNA|MIR485_ENST00000385292.2_RNA|MIR134_ENST00000385258.2_RNA|MIR323B_ENST00000385269.2_RNA	NR_030162.1				microRNA 487a																		CTCTCCTCTCTTTTAGTGTCAA	0.51																																																	0																																												0					14q32.31	2011-09-12	2006-02-23	2008-12-18	ENSG00000207558	ENSG00000207558		"""ncRNAs / Micro RNAs"""	32343	non-coding RNA	RNA, micro			"""microRNA 487"""	MIRN487, MIRN487A			Standard	NR_030162		Approved	hsa-mir-487, hsa-mir-487a	uc021sdk.1				14.37:g.101521824_101521825delTT				RNA	DEL	-	NULL	ENST00000384827.1	37	NULL		14																																																																																			MIR485	-	-	ENSG00000208027		0.510	MIR487A-201	KNOWN	basic	miRNA	MIR485	HGNC	miRNA			0.00	26	0	TT	NR_030162		101521823	+1	tier1		no_errors	ENST00000385292	ensembl	human	known	74_37	rna	19.05	34	8	DEL	1.000:1.000	-
MROH8	140699	genome.wustl.edu	37	20	35769704	35769704	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr20:35769704A>C	ENST00000400441.3	-	12	1348	c.1349T>G	c.(1348-1350)tTt>tGt	p.F450C	MROH8_ENST00000217333.8_Intron|MROH8_ENST00000441008.2_Missense_Mutation_p.F436C			Q9H579	MROH8_HUMAN	maestro heat-like repeat family member 8	335																	TGAATCAAGAAAACCTTCAAA	0.388																																																	0													59.0	52.0	54.0					20																	35769704		1848	4090	5938	SO:0001583	missense	0			AL136172		20q11.22	2012-12-19	2012-12-19	2012-12-19	ENSG00000101353	ENSG00000101353		"""maestro heat-like repeat containing"""	16125	protein-coding gene	gene with protein product	"""hypothetical protein LOC140699"""		"""chromosome 20 open reading frame 131"", ""chromosome 20 open reading frame 132"""	C20orf131, C20orf132		11780052, 15635413	Standard	NM_152503		Approved	dJ621N11.4, dJ621N11.3	uc010zvu.2	Q9H579	OTTHUMG00000032407	ENST00000400441.3:c.1349T>G	20.37:g.35769704A>C	ENSP00000383291:p.Phe450Cys		Q5JYQ6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.F450C	ENST00000400441.3	37	c.1349		20	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	15.36|15.36|15.36	2.811433|2.811433|2.811433	0.50527|0.50527|0.50527	.|.|.	.|.|.	ENSG00000101353|ENSG00000101353|ENSG00000101353	ENST00000441008;ENST00000400441|ENST00000421643|ENST00000343811;ENST00000400440	T;T|.|T;T	0.04970|.|0.04654	3.52;3.52|.|3.58;3.58	6.01|6.01|6.01	6.01|6.01|6.01	0.97437|0.97437|0.97437	.|.|.	0.091745|0.091745|0.091745	0.48767|0.48767|0.48767	D|N|D	0.000173|0.000173|0.000173	T|T|T	0.11922|0.11922|0.11922	0.0290|0.0290|0.0290	M|M|M	0.66939|0.66939|0.66939	2.045|2.045|2.045	0.39327|0.39327|0.39327	D|D|D	0.965357|0.965357|0.965357	D;D;D|.|.	0.89917|.|.	0.999;1.0;1.0|.|.	D;D;D|.|.	0.70935|.|.	0.946;0.971;0.971|.|.	T|T|T	0.22173|0.22173|0.22173	-1.0224|-1.0224|-1.0224	10|6|8	0.38643|.|0.15952	T|.|T	0.18|.|0.53	-12.6004|-12.6004|-12.6004	12.9124|12.9124|12.9124	0.58187|0.58187|0.58187	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	450;335;460|.|.	E7ETR9;Q9H579;Q6PF12|.|.	.;CT132_HUMAN;.|.|.	C|L|V	436;450|451|477;481	ENSP00000392144:F436C;ENSP00000383291:F450C|.|ENSP00000339971:F477V;ENSP00000383290:F481V	ENSP00000383291:F450C|.|ENSP00000339971:F477V	F|F|F	-|-|-	2|3|1	0|2|0	C20orf132|C20orf132|C20orf132	35203118|35203118|35203118	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.996000|0.996000|0.996000	0.52242|0.52242|0.52242	0.530000|0.530000|0.530000	0.34684|0.34684|0.34684	4.149000|4.149000|4.149000	0.58091|0.58091|0.58091	2.299000|2.299000|2.299000	0.77371|0.77371|0.77371	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	TTT|TTT|TTC	MROH8	-	superfamily_ARM-type_fold	ENSG00000101353		0.388	MROH8-202	KNOWN	basic|appris_principal	protein_coding	MROH8	HGNC	protein_coding		-	0.00	23	0	A	NM_152503		35769704	-1	tier1	-	no_errors	ENST00000400441	ensembl	human	known	74_37	missense	13.73	44	7	SNP	1.000	C
MTCH1	23787	genome.wustl.edu	37	6	36938449	36938449	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:36938449G>A	ENST00000373627.5	-	9	1052	c.928C>T	c.(928-930)Cgg>Tgg	p.R310W	MTCH1_ENST00000538808.1_Missense_Mutation_p.R137W|MTCH1_ENST00000471737.1_5'UTR|MTCH1_ENST00000373616.5_Missense_Mutation_p.R293W	NM_001271641.1	NP_001258570.1	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier 1	310					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|neuronal ion channel clustering (GO:0045161)|positive regulation of apoptotic process (GO:0043065)|regulation of signal transduction (GO:0009966)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	6						GTATAGCTCCGGATGGCCAGG	0.597																																																	0													101.0	69.0	80.0					6																	36938449		2203	4300	6503	SO:0001583	missense	0			AF151822	CCDS4828.1, CCDS64411.1	6p21.2	2013-05-22	2011-05-19		ENSG00000137409	ENSG00000137409		"""Solute carriers"""	17586	protein-coding gene	gene with protein product	"""solute carrier family 25, member 49"""	610449	"""mitochondrial carrier homolog 1 (C. elegans)"""			12377771	Standard	NM_014341		Approved	CGI-64, PSAP, SLC25A49	uc003ond.2	Q9NZJ7	OTTHUMG00000014614	ENST00000373627.5:c.928C>T	6.37:g.36938449G>A	ENSP00000362730:p.Arg310Trp		A8KAX5|B2RCE3|Q6PK60|Q6UX45|Q7L465|Q9BW23|Q9NZR6|Q9UJZ5	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.R310W	ENST00000373627.5	37	c.928		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.28|14.28	2.488739|2.488739	0.44249|0.44249	.|.	.|.	ENSG00000137409|ENSG00000137409	ENST00000373550|ENST00000373616;ENST00000373627;ENST00000337855;ENST00000373565;ENST00000460219;ENST00000538808	.|T;T;T;T	.|0.44482	.|0.92;0.92;0.92;0.92	5.52|5.52	3.75|3.75	0.43078|0.43078	.|Mitochondrial carrier domain (2);	.|0.174949	.|0.35179	.|N	.|0.003395	T|T	0.19208|0.19208	0.0461|0.0461	M|M	0.64567|0.64567	1.98|1.98	0.46798|0.46798	D|D	0.999208|0.999208	.|B;B;B;B	.|0.31817	.|0.135;0.341;0.317;0.025	.|B;B;B;B	.|0.19946	.|0.019;0.027;0.026;0.006	T|T	0.08534|0.08534	-1.0717|-1.0717	6|10	0.10902|0.87932	T|D	0.67|0	-9.4896|-9.4896	6.3252|6.3252	0.21239|0.21239	0.1514:0.0:0.7012:0.1474|0.1514:0.0:0.7012:0.1474	.|.	.|137;292;310;293	.|B4E0C5;Q8IW90;Q9NZJ7;Q9NZJ7-2	.|.;.;MTCH1_HUMAN;.	L|W	230|293;310;229;123;277;137	.|ENSP00000362718:R293W;ENSP00000362730:R310W;ENSP00000419739:R277W;ENSP00000437660:R137W	ENSP00000362651:P230L|ENSP00000338712:R229W	P|R	-|-	2|1	0|2	MTCH1|MTCH1	37046427|37046427	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	2.587000|2.587000	0.46128|0.46128	0.713000|0.713000	0.32060|0.32060	-0.140000|-0.140000	0.14226|0.14226	CCG|CGG	MTCH1	-	superfamily_Mt_carrier_dom	ENSG00000137409		0.597	MTCH1-008	KNOWN	basic|appris_principal	protein_coding	MTCH1	HGNC	protein_coding	OTTHUMT00000040396.1		0.00	20	0	G	NM_014341		36938449	-1			no_errors	ENST00000373627	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	A
MTMR3	8897	genome.wustl.edu	37	22	30416172	30416172	+	Missense_Mutation	SNP	G	G	A	rs199966820	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr22:30416172G>A	ENST00000401950.2	+	17	2866	c.2524G>A	c.(2524-2526)Gtg>Atg	p.V842M	CTA-85E5.10_ENST00000453743.2_RNA|MTMR3_ENST00000323630.5_Missense_Mutation_p.V706M|MTMR3_ENST00000406629.1_Missense_Mutation_p.V842M|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000333027.3_Missense_Mutation_p.V842M|MTMR3_ENST00000351488.3_Missense_Mutation_p.V842M	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	842					peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			AGGACCAAACGTGGACAGTTC	0.463													g|||	2	0.000399361	0.0015	0.0	5008	,	,		21993	0.0		0.0	False		,,,				2504	0.0																0								A	MET/VAL,MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	101.0	92.0	95.0		2524,2524,2524	-6.2	0.0	22		95	2,8598	2.2+/-6.3	0,2,4298	yes	missense,missense,missense	MTMR3	NM_021090.3,NM_153050.2,NM_153051.2	21,21,21	0,3,6500	AA,AG,GG		0.0233,0.0227,0.0231	benign,benign,benign	842/1199,842/1171,842/1162	30416172	3,13003	2203	4300	6503	SO:0001583	missense	0			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.2524G>A	22.37:g.30416172G>A	ENSP00000384651:p.Val842Met		A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Tyr_Pase_cat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.V842M	ENST00000401950.2	37	c.2524	CCDS13870.1	22	.	.	.	.	.	.	.	.	.	.	g	2.170	-0.390142	0.04932	2.27E-4	2.33E-4	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000323630;ENST00000351488;ENST00000406629	D;D;D;D;D	0.93712	-3.08;-3.06;-3.27;-3.11;-3.06	5.4	-6.24	0.02046	.	5.573390	0.00166	N	0.000000	T	0.80939	0.4720	N	0.03608	-0.345	0.09310	N	1	B;B;B	0.18610	0.029;0.017;0.029	B;B;B	0.13407	0.009;0.004;0.009	T	0.74671	-0.3587	10	0.27785	T	0.31	.	5.0614	0.14559	0.5786:0.0966:0.2347:0.0902	.	842;842;842	Q13615-3;Q13615;Q13615-2	.;MTMR3_HUMAN;.	M	842;842;706;842;842	ENSP00000384651:V842M;ENSP00000331649:V842M;ENSP00000318070:V706M;ENSP00000307271:V842M;ENSP00000384077:V842M	ENSP00000318070:V706M	V	+	1	0	MTMR3	28746172	0.000000	0.05858	0.000000	0.03702	0.213000	0.24496	-0.034000	0.12225	-1.447000	0.01943	-0.954000	0.02651	GTG	MTMR3	-	NULL	ENSG00000100330		0.463	MTMR3-001	KNOWN	basic|CCDS	protein_coding	MTMR3	HGNC	protein_coding	OTTHUMT00000322066.1	-	0.00	54	0	G	NM_021090		30416172	+1	tier1	rs199966820	no_errors	ENST00000401950	ensembl	human	known	74_37	missense	18.18	63	14	SNP	0.000	A
MUC19	283463	genome.wustl.edu	37	12	40840291	40840291	+	Splice_Site	SNP	T	T	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:40840291T>A	ENST00000454784.4	+	31	3718	c.2985T>A	c.(2983-2985)ggT>ggA	p.G995G	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	995	Approximate repeats of G-V-T-G-T-T-G-P-S- A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						TACACACAGGTTGTTATGCTA	0.338																																																	0																																										SO:0001630	splice_region_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.2984-1T>A	12.37:g.40840291T>A			Q8NA85	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich	p.G995	ENST00000454784.4	37	c.2985		12																																																																																			MUC19	-	superfamily_TIL_dom	ENSG00000205592		0.338	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	-	0.00	36	0	T	XM_003403524	Silent	40840291	+1	tier1	-	no_errors	ENST00000454784	ensembl	human	novel	74_37	silent	60.00	16	24	SNP	0.997	A
MUC19	283463	genome.wustl.edu	37	12	40921494	40921494	+	3'UTR	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:40921494T>C	ENST00000474954.1	+	0	2772				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CAGTATTTTCTTTCTTATGTC	0.408																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*2769T>C	12.37:g.40921494T>C			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.408	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	19	0	T	XM_003403524		40921494	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	47.73	23	21	SNP	0.000	C
MUC4	4585	genome.wustl.edu	37	3	195509509	195509509	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:195509509T>A	ENST00000463781.3	-	2	9401	c.8942A>T	c.(8941-8943)gAc>gTc	p.D2981V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.D2981V|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGAAGTGTCGGTGTCAGG	0.582																																																	0													19.0	11.0	13.0					3																	195509509		653	1556	2209	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.8942A>T	3.37:g.195509509T>A	ENSP00000417498:p.Asp2981Val		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.D2981V	ENST00000463781.3	37	c.8942	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	N	4.181	0.032171	0.08101	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.33438	1.42;1.41	.	.	.	.	.	.	.	.	T	0.14485	0.0350	N	0.19112	0.55	0.09310	N	1	B	0.19200	0.034	B	0.14023	0.01	T	0.28170	-1.0052	7	.	.	.	.	2.737	0.05243	0.0:0.2482:0.2624:0.4894	.	2853	E7ESK3	.	V	2981	ENSP00000417498:D2981V;ENSP00000420243:D2981V	.	D	-	2	0	MUC4	196994288	.	.	0.004000	0.12327	0.000000	0.00434	.	.	-0.437000	0.07243	0.000000	0.15137	GAC	MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	178	0	T	NM_018406		195509509	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	6.87	215	16	SNP	0.000	A
MYB	4602	genome.wustl.edu	37	6	135539052	135539052	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:135539052G>C	ENST00000367814.4	+	15	2043	c.1857G>C	c.(1855-1857)caG>caC	p.Q619H	MYB_ENST00000531845.1_3'UTR|MYB_ENST00000525369.1_Missense_Mutation_p.Q534H|MYB_ENST00000341911.5_Missense_Mutation_p.Q740H|MYB_ENST00000442647.2_Missense_Mutation_p.Q616H|MYB_ENST00000533624.1_Missense_Mutation_p.Q584H|MYB_ENST00000534044.1_Missense_Mutation_p.Q582H|MYB_ENST00000534121.1_Missense_Mutation_p.Q724H|MYB_ENST00000528774.1_Missense_Mutation_p.Q737H|MYB_ENST00000316528.8_Missense_Mutation_p.Q705H	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog	619					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		TGGAGGAGCAGATGACATCTT	0.483			T	NFIB	adenoid cystic carcinoma																																			Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0													191.0	164.0	173.0					6																	135539052		2203	4300	6503	SO:0001583	missense	0				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.1857G>C	6.37:g.135539052G>C	ENSP00000356788:p.Gln619His		E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	Missense_Mutation	SNP	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.Q740H	ENST00000367814.4	37	c.2220	CCDS5174.1	6	.	.	.	.	.	.	.	.	.	.	G	11.08	1.534432	0.27475	.	.	ENSG00000118513	ENST00000341911;ENST00000442647;ENST00000316528;ENST00000367814;ENST00000525369;ENST00000528774;ENST00000534121;ENST00000534044;ENST00000533624	T;T;T;T;T;T;T;T;T	0.46451	1.85;1.19;1.82;1.19;0.87;1.85;1.83;1.63;1.25	5.65	3.55	0.40652	.	0.055623	0.85682	D	0.000000	T	0.47619	0.1455	M	0.66297	2.02	0.26434	N	0.975884	D;D;D;D;D;D;D;D	0.89917	0.998;0.999;0.998;0.998;0.99;1.0;0.999;0.997	D;D;D;D;D;D;D;P	0.87578	0.993;0.993;0.994;0.993;0.979;0.998;0.997;0.85	T	0.36163	-0.9759	10	0.87932	D	0	-10.5835	10.7032	0.45939	0.2267:0.0:0.7733:0.0	.	584;582;616;737;534;724;740;619	E9PI07;E9PLZ5;P10242-2;E9PNL6;E9PRS2;E9PNA4;P10242-4;P10242	.;.;.;.;.;.;.;MYB_HUMAN	H	740;616;705;619;534;737;724;582;584	ENSP00000339992:Q740H;ENSP00000410825:Q616H;ENSP00000326328:Q705H;ENSP00000356788:Q619H;ENSP00000435938:Q534H;ENSP00000434723:Q737H;ENSP00000432851:Q724H;ENSP00000435055:Q582H;ENSP00000436605:Q584H	ENSP00000326328:Q705H	Q	+	3	2	MYB	135580745	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.260000	0.43267	1.386000	0.46466	0.655000	0.94253	CAG	MYB	-	NULL	ENSG00000118513		0.483	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	-	0.00	58	0	G			135539052	+1	tier1	-	no_errors	ENST00000341911	ensembl	human	known	74_37	missense	89.08	55	457	SNP	1.000	C
MYB	4602	genome.wustl.edu	37	6	135539249	135539249	+	3'UTR	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:135539249G>A	ENST00000367814.4	+	0	2240				MYB_ENST00000531845.1_3'UTR|MYB_ENST00000525369.1_3'UTR|MYB_ENST00000341911.5_3'UTR|MYB_ENST00000442647.2_3'UTR|MYB_ENST00000316528.8_3'UTR	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog						B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		GTTGAGAGCAGCACCAAGTGC	0.333			T	NFIB	adenoid cystic carcinoma																																			Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.*131G>A	6.37:g.135539249G>A			E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	RNA	SNP	-	NULL	ENST00000367814.4	37	NULL	CCDS5174.1	6																																																																																			MYB	-	-	ENSG00000118513		0.333	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	-	0.00	31	0	G			135539249	+1	tier1	-	no_errors	ENST00000531845	ensembl	human	known	74_37	rna	87.77	50	366	SNP	1.000	A
MYB	4602	genome.wustl.edu	37	6	135539839	135539839	+	3'UTR	SNP	G	G	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:135539839G>C	ENST00000367814.4	+	0	2830				MYB_ENST00000531845.1_3'UTR|MYB_ENST00000525369.1_3'UTR|MYB_ENST00000341911.5_3'UTR|MYB_ENST00000442647.2_3'UTR|MYB_ENST00000316528.8_3'UTR	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog						B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		TGGACAGAAAGAAAAGAAACT	0.323			T	NFIB	adenoid cystic carcinoma																																			Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.*721G>C	6.37:g.135539839G>C			E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	RNA	SNP	-	NULL	ENST00000367814.4	37	NULL	CCDS5174.1	6																																																																																			MYB	-	-	ENSG00000118513		0.323	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	-	0.00	14	0	G			135539839	+1	tier1	-	no_errors	ENST00000531845	ensembl	human	known	74_37	rna	81.54	24	106	SNP	0.737	C
MYB	4602	genome.wustl.edu	37	6	135540214	135540214	+	3'UTR	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:135540214G>A	ENST00000367814.4	+	0	3205				MYB_ENST00000531845.1_3'UTR|MYB_ENST00000525369.1_3'UTR|MYB_ENST00000341911.5_3'UTR|MYB_ENST00000442647.2_3'UTR|MYB_ENST00000316528.8_3'UTR	NM_001161659.1|NM_005375.2	NP_001155131.1|NP_005366.2	P10242	MYB_HUMAN	v-myb avian myeloblastosis viral oncogene homolog						B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|chromatin remodeling (GO:0006338)|embryonic digestive tract development (GO:0048566)|G1/S transition of mitotic cell cycle (GO:0000082)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of T-helper cell differentiation (GO:0045624)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|thymus development (GO:0048538)	nuclear matrix (GO:0016363)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(4)|endometrium(1)|kidney(2)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		ACTGCCTTAAGAACATTTGAT	0.428			T	NFIB	adenoid cystic carcinoma																																			Dom	yes		6	6q22-23	4602	v-myb myeloblastosis viral oncogene homolog		E	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS5174.1, CCDS47481.1, CCDS47482.1, CCDS55058.1, CCDS55059.1, CCDS55060.1, CCDS55061.1, CCDS55062.1	6q22-q23	2013-07-09	2013-07-09		ENSG00000118513	ENSG00000118513			7545	protein-coding gene	gene with protein product		189990				17599807	Standard	NM_001130172		Approved	c-myb	uc003qfh.3	P10242	OTTHUMG00000015629	ENST00000367814.4:c.*1096G>A	6.37:g.135540214G>A			E9PI07|E9PLZ5|E9PNA4|E9PNL6|E9PRS2|P78391|P78392|P78525|P78526|Q14023|Q14024|Q708E4|Q708E7|Q9UE83	RNA	SNP	-	NULL	ENST00000367814.4	37	NULL	CCDS5174.1	6																																																																																			MYB	-	-	ENSG00000118513		0.428	MYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYB	HGNC	protein_coding	OTTHUMT00000042347.4	-	0.00	56	0	G			135540214	+1	tier1	-	no_errors	ENST00000531845	ensembl	human	known	74_37	rna	88.41	89	679	SNP	0.999	A
NBEAL2	23218	genome.wustl.edu	37	3	47040460	47040460	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:47040460G>A	ENST00000450053.3	+	24	3575	c.3396G>A	c.(3394-3396)gcG>gcA	p.A1132A	NBEAL2_ENST00000292309.5_Intron|NBEAL2_ENST00000383740.2_De_novo_Start_InFrame	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	1132					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		CGGTGGGTGCGCTGGACCTGC	0.662											OREG0015546	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													36.0	44.0	41.0					3																	47040460		2171	4249	6420	SO:0001819	synonymous_variant	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.3396G>A	3.37:g.47040460G>A		943	O60288|Q6P994|Q6UX91|Q8NAC9	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A1132	ENST00000450053.3	37	c.3396	CCDS46817.1	3																																																																																			NBEAL2	-	NULL	ENSG00000160796		0.662	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	-	0.00	84	0	G	XM_291064		47040460	+1	tier1	-	no_errors	ENST00000450053	ensembl	human	known	74_37	silent	8.33	99	9	SNP	0.000	A
NCOA3	8202	genome.wustl.edu	37	20	46279857	46279857	+	Silent	SNP	G	G	A	rs561036149	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr20:46279857G>A	ENST00000371998.3	+	20	3974	c.3783G>A	c.(3781-3783)caG>caA	p.Q1261Q	NCOA3_ENST00000341724.6_Silent_p.Q1187Q|NCOA3_ENST00000372004.3_Silent_p.Q1257Q|NCOA3_ENST00000371997.3_Silent_p.Q1252Q			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	1261	Acetyltransferase.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						agcagcagcagcagcagcaac	0.572													G|||	3	0.000599042	0.0008	0.0	5008	,	,		14246	0.0		0.0	False		,,,				2504	0.002																0													50.0	54.0	53.0					20																	46279857		2203	4300	6503	SO:0001819	synonymous_variant	0			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.3783G>A	20.37:g.46279857G>A			A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Silent	SNP	pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_SRC-1,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.Q1261	ENST00000371998.3	37	c.3783	CCDS13407.1	20																																																																																			NCOA3	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000124151		0.572	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	HGNC	protein_coding	OTTHUMT00000080405.1		0.00	62	0	G	NM_006534		46279857	+1			no_errors	ENST00000371998	ensembl	human	known	74_37	silent	9.57	104	11	SNP	0.971	A
NEDD9	4739	genome.wustl.edu	37	6	11185638	11185638	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:11185638G>T	ENST00000379446.5	-	7	2428	c.2262C>A	c.(2260-2262)caC>caA	p.H754Q	RP3-510L9.1_ENST00000500636.2_RNA|NEDD9_ENST00000504387.1_Missense_Mutation_p.H754Q	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	754	Divergent helix-loop-helix motif.				actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			ACACCAGTTTGTGTGCACTGA	0.552																																																	0													202.0	162.0	176.0					6																	11185638		2203	4300	6503	SO:0001583	missense	0			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.2262C>A	6.37:g.11185638G>T	ENSP00000368759:p.His754Gln		A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.H754Q	ENST00000379446.5	37	c.2262	CCDS4520.1	6	.	.	.	.	.	.	.	.	.	.	G	20.1	3.937561	0.73557	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	T;T	0.26223	1.75;1.75	6.11	5.24	0.73138	CAS family, DUF3513 (1);	0.000000	0.85682	D	0.000000	T	0.28333	0.0700	L	0.39514	1.22	0.80722	D	1	D;D;D	0.89917	0.99;0.996;1.0	D;D;D	0.97110	0.946;0.981;1.0	T	0.04029	-1.0983	10	0.34782	T	0.22	-40.2403	12.3856	0.55330	0.1343:0.0:0.8657:0.0	.	754;754;754	G5E9Y9;A8K9G7;Q14511	.;.;CASL_HUMAN	Q	754	ENSP00000368759:H754Q;ENSP00000422871:H754Q	ENSP00000368759:H754Q	H	-	3	2	NEDD9	11293624	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.439000	0.73430	1.602000	0.50124	0.655000	0.94253	CAC	NEDD9	-	pfam_CAS_DUF3513	ENSG00000111859		0.552	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD9	HGNC	protein_coding	OTTHUMT00000039853.2	-	0.00	57	0	G	NM_006403		11185638	-1	tier1	-	no_errors	ENST00000379446	ensembl	human	known	74_37	missense	35.14	24	13	SNP	1.000	T
NETO2	81831	genome.wustl.edu	37	16	47117434	47117434	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr16:47117434G>A	ENST00000562435.1	-	9	1660	c.1276C>T	c.(1276-1278)Cgg>Tgg	p.R426W	NETO2_ENST00000303155.5_Missense_Mutation_p.R419W	NM_018092.4	NP_060562.3	Q8NC67	NETO2_HUMAN	neuropilin (NRP) and tolloid (TLL)-like 2	426					regulation of kainate selective glutamate receptor activity (GO:2000312)	kainate selective glutamate receptor complex (GO:0032983)|postsynaptic density (GO:0014069)		p.R426W(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(8)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	29		all_cancers(37;0.00114)|all_lung(18;0.00432)|Lung NSC(13;0.0384)|Breast(268;0.174)				GAGGAGCGCCGCATCTTCTGG	0.532										HNSCC(25;0.065)																																							1	Substitution - Missense(1)	large_intestine(1)											87.0	82.0	83.0					16																	47117434		2203	4300	6503	SO:0001583	missense	0			AK001292	CCDS10727.1, CCDS58460.1	16q11.2	2008-08-04			ENSG00000171208	ENSG00000171208			14644	protein-coding gene	gene with protein product		607974				11943477	Standard	NM_018092		Approved	FLJ10430, NEOT2	uc002eer.2	Q8NC67	OTTHUMG00000133101	ENST00000562435.1:c.1276C>T	16.37:g.47117434G>A	ENSP00000455169:p.Arg426Trp		J3KNF1|Q7Z381|Q8ND51|Q96SP4|Q9NVY8	Missense_Mutation	SNP	pfam_CUB_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt	p.R426W	ENST00000562435.1	37	c.1276	CCDS10727.1	16	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565128	0.45694	.	.	ENSG00000171208	ENST00000303155	T	0.44881	0.91	5.78	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.37544	0.1007	L	0.47716	1.5	0.54753	D	0.999989	B;B;B	0.29301	0.241;0.153;0.238	B;B;B	0.25759	0.063;0.018;0.04	T	0.23190	-1.0195	10	0.54805	T	0.06	.	14.2876	0.66256	0.0:0.0:0.5757:0.4243	.	283;426;102	B7Z4I7;Q8NC67;Q8NC67-2	.;NETO2_HUMAN;.	W	426	ENSP00000306726:R426W	ENSP00000306726:R426W	R	-	1	2	NETO2	45674935	1.000000	0.71417	0.999000	0.59377	0.813000	0.45954	1.196000	0.32198	1.398000	0.46701	0.655000	0.94253	CGG	NETO2	-	NULL	ENSG00000171208		0.532	NETO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NETO2	HGNC	protein_coding	OTTHUMT00000256766.2	-	0.00	40	0	G	NM_018092		47117434	-1	tier1	-	no_errors	ENST00000562435	ensembl	human	known	74_37	missense	15.00	51	9	SNP	1.000	A
NFATC3	4775	genome.wustl.edu	37	16	68260696	68260696	+	3'UTR	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr16:68260696T>G	ENST00000346183.3	+	0	3574				NFATC3_ENST00000329524.4_3'UTR|NFATC3_ENST00000349223.5_3'UTR|RP11-96D1.11_ENST00000571197.1_RNA|RP11-96D1.10_ENST00000571975.1_RNA|NFATC3_ENST00000535127.2_3'UTR	NM_173165.2	NP_775188.1	Q12968	NFAC3_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 3						cellular respiration (GO:0045333)|cellular response to calcium ion (GO:0071277)|cellular response to lithium ion (GO:0071285)|Fc-epsilon receptor signaling pathway (GO:0038095)|heart development (GO:0007507)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	44		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0452)|all cancers(182;0.24)		ACCTGGTTACTTAGCTAGGAT	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	0			L41067	CCDS10860.1, CCDS10861.1, CCDS10862.1	16q22	2009-11-24			ENSG00000072736	ENSG00000072736		"""Nuclear factor of activated T-cells"""	7777	protein-coding gene	gene with protein product		602698				7749981	Standard	NM_004555		Approved	NFAT4, NFATX	uc002evo.2	Q12968	OTTHUMG00000137555	ENST00000346183.3:c.*322T>G	16.37:g.68260696T>G			O75211|Q14516|Q99840|Q99841|Q99842	RNA	SNP	-	NULL	ENST00000346183.3	37	NULL	CCDS10860.1	16																																																																																			NFATC3	-	-	ENSG00000072736		0.373	NFATC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NFATC3	HGNC	protein_coding	OTTHUMT00000268890.2	-	0.00	63	0	T	NM_004555		68260696	+1	tier1	-	no_errors	ENST00000535127	ensembl	human	known	74_37	rna	6.06	62	4	SNP	0.789	G
NLRP3	114548	genome.wustl.edu	37	1	247588567	247588567	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:247588567C>A	ENST00000336119.3	+	3	2568	c.1822C>A	c.(1822-1824)Ctg>Atg	p.L608M	NLRP3_ENST00000391828.3_Missense_Mutation_p.L608M|NLRP3_ENST00000366497.2_Missense_Mutation_p.L608M|NLRP3_ENST00000348069.2_Missense_Mutation_p.L608M|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391827.2_Missense_Mutation_p.L608M|NLRP3_ENST00000366496.2_Missense_Mutation_p.L608M	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	608					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CAGGCTGGAGCTGCTGAAATG	0.463																																																	0													52.0	53.0	53.0					1																	247588567		2203	4300	6503	SO:0001583	missense	0			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1822C>A	1.37:g.247588567C>A	ENSP00000337383:p.Leu608Met		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L608M	ENST00000336119.3	37	c.1822	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	C	13.70	2.316080	0.40996	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1;-2.1;-2.1	3.96	0.736	0.18307	.	0.000000	0.40469	N	0.001097	D	0.90625	0.7060	M	0.75085	2.285	0.27457	N	0.95327	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.993;0.989	D;D;D;D;D	0.87578	0.996;0.98;0.998;0.96;0.919	T	0.82468	-0.0442	10	0.72032	D	0.01	.	6.0187	0.19616	0.0:0.6173:0.0:0.3827	.	608;608;608;608;608	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	M	608	ENSP00000375704:L608M;ENSP00000355453:L608M;ENSP00000337383:L608M;ENSP00000294752:L608M;ENSP00000355452:L608M;ENSP00000375703:L608M	ENSP00000337383:L608M	L	+	1	2	NLRP3	245655190	0.001000	0.12720	0.944000	0.38274	0.893000	0.52053	-0.081000	0.11321	0.165000	0.19558	-0.140000	0.14226	CTG	NLRP3	-	NULL	ENSG00000162711		0.463	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	HGNC	protein_coding	OTTHUMT00000097740.1	-	0.00	46	0	C	NM_004895		247588567	+1	tier1	-	no_errors	ENST00000336119	ensembl	human	known	74_37	missense	25.00	48	16	SNP	0.934	A
NNMT	4837	genome.wustl.edu	37	11	114183177	114183177	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:114183177G>C	ENST00000535401.1	+	5	1037	c.773G>C	c.(772-774)aGg>aCg	p.R258T	NNMT_ENST00000545255.1_Missense_Mutation_p.R63T|NNMT_ENST00000541754.1_Missense_Mutation_p.R63T|NNMT_ENST00000542647.1_Missense_Mutation_p.R63T|NNMT_ENST00000299964.3_Missense_Mutation_p.R258T|RP11-64D24.2_ENST00000544925.1_RNA			P40261	NNMT_HUMAN	nicotinamide N-methyltransferase	258					methylation (GO:0032259)|organ regeneration (GO:0031100)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	nicotinamide N-methyltransferase activity (GO:0008112)			kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;4.83e-16)|all_epithelial(67;7.28e-09)|all_hematologic(158;0.000135)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.79e-06)|Epithelial(105;1.32e-05)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.128)	Niacin(DB00627)	CTGGTGGCGAGGAAGCTGAGC	0.478																																																	0													97.0	92.0	94.0					11																	114183177		2201	4296	6497	SO:0001583	missense	0			U08021	CCDS8368.1	11q23.1	2007-08-15					2.1.1.1		7861	protein-coding gene	gene with protein product		600008				8575745	Standard	NM_006169		Approved		uc001pos.1	P40261		ENST00000535401.1:c.773G>C	11.37:g.114183177G>C	ENSP00000441434:p.Arg258Thr			Missense_Mutation	SNP	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	p.R258T	ENST00000535401.1	37	c.773	CCDS8368.1	11	.	.	.	.	.	.	.	.	.	.	G	14.50	2.554029	0.45487	.	.	ENSG00000166741	ENST00000535401;ENST00000299964;ENST00000541754;ENST00000542647;ENST00000545255	T;T;T;T;T	0.03607	3.87;3.87;3.87;3.87;3.87	4.93	-0.227	0.13102	.	0.504438	0.19070	N	0.123536	T	0.08223	0.0205	M	0.70595	2.14	0.18873	N	0.999984	D	0.56035	0.974	P	0.51615	0.675	T	0.11792	-1.0573	10	0.51188	T	0.08	-8.6972	8.0012	0.30297	0.5422:0.0:0.4578:0.0	.	258	P40261	NNMT_HUMAN	T	258;258;63;63;63	ENSP00000441434:R258T;ENSP00000299964:R258T;ENSP00000445680:R63T;ENSP00000445994:R63T;ENSP00000445248:R63T	ENSP00000299964:R258T	R	+	2	0	NNMT	113688387	0.002000	0.14202	0.224000	0.23877	0.700000	0.40528	-0.052000	0.11865	0.147000	0.19030	0.563000	0.77884	AGG	NNMT	-	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	ENSG00000166741		0.478	NNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNMT	HGNC	protein_coding	OTTHUMT00000398951.1	-	0.00	36	0	G	NM_006169		114183177	+1	tier1	-	no_errors	ENST00000299964	ensembl	human	known	74_37	missense	42.55	27	20	SNP	0.157	C
NOL9	79707	genome.wustl.edu	37	1	6592771	6592771	+	Missense_Mutation	SNP	G	G	T	rs146362012		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:6592771G>T	ENST00000377705.5	-	8	1319	c.1287C>A	c.(1285-1287)agC>agA	p.S429R		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	429					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		GAACCACGTGGCTGGGAGACA	0.502																																																	0													108.0	96.0	100.0					1																	6592771		2203	4300	6503	SO:0001583	missense	0			AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.1287C>A	1.37:g.6592771G>T	ENSP00000366934:p.Ser429Arg		Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Missense_Mutation	SNP	pfam_Pre-mRNA_cleavage_cplxII_Clp1,superfamily_P-loop_NTPase	p.S429R	ENST00000377705.5	37	c.1287	CCDS80.1	1	.	.	.	.	.	.	.	.	.	.	G	18.03	3.533093	0.64972	.	.	ENSG00000162408	ENST00000377705	T	0.48201	0.82	5.95	1.17	0.20885	Pre-mRNA cleavage complex II Clp1 (1);	0.345449	0.31673	N	0.007259	T	0.54806	0.1881	L	0.60455	1.87	0.30420	N	0.778219	D	0.71674	0.998	D	0.70487	0.969	T	0.52094	-0.8621	10	0.54805	T	0.06	-25.2379	4.0075	0.09608	0.3764:0.169:0.4547:0.0	.	429	Q5SY16	NOL9_HUMAN	R	429	ENSP00000366934:S429R	ENSP00000366934:S429R	S	-	3	2	NOL9	6515358	0.997000	0.39634	0.995000	0.50966	0.622000	0.37654	0.407000	0.21049	0.826000	0.34661	0.491000	0.48974	AGC	NOL9	-	pfam_Pre-mRNA_cleavage_cplxII_Clp1,superfamily_P-loop_NTPase	ENSG00000162408		0.502	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL9	HGNC	protein_coding	OTTHUMT00000002625.1		0.00	42	0	G	NM_024654		6592771	-1			no_errors	ENST00000377705	ensembl	human	known	74_37	missense	6.52	43	3	SNP	0.998	T
NPY2R	4887	genome.wustl.edu	37	4	156136005	156136005	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:156136005T>G	ENST00000329476.3	+	2	1403	c.914T>G	c.(913-915)cTc>cGc	p.L305R	NPY2R_ENST00000506608.1_Missense_Mutation_p.L305R	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	305					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	GAGTACAAACTCATCTTCACA	0.527																																																	0													118.0	93.0	102.0					4																	156136005		2203	4300	6503	SO:0001583	missense	0			U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.914T>G	4.37:g.156136005T>G	ENSP00000332591:p.Leu305Arg		Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY2_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NPFF_rcpt	p.L305R	ENST00000329476.3	37	c.914	CCDS3791.1	4	.	.	.	.	.	.	.	.	.	.	T	17.86	3.492320	0.64074	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.71341	-0.56;-0.56	5.75	5.75	0.90469	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.85944	0.5815	M	0.86343	2.81	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88049	0.2786	10	0.62326	D	0.03	.	15.2333	0.73407	0.0:0.0:0.0:1.0	.	305	P49146	NPY2R_HUMAN	R	305	ENSP00000332591:L305R;ENSP00000426366:L305R	ENSP00000332591:L305R	L	+	2	0	NPY2R	156355455	1.000000	0.71417	1.000000	0.80357	0.563000	0.35712	8.040000	0.89188	2.190000	0.69967	0.523000	0.50628	CTC	NPY2R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY2_rcpt	ENSG00000185149		0.527	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY2R	HGNC	protein_coding	OTTHUMT00000365128.1	-	0.00	37	0	T	NM_000910		156136005	+1	tier1	-	no_errors	ENST00000329476	ensembl	human	known	74_37	missense	17.07	33	7	SNP	1.000	G
NRCAM	4897	genome.wustl.edu	37	7	107830095	107830095	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr7:107830095T>C	ENST00000425651.2	-	17	2028	c.2029A>G	c.(2029-2031)Att>Gtt	p.I677V	NRCAM_ENST00000379024.4_Missense_Mutation_p.I658V|NRCAM_ENST00000379028.3_Missense_Mutation_p.I677V|NRCAM_ENST00000351718.4_Missense_Mutation_p.I661V|NRCAM_ENST00000413765.2_Missense_Mutation_p.I658V|NRCAM_ENST00000379022.4_Missense_Mutation_p.I677V	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	677	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						ATACTTGTAATGGGGCTATTG	0.408																																																	0													178.0	156.0	164.0					7																	107830095		2203	4300	6503	SO:0001583	missense	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2029A>G	7.37:g.107830095T>C	ENSP00000401244:p.Ile677Val		A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.I677V	ENST00000425651.2	37	c.2029	CCDS47686.1	7	.	.	.	.	.	.	.	.	.	.	T	15.37	2.812134	0.50527	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000413765;ENST00000537765;ENST00000351718;ENST00000379024;ENST00000425651;ENST00000379022;ENST00000445979	T;T;T;T;T;T	0.60171	0.21;0.21;0.21;0.21;0.21;0.21	5.18	3.95	0.45737	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.215104	0.44688	D	0.000421	T	0.50735	0.1633	L	0.40543	1.245	0.80722	D	1	B;B;B;B;B	0.27013	0.054;0.003;0.025;0.011;0.166	B;B;B;B;B	0.35655	0.033;0.024;0.099;0.041;0.207	T	0.51601	-0.8685	10	0.40728	T	0.16	.	10.9141	0.47126	0.1404:0.0:0.0:0.8596	.	677;658;658;661;677	Q92823-5;Q92823-3;E9PDA4;Q92823-4;Q92823	.;.;.;.;NRCAM_HUMAN	V	677;677;658;677;661;658;677;677;661	ENSP00000368314:I677V;ENSP00000407858:I658V;ENSP00000325269:I661V;ENSP00000368310:I658V;ENSP00000401244:I677V;ENSP00000368308:I677V	ENSP00000325269:I661V	I	-	1	0	NRCAM	107617331	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	6.210000	0.72176	1.952000	0.56665	0.477000	0.44152	ATT	NRCAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000091129		0.408	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding	OTTHUMT00000337942.2	-	0.00	30	0	T	NM_001037132		107830095	-1	tier1	-	no_errors	ENST00000379028	ensembl	human	known	74_37	missense	50.00	17	17	SNP	1.000	C
NTRK3	4916	genome.wustl.edu	37	15	88522553	88522553	+	Intron	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:88522553A>C	ENST00000360948.2	-	14	1747				NTRK3_ENST00000557856.1_Intron|NTRK3_ENST00000542733.2_Intron|NTRK3_ENST00000355254.2_Intron|NTRK3_ENST00000558676.1_Intron|NTRK3_ENST00000357724.2_Intron|NTRK3_ENST00000394480.2_Intron|NTRK3_ENST00000558306.1_5'UTR|NTRK3_ENST00000540489.2_3'UTR|NTRK3_ENST00000317501.3_3'UTR	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3						activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TGACATCAAAACAAGGAGGCT	0.448			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																														Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0													87.0	86.0	86.0					15																	88522553		2201	4299	6500	SO:0001627	intron_variant	0			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.1586-38569T>G	15.37:g.88522553A>C			B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	RNA	SNP	-	NULL	ENST00000360948.2	37	NULL	CCDS32322.1	15																																																																																			NTRK3	-	-	ENSG00000140538		0.448	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding		-	0.00	31	0	A			88522553	-1	tier1	-	no_errors	ENST00000558306	ensembl	human	putative	74_37	rna	35.48	20	11	SNP	0.996	C
NTRK3	4916	genome.wustl.edu	37	15	88799249	88799249	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:88799249G>A	ENST00000360948.2	-	2	297	c.136C>T	c.(136-138)Cgg>Tgg	p.R46W	NTRK3_ENST00000557856.1_Missense_Mutation_p.R46W|NTRK3_ENST00000355254.2_Missense_Mutation_p.R46W|NTRK3_ENST00000558676.1_Missense_Mutation_p.R46W|NTRK3_ENST00000357724.2_Missense_Mutation_p.R46W|NTRK3-AS1_ENST00000569588.1_lincRNA|NTRK3_ENST00000394480.2_Missense_Mutation_p.R46W|NTRK3_ENST00000540489.2_Missense_Mutation_p.R46W|NTRK3_ENST00000317501.3_Missense_Mutation_p.R46W	NM_001012338.2	NP_001012338.1	Q16288	NTRK3_HUMAN	neurotrophic tyrosine kinase, receptor, type 3	46					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|cellular response to retinoic acid (GO:0071300)|circadian rhythm (GO:0007623)|cochlea development (GO:0090102)|lens fiber cell differentiation (GO:0070306)|mechanoreceptor differentiation (GO:0042490)|modulation by virus of host transcription (GO:0019056)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell death (GO:0060548)|negative regulation of protein phosphorylation (GO:0001933)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|neurotrophin signaling pathway (GO:0038179)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of axon extension involved in regeneration (GO:0048691)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of positive chemotaxis (GO:0050927)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|response to corticosterone (GO:0051412)|response to ethanol (GO:0045471)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|neurotrophin binding (GO:0043121)|neurotrophin receptor activity (GO:0005030)|p53 binding (GO:0002039)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ETV6/NTRK3(238)	breast(3)|central_nervous_system(3)|endometrium(6)|kidney(1)|large_intestine(22)|lung(63)|ovary(6)|pancreas(3)|prostate(1)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)	119			BRCA - Breast invasive adenocarcinoma(143;0.211)			TCCGGCCGCCGGCAATTGATC	0.567			T	ETV6	"""congenital fibrosarcoma, Secretory breast """					TSP Lung(13;0.10)																														Dom	yes		15	15q25	4916	"""neurotrophic tyrosine kinase, receptor, type 3"""		"""E, M"""	0													263.0	218.0	234.0					15																	88799249		2201	4299	6500	SO:0001583	missense	0			U05012	CCDS10340.1, CCDS32322.1, CCDS32323.1, CCDS58399.1	15q24-q25	2013-01-11			ENSG00000140538	ENSG00000140538	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8033	protein-coding gene	gene with protein product		191316				7806211	Standard	NM_001012338		Approved	TRKC	uc002bme.2	Q16288	OTTHUMG00000148677	ENST00000360948.2:c.136C>T	15.37:g.88799249G>A	ENSP00000354207:p.Arg46Trp		B7Z4C5|E9PG56|H0YND1|O75682|Q12827|Q16289	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R46W	ENST00000360948.2	37	c.136	CCDS32322.1	15	.	.	.	.	.	.	.	.	.	.	G	17.20	3.330215	0.60743	.	.	ENSG00000140538	ENST00000394480;ENST00000360948;ENST00000357724;ENST00000355254;ENST00000540489;ENST00000317501	D;D;D;D;D;D	0.96685	-4.09;-4.09;-4.09;-4.09;-4.09;-4.09	3.85	1.3	0.21679	Leucine-rich repeat-containing N-terminal (2);	0.442058	0.17498	U	0.172120	D	0.90803	0.7112	N	0.08118	0	0.37917	D	0.931565	P;P;D;P;P	0.58620	0.484;0.764;0.983;0.947;0.919	B;B;P;B;P	0.47206	0.124;0.205;0.541;0.406;0.472	D	0.89679	0.3889	10	0.66056	D	0.02	.	9.4016	0.38435	0.0:0.0:0.3578:0.6422	.	46;46;46;46;46	E9PG56;B7Z4C5;Q96CY4;Q16288-3;Q16288	.;.;.;.;NTRK3_HUMAN	W	46	ENSP00000377990:R46W;ENSP00000354207:R46W;ENSP00000350356:R46W;ENSP00000347397:R46W;ENSP00000444673:R46W;ENSP00000318328:R46W	ENSP00000318328:R46W	R	-	1	2	NTRK3	86600253	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.737000	0.47393	0.679000	0.31345	0.455000	0.32223	CGG	NTRK3	-	pfam_LRR-contain_N,smart_LRR-contain_N	ENSG00000140538		0.567	NTRK3-204	KNOWN	basic|CCDS	protein_coding	NTRK3	HGNC	protein_coding			0.00	58	0	G			88799249	-1			no_errors	ENST00000360948	ensembl	human	known	74_37	missense	5.56	67	4	SNP	1.000	A
OR10G9	219870	genome.wustl.edu	37	11	123894160	123894160	+	Silent	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:123894160T>G	ENST00000375024.1	+	1	441	c.441T>G	c.(439-441)acT>acG	p.T147T		NM_001001953.1	NP_001001953.1	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G, member 9	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T147T(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(33)|prostate(2)|skin(4)|stomach(8)|urinary_tract(1)	61		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CCACCAGCACTTGGCTCAGTG	0.532																																																	1	Substitution - coding silent(1)	stomach(1)											124.0	105.0	111.0					11																	123894160		2201	4299	6500	SO:0001819	synonymous_variant	0			AB065756	CCDS31703.1	11q24.1	2012-08-09			ENSG00000236981	ENSG00000236981		"""GPCR / Class A : Olfactory receptors"""	15129	protein-coding gene	gene with protein product				OR10G10P			Standard	NM_001001953		Approved		uc010sad.2	Q8NGN4	OTTHUMG00000165967	ENST00000375024.1:c.441T>G	11.37:g.123894160T>G				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T147	ENST00000375024.1	37	c.441	CCDS31703.1	11																																																																																			OR10G9	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000236981		0.532	OR10G9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G9	HGNC	protein_coding	OTTHUMT00000387269.1	-	0.00	91	0	T	NM_001001953		123894160	+1	tier1	-	no_errors	ENST00000375024	ensembl	human	known	74_37	silent	10.87	123	15	SNP	0.000	G
OR2J1	442185	genome.wustl.edu	37	6	29068844	29068844	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:29068844G>C	ENST00000377171.3	+	1	459	c.125G>C	c.(124-126)gGa>gCa	p.G42A				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|lung(6)	7						ACACTGATAGGAAACCTGTTC	0.408																																																	0																																										SO:0001583	missense	0					6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.125G>C	6.37:g.29068844G>C	ENSP00000366376:p.Gly42Ala		A2AAS1|B0V1T2|Q9GZK1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.G42A	ENST00000377171.3	37	c.125		6	.	.	.	.	.	.	.	.	.	.	G	7.370	0.626616	0.14257	.	.	ENSG00000204702	ENST00000377171	T	0.04234	3.67	2.21	2.21	0.28008	.	.	.	.	.	T	0.03136	0.0092	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38650	-0.9651	6	0.66056	D	0.02	.	8.9075	0.35532	0.0:0.2313:0.7686:0.0	.	.	.	.	A	42	ENSP00000366376:G42A	ENSP00000366376:G42A	G	+	2	0	OR2J1	29176823	0.036000	0.19791	0.026000	0.17262	0.094000	0.18550	0.393000	0.20817	1.215000	0.43411	0.467000	0.42956	GGA	OR2J1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000204702		0.408	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	OR2J1	HGNC	protein_coding	OTTHUMT00000076612.2	-	0.00	75	0	G	NG_004683		29068844	+1	tier1	-	no_errors	ENST00000377171	ensembl	human	known	74_37	missense	6.54	99	7	SNP	0.017	C
OR4C15	81309	genome.wustl.edu	37	11	55322473	55322473	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:55322473A>C	ENST00000314644.2	+	1	691	c.691A>C	c.(691-693)Atg>Ctg	p.M231L		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	177						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						CAATCACTTTATGTGTGACTT	0.463										HNSCC(20;0.049)																																							0													108.0	80.0	89.0					11																	55322473		2201	4296	6497	SO:0001583	missense	0			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.691A>C	11.37:g.55322473A>C	ENSP00000324958:p.Met231Leu		Q6IFE2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M231L	ENST00000314644.2	37	c.691	CCDS31501.1	11	.	.	.	.	.	.	.	.	.	.	A	2.368	-0.344941	0.05208	.	.	ENSG00000181939	ENST00000314644	T	0.00042	8.84	5.02	-2.53	0.06326	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.17838	0.53	0.09310	N	1	B	0.02656	0.0	B	0.13407	0.009	T	0.06807	-1.0806	9	0.37606	T	0.19	.	2.2325	0.04000	0.3096:0.1386:0.0786:0.4732	.	177	Q8NGM1	OR4CF_HUMAN	L	231	ENSP00000324958:M231L	ENSP00000324958:M231L	M	+	1	0	OR4C15	55079049	0.000000	0.05858	0.011000	0.14972	0.006000	0.05464	0.654000	0.24918	-0.215000	0.10063	-0.970000	0.02610	ATG	OR4C15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181939		0.463	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	HGNC	protein_coding	OTTHUMT00000391164.1	-	0.00	50	0	A	NM_001001920		55322473	+1	tier1	-	no_errors	ENST00000314644	ensembl	human	known	74_37	missense	16.67	49	10	SNP	0.000	C
OR4N2	390429	genome.wustl.edu	37	14	20295732	20295732	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr14:20295732A>C	ENST00000315947.1	+	1	125	c.125A>C	c.(124-126)aAt>aCt	p.N42T	OR4N2_ENST00000568211.1_Missense_Mutation_p.N42T	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTCCCTGGAAATTTTCTCATT	0.443																																																	0													187.0	218.0	207.0					14																	20295732		2203	4300	6503	SO:0001583	missense	0				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.125A>C	14.37:g.20295732A>C	ENSP00000319601:p.Asn42Thr		Q6IEY9|Q6IFA2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.N42T	ENST00000315947.1	37	c.125	CCDS32022.1	14	.	.	.	.	.	.	.	.	.	.	.	15.87	2.960257	0.53400	.	.	ENSG00000176294	ENST00000557677;ENST00000315947	D;T	0.96619	-4.07;-0.94	4.3	4.3	0.51218	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000079	D	0.98676	0.9556	H	0.97587	4.035	0.36720	D	0.881104	D	0.89917	1.0	D	0.97110	1.0	D	0.99951	1.1549	10	0.87932	D	0	-11.3074	11.7038	0.51585	1.0:0.0:0.0:0.0	.	42	Q8NGD1	OR4N2_HUMAN	T	42	ENSP00000452022:N42T;ENSP00000319601:N42T	ENSP00000319601:N42T	N	+	2	0	OR4N2	19365572	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	6.305000	0.72805	1.922000	0.55676	0.482000	0.46254	AAT	OR4N2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000176294		0.443	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	HGNC	protein_coding	OTTHUMT00000409821.2	-	0.00	88	0	A			20295732	+1	tier1	-	no_errors	ENST00000315947	ensembl	human	known	74_37	missense	24.44	68	22	SNP	1.000	C
OR5D18	219438	genome.wustl.edu	37	11	55587684	55587684	+	Silent	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:55587684T>G	ENST00000333976.4	+	1	599	c.579T>G	c.(577-579)acT>acG	p.T193T		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				GCTCTGATACTTACATCAACC	0.403																																																	0													196.0	173.0	181.0					11																	55587684		2200	4296	6496	SO:0001819	synonymous_variant	0			AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.579T>G	11.37:g.55587684T>G			Q6IF67|Q6IFD3|Q96RB3	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T193	ENST00000333976.4	37	c.579	CCDS31510.1	11																																																																																			OR5D18	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000186119		0.403	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D18	HGNC	protein_coding	OTTHUMT00000391515.1	-	0.00	60	0	T	NM_001001952		55587684	+1	tier1	-	no_errors	ENST00000333976	ensembl	human	known	74_37	silent	19.10	72	17	SNP	0.002	G
OR5K3	403277	genome.wustl.edu	37	3	98110010	98110010	+	Silent	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:98110010T>C	ENST00000383695.1	+	1	501	c.501T>C	c.(499-501)acT>acC	p.T167T	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005516.1	NP_001005516.1	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K, member 3	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|prostate(1)|skin(1)|urinary_tract(1)	27						TGAGGTTAACTTTCTGTGGGT	0.383																																																	0													156.0	152.0	153.0					3																	98110010		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS33803.1	3q11.2	2013-09-23			ENSG00000206536	ENSG00000206536		"""GPCR / Class A : Olfactory receptors"""	31290	protein-coding gene	gene with protein product							Standard	NM_001005516		Approved		uc011bgw.2	A6NET4	OTTHUMG00000160077	ENST00000383695.1:c.501T>C	3.37:g.98110010T>C				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T167	ENST00000383695.1	37	c.501	CCDS33803.1	3																																																																																			OR5K3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000206536		0.383	OR5K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K3	HGNC	protein_coding	OTTHUMT00000359110.1	-	0.00	75	0	T			98110010	+1	tier1	-	no_errors	ENST00000383695	ensembl	human	known	74_37	silent	40.34	71	48	SNP	0.061	C
OR5L2	26338	genome.wustl.edu	37	11	55594761	55594761	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:55594761T>G	ENST00000378397.1	+	1	67	c.67T>G	c.(67-69)Ttg>Gtg	p.L23V		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	23						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				TGTCCCTGAGTTGAGAGTCTG	0.483										HNSCC(27;0.073)																																							0													239.0	220.0	227.0					11																	55594761		2200	4293	6493	SO:0001583	missense	0			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.67T>G	11.37:g.55594761T>G	ENSP00000367650:p.Leu23Val		Q6IF66|Q96RB2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L23V	ENST00000378397.1	37	c.67	CCDS31511.1	11	.	.	.	.	.	.	.	.	.	.	.	14.65	2.599174	0.46318	.	.	ENSG00000205030	ENST00000378397	T	0.04970	3.52	5.31	-5.25	0.02781	.	0.000000	0.38778	N	0.001564	T	0.11537	0.0281	L	0.55834	1.745	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.03000	-1.1084	10	0.46703	T	0.11	-7.4956	3.7277	0.08481	0.105:0.2994:0.1033:0.4923	.	23	Q8NGL0	OR5L2_HUMAN	V	23	ENSP00000367650:L23V	ENSP00000367650:L23V	L	+	1	2	OR5L2	55351337	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-3.002000	0.00652	-1.335000	0.02241	-0.305000	0.09177	TTG	OR5L2	-	NULL	ENSG00000205030		0.483	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L2	HGNC	protein_coding	OTTHUMT00000391516.1	-	0.00	72	0	T	NM_001004739		55594761	+1	tier1	-	no_errors	ENST00000378397	ensembl	human	known	74_37	missense	40.22	54	37	SNP	0.003	G
OR5T2	219464	genome.wustl.edu	37	11	55999981	55999981	+	Silent	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:55999981A>G	ENST00000313264.4	-	1	756	c.681T>C	c.(679-681)tcT>tcC	p.S227S		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					TGTCAGAATAAGAAATAGCAA	0.423																																																	0													140.0	130.0	133.0					11																	55999981		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.681T>C	11.37:g.55999981A>G			B9EGX5|Q6IFC8	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S227	ENST00000313264.4	37	c.681	CCDS31523.1	11																																																																																			OR5T2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181718		0.423	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T2	HGNC	protein_coding	OTTHUMT00000391598.1	-	0.00	63	0	A	NM_001004746		55999981	-1	tier1	-	no_errors	ENST00000313264	ensembl	human	known	74_37	silent	12.50	91	13	SNP	0.001	G
OR6M1	390261	genome.wustl.edu	37	11	123676607	123676607	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:123676607A>T	ENST00000309154.2	-	1	488	c.451T>A	c.(451-453)Ttc>Atc	p.F151I		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	151						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		ACAGACAGGAAGGCTCCCACC	0.498																																																	0													51.0	54.0	53.0					11																	123676607		2202	4299	6501	SO:0001583	missense	0			AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.451T>A	11.37:g.123676607A>T	ENSP00000311038:p.Phe151Ile		B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F151I	ENST00000309154.2	37	c.451	CCDS31696.1	11	.	.	.	.	.	.	.	.	.	.	A	12.96	2.094097	0.36952	.	.	ENSG00000196099	ENST00000309154	T	0.00169	8.63	3.58	2.45	0.29901	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34828	U	0.003649	T	0.00356	0.0011	L	0.58925	1.835	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.49457	-0.8938	10	0.72032	D	0.01	.	5.2633	0.15586	0.8646:0.0:0.1354:0.0	.	151	Q8NGM8	OR6M1_HUMAN	I	151	ENSP00000311038:F151I	ENSP00000311038:F151I	F	-	1	0	OR6M1	123181817	0.035000	0.19736	0.242000	0.24170	0.591000	0.36615	0.673000	0.25203	0.456000	0.26937	0.533000	0.62120	TTC	OR6M1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196099		0.498	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6M1	HGNC	protein_coding	OTTHUMT00000387437.1		0.00	26	0	A	NM_001005325		123676607	-1			no_errors	ENST00000309154	ensembl	human	known	74_37	missense	12.82	34	5	SNP	0.000	T
OR8G1	26494	genome.wustl.edu	37	11	124120732	124120732	+	RNA	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:124120732T>C	ENST00000534473.2	+	0	310				OR8G1_ENST00000341493.2_RNA			Q15617	OR8G1_HUMAN	olfactory receptor, family 8, subfamily G, member 1						detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0569)|Lung(307;0.174)		GCTCTACTTCTTCCTCGTTTT	0.468																																																	0													173.0	165.0	168.0					11																	124120732		2163	4274	6437			0			AB065946	CCDS73407.1	11q24.2	2013-01-23	2004-07-27	2005-05-16	ENSG00000197849	ENSG00000197849		"""GPCR / Class A : Olfactory receptors"""	8484	protein-coding gene	gene with protein product			"""olfactory receptor, family 8, subfamily G, member 1 pseudogene"""	OR8G1P		9119360	Standard	NR_045681		Approved	TPCR25, HSTPCR25	uc031qep.1	Q15617	OTTHUMG00000165974		11.37:g.124120732T>C			Q8NG88	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F104L	ENST00000534473.2	37	c.310		11																																																																																			OR8G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000197849		0.468	OR8G1-001	KNOWN	basic	polymorphic_pseudogene	OR8G1	HGNC	polymorphic_pseudogene	OTTHUMT00000387282.2	-	0.00	123	0	T	NM_001002905		124120732	+1	tier1	-	no_errors	ENST00000341493	ensembl	human	known	74_37	missense	15.29	144	26	SNP	0.658	C
PABPC4L	132430	genome.wustl.edu	37	4	135121457	135121457	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:135121457G>A	ENST00000421491.3	-	2	974	c.718C>T	c.(718-720)Cat>Tat	p.H240Y	PABPC4L_ENST00000529122.2_Missense_Mutation_p.H298Y			P0CB38	PAB4L_HUMAN	poly(A) binding protein, cytoplasmic 4-like	240	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|endometrium(2)	3						GCAGCCTCATGGCTATCAAAA	0.453																																																	0													40.0	33.0	35.0					4																	135121457		692	1591	2283	SO:0001583	missense	0			AY672099		4q28.3	2013-02-12				ENSG00000254535		"""RNA binding motif (RRM) containing"""	31955	protein-coding gene	gene with protein product							Standard	NM_001114734		Approved		uc010ioe.3	P0CB38		ENST00000421491.3:c.718C>T	4.37:g.135121457G>A	ENSP00000463233:p.His240Tyr			Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,tigrfam_PABP_1234	p.H298Y	ENST00000421491.3	37	c.892		4																																																																																			PABPC4L	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000254535		0.453	PABPC4L-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	PABPC4L	HGNC	protein_coding	OTTHUMT00000364399.2	-	0.00	38	0	G	NM_001114734		135121457	-1	tier1	-	no_errors	ENST00000529122	ensembl	human	known	74_37	missense	23.81	32	10	SNP	1.000	A
PCDH11X	27328	genome.wustl.edu	37	X	91131912	91131912	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:91131912G>T	ENST00000373094.1	+	2	1518	c.673G>T	c.(673-675)Ggc>Tgc	p.G225C	PCDH11X_ENST00000361724.1_Missense_Mutation_p.G225C|PCDH11X_ENST00000406881.1_Missense_Mutation_p.G225C|PCDH11X_ENST00000504220.2_Missense_Mutation_p.G225C|PCDH11X_ENST00000395337.2_Missense_Mutation_p.G225C|PCDH11X_ENST00000298274.8_Missense_Mutation_p.G225C|PCDH11X_ENST00000373097.1_Missense_Mutation_p.G225C|PCDH11X_ENST00000373088.1_Missense_Mutation_p.G225C|PCDH11X_ENST00000361655.2_Missense_Mutation_p.G225C	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	225	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						TGAAGATGGTGGCTTTCCTCA	0.408																																					NSCLC(38;925 1092 2571 38200 45895)												0													241.0	211.0	221.0					X																	91131912		2203	4300	6503	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.673G>T	X.37:g.91131912G>T	ENSP00000362186:p.Gly225Cys		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G225C	ENST00000373094.1	37	c.673	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	G	21.0	4.087645	0.76642	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59;1.59;1.59;1.59	4.63	4.63	0.57726	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.71542	0.3352	H	0.98646	4.29	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.84408	0.0564	10	0.87932	D	0	.	15.613	0.76740	0.0:0.0:1.0:0.0	.	225;225;225;225;225;225;225;225	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	C	225	ENSP00000378746:G225C;ENSP00000362186:G225C;ENSP00000362189:G225C;ENSP00000355040:G225C;ENSP00000362180:G225C;ENSP00000423762:G225C;ENSP00000355105:G225C;ENSP00000384758:G225C;ENSP00000298274:G225C	ENSP00000298274:G225C	G	+	1	0	PCDH11X	91018568	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	9.507000	0.97996	1.870000	0.54199	0.544000	0.68410	GGC	PCDH11X	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000102290		0.408	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	83	0	G	NM_032969		91131912	+1	tier1	-	no_errors	ENST00000373094	ensembl	human	known	74_37	missense	6.00	94	6	SNP	1.000	T
PCDHB3	56132	genome.wustl.edu	37	5	140482358	140482358	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:140482358G>A	ENST00000231130.2	+	1	2125	c.2125G>A	c.(2125-2127)Gtg>Atg	p.V709M	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	709					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCCTGTTCGTGGCGGTGCG	0.692																																																	0													61.0	65.0	64.0					5																	140482358		2124	4160	6284	SO:0001583	missense	0			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.2125G>A	5.37:g.140482358G>A	ENSP00000231130:p.Val709Met		B2R8P2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V709M	ENST00000231130.2	37	c.2125	CCDS4245.1	5	.	.	.	.	.	.	.	.	.	.	G	12.03	1.814630	0.32053	.	.	ENSG00000113205	ENST00000231130	T	0.15256	2.44	4.29	-0.24	0.13047	.	.	.	.	.	T	0.27765	0.0683	H	0.96048	3.76	0.09310	N	1	P	0.48162	0.906	B	0.36378	0.223	T	0.35674	-0.9779	9	0.72032	D	0.01	.	8.3353	0.32211	0.568:0.0:0.432:0.0	.	709	Q9Y5E6	PCDB3_HUMAN	M	709	ENSP00000231130:V709M	ENSP00000231130:V709M	V	+	1	0	PCDHB3	140462542	0.000000	0.05858	0.005000	0.12908	0.075000	0.17131	-0.280000	0.08468	0.074000	0.16767	-0.330000	0.08379	GTG	PCDHB3	-	NULL	ENSG00000113205		0.692	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2	-	0.00	179	0	G	NM_018937		140482358	+1	tier1	-	no_errors	ENST00000231130	ensembl	human	known	74_37	missense	11.73	158	21	SNP	0.000	A
PDE8B	8622	genome.wustl.edu	37	5	76696107	76696107	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:76696107C>A	ENST00000264917.5	+	11	1247	c.1202C>A	c.(1201-1203)tCt>tAt	p.S401Y	PDE8B_ENST00000346042.3_Missense_Mutation_p.S304Y|PDE8B_ENST00000342343.4_Missense_Mutation_p.S381Y|PDE8B_ENST00000340978.3_Missense_Mutation_p.S354Y|PDE8B_ENST00000333194.4_Missense_Mutation_p.S401Y	NM_003719.3	NP_003710.1	O95263	PDE8B_HUMAN	phosphodiesterase 8B	401					cAMP catabolic process (GO:0006198)|cyclic nucleotide metabolic process (GO:0009187)|negative regulation of insulin secretion (GO:0046676)|negative regulation of steroid hormone biosynthetic process (GO:0090032)|phosphorelay signal transduction system (GO:0000160)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)		GMDS/PDE8B(2)	NS(1)|autonomic_ganglia(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(10)|lung(15)|ovary(1)|prostate(2)|skin(3)	40		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)	Caffeine(DB00201)|Ketotifen(DB00920)	GGAGACAATTCTCAGACAGGT	0.338																																																	0													89.0	92.0	91.0					5																	76696107		2203	4300	6503	SO:0001583	missense	0			AF079529	CCDS4037.1, CCDS34190.1, CCDS34191.1, CCDS34192.1, CCDS34193.1	5q14.1	2008-05-15			ENSG00000113231	ENSG00000113231	3.1.4.17	"""Phosphodiesterases"""	8794	protein-coding gene	gene with protein product		603390				9784418	Standard	NM_003719		Approved		uc003kfa.3	O95263	OTTHUMG00000102170	ENST00000264917.5:c.1202C>A	5.37:g.76696107C>A	ENSP00000264917:p.Ser401Tyr		Q5J7V7|Q86XK8|Q8IUJ7|Q8IUJ8|Q8IUJ9|Q8IUK0|Q8N3T2	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_PDE8,pfam_Sig_transdc_resp-reg_receiver,pfam_PAS_fold,pfam_PAS_4,pfam_PAS_fold_3,superfamily_PAS,superfamily_CheY-like_superfamily,smart_PAS,smart_HD/PDEase_dom,pfscan_PAS,prints_PDEase,tigrfam_PAS	p.S401Y	ENST00000264917.5	37	c.1202	CCDS4037.1	5	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229780	0.58777	.	.	ENSG00000113231	ENST00000340978;ENST00000346042;ENST00000264917;ENST00000342343;ENST00000333194	T;T;T;T;T	0.71222	-0.43;-0.55;-0.43;-0.43;-0.54	5.32	5.32	0.75619	.	0.499351	0.23492	N	0.047598	T	0.72574	0.3477	M	0.61703	1.905	0.80722	D	1	P;P;P;P;P	0.39717	0.536;0.684;0.684;0.684;0.556	B;B;B;B;B	0.43251	0.413;0.381;0.381;0.381;0.211	T	0.72020	-0.4416	10	0.37606	T	0.19	.	16.509	0.84279	0.0:1.0:0.0:0.0	.	304;354;401;381;401	O95263-2;O95263-6;O95263-3;O95263-4;O95263	.;.;.;.;PDE8B_HUMAN	Y	354;304;401;381;401	ENSP00000345446:S354Y;ENSP00000330428:S304Y;ENSP00000264917:S401Y;ENSP00000345646:S381Y;ENSP00000331336:S401Y	ENSP00000264917:S401Y	S	+	2	0	PDE8B	76731863	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.403000	0.59729	2.642000	0.89623	0.563000	0.77884	TCT	PDE8B	-	NULL	ENSG00000113231		0.338	PDE8B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE8B	HGNC	protein_coding	OTTHUMT00000220015.3	-	0.00	37	0	C	NM_003719		76696107	+1	tier1	-	no_errors	ENST00000264917	ensembl	human	known	74_37	missense	28.89	32	13	SNP	1.000	A
PCDHGA4	56111	genome.wustl.edu	37	5	140734992	140734992	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:140734992C>T	ENST00000571252.1	+	1	225	c.225C>T	c.(223-225)ttC>ttT	p.F75F	PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	75	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCAGCTTTTCGCCCTGAACC	0.637																																																	0													51.0	61.0	57.0					5																	140734992		2185	4297	6482	SO:0001819	synonymous_variant	0			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.225C>T	5.37:g.140734992C>T			Q9Y5D3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F75	ENST00000571252.1	37	c.225	CCDS58979.1	5																																																																																			PCDHGA4	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000262576		0.637	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	HGNC	protein_coding	OTTHUMT00000437959.1		0.00	62	0	C	NM_018917		140734992	+1			no_errors	ENST00000571252	ensembl	human	known	74_37	silent	6.82	41	3	SNP	0.959	T
PCDHGA6	56109	genome.wustl.edu	37	5	140755574	140755574	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:140755574C>A	ENST00000517434.1	+	1	1924	c.1924C>A	c.(1924-1926)Cta>Ata	p.L642I	PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	642	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAGCAGAGCCTAGTGGTGGC	0.697																																																	0													39.0	50.0	46.0					5																	140755574		2201	4297	6498	SO:0001583	missense	0			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1924C>A	5.37:g.140755574C>A	ENSP00000429601:p.Leu642Ile		A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L642I	ENST00000517434.1	37	c.1924	CCDS54926.1	5	.	.	.	.	.	.	.	.	.	.	.	19.95	3.921910	0.73213	.	.	ENSG00000253731	ENST00000517434	T	0.69040	-0.37	4.87	4.87	0.63330	Cadherin (4);Cadherin-like (1);	0.000000	0.28393	U	0.015516	T	0.80854	0.4703	M	0.83774	2.66	0.30340	N	0.785847	D;D	0.63046	0.992;0.975	P;D	0.63192	0.775;0.912	T	0.80547	-0.1334	10	0.87932	D	0	.	13.8554	0.63524	0.0:0.8469:0.1531:0.0	.	642;642	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	I	642	ENSP00000429601:L642I	ENSP00000429601:L642I	L	+	1	2	PCDHGA6	140735758	0.039000	0.19947	0.998000	0.56505	0.917000	0.54804	0.589000	0.23939	2.676000	0.91093	0.563000	0.77884	CTA	PCDHGA6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253731		0.697	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA6	HGNC	protein_coding	OTTHUMT00000374743.1	-	0.00	118	0	C	NM_018919		140755574	+1	tier1	-	no_errors	ENST00000517434	ensembl	human	known	74_37	missense	7.74	143	12	SNP	1.000	A
PCDHGB6	56100	genome.wustl.edu	37	5	140788505	140788505	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:140788505G>A	ENST00000520790.1	+	1	736	c.736G>A	c.(736-738)Gaa>Aaa	p.E246K	PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018926.2|NM_032100.1	NP_061749.1|NP_115271.1	Q9Y5F9	PCDGI_HUMAN	protocadherin gamma subfamily B, 6	246	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.E246*(1)		breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)	48			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCAGAGACGAATATAGAAT	0.502																																																	1	Substitution - Nonsense(1)	endometrium(1)											33.0	34.0	34.0					5																	140788505		1848	4094	5942	SO:0001583	missense	0			AF152522	CCDS54929.1, CCDS75342.1	5q31	2010-01-26				ENSG00000253305		"""Cadherins / Protocadherins : Clustered"""	8713	other	protocadherin		606303				10380929	Standard	NM_018926		Approved	PCDH-GAMMA-B6		Q9Y5F9		ENST00000520790.1:c.736G>A	5.37:g.140788505G>A	ENSP00000428603:p.Glu246Lys		Q9Y5C5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E246K	ENST00000520790.1	37	c.736	CCDS54929.1	5	.	.	.	.	.	.	.	.	.	.	g	11.10	1.539023	0.27475	.	.	ENSG00000253305	ENST00000520790	T	0.61274	0.12	5.34	5.34	0.76211	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.49626	0.1568	L	0.46157	1.445	0.09310	N	1	P;P	0.41624	0.644;0.757	B;B	0.35039	0.126;0.194	T	0.53258	-0.8464	9	0.66056	D	0.02	.	13.05	0.58950	0.0784:0.0:0.9216:0.0	.	246;246	Q9Y5F9;Q9Y5F9-2	PCDGI_HUMAN;.	K	246	ENSP00000428603:E246K	ENSP00000428603:E246K	E	+	1	0	PCDHGB6	140768689	0.000000	0.05858	0.876000	0.34364	0.630000	0.37929	-0.575000	0.05861	2.502000	0.84385	0.467000	0.42956	GAA	PCDHGB6	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000253305		0.502	PCDHGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB6	HGNC	protein_coding	OTTHUMT00000374746.1		0.00	13	0	G	NM_018926		140788505	+1			no_errors	ENST00000520790	ensembl	human	known	74_37	missense	12.00	22	3	SNP	0.018	A
PCDHGA11	56105	genome.wustl.edu	37	5	140801036	140801036	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:140801036G>A	ENST00000398587.2	+	1	275	c.242G>A	c.(241-243)cGa>cAa	p.R81Q	PCDHGB7_ENST00000398594.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA11_ENST00000518882.1_Missense_Mutation_p.R81Q|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	81	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGAATCCGCGAAGCGGCAGC	0.577																																																	0													41.0	50.0	47.0					5																	140801036		2157	4288	6445	SO:0001583	missense	0			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.242G>A	5.37:g.140801036G>A	ENSP00000381589:p.Arg81Gln		B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R81Q	ENST00000398587.2	37	c.242	CCDS47294.1	5	.	.	.	.	.	.	.	.	.	.	g	11.57	1.678652	0.29783	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;T	0.26810	1.71;1.71	5.93	4.12	0.48240	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	0.000000	0.28901	U	0.013773	T	0.18593	0.0446	L	0.41710	1.295	0.09310	N	0.999999	P;P;P	0.45902	0.525;0.868;0.812	B;B;B	0.40864	0.124;0.329;0.342	T	0.13764	-1.0497	10	0.44086	T	0.13	.	4.8548	0.13554	0.2479:0.2986:0.4535:0.0	.	81;81;81	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	Q	81	ENSP00000381589:R81Q;ENSP00000428333:R81Q	ENSP00000381589:R81Q	R	+	2	0	PCDHGA11	140781220	0.000000	0.05858	1.000000	0.80357	0.736000	0.42039	0.075000	0.14686	0.807000	0.34208	0.591000	0.81541	CGA	PCDHGA11	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000253873		0.577	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA11	HGNC	protein_coding	OTTHUMT00000376974.1		0.00	46	0	G	NM_018914		140801036	+1			no_errors	ENST00000398587	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.391	A
PDGFD	80310	genome.wustl.edu	37	11	103870968	103870968	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:103870968G>T	ENST00000393158.2	-	2	319	c.140C>A	c.(139-141)aCa>aAa	p.T47K	PDGFD_ENST00000302251.5_Intron			Q9GZP0	PDGFD_HUMAN	platelet derived growth factor D	47					cellular response to amino acid stimulus (GO:0071230)|multicellular organismal development (GO:0007275)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Melanoma(852;0.0563)|all_neural(303;0.165)		BRCA - Breast invasive adenocarcinoma(274;0.00136)|Epithelial(105;0.111)		GTACAAGTCTGTGAGGTGATT	0.443																																																	0													160.0	132.0	142.0					11																	103870968		2202	4299	6501	SO:0001583	missense	0			AF113216	CCDS8326.1, CCDS41703.1	11q22.3	2008-02-05			ENSG00000170962	ENSG00000170962			30620	protein-coding gene	gene with protein product	"""spinal cord derived growth factor B"""	609673				11162582, 11980634	Standard	NM_033135		Approved	SCDGF-B, MSTP036, IEGF	uc001phq.3	Q9GZP0	OTTHUMG00000165953	ENST00000393158.2:c.140C>A	11.37:g.103870968G>T	ENSP00000376865:p.Thr47Lys		A8K9T6|Q9BWV5	Missense_Mutation	SNP	pfam_CUB_dom,pfam_PDGF/VEGF_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_PDGF/VEGF_dom	p.T47K	ENST00000393158.2	37	c.140	CCDS41703.1	11	.	.	.	.	.	.	.	.	.	.	G	21.1	4.100973	0.76983	.	.	ENSG00000170962	ENST00000393158;ENST00000529268	T;T	0.26660	1.76;1.72	5.85	4.94	0.65067	.	0.000000	0.56097	U	0.000029	T	0.28962	0.0719	L	0.27053	0.805	0.80722	D	1	D	0.67145	0.996	P	0.56216	0.794	T	0.02868	-1.1100	10	0.13470	T	0.59	-9.0346	14.9183	0.70815	0.0687:0.0:0.9313:0.0	.	47	Q9GZP0	PDGFD_HUMAN	K	47;70	ENSP00000376865:T47K;ENSP00000432909:T70K	ENSP00000376865:T47K	T	-	2	0	PDGFD	103376178	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.280000	0.72626	1.483000	0.48342	0.561000	0.74099	ACA	PDGFD	-	NULL	ENSG00000170962		0.443	PDGFD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDGFD	HGNC	protein_coding	OTTHUMT00000387231.2	-	0.00	54	0	G	NM_025208		103870968	-1	tier1	-	no_errors	ENST00000393158	ensembl	human	known	74_37	missense	28.57	55	22	SNP	1.000	T
PDGFRB	5159	genome.wustl.edu	37	5	149504349	149504349	+	Missense_Mutation	SNP	G	G	A	rs139554380		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:149504349G>A	ENST00000261799.4	-	13	2322	c.1853C>T	c.(1852-1854)aCg>aTg	p.T618M		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	618	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCCATGAGCCGTGGCCTCCAC	0.602			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																			Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	0													44.0	42.0	43.0					5																	149504349		2203	4300	6503	SO:0001583	missense	0			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.1853C>T	5.37:g.149504349G>A	ENSP00000261799:p.Thr618Met		B5A957|Q8N5L4	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T618M	ENST00000261799.4	37	c.1853	CCDS4303.1	5	.	.	.	.	.	.	.	.	.	.	G	23.1	4.375035	0.82682	.	.	ENSG00000113721	ENST00000261799;ENST00000544453	D	0.89617	-2.54	4.65	4.65	0.58169	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000089	D	0.91862	0.7424	L	0.50919	1.6	0.51482	D	0.999923	D;D	0.89917	1.0;1.0	D;D	0.79108	0.987;0.992	D	0.92243	0.5802	10	0.87932	D	0	.	12.2053	0.54348	0.0821:0.0:0.9179:0.0	.	618;618	A8KAM8;P09619	.;PGFRB_HUMAN	M	618;288	ENSP00000261799:T618M	ENSP00000261799:T618M	T	-	2	0	PDGFRB	149484542	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	4.499000	0.60380	2.412000	0.81896	0.455000	0.32223	ACG	PDGFRB	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000113721		0.602	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRB	HGNC	protein_coding	OTTHUMT00000252332.1	-	0.00	36	0	G	NM_002609		149504349	-1	tier1	-	no_errors	ENST00000261799	ensembl	human	known	74_37	missense	45.16	17	14	SNP	1.000	A
PDHA2	5161	genome.wustl.edu	37	4	96761425	96761425	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:96761425T>G	ENST00000295266.4	+	1	187	c.124T>G	c.(124-126)Tat>Gat	p.Y42D		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	42					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		ATGTGATCTTTATCTGTTGGA	0.493																																																	0													56.0	57.0	56.0					4																	96761425		2203	4300	6503	SO:0001583	missense	0				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.124T>G	4.37:g.96761425T>G	ENSP00000295266:p.Tyr42Asp		B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Missense_Mutation	SNP	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	p.Y42D	ENST00000295266.4	37	c.124	CCDS3644.1	4	.	.	.	.	.	.	.	.	.	.	T	11.92	1.782049	0.31502	.	.	ENSG00000163114	ENST00000295266	D	0.97328	-4.34	4.74	-5.76	0.02376	.	0.296240	0.35436	N	0.003218	D	0.94142	0.8121	L	0.53249	1.67	0.09310	N	1	P	0.41710	0.76	B	0.44044	0.439	D	0.90180	0.4242	10	0.87932	D	0	-6.0138	8.9763	0.35937	0.0:0.4873:0.1177:0.395	.	42	P29803	ODPAT_HUMAN	D	42	ENSP00000295266:Y42D	ENSP00000295266:Y42D	Y	+	1	0	PDHA2	96980448	0.001000	0.12720	0.000000	0.03702	0.013000	0.08279	0.247000	0.18179	-1.323000	0.02275	-1.773000	0.00660	TAT	PDHA2	-	NULL	ENSG00000163114		0.493	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHA2	HGNC	protein_coding	OTTHUMT00000253608.1	-	0.00	48	0	T			96761425	+1	tier1	-	no_errors	ENST00000295266	ensembl	human	known	74_37	missense	29.63	38	16	SNP	0.000	G
PGK1	5230	genome.wustl.edu	37	X	77381499	77381499	+	3'UTR	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:77381499C>T	ENST00000373316.4	+	0	1593				PGK1_ENST00000476531.1_3'UTR|PGK1_ENST00000537456.1_3'UTR|PGK1_ENST00000442431.1_3'UTR	NM_000291.3	NP_000282.1	P00558	PGK1_HUMAN	phosphoglycerate kinase 1						carbohydrate metabolic process (GO:0005975)|epithelial cell differentiation (GO:0030855)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphoglycerate kinase activity (GO:0004618)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	24					Lamivudine(DB00709)	ATCTTCACTGCACCCTGGATT	0.393																																																	0																																										SO:0001624	3_prime_UTR_variant	0			L00159	CCDS14438.1	Xq13.3	2011-03-17			ENSG00000102144	ENSG00000102144	2.7.2.3		8896	protein-coding gene	gene with protein product		311800				6188151, 6099325	Standard	NM_000291		Approved		uc004ecz.4	P00558	OTTHUMG00000021888	ENST00000373316.4:c.*172C>T	X.37:g.77381499C>T			A8K4W6|B7Z7A9|Q5J7W1|Q6IBT6|Q8NI87	RNA	SNP	-	NULL	ENST00000373316.4	37	NULL	CCDS14438.1	X																																																																																			PGK1	-	-	ENSG00000102144		0.393	PGK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGK1	HGNC	protein_coding	OTTHUMT00000057310.1	-	0.00	39	0	C			77381499	+1	tier1	-	no_errors	ENST00000476531	ensembl	human	known	74_37	rna	8.00	46	4	SNP	0.032	T
PHF21A	51317	genome.wustl.edu	37	11	46001444	46001444	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:46001444G>A	ENST00000418153.2	-	6	426	c.227C>T	c.(226-228)cCa>cTa	p.P76L	PHF21A_ENST00000323180.6_Missense_Mutation_p.P76L|PHF21A_ENST00000257821.4_Missense_Mutation_p.P76L			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	76	Gln-rich.				blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						TTGTGGCAATGGCTGTATTTG	0.433																																																	0													375.0	307.0	330.0					11																	46001444		2202	4299	6501	SO:0001583	missense	0			AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.227C>T	11.37:g.46001444G>A	ENSP00000398824:p.Pro76Leu		D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.P76L	ENST00000418153.2	37	c.227	CCDS44578.1	11	.	.	.	.	.	.	.	.	.	.	G	27.4	4.826539	0.90955	.	.	ENSG00000135365	ENST00000257821;ENST00000323180;ENST00000418153;ENST00000524497;ENST00000531959;ENST00000529734;ENST00000529782	D;D;D	0.94457	-3.0;-3.43;-3.0	5.88	5.88	0.94601	.	0.106561	0.64402	D	0.000004	D	0.92691	0.7677	L	0.51422	1.61	0.80722	D	1	P;P	0.39022	0.584;0.655	B;B	0.35039	0.182;0.194	D	0.92759	0.6222	10	0.72032	D	0.01	-5.5865	20.2187	0.98312	0.0:0.0:1.0:0.0	.	76;76	Q96BD5;Q96BD5-2	PF21A_HUMAN;.	L	76;76;76;83;83;76;53	ENSP00000257821:P76L;ENSP00000323152:P76L;ENSP00000398824:P76L	ENSP00000257821:P76L	P	-	2	0	PHF21A	45958020	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.224000	0.78042	2.780000	0.95670	0.655000	0.94253	CCA	PHF21A	-	NULL	ENSG00000135365		0.433	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHF21A	HGNC	protein_coding	OTTHUMT00000392583.1	-	0.00	260	0	G	NM_016621		46001444	-1	tier1	-	no_errors	ENST00000257821	ensembl	human	known	74_37	missense	37.34	239	143	SNP	1.000	A
PIEZO2	63895	genome.wustl.edu	37	18	10784843	10784843	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr18:10784843G>A	ENST00000503781.3	-	17	2430	c.2431C>T	c.(2431-2433)Cgg>Tgg	p.R811W	PIEZO2_ENST00000383408.2_Missense_Mutation_p.R74W|PIEZO2_ENST00000302079.6_Missense_Mutation_p.R811W|PIEZO2_ENST00000580640.1_Missense_Mutation_p.R811W	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	811					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										TCAAGGAACCGGTCATGGAAG	0.468																																																	0													294.0	241.0	257.0					18																	10784843		692	1591	2283	SO:0001583	missense	0			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.2431C>T	18.37:g.10784843G>A	ENSP00000421377:p.Arg811Trp		B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	NULL	p.R811W	ENST00000503781.3	37	c.2431		18	.	.	.	.	.	.	.	.	.	.	G	14.00	2.405511	0.42715	.	.	ENSG00000154864	ENST00000302079;ENST00000383408	T;T	0.06687	3.27;3.27	5.35	3.5	0.40072	.	0.519754	0.14283	U	0.329383	T	0.23532	0.0569	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	P	0.60886	0.88	T	0.00626	-1.1638	10	0.38643	T	0.18	.	14.5513	0.68068	0.0:0.0:0.7328:0.2672	.	811	Q9H5I5-4	.	W	811;74	ENSP00000303316:R811W;ENSP00000372900:R74W	ENSP00000303316:R811W	R	-	1	2	FAM38B	10774843	1.000000	0.71417	0.970000	0.41538	0.999000	0.98932	6.336000	0.72954	0.691000	0.31592	0.650000	0.86243	CGG	PIEZO2	-	NULL	ENSG00000154864		0.468	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	HGNC	protein_coding	OTTHUMT00000442385.4	-	0.00	84	0	G	NM_022068		10784843	-1	tier1	-	no_errors	ENST00000582913	ensembl	human	known	74_37	missense	5.48	138	8	SNP	0.976	A
PIGQ	9091	genome.wustl.edu	37	16	626145	626145	+	Missense_Mutation	SNP	C	C	T	rs370004325		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr16:626145C>T	ENST00000026218.5	+	4	921	c.833C>T	c.(832-834)aCg>aTg	p.T278M	PIGQ_ENST00000321878.5_Missense_Mutation_p.T278M|PIGQ_ENST00000470411.2_3'UTR|PIGQ_ENST00000409527.2_Missense_Mutation_p.T278M	NM_148920.2	NP_683721.1	Q9BRB3	PIGQ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Q	278	Leu-rich.				C-terminal protein lipidation (GO:0006501)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(780;0.00335)				AAGGCCAACACGGTGGCCTCT	0.716													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16210	0.0		0.0	False		,,,				2504	0.0																0								C	MET/THR,MET/THR	2,4110		0,2,2054	31.0	29.0	30.0		833,833	-1.3	0.0	16		30	0,8080		0,0,4040	no	missense,missense	PIGQ	NM_004204.3,NM_148920.1	81,81	0,2,6094	TT,TC,CC		0.0,0.0486,0.0164	benign,benign	278/582,278/761	626145	2,12190	2056	4040	6096	SO:0001583	missense	0			AB003723	CCDS10411.1, CCDS10412.1	16p13.3	2013-03-28	2006-06-28		ENSG00000007541	ENSG00000007541		"""Phosphatidylinositol glycan anchor biosynthesis"""	14135	protein-coding gene	gene with protein product		605754	"""phosphatidylinositol glycan, class Q"""			9463366, 9729469	Standard	NM_004204		Approved	hGPI1, GPI1	uc002cho.3	Q9BRB3	OTTHUMG00000168047	ENST00000026218.5:c.833C>T	16.37:g.626145C>T	ENSP00000026218:p.Thr278Met		A2IDE1|D3DU52|O14927|Q96G00|Q96S22|Q9UJH4	Missense_Mutation	SNP	pfam_GlcNAc_Gpi1	p.T278M	ENST00000026218.5	37	c.833	CCDS10411.1	16	.	.	.	.	.	.	.	.	.	.	C	3.509	-0.100261	0.06967	4.86E-4	0.0	ENSG00000007541	ENST00000409527;ENST00000422307;ENST00000321878;ENST00000026218	T;T;T;T	0.46819	0.86;0.99;0.86;2.16	5.16	-1.26	0.09376	.	0.647253	0.17145	N	0.185285	T	0.31358	0.0794	L	0.33339	1.005	0.36335	D	0.859125	B;B;B	0.29886	0.11;0.26;0.004	B;B;B	0.21546	0.02;0.035;0.005	T	0.09729	-1.0661	10	0.44086	T	0.13	-1.1889	10.8095	0.46538	0.0:0.523:0.0:0.477	.	292;278;278	E7ERP4;Q9BRB3;Q9BRB3-2	.;PIGQ_HUMAN;.	M	278	ENSP00000386760:T278M;ENSP00000413753:T278M;ENSP00000326674:T278M;ENSP00000026218:T278M	ENSP00000026218:T278M	T	+	2	0	PIGQ	566146	0.964000	0.33143	0.002000	0.10522	0.396000	0.30629	1.230000	0.32612	-0.566000	0.06054	0.467000	0.42956	ACG	PIGQ	-	pfam_GlcNAc_Gpi1	ENSG00000007541		0.716	PIGQ-002	KNOWN	basic|CCDS	protein_coding	PIGQ	HGNC	protein_coding	OTTHUMT00000239270.2	-	0.00	22	0	C	NM_004204		626145	+1	tier1	-	no_errors	ENST00000026218	ensembl	human	known	74_37	missense	21.05	15	4	SNP	0.408	T
PIK3CA	5290	genome.wustl.edu	37	3	178947851	178947851	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:178947851T>G	ENST00000263967.3	+	19	2883	c.2726T>G	c.(2725-2727)tTc>tGc	p.F909C		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	909	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GTAGCTACCTTCATTTTGGGA	0.363		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	0													199.0	187.0	191.0					3																	178947851		1900	4124	6024	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2726T>G	3.37:g.178947851T>G	ENSP00000263967:p.Phe909Cys		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.F909C	ENST00000263967.3	37	c.2726	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	T	20.5	4.007111	0.75046	.	.	ENSG00000121879	ENST00000263967	T	0.76316	-1.01	5.61	4.44	0.53790	Protein kinase-like domain (1);Phosphatidylinositol 3/4-kinase, conserved site (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.84986	0.5594	M	0.62016	1.91	0.80722	D	1	D	0.89917	1.0	D	0.79108	0.992	D	0.84652	0.0701	10	0.52906	T	0.07	-12.9985	12.0397	0.53446	0.1294:0.0:0.0:0.8706	.	909	P42336	PK3CA_HUMAN	C	909	ENSP00000263967:F909C	ENSP00000263967:F909C	F	+	2	0	PIK3CA	180430545	1.000000	0.71417	0.991000	0.47740	0.978000	0.69477	7.611000	0.82962	0.939000	0.37446	0.477000	0.44152	TTC	PIK3CA	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.363	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	-	0.00	70	0	T			178947851	+1	tier1	-	no_errors	ENST00000263967	ensembl	human	known	74_37	missense	17.50	99	21	SNP	1.000	G
PIWIL2	55124	genome.wustl.edu	37	8	22167540	22167540	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:22167540G>A	ENST00000454009.2	+	15	2262	c.1753G>A	c.(1753-1755)Gaa>Aaa	p.E585K	PIWIL2_ENST00000521356.1_Missense_Mutation_p.E585K|PIWIL2_ENST00000356766.6_Missense_Mutation_p.E585K	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	585					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		CACATCTCAGGAACTAAACTG	0.383																																																	0													123.0	123.0	123.0					8																	22167540		2203	4300	6503	SO:0001583	missense	0			AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.1753G>A	8.37:g.22167540G>A	ENSP00000406956:p.Glu585Lys		A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.E585K	ENST00000454009.2	37	c.1753	CCDS6029.1	8	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777403	0.49786	.	.	ENSG00000197181	ENST00000356766;ENST00000521356;ENST00000454009	T;T;T	0.05855	3.38;3.38;3.38	6.03	6.03	0.97812	Ribonuclease H-like (1);	0.251786	0.43747	D	0.000526	T	0.09158	0.0226	M	0.62723	1.935	0.37899	D	0.930986	B;B	0.06786	0.001;0.001	B;B	0.12156	0.007;0.007	T	0.19224	-1.0312	10	0.06891	T	0.86	-17.3717	17.4736	0.87653	0.0:0.0:1.0:0.0	.	585;585	E7ECA4;Q8TC59	.;PIWL2_HUMAN	K	585	ENSP00000349208:E585K;ENSP00000428267:E585K;ENSP00000406956:E585K	ENSP00000349208:E585K	E	+	1	0	PIWIL2	22223485	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.267000	0.78462	2.861000	0.98227	0.655000	0.94253	GAA	PIWIL2	-	superfamily_RNaseH-like_dom	ENSG00000197181		0.383	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PIWIL2	HGNC	protein_coding	OTTHUMT00000375438.1	-	0.00	26	0	G			22167540	+1	tier1	-	no_errors	ENST00000356766	ensembl	human	known	74_37	missense	34.69	32	17	SNP	1.000	A
PKHD1	5314	genome.wustl.edu	37	6	51935814	51935814	+	Silent	SNP	G	G	A	rs189345248		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:51935814G>A	ENST00000371117.3	-	9	932	c.657C>T	c.(655-657)ggC>ggT	p.G219G	PKHD1_ENST00000340994.4_Silent_p.G219G	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	219	IPT/TIG 2.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CGATGTAGTCGCCTTCCACAT	0.413																																																	0			GRCh37	CS032417	PKHD1	S	rs189345248						95.0	91.0	92.0					6																	51935814		2203	4300	6503	SO:0001819	synonymous_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.657C>T	6.37:g.51935814G>A			Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.G219	ENST00000371117.3	37	c.657	CCDS4935.1	6																																																																																			PKHD1	-	NULL	ENSG00000170927		0.413	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1		0.00	17	0	G	NM_138694		51935814	-1			no_errors	ENST00000371117	ensembl	human	known	74_37	silent	9.09	30	3	SNP	0.853	A
PLCG1	5335	genome.wustl.edu	37	20	39794968	39794968	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr20:39794968G>A	ENST00000373271.1	+	17	2339	c.1934G>A	c.(1933-1935)cGc>cAc	p.R645H	PLCG1_ENST00000373272.2_Missense_Mutation_p.R645H|PLCG1_ENST00000244007.3_Missense_Mutation_p.R645H	NM_182811.1	NP_877963.1	P19174	PLCG1_HUMAN	phospholipase C, gamma 1	645	SH2 1. {ECO:0000255|PROSITE- ProRule:PRU00191}.				activation of MAPKK activity (GO:0000186)|activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cytokine-mediated signaling pathway (GO:0019221)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phospholipid catabolic process (GO:0009395)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cell projection (GO:0042995)|cell-cell junction (GO:0005911)|COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	calcium ion binding (GO:0005509)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|protein kinase binding (GO:0019901)|receptor signaling protein activity (GO:0005057)			breast(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(16)|skin(6)|urinary_tract(2)	46		Myeloproliferative disorder(115;0.00878)				GTGCCCCTGCGCTGTAATGAG	0.582																																																	0													89.0	83.0	85.0					20																	39794968		2203	4300	6503	SO:0001583	missense	0			M34667	CCDS13313.1, CCDS13314.1	20q12-q13.1	2013-02-14	2004-01-29		ENSG00000124181	ENSG00000124181	3.1.4.11	"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"", ""SH2 domain containing"""	9065	protein-coding gene	gene with protein product		172420	"""phospholipase C, gamma 1 (formerly subtype 148)"""	PLC1		2167438, 3254788	Standard	NM_182811		Approved	PLC148, PLC-II, PLCgamma1, NCKAP3	uc002xjo.1	P19174	OTTHUMG00000033082	ENST00000373271.1:c.1934G>A	20.37:g.39794968G>A	ENSP00000362368:p.Arg645His		B7ZLY7|B9EGH4|E1P5W4|Q2V575	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_Pleckstrin_homology,pfam_C2_dom,pfam_SH3_domain,pfam_SH3_2,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_dom,pirsf_PLC-gamma,pfscan_EF_hand_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2	p.R645H	ENST00000373271.1	37	c.1934	CCDS13314.1	20	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313193	0.81358	.	.	ENSG00000124181	ENST00000244007;ENST00000373271;ENST00000373272	D;D;D	0.93019	-3.15;-3.15;-3.15	5.6	5.6	0.85130	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);Pleckstrin homology domain (1);SH2 motif (3);	0.000000	0.85682	D	0.000000	D	0.97442	0.9163	M	0.89904	3.07	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.938;0.973	D	0.97909	1.0307	10	0.87932	D	0	.	19.6109	0.95606	0.0:0.0:1.0:0.0	.	645;645;645	P19174-2;P19174;A2A284	.;PLCG1_HUMAN;.	H	645	ENSP00000244007:R645H;ENSP00000362368:R645H;ENSP00000362369:R645H	ENSP00000244007:R645H	R	+	2	0	PLCG1	39228382	1.000000	0.71417	1.000000	0.80357	0.289000	0.27227	9.869000	0.99810	2.653000	0.90120	0.491000	0.48974	CGC	PLCG1	-	superfamily_PLC-like_Pdiesterase_TIM-brl,smart_Pleckstrin_homology,smart_SH2,pirsf_PLC-gamma,pfscan_SH2	ENSG00000124181		0.582	PLCG1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCG1	HGNC	protein_coding	OTTHUMT00000080514.3	-	0.00	39	0	G	NM_182811		39794968	+1	tier1	-	no_errors	ENST00000244007	ensembl	human	known	74_37	missense	50.65	38	39	SNP	1.000	A
PLS3	5358	genome.wustl.edu	37	X	114863595	114863595	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:114863595G>T	ENST00000420625.2	+	4	457	c.323G>T	c.(322-324)gGa>gTa	p.G108V	PLS3_ENST00000539310.1_Missense_Mutation_p.G63V|PLS3_ENST00000537301.1_Missense_Mutation_p.G86V|PLS3_ENST00000289290.3_Missense_Mutation_p.G63V|PLS3_ENST00000355899.3_Missense_Mutation_p.G108V	NM_001136025.3|NM_001172335.1|NM_001282338.1	NP_001129497.1|NP_001165806.1|NP_001269267.1	P13797	PLST_HUMAN	plastin 3	108					bone development (GO:0060348)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)	26						GCTCTGGGTGGAACTTCAGAG	0.383																																					Colon(160;1047 1864 8490 12969 29601)												0													129.0	114.0	119.0					X																	114863595		2203	4300	6503	SO:0001583	missense	0			L05491	CCDS14568.1, CCDS65312.1	Xq23	2013-01-10	2010-02-10		ENSG00000102024	ENSG00000102024		"""EF-hand domain containing"""	9091	protein-coding gene	gene with protein product		300131	"""plastin 3 (T isoform)"""			8428952	Standard	NM_005032		Approved	T-plastin	uc004eqe.3	P13797	OTTHUMG00000022237	ENST00000420625.2:c.323G>T	X.37:g.114863595G>T	ENSP00000398945:p.Gly108Val		A8K579|B1AQ09|B4DGB4|B7Z6M1|Q86YI6	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_dom,smart_CH-domain,pfscan_CH-domain,pfscan_EF_hand_dom	p.G108V	ENST00000420625.2	37	c.323	CCDS14568.1	X	.	.	.	.	.	.	.	.	.	.	G	25.3	4.622540	0.87460	.	.	ENSG00000102024	ENST00000355899;ENST00000537301;ENST00000289290;ENST00000420625;ENST00000539310	T;D;T;T;T	0.84660	-0.63;-1.88;0.98;-0.63;0.98	4.86	4.86	0.63082	.	0.048580	0.85682	D	0.000000	D	0.92760	0.7698	M	0.86953	2.85	0.80722	D	1	D;D;P	0.69078	0.997;0.961;0.871	D;P;P	0.68765	0.96;0.653;0.548	D	0.94084	0.7347	10	0.87932	D	0	-1.4824	15.6626	0.77199	0.0:0.0:1.0:0.0	.	81;86;108	B4DPW9;B4DGB4;P13797	.;.;PLST_HUMAN	V	108;86;63;108;63	ENSP00000348163:G108V;ENSP00000445105:G86V;ENSP00000289290:G63V;ENSP00000398945:G108V;ENSP00000445339:G63V	ENSP00000289290:G63V	G	+	2	0	PLS3	114769851	1.000000	0.71417	0.995000	0.50966	0.852000	0.48524	9.657000	0.98554	2.256000	0.74724	0.594000	0.82650	GGA	PLS3	-	NULL	ENSG00000102024		0.383	PLS3-201	KNOWN	basic|CCDS	protein_coding	PLS3	HGNC	protein_coding	OTTHUMT00000057976.2	-	0.00	38	0	G			114863595	+1	tier1	-	no_errors	ENST00000355899	ensembl	human	known	74_37	missense	25.93	40	14	SNP	1.000	T
PLXNB3	5365	genome.wustl.edu	37	X	153039000	153039000	+	Silent	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:153039000C>A	ENST00000361971.5	+	19	3225	c.3111C>A	c.(3109-3111)ggC>ggA	p.G1037G	PLXNB3_ENST00000538776.1_Silent_p.G690G|PLXNB3_ENST00000538966.1_Silent_p.G1060G|SRPK3_ENST00000489426.1_5'Flank|PLXNB3_ENST00000538282.1_Silent_p.G647G	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	1037	IPT/TIG 3.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					GTGTCAGGGGCACCGGCCTAG	0.687																																																	0													23.0	23.0	23.0					X																	153039000		2187	4273	6460	SO:0001819	synonymous_variant	0			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.3111C>A	X.37:g.153039000C>A			B7Z3E6|F5H773|Q9HDA4	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT,pfam_Plexin_repeat,pfam_Semap_dom,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.G1060	ENST00000361971.5	37	c.3180	CCDS14729.1	X																																																																																			PLXNB3	-	superfamily_Ig_E-set,smart_IPT	ENSG00000198753		0.687	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLXNB3	HGNC	protein_coding	OTTHUMT00000061063.1	-	0.00	9	0	C			153039000	+1	tier1	-	no_errors	ENST00000538966	ensembl	human	known	74_37	silent	63.16	7	12	SNP	0.913	A
PNLIPRP3	119548	genome.wustl.edu	37	10	118236293	118236293	+	Silent	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr10:118236293A>G	ENST00000369230.3	+	11	1448	c.1302A>G	c.(1300-1302)gcA>gcG	p.A434A		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	434	PLAT.				lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)	p.A434A(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		AGTTGGGAGCAGAAATGGTGA	0.308																																																	1	Substitution - coding silent(1)	large_intestine(1)											93.0	98.0	96.0					10																	118236293		2203	4300	6503	SO:0001819	synonymous_variant	0			BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.1302A>G	10.37:g.118236293A>G				Silent	SNP	pfam_Lipase_N,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase,prints_Lipase_panc	p.A434	ENST00000369230.3	37	c.1302	CCDS31292.1	10																																																																																			PNLIPRP3	-	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH	ENSG00000203837		0.308	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIPRP3	HGNC	protein_coding	OTTHUMT00000050520.1	-	0.00	51	0	A	XM_058404		118236293	+1	tier1	-	no_errors	ENST00000369230	ensembl	human	known	74_37	silent	29.31	41	17	SNP	1.000	G
PNMAL2	57469	genome.wustl.edu	37	19	46998401	46998401	+	Missense_Mutation	SNP	G	G	A	rs538950722		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:46998401G>A	ENST00000377655.2	-	1	321	c.322C>T	c.(322-324)Cgc>Tgc	p.R108C	PNMAL2_ENST00000594749.1_Intron|PNMAL2_ENST00000599531.1_Missense_Mutation_p.R108C|AC011484.1_ENST00000377652.3_Missense_Mutation_p.R171H			Q9ULN7	PNML2_HUMAN	paraneoplastic Ma antigen family-like 2	108										central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(4)	8		Ovarian(192;0.00965)|all_neural(266;0.0459)		OV - Ovarian serous cystadenocarcinoma(262;0.000322)|all cancers(93;0.00233)|GBM - Glioblastoma multiforme(486;0.0421)|Epithelial(262;0.0427)		AGCAGCAGGCGTCTCATCTGC	0.687													G|||	1	0.000199681	0.0	0.0	5008	,	,		16145	0.0		0.0	False		,,,				2504	0.001																0													92.0	98.0	96.0					19																	46998401		2203	4300	6503	SO:0001583	missense	0			AB033009	CCDS59400.1	19q13.32	2014-02-12	2012-02-09		ENSG00000204851	ENSG00000204851		"""Paraneoplastic Ma antigens"""	29206	protein-coding gene	gene with protein product			"""PNMA-like 2"""			10574461	Standard	NM_020709		Approved	KIAA1183	uc002pes.2	Q9ULN7		ENST00000377655.2:c.322C>T	19.37:g.46998401G>A	ENSP00000366883:p.Arg108Cys		C9JGD5|M0R374|Q08E79|Q0D2F9|Q6ZVD1	Missense_Mutation	SNP	NULL	p.R108C	ENST00000377655.2	37	c.322		19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.18|19.18	3.778193|3.778193	0.70107|0.70107	.|.	.|.	ENSG00000204851|ENSG00000204850	ENST00000377655|ENST00000377652	T|.	0.10099|.	2.91|.	2.87|2.87	0.667|0.667	0.17907|0.17907	.|.	.|.	.|.	.|.	.|.	T|T	0.16642|0.16642	0.0400|0.0400	L|L	0.29908|0.29908	0.895|0.895	0.09310|0.09310	N|N	1|1	P|P	0.37352|0.39535	0.591|0.677	B|B	0.27170|0.31290	0.077|0.127	T|T	0.15235|0.15235	-1.0444|-1.0444	9|8	0.39692|0.87932	T|D	0.17|0	-3.2221|-3.2221	4.2347|4.2347	0.10620|0.10620	0.1373:0.2382:0.6245:0.0|0.1373:0.2382:0.6245:0.0	.|.	108|171	Q9ULN7|Q6ZVU4	PNML2_HUMAN|.	C|H	108|171	ENSP00000366883:R108C|.	ENSP00000366883:R108C|ENSP00000366880:R171H	R|R	-|+	1|2	0|0	PNMAL2|AC011484.1	51690241|51690241	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.745000|0.745000	0.42441|0.42441	0.310000|0.310000	0.19356|0.19356	0.249000|0.249000	0.21456|0.21456	0.561000|0.561000	0.74099|0.74099	CGC|CGT	PNMAL2	-	NULL	ENSG00000204851		0.687	PNMAL2-201	KNOWN	basic	protein_coding	PNMAL2	HGNC	protein_coding		-	0.00	47	0	G	NM_020709		46998401	-1	tier1	-	no_errors	ENST00000599531	ensembl	human	known	74_37	missense	36.17	30	17	SNP	0.002	A
PNMT	5409	genome.wustl.edu	37	17	37826276	37826276	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:37826276G>A	ENST00000269582.2	+	3	801	c.483G>A	c.(481-483)caG>caA	p.Q161Q	PNMT_ENST00000394246.1_Silent_p.Q63Q|PNMT_ENST00000581428.1_3'UTR	NM_002686.3	NP_002677.1	P11086	PNMT_HUMAN	phenylethanolamine N-methyltransferase	161					catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|epinephrine biosynthetic process (GO:0042418)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phenylethanolamine N-methyltransferase activity (GO:0004603)			NS(1)|breast(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8	all_cancers(6;6.59e-85)|all_epithelial(6;2.89e-103)|Breast(7;1.05e-86)|Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;3.87e-45)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			ACGTGCACCAGCCCCAGCCCC	0.657																																																	0													36.0	39.0	38.0					17																	37826276		2203	4299	6502	SO:0001819	synonymous_variant	0				CCDS11343.1	17q	2010-04-16			ENSG00000141744	ENSG00000141744	2.1.1.28		9160	protein-coding gene	gene with protein product		171190		PENT		3372503	Standard	NM_002686		Approved		uc002hsi.2	P11086	OTTHUMG00000133209	ENST00000269582.2:c.483G>A	17.37:g.37826276G>A				Silent	SNP	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	p.Q161	ENST00000269582.2	37	c.483	CCDS11343.1	17																																																																																			PNMT	-	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	ENSG00000141744		0.657	PNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNMT	HGNC	protein_coding	OTTHUMT00000256923.2	-	0.00	43	0	G	NM_002686		37826276	+1	tier1	-	no_errors	ENST00000269582	ensembl	human	known	74_37	silent	43.95	374	294	SNP	1.000	A
POLE	5426	genome.wustl.edu	37	12	133219838	133219838	+	Missense_Mutation	SNP	C	C	T	rs142508245		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:133219838C>T	ENST00000320574.5	-	35	4566	c.4523G>A	c.(4522-4524)cGc>cAc	p.R1508H	POLE_ENST00000535270.1_Missense_Mutation_p.R1481H|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1508					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GGATGCCCTGCGCTGTGAGGG	0.592								DNA polymerases (catalytic subunits)					C|||	1	0.000199681	0.0	0.0	5008	,	,		21380	0.0		0.001	False		,,,				2504	0.0																0								C	HIS/ARG	11,4395	17.9+/-39.9	0,11,2192	109.0	97.0	101.0		4523	5.1	1.0	12	dbSNP_134	101	12,8588	9.1+/-34.3	0,12,4288	yes	missense	POLE	NM_006231.2	29	0,23,6480	TT,TC,CC		0.1395,0.2497,0.1768	benign	1508/2287	133219838	23,12983	2203	4300	6503	SO:0001583	missense	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4523G>A	12.37:g.133219838C>T	ENSP00000322570:p.Arg1508His		Q13533|Q86VH9	Missense_Mutation	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.R1508H	ENST00000320574.5	37	c.4523	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	C	13.25	2.181419	0.38511	0.002497	0.001395	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.02737	4.18;4.18;4.18	5.96	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.04272	0.0118	L	0.42245	1.32	0.58432	D	0.999999	B;B	0.12013	0.005;0.002	B;B	0.08055	0.003;0.001	T	0.38067	-0.9678	10	0.49607	T	0.09	.	15.3897	0.74731	0.0:0.9333:0.0:0.0667	.	1481;1508	F5H1D6;Q07864	.;DPOE1_HUMAN	H	1508;1519;1481	ENSP00000322570:R1508H;ENSP00000406383:R1519H;ENSP00000445753:R1481H	ENSP00000322570:R1508H	R	-	2	0	POLE	131729911	1.000000	0.71417	0.999000	0.59377	0.090000	0.18270	5.993000	0.70616	1.523000	0.49018	-0.137000	0.14449	CGC	POLE	-	NULL	ENSG00000177084		0.592	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	-	0.00	8	0	C	NM_006231		133219838	-1	tier1	rs142508245	no_errors	ENST00000320574	ensembl	human	known	74_37	missense	60.00	6	9	SNP	1.000	T
PPP1R37	284352	genome.wustl.edu	37	19	45649041	45649041	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:45649041G>A	ENST00000221462.4	+	11	2091	c.1727G>A	c.(1726-1728)aGc>aAc	p.S576N	PPP1R37_ENST00000421905.1_Missense_Mutation_p.S572N	NM_019121.1	NP_061994.1	O75864	PPR37_HUMAN	protein phosphatase 1, regulatory subunit 37	576	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										CGGGTGGAGAGCCCGCCCGAG	0.736																																																	0																																										SO:0001583	missense	0			BC035704	CCDS56096.1	19q13.32	2012-04-17	2011-10-11	2011-10-11	ENSG00000104866	ENSG00000104866		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	27607	protein-coding gene	gene with protein product			"""leucine rich repeat containing 68"""	LRRC68		12477932	Standard	NM_019121		Approved		uc021uvs.1	O75864	OTTHUMG00000168143	ENST00000221462.4:c.1727G>A	19.37:g.45649041G>A	ENSP00000221462:p.Ser576Asn		B5MDA4|Q8IWK3|Q8TF16	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.S576N	ENST00000221462.4	37	c.1727	CCDS56096.1	19	.	.	.	.	.	.	.	.	.	.	G	13.07	2.125994	0.37533	.	.	ENSG00000104866	ENST00000421905;ENST00000221462	T;T	0.72615	-0.67;-0.39	4.36	4.36	0.52297	.	.	.	.	.	T	0.59046	0.2165	L	0.40543	1.245	0.28951	N	0.890387	P	0.39181	0.663	B	0.36092	0.217	T	0.58244	-0.7670	9	0.48119	T	0.1	0.2298	8.0952	0.30824	0.1091:0.0:0.8909:0.0	.	576	B5MDA4	.	N	572;576	ENSP00000390861:S572N;ENSP00000221462:S576N	ENSP00000221462:S576N	S	+	2	0	LRRC68	50340881	1.000000	0.71417	0.998000	0.56505	0.730000	0.41778	3.234000	0.51320	2.257000	0.74773	0.462000	0.41574	AGC	PPP1R37	-	NULL	ENSG00000104866		0.736	PPP1R37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R37	HGNC	protein_coding	OTTHUMT00000398356.2	-	0.00	19	0	G	NM_173634		45649041	+1	tier1	-	no_errors	ENST00000221462	ensembl	human	known	74_37	missense	43.75	9	7	SNP	1.000	A
PPP1R42	286187	genome.wustl.edu	37	8	67926793	67926793	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:67926793A>G	ENST00000324682.5	-	3	308	c.164T>C	c.(163-165)tTa>tCa	p.L55S	PPP1R42_ENST00000522909.1_Missense_Mutation_p.L55S|PPP1R42_ENST00000517834.1_Intron	NM_001013626.2	NP_001013648.1	Q7Z4L9	PPR42_HUMAN	protein phosphatase 1, regulatory subunit 42	55					regulation of phosphatase activity (GO:0010921)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|manchette (GO:0002177)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)	actin binding (GO:0003779)|dynein binding (GO:0045502)|tubulin binding (GO:0015631)										ATATAAATATAAAACACTAAG	0.289																																																	0													51.0	60.0	57.0					8																	67926793		2196	4288	6484	SO:0001583	missense	0			BC055413	CCDS34902.1	8q13.1-q13.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000178125	ENSG00000178125		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	33732	protein-coding gene	gene with protein product	"""testis leucine-rich repeat"""		"""leucine rich repeat containing 67"""	LRRC67			Standard	NM_001013626		Approved	dtr, TLLR	uc003xxc.3	Q7Z4L9	OTTHUMG00000164745	ENST00000324682.5:c.164T>C	8.37:g.67926793A>G	ENSP00000315035:p.Leu55Ser			Missense_Mutation	SNP	pfam_Leu-rich_rpt	p.L55S	ENST00000324682.5	37	c.164	CCDS34902.1	8	.	.	.	.	.	.	.	.	.	.	A	25.3	4.620991	0.87460	.	.	ENSG00000178125	ENST00000522909;ENST00000421742;ENST00000324682	T;T	0.67698	0.26;-0.28	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	D	0.89466	0.6723	H	0.99011	4.4	0.52099	D	0.999946	D	0.89917	1.0	D	0.91635	0.999	D	0.93677	0.6995	10	0.87932	D	0	-5.8764	16.0711	0.80936	1.0:0.0:0.0:0.0	.	55	Q7Z4L9-2	.	S	55	ENSP00000429721:L55S;ENSP00000315035:L55S	ENSP00000315035:L55S	L	-	2	0	LRRC67	68089347	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.000000	0.93564	2.197000	0.70478	0.482000	0.46254	TTA	PPP1R42	-	NULL	ENSG00000178125		0.289	PPP1R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R42	HGNC	protein_coding	OTTHUMT00000380034.2		0.00	14	0	A	NM_001013626		67926793	-1			no_errors	ENST00000522909	ensembl	human	known	74_37	missense	12.24	43	6	SNP	1.000	G
PPP4R1	9989	genome.wustl.edu	37	18	9595065	9595065	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr18:9595065G>T	ENST00000400556.3	-	3	212	c.139C>A	c.(139-141)Ccc>Acc	p.P47T	PPP4R1_ENST00000580583.1_5'Flank|PPP4R1_ENST00000400555.3_Missense_Mutation_p.P30T	NM_001042388.2	NP_001035847.1	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	47					dephosphorylation (GO:0016311)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase 4 complex (GO:0030289)	protein phosphatase type 4 regulator activity (GO:0030362)			large_intestine(1)|skin(2)	3						CTCCCCAGGGGCGTCAACATT	0.413																																					Melanoma(188;1232 2082 5061 11948 35994)												0													149.0	136.0	140.0					18																	9595065		1883	4114	5997	SO:0001583	missense	0			AF111106	CCDS42412.1, CCDS42413.1	18p11.22	2010-06-18			ENSG00000154845	ENSG00000154845		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	9320	protein-coding gene	gene with protein product		604908				10026142	Standard	NM_001042388		Approved	PP4R1	uc002koe.2	Q8TF05	OTTHUMG00000137466	ENST00000400556.3:c.139C>A	18.37:g.9595065G>T	ENSP00000383402:p.Pro47Thr		Q99774|Q9UNQ7	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.P47T	ENST00000400556.3	37	c.139	CCDS42412.1	18	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081278	0.36758	.	.	ENSG00000154845	ENST00000400556;ENST00000400555	T;T	0.31769	1.48;1.48	4.66	3.77	0.43336	Armadillo-like helical (1);Armadillo-type fold (1);	0.130879	0.51477	D	0.000085	T	0.52629	0.1746	M	0.65975	2.015	0.53005	D	0.999964	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.992;0.992;0.996	T	0.54302	-0.8314	9	.	.	.	-16.4614	15.1049	0.72312	0.0:0.1424:0.8576:0.0	.	30;47;30	A8K923;Q8TF05;Q8TF05-2	.;PP4R1_HUMAN;.	T	47;30	ENSP00000383402:P47T;ENSP00000383401:P30T	.	P	-	1	0	PPP4R1	9585065	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	9.134000	0.94467	1.299000	0.44798	0.563000	0.77884	CCC	PPP4R1	-	superfamily_ARM-type_fold	ENSG00000154845		0.413	PPP4R1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP4R1	HGNC	protein_coding	OTTHUMT00000268571.1	-	0.00	47	0	G	NM_005134		9595065	-1	tier1	-	no_errors	ENST00000400556	ensembl	human	known	74_37	missense	10.34	52	6	SNP	1.000	T
PRAMEF11	440560	genome.wustl.edu	37	1	12888666	12888666	+	Splice_Site	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:12888666T>G	ENST00000535591.1	-	2	55		c.e2-2			NM_001146344.1	NP_001139816.1	O60813	PRA11_HUMAN	PRAME family member 11						negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|lung(7)|pancreas(2)|skin(4)|urinary_tract(1)	27						CAGGGAAAACTTCCAGAGGAC	0.557																																																	0																																										SO:0001630	splice_region_variant	0			AL049680	CCDS53268.1	1p36.21	2013-01-17			ENSG00000204513	ENSG00000239810		"""-"""	14086	protein-coding gene	gene with protein product							Standard	XM_006710645		Approved		uc001auk.2	O60813	OTTHUMG00000001929	ENST00000535591.1:c.141-2A>C	1.37:g.12888666T>G				Splice_Site	SNP	-	e1-2	ENST00000535591.1	37	c.1-2	CCDS53268.1	1																																																																																			PRAMEF11	-	-	ENSG00000204513		0.557	PRAMEF11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF11	HGNC	protein_coding		-	0.00	284	0	T	XM_496341	Intron	12888666	-1	tier1	-	no_errors	ENST00000535591	ensembl	human	known	74_37	splice_site	13.33	247	38	SNP	0.000	G
PRB3	5544	genome.wustl.edu	37	12	11420304	11420304	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:11420304G>A	ENST00000381842.3	-	5	789	c.752C>T	c.(751-753)cCa>cTa	p.P251L	PRB3_ENST00000279573.7_Silent_p.P293P|PRB3_ENST00000538488.1_Missense_Mutation_p.P251L|PRB3_ENST00000440870.3_5'UTR	NM_006249.4	NP_006240.4	Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	251	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.				defense response to Gram-negative bacterium (GO:0050829)	extracellular region (GO:0005576)				breast(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(5)	25			OV - Ovarian serous cystadenocarcinoma(49;0.201)			ACCTTCTTGTGGGGGTGGTCC	0.612																																																	0													169.0	194.0	185.0					12																	11420304		2189	4292	6481	SO:0001583	missense	0					12p13.2	2012-10-02				ENSG00000197870			9339	protein-coding gene	gene with protein product		168840				1894623	Standard	NM_006249		Approved	PRG	uc001qzs.3	Q04118		ENST00000381842.3:c.752C>T	12.37:g.11420304G>A	ENSP00000371264:p.Pro251Leu		Q15188|Q4VAY3|Q4VAY4|Q7M4M9|Q9UCT9	Missense_Mutation	SNP	NULL	p.P251L	ENST00000381842.3	37	c.752		12	.	.	.	.	.	.	.	.	.	.	.	9.245	1.039224	0.19669	.	.	ENSG00000197870	ENST00000381842;ENST00000538488	T;T	0.08896	3.04;3.04	0.704	0.704	0.18121	.	.	.	.	.	T	0.06735	0.0172	.	.	.	0.09310	N	0.99999	B	0.23540	0.087	B	0.18263	0.021	T	0.33240	-0.9876	8	0.72032	D	0.01	.	7.2501	0.26144	1.0E-4:0.0:0.9999:0.0	.	251	Q04118	PRB3_HUMAN	L	251	ENSP00000371264:P251L;ENSP00000442626:P251L	ENSP00000371264:P251L	P	-	2	0	PRB3	11311571	0.002000	0.14202	0.012000	0.15200	0.285000	0.27093	0.175000	0.16762	0.653000	0.30826	0.298000	0.19748	CCA	PRB3	-	NULL	ENSG00000197870		0.612	PRB3-201	KNOWN	basic|appris_candidate_longest	protein_coding	PRB3	HGNC	protein_coding		-	0.00	140	0	G	NM_006249		11420304	-1	tier1	-	no_errors	ENST00000381842	ensembl	human	known	74_37	missense	6.67	168	12	SNP	0.335	A
PRL	5617	genome.wustl.edu	37	6	22292815	22292815	+	Silent	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:22292815A>C	ENST00000306482.1	-	3	782	c.264T>G	c.(262-264)acT>acG	p.T88T	RP3-404K8.2_ENST00000561912.1_RNA	NM_000948.5|NM_001163558.2	NP_000939.1|NP_001157030.1	P01236	PRL_HUMAN	prolactin	88					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|circadian rhythm (GO:0007623)|female pregnancy (GO:0007565)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|multicellular organismal response to stress (GO:0033555)|ovulation cycle (GO:0042698)|parturition (GO:0007567)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of JAK-STAT cascade (GO:0046427)|regulation of multicellular organism growth (GO:0040014)|regulation of ossification (GO:0030278)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	prolactin receptor binding (GO:0005148)			NS(1)|endometrium(2)|large_intestine(6)|lung(6)|prostate(1)	16	Ovarian(93;0.163)					CAAGGGAAGAAGTGTGGCAGC	0.488																																																	0													146.0	122.0	130.0					6																	22292815		2203	4300	6503	SO:0001819	synonymous_variant	0			D00411	CCDS4548.1	6p22.3	2013-09-16			ENSG00000172179	ENSG00000172179			9445	protein-coding gene	gene with protein product		176760					Standard	NM_000948		Approved		uc003ndq.3	P01236	OTTHUMG00000016111	ENST00000306482.1:c.264T>G	6.37:g.22292815A>C			Q15199|Q92996	Silent	SNP	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	p.T88	ENST00000306482.1	37	c.264	CCDS4548.1	6																																																																																			PRL	-	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	ENSG00000172179		0.488	PRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRL	HGNC	protein_coding	OTTHUMT00000043327.1	-	0.00	79	0	A	NM_000948		22292815	-1	tier1	-	no_errors	ENST00000306482	ensembl	human	known	74_37	silent	10.07	125	14	SNP	0.172	C
PRDM13	59336	genome.wustl.edu	37	6	100060981	100060981	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:100060981G>A	ENST00000369215.4	+	4	775	c.470G>A	c.(469-471)cGt>cAt	p.R157H		NM_021620.3	NP_067633.2	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	157					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(1)	17		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		GCACACCTGCGTTTCCACTGC	0.627																																																	0													40.0	42.0	41.0					6																	100060981		2040	4182	6222	SO:0001583	missense	0			AY004253	CCDS43487.1	6q16.2	2012-03-28			ENSG00000112238	ENSG00000112238			13998	protein-coding gene	gene with protein product							Standard	NM_021620		Approved		uc003pqg.1	Q9H4Q3	OTTHUMG00000015269	ENST00000369215.4:c.470G>A	6.37:g.100060981G>A	ENSP00000358217:p.Arg157His		Q5TGC1|Q5TGC2	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.R157H	ENST00000369215.4	37	c.470	CCDS43487.1	6	.	.	.	.	.	.	.	.	.	.	G	11.06	1.528216	0.27299	.	.	ENSG00000112238	ENST00000369215;ENST00000369214	T;T	0.58506	0.33;0.33	5.49	4.51	0.55191	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.170375	0.28343	N	0.015699	T	0.37019	0.0988	M	0.78456	2.415	0.41295	D	0.987005	B	0.18610	0.029	B	0.10450	0.005	T	0.48948	-0.8989	10	0.32370	T	0.25	-13.2012	3.7815	0.08682	0.3378:0.0:0.6622:0.0	.	157	Q9H4Q3	PRD13_HUMAN	H	157;167	ENSP00000358217:R157H;ENSP00000358216:R167H	ENSP00000358216:R167H	R	+	2	0	PRDM13	100167702	1.000000	0.71417	0.985000	0.45067	0.970000	0.65996	4.853000	0.62911	2.579000	0.87056	0.557000	0.71058	CGT	PRDM13	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000112238		0.627	PRDM13-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRDM13	HGNC	protein_coding	OTTHUMT00000041619.2	-	0.00	40	0	G			100060981	+1	tier1	-	no_errors	ENST00000369215	ensembl	human	known	74_37	missense	10.29	61	7	SNP	0.999	A
PRSS1	5644	genome.wustl.edu	37	7	142459717	142459717	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr7:142459717A>G	ENST00000311737.7	+	3	299	c.293A>G	c.(292-294)cAa>cGa	p.Q98R	PRSS1_ENST00000486171.1_Missense_Mutation_p.Q112R	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	98	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	CGCCACCCCCAATACGACAGG	0.547																																																	0													234.0	219.0	224.0					7																	142459717		2203	4300	6503	SO:0001583	missense	0			M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.293A>G	7.37:g.142459717A>G	ENSP00000308720:p.Gln98Arg		A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.Q98R	ENST00000311737.7	37	c.293	CCDS5872.1	7	.	.	.	.	.	.	.	.	.	.	A	0.507	-0.868103	0.02590	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243;ENST00000492062	D;D;T	0.92858	-3.12;-3.12;-1.49	3.28	-6.56	0.01848	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.293800	0.04657	N	0.408175	D	0.84275	0.5436	N	0.20574	0.59	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.70648	-0.4814	10	0.27785	T	0.31	.	12.9713	0.58513	0.3763:0.0:0.6237:0.0	.	112;98	E7EQ64;P07477	.;TRY1_HUMAN	R	112;98;88;48	ENSP00000417854:Q112R;ENSP00000308720:Q98R;ENSP00000419912:Q48R	ENSP00000308720:Q98R	Q	+	2	0	PRSS1	142139291	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.668000	0.01959	-1.697000	0.01420	-0.554000	0.04202	CAA	PRSS1	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000204983		0.547	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS1	HGNC	protein_coding	OTTHUMT00000352538.2	-	0.00	95	0	A			142459717	+1	tier1	-	no_errors	ENST00000311737	ensembl	human	known	74_37	missense	8.75	73	7	SNP	0.000	G
PTCHD2	57540	genome.wustl.edu	37	1	11562884	11562884	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:11562884G>A	ENST00000294484.6	+	3	1384	c.1246G>A	c.(1246-1248)Gag>Aag	p.E416K	PTCHD2_ENST00000389575.3_Missense_Mutation_p.E416K	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	416					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		TGACCGCTGGGAGGAACAACG	0.567																																																	0													92.0	94.0	93.0					1																	11562884		2002	4177	6179	SO:0001583	missense	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.1246G>A	1.37:g.11562884G>A	ENSP00000294484:p.Glu416Lys		Q5VTU9|Q9UJD6	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL_dom,pfscan_SSD	p.E416K	ENST00000294484.6	37	c.1246	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	G	19.64	3.864728	0.71949	.	.	ENSG00000204624	ENST00000294484;ENST00000389575	D;D	0.86030	-2.06;-2.06	6.08	6.08	0.98989	.	0.376195	0.29185	N	0.012886	D	0.82912	0.5140	L	0.36672	1.1	0.40640	D	0.981937	P	0.43938	0.822	P	0.45794	0.493	T	0.78889	-0.2026	10	0.16420	T	0.52	-34.0868	19.2272	0.93822	0.0:0.0:1.0:0.0	.	416	Q9P2K9	PTHD2_HUMAN	K	416	ENSP00000294484:E416K;ENSP00000374226:E416K	ENSP00000294484:E416K	E	+	1	0	PTCHD2	11485471	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.420000	0.52735	2.894000	0.99253	0.655000	0.94253	GAG	PTCHD2	-	pfam_Patched	ENSG00000204624		0.567	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	-	0.00	67	0	G	XM_052561		11562884	+1	tier1	-	no_errors	ENST00000294484	ensembl	human	known	74_37	missense	13.79	50	8	SNP	1.000	A
PXDN	7837	genome.wustl.edu	37	2	1652615	1652615	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:1652615G>A	ENST00000252804.4	-	17	2987	c.2937C>T	c.(2935-2937)aaC>aaT	p.N979N		NM_012293.1	NP_036425.1	Q92626	PXDN_HUMAN	peroxidasin homolog (Drosophila)	979					extracellular matrix organization (GO:0030198)|hydrogen peroxide catabolic process (GO:0042744)|immune response (GO:0006955)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|oxidation-reduction process (GO:0055114)	endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heme binding (GO:0020037)|interleukin-1 receptor antagonist activity (GO:0005152)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(24)|lung(48)|ovary(3)|pancreas(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	112	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		CCAGCTGCTCGTTGGCGCGGT	0.692																																																	0													18.0	19.0	19.0					2																	1652615		2132	4223	6355	SO:0001819	synonymous_variant	0			AF200348	CCDS46221.1	2p25.3	2013-01-11			ENSG00000130508	ENSG00000130508		"""Immunoglobulin superfamily / I-set domain containing"""	14966	protein-coding gene	gene with protein product		605158				10441517, 9039502	Standard	XM_005264707		Approved	KIAA0230, PRG2, MG50, D2S448, D2S448E, PXN	uc002qxa.3	Q92626	OTTHUMG00000059697	ENST00000252804.4:c.2937C>T	2.37:g.1652615G>A			A8QM65|D6W4Y0|Q4KMG2	Silent	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.N979	ENST00000252804.4	37	c.2937	CCDS46221.1	2																																																																																			PXDN	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,prints_Haem_peroxidase_animal_subgr,pfscan_Haem_peroxidase_animal	ENSG00000130508		0.692	PXDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDN	HGNC	protein_coding	OTTHUMT00000322505.1		0.00	23	0	G	XM_056455		1652615	-1			no_errors	ENST00000252804	ensembl	human	known	74_37	silent	20.00	24	6	SNP	0.996	A
PXDNL	137902	genome.wustl.edu	37	8	52320958	52320958	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:52320958C>T	ENST00000356297.4	-	17	3326	c.3226G>A	c.(3226-3228)Gaa>Aaa	p.E1076K	PXDNL_ENST00000543296.1_Missense_Mutation_p.E1076K	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	1076					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				AGGTGGCCTTCGGAAATTTCA	0.483																																																	0													58.0	61.0	60.0					8																	52320958		1898	4119	6017	SO:0001583	missense	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.3226G>A	8.37:g.52320958C>T	ENSP00000348645:p.Glu1076Lys		B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like_dom	p.E1076K	ENST00000356297.4	37	c.3226	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	C	12.52	1.963471	0.34659	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.68181	-0.31;-0.31	3.82	1.35	0.21983	.	0.380701	0.21947	N	0.066787	T	0.60104	0.2243	L	0.56199	1.76	0.27967	N	0.936562	P	0.51791	0.948	P	0.46659	0.523	T	0.56950	-0.7894	10	0.72032	D	0.01	.	4.7481	0.13047	0.0:0.4436:0.3803:0.176	.	1076	A1KZ92	PXDNL_HUMAN	K	1076	ENSP00000348645:E1076K;ENSP00000444865:E1076K	ENSP00000348645:E1076K	E	-	1	0	PXDNL	52483511	0.801000	0.28930	0.200000	0.23457	0.106000	0.19336	0.995000	0.29706	-0.076000	0.12775	0.655000	0.94253	GAA	PXDNL	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000147485		0.483	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	-	0.00	38	0	C	NM_144651		52320958	-1	tier1	-	no_errors	ENST00000356297	ensembl	human	known	74_37	missense	23.08	30	9	SNP	0.989	T
RAPGEF3	10411	genome.wustl.edu	37	12	48142277	48142277	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:48142277C>T	ENST00000449771.2	-	12	1291	c.1203G>A	c.(1201-1203)ttG>ttA	p.L401L	RAPGEF3_ENST00000549151.1_Silent_p.L359L|RAPGEF3_ENST00000171000.4_Silent_p.L359L|RAPGEF3_ENST00000395358.3_Silent_p.L401L|RAPGEF3_ENST00000548919.1_Silent_p.L359L|RAPGEF3_ENST00000389212.3_Silent_p.L401L|RAPGEF3_ENST00000405493.2_Silent_p.L359L			O95398	RPGF3_HUMAN	Rap guanine nucleotide exchange factor (GEF) 3	401	Interaction with PDE3B.|N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cAMP-mediated signaling (GO:0019933)|cell proliferation (GO:0008283)|cellular response to cAMP (GO:0071320)|energy reserve metabolic process (GO:0006112)|establishment of endothelial barrier (GO:0061028)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of stress fiber assembly (GO:0051496)|Rap protein signal transduction (GO:0032486)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cAMP-dependent protein kinase complex (GO:0005952)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase regulator activity (GO:0008603)|guanyl-nucleotide exchange factor activity (GO:0005085)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)			endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|skin(7)	25	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.0375)		CCATGGCCTCCAACAGAAGCT	0.552																																																	0													122.0	102.0	109.0					12																	48142277		2203	4300	6503	SO:0001819	synonymous_variant	0			AK092448	CCDS31784.1, CCDS41775.1	12q13.1	2006-04-12	2004-03-26		ENSG00000079337	ENSG00000079337			16629	protein-coding gene	gene with protein product	"""exchange protein directly activated by cAMP 1"""	606057	"""RAP guanine-nucleotide-exchange factor (GEF) 3"""			10777494, 9856955	Standard	NM_001098531		Approved	cAMP-GEFI, EPAC, bcm910	uc001rpz.4	O95398	OTTHUMG00000133667	ENST00000449771.2:c.1203G>A	12.37:g.48142277C>T			A8K2G5|E7EQC8|O95634|Q8WVN0	Silent	SNP	pfam_RasGRF_CDC25,pfam_cNMP-bd_dom,pfam_DEP_dom,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_cNMP-bd-like,smart_DEP_dom,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_DEP_dom,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_cAMP/cGMP_kin	p.L401	ENST00000449771.2	37	c.1203	CCDS41775.1	12																																																																																			RAPGEF3	-	pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000079337		0.552	RAPGEF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF3	HGNC	protein_coding	OTTHUMT00000257848.1	-	0.00	20	0	C	NM_006105		48142277	-1	tier1	-	no_errors	ENST00000389212	ensembl	human	known	74_37	silent	60.00	6	9	SNP	1.000	T
RBM3	5935	genome.wustl.edu	37	X	48433656	48433656	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:48433656G>A	ENST00000376759.3	+	2	151	c.88G>A	c.(88-90)Gga>Aga	p.G30R	AC115618.1_ENST00000376775.2_5'Flank|RBM3_ENST00000430348.2_5'UTR|RBM3_ENST00000466764.1_3'UTR|RBM3_ENST00000354480.2_5'Flank|RBM3_ENST00000376755.1_Missense_Mutation_p.G30R	NM_006743.4	NP_006734.1	P98179	RBM3_HUMAN	RNA binding motif (RNP1, RRM) protein 3	30	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				positive regulation of translation (GO:0045727)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|regulation of translation (GO:0006417)|response to cold (GO:0009409)|RNA processing (GO:0006396)|translation (GO:0006412)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)	4						CAGCAGTTTCGGACCTATCTC	0.498											OREG0019765	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													71.0	52.0	59.0					X																	48433656		2203	4300	6503	SO:0001583	missense	0			BC006825	CCDS14301.1	Xp11.2	2014-05-19	2004-04-23		ENSG00000102317	ENSG00000102317		"""RNA binding motif (RRM) containing"""	9900	protein-coding gene	gene with protein product		300027	"""RNA binding motif protein 3"""			8634703	Standard	NM_006743		Approved	IS1-RNPL	uc004dkf.2	P98179	OTTHUMG00000024121	ENST00000376759.3:c.88G>A	X.37:g.48433656G>A	ENSP00000365950:p.Gly30Arg	954		Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G30R	ENST00000376759.3	37	c.88	CCDS14301.1	X	.	.	.	.	.	.	.	.	.	.	G	15.85	2.953805	0.53293	.	.	ENSG00000102317	ENST00000376759;ENST00000376755	T;T	0.47177	0.85;0.85	4.48	4.48	0.54585	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.56097	U	0.000033	T	0.69735	0.3144	H	0.94222	3.51	0.80722	D	1	D	0.59767	0.986	P	0.53549	0.729	T	0.79713	-0.1688	10	0.62326	D	0.03	-2.1885	13.7747	0.63046	0.0:0.0:1.0:0.0	.	30	P98179	RBM3_HUMAN	R	30	ENSP00000365950:G30R;ENSP00000365946:G30R	ENSP00000365946:G30R	G	+	1	0	RBM3	48318600	1.000000	0.71417	0.165000	0.22776	0.160000	0.22226	7.534000	0.82004	2.210000	0.71456	0.513000	0.50165	GGA	RBM3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000102317		0.498	RBM3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM3	HGNC	protein_coding	OTTHUMT00000060755.1		0.00	39	0	G	NM_006743		48433656	+1			no_errors	ENST00000376755	ensembl	human	known	74_37	missense	9.26	49	5	SNP	0.840	A
RBMXL3	139804	genome.wustl.edu	37	X	114426992	114426992	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:114426992C>T	ENST00000424776.3	+	1	3030	c.2988C>T	c.(2986-2988)ggC>ggT	p.G996G	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	996	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CCTACAGCGGCGACCACGACA	0.652																																																	0													61.0	59.0	60.0					X																	114426992		692	1591	2283	SO:0001819	synonymous_variant	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2988C>T	X.37:g.114426992C>T			B4DXC0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G996	ENST00000424776.3	37	c.2988	CCDS55478.1	X																																																																																			RBMXL3	-	NULL	ENSG00000175718		0.652	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	-	0.00	47	0	C	NM_001145346		114426992	+1	tier1	-	no_errors	ENST00000424776	ensembl	human	known	74_37	silent	42.35	49	36	SNP	0.066	T
RECQL4	9401	genome.wustl.edu	37	8	145739686	145739686	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:145739686C>T	ENST00000428558.2	-	11	1806	c.1765G>A	c.(1765-1767)Ggc>Agc	p.G589S	RECQL4_ENST00000532237.1_5'UTR|CTD-2517M22.17_ENST00000580385.1_RNA	NM_004260.3	NP_004251.3	O94761	RECQ4_HUMAN	RecQ protein-like 4	589	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)|multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|bubble DNA binding (GO:0000405)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|lung(10)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	26	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GGAGGGAGGCCTCCCGCCCCC	0.642			"""N, F, S"""			"""osteosarcoma, skin basal and sqamous cell"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Rothmund-Thomson syndrome;RAPADILINO syndrome;Baller-Gerold syndrome																														yes	Rec		Rothmund-Thompson Syndrome	8	8q24.3	9401	RecQ protein-like 4		M	0													24.0	31.0	29.0					8																	145739686		2092	4209	6301	SO:0001583	missense	0	Familial Cancer Database	RTS, Poikiloderma Atrophicans and Cataract, Congenital Poikiloderma; ;Craniosynostosis with Radial Defects	AB006532	CCDS75804.1	8q24.3	2014-09-17	2014-03-07	2014-03-07		ENSG00000160957			9949	protein-coding gene	gene with protein product		603780				9878247, 15960976	Standard	NM_004260		Approved	RecQ4	uc003zdj.3	O94761		ENST00000428558.2:c.1765G>A	8.37:g.145739686C>T	ENSP00000475456:p.Gly589Ser		Q3Y424|Q96DW2|Q96F55	Missense_Mutation	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DNA_rep_checkpnt_protein,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.G589S	ENST00000428558.2	37	c.1765		8																																																																																			RECQL4	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000160957		0.642	RECQL4-201	KNOWN	basic|appris_principal	protein_coding	RECQL4	HGNC	protein_coding		-	0.00	29	0	C	NM_004260		145739686	-1	tier1	-	no_errors	ENST00000428558	ensembl	human	known	74_37	missense	14.81	46	8	SNP	0.005	T
RGPD3	653489	genome.wustl.edu	37	2	107049690	107049690	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:107049690C>T	ENST00000409886.3	-	16	2344	c.2257G>A	c.(2257-2259)Gaa>Aaa	p.E753K	RGPD3_ENST00000304514.7_Missense_Mutation_p.E753K	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	753					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						TTTTCGAGTTCCTGCATGACT	0.368																																																	0													128.0	108.0	114.0					2																	107049690		692	1590	2282	SO:0001583	missense	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2257G>A	2.37:g.107049690C>T	ENSP00000386588:p.Glu753Lys		B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.E753K	ENST00000409886.3	37	c.2257	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	6.877	0.531227	0.13127	.	.	ENSG00000153165	ENST00000409886;ENST00000452099;ENST00000304514	T;T	0.20738	2.05;2.05	2.34	2.34	0.29019	.	.	.	.	.	T	0.18759	0.0450	L	0.60455	1.87	0.26264	N	0.978537	B	0.23854	0.092	B	0.14578	0.011	T	0.16453	-1.0402	9	0.51188	T	0.08	-20.1361	5.0731	0.14617	0.0:0.8227:0.0:0.1773	.	753	A6NKT7	RGPD3_HUMAN	K	753;511;753	ENSP00000386588:E753K;ENSP00000303659:E753K	ENSP00000303659:E753K	E	-	1	0	RGPD3	106416122	0.997000	0.39634	0.965000	0.40720	0.017000	0.09413	1.622000	0.36997	1.308000	0.44962	0.173000	0.16961	GAA	RGPD3	-	NULL	ENSG00000153165		0.368	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	-	0.00	219	0	C	XM_929931		107049690	-1	tier1	-	no_errors	ENST00000304514	ensembl	human	known	74_37	missense	5.46	277	16	SNP	1.000	T
RGS20	8601	genome.wustl.edu	37	8	54791923	54791923	+	Missense_Mutation	SNP	C	C	T	rs141996990		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:54791923C>T	ENST00000297313.3	+	2	363	c.271C>T	c.(271-273)Cgg>Tgg	p.R91W	RGS20_ENST00000276500.4_5'Flank|RGS20_ENST00000344277.6_Intron|RP11-1070A24.2_ENST00000606037.1_RNA|RGS20_ENST00000522225.1_5'Flank	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	91					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			TCACCTTCTCCGGCGACCCCC	0.721																																																	0								C	TRP/ARG	0,4406		0,0,2203	52.0	66.0	61.0		271	4.4	1.0	8	dbSNP_134	61	2,8598	2.2+/-6.3	0,2,4298	no	missense	RGS20	NM_170587.2	101	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	probably-damaging	91/389	54791923	2,13004	2203	4300	6503	SO:0001583	missense	0			AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.271C>T	8.37:g.54791923C>T	ENSP00000297313:p.Arg91Trp		Q96BG9	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.R91W	ENST00000297313.3	37	c.271	CCDS6155.1	8	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044404	0.55110	0.0	2.33E-4	ENSG00000147509	ENST00000297313	T	0.55930	0.49	4.37	4.37	0.52481	.	.	.	.	.	T	0.43567	0.1253	L	0.47716	1.5	0.80722	D	1	B	0.18610	0.029	B	0.08055	0.003	T	0.47446	-0.9117	9	0.87932	D	0	.	8.1238	0.30986	0.0:0.8931:0.0:0.1069	.	91	O76081	RGS20_HUMAN	W	91	ENSP00000297313:R91W	ENSP00000297313:R91W	R	+	1	2	RGS20	54954476	0.354000	0.24912	0.990000	0.47175	0.859000	0.49053	1.398000	0.34554	2.269000	0.75478	0.561000	0.74099	CGG	RGS20	-	NULL	ENSG00000147509		0.721	RGS20-001	KNOWN	basic|CCDS	protein_coding	RGS20	HGNC	protein_coding	OTTHUMT00000380058.1		0.00	41	0	C			54791923	+1			no_errors	ENST00000297313	ensembl	human	known	74_37	missense	7.27	50	4	SNP	0.895	T
RGS6	9628	genome.wustl.edu	37	14	73029207	73029207	+	3'UTR	SNP	C	C	A	rs199552071		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr14:73029207C>A	ENST00000553530.1	+	0	1658				RP3-514A23.2_ENST00000555303.1_lincRNA|RGS6_ENST00000554782.1_Intron|RGS6_ENST00000556437.1_3'UTR	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6						G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		GGCCTGGGCCCGCGGACCCCA	0.637																																					Ovarian(143;1926 2468 21071 48641)												0													26.0	27.0	27.0					14																	73029207		2203	4299	6502	SO:0001624	3_prime_UTR_variant	0			AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.*32C>A	14.37:g.73029207C>A			C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	RNA	SNP	-	NULL	ENST00000553530.1	37	NULL	CCDS9808.1	14																																																																																			RGS6	-	-	ENSG00000182732		0.637	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	RGS6	HGNC	protein_coding	OTTHUMT00000413033.2	-	0.00	21	0	C			73029207	+1	tier1	-	no_errors	ENST00000554300	ensembl	human	putative	74_37	rna	65.22	8	15	SNP	0.003	A
RGSL1	353299	genome.wustl.edu	37	1	182443459	182443459	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:182443459G>A	ENST00000294854.8	+	6	1233	c.1213G>A	c.(1213-1215)Gac>Aac	p.D405N	RGSL1_ENST00000542961.1_Missense_Mutation_p.D440N	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	405					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						CCTCTGGCAGGACTTGCAGCA	0.488																																					Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)												0													161.0	136.0	143.0					1																	182443459		692	1591	2283	SO:0001583	missense	0			AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.1213G>A	1.37:g.182443459G>A	ENSP00000457748:p.Asp405Asn		A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam	p.D405N	ENST00000294854.8	37	c.1213	CCDS58049.1	1																																																																																			RGSL1	-	superfamily_Regulat_G_prot_signal_superfam	ENSG00000121446		0.488	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	RGSL1	HGNC	protein_coding	OTTHUMT00000320710.3	-	0.00	22	0	G	NM_181572		182443459	+1	tier1	-	no_errors	ENST00000294854	ensembl	human	known	74_37	missense	29.73	26	11	SNP	1.000	A
ROBO2	6092	genome.wustl.edu	37	3	77542488	77542488	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:77542488C>A	ENST00000461745.1	+	5	1661	c.761C>A	c.(760-762)cCa>cAa	p.P254Q	ROBO2_ENST00000487694.3_Missense_Mutation_p.P270Q|ROBO2_ENST00000332191.8_Missense_Mutation_p.P254Q	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	254	Ig-like C2-type 3.				apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GATCCTCAACCAACTGTGAGG	0.418																																																	0													117.0	110.0	112.0					3																	77542488		1902	4143	6045	SO:0001583	missense	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.761C>A	3.37:g.77542488C>A	ENSP00000417164:p.Pro254Gln		O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P254Q	ENST00000461745.1	37	c.761	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	C	29.3	4.992617	0.93167	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191	T;T;T	0.73469	-0.75;-0.75;-0.75	5.88	5.88	0.94601	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.43747	U	0.000522	D	0.93184	0.7829	H	0.99475	4.585	0.47819	D	0.999522	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.997;0.999	D	0.95590	0.8654	9	0.87932	D	0	.	20.2267	0.98341	0.0:1.0:0.0:0.0	.	270;254;254	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	Q	270;270;270;254;254	ENSP00000417335:P270Q;ENSP00000417164:P254Q;ENSP00000327536:P254Q	ENSP00000327536:P254Q	P	+	2	0	ROBO2	77625178	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.762000	0.85270	2.791000	0.96007	0.491000	0.48974	CCA	ROBO2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000185008		0.418	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	-	0.00	26	0	C	XM_031246		77542488	+1	tier1	-	no_errors	ENST00000461745	ensembl	human	known	74_37	missense	32.50	27	13	SNP	1.000	A
RP1L1	94137	genome.wustl.edu	37	8	10466111	10466111	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:10466111C>T	ENST00000382483.3	-	4	5720	c.5497G>A	c.(5497-5499)Gaa>Aaa	p.E1833K		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1913					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TCTATGCCTTCGGCCCCATCA	0.627																																																	0													147.0	164.0	159.0					8																	10466111		2008	4160	6168	SO:0001583	missense	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5497G>A	8.37:g.10466111C>T	ENSP00000371923:p.Glu1833Lys		Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	pfam_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.E1833K	ENST00000382483.3	37	c.5497	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	C	9.510	1.105387	0.20632	.	.	ENSG00000183638	ENST00000382483	T	0.04049	3.72	3.96	0.953	0.19590	.	.	.	.	.	T	0.01835	0.0058	N	0.08118	0	0.09310	N	1	P	0.35011	0.48	B	0.15484	0.013	T	0.47209	-0.9135	9	0.30078	T	0.28	6.2257	3.7972	0.08744	0.0:0.4886:0.1845:0.3268	.	1833	A6NKC6	.	K	1833	ENSP00000371923:E1833K	ENSP00000371923:E1833K	E	-	1	0	RP1L1	10503521	.	.	0.000000	0.03702	0.009000	0.06853	.	.	-0.141000	0.11374	0.455000	0.32223	GAA	RP1L1	-	NULL	ENSG00000183638		0.627	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	-	0.00	70	0	C			10466111	-1	tier1	-	no_errors	ENST00000382483	ensembl	human	known	74_37	missense	9.26	97	10	SNP	0.000	T
RPS10	6204	genome.wustl.edu	37	6	34389563	34389563	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:34389563G>A	ENST00000326199.8	-	4	437	c.344C>T	c.(343-345)gCg>gTg	p.A115V	RPS10_ENST00000344700.3_Missense_Mutation_p.A115V|RPS10_ENST00000494077.1_5'UTR|RPS10-NUDT3_ENST00000605528.1_Missense_Mutation_p.A115V	NM_001014.4|NM_001203245.2|NM_001204091.1	NP_001005.1|NP_001190174.1|NP_001191020.1	P46783	RS10_HUMAN	ribosomal protein S10	115					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	9						TGTGAGTCTCGCAGGTCGCTC	0.493																																					Colon(121;749 1624 4895 8687 22360)												0													200.0	201.0	201.0					6																	34389563		2203	4300	6503	SO:0001583	missense	0			U14972	CCDS4792.1	6p21.31	2011-04-05			ENSG00000124614	ENSG00000124614		"""S ribosomal proteins"""	10383	protein-coding gene	gene with protein product		603632				7772601, 9582194	Standard	NM_001014		Approved	MGC88819, S10		P46783	OTTHUMG00000014546	ENST00000326199.8:c.344C>T	6.37:g.34389563G>A	ENSP00000347271:p.Ala115Val		B2R4E3|Q5TZC0	Missense_Mutation	SNP	pfam_S10_plectin_N	p.A115V	ENST00000326199.8	37	c.344	CCDS4792.1	6	.	.	.	.	.	.	.	.	.	.	G	17.92	3.506628	0.64410	.	.	ENSG00000124614	ENST00000326199;ENST00000344700	T;T	0.77750	-1.09;-1.12	5.32	4.46	0.54185	.	0.128665	0.52532	D	0.000078	T	0.69097	0.3073	M	0.86178	2.8	0.58432	D	0.999999	B	0.21452	0.056	B	0.17433	0.018	T	0.69745	-0.5062	10	0.29301	T	0.29	-8.9891	14.0595	0.64790	0.0728:0.0:0.9272:0.0	.	115	P46783	RS10_HUMAN	V	115	ENSP00000347271:A115V;ENSP00000363169:A115V	ENSP00000347271:A115V	A	-	2	0	RPS10	34497541	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.738000	0.84966	1.383000	0.46405	0.591000	0.81541	GCG	RPS10	-	NULL	ENSG00000124614		0.493	RPS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS10	HGNC	protein_coding	OTTHUMT00000040230.1	-	0.00	56	0	G			34389563	-1	tier1	-	no_errors	ENST00000326199	ensembl	human	known	74_37	missense	39.25	65	42	SNP	1.000	A
RTL1	388015	genome.wustl.edu	37	14	101347476	101347476	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr14:101347476T>G	ENST00000534062.1	-	1	3708	c.3650A>C	c.(3649-3651)aAc>aCc	p.N1217T	MIR433_ENST00000384837.1_RNA|MIR431_ENST00000385266.1_RNA|MIR127_ENST00000384876.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	1217					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						CAGGTAGCGGTTCTGACGCAG	0.617																																																	0													16.0	17.0	17.0					14																	101347476		1560	3571	5131	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.3650A>C	14.37:g.101347476T>G	ENSP00000435342:p.Asn1217Thr		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.N1217T	ENST00000534062.1	37	c.3650	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	T	1.904	-0.452371	0.04540	.	.	ENSG00000254656	ENST00000534062	T	0.22743	1.94	3.33	-6.66	0.01789	.	1.334020	0.05524	N	0.562587	T	0.08802	0.0218	N	0.12182	0.205	0.09310	N	1	B	0.14438	0.01	B	0.09377	0.004	T	0.27365	-1.0076	10	0.49607	T	0.09	.	1.6547	0.02779	0.1377:0.2288:0.3898:0.2438	.	1217	E9PKS8	.	T	1217	ENSP00000435342:N1217T	ENSP00000435342:N1217T	N	-	2	0	RTL1	100417229	0.000000	0.05858	0.000000	0.03702	0.148000	0.21650	-1.237000	0.02922	-1.552000	0.01704	-0.250000	0.11733	AAC	RTL1	-	NULL	ENSG00000254656		0.617	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	-	0.00	56	0	T	NM_001134888		101347476	-1	tier1	-	no_errors	ENST00000534062	ensembl	human	known	74_37	missense	30.43	16	7	SNP	0.000	G
RYR2	6262	genome.wustl.edu	37	1	237865317	237865317	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:237865317G>A	ENST00000366574.2	+	66	9724	c.9407G>A	c.(9406-9408)aGc>aAc	p.S3136N	RYR2_ENST00000542537.1_Missense_Mutation_p.S3120N|RYR2_ENST00000360064.6_Missense_Mutation_p.S3134N|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3136					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATTCTGACTAGCTTATATGCT	0.333																																																	0													132.0	120.0	123.0					1																	237865317		1815	4080	5895	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.9407G>A	1.37:g.237865317G>A	ENSP00000355533:p.Ser3136Asn		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.S3134N	ENST00000366574.2	37	c.9401	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.789647	0.90367	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288;ENST00000540213	T;T;T	0.30981	1.51;1.51;1.51	4.83	4.83	0.62350	.	0.000000	0.85682	U	0.000000	T	0.57460	0.2055	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.68621	0.959	T	0.62695	-0.6800	10	0.59425	D	0.04	.	18.2786	0.90091	0.0:0.0:1.0:0.0	.	3136	Q92736	RYR2_HUMAN	N	3136;3134;3120;91;131	ENSP00000355533:S3136N;ENSP00000353174:S3134N;ENSP00000443798:S3120N	ENSP00000353174:S3134N	S	+	2	0	RYR2	235931940	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.921000	0.87530	2.371000	0.80710	0.573000	0.79308	AGC	RYR2	-	NULL	ENSG00000198626		0.333	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	38	0	G	NM_001035		237865317	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	30.00	28	12	SNP	1.000	A
SAFB	6294	genome.wustl.edu	37	19	5641936	5641936	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:5641936G>A	ENST00000292123.5	+	4	632	c.525G>A	c.(523-525)ccG>ccA	p.P175P	SAFB_ENST00000454510.1_Intron|SAFB_ENST00000433404.1_Silent_p.P5P|SAFB_ENST00000586934.1_3'UTR|SAFB_ENST00000588852.1_Silent_p.P175P|SAFB_ENST00000538656.1_Intron|SAFB_ENST00000592224.1_Silent_p.P175P	NM_001201338.1|NM_001201339.1|NM_002967.3	NP_001188267.1|NP_001188268.1|NP_002958.2	Q15424	SAFB1_HUMAN	scaffold attachment factor B	175					chromatin organization (GO:0006325)|growth (GO:0040007)|hormone metabolic process (GO:0042445)|intracellular estrogen receptor signaling pathway (GO:0030520)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|liver(1)|lung(6)|ovary(2)|skin(1)	23				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		AAGAGCTTCCGGAGCAGCTTC	0.463																																					Colon(88;338 1345 6184 8214 20897)												0													62.0	57.0	59.0					19																	5641936		2203	4300	6503	SO:0001819	synonymous_variant	0			L43631	CCDS12142.1, CCDS56077.1, CCDS59339.1, CCDS59340.1	19p13.3-p13.2	2013-02-12				ENSG00000160633		"""RNA binding motif (RRM) containing"""	10520	protein-coding gene	gene with protein product	"""Hsp27 ERE-TATA binding protein"""	602895				9605873, 8600450	Standard	NM_002967		Approved	HET, SAFB1	uc002mcg.3	Q15424		ENST00000292123.5:c.525G>A	19.37:g.5641936G>A			A0AV56|B7Z5B6|B7ZLP6|F5H0H3|O60406|Q59HH8	Silent	SNP	pfam_RRM_dom,pfam_SAP_dom,smart_SAP_dom,smart_RRM_dom,pfscan_SAP_dom,pfscan_RRM_dom	p.P175	ENST00000292123.5	37	c.525	CCDS12142.1	19																																																																																			SAFB	-	NULL	ENSG00000160633		0.463	SAFB-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SAFB	HGNC	protein_coding	OTTHUMT00000451641.2	-	0.00	23	0	G			5641936	+1	tier1	-	no_errors	ENST00000588852	ensembl	human	known	74_37	silent	24.44	34	11	SNP	0.364	A
SAMD9	54809	genome.wustl.edu	37	7	92734538	92734538	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr7:92734538T>G	ENST00000379958.2	-	3	1142	c.873A>C	c.(871-873)gaA>gaC	p.E291D		NM_001193307.1|NM_017654.3	NP_001180236.1|NP_060124.2	Q5K651	SAMD9_HUMAN	sterile alpha motif domain containing 9	291						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(4)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(20)|lung(32)|ovary(4)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	88	all_cancers(62;5.71e-11)|all_epithelial(64;3.25e-10)|Breast(17;0.000675)|Lung NSC(181;0.0969)|all_lung(186;0.125)		STAD - Stomach adenocarcinoma(171;0.000302)			GCAGTAAAACTTCCACAAATC	0.348																																																	0													121.0	120.0	120.0					7																	92734538		2203	4300	6503	SO:0001583	missense	0			AB095925	CCDS34680.1	7q21.2	2013-01-10	2004-07-15	2004-07-16	ENSG00000205413	ENSG00000205413		"""Sterile alpha motif (SAM) domain containing"""	1348	protein-coding gene	gene with protein product		610456	"""chromosome 7 open reading frame 5"""	C7orf5			Standard	NM_017654		Approved	KIAA2004, FLJ20073	uc003umg.3	Q5K651	OTTHUMG00000155809	ENST00000379958.2:c.873A>C	7.37:g.92734538T>G	ENSP00000369292:p.Glu291Asp		A2RU68|Q5K649|Q6P080|Q75N21|Q8IVG6|Q9NXS8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_P-loop_NTPase,smart_SAM,pfscan_SAM	p.E291D	ENST00000379958.2	37	c.873	CCDS34680.1	7	.	.	.	.	.	.	.	.	.	.	T	12.22	1.873526	0.33069	.	.	ENSG00000205413	ENST00000379958;ENST00000446617	T;T	0.15718	2.4;2.4	4.34	1.91	0.25777	.	0.190136	0.33127	U	0.005253	T	0.14485	0.0350	L	0.61036	1.89	0.26106	N	0.980747	B	0.14012	0.009	B	0.15052	0.012	T	0.23404	-1.0189	10	0.49607	T	0.09	-8.454	2.2335	0.04002	0.1494:0.0887:0.1716:0.5904	.	291	Q5K651	SAMD9_HUMAN	D	291	ENSP00000369292:E291D;ENSP00000414529:E291D	ENSP00000369292:E291D	E	-	3	2	SAMD9	92572474	1.000000	0.71417	0.991000	0.47740	0.860000	0.49131	0.826000	0.27407	0.290000	0.22444	-0.346000	0.07831	GAA	SAMD9	-	NULL	ENSG00000205413		0.348	SAMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9	HGNC	protein_coding	OTTHUMT00000341761.1		0.00	22	0	T	NM_017654		92734538	-1			no_errors	ENST00000379958	ensembl	human	known	74_37	missense	9.86	64	7	SNP	0.999	G
SCML2	10389	genome.wustl.edu	37	X	18264857	18264857	+	Nonsense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:18264857A>C	ENST00000251900.4	-	13	1821	c.1662T>G	c.(1660-1662)taT>taG	p.Y554*	SCML2_ENST00000398048.3_Nonsense_Mutation_p.Y290*	NM_006089.2	NP_006080.1	Q9UQR0	SCML2_HUMAN	sex comb on midleg-like 2 (Drosophila)	554					anatomical structure morphogenesis (GO:0009653)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	36	Hepatocellular(33;0.183)					CAGGATTCAAATAATTTCCTG	0.433																																					Esophageal Squamous(100;1252 1965 19021 35517)												0													85.0	89.0	87.0					X																	18264857		2203	4300	6503	SO:0001587	stop_gained	0			Y18004	CCDS14185.1	Xp22	2013-01-10	2001-11-28		ENSG00000102098	ENSG00000102098		"""Sterile alpha motif (SAM) domain containing"""	10581	protein-coding gene	gene with protein product		300208	"""sex comb on midleg (Drosophila)-like 2"""			10331946	Standard	NM_006089		Approved		uc004cyl.2	Q9UQR0	OTTHUMG00000021212	ENST00000251900.4:c.1662T>G	X.37:g.18264857A>C	ENSP00000251900:p.Tyr554*		Q5JXE6|Q86U98|Q8IWD0|Q8NDP2|Q9UGC5	Nonsense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt	p.Y554*	ENST00000251900.4	37	c.1662	CCDS14185.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.00|16.00	2.999634|2.999634	0.54147|0.54147	.|.	.|.	ENSG00000102098|ENSG00000102098	ENST00000420857|ENST00000251900;ENST00000398048;ENST00000442000	.|.	.|.	.|.	5.84|5.84	3.45|3.45	0.39498|0.39498	.|.	.|4.506400	.|0.00166	.|N	.|0.000006	T|.	0.19805|.	0.0476|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.24119|.	-1.0169|.	3|.	.|0.12430	.|T	.|0.62	.|.	4.6728|4.6728	0.12698|0.12698	0.5808:0.1672:0.2521:0.0|0.5808:0.1672:0.2521:0.0	.|.	.|.	.|.	.|.	S|X	70|554;290;522	.|.	.|ENSP00000251900:Y554X	I|Y	-|-	2|3	0|2	SCML2|SCML2	18174778|18174778	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	0.637000|0.637000	0.24659|0.24659	0.316000|0.316000	0.23135|0.23135	-0.314000|-0.314000	0.08810|0.08810	ATT|TAT	SCML2	-	NULL	ENSG00000102098		0.433	SCML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCML2	HGNC	protein_coding	OTTHUMT00000055941.1	-	0.00	32	0	A	NM_006089		18264857	-1	tier1	-	no_errors	ENST00000251900	ensembl	human	known	74_37	nonsense	35.29	44	24	SNP	0.000	C
SCN3A	6328	genome.wustl.edu	37	2	165994580	165994580	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:165994580C>A	ENST00000360093.3	-	15	2691	c.2200G>T	c.(2200-2202)Gcc>Tcc	p.A734S	SCN3A_ENST00000409101.3_Missense_Mutation_p.A685S|SCN3A_ENST00000283254.7_Missense_Mutation_p.A734S	NM_001081677.1	NP_001075146.1	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha subunit	734					membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(19)|liver(2)|lung(47)|ovary(6)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(3)	120					Lacosamide(DB06218)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AACACATTGGCAAATCTATAC	0.363																																																	0													103.0	101.0	102.0					2																	165994580		2203	4300	6503	SO:0001583	missense	0			AF035685	CCDS33312.1, CCDS46440.1	2q24	2012-02-26	2007-01-23		ENSG00000153253	ENSG00000153253		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10590	protein-coding gene	gene with protein product		182391	"""sodium channel, voltage-gated, type III, alpha polypeptide"""			9589372, 16382098	Standard	NM_001081676		Approved	Nav1.3	uc002ucx.3	Q9NY46	OTTHUMG00000044171	ENST00000360093.3:c.2200G>T	2.37:g.165994580C>A	ENSP00000353206:p.Ala734Ser		Q16142|Q53SX0|Q9BZB3|Q9C006|Q9NYK2|Q9P2J1|Q9UPD1|Q9Y6P4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.A734S	ENST00000360093.3	37	c.2200		2	.	.	.	.	.	.	.	.	.	.	C	28.0	4.885961	0.91814	.	.	ENSG00000153253	ENST00000360093;ENST00000283254;ENST00000409101;ENST00000440431	D;D;D;D	0.96774	-4.12;-4.12;-4.0;-3.89	5.76	5.76	0.90799	.	0.000000	0.64402	D	0.000010	D	0.97356	0.9135	L	0.48935	1.535	0.80722	D	1	P;D;D;D;P	0.67145	0.733;0.993;0.996;0.996;0.85	B;D;D;D;P	0.77557	0.363;0.978;0.99;0.99;0.591	D	0.96845	0.9621	10	0.45353	T	0.12	.	20.3431	0.98773	0.0:1.0:0.0:0.0	.	734;685;685;685;734	Q9NY46;E7EUE6;Q9NY46-2;Q9NY46-4;Q9NY46-3	SCN3A_HUMAN;.;.;.;.	S	734;734;685;685	ENSP00000353206:A734S;ENSP00000283254:A734S;ENSP00000386726:A685S;ENSP00000403348:A685S	ENSP00000283254:A734S	A	-	1	0	SCN3A	165702826	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.935000	0.70145	2.880000	0.98712	0.650000	0.86243	GCC	SCN3A	-	NULL	ENSG00000153253		0.363	SCN3A-201	KNOWN	basic|appris_candidate_longest	protein_coding	SCN3A	HGNC	protein_coding		-	0.00	57	0	C	NM_006922		165994580	-1	tier1	-	no_errors	ENST00000283254	ensembl	human	known	74_37	missense	11.54	46	6	SNP	1.000	A
SCN4A	6329	genome.wustl.edu	37	17	62018150	62018150	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:62018150A>T	ENST00000435607.1	-	24	5568	c.5492T>A	c.(5491-5493)gTc>gAc	p.V1831D	SCN4A_ENST00000578147.1_Missense_Mutation_p.V1831D	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1831					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGACTCCTTGACACCTGGGCG	0.672																																																	0													38.0	48.0	45.0					17																	62018150		2052	4195	6247	SO:0001583	missense	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.5492T>A	17.37:g.62018150A>T	ENSP00000396320:p.Val1831Asp		Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2	p.V1831D	ENST00000435607.1	37	c.5492	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	A	16.61	3.172336	0.57584	.	.	ENSG00000007314	ENST00000435607	D	0.96685	-4.09	4.32	4.32	0.51571	.	2.835930	0.01437	N	0.014959	D	0.94006	0.8080	N	0.08118	0	0.58432	D	0.999998	D	0.55385	0.971	P	0.50440	0.641	D	0.86008	0.1499	10	0.44086	T	0.13	.	11.6559	0.51318	1.0:0.0:0.0:0.0	.	1831	P35499	SCN4A_HUMAN	D	1831	ENSP00000396320:V1831D	ENSP00000396320:V1831D	V	-	2	0	SCN4A	59371882	1.000000	0.71417	1.000000	0.80357	0.315000	0.28087	3.042000	0.49815	1.944000	0.56390	0.459000	0.35465	GTC	SCN4A	-	NULL	ENSG00000007314		0.672	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		-	0.00	47	0	A	NM_000334		62018150	-1	tier1	-	no_errors	ENST00000435607	ensembl	human	known	74_37	missense	52.00	24	26	SNP	1.000	T
SCUBE1	80274	genome.wustl.edu	37	22	43606144	43606144	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr22:43606144G>A	ENST00000360835.4	-	19	2612	c.2486C>T	c.(2485-2487)gCg>gTg	p.A829V	Z82214.3_ENST00000420269.1_RNA	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	829	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				TGGGGGAGGCGCGATGTGCCA	0.607																																																	0													102.0	86.0	92.0					22																	43606144		2203	4300	6503	SO:0001583	missense	0				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.2486C>T	22.37:g.43606144G>A	ENSP00000354080:p.Ala829Val		Q5R336	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.A829V	ENST00000360835.4	37	c.2486	CCDS14048.1	22	.	.	.	.	.	.	.	.	.	.	G	12.98	2.099317	0.37048	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	T	0.17691	2.26	3.63	2.51	0.30379	CUB (5);	0.161907	0.52532	D	0.000071	T	0.05181	0.0138	N	0.01640	-0.785	0.80722	D	1	B	0.10296	0.003	B	0.10450	0.005	T	0.26395	-1.0104	10	0.32370	T	0.25	.	6.1192	0.20144	0.0:0.1471:0.4575:0.3954	.	829	Q8IWY4	SCUB1_HUMAN	V	829;459	ENSP00000354080:A829V	ENSP00000354080:A829V	A	-	2	0	SCUBE1	41936088	0.786000	0.28738	0.410000	0.26471	0.645000	0.38454	1.999000	0.40806	2.038000	0.60285	0.561000	0.74099	GCG	SCUBE1	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000159307		0.607	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	HGNC	protein_coding	OTTHUMT00000319582.3	-	0.00	57	0	G	NM_173050		43606144	-1	tier1	-	no_errors	ENST00000360835	ensembl	human	known	74_37	missense	29.23	45	19	SNP	0.961	A
SEC13	6396	genome.wustl.edu	37	3	10354308	10354308	+	Missense_Mutation	SNP	C	C	T	rs137884718		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:10354308C>T	ENST00000350697.3	-	4	396	c.271G>A	c.(271-273)Ggc>Agc	p.G91S	SEC13_ENST00000397109.3_Missense_Mutation_p.G77S|SEC13_ENST00000397117.1_Missense_Mutation_p.G77S|SEC13_ENST00000337354.4_Missense_Mutation_p.G94S|SEC13_ENST00000383801.2_Missense_Mutation_p.G137S	NM_183352.1	NP_899195.1	P55735	SEC13_HUMAN	SEC13 homolog (S. cerevisiae)	91					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17						TCCCAGGTGCCGTTTTCCTCT	0.582																																																	0								C	SER/GLY,SER/GLY	2,4404	4.2+/-10.8	0,2,2201	133.0	135.0	134.0		229,271	4.9	0.9	3	dbSNP_134	134	0,8600		0,0,4300	no	missense,missense	SEC13	NM_001136232.1,NM_183352.1	56,56	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign,benign	77/309,91/323	10354308	2,13004	2203	4300	6503	SO:0001583	missense	0				CCDS2599.1, CCDS46751.1, CCDS63540.1	3p25-p24	2013-01-10	2006-11-07	2006-11-07	ENSG00000157020	ENSG00000157020		"""WD repeat domain containing"""	10697	protein-coding gene	gene with protein product		600152	"""SEC13 (S. cerevisiae)-like 1"", ""SEC13-like 1 (S. cerevisiae)"""	D3S1231E, SEC13L1		7987303	Standard	NM_183352		Approved	SEC13R, npp-20	uc003bvn.3	P55735	OTTHUMG00000128671	ENST00000350697.3:c.271G>A	3.37:g.10354308C>T	ENSP00000312122:p.Gly91Ser		A8MV37|B4DXJ1|Q5BJF0|Q9BRM6|Q9BUG7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G91S	ENST00000350697.3	37	c.271	CCDS2599.1	3	.	.	.	.	.	.	.	.	.	.	C	17.27	3.345881	0.61073	4.54E-4	0.0	ENSG00000157020	ENST00000397109;ENST00000337354;ENST00000350697;ENST00000397117;ENST00000383801;ENST00000397105	T;T;T;T;T	0.73363	-0.55;-0.55;-0.55;-0.39;-0.74	4.93	4.93	0.64822	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.050329	0.85682	D	0.000000	T	0.65291	0.2677	L	0.56124	1.755	0.80722	D	1	P;B;B;B;B	0.46064	0.872;0.026;0.017;0.106;0.007	B;B;B;B;B	0.31547	0.132;0.009;0.033;0.016;0.016	T	0.70037	-0.4982	10	0.39692	T	0.17	.	15.6633	0.77206	0.0:1.0:0.0:0.0	.	91;91;77;137;91	A8MWR8;E9PHR5;A8MXL6;B4DXJ1;P55735	.;.;.;.;SEC13_HUMAN	S	77;94;91;77;137;91	ENSP00000380298:G77S;ENSP00000336566:G94S;ENSP00000312122:G91S;ENSP00000380306:G77S;ENSP00000373312:G137S	ENSP00000336566:G94S	G	-	1	0	SEC13	10329308	1.000000	0.71417	0.935000	0.37517	0.946000	0.59487	5.941000	0.70195	2.276000	0.75962	0.561000	0.74099	GGC	SEC13	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000157020		0.582	SEC13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC13	HGNC	protein_coding	OTTHUMT00000250563.3	-	0.00	35	0	C			10354308	-1	tier1	rs137884718	no_errors	ENST00000350697	ensembl	human	known	74_37	missense	37.04	17	10	SNP	1.000	T
SDHAP1	255812	genome.wustl.edu	37	3	195702747	195702747	+	RNA	SNP	G	G	A	rs370860045		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:195702747G>A	ENST00000427841.1	-	0	1215					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		GCAGGTAGACGTGATCTTTCT	0.552																																					Ovarian(67;1158 1227 12109 20189 43170)												0																																												0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195702747G>A				RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.552	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1		0.00	80	0	G			195702747	-1			no_errors	ENST00000427841	ensembl	human	known	74_37	rna	7.41	100	8	SNP	0.997	A
SEMA6D	80031	genome.wustl.edu	37	15	48063701	48063701	+	Silent	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:48063701T>C	ENST00000316364.5	+	19	3380	c.2941T>C	c.(2941-2943)Tta>Cta	p.L981L	SEMA6D_ENST00000537942.1_Silent_p.L919L|SEMA6D_ENST00000558816.1_3'UTR|SEMA6D_ENST00000358066.4_Silent_p.L919L|SEMA6D_ENST00000558014.1_Silent_p.L919L|SEMA6D_ENST00000389432.2_Silent_p.L938L|SEMA6D_ENST00000355997.3_3'UTR|SEMA6D_ENST00000389433.2_Silent_p.L962L|SEMA6D_ENST00000536845.2_Silent_p.L981L|SEMA6D_ENST00000389428.3_Silent_p.L906L|SEMA6D_ENST00000354744.4_Silent_p.L925L	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	981					axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		GCCTAAAAACTTAAACTCACC	0.473																																																	0													99.0	103.0	101.0					15																	48063701		2198	4297	6495	SO:0001819	synonymous_variant	0			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.2941T>C	15.37:g.48063701T>C			A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Silent	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.L981	ENST00000316364.5	37	c.2941	CCDS32225.1	15																																																																																			SEMA6D	-	NULL	ENSG00000137872		0.473	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	-	0.00	35	0	T	NM_024966		48063701	+1	tier1	-	no_errors	ENST00000316364	ensembl	human	known	74_37	silent	42.86	24	18	SNP	1.000	C
SFRP1	6422	genome.wustl.edu	37	8	41122735	41122735	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:41122735T>G	ENST00000220772.3	-	3	1233	c.896A>C	c.(895-897)aAg>aCg	p.K299T	SFRP1_ENST00000379845.3_Missense_Mutation_p.K163T	NM_003012.4	NP_003003.3	Q8N474	SFRP1_HUMAN	secreted frizzled-related protein 1	299	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				bone trabecula formation (GO:0060346)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to BMP stimulus (GO:0071773)|cellular response to estradiol stimulus (GO:0071392)|cellular response to estrogen stimulus (GO:0071391)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heparin (GO:0071504)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to prostaglandin E stimulus (GO:0071380)|cellular response to starvation (GO:0009267)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vitamin D (GO:0071305)|cellular response to X-ray (GO:0071481)|convergent extension involved in somitogenesis (GO:0090246)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral axis specification (GO:0009950)|female gonad development (GO:0008585)|gonad development (GO:0008406)|hematopoietic progenitor cell differentiation (GO:0002244)|hematopoietic stem cell differentiation (GO:0060218)|male gonad development (GO:0008584)|menstrual cycle phase (GO:0022601)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of bone remodeling (GO:0046851)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000080)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of osteoblast proliferation (GO:0033689)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|negative regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000054)|neural crest cell fate commitment (GO:0014034)|neural tube closure (GO:0001843)|osteoblast differentiation (GO:0001649)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of non-canonical Wnt signaling pathway (GO:2000052)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|proteolysis (GO:0006508)|regulation of angiogenesis (GO:0045765)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell cycle process (GO:0010564)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|somatic stem cell maintenance (GO:0035019)|stromal-epithelial cell signaling involved in prostate gland development (GO:0044345)|ureteric bud development (GO:0001657)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	cysteine-type endopeptidase activity (GO:0004197)|drug binding (GO:0008144)|frizzled binding (GO:0005109)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|central_nervous_system(1)|large_intestine(2)|liver(1)|lung(1)|skin(1)	7	Breast(1;9.19e-13)|Ovarian(28;0.00769)|Colorectal(14;0.0305)|Lung SC(25;0.211)	all_lung(54;0.0034)|Lung NSC(58;0.0134)|Hepatocellular(245;0.023)|Esophageal squamous(32;0.0559)	BRCA - Breast invasive adenocarcinoma(1;1.11e-10)|LUSC - Lung squamous cell carcinoma(45;0.00894)|COAD - Colon adenocarcinoma(11;0.0174)			TTTCATTTTCTTCATGAAGTT	0.547																																																	0													64.0	56.0	58.0					8																	41122735		2203	4300	6503	SO:0001583	missense	0			AF017987	CCDS34886.1	8p11.21	2006-12-15			ENSG00000104332	ENSG00000104332		"""Secreted frizzled-related proteins"""	10776	protein-coding gene	gene with protein product		604156				9391078, 9192640	Standard	NM_003012		Approved	SARP2, FRP, FRP-1	uc003xnt.3	Q8N474	OTTHUMG00000164074	ENST00000220772.3:c.896A>C	8.37:g.41122735T>G	ENSP00000220772:p.Lys299Thr		O00546|O14779	Missense_Mutation	SNP	pfam_Frizzled_dom,pfam_Netrin_module_non-TIMP,superfamily_Frizzled_dom,superfamily_TIMP-like_OB-fold,smart_Frizzled_dom,smart_Netrin_module_non-TIMP,pfscan_Frizzled_dom,pfscan_Netrin_domain	p.K299T	ENST00000220772.3	37	c.896	CCDS34886.1	8	.	.	.	.	.	.	.	.	.	.	T	16.73	3.204516	0.58234	.	.	ENSG00000104332	ENST00000220772;ENST00000379845;ENST00000535263	T;T	0.25749	1.78;1.78	4.7	3.55	0.40652	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (2);	0.061993	0.64402	D	0.000010	T	0.43942	0.1270	M	0.72894	2.215	0.53688	D	0.999974	D	0.76494	0.999	D	0.68943	0.961	T	0.33624	-0.9861	10	0.72032	D	0.01	.	7.1033	0.25351	0.0:0.1748:0.0:0.8252	.	299	Q8N474	SFRP1_HUMAN	T	299;163;299	ENSP00000220772:K299T;ENSP00000369174:K163T	ENSP00000220772:K299T	K	-	2	0	SFRP1	41241892	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	6.129000	0.71657	0.840000	0.34995	-0.371000	0.07208	AAG	SFRP1	-	pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,smart_Netrin_module_non-TIMP,pfscan_Netrin_domain	ENSG00000104332		0.547	SFRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFRP1	HGNC	protein_coding	OTTHUMT00000377132.1	-	0.00	62	0	T	NM_003012		41122735	-1	tier1	-	no_errors	ENST00000220772	ensembl	human	known	74_37	missense	16.05	68	13	SNP	1.000	G
SFTPA1	653509	genome.wustl.edu	37	10	81373718	81373718	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr10:81373718G>C	ENST00000398636.3	+	6	734	c.596G>C	c.(595-597)cGc>cCc	p.R199P	SFTPA1_ENST00000419470.2_Missense_Mutation_p.R214P|SFTPA1_ENST00000372313.5_Missense_Mutation_p.R140P|SFTPA1_ENST00000372308.3_Missense_Mutation_p.R199P|SFTPA1_ENST00000428376.2_Missense_Mutation_p.R199P	NM_001164644.1|NM_001164646.1|NM_005411.4	NP_001158116.1|NP_001158118.1|NP_005402.3	Q8IWL2	SFTA1_HUMAN	surfactant protein A1	199	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				lipid transport (GO:0006869)|respiratory gaseous exchange (GO:0007585)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|lipid transporter activity (GO:0005319)			endometrium(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			GGAGACTTCCGCTACTCAGAC	0.547																																																	0													187.0	194.0	192.0					10																	81373718		2203	4296	6499	SO:0001583	missense	0			BC026229	CCDS44444.1, CCDS44445.1, CCDS44444.2	10q22.3	2012-11-02	2008-08-26			ENSG00000122852		"""Collectins"""	10798	protein-coding gene	gene with protein product	"""surfactant, pulmonary-associated protein A1A"""	178630	"""surfactant, pulmonary-associated protein A1"""	SFTP1			Standard	NM_001093770		Approved	SP-A, SP-A1, COLEC4	uc009xry.3	Q8IWL2		ENST00000398636.3:c.596G>C	10.37:g.81373718G>C	ENSP00000381633:p.Arg199Pro		A8K3T8|B7ZW50|E3VLD8|E3VLD9|E3VLE0|E3VLE1|G5E9J3|P07714|Q14DV4|Q5RIR5|Q5RIR7|Q6PIT0|Q8TC19	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.R214P	ENST00000398636.3	37	c.641	CCDS44445.1	10	.	.	.	.	.	.	.	.	.	.	.	9.915	1.210518	0.22289	.	.	ENSG00000122852	ENST00000372308;ENST00000398636;ENST00000428376;ENST00000372313;ENST00000419470;ENST00000394569	T;T;T;T;T	0.19394	2.15;2.15;2.15;2.15;2.15	2.89	-3.46	0.04767	C-type lectin fold (2);C-type lectin-like (2);C-type lectin (6);	0.949363	0.08814	N	0.889736	T	0.28067	0.0692	M	0.79926	2.475	0.09310	N	1	P;P;P	0.50710	0.894;0.871;0.938	P;P;P	0.49502	0.613;0.479;0.613	T	0.17107	-1.0380	10	0.37606	T	0.19	-0.6015	3.9783	0.09484	0.5094:0.0:0.3329:0.1576	.	199;214;199	Q8IWL1;G5E9J3;Q8IWL2	SFPA2_HUMAN;.;SFTA1_HUMAN	P	199;199;199;140;214;199	ENSP00000361382:R199P;ENSP00000381633:R199P;ENSP00000411102:R199P;ENSP00000361387:R140P;ENSP00000397082:R214P	ENSP00000361382:R199P	R	+	2	0	SFTPA1	81043724	0.000000	0.05858	0.000000	0.03702	0.536000	0.34869	-1.911000	0.01583	-0.735000	0.04837	0.297000	0.19635	CGC	SFTPA1	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000122852		0.547	SFTPA1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFTPA1	HGNC	protein_coding		-	0.00	59	0	G	NM_005411		81373718	+1	tier1	-	no_errors	ENST00000419470	ensembl	human	known	74_37	missense	28.07	41	16	SNP	0.004	C
SIGLEC5	8778	genome.wustl.edu	37	19	52130727	52130727	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:52130727G>T	ENST00000534261.2	-	7	1669	c.1270C>A	c.(1270-1272)Ctg>Atg	p.L424M	SIGLEC5_ENST00000570106.2_Missense_Mutation_p.L424M|SIGLEC5_ENST00000429354.3_Missense_Mutation_p.L424M|SIGLEC5_ENST00000222107.4_Missense_Mutation_p.L424M|SIGLEC5_ENST00000599649.1_Missense_Mutation_p.L424M			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	424					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		TGCAGCAGCAGGACAGAGCCG	0.637																																																	0													86.0	88.0	88.0					19																	52130727		2203	4300	6503	SO:0001583	missense	0			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1270C>A	19.37:g.52130727G>T	ENSP00000473238:p.Leu424Met			Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.L424M	ENST00000534261.2	37	c.1270	CCDS33088.1	19	.	.	.	.	.	.	.	.	.	.	G	5.303	0.241287	0.10077	.	.	ENSG00000105501	ENST00000222107;ENST00000429354	T;T	0.04360	3.64;3.64	3.85	2.79	0.32731	.	.	.	.	.	T	0.21962	0.0529	M	0.84683	2.71	0.09310	N	1	D	0.56968	0.978	D	0.67382	0.951	T	0.03630	-1.1018	9	0.62326	D	0.03	.	12.0479	0.53491	0.0:0.1779:0.8221:0.0	.	424	O15389	SIGL5_HUMAN	M	424	ENSP00000222107:L424M;ENSP00000415200:L424M	ENSP00000222107:L424M	L	-	1	2	SIGLEC5	56822539	0.008000	0.16893	0.252000	0.24328	0.098000	0.18820	0.197000	0.17197	0.399000	0.25367	-2.158000	0.00328	CTG	SIGLEC5	-	NULL	ENSG00000105501		0.637	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	HGNC	protein_coding	OTTHUMT00000466897.2	-	0.00	78	0	G	NM_003830		52130727	-1	tier1	-	no_errors	ENST00000222107	ensembl	human	known	74_37	missense	41.18	60	42	SNP	0.222	T
SLC25A44	9673	genome.wustl.edu	37	1	156180848	156180851	+	3'UTR	DEL	TGTG	TGTG	-	rs58631766|rs111363590		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	TGTG	TGTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:156180848_156180851delTGTG	ENST00000359511.4	+	0	1743_1746				PMF1_ENST00000565805.1_5'Flank|PMF1-BGLAP_ENST00000320139.5_5'Flank|SLC25A44_ENST00000469537.1_3'UTR|PMF1-BGLAP_ENST00000490491.1_5'Flank|PMF1_ENST00000368279.3_5'Flank|PMF1-BGLAP_ENST00000368276.4_5'Flank|PMF1_ENST00000368273.4_5'Flank|PMF1_ENST00000567140.1_5'Flank|PMF1_ENST00000368277.3_5'Flank	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					ACTTTTGTTTtgtgtgtgtgtgtg	0.471																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.*629TGTG>-	1.37:g.156180856_156180859delTGTG			O75034	RNA	DEL	-	NULL	ENST00000359511.4	37	NULL	CCDS1133.1	1																																																																																			SLC25A44	-	-	ENSG00000160785		0.471	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A44	HGNC	protein_coding	OTTHUMT00000040856.1		0.00	16	0	TGTG	NM_014655		156180851	+1	tier1		no_errors	ENST00000469537	ensembl	human	known	74_37	rna	20.69	23	6	DEL	0.000:0.000:0.000:0.001	-
SLC39A12	221074	genome.wustl.edu	37	10	18270308	18270308	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr10:18270308A>T	ENST00000377369.2	+	6	1265	c.992A>T	c.(991-993)gAg>gTg	p.E331V	SLC39A12_ENST00000377371.3_Missense_Mutation_p.E331V|SLC39A12_ENST00000377374.4_Missense_Mutation_p.E331V|SLC39A12_ENST00000539911.1_Missense_Mutation_p.E197V	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	331					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						ATTTCTAAGGAGGACTTTAAG	0.488																																																	0													88.0	83.0	84.0					10																	18270308		2203	4300	6503	SO:0001583	missense	0				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.992A>T	10.37:g.18270308A>T	ENSP00000366586:p.Glu331Val		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	pfam_ZIP	p.E331V	ENST00000377369.2	37	c.992	CCDS44362.1	10	.	.	.	.	.	.	.	.	.	.	A	26.8	4.773123	0.90108	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.64803	0.02;-0.12;0.01;-0.07	5.8	5.8	0.92144	.	0.141204	0.64402	D	0.000006	T	0.80259	0.4590	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.80764	0.994;0.968;0.994	T	0.82408	-0.0472	10	0.59425	D	0.04	-12.0773	16.1499	0.81605	1.0:0.0:0.0:0.0	.	331;331;331	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	V	331;331;331;197;251	ENSP00000366586:E331V;ENSP00000366591:E331V;ENSP00000366588:E331V;ENSP00000440445:E197V	ENSP00000366586:E331V	E	+	2	0	SLC39A12	18310314	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.572000	0.90756	2.220000	0.72140	0.533000	0.62120	GAG	SLC39A12	-	NULL	ENSG00000148482		0.488	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A12	HGNC	protein_coding		-	0.00	23	0	A	NM_152725		18270308	+1	tier1	-	no_errors	ENST00000377369	ensembl	human	known	74_37	missense	20.51	31	8	SNP	1.000	T
SLC45A1	50651	genome.wustl.edu	37	1	8398028	8398028	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:8398028G>A	ENST00000471889.1	+	7	2135	c.1750G>A	c.(1750-1752)Gcc>Acc	p.A584T	SLC45A1_ENST00000377479.2_Missense_Mutation_p.A618T|SLC45A1_ENST00000289877.8_Missense_Mutation_p.A584T			Q9Y2W3	S45A1_HUMAN	solute carrier family 45, member 1	584					carbohydrate transport (GO:0008643)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(2)	33	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)		GTGTATCTACGCCTTCAGTGC	0.602																																																	0													99.0	91.0	93.0					1																	8398028		2203	4300	6503	SO:0001583	missense	0			AF118274	CCDS30577.1	1p36.23	2014-01-28	2005-10-04	2005-10-04	ENSG00000162426	ENSG00000162426		"""Solute carriers"""	17939	protein-coding gene	gene with protein product	"""H+/sugar symporter"""	605763	"""deleted in neuroblastoma 5"""	DNB5		10729226	Standard	XM_005263467		Approved		uc001apb.3	Q9Y2W3	OTTHUMG00000000503	ENST00000471889.1:c.1750G>A	1.37:g.8398028G>A	ENSP00000418096:p.Ala584Thr		Q5VY46|Q5VY49	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.A618T	ENST00000471889.1	37	c.1852	CCDS30577.1	1	.	.	.	.	.	.	.	.	.	.	G	16.61	3.171765	0.57584	.	.	ENSG00000162426	ENST00000471889;ENST00000377479;ENST00000289877	D;D;D	0.81499	-1.5;-1.5;-1.5	4.83	3.91	0.45181	Major facilitator superfamily domain, general substrate transporter (1);	0.161379	0.53938	N	0.000042	T	0.74824	0.3767	L	0.45470	1.425	0.58432	D	0.999999	B	0.21452	0.056	B	0.13407	0.009	T	0.72097	-0.4393	10	0.66056	D	0.02	-31.899	13.5351	0.61643	0.0:0.0:0.8429:0.1571	.	584	Q9Y2W3	S45A1_HUMAN	T	584;618;584	ENSP00000418096:A584T;ENSP00000366699:A618T;ENSP00000289877:A584T	ENSP00000289877:A584T	A	+	1	0	SLC45A1	8320615	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	9.380000	0.97202	0.976000	0.38417	0.655000	0.94253	GCC	SLC45A1	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000162426		0.602	SLC45A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A1	HGNC	protein_coding	OTTHUMT00000001245.5	-	0.00	43	0	G			8398028	+1	tier1	-	no_errors	ENST00000377479	ensembl	human	known	74_37	missense	16.39	51	10	SNP	1.000	A
SLC6A1	6529	genome.wustl.edu	37	3	11067497	11067497	+	Silent	SNP	C	C	T	rs144034291		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:11067497C>T	ENST00000287766.4	+	9	1309	c.888C>T	c.(886-888)taC>taT	p.Y296Y	SLC6A1_ENST00000536032.1_Silent_p.Y118Y	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	296					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	TCTTCTCATACGGGCTGGGCC	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		17698	0.0		0.001	False		,,,				2504	0.0																0								C		1,4405	2.1+/-5.4	0,1,2202	108.0	110.0	109.0		888	-3.3	1.0	3	dbSNP_134	109	0,8600		0,0,4300	no	coding-synonymous	SLC6A1	NM_003042.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		296/600	11067497	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.888C>T	3.37:g.11067497C>T			Q8N4K8	Silent	SNP	pfam_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT1,pfscan_Na/ntran_symport	p.Y296	ENST00000287766.4	37	c.888	CCDS2603.1	3																																																																																			SLC6A1	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000157103		0.532	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A1	HGNC	protein_coding	OTTHUMT00000102767.2	-	0.00	44	0	C	NM_003042		11067497	+1	tier1	rs144034291	no_errors	ENST00000287766	ensembl	human	known	74_37	silent	26.83	30	11	SNP	0.759	T
SLC8A1	6546	genome.wustl.edu	37	2	40656365	40656365	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:40656365T>A	ENST00000403092.1	-	2	1089	c.1056A>T	c.(1054-1056)caA>caT	p.Q352H	SLC8A1_ENST00000408028.2_Missense_Mutation_p.Q352H|SLC8A1_ENST00000406391.2_Missense_Mutation_p.Q352H|SLC8A1_ENST00000405901.3_Missense_Mutation_p.Q352H|SLC8A1_ENST00000542756.1_Missense_Mutation_p.Q352H|SLC8A1_ENST00000402441.1_Missense_Mutation_p.Q352H|SLC8A1_ENST00000542024.1_Missense_Mutation_p.Q352H|SLC8A1_ENST00000406785.2_Missense_Mutation_p.Q352H|SLC8A1_ENST00000405269.1_Missense_Mutation_p.Q352H|SLC8A1_ENST00000332839.4_Missense_Mutation_p.Q352H			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	352					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GACTTAGGACTTGGTAGTTAG	0.413																																																	0													168.0	167.0	167.0					2																	40656365		2203	4300	6503	SO:0001583	missense	0				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1056A>T	2.37:g.40656365T>A	ENSP00000384763:p.Gln352His		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,pfscan_DnaJ_domain,prints_Na_Ca_Ex,prints_NaCa_exhngr1,tigrfam_Na_Ca_Ex	p.Q352H	ENST00000403092.1	37	c.1056	CCDS1806.1	2	.	.	.	.	.	.	.	.	.	.	T	11.87	1.767425	0.31320	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.29917	1.56;1.6;1.6;1.6;1.56;1.56;1.6;1.56;1.56;1.55	6.17	-4.89	0.03103	Heat shock protein DnaJ, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.43033	0.1229	L	0.49350	1.555	0.80722	D	1	D;D;D;B;B	0.76494	0.999;0.995;0.999;0.094;0.056	D;D;D;B;B	0.83275	0.993;0.996;0.995;0.055;0.037	T	0.36553	-0.9743	10	0.41790	T	0.15	.	15.3352	0.74247	0.0:0.6094:0.0:0.3906	.	352;352;352;352;352	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	H	352	ENSP00000383886:Q352H;ENSP00000440727:Q352H;ENSP00000384763:Q352H;ENSP00000385678:Q352H;ENSP00000385188:Q352H;ENSP00000385535:Q352H;ENSP00000332931:Q352H;ENSP00000384908:Q352H;ENSP00000385811:Q352H;ENSP00000443515:Q352H	ENSP00000332931:Q352H	Q	-	3	2	SLC8A1	40509869	0.840000	0.29493	0.929000	0.37066	0.998000	0.95712	-0.064000	0.11636	-0.897000	0.03910	0.533000	0.62120	CAA	SLC8A1	-	pfscan_DnaJ_domain,tigrfam_Na_Ca_Ex	ENSG00000183023		0.413	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A1	HGNC	protein_coding	OTTHUMT00000326065.1	-	0.00	79	0	T	NM_021097		40656365	-1	tier1	-	no_errors	ENST00000332839	ensembl	human	known	74_37	missense	30.68	61	27	SNP	0.968	A
SLC9A6	10479	genome.wustl.edu	37	X	135104757	135104757	+	Silent	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:135104757T>C	ENST00000370698.3	+	11	1302	c.1267T>C	c.(1267-1269)Ttg>Ctg	p.L423L	SLC9A6_ENST00000370695.4_Silent_p.L455L|SLC9A6_ENST00000370701.1_Silent_p.L403L	NM_006359.2	NP_006350.1	Q92581	SL9A6_HUMAN	solute carrier family 9, subfamily A (NHE6, cation proton antiporter 6), member 6	423					axon extension (GO:0048675)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|dendrite extension (GO:0097484)|dendritic spine development (GO:0060996)|ion transport (GO:0006811)|neuron projection morphogenesis (GO:0048812)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon terminus (GO:0043679)|axonal spine (GO:0044308)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|early endosome membrane (GO:0031901)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|synapse (GO:0045202)	sodium:proton antiporter activity (GO:0015385)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(18)|ovary(2)|upper_aerodigestive_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					TGCTATTTTCTTGGGAAGAGC	0.313																																																	0													93.0	82.0	86.0					X																	135104757		2203	4300	6503	SO:0001819	synonymous_variant	0			AF030409	CCDS14654.1, CCDS44003.1, CCDS55504.1	Xq26.3	2013-05-22	2012-03-22		ENSG00000198689	ENSG00000198689		"""Solute carriers"""	11079	protein-coding gene	gene with protein product		300231	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 6"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 6"""			9507001	Standard	NM_001042537		Approved	NHE6, KIAA0267	uc004ezk.3	Q92581	OTTHUMG00000022498	ENST00000370698.3:c.1267T>C	X.37:g.135104757T>C			A6NIQ9|A8K160|B4DU30|B7ZAE0|Q3ZCW7|Q5JPP8|Q5JPP9|Q86VS0	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.L455	ENST00000370698.3	37	c.1363	CCDS14654.1	X																																																																																			SLC9A6	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000198689		0.313	SLC9A6-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	SLC9A6	HGNC	protein_coding	OTTHUMT00000058450.1	-	0.00	39	0	T	NM_006359		135104757	+1	tier1	-	no_errors	ENST00000370695	ensembl	human	known	74_37	silent	11.11	56	7	SNP	1.000	C
SLCO3A1	28232	genome.wustl.edu	37	15	92663743	92663743	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:92663743G>T	ENST00000318445.6	+	5	1272	c.1058G>T	c.(1057-1059)tGc>tTc	p.C353F	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.C353F|SLCO3A1_ENST00000555549.1_3'UTR	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	353					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	GTGTTCACCTGCATCATCCTG	0.567																																																	0													230.0	188.0	202.0					15																	92663743		2198	4298	6496	SO:0001583	missense	0			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.1058G>T	15.37:g.92663743G>T	ENSP00000320634:p.Cys353Phe		A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.C353F	ENST00000318445.6	37	c.1058	CCDS10371.1	15	.	.	.	.	.	.	.	.	.	.	G	11.83	1.756461	0.31137	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000555549	T;T	0.38722	1.12;1.12	5.2	5.2	0.72013	Major facilitator superfamily domain, general substrate transporter (1);	0.000000	0.85682	D	0.000000	T	0.48484	0.1502	N	0.17838	0.53	0.80722	D	1	D;D;P	0.89917	0.999;1.0;0.952	D;D;P	0.85130	0.952;0.997;0.786	T	0.33137	-0.9880	10	0.11182	T	0.66	.	18.7361	0.91755	0.0:0.0:1.0:0.0	.	295;353;353	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	F	353;353;72	ENSP00000320634:C353F;ENSP00000387846:C353F	ENSP00000320634:C353F	C	+	2	0	SLCO3A1	90464747	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.198000	0.94994	2.418000	0.82041	0.650000	0.86243	TGC	SLCO3A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000176463		0.567	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO3A1	HGNC	protein_coding	OTTHUMT00000313529.1	-	0.00	47	0	G	NM_013272		92663743	+1	tier1	-	no_errors	ENST00000318445	ensembl	human	known	74_37	missense	40.00	36	24	SNP	1.000	T
SLIT3	6586	genome.wustl.edu	37	5	168151436	168151436	+	Missense_Mutation	SNP	C	C	T	rs561553750		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:168151436C>T	ENST00000519560.1	-	21	2743	c.2324G>A	c.(2323-2325)cGa>cAa	p.R775Q	SLIT3_ENST00000404867.3_Missense_Mutation_p.R775Q|SLIT3_ENST00000332966.8_Missense_Mutation_p.R775Q	NM_001271946.1|NM_003062.2	NP_001258875.1|NP_003053	O75094	SLIT3_HUMAN	slit homolog 3 (Drosophila)	775					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|cellular response to hormone stimulus (GO:0032870)|negative chemotaxis (GO:0050919)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of gene expression (GO:0010629)|organ morphogenesis (GO:0009887)|response to cortisol (GO:0051414)|Roundabout signaling pathway (GO:0035385)	extracellular space (GO:0005615)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|Roundabout binding (GO:0048495)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(15)|liver(2)|lung(48)|ovary(4)|prostate(7)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	100	Renal(175;0.000159)|Lung NSC(126;0.0174)|all_lung(126;0.0392)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CGTCAGGTGTCGGAGGGCGGA	0.522													c|||	1	0.000199681	0.0	0.0014	5008	,	,		17874	0.0		0.0	False		,,,				2504	0.0				Ovarian(29;311 847 10864 17279 24903)												0													68.0	63.0	65.0					5																	168151436		2203	4297	6500	SO:0001583	missense	0			AB011538	CCDS4369.1, CCDS64311.1	5q35	2008-07-18	2001-11-28		ENSG00000184347	ENSG00000184347			11087	protein-coding gene	gene with protein product		603745	"""slit (Drosophila) homolog 3"""	SLIL2		9693030, 9813312	Standard	NM_001271946		Approved	slit2, MEGF5, SLIT1, Slit-3	uc010jjg.4	O75094	OTTHUMG00000130409	ENST00000519560.1:c.2324G>A	5.37:g.168151436C>T	ENSP00000430333:p.Arg775Gln		A6H8U9|J3KNP3|O95804|Q9UFH5	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Leu-rich_rpt,pfam_Laminin_G,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl_sf,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.R775Q	ENST00000519560.1	37	c.2324	CCDS4369.1	5	.	.	.	.	.	.	.	.	.	.	c	20.9	4.069808	0.76301	.	.	ENSG00000184347	ENST00000519560;ENST00000332966;ENST00000404867	T;T;T	0.79749	-1.3;-1.3;-1.3	4.87	3.99	0.46301	.	0.114014	0.64402	D	0.000013	T	0.71099	0.3300	N	0.13371	0.34	0.39901	D	0.973894	P	0.51537	0.946	P	0.49477	0.612	T	0.74340	-0.3697	10	0.72032	D	0.01	.	8.8978	0.35476	0.0:0.7702:0.1508:0.079	.	775	O75094	SLIT3_HUMAN	Q	775	ENSP00000430333:R775Q;ENSP00000332164:R775Q;ENSP00000384890:R775Q	ENSP00000332164:R775Q	R	-	2	0	SLIT3	168084014	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	2.855000	0.48333	1.040000	0.40099	0.489000	0.48404	CGA	SLIT3	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000184347		0.522	SLIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT3	HGNC	protein_coding	OTTHUMT00000252792.4	-	0.00	49	0	C	NM_003062		168151436	-1	tier1	-	no_errors	ENST00000519560	ensembl	human	known	74_37	missense	31.03	40	18	SNP	1.000	T
SLITRK1	114798	genome.wustl.edu	37	13	84453910	84453910	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr13:84453910C>A	ENST00000377084.2	-	1	2618	c.1733G>T	c.(1732-1734)tGc>tTc	p.C578F		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	578	LRRCT 2.				adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CAGCTGAGGGCAGATCTCGTC	0.537																																																	0													89.0	76.0	81.0					13																	84453910		2203	4300	6503	SO:0001583	missense	0			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.1733G>T	13.37:g.84453910C>A	ENSP00000366288:p.Cys578Phe		Q5U5I6|Q96SF9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.C578F	ENST00000377084.2	37	c.1733	CCDS9464.1	13	.	.	.	.	.	.	.	.	.	.	C	17.32	3.360520	0.61403	.	.	ENSG00000178235	ENST00000377084	T	0.68479	-0.33	5.22	5.22	0.72569	Cysteine-rich flanking region, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83468	0.5261	M	0.83312	2.635	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85873	0.1417	10	0.87932	D	0	-9.7137	17.693	0.88273	0.0:1.0:0.0:0.0	.	578	Q96PX8	SLIK1_HUMAN	F	578	ENSP00000366288:C578F	ENSP00000366288:C578F	C	-	2	0	SLITRK1	83351911	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.776000	0.85560	2.603000	0.88011	0.655000	0.94253	TGC	SLITRK1	-	smart_Cys-rich_flank_reg_C	ENSG00000178235		0.537	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK1	HGNC	protein_coding	OTTHUMT00000045396.1	-	0.00	16	0	C	NM_052910		84453910	-1	tier1	-	no_errors	ENST00000377084	ensembl	human	known	74_37	missense	27.27	16	6	SNP	1.000	A
SLITRK2	84631	genome.wustl.edu	37	X	144905711	144905711	+	Silent	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:144905711T>C	ENST00000370490.1	+	1	6023	c.1768T>C	c.(1768-1770)Ttg>Ctg	p.L590L	SLITRK2_ENST00000428560.2_Silent_p.L590L|SLITRK2_ENST00000413937.2_Silent_p.L590L|SLITRK2_ENST00000434188.2_Silent_p.L590L|SLITRK2_ENST00000447897.2_Silent_p.L590L			Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2	590					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(17)|lung(40)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	86	Acute lymphoblastic leukemia(192;6.56e-05)					TGGAACCGTCTTGTCAATGAA	0.468																																																	0													85.0	66.0	73.0					X																	144905711		2203	4300	6503	SO:0001819	synonymous_variant	0			Y19205	CCDS14680.1	Xq27.3	2008-02-05	2004-03-11		ENSG00000185985	ENSG00000185985			13449	protein-coding gene	gene with protein product		300561	"""slit-like 1 (Drosophila)"""	SLITL1		11347906, 14557068	Standard	NM_032539		Approved	KIAA1854, CXorf2	uc011mwr.2	Q9H156	OTTHUMG00000022595	ENST00000370490.1:c.1768T>C	X.37:g.144905711T>C			A8K117|Q2KHN3|Q5JXB1|Q8NBC7|Q96JH3	Silent	SNP	pfam_Leu-rich_rpt,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L590	ENST00000370490.1	37	c.1768	CCDS14680.1	X																																																																																			SLITRK2	-	NULL	ENSG00000185985		0.468	SLITRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK2	HGNC	protein_coding	OTTHUMT00000058633.1	-	0.00	27	0	T	NM_032539		144905711	+1	tier1	-	no_errors	ENST00000370490	ensembl	human	known	74_37	silent	56.10	18	23	SNP	0.036	C
SMC2	10592	genome.wustl.edu	37	9	106864245	106864245	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr9:106864245G>C	ENST00000286398.7	+	8	929	c.641G>C	c.(640-642)aGa>aCa	p.R214T	SMC2_ENST00000303219.8_Missense_Mutation_p.R214T|SMC2_ENST00000374787.3_Missense_Mutation_p.R214T|SMC2_ENST00000374793.3_Missense_Mutation_p.R214T	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	214					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						TTTCAGGAAAGATCGTCCTAC	0.279																																																	0													68.0	74.0	72.0					9																	106864245		2182	4292	6474	SO:0001583	missense	0			AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.641G>C	9.37:g.106864245G>C	ENSP00000286398:p.Arg214Thr		Q6IEE0|Q9P1P2	Missense_Mutation	SNP	pfam_RecF/RecN/SMC_N,pfam_SMC_hinge,superfamily_P-loop_NTPase,superfamily_SMC_hinge,smart_SMC_hinge	p.R214T	ENST00000286398.7	37	c.641	CCDS35086.1	9	.	.	.	.	.	.	.	.	.	.	G	28.8	4.954832	0.92726	.	.	ENSG00000136824	ENST00000286398;ENST00000440179;ENST00000374793;ENST00000303219;ENST00000536893;ENST00000374787	T;T;T;T;T	0.79247	-1.25;3.3;-1.25;3.3;-1.25	5.86	5.86	0.93980	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.90428	0.7003	M	0.89478	3.035	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.87578	0.998;0.985;0.997	D	0.91173	0.4970	10	0.87932	D	0	-24.7139	19.1404	0.93444	0.0:0.0:1.0:0.0	.	214;214;214	A8K984;O95347;Q2KQ72	.;SMC2_HUMAN;.	T	214;69;214;214;214;214	ENSP00000286398:R214T;ENSP00000414999:R69T;ENSP00000363925:R214T;ENSP00000306152:R214T;ENSP00000363919:R214T	ENSP00000286398:R214T	R	+	2	0	SMC2	105904066	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.644000	0.98468	2.937000	0.99478	0.650000	0.86243	AGA	SMC2	-	pfam_RecF/RecN/SMC_N,superfamily_P-loop_NTPase	ENSG00000136824		0.279	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC2	HGNC	protein_coding	OTTHUMT00000053470.1		0.00	30	0	G			106864245	+1			no_errors	ENST00000286398	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	C
SNX16	64089	genome.wustl.edu	37	8	82727597	82727597	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:82727597T>A	ENST00000345957.4	-	5	922	c.644A>T	c.(643-645)gAt>gTt	p.D215V	SNX16_ENST00000396330.2_Missense_Mutation_p.D215V|SNX16_ENST00000353788.4_Missense_Mutation_p.D186V|RP13-923O23.6_ENST00000524337.1_RNA	NM_152836.2	NP_690049.1	P57768	SNX16_HUMAN	sorting nexin 16	215	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				early endosome to late endosome transport (GO:0045022)|endosome to lysosome transport (GO:0008333)|protein targeting to lysosome (GO:0006622)	early endosome (GO:0005769)|extrinsic component of endosome membrane (GO:0031313)|late endosome (GO:0005770)|lysosome (GO:0005764)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			large_intestine(1)|ovary(1)|pancreas(1)|skin(2)	5						ACCCGGTGGATCATCCAAACA	0.343																																																	0													95.0	85.0	88.0					8																	82727597		2203	4300	6503	SO:0001583	missense	0			AF305779	CCDS6234.1, CCDS6235.1	8q21.13	2011-05-03			ENSG00000104497	ENSG00000104497		"""Sorting nexins"""	14980	protein-coding gene	gene with protein product		614903				12461558, 12813048	Standard	NM_152837		Approved		uc003ycn.3	P57768	OTTHUMG00000164727	ENST00000345957.4:c.644A>T	8.37:g.82727597T>A	ENSP00000322652:p.Asp215Val		A8K4D8|Q658L0|Q8N4U3	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.D215V	ENST00000345957.4	37	c.644	CCDS6234.1	8	.	.	.	.	.	.	.	.	.	.	T	26.0	4.696712	0.88830	.	.	ENSG00000104497	ENST00000353788;ENST00000396330;ENST00000345957	T;T;T	0.57273	0.41;0.41;0.41	5.76	5.76	0.90799	Phox homologous domain (3);	0.044558	0.85682	D	0.000000	T	0.72366	0.3451	M	0.75615	2.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	T	0.73975	-0.3813	10	0.49607	T	0.09	-20.3028	16.0723	0.80943	0.0:0.0:0.0:1.0	.	186;215	Q658L0;P57768	.;SNX16_HUMAN	V	186;215;215	ENSP00000322631:D186V;ENSP00000379621:D215V;ENSP00000322652:D215V	ENSP00000322652:D215V	D	-	2	0	SNX16	82890152	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.350000	0.79385	2.199000	0.70637	0.528000	0.53228	GAT	SNX16	-	superfamily_Phox,pfscan_Phox	ENSG00000104497		0.343	SNX16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX16	HGNC	protein_coding	OTTHUMT00000379929.1		0.00	20	0	T	NM_022133		82727597	-1			no_errors	ENST00000345957	ensembl	human	known	74_37	missense	10.00	27	3	SNP	1.000	A
SPACA1	81833	genome.wustl.edu	37	6	88768457	88768457	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:88768457C>A	ENST00000237201.1	+	4	508	c.391C>A	c.(391-393)Ctt>Att	p.L131I		NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	131					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		TTCAGAAAGTCTTGAAAGTGT	0.313																																																	0													87.0	91.0	90.0					6																	88768457		2203	4300	6503	SO:0001583	missense	0			AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.391C>A	6.37:g.88768457C>A	ENSP00000237201:p.Leu131Ile			Missense_Mutation	SNP	NULL	p.L131I	ENST00000237201.1	37	c.391	CCDS5014.1	6	.	.	.	.	.	.	.	.	.	.	C	17.72	3.459628	0.63401	.	.	ENSG00000118434	ENST00000237201	T	0.42131	0.98	5.49	4.59	0.56863	.	0.116551	0.38959	N	0.001505	T	0.18341	0.0440	L	0.53249	1.67	0.25375	N	0.988662	P	0.42518	0.782	B	0.34652	0.187	T	0.08617	-1.0713	10	0.45353	T	0.12	-13.9163	8.5368	0.33368	0.1533:0.7671:0.0:0.0796	.	131	Q9HBV2	SACA1_HUMAN	I	131	ENSP00000237201:L131I	ENSP00000237201:L131I	L	+	1	0	SPACA1	88825176	0.514000	0.26202	1.000000	0.80357	0.982000	0.71751	1.535000	0.36061	2.575000	0.86900	0.650000	0.86243	CTT	SPACA1	-	NULL	ENSG00000118434		0.313	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPACA1	HGNC	protein_coding	OTTHUMT00000041459.1	-	0.00	24	0	C			88768457	+1	tier1	-	no_errors	ENST00000237201	ensembl	human	known	74_37	missense	30.00	35	15	SNP	0.967	A
SPPL2C	162540	genome.wustl.edu	37	17	43922683	43922683	+	Silent	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:43922683G>A	ENST00000329196.5	+	1	428	c.411G>A	c.(409-411)caG>caA	p.Q137Q	MAPT-AS1_ENST00000579244.1_RNA|MAPT-AS1_ENST00000579599.1_RNA|MAPT-AS1_ENST00000581125.1_RNA	NM_175882.2	NP_787078.2	Q8IUH8	SPP2C_HUMAN	signal peptide peptidase like 2C	137	PA.					endoplasmic reticulum membrane (GO:0005789)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)										TGGCACCCCAGGATCCCCGCC	0.647																																																	0													51.0	48.0	49.0					17																	43922683		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32673.1	17q21.31	2014-02-12			ENSG00000185294	ENSG00000185294			28902	protein-coding gene	gene with protein product	"""intramembrane protease 5"""	608284				12139484	Standard	NM_175882		Approved	IMP5	uc010wka.2	Q8IUH8		ENST00000329196.5:c.411G>A	17.37:g.43922683G>A			Q8TC67|Q8WVZ6	Silent	SNP	pfam_Peptidase_A22B_SPP,pfam_Protease-assoc_domain,smart_Preselin/SPP	p.Q137	ENST00000329196.5	37	c.411	CCDS32673.1	17																																																																																			SPPL2C	-	pfam_Protease-assoc_domain	ENSG00000185294		0.647	SPPL2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL2C	HGNC	protein_coding	OTTHUMT00000441156.1	-	0.00	49	0	G	NM_175882		43922683	+1	tier1	-	no_errors	ENST00000329196	ensembl	human	known	74_37	silent	58.42	42	59	SNP	0.286	A
SSX2IP	117178	genome.wustl.edu	37	1	85136405	85136405	+	Missense_Mutation	SNP	G	G	A	rs373832172		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:85136405G>A	ENST00000342203.3	-	3	400	c.137C>T	c.(136-138)tCg>tTg	p.S46L	SSX2IP_ENST00000605755.1_Missense_Mutation_p.S19L|SSX2IP_ENST00000603677.1_Intron|SSX2IP_ENST00000437941.2_Missense_Mutation_p.S19L|SSX2IP_ENST00000370612.4_Missense_Mutation_p.S46L	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	46					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		CACATTTTTCGATAAAGGTAT	0.338																																																	0								G	LEU/SER,LEU/SER,LEU/SER,LEU/SER,LEU/SER	0,4406		0,0,2203	114.0	128.0	123.0		137,137,56,56,137	4.4	1.0	1		123	1,8595	1.2+/-3.3	0,1,4297	no	missense,missense,missense,missense,missense	SSX2IP	NM_014021.3,NM_001166417.1,NM_001166295.1,NM_001166294.1,NM_001166293.1	145,145,145,145,145	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign	46/615,46/615,19/588,19/588,46/615	85136405	1,13001	2203	4298	6501	SO:0001583	missense	0				CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.137C>T	1.37:g.85136405G>A	ENSP00000340279:p.Ser46Leu		A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Missense_Mutation	SNP	pfam_Afadin/alpha-actinin-bd	p.S46L	ENST00000342203.3	37	c.137	CCDS699.1	1	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705984	0.48412	0.0	1.16E-4	ENSG00000117155	ENST00000342203;ENST00000437941;ENST00000544699;ENST00000370612;ENST00000422026	T;T	0.48522	0.84;0.81	5.33	4.42	0.53409	.	0.345508	0.31301	N	0.007894	T	0.18800	0.0451	N	0.24115	0.695	0.34287	D	0.682772	B;B;B	0.19706	0.03;0.038;0.018	B;B;B	0.10450	0.004;0.005;0.003	T	0.07868	-1.0750	10	0.62326	D	0.03	0.7109	12.3179	0.54969	0.0789:0.0:0.9211:0.0	.	42;46;19	F5H549;Q9Y2D8;B4DFE3	.;ADIP_HUMAN;.	L	46;19;42;46;46	ENSP00000340279:S46L;ENSP00000412781:S19L	ENSP00000340279:S46L	S	-	2	0	SSX2IP	84908993	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.816000	0.55658	1.260000	0.44134	0.591000	0.81541	TCG	SSX2IP	-	NULL	ENSG00000117155		0.338	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX2IP	HGNC	protein_coding	OTTHUMT00000027469.1	-	0.00	19	0	G	NM_014021		85136405	-1	tier1	-	no_errors	ENST00000342203	ensembl	human	known	74_37	missense	31.03	20	9	SNP	1.000	A
STAG2	10735	genome.wustl.edu	37	X	123176428	123176428	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:123176428C>A	ENST00000371160.1	+	7	685	c.395C>A	c.(394-396)aCa>aAa	p.T132K	STAG2_ENST00000371145.3_Missense_Mutation_p.T132K|STAG2_ENST00000354548.5_Missense_Mutation_p.T63K|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000371157.3_Missense_Mutation_p.T132K|STAG2_ENST00000218089.9_Missense_Mutation_p.T132K|STAG2_ENST00000371144.3_Missense_Mutation_p.T132K	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	132					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						GGAGTTGTCACAGCAGAAATG	0.313																																																	0													69.0	66.0	67.0					X																	123176428		2203	4300	6503	SO:0001583	missense	0			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.395C>A	X.37:g.123176428C>A	ENSP00000360202:p.Thr132Lys		B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.T132K	ENST00000371160.1	37	c.395	CCDS14607.1	X	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453554	0.63290	.	.	ENSG00000101972	ENST00000218089;ENST00000455404;ENST00000354548;ENST00000371160;ENST00000435103;ENST00000371157;ENST00000371145;ENST00000371144;ENST00000428941;ENST00000435215	T;T;T;T;T;T;T	0.49139	1.8;0.79;1.41;1.4;1.4;1.8;1.4	5.44	4.55	0.56014	.	0.050015	0.85682	D	0.000000	T	0.46229	0.1382	L	0.56769	1.78	0.43187	D	0.995018	B;P	0.35226	0.234;0.491	B;B	0.35182	0.197;0.184	T	0.39440	-0.9614	10	0.34782	T	0.22	-12.738	15.488	0.75582	0.0:0.8647:0.1353:0.0	.	132;132	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	K	132;132;63;132;132;132;132;132;132;132	ENSP00000218089:T132K;ENSP00000397265:T132K;ENSP00000346555:T63K;ENSP00000360202:T132K;ENSP00000360199:T132K;ENSP00000360187:T132K;ENSP00000360186:T132K	ENSP00000218089:T132K	T	+	2	0	STAG2	123004109	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	2.110000	0.41873	1.162000	0.42619	0.522000	0.50473	ACA	STAG2	-	NULL	ENSG00000101972		0.313	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAG2	HGNC	protein_coding	OTTHUMT00000156159.2	-	0.00	75	0	C	NM_006603		123176428	+1	tier1	-	no_errors	ENST00000218089	ensembl	human	known	74_37	missense	12.50	49	7	SNP	1.000	A
TRIM74	378108	genome.wustl.edu	37	7	72440244	72440244	+	5'Flank	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr7:72440244G>A	ENST00000285805.3	-	0	0				TRIM74_ENST00000395244.1_5'Flank	NM_198853.1	NP_942150.1	Q86UV6	TRI74_HUMAN	tripartite motif containing 74							intracellular (GO:0005622)	zinc ion binding (GO:0008270)			prostate(1)	1						GGGGTCTGCCGGGCATAAAGG	0.682																																																	0																																										SO:0001631	upstream_gene_variant	0			AF498999	CCDS5545.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000155428	ENSG00000155428		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	17453	protein-coding gene	gene with protein product		612550	"""tripartite motif-containing 50C"", ""tripartite motif-containing 74"""	TRIM50C			Standard	NM_198853		Approved	MGC45440		Q86UV6	OTTHUMG00000129851		7.37:g.72440244G>A	Exception_encountered		B7WP46	RNA	SNP	-	NULL	ENST00000285805.3	37	NULL	CCDS5545.1	7																																																																																			STAG3L3	-	-	ENSG00000174353		0.682	TRIM74-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAG3L3	HGNC	protein_coding	OTTHUMT00000252093.1	-	0.00	59	0	G	NM_198853		72440244	-1	tier1	-	no_errors	ENST00000436857	ensembl	human	known	74_37	rna	39.81	64	43	SNP	0.009	A
STARD8	9754	genome.wustl.edu	37	X	67942429	67942429	+	Missense_Mutation	SNP	C	C	T	rs139291119		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:67942429C>T	ENST00000252336.6	+	11	2872	c.2500C>T	c.(2500-2502)Cgc>Tgc	p.R834C	STARD8_ENST00000374597.3_Missense_Mutation_p.R834C|STARD8_ENST00000374599.3_Missense_Mutation_p.R914C	NM_014725.4	NP_055540.2	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8	834	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						TGCTGCTGAGCGCTTCAAGGG	0.637																																																	0									CYS/ARG,CYS/ARG,CYS/ARG	0,3835		0,0,1632,571	57.0	49.0	52.0		2740,2500,2500	0.3	1.0	X	dbSNP_134	52	1,6727		0,1,2427,1872	no	missense,missense,missense	STARD8	NM_001142503.2,NM_001142504.2,NM_014725.4	180,180,180	0,1,4059,2443	TT,TC,CC,C		0.0149,0.0,0.0095	probably-damaging,probably-damaging,probably-damaging	914/1104,834/1024,834/1024	67942429	1,10562	2203	4300	6503	SO:0001583	missense	0			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000252336.6:c.2500C>T	X.37:g.67942429C>T	ENSP00000252336:p.Arg834Cys		A8K6T2|D3DVT9|Q5JST0|Q68DG7	Missense_Mutation	SNP	pfam_START_lipid-bd_dom,pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom,pfscan_RhoGAP_dom	p.R914C	ENST00000252336.6	37	c.2740	CCDS14390.1	X	.	.	.	.	.	.	.	.	.	.	c	18.07	3.540971	0.65085	0.0	1.49E-4	ENSG00000130052	ENST00000252336;ENST00000374599;ENST00000374597	T;T;T	0.30182	1.54;1.54;1.54	4.36	0.348	0.16026	Lipid-binding START (3);START-like domain (1);	0.256282	0.29544	N	0.011854	T	0.42426	0.1202	L	0.59436	1.845	0.49582	D	0.999804	D;D	0.89917	0.998;1.0	D;D	0.77557	0.982;0.99	T	0.29305	-1.0016	10	0.87932	D	0	.	4.1279	0.10136	0.1629:0.5354:0.0:0.3017	.	914;834	Q92502-2;Q92502	.;STAR8_HUMAN	C	834;914;834	ENSP00000252336:R834C;ENSP00000363727:R914C;ENSP00000363725:R834C	ENSP00000252336:R834C	R	+	1	0	STARD8	67859154	1.000000	0.71417	0.989000	0.46669	0.980000	0.70556	1.762000	0.38451	0.027000	0.15297	0.509000	0.49947	CGC	STARD8	-	pfam_START_lipid-bd_dom,smart_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	ENSG00000130052		0.637	STARD8-201	KNOWN	basic|CCDS	protein_coding	STARD8	HGNC	protein_coding	OTTHUMT00000057026.2	-	0.00	79	0	C	NM_014725		67942429	+1	tier1	rs139291119	no_errors	ENST00000374599	ensembl	human	known	74_37	missense	7.14	91	7	SNP	0.997	T
STIP1	10963	genome.wustl.edu	37	11	63970376	63970376	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:63970376C>T	ENST00000305218.4	+	11	1421	c.1274C>T	c.(1273-1275)cCg>cTg	p.P425L	STIP1_ENST00000538945.1_Missense_Mutation_p.P401L|STIP1_ENST00000358794.5_Missense_Mutation_p.P472L	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	425					response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						CAGCTGGAGCCGACCTTCAGT	0.488																																																	0													213.0	195.0	201.0					11																	63970376		2201	4297	6498	SO:0001583	missense	0			BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.1274C>T	11.37:g.63970376C>T	ENSP00000305958:p.Pro425Leu		B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,smart_STI1_HS-bd,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P425L	ENST00000305218.4	37	c.1274	CCDS8058.1	11	.	.	.	.	.	.	.	.	.	.	C	32	5.128483	0.94473	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945;ENST00000540887	T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.49	5.0	5.0	0.66597	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.054800	0.85682	D	0.000000	D	0.88683	0.6503	H	0.99090	4.425	0.80722	D	1	P;P	0.44690	0.808;0.841	B;P	0.46940	0.263;0.532	D	0.93279	0.6658	10	0.87932	D	0	-17.3734	17.4505	0.87591	0.0:1.0:0.0:0.0	.	401;425	F5H0T1;P31948	.;STIP1_HUMAN	L	472;425;401;24	ENSP00000351646:P472L;ENSP00000305958:P425L;ENSP00000445957:P401L;ENSP00000443416:P24L	ENSP00000305958:P425L	P	+	2	0	STIP1	63726952	1.000000	0.71417	0.958000	0.39756	0.978000	0.69477	7.030000	0.76484	2.506000	0.84524	0.561000	0.74099	CCG	STIP1	-	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000168439		0.488	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STIP1	HGNC	protein_coding	OTTHUMT00000396289.2	-	0.00	66	0	C	NM_006819		63970376	+1	tier1	-	no_errors	ENST00000305218	ensembl	human	known	74_37	missense	10.71	74	9	SNP	1.000	T
STK32B	55351	genome.wustl.edu	37	4	5053593	5053593	+	Start_Codon_SNP	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:5053593G>A	ENST00000282908.5	+	1	425	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_018401.1	NP_060871.1			serine/threonine kinase 32B											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						GGCGGAATATGGGCGGGAACC	0.672																																																	0													47.0	44.0	45.0					4																	5053593		2196	4287	6483	SO:0001582	initiator_codon_variant	0			AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.3G>A	4.37:g.5053593G>A	ENSP00000282908:p.Met1Ile			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.M1I	ENST00000282908.5	37	c.3	CCDS3380.1	4	.	.	.	.	.	.	.	.	.	.	G	18.44	3.624527	0.66901	.	.	ENSG00000152953	ENST00000282908	T	0.64618	-0.11	4.6	4.6	0.57074	.	0.000000	0.44688	U	0.000432	T	0.77651	0.4162	.	.	.	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.80422	-0.1389	9	0.62326	D	0.03	.	12.9083	0.58164	0.0:0.0:1.0:0.0	.	1	Q9NY57	ST32B_HUMAN	I	1	ENSP00000282908:M1I	ENSP00000282908:M1I	M	+	3	0	STK32B	5104494	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	4.139000	0.58024	2.073000	0.62155	0.591000	0.81541	ATG	STK32B	-	NULL	ENSG00000152953		0.672	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK32B	HGNC	protein_coding	OTTHUMT00000206854.4	-	0.00	67	0	G	NM_018401	Missense_Mutation	5053593	+1	tier1	-	no_errors	ENST00000282908	ensembl	human	known	74_37	missense	32.50	27	13	SNP	1.000	A
STK38L	23012	genome.wustl.edu	37	12	27472324	27472324	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:27472324C>T	ENST00000389032.3	+	12	1312	c.1143C>T	c.(1141-1143)ccC>ccT	p.P381P	STK38L_ENST00000539577.1_Silent_p.P288P	NM_015000.3	NP_055815.1			serine/threonine kinase 38 like											breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)|skin(1)	12	Colorectal(261;0.0847)					AAGGTCATCCCTTTTTTGAAG	0.343																																																	0													108.0	106.0	107.0					12																	27472324		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023182	CCDS31761.1	12p11.23	2014-04-23			ENSG00000211455	ENSG00000211455			17848	protein-coding gene	gene with protein product	"""nuclear Dbf2-related 2"""	615836				16488889	Standard	NM_015000		Approved	KIAA0965, NDR2	uc001rhr.3	Q9Y2H1	OTTHUMG00000169284	ENST00000389032.3:c.1143C>T	12.37:g.27472324C>T				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_dom	p.P381	ENST00000389032.3	37	c.1143	CCDS31761.1	12																																																																																			STK38L	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000211455		0.343	STK38L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK38L	HGNC	protein_coding	OTTHUMT00000403297.1	-	0.00	42	0	C	NM_015000		27472324	+1	tier1	-	no_errors	ENST00000389032	ensembl	human	known	74_37	silent	9.09	50	5	SNP	0.567	T
SUCNR1	56670	genome.wustl.edu	37	3	151599113	151599113	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:151599113G>A	ENST00000362032.5	+	3	887	c.782G>A	c.(781-783)gGg>gAg	p.G261E	RP11-454C18.2_ENST00000475855.1_RNA|RP11-454C18.2_ENST00000483843.2_RNA	NM_033050.4	NP_149039.2	Q9BXA5	SUCR1_HUMAN	succinate receptor 1	261						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)		Succinic acid(DB00139)	TCACGCCTGGGGAGTTGGAAG	0.488																																																	0													221.0	196.0	204.0					3																	151599113		2203	4300	6503	SO:0001583	missense	0			AF348078	CCDS3162.1	3q25.1	2012-08-21	2004-07-08	2004-07-09	ENSG00000198829	ENSG00000198829		"""GPCR / Class A : Orphans"""	4542	protein-coding gene	gene with protein product		606381	"""G protein-coupled receptor 91"""	GPR91		11273702, 15141213, 17192395	Standard	NM_033050		Approved		uc003ezf.2	Q9BXA5	OTTHUMG00000159880	ENST00000362032.5:c.782G>A	3.37:g.151599113G>A	ENSP00000355156:p.Gly261Glu		A8K305|Q8TDQ8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.G261E	ENST00000362032.5	37	c.782	CCDS3162.1	3	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.290887	0.00248	.	.	ENSG00000198829	ENST00000362032	T	0.71222	-0.55	5.46	-6.98	0.01611	GPCR, rhodopsin-like superfamily (1);	2.141030	0.02196	N	0.061795	T	0.40932	0.1137	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.53158	-0.8478	10	0.02654	T	1	.	9.2348	0.37459	0.7231:0.0926:0.0985:0.0857	.	261	Q9BXA5	SUCR1_HUMAN	E	261	ENSP00000355156:G261E	ENSP00000355156:G261E	G	+	2	0	SUCNR1	153081803	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.436000	0.06922	-1.204000	0.02648	-0.911000	0.02809	GGG	SUCNR1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198829		0.488	SUCNR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCNR1	HGNC	protein_coding	OTTHUMT00000357897.2	-	0.00	83	0	G	NM_033050		151599113	+1	tier1	-	no_errors	ENST00000362032	ensembl	human	known	74_37	missense	16.67	120	24	SNP	0.000	A
SULF1	23213	genome.wustl.edu	37	8	70476293	70476293	+	Missense_Mutation	SNP	C	C	T	rs376825615		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:70476293C>T	ENST00000260128.4	+	5	800	c.83C>T	c.(82-84)cCg>cTg	p.P28L	SULF1_ENST00000402687.4_Missense_Mutation_p.P28L|SULF1_ENST00000419716.3_Missense_Mutation_p.P28L|SULF1_ENST00000458141.2_Missense_Mutation_p.P28L	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	28					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)	p.P28Q(1)		breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			GTCAGATCCCCGAGGTTCAGA	0.483																																																	1	Substitution - Missense(1)	lung(1)						C	LEU/PRO,LEU/PRO,LEU/PRO,LEU/PRO	0,4406		0,0,2203	157.0	144.0	148.0		83,83,83,83	2.1	0.0	8		148	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	SULF1	NM_001128204.1,NM_001128205.1,NM_001128206.1,NM_015170.2	98,98,98,98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign,benign,benign	28/872,28/872,28/872,28/872	70476293	1,13005	2203	4300	6503	SO:0001583	missense	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.83C>T	8.37:g.70476293C>T	ENSP00000260128:p.Pro28Leu		Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.P28L	ENST00000260128.4	37	c.83	CCDS6204.1	8	.	.	.	.	.	.	.	.	.	.	C	11.00	1.509971	0.27036	0.0	1.16E-4	ENSG00000137573	ENST00000525061;ENST00000458141;ENST00000260128;ENST00000529134;ENST00000402687;ENST00000419716;ENST00000534179;ENST00000528783;ENST00000525999	D;D;T;D;D;T;D	0.98862	-5.19;-5.19;0.97;-5.19;-5.19;0.96;-4.69	6.06	2.06	0.26882	.	0.300612	0.37095	N	0.002241	D	0.94745	0.8304	L	0.27053	0.805	0.20074	N	0.999936	B	0.02656	0.0	B	0.01281	0.0	D	0.85022	0.0912	10	0.11794	T	0.64	.	9.763	0.40543	0.5024:0.4335:0.0:0.0641	.	28	Q8IWU6	SULF1_HUMAN	L	28	ENSP00000403040:P28L;ENSP00000260128:P28L;ENSP00000432178:P28L;ENSP00000385704:P28L;ENSP00000390315:P28L;ENSP00000436949:P28L;ENSP00000431753:P28L	ENSP00000260128:P28L	P	+	2	0	SULF1	70638847	0.990000	0.36364	0.044000	0.18714	0.895000	0.52256	1.941000	0.40233	0.084000	0.17077	0.650000	0.86243	CCG	SULF1	-	pirsf_Extracellular_sulfatase	ENSG00000137573		0.483	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	-	0.00	81	0	C	NM_015170		70476293	+1	tier1	-	no_errors	ENST00000260128	ensembl	human	known	74_37	missense	13.38	122	19	SNP	0.143	T
SUMO1	7341	genome.wustl.edu	37	2	203084799	203084799	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:203084799delC	ENST00000392246.2	-	2	199	c.43delG	c.(43-45)gatfs	p.D15fs	SUMO1_ENST00000469034.1_5'UTR|SUMO1_ENST00000392244.3_Intron|SUMO1_ENST00000409368.1_Frame_Shift_Del_p.D15fs|SUMO1_ENST00000392245.1_Frame_Shift_Del_p.D15fs|SUMO1_ENST00000409712.1_Frame_Shift_Del_p.D15fs|SUMO1_ENST00000409205.1_5'UTR|SUMO1_ENST00000409181.1_Frame_Shift_Del_p.D15fs|SUMO1_ENST00000409498.2_5'UTR	NM_003352.4	NP_003343.1	P63165	SUMO1_HUMAN	small ubiquitin-like modifier 1	15					cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|DNA repair (GO:0006281)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of DNA binding (GO:0043392)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|PML body organization (GO:0030578)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein complex assembly (GO:0031334)|post-translational protein modification (GO:0043687)|protein localization to nuclear pore (GO:0090204)|protein sumoylation (GO:0016925)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein localization (GO:0032880)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)										TCCTTCTTATCCCCCAAGTCC	0.338																																																	0													122.0	132.0	129.0					2																	203084799		2203	4299	6502	SO:0001589	frameshift_variant	0			U38784	CCDS2352.1, CCDS46493.1	2q33	2013-06-05	2013-06-05	2004-05-19	ENSG00000116030	ENSG00000116030			12502	protein-coding gene	gene with protein product		601912	"""ubiquitin-like 1 (sentrin)"", ""SMT3 suppressor of mif two 3 homolog 1 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)"""	UBL1		8812453, 8906799	Standard	NM_003352		Approved	PIC1, GMP1, SMT3C, SUMO-1, SMT3H3, OFC10	uc002uyz.1	P63165	OTTHUMG00000132839	ENST00000392246.2:c.43delG	2.37:g.203084799delC	ENSP00000376077:p.Asp15fs		A8MUS8|B2R4I5|P55856|Q6FGG0|Q6NZ62|Q93068	Frame_Shift_Del	DEL	pfam_Rad60/SUMO_like,pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.D15fs	ENST00000392246.2	37	c.43	CCDS2352.1	2																																																																																			SUMO1	-	NULL	ENSG00000116030		0.338	SUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUMO1	HGNC	protein_coding	OTTHUMT00000256312.2		0.00	51	0	C	NM_003352		203084799	-1	tier1		no_errors	ENST00000392245	ensembl	human	known	74_37	frame_shift_del	29.17	51	21	DEL	1.000	-
TENM4	26011	genome.wustl.edu	37	11	78565358	78565358	+	Splice_Site	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:78565358A>C	ENST00000278550.7	-	12	1934	c.1472T>G	c.(1471-1473)tTt>tGt	p.F491C		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	491					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CACAAAGTCAAACTGAAAGAC	0.607																																																	0													7.0	8.0	8.0					11																	78565358		690	1584	2274	SO:0001630	splice_region_variant	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.1471-1T>G	11.37:g.78565358A>C			A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.F491C	ENST00000278550.7	37	c.1472	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	A	18.46	3.629048	0.67015	.	.	ENSG00000149256	ENST00000278550	T	0.35048	1.33	5.07	5.07	0.68467	.	0.062472	0.64402	D	0.000003	T	0.54287	0.1849	L	0.55990	1.75	0.54753	D	0.999987	D	0.76494	0.999	D	0.79784	0.993	T	0.52056	-0.8626	9	.	.	.	.	15.0026	0.71486	1.0:0.0:0.0:0.0	.	491	Q6N022	TEN4_HUMAN	C	491	ENSP00000278550:F491C	.	F	-	2	0	ODZ4	78243006	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	5.827000	0.69300	2.126000	0.65437	0.459000	0.35465	TTT	TENM4	-	NULL	ENSG00000149256		0.607	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	-	0.00	33	0	A		Missense_Mutation	78565358	-1	tier1	-	no_errors	ENST00000278550	ensembl	human	known	74_37	missense	10.34	26	3	SNP	1.000	C
TEX10	54881	genome.wustl.edu	37	9	103108371	103108371	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr9:103108371C>A	ENST00000374902.4	-	4	1296	c.1120G>T	c.(1120-1122)Gat>Tat	p.D374Y	TEX10_ENST00000537512.1_Missense_Mutation_p.D309Y|TEX10_ENST00000535814.1_Missense_Mutation_p.D377Y	NM_017746.3	NP_060216.2	Q9NXF1	TEX10_HUMAN	testis expressed 10	374						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|MLL1 complex (GO:0071339)				NS(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	38		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TGGGTTTCATCCTGTTGTTTA	0.353																																																	0													55.0	59.0	57.0					9																	103108371		2203	4299	6502	SO:0001583	missense	0			AB060968	CCDS6748.1, CCDS55330.1	9q31.1	2012-05-02	2007-03-13		ENSG00000136891	ENSG00000136891			25988	protein-coding gene	gene with protein product			"""testis expressed gene 10"", ""testis expressed sequence 10"""			12477932	Standard	NM_017746		Approved	FLJ20287, bA208F1.2, Ipi1	uc004bas.3	Q9NXF1	OTTHUMG00000020366	ENST00000374902.4:c.1120G>T	9.37:g.103108371C>A	ENSP00000364037:p.Asp374Tyr		B4DYV2|Q5T722|Q5T723|Q8NCN8|Q8TDY0	Missense_Mutation	SNP	pfam_IPI1/TEX10,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.D374Y	ENST00000374902.4	37	c.1120	CCDS6748.1	9	.	.	.	.	.	.	.	.	.	.	C	16.46	3.130669	0.56828	.	.	ENSG00000136891	ENST00000535814;ENST00000374902;ENST00000444730;ENST00000429235;ENST00000537512	.	.	.	5.46	5.46	0.80206	Armadillo-type fold (1);	0.105052	0.64402	D	0.000004	T	0.78123	0.4234	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D	0.89917	0.991;0.999;1.0;1.0;0.998	P;P;D;D;P	0.91635	0.77;0.87;0.988;0.999;0.861	T	0.77678	-0.2498	9	0.49607	T	0.09	-11.5434	19.2962	0.94122	0.0:1.0:0.0:0.0	.	309;377;242;242;374	B7Z9D5;B4DYV2;E7ERG2;B4DQR0;Q9NXF1	.;.;.;.;TEX10_HUMAN	Y	377;374;242;19;309	.	ENSP00000364037:D374Y	D	-	1	0	TEX10	102148192	1.000000	0.71417	0.982000	0.44146	0.988000	0.76386	6.153000	0.71819	2.558000	0.86282	0.561000	0.74099	GAT	TEX10	-	superfamily_ARM-type_fold	ENSG00000136891		0.353	TEX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX10	HGNC	protein_coding	OTTHUMT00000053416.1		0.00	30	0	C	NM_017746		103108371	-1			no_errors	ENST00000374902	ensembl	human	known	74_37	missense	5.41	35	2	SNP	1.000	A
TFAP2D	83741	genome.wustl.edu	37	6	50696968	50696968	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr6:50696968T>G	ENST00000008391.3	+	5	1054	c.826T>G	c.(826-828)Tta>Gta	p.L276V	TFAP2D_ENST00000492804.1_3'UTR	NM_172238.3	NP_758438.2			transcription factor AP-2 delta (activating enhancer binding protein 2 delta)											NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(26)|ovary(6)|pancreas(1)|prostate(5)|stomach(1)	60	Lung NSC(77;0.0334)					TGGCTTAAACTTACCAGCAGG	0.418																																																	0													158.0	139.0	146.0					6																	50696968		2203	4300	6503	SO:0001583	missense	0			AY028376	CCDS4933.1	6p12.3	2008-02-05	2004-10-26	2004-10-27		ENSG00000008197			15581	protein-coding gene	gene with protein product		610161	"""transcription factor AP-2 beta (activating enhancer-binding protein 2 beta)-like 1"""	TFAP2BL1		11733187	Standard	NM_172238		Approved		uc003paf.3	Q7Z6R9		ENST00000008391.3:c.826T>G	6.37:g.50696968T>G	ENSP00000008391:p.Leu276Val			Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C	p.L276V	ENST00000008391.3	37	c.826	CCDS4933.1	6	.	.	.	.	.	.	.	.	.	.	T	21.4	4.138948	0.77775	.	.	ENSG00000008197	ENST00000008391	D	0.96913	-4.17	6.08	3.68	0.42216	Transcription factor AP-2, C-terminal (2);	0.000000	0.64402	D	0.000001	D	0.97798	0.9277	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98266	1.0501	10	0.87932	D	0	-13.5664	10.8308	0.46659	0.0:0.1293:0.0:0.8707	.	276	Q7Z6R9	AP2D_HUMAN	V	276	ENSP00000008391:L276V	ENSP00000008391:L276V	L	+	1	2	TFAP2D	50804927	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	2.425000	0.44723	1.129000	0.42072	0.482000	0.46254	TTA	TFAP2D	-	pfam_TF_AP2_C,prints_TF_AP2_C	ENSG00000008197		0.418	TFAP2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2D	HGNC	protein_coding	OTTHUMT00000040881.1		0.00	35	0	T	NM_172238		50696968	+1			no_errors	ENST00000008391	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	G
TGM5	9333	genome.wustl.edu	37	15	43545067	43545067	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:43545067T>C	ENST00000220420.5	-	6	759	c.752A>G	c.(751-753)aAc>aGc	p.N251S	TGM5_ENST00000349114.4_Missense_Mutation_p.N169S	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	251					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	CTCCGCAGGGTTGGCGCCGTC	0.552																																																	0													86.0	75.0	79.0					15																	43545067		2202	4299	6501	SO:0001583	missense	0			AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.752A>G	15.37:g.43545067T>C	ENSP00000220420:p.Asn251Ser		O43549|Q0VF40|Q9UEZ4	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.N251S	ENST00000220420.5	37	c.752	CCDS32212.1	15	.	.	.	.	.	.	.	.	.	.	T	0.032	-1.329254	0.01298	.	.	ENSG00000104055	ENST00000220420;ENST00000349114;ENST00000396996	D;D	0.88586	-2.4;-2.4	4.64	3.31	0.37934	.	0.336715	0.31963	N	0.006786	T	0.63307	0.2500	N	0.01631	-0.79	0.24293	N	0.995156	B;B	0.11235	0.004;0.003	B;B	0.17098	0.016;0.017	T	0.57642	-0.7776	10	0.05721	T	0.95	-34.1642	3.1436	0.06464	0.0:0.1586:0.2433:0.598	.	169;251	O43548-2;O43548	.;TGM5_HUMAN	S	251;169;250	ENSP00000220420:N251S;ENSP00000220419:N169S	ENSP00000220420:N251S	N	-	2	0	TGM5	41332359	0.006000	0.16342	0.995000	0.50966	0.261000	0.26267	0.052000	0.14163	1.850000	0.53721	0.459000	0.35465	AAC	TGM5	-	NULL	ENSG00000104055		0.552	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM5	HGNC	protein_coding	OTTHUMT00000432257.1	-	0.00	18	0	T	NM_004245		43545067	-1	tier1	-	no_errors	ENST00000220420	ensembl	human	known	74_37	missense	25.00	24	8	SNP	0.878	C
TIAM1	7074	genome.wustl.edu	37	21	32554886	32554886	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr21:32554886A>T	ENST00000286827.3	-	16	3210	c.2739T>A	c.(2737-2739)gaT>gaA	p.D913E	TIAM1_ENST00000541036.1_Missense_Mutation_p.D853E	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	913					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						GTGAGAGGAAATCTTTGAGCA	0.562																																																	0													72.0	67.0	69.0					21																	32554886		2203	4300	6503	SO:0001583	missense	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.2739T>A	21.37:g.32554886A>T	ENSP00000286827:p.Asp913Glu		B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.D913E	ENST00000286827.3	37	c.2739	CCDS13609.1	21	.	.	.	.	.	.	.	.	.	.	A	9.270	1.045361	0.19748	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.26067	1.76;1.76	4.42	0.664	0.17890	PDZ/DHR/GLGF (3);	0.210163	0.41605	D	0.000858	T	0.16896	0.0406	L	0.47716	1.5	0.31693	N	0.641707	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.08554	-1.0716	10	0.29301	T	0.29	.	3.9193	0.09236	0.3941:0.3856:0.2203:0.0	.	853;853;913	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	E	913;754;853	ENSP00000286827:D913E;ENSP00000441570:D853E	ENSP00000286827:D913E	D	-	3	2	TIAM1	31476757	0.711000	0.27906	1.000000	0.80357	0.992000	0.81027	-0.393000	0.07305	0.239000	0.21243	0.454000	0.30748	GAT	TIAM1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ	ENSG00000156299		0.562	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	-	0.00	72	0	A	NM_003253		32554886	-1	tier1	-	no_errors	ENST00000286827	ensembl	human	known	74_37	missense	22.45	38	11	SNP	0.997	T
TIMP1	7076	genome.wustl.edu	37	X	47444888	47444888	+	Intron	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:47444888C>A	ENST00000218388.4	+	5	498				MIR4769_ENST00000584126.1_RNA|SYN1_ENST00000340666.4_Intron|TIMP1_ENST00000377018.2_Missense_Mutation_p.A86E|TIMP1_ENST00000456754.2_3'UTR|SYN1_ENST00000295987.7_Intron|TIMP1_ENST00000377017.1_Intron	NM_003254.2	NP_003245.1	P01033	TIMP1_HUMAN	TIMP metallopeptidase inhibitor 1						aging (GO:0007568)|blood coagulation (GO:0007596)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of membrane protein ectodomain proteolysis (GO:0051045)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of trophoblast cell migration (GO:1901164)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell proliferation (GO:0008284)|regulation of integrin-mediated signaling pathway (GO:2001044)|response to cytokine (GO:0034097)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	cytokine activity (GO:0005125)|metal ion binding (GO:0046872)|metalloendopeptidase inhibitor activity (GO:0008191)			endometrium(1)|large_intestine(2)	3						GGCAGCTTGGCAGCTCAGCCA	0.572																																																	0																																										SO:0001627	intron_variant	0				CCDS14281.1	Xp11.3-p11.23	2008-07-29	2005-08-08		ENSG00000102265	ENSG00000102265			11820	protein-coding gene	gene with protein product		305370	"""tissue inhibitor of metalloproteinase 1 (erythroid potentiating activity, collagenase inhibitor)"""	TIMP, CLGI			Standard	XM_005272645		Approved	EPO	uc004dif.3	P01033	OTTHUMG00000021447	ENST00000218388.4:c.329-54C>A	X.37:g.47444888C>A			Q14252|Q9UCU1	Missense_Mutation	SNP	pfam_Prot_inh_TIMP,superfamily_TIMP-like_OB-fold,smart_Prot_inh_TIMP	p.A86E	ENST00000218388.4	37	c.257	CCDS14281.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	1.768|1.768	-0.485154|-0.485154	0.04352|0.04352	.|.	.|.	ENSG00000102265|ENSG00000102265	ENST00000377018|ENST00000445623	.|.	.|.	.|.	3.02|3.02	-4.76|-4.76	0.03229|0.03229	.|.	.|.	.|.	.|.	.|.	T|T	0.33527|0.33527	0.0866|0.0866	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	B|.	0.22003|.	0.063|.	B|.	0.10450|.	0.005|.	T|T	0.31724|0.31724	-0.9933|-0.9933	7|4	0.87932|.	D|.	0|.	.|.	11.8667|11.8667	0.52496|0.52496	0.0:0.1963:0.0:0.8037|0.0:0.1963:0.0:0.8037	.|.	86|.	B4DJK3|.	.|.	E|K	86|50	.|.	ENSP00000366217:A86E|.	A|Q	+|+	2|1	0|0	TIMP1|TIMP1	47329832|47329832	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-0.470000|-0.470000	0.06639|0.06639	-1.789000|-1.789000	0.01264|0.01264	-0.311000|-0.311000	0.09066|0.09066	GCA|CAG	TIMP1	-	smart_Prot_inh_TIMP	ENSG00000102265		0.572	TIMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMP1	HGNC	protein_coding	OTTHUMT00000056423.1	-	0.00	64	0	C	NM_003254		47444888	+1	tier1	-	no_errors	ENST00000377018	ensembl	human	known	74_37	missense	25.71	52	18	SNP	0.000	A
TLE4	7091	genome.wustl.edu	37	9	82335074	82335074	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr9:82335074C>T	ENST00000376552.2	+	16	2722	c.1704C>T	c.(1702-1704)cgC>cgT	p.R568R	TLE4_ENST00000376520.4_Silent_p.R600R|TLE4_ENST00000376534.4_Silent_p.R205R|TLE4_ENST00000265284.6_Silent_p.R543R|TLE4_ENST00000376544.3_Silent_p.R499R|TLE4_ENST00000376537.4_Silent_p.R600R	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	568					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						CAACCCCACGCATCAAGGCAG	0.597																																																	0													63.0	62.0	62.0					9																	82335074		2203	4300	6503	SO:0001819	synonymous_variant	0			M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.1704C>T	9.37:g.82335074C>T			F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Silent	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.R600	ENST00000376552.2	37	c.1800	CCDS43837.1	9																																																																																			TLE4	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000106829		0.597	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE4	HGNC	protein_coding	OTTHUMT00000052792.4	-	0.00	65	0	C	XM_212237		82335074	+1	tier1	-	no_errors	ENST00000376520	ensembl	human	known	74_37	silent	25.45	41	14	SNP	0.959	T
TLN2	83660	genome.wustl.edu	37	15	63088404	63088404	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr15:63088404G>A	ENST00000561311.1	+	46	6192	c.5962G>A	c.(5962-5964)Ggg>Agg	p.G1988R	TLN2_ENST00000306829.6_Missense_Mutation_p.G1988R			Q9Y4G6	TLN2_HUMAN	talin 2	1988					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						CGCTGTGTCTGGGATCATTGC	0.577																																																	0													74.0	70.0	71.0					15																	63088404		2203	4300	6503	SO:0001583	missense	0			AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.5962G>A	15.37:g.63088404G>A	ENSP00000453508:p.Gly1988Arg		A6NLB8	Missense_Mutation	SNP	pfam_Talin_cent,pfam_ILWEQ_dom,pfam_Vinculin-bd_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.G1988R	ENST00000561311.1	37	c.5962	CCDS32261.1	15	.	.	.	.	.	.	.	.	.	.	G	29.8	5.038883	0.93630	.	.	ENSG00000171914	ENST00000306829	T	0.69685	-0.42	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.81851	0.4910	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82285	-0.0533	10	0.52906	T	0.07	-21.9952	19.1696	0.93572	0.0:0.0:1.0:0.0	.	1988	Q9Y4G6	TLN2_HUMAN	R	1988	ENSP00000303476:G1988R	ENSP00000303476:G1988R	G	+	1	0	TLN2	60875457	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	9.813000	0.99286	2.522000	0.85027	0.655000	0.94253	GGG	TLN2	-	NULL	ENSG00000171914		0.577	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN2	HGNC	protein_coding	OTTHUMT00000257878.2	-	0.00	42	0	G			63088404	+1	tier1	-	no_errors	ENST00000306829	ensembl	human	known	74_37	missense	8.86	72	7	SNP	1.000	A
TMED6	146456	genome.wustl.edu	37	16	69385482	69385482	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr16:69385482A>T	ENST00000288025.3	-	1	230	c.175T>A	c.(175-177)Ttt>Att	p.F59I	RP11-343C2.9_ENST00000563634.1_Intron|RP11-343C2.7_ENST00000564737.1_Missense_Mutation_p.I51N	NM_144676.3	NP_653277.2	Q8WW62	TMED6_HUMAN	transmembrane emp24 protein transport domain containing 6	59	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.F59I(1)		breast(1)|endometrium(2)|kidney(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)	9						TGGTGGGCAAATTGCCAAAAG	0.488																																																	1	Substitution - Missense(1)	kidney(1)											90.0	87.0	88.0					16																	69385482		2198	4300	6498	SO:0001583	missense	0			BC020827	CCDS10878.1	16q22.1	2008-02-05			ENSG00000157315	ENSG00000157315			28331	protein-coding gene	gene with protein product						12477932	Standard	NM_144676		Approved	MGC23911	uc002exc.2	Q8WW62	OTTHUMG00000137571	ENST00000288025.3:c.175T>A	16.37:g.69385482A>T	ENSP00000288025:p.Phe59Ile		Q6UXN5	Missense_Mutation	SNP	pfam_GOLD,superfamily_GOLD,pfscan_GOLD	p.F59I	ENST00000288025.3	37	c.175	CCDS10878.1	16	.	.	.	.	.	.	.	.	.	.	A	33	5.227831	0.95173	.	.	ENSG00000157315	ENST00000288025	T	0.54279	0.58	5.85	5.85	0.93711	GOLD (2);	0.048871	0.85682	D	0.000000	T	0.65995	0.2745	M	0.73598	2.24	0.80722	D	1	D	0.52996	0.957	P	0.54174	0.744	T	0.65413	-0.6174	10	0.33141	T	0.24	-10.5849	16.2355	0.82371	1.0:0.0:0.0:0.0	.	59	Q8WW62	TMED6_HUMAN	I	59	ENSP00000288025:F59I	ENSP00000288025:F59I	F	-	1	0	TMED6	67942983	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.283000	0.89909	2.238000	0.73509	0.533000	0.62120	TTT	TMED6	-	pfam_GOLD,superfamily_GOLD,pfscan_GOLD	ENSG00000157315		0.488	TMED6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED6	HGNC	protein_coding	OTTHUMT00000268951.1	-	0.00	39	0	A	NM_144676		69385482	-1	tier1	-	no_errors	ENST00000288025	ensembl	human	known	74_37	missense	21.05	45	12	SNP	1.000	T
TMEM132D	121256	genome.wustl.edu	37	12	129566348	129566348	+	Missense_Mutation	SNP	C	C	G	rs371664509		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:129566348C>G	ENST00000422113.2	-	7	2205	c.1879G>C	c.(1879-1881)Gga>Cga	p.G627R	TMEM132D_ENST00000389441.4_Missense_Mutation_p.G165R	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	627					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGGATCTGTCCGCCTTGCAGC	0.527																																																	0													53.0	50.0	51.0					12																	129566348		2203	4300	6503	SO:0001583	missense	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1879G>C	12.37:g.129566348C>G	ENSP00000408581:p.Gly627Arg		Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.G627R	ENST00000422113.2	37	c.1879	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	C	10.48	1.361447	0.24684	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.51817	0.69;0.69	4.32	4.32	0.51571	.	0.000000	0.64402	D	0.000002	T	0.65780	0.2724	M	0.67569	2.06	0.58432	D	0.999997	D;P	0.89917	1.0;0.527	D;P	0.87578	0.998;0.583	T	0.67241	-0.5720	9	.	.	.	-22.6183	14.9612	0.71158	0.0:1.0:0.0:0.0	.	627;165	Q14C87;Q14C87-2	T132D_HUMAN;.	R	165;627	ENSP00000374092:G165R;ENSP00000408581:G627R	.	G	-	1	0	TMEM132D	128132301	0.980000	0.34600	0.132000	0.22025	0.014000	0.08584	3.183000	0.50918	1.929000	0.55896	0.561000	0.74099	GGA	TMEM132D	-	NULL	ENSG00000151952		0.527	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	-	0.00	64	0	C	NM_133448		129566348	-1	tier1	-	no_errors	ENST00000422113	ensembl	human	known	74_37	missense	44.44	25	20	SNP	0.982	G
TMEM176B	28959	genome.wustl.edu	37	7	150491085	150491085	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr7:150491085C>T	ENST00000447204.2	-	3	651	c.279G>A	c.(277-279)ctG>ctA	p.L93L	TMEM176B_ENST00000429904.2_Silent_p.L93L|TMEM176B_ENST00000326442.5_Silent_p.L93L|TMEM176B_ENST00000492607.1_Silent_p.L93L|TMEM176B_ENST00000450753.2_Intron|TMEM176B_ENST00000434545.1_Silent_p.L93L	NM_014020.3	NP_054739.3	Q3YBM2	T176B_HUMAN	transmembrane protein 176B	93					cell differentiation (GO:0030154)|negative regulation of dendritic cell differentiation (GO:2001199)|organ morphogenesis (GO:0009887)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				cervix(1)|large_intestine(4)|lung(10)|ovary(1)|skin(3)	19			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CTGAGGCACTCAGCACAGTCC	0.567																																																	0													221.0	191.0	201.0					7																	150491085		2203	4300	6503	SO:0001819	synonymous_variant	0			AF115384	CCDS5908.1, CCDS47746.1	7q36.1	2006-09-04			ENSG00000106565	ENSG00000106565			29596	protein-coding gene	gene with protein product		610385				9922225	Standard	NM_014020		Approved	LR8	uc003whu.4	Q3YBM2	OTTHUMG00000157577	ENST00000447204.2:c.279G>A	7.37:g.150491085C>T			B2RDK2|D3DWZ7|E9PAV4|Q5BJI2|Q9BT42|Q9Y609	Silent	SNP	pfam_CD20-like,superfamily_MFS_dom_general_subst_transpt	p.L93	ENST00000447204.2	37	c.279	CCDS5908.1	7																																																																																			TMEM176B	-	pfam_CD20-like,superfamily_MFS_dom_general_subst_transpt	ENSG00000106565		0.567	TMEM176B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM176B	HGNC	protein_coding	OTTHUMT00000349204.1	-	0.00	39	0	C	NM_014020		150491085	-1	tier1	-	no_errors	ENST00000326442	ensembl	human	known	74_37	silent	55.56	24	30	SNP	0.164	T
TMEM184C	55751	genome.wustl.edu	37	4	148555367	148555367	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:148555367C>T	ENST00000296582.3	+	10	1673	c.1099C>T	c.(1099-1101)Caa>Taa	p.Q367*	TMEM184C_ENST00000508208.1_Intron	NM_018241.2	NP_060711.2	Q9NVA4	T184C_HUMAN	transmembrane protein 184C	367						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(2)|prostate(1)	16						TCCCGAGGATCAAGATCAAAA	0.363																																																	0													68.0	64.0	65.0					4																	148555367		2203	4300	6503	SO:0001587	stop_gained	0			AF305823	CCDS3770.1	4q31.22	2008-06-05	2008-06-05	2008-06-05		ENSG00000164168			25587	protein-coding gene	gene with protein product		613937	"""transmembrane protein 34"""	TMEM34			Standard	NM_018241		Approved	FLJ10846	uc003ila.4	Q9NVA4		ENST00000296582.3:c.1099C>T	4.37:g.148555367C>T	ENSP00000296582:p.Gln367*		D3DP04|Q86X84|Q969I7|Q9NXM2	Nonsense_Mutation	SNP	pfam_Ost-alpha	p.Q367*	ENST00000296582.3	37	c.1099	CCDS3770.1	4	.	.	.	.	.	.	.	.	.	.	C	40	8.064980	0.98635	.	.	ENSG00000164168	ENST00000296582	.	.	.	5.55	3.74	0.42951	.	0.592787	0.19489	N	0.113035	.	.	.	.	.	.	0.22479	N	0.999063	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-11.4884	11.9019	0.52688	0.0:0.8093:0.1224:0.0683	.	.	.	.	X	367	.	ENSP00000296582:Q367X	Q	+	1	0	TMEM184C	148774817	0.809000	0.29036	0.983000	0.44433	0.956000	0.61745	2.343000	0.44001	1.481000	0.48307	0.561000	0.74099	CAA	TMEM184C	-	NULL	ENSG00000164168		0.363	TMEM184C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM184C	HGNC	protein_coding	OTTHUMT00000364644.1		0.00	16	0	C	NM_018241		148555367	+1			no_errors	ENST00000296582	ensembl	human	known	74_37	nonsense	11.11	24	3	SNP	0.177	T
TOPORS	10210	genome.wustl.edu	37	9	32543529	32543529	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr9:32543529C>T	ENST00000360538.2	-	3	1110	c.994G>A	c.(994-996)Gag>Aag	p.E332K	TOPORS_ENST00000379858.1_Missense_Mutation_p.E267K	NM_005802.4	NP_005793.2	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich, E3 ubiquitin protein ligase	332	Required for DNA-binding.				cellular response to DNA damage stimulus (GO:0006974)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of apoptotic process (GO:0043066)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein localization to nucleus (GO:0034504)|protein monoubiquitination (GO:0006513)|protein sumoylation (GO:0016925)|regulation of cell proliferation (GO:0042127)|retina layer formation (GO:0010842)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|transcription, DNA-templated (GO:0006351)|ubiquitin-dependent protein catabolic process (GO:0006511)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|gamma-tubulin complex (GO:0000930)|midbody (GO:0030496)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|PML body (GO:0016605)|spindle pole (GO:0000922)|ubiquitin ligase complex (GO:0000151)	antigen binding (GO:0003823)|DNA binding (GO:0003677)|DNA topoisomerase binding (GO:0044547)|SUMO ligase activity (GO:0019789)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(6)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		GCCTGACTCTCCAAGTCATAG	0.348																																																	0													54.0	53.0	54.0					9																	32543529		2203	4300	6503	SO:0001583	missense	0			AF098300	CCDS6527.1, CCDS56566.1	9p21	2013-01-09	2010-09-17		ENSG00000197579	ENSG00000197579		"""RING-type (C3HC4) zinc fingers"""	21653	protein-coding gene	gene with protein product		609507	"""retinitis pigmentosa 31 (autosomal dominant)"", ""topoisomerase I binding, arginine/serine-rich"""	RP31		10352183, 12083797, 17924349	Standard	NM_005802		Approved	TP53BPL, LUN	uc003zrb.3	Q9NS56	OTTHUMG00000019743	ENST00000360538.2:c.994G>A	9.37:g.32543529C>T	ENSP00000353735:p.Glu332Lys		O43273|Q6P987|Q9NS55|Q9UNR9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.E332K	ENST00000360538.2	37	c.994	CCDS6527.1	9	.	.	.	.	.	.	.	.	.	.	C	11.71	1.720968	0.30503	.	.	ENSG00000197579	ENST00000360538;ENST00000379858	T;T	0.15834	2.39;2.39	5.93	5.03	0.67393	.	0.000000	0.51477	D	0.000095	T	0.13030	0.0316	N	0.19112	0.55	0.49798	D	0.999825	B	0.20052	0.041	B	0.20184	0.028	T	0.04991	-1.0913	10	0.44086	T	0.13	-21.0295	14.2231	0.65841	0.0:0.9272:0.0:0.0728	.	332	Q9NS56	TOPRS_HUMAN	K	332;267	ENSP00000353735:E332K;ENSP00000369187:E267K	ENSP00000353735:E332K	E	-	1	0	TOPORS	32533529	1.000000	0.71417	1.000000	0.80357	0.522000	0.34438	5.667000	0.68067	1.511000	0.48818	-0.150000	0.13652	GAG	TOPORS	-	NULL	ENSG00000197579		0.348	TOPORS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOPORS	HGNC	protein_coding	OTTHUMT00000052007.1		0.00	22	0	C	NM_005802		32543529	-1			no_errors	ENST00000360538	ensembl	human	known	74_37	missense	9.52	19	2	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578431	7578431	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:7578431G>A	ENST00000269305.4	-	5	688	c.499C>T	c.(499-501)Cag>Tag	p.Q167*	TP53_ENST00000413465.2_Nonsense_Mutation_p.Q167*|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q167*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q167*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q167*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q167*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	167	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in LFS; germline mutation and in a sporadic cancer; somatic mutation).|Q -> L (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|QH -> HD (in a sporadic cancer; somatic mutation).|QH -> YL (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q167*(23)|p.0?(8)|p.Q167fs*13(3)|p.Q167fs*14(2)|p.Q167fs*3(2)|p.K164fs*3(2)|p.V157_C176del20(1)|p.Q167_H168>YL(1)|p.Q167K(1)|p.Y163fs*1(1)|p.Q167fs*12(1)|p.P151_V173del23(1)|p.Q165_M169delQSQHM(1)|p.Q167del(1)|p.S149fs*72(1)|p.A159_Q167delAMAIYKQSQ(1)|p.Q74*(1)|p.Q167E(1)|p.Q35*(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTCATGTGCTGTGACTGCTTG	0.642		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	53	Substitution - Nonsense(25)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Substitution - Missense(2)|Complex - compound substitution(1)	upper_aerodigestive_tract(9)|lung(8)|oesophagus(8)|large_intestine(7)|breast(5)|bone(4)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(3)|stomach(2)|soft_tissue(1)|urinary_tract(1)|ovary(1)|liver(1)	GRCh37	CM942118	TP53	M							54.0	54.0	54.0					17																	7578431		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.499C>T	17.37:g.7578431G>A	ENSP00000269305:p.Gln167*		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Q167*	ENST00000269305.4	37	c.499	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772268	0.49680	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.59	4.63	0.57726	.	0.106561	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.276	12.4331	0.55584	0.0:0.6985:0.3015:0.0	.	.	.	.	X	167;167;167;167;167;167;156;74;35;74;35	.	ENSP00000269305:Q167X	Q	-	1	0	TP53	7519156	1.000000	0.71417	0.013000	0.15412	0.114000	0.19823	5.156000	0.64905	1.520000	0.48965	0.655000	0.94253	CAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.642	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	36	0	G	NM_000546		7578431	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	nonsense	54.29	16	19	SNP	0.998	A
TRAF5	7188	genome.wustl.edu	37	1	211545598	211545598	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:211545598G>A	ENST00000261464.5	+	11	1282	c.1228G>A	c.(1228-1230)Gtg>Atg	p.V410M	TRAF5_ENST00000336184.2_Missense_Mutation_p.V410M|TRAF5_ENST00000367004.3_Missense_Mutation_p.V410M|TRAF5_ENST00000427925.2_Missense_Mutation_p.V304M	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5	410	Interaction with EIF2AK2/PKR.|MATH. {ECO:0000255|PROSITE- ProRule:PRU00129}.				apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		CATTTGGAAGGTGACAGATTA	0.463																																																	0													125.0	134.0	131.0					1																	211545598		2203	4300	6503	SO:0001583	missense	0			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.1228G>A	1.37:g.211545598G>A	ENSP00000261464:p.Val410Met		B4DIS9|B4E0A2|Q6FHY1	Missense_Mutation	SNP	pfam_MATH,superfamily_TRAF-like,smart_Znf_RING,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.V410M	ENST00000261464.5	37	c.1228	CCDS1497.1	1	.	.	.	.	.	.	.	.	.	.	G	17.17	3.321373	0.60634	.	.	ENSG00000082512	ENST00000336184;ENST00000427925;ENST00000261464;ENST00000367004	T;T;T;T	0.39406	1.91;1.08;1.91;1.91	5.16	4.23	0.50019	TRAF-type (1);TRAF-like (1);MATH (2);	0.198607	0.44097	D	0.000499	T	0.46870	0.1415	L	0.38175	1.15	0.35526	D	0.801875	D;D;D	0.71674	0.998;0.993;0.991	D;D;P	0.69142	0.962;0.93;0.906	T	0.58880	-0.7558	10	0.87932	D	0	-15.4514	4.1334	0.10159	0.1902:0.0:0.6096:0.2001	.	304;421;410	F5H1P7;B4E0A2;O00463	.;.;TRAF5_HUMAN	M	410;304;410;410	ENSP00000336825:V410M;ENSP00000389891:V304M;ENSP00000261464:V410M;ENSP00000355971:V410M	ENSP00000261464:V410M	V	+	1	0	TRAF5	209612221	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.193000	0.77780	1.260000	0.44134	0.650000	0.86243	GTG	TRAF5	-	superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH	ENSG00000082512		0.463	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF5	HGNC	protein_coding	OTTHUMT00000089825.1		0.00	44	0	G	NM_004619		211545598	+1			no_errors	ENST00000261464	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	A
TRIM42	287015	genome.wustl.edu	37	3	140407130	140407130	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:140407130A>G	ENST00000286349.3	+	3	1797	c.1606A>G	c.(1606-1608)Agc>Ggc	p.S536G		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	536						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ATACCAGCGAAGCTCCTCCAT	0.592																																																	0													93.0	84.0	87.0					3																	140407130		2203	4300	6503	SO:0001583	missense	0			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.1606A>G	3.37:g.140407130A>G	ENSP00000286349:p.Ser536Gly		A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.S536G	ENST00000286349.3	37	c.1606	CCDS3113.1	3	.	.	.	.	.	.	.	.	.	.	A	15.46	2.839831	0.51057	.	.	ENSG00000155890	ENST00000286349	T	0.40756	1.02	5.52	5.52	0.82312	.	0.073732	0.64402	D	0.000020	T	0.28466	0.0704	L	0.27053	0.805	0.31404	N	0.67632	P	0.38767	0.646	B	0.35770	0.21	T	0.28332	-1.0047	10	0.22109	T	0.4	-27.9829	12.3166	0.54960	1.0:0.0:0.0:0.0	.	536	Q8IWZ5	TRI42_HUMAN	G	536	ENSP00000286349:S536G	ENSP00000286349:S536G	S	+	1	0	TRIM42	141889820	0.990000	0.36364	1.000000	0.80357	0.840000	0.47671	5.424000	0.66464	2.234000	0.73211	0.533000	0.62120	AGC	TRIM42	-	NULL	ENSG00000155890		0.592	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	-	0.00	27	0	A	NM_152616		140407130	+1	tier1	-	no_errors	ENST00000286349	ensembl	human	known	74_37	missense	16.28	36	7	SNP	1.000	G
TRIML2	205860	genome.wustl.edu	37	4	189018248	189018248	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:189018248T>C	ENST00000512729.1	-	6	936	c.562A>G	c.(562-564)Aga>Gga	p.R188G	TRIML2_ENST00000326754.3_Missense_Mutation_p.R213G	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	188	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		CTGAGTCCTCTTATGTGGCAT	0.493																																																	0													145.0	135.0	138.0					4																	189018248		2203	4300	6503	SO:0001583	missense	0			AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.562A>G	4.37:g.189018248T>C	ENSP00000422581:p.Arg188Gly		B7Z6J6	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.R188G	ENST00000512729.1	37	c.562	CCDS3850.1	4	.	.	.	.	.	.	.	.	.	.	T	9.502	1.103538	0.20632	.	.	ENSG00000179046	ENST00000512729;ENST00000326754	T;T	0.58797	3.61;0.31	4.51	-2.69	0.06022	B30.2/SPRY domain (1);	2.102030	0.02146	N	0.057585	T	0.36690	0.0976	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.05818	-1.0862	10	0.27785	T	0.31	.	1.467	0.02408	0.2695:0.0896:0.3561:0.2849	.	213;188	B7ZLC3;Q8N7C3	.;TRIMM_HUMAN	G	188;213	ENSP00000422581:R188G;ENSP00000317498:R213G	ENSP00000317498:R213G	R	-	1	2	TRIML2	189255242	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.028000	0.12350	-0.418000	0.07450	-0.360000	0.07572	AGA	TRIML2	-	pfscan_B30.2/SPRY	ENSG00000179046		0.493	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	HGNC	protein_coding	OTTHUMT00000359733.1	-	0.00	36	0	T	NM_173553		189018248	-1	tier1	-	no_errors	ENST00000512729	ensembl	human	known	74_37	missense	18.18	27	6	SNP	0.000	C
TRPS1	7227	genome.wustl.edu	37	8	116430667	116430667	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:116430667G>T	ENST00000220888.5	-	5	2834	c.2675C>A	c.(2674-2676)tCc>tAc	p.S892Y	TRPS1_ENST00000520276.1_Missense_Mutation_p.S896Y|TRPS1_ENST00000395715.3_Missense_Mutation_p.S905Y|TRPS1_ENST00000519076.1_Missense_Mutation_p.S646Y			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	892					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			AAAAACACCGGAGCCTCTACG	0.478									Langer-Giedion syndrome																																								0													102.0	103.0	103.0					8																	116430667		1912	4121	6033	SO:0001583	missense	0	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2675C>A	8.37:g.116430667G>T	ENSP00000220888:p.Ser892Tyr		B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_C2H2-like,smart_Znf_GATA,pfscan_Znf_C2H2,pfscan_Znf_GATA,prints_Znf_GATA	p.S905Y	ENST00000220888.5	37	c.2714		8	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768210	0.49680	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276	D;D;D;D	0.99671	-6.35;-6.35;-6.35;-6.35	5.81	5.81	0.92471	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (3);	0.129302	0.53938	D	0.000043	D	0.99275	0.9747	L	0.27053	0.805	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.996;0.998	D	0.99906	1.1179	10	0.87932	D	0	.	20.0805	0.97772	0.0:0.0:1.0:0.0	.	896;892;905	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	Y	905;892;646;896	ENSP00000379065:S905Y;ENSP00000220888:S892Y;ENSP00000428910:S646Y;ENSP00000428680:S896Y	ENSP00000220888:S892Y	S	-	2	0	TRPS1	116499843	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	6.110000	0.71535	2.755000	0.94549	0.650000	0.86243	TCC	TRPS1	-	smart_Znf_GATA,pfscan_Znf_GATA,prints_Znf_GATA	ENSG00000104447		0.478	TRPS1-002	KNOWN	basic	protein_coding	TRPS1	HGNC	protein_coding	OTTHUMT00000286436.3	-	0.00	17	0	G	NM_014112		116430667	-1	tier1	-	no_errors	ENST00000395715	ensembl	human	known	74_37	missense	32.56	29	14	SNP	0.996	T
TRPV3	162514	genome.wustl.edu	37	17	3432156	3432156	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:3432156G>A	ENST00000576742.1	-	10	1697	c.1376C>T	c.(1375-1377)tCg>tTg	p.S459L	TRPV3_ENST00000301365.4_Missense_Mutation_p.S459L|TRPV3_ENST00000572519.1_Missense_Mutation_p.S459L	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	459					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	GCGGTAGTACGAGACGAGGGT	0.572																																																	0													108.0	106.0	107.0					17																	3432156		2203	4300	6503	SO:0001583	missense	0			AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.1376C>T	17.37:g.3432156G>A	ENSP00000461518:p.Ser459Leu		Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel	p.S459L	ENST00000576742.1	37	c.1376	CCDS11029.1	17	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344370	0.82022	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	D	0.88975	-2.45	5.12	4.16	0.48862	.	0.000000	0.64402	D	0.000002	D	0.88629	0.6488	L	0.33485	1.01	0.41774	D	0.989785	D;B;P;D;P;P;B;D	0.67145	0.989;0.255;0.895;0.996;0.895;0.531;0.396;0.996	P;B;B;P;B;B;B;P	0.55965	0.668;0.119;0.282;0.773;0.282;0.034;0.025;0.788	D	0.89760	0.3946	10	0.87932	D	0	-8.0187	12.9749	0.58532	0.0783:0.0:0.9217:0.0	.	41;443;443;459;443;459;459;459	B4E3L1;E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;.;TRPV3_HUMAN;.	L	459;459;443	ENSP00000301365:S459L	ENSP00000301365:S459L	S	-	2	0	TRPV3	3378906	1.000000	0.71417	0.590000	0.28732	0.914000	0.54420	9.412000	0.97347	1.312000	0.45043	0.655000	0.94253	TCG	TRPV3	-	prints_TRPV1-4_channel	ENSG00000167723		0.572	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPV3	HGNC	protein_coding	OTTHUMT00000207379.2		0.00	28	0	G	NM_145068		3432156	-1			no_errors	ENST00000301365	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.999	A
TRPV4	59341	genome.wustl.edu	37	12	110252313	110252313	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:110252313G>A	ENST00000418703.2	-	1	383	c.289C>T	c.(289-291)Cct>Tct	p.P97S	TRPV4_ENST00000537083.1_Missense_Mutation_p.P97S|TRPV4_ENST00000536838.1_Missense_Mutation_p.P63S|TRPV4_ENST00000541794.1_Missense_Mutation_p.P97S|TRPV4_ENST00000346520.2_Missense_Mutation_p.P97S|TRPV4_ENST00000544971.1_Missense_Mutation_p.P97S|TRPV4_ENST00000392719.2_Missense_Mutation_p.P97S|TRPV4_ENST00000536570.1_5'Flank|TRPV4_ENST00000261740.2_Missense_Mutation_p.P97S	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	97			P -> R (in DSMAC; loss of function mutation). {ECO:0000269|PubMed:22526352}.		actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						TTGGGCCCAGGCACCACCGAG	0.567																																																	0													71.0	68.0	69.0					12																	110252313		2203	4300	6503	SO:0001583	missense	0			AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.289C>T	12.37:g.110252313G>A	ENSP00000406191:p.Pro97Ser		B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,prints_TRPV4_channel,tigrfam_TRP_channel	p.P97S	ENST00000418703.2	37	c.289	CCDS9134.1	12	.	.	.	.	.	.	.	.	.	.	G	15.59	2.877283	0.51801	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	D;D;D;D;D;D;D;D	0.91351	-2.72;-2.72;-2.68;-2.83;-2.73;-2.83;-2.68;-2.71	3.68	3.68	0.42216	.	0.415319	0.26418	N	0.024484	D	0.83603	0.5290	L	0.27053	0.805	0.25104	N	0.990767	P;B;P;B;B	0.43578	0.811;0.016;0.48;0.013;0.027	B;B;B;B;B	0.40534	0.332;0.007;0.188;0.011;0.015	T	0.75736	-0.3213	10	0.32370	T	0.25	.	12.1598	0.54098	0.0:0.0:1.0:0.0	.	97;97;97;97;63	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	S	97;97;97;97;97;97;97;63	ENSP00000406191:P97S;ENSP00000261740:P97S;ENSP00000376480:P97S;ENSP00000319003:P97S;ENSP00000443611:P97S;ENSP00000442738:P97S;ENSP00000442167:P97S;ENSP00000444336:P63S	ENSP00000261740:P97S	P	-	1	0	TRPV4	108736696	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.125000	0.89590	1.615000	0.50252	0.465000	0.42564	CCT	TRPV4	-	prints_TRPV4_channel	ENSG00000111199		0.567	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRPV4	HGNC	protein_coding	OTTHUMT00000403270.1	-	0.00	43	0	G	NM_021625		110252313	-1	tier1	-	no_errors	ENST00000261740	ensembl	human	known	74_37	missense	58.33	25	35	SNP	1.000	A
TSPAN7	7102	genome.wustl.edu	37	X	38515293	38515293	+	Intron	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:38515293G>A	ENST00000378482.2	+	2	258				TSPAN7_ENST00000422612.2_Intron|TSPAN7_ENST00000545599.1_Intron|TM4SF2_ENST00000465127.1_Intron|TSPAN7_ENST00000286824.6_Intron|TSPAN7_ENST00000488893.1_Intron	NM_004615.3	NP_004606.2	P41732	TSN7_HUMAN	tetraspanin 7						viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						CAATAAAAGGGAGCTGAATTT	0.373																																																	0																																										SO:0001627	intron_variant	0			D29808	CCDS14248.1	Xp11.4	2013-02-14	2005-03-21	2005-03-21	ENSG00000156298	ENSG00000156298		"""CD molecules"", ""Tetraspanins"""	11854	protein-coding gene	gene with protein product		300096	"""transmembrane 4 superfamily member 2"", ""mental retardation, X-linked 58"""	MXS1, TM4SF2, MRX58		12070254	Standard	NM_004615		Approved	DXS1692E, TALLA-1, A15, CD231	uc004deg.4	P41732	OTTHUMG00000024090	ENST00000378482.2:c.82-10082G>A	X.37:g.38515293G>A			B2R5W7|D3DWB1|Q8WVG5|Q9UEY9	Silent	SNP	NULL	p.G42	ENST00000378482.2	37	c.126	CCDS14248.1	X																																																																																			TSPAN7	-	NULL	ENSG00000156298		0.373	TSPAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN7	HGNC	protein_coding	OTTHUMT00000356412.1	-	0.00	16	0	G			38515293	+1	tier1	-	no_errors	ENST00000480976	ensembl	human	known	74_37	silent	36.00	16	9	SNP	0.006	A
TSSC1	7260	genome.wustl.edu	37	2	3192879	3192879	+	3'UTR	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:3192879G>A	ENST00000382125.4	-	0	1582				TSSC1_ENST00000478754.1_5'UTR|TSSC1_ENST00000398659.4_3'UTR	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1											breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		ATAATAATGTGGGGCTCTGTC	0.448																																					Colon(140;1261 1762 4183 34270 49743)												0																																										SO:0001624	3_prime_UTR_variant	0			AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.*226C>T	2.37:g.3192879G>A			D6W4Y1|O43179|Q53S19|Q53SG2	RNA	SNP	-	NULL	ENST00000382125.4	37	NULL	CCDS1651.1	2																																																																																			TSSC1	-	-	ENSG00000032389		0.448	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSC1	HGNC	protein_coding	OTTHUMT00000206694.2	-	0.00	11	0	G	NM_003310		3192879	-1	tier1	-	no_errors	ENST00000478754	ensembl	human	known	74_37	rna	63.64	4	7	SNP	0.001	A
TSSK2	23617	genome.wustl.edu	37	22	19119927	19119927	+	Missense_Mutation	SNP	G	G	A	rs140549220		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr22:19119927G>A	ENST00000399635.2	+	1	1607	c.1015G>A	c.(1015-1017)Gag>Aag	p.E339K	DGCR14_ENST00000252137.6_3'UTR	NM_053006.4	NP_443732.3	Q96PF2	TSSK2_HUMAN	testis-specific serine kinase 2	339					multicellular organismal development (GO:0007275)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	acrosomal vesicle (GO:0001669)|centriole (GO:0005814)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(2)|lung(2)|prostate(4)|stomach(1)	11	Colorectal(54;0.0993)					CAGGCTGGCCGAGACCTCCAG	0.642																																																	0								G	,LYS/GLU	1,4399		0,1,2199	33.0	34.0	34.0		,1015	3.0	1.0	22	dbSNP_134	34	0,8588		0,0,4294	no	utr-3,missense	DGCR14,TSSK2	NM_022719.2,NM_053006.4	,56	0,1,6493	AA,AG,GG		0.0,0.0227,0.0077	,benign	,339/359	19119927	1,12987	2200	4294	6494	SO:0001583	missense	0			AF362953	CCDS13755.1	22q11.21	2007-01-30	2005-03-10	2005-03-12	ENSG00000206203	ENSG00000206203			11401	protein-coding gene	gene with protein product		610710	"""serine/threonine kinase 22B (spermiogenesis associated)"""	STK22B		10591208	Standard	NM_053006		Approved	SPOGA2, FLJ38613	uc002zow.2	Q96PF2	OTTHUMG00000150118	ENST00000399635.2:c.1015G>A	22.37:g.19119927G>A	ENSP00000382544:p.Glu339Lys		Q8IY55	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E339K	ENST00000399635.2	37	c.1015	CCDS13755.1	22	.	.	.	.	.	.	.	.	.	.	G	14.61	2.588270	0.46110	2.27E-4	0.0	ENSG00000206203	ENST00000399635	T	0.69926	-0.44	5.03	2.95	0.34219	.	0.000000	0.51477	D	0.000094	T	0.43433	0.1247	N	0.14661	0.345	0.28868	N	0.895157	D	0.56521	0.976	B	0.43680	0.427	T	0.35151	-0.9800	10	0.27785	T	0.31	.	3.7651	0.08619	0.0886:0.1652:0.5753:0.1709	.	339	Q96PF2	TSSK2_HUMAN	K	339	ENSP00000382544:E339K	ENSP00000382544:E339K	E	+	1	0	TSSK2	17499927	0.721000	0.28007	0.968000	0.41197	0.978000	0.69477	0.617000	0.24359	0.710000	0.31997	-0.150000	0.13652	GAG	TSSK2	-	NULL	ENSG00000206203		0.642	TSSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK2	HGNC	protein_coding	OTTHUMT00000316431.1		0.00	14	0	G			19119927	+1			no_errors	ENST00000399635	ensembl	human	known	74_37	missense	29.41	12	5	SNP	0.885	A
TTC28	23331	genome.wustl.edu	37	22	28379105	28379105	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr22:28379105C>T	ENST00000397906.2	-	23	6691	c.6550G>A	c.(6550-6552)Ggc>Agc	p.G2184S	TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000454996.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000419253.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000425112.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000430525.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	2184					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						ACCTGGCCGCCGCTCCTCTGA	0.547																																																	0													56.0	43.0	47.0					22																	28379105		692	1591	2283	SO:0001583	missense	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.6550G>A	22.37:g.28379105C>T	ENSP00000381003:p.Gly2184Ser		K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G2184S	ENST00000397906.2	37	c.6550	CCDS46678.1	22	.	.	.	.	.	.	.	.	.	.	C	9.885	1.202732	0.22121	.	.	ENSG00000100154	ENST00000397906	D	0.88046	-2.33	5.23	3.11	0.35812	.	0.062472	0.64402	D	0.000004	T	0.74943	0.3783	N	0.17082	0.46	0.28476	N	0.91517	B	0.11235	0.004	B	0.06405	0.002	T	0.63319	-0.6664	10	0.32370	T	0.25	-18.9619	9.312	0.37910	0.0:0.7507:0.0:0.2493	.	2184	Q96AY4	TTC28_HUMAN	S	2184	ENSP00000381003:G2184S	ENSP00000381003:G2184S	G	-	1	0	TTC28	26709105	0.604000	0.26932	0.022000	0.16811	0.233000	0.25261	1.795000	0.38784	0.701000	0.31803	0.655000	0.94253	GGC	TTC28	-	NULL	ENSG00000100154		0.547	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	-	0.00	62	0	C	XM_929318		28379105	-1	tier1	-	no_errors	ENST00000397906	ensembl	human	novel	74_37	missense	24.62	49	16	SNP	0.362	T
TTN	7273	genome.wustl.edu	37	2	179454489	179454489	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:179454489C>T	ENST00000591111.1	-	254	57264	c.57040G>A	c.(57040-57042)Gaa>Aaa	p.E19014K	TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E11782K|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E11715K|TTN_ENST00000342992.6_Missense_Mutation_p.E18087K|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E11590K|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E20655K			Q8WZ42	TITIN_HUMAN	titin	19014	Fibronectin type-III 37. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTTTTGTTTCGATGGTTGGC	0.393																																																	0													222.0	212.0	215.0					2																	179454489		1889	4103	5992	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.57040G>A	2.37:g.179454489C>T	ENSP00000465570:p.Glu19014Lys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E18087K	ENST00000591111.1	37	c.54259		2	.	.	.	.	.	.	.	.	.	.	C	15.18	2.756785	0.49362	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55760	0.5;0.5;0.5;0.5	6.1	6.1	0.99115	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74951	0.3784	M	0.76727	2.345	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.75484	0.986;0.986;0.986;0.986	T	0.75224	-0.3393	9	0.87932	D	0	.	20.7146	0.99709	0.0:1.0:0.0:0.0	.	11590;11715;11782;19014	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	18087;11590;11782;11715;11588	ENSP00000343764:E18087K;ENSP00000434586:E11590K;ENSP00000340554:E11782K;ENSP00000352154:E11715K	ENSP00000340554:E11782K	E	-	1	0	TTN	179162735	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.770000	0.85390	2.902000	0.99343	0.650000	0.86243	GAA	TTN	-	superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,pfscan_Fibronectin_type3	ENSG00000155657		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	72	0	C	NM_133378		179454489	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	22.22	63	18	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179596509	179596509	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr2:179596509T>C	ENST00000591111.1	-	56	16366	c.16142A>G	c.(16141-16143)aAg>aGg	p.K5381R	TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.K4454R|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.K5698R			Q8WZ42	TITIN_HUMAN	titin	12200	Ig-like 34.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGCTACAAACTTGAGGATCTG	0.478																																																	0													116.0	116.0	116.0					2																	179596509		1946	4153	6099	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.16142A>G	2.37:g.179596509T>C	ENSP00000465570:p.Lys5381Arg		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.K4454R	ENST00000591111.1	37	c.13361		2	.	.	.	.	.	.	.	.	.	.	T	9.043	0.990077	0.18966	.	.	ENSG00000155657	ENST00000342992	T	0.43294	0.95	5.93	4.77	0.60923	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.27933	0.0688	N	0.17872	0.535	0.80722	D	1	B	0.09022	0.002	B	0.12156	0.007	T	0.07290	-1.0780	9	0.87932	D	0	.	8.1821	0.31317	0.0:0.2227:0.0:0.7773	.	5381	Q8WZ42	TITIN_HUMAN	R	4454	ENSP00000343764:K4454R	ENSP00000343764:K4454R	K	-	2	0	TTN	179304754	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	0.525000	0.22956	1.072000	0.40860	0.533000	0.62120	AAG	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.478	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	38	0	T	NM_133378		179596509	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	15.91	37	7	SNP	1.000	C
TTPAL	79183	genome.wustl.edu	37	20	43118107	43118107	+	Silent	SNP	C	C	T	rs374289262		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr20:43118107C>T	ENST00000372904.3	+	6	1097	c.954C>T	c.(952-954)ccC>ccT	p.P318P	TTPAL_ENST00000372906.2_3'UTR|TTPAL_ENST00000262605.4_Silent_p.P318P	NM_024331.4	NP_077307.2	Q9BTX7	TTPAL_HUMAN	tocopherol (alpha) transfer protein-like	318						intracellular (GO:0005622)|membrane (GO:0016020)	transporter activity (GO:0005215)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|ovary(2)|skin(5)	18						CGCTGCTGCCCGAGGGCCTGA	0.577																																																	0								T	,	1,4405	826.1+/-416.6	0,1,2202	60.0	56.0	58.0		954,954	-12.3	0.0	20		58	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	TTPAL	NM_001039199.1,NM_024331.3	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	318/343,318/343	43118107	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			BC003071	CCDS13332.2	20q13.12	2008-06-23	2008-06-23	2008-06-23	ENSG00000124120	ENSG00000124120			16114	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 121"""	C20orf121			Standard	NM_024331		Approved	dJ179M20.3	uc002xmd.2	Q9BTX7	OTTHUMG00000032536	ENST00000372904.3:c.954C>T	20.37:g.43118107C>T			E1P5X3|Q5QPC1|Q9H1G2|Q9NQG8	Silent	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,prints_CRAL-bd_toc_tran	p.P318	ENST00000372904.3	37	c.954	CCDS13332.2	20																																																																																			TTPAL	-	NULL	ENSG00000124120		0.577	TTPAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTPAL	HGNC	protein_coding	OTTHUMT00000106886.2	-	0.00	44	0	C	NM_024331		43118107	+1	tier1	-	no_errors	ENST00000262605	ensembl	human	known	74_37	silent	17.53	80	17	SNP	0.000	T
TUBA1B	10376	genome.wustl.edu	37	12	49521906	49521906	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr12:49521906C>T	ENST00000336023.5	-	4	1285	c.1191G>A	c.(1189-1191)ctG>ctA	p.L397L	RP11-386G11.10_ENST00000547387.1_RNA|RP11-386G11.10_ENST00000552893.1_RNA|RP11-386G11.10_ENST00000548149.1_RNA	NM_006082.2	NP_006073.2	P68363	TBA1B_HUMAN	tubulin, alpha 1b	397					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(4)	12						TGGCATACATCAGGTCAAACT	0.572																																																	0													47.0	48.0	48.0					12																	49521906		2202	4280	6482	SO:0001819	synonymous_variant	0			AF081484	CCDS31792.1	12q13.12	2007-02-12				ENSG00000123416		"""Tubulins"""	18809	protein-coding gene	gene with protein product	"""tubulin, alpha, ubiquitous"""	602530				12054644, 6646120	Standard	NM_006082		Approved	K-ALPHA-1	uc001rtm.3	P68363	OTTHUMG00000170410	ENST00000336023.5:c.1191G>A	12.37:g.49521906C>T			P04687|P05209|Q27I68|Q8WU19	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.L397	ENST00000336023.5	37	c.1191	CCDS31792.1	12																																																																																			TUBA1B	-	superfamily_Tub_FtsZ_C,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin	ENSG00000123416		0.572	TUBA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA1B	HGNC	protein_coding	OTTHUMT00000409005.1	-	0.00	127	0	C	NM_006082		49521906	-1	tier1	-	no_errors	ENST00000336023	ensembl	human	known	74_37	silent	14.94	148	26	SNP	1.000	T
UBE2QL1	134111	genome.wustl.edu	37	5	6449291	6449291	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:6449291C>T	ENST00000399816.3	+	1	556	c.285C>T	c.(283-285)cgC>cgT	p.R95R		NM_001145161.2	NP_001138633.1	A1L167	U2QL1_HUMAN	ubiquitin-conjugating enzyme E2Q family-like 1	95					protein ubiquitination (GO:0016567)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			breast(1)|endometrium(1)	2						TCACGCCGCGCGGCTGGTCCA	0.726																																																	0													56.0	56.0	56.0					5																	6449291		692	1591	2283	SO:0001819	synonymous_variant	0			AK057805	CCDS47189.1	5p15.31	2010-02-17			ENSG00000215218	ENSG00000215218			37269	protein-coding gene	gene with protein product		615832					Standard	NM_001145161		Approved	FLJ25076	uc003jdp.4	A1L167	OTTHUMG00000161683	ENST00000399816.3:c.285C>T	5.37:g.6449291C>T				Silent	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.R95	ENST00000399816.3	37	c.285	CCDS47189.1	5																																																																																			UBE2QL1	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000215218		0.726	UBE2QL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2QL1	HGNC	protein_coding	OTTHUMT00000365717.1	-	0.00	10	0	C	NM_001145161		6449291	+1	tier1	-	no_errors	ENST00000399816	ensembl	human	known	74_37	silent	58.33	5	7	SNP	0.999	T
UBQLNL	143630	genome.wustl.edu	37	11	5536298	5536298	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:5536298C>A	ENST00000380184.1	-	1	1637	c.1374G>T	c.(1372-1374)caG>caT	p.Q458H	HBG2_ENST00000380259.2_Intron	NM_145053.4	NP_659490.4	Q8IYU4	UBQLN_HUMAN	ubiquilin-like	458										endometrium(1)|kidney(3)|large_intestine(9)|lung(13)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	33		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.136)		TGGGCAGCTGCTGCCTCCACT	0.498																																																	0													109.0	107.0	108.0					11																	5536298		2201	4297	6498	SO:0001583	missense	0			AK127987	CCDS31385.1	11p15.4	2014-02-12			ENSG00000175518	ENSG00000175518		"""Ubiquilin family"""	28294	protein-coding gene	gene with protein product							Standard	NM_145053		Approved	MGC20470, MGC26958	uc001maz.4	Q8IYU4	OTTHUMG00000066903	ENST00000380184.1:c.1374G>T	11.37:g.5536298C>A	ENSP00000369531:p.Gln458His		Q6ZRU1|Q96EK3|Q96MB0	Missense_Mutation	SNP	pfam_Ubiquitin_dom,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	p.Q458H	ENST00000380184.1	37	c.1374	CCDS31385.1	11	.	.	.	.	.	.	.	.	.	.	C	5.387	0.256571	0.10185	.	.	ENSG00000175518	ENST00000380184;ENST00000538889	T	0.52983	0.64	5.82	1.95	0.26073	.	0.663319	0.12977	N	0.423605	T	0.59074	0.2167	L	0.54323	1.7	0.30699	N	0.750542	D	0.89917	1.0	D	0.87578	0.998	T	0.56001	-0.8051	10	0.51188	T	0.08	.	7.3434	0.26650	0.0:0.5969:0.0:0.4031	.	458	Q8IYU4	UBQLN_HUMAN	H	458;243	ENSP00000369531:Q458H	ENSP00000369531:Q458H	Q	-	3	2	UBQLNL	5492874	0.478000	0.25917	0.513000	0.27749	0.099000	0.18886	0.155000	0.16362	0.537000	0.28751	0.655000	0.94253	CAG	UBQLNL	-	NULL	ENSG00000175518		0.498	UBQLNL-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	UBQLNL	HGNC	protein_coding	OTTHUMT00000143386.1	-	0.00	25	0	C	NM_145053		5536298	-1	tier1	-	no_errors	ENST00000380184	ensembl	human	putative	74_37	missense	20.69	23	6	SNP	0.662	A
USP1	7398	genome.wustl.edu	37	1	62910645	62910645	+	Missense_Mutation	SNP	C	C	T	rs528857044		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr1:62910645C>T	ENST00000339950.4	+	6	1609	c.794C>T	c.(793-795)cCa>cTa	p.P265L	USP1_ENST00000371146.1_Missense_Mutation_p.P265L	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	265	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		GAGAAACTCCCAAAAGGAAAT	0.363																																					Ovarian(122;1846 2315 3982 19504)												0													60.0	64.0	63.0					1																	62910645		2203	4297	6500	SO:0001583	missense	0				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.794C>T	1.37:g.62910645C>T	ENSP00000343526:p.Pro265Leu		A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	p.P265L	ENST00000339950.4	37	c.794	CCDS621.1	1	.	.	.	.	.	.	.	.	.	.	C	11.76	1.733792	0.30684	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	T;T	0.17528	2.27;2.27	5.5	2.58	0.30949	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.553882	0.20370	N	0.093666	T	0.11367	0.0277	L	0.29908	0.895	0.09310	N	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.19128	-1.0315	10	0.51188	T	0.08	0.2572	6.7233	0.23342	0.1181:0.6193:0.0:0.2627	.	265	O94782	UBP1_HUMAN	L	265	ENSP00000360188:P265L;ENSP00000343526:P265L	ENSP00000343526:P265L	P	+	2	0	USP1	62683233	0.000000	0.05858	0.954000	0.39281	0.892000	0.51952	0.077000	0.14738	0.875000	0.35847	0.650000	0.86243	CCA	USP1	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000162607		0.363	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP1	HGNC	protein_coding	OTTHUMT00000024881.1		0.00	11	0	C	NM_001017415		62910645	+1			no_errors	ENST00000339950	ensembl	human	known	74_37	missense	17.65	14	3	SNP	0.001	T
CCDC144A	9720	genome.wustl.edu	37	17	16704479	16704480	+	Intron	INS	-	-	GAAT	rs376397807|rs543300328	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:16704479_16704480insGAAT	ENST00000443444.2	+	26	6717				RP11-219A15.4_ENST00000602730.1_RNA|USP32P1_ENST00000393005.2_RNA|RP11-219A15.1_ENST00000448331.3_Intron			A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A																		AGTTAGAAACAATCAACAGAAC	0.337														145	0.0289537	0.0666	0.0072	5008	,	,		13687	0.0149		0.006	False		,,,				2504	0.0317																0																																										SO:0001627	intron_variant	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000443444.2:c.4281+37->GAAT	17.37:g.16704479_16704480insGAAT			O60311|Q6ZU57	RNA	INS	-	NULL	ENST00000443444.2	37	NULL	CCDS45621.1	17																																																																																			USP32P1	-	-	ENSG00000188933		0.337	CCDC144A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP32P1	HGNC	protein_coding			0.00	42	0	-			16704480	+1	tier1		no_errors	ENST00000444558	ensembl	human	known	74_37	rna	9.52	19	2	INS	0.103:0.004	GAAT
USP6	9098	genome.wustl.edu	37	17	5072078	5072078	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:5072078G>A	ENST00000574788.1	+	35	5475	c.3245G>A	c.(3244-3246)cGa>cAa	p.R1082Q	USP6_ENST00000332776.4_3'UTR|USP6_ENST00000304328.5_Missense_Mutation_p.R765Q|USP6_ENST00000250066.6_Missense_Mutation_p.R1082Q			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	1082	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						CACCTTAAGCGATTTCAATTT	0.348			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																			Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0													76.0	90.0	85.0					17																	5072078		2197	4296	6493	SO:0001583	missense	0			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.3245G>A	17.37:g.5072078G>A	ENSP00000460380:p.Arg1082Gln		Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Peptidase_C19/C67	p.R1082Q	ENST00000574788.1	37	c.3245	CCDS11069.2	17	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996997	0.54147	.	.	ENSG00000129204	ENST00000250066;ENST00000304328	T;T	0.17054	2.3;2.3	2.35	2.35	0.29111	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.45236	0.1332	M	0.90198	3.095	0.49051	D	0.999742	D;D	0.89917	0.999;1.0	D;D	0.91635	0.993;0.999	T	0.54437	-0.8294	10	0.87932	D	0	.	10.4068	0.44266	0.0:0.0:1.0:0.0	.	765;1082	P35125-2;P35125	.;UBP6_HUMAN	Q	1082;765	ENSP00000250066:R1082Q;ENSP00000305473:R765Q	ENSP00000250066:R1082Q	R	+	2	0	USP6	5012802	1.000000	0.71417	1.000000	0.80357	0.233000	0.25261	8.953000	0.93041	1.313000	0.45069	0.184000	0.17185	CGA	USP6	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000129204		0.348	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	HGNC	protein_coding	OTTHUMT00000438990.1	-	0.00	120	0	G	NM_004505		5072078	+1	tier1	-	no_errors	ENST00000250066	ensembl	human	known	74_37	missense	15.83	117	22	SNP	1.000	A
VCAN	1462	genome.wustl.edu	37	5	82816669	82816669	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:82816669A>C	ENST00000265077.3	+	7	3109	c.2544A>C	c.(2542-2544)gaA>gaC	p.E848D	VCAN_ENST00000342785.4_Missense_Mutation_p.E848D|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000512590.2_Missense_Mutation_p.E800D	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	848	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GTTTCACTGAAGATGGAGCAG	0.413																																																	0													106.0	105.0	106.0					5																	82816669		2203	4300	6503	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.2544A>C	5.37:g.82816669A>C	ENSP00000265077:p.Glu848Asp		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EG-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.E848D	ENST00000265077.3	37	c.2544	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	A	5.420	0.262682	0.10294	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	T;T;T	0.28666	1.6;1.6;1.6	6.06	-2.91	0.05631	.	0.423542	0.22370	N	0.060960	T	0.16342	0.0393	L	0.40543	1.245	0.09310	N	1	B;B	0.21606	0.01;0.058	B;B	0.17098	0.009;0.017	T	0.09530	-1.0670	10	0.36615	T	0.2	.	1.4656	0.02405	0.2863:0.1138:0.1383:0.4616	.	848;848	P13611-3;P13611	.;CSPG2_HUMAN	D	848;848;800	ENSP00000265077:E848D;ENSP00000342768:E848D;ENSP00000425959:E800D	ENSP00000265077:E848D	E	+	3	2	VCAN	82852425	0.028000	0.19301	0.007000	0.13788	0.121000	0.20230	0.008000	0.13197	-0.741000	0.04797	0.528000	0.53228	GAA	VCAN	-	NULL	ENSG00000038427		0.413	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	-	0.00	25	0	A	NM_004385		82816669	+1	tier1	-	no_errors	ENST00000265077	ensembl	human	known	74_37	missense	53.85	12	14	SNP	0.003	C
VN1R2	317701	genome.wustl.edu	37	19	53762665	53762665	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:53762665G>T	ENST00000341702.3	+	1	1121	c.1037G>T	c.(1036-1038)tGg>tTg	p.W346L	VN1R2_ENST00000598458.1_Intron	NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	346					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		AATTCCAGTTGGTGGCTAGTG	0.468																																																	0													252.0	227.0	235.0					19																	53762665		2203	4300	6503	SO:0001583	missense	0			AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.1037G>T	19.37:g.53762665G>T	ENSP00000351244:p.Trp346Leu		A1L411|Q8TDU4	Missense_Mutation	SNP	pfam_Vmron_rcpt_1,pfam_GPCR_Rhodpsn,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	p.W346L	ENST00000341702.3	37	c.1037	CCDS12862.1	19	.	.	.	.	.	.	.	.	.	.	G	4.793	0.147404	0.09134	.	.	ENSG00000196131	ENST00000341702	T	0.07216	3.21	2.94	0.61	0.17580	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.04272	0.0118	N	0.11892	0.195	0.09310	N	1	B	0.21147	0.052	B	0.20577	0.03	T	0.46428	-0.9192	9	0.22109	T	0.4	.	6.3025	0.21121	0.0:0.3908:0.4096:0.1997	.	346	Q8NFZ6	VN1R2_HUMAN	L	346	ENSP00000351244:W346L	ENSP00000351244:W346L	W	+	2	0	VN1R2	58454477	0.008000	0.16893	0.001000	0.08648	0.086000	0.17979	-0.228000	0.09114	0.270000	0.21984	0.596000	0.82720	TGG	VN1R2	-	pfam_Vmron_rcpt_1,pfam_GPCR_Rhodpsn,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196131		0.468	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R2	HGNC	protein_coding	OTTHUMT00000464285.1	-	0.00	79	0	G	NM_173856		53762665	+1	tier1	-	no_errors	ENST00000341702	ensembl	human	known	74_37	missense	11.97	103	14	SNP	0.002	T
WDFY4	57705	genome.wustl.edu	37	10	50171915	50171915	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr10:50171915A>C	ENST00000325239.5	+	53	8279	c.8252A>C	c.(8251-8253)aAc>aCc	p.N2751T	WDFY4_ENST00000465910.1_3'UTR|WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2751	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.					integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GTCAGTGCCAACCTCCACCAT	0.502																																																	0													105.0	82.0	89.0					10																	50171915		692	1591	2283	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.8252A>C	10.37:g.50171915A>C	ENSP00000320563:p.Asn2751Thr		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N2751T	ENST00000325239.5	37	c.8252	CCDS44385.1	10	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	20.7|20.7|20.7	4.037578|4.037578|4.037578	0.75617|0.75617|0.75617	.|.|.	.|.|.	ENSG00000128815|ENSG00000128815|ENSG00000128815	ENST00000426033;ENST00000325239;ENST00000544136|ENST00000312002|ENST00000265453	T|.|.	0.81078|.|.	-1.45|.|.	5.57|5.57|5.57	5.57|5.57|5.57	0.84162|0.84162|0.84162	BEACH domain (4);|.|.	0.169234|.|.	0.49916|.|.	D|.|.	0.000129|.|.	T|T|T	0.72203|0.72203|0.72203	0.3431|0.3431|0.3431	M|M|M	0.65677|0.65677|0.65677	2.01|2.01|2.01	0.80722|0.80722|0.80722	D|D|D	1|1|1	B;P|.|.	0.46142|.|.	0.143;0.873|.|.	B;P|.|.	0.51895|.|.	0.219;0.683|.|.	T|T|T	0.71836|0.71836|0.71836	-0.4472|-0.4472|-0.4472	9|5|5	.|.|.	.|.|.	.|.|.	.|.|.	14.9019|14.9019|14.9019	0.70687|0.70687|0.70687	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	214;2751|.|.	B4DWY9;Q6ZS81|.|.	.;WDFY4_HUMAN|.|.	T|H|P	2751;2751;214|1841|838	ENSP00000320563:N2751T|.|.	.|.|.	N|Q|T	+|+|+	2|3|1	0|2|0	WDFY4|WDFY4|WDFY4	49841921|49841921|49841921	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.998000|0.998000|0.998000	0.95712|0.95712|0.95712	7.407000|7.407000|7.407000	0.80029|0.80029|0.80029	2.119000|2.119000|2.119000	0.64992|0.64992|0.64992	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	AAC|CAA|ACC	WDFY4	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000128815		0.502	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		-	0.00	67	0	A	XM_033379		50171915	+1	tier1	-	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	50.00	49	49	SNP	1.000	C
WDR49	151790	genome.wustl.edu	37	3	167339315	167339315	+	Intron	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:167339315A>G	ENST00000308378.3	-	2	241				WDR49_ENST00000453925.2_5'Flank|WDR49_ENST00000479765.1_Silent_p.Y241Y	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49											breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						GATCATACCAATAATCCATGC	0.363																																																	0																																										SO:0001627	intron_variant	0			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.65-17059T>C	3.37:g.167339315A>G			Q8N297	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_EF_hand_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y241	ENST00000308378.3	37	c.723	CCDS3201.1	3																																																																																			WDR49	-	superfamily_WD40_repeat_dom	ENSG00000174776		0.363	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR49	HGNC	protein_coding	OTTHUMT00000350592.3	-	0.00	26	0	A	NM_178824		167339315	-1	tier1	-	no_errors	ENST00000479765	ensembl	human	putative	74_37	silent	15.28	61	11	SNP	1.000	G
WFIKKN1	117166	genome.wustl.edu	37	16	683884	683884	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr16:683884C>T	ENST00000319070.2	+	2	1796	c.1474C>T	c.(1474-1476)Ccc>Tcc	p.P492S		NM_053284.2	NP_444514.1	Q96NZ8	WFKN1_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 1	492	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|prostate(1)|upper_aerodigestive_tract(1)	4		Hepatocellular(780;0.00335)				CTGCCCCTGCCCCAACATGAC	0.672																																																	0													54.0	30.0	38.0					16																	683884		2174	4287	6461	SO:0001583	missense	0			AK075356	CCDS10414.1	16p13	2013-01-21			ENSG00000127578	ENSG00000127578		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30912	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20A"""	608021	"""chromosome 16 open reading frame 12"""	C16orf12		11274388, 11928817	Standard	NM_053284		Approved	RJD2, WFIKKN, WFDC20A	uc002cht.1	Q96NZ8	OTTHUMG00000090359	ENST00000319070.2:c.1474C>T	16.37:g.683884C>T	ENSP00000324763:p.Pro492Ser		Q7LDW0|Q8NBQ1|Q96S20	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,pfam_Ig_I-set,pfam_Ig_V-set,pfam_WAP-type_4-diS_core,pfam_Kazal_dom,pfam_Immunoglobulin,pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,superfamily_Prot_inh_Kunz-m,superfamily_WAP-type_4-diS_core,smart_WAP-type_4-diS_core,smart_Ig_sub,smart_Ig_sub2,smart_Prot_inh_Kunz-m,pfscan_Netrin_domain,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like_dom,prints_Prot_inh_Kunz-m	p.P492S	ENST00000319070.2	37	c.1474	CCDS10414.1	16	.	.	.	.	.	.	.	.	.	.	c	15.57	2.873292	0.51695	.	.	ENSG00000127578	ENST00000319070	T	0.55930	0.49	5.31	5.31	0.75309	Tissue inhibitor of metalloproteinases-like, OB-fold (1);Netrin domain (1);Netrin module, non-TIMP type (1);	0.064282	0.64402	D	0.000006	T	0.67468	0.2896	M	0.67397	2.05	0.46376	D	0.999019	D	0.65815	0.995	P	0.62491	0.903	T	0.70554	-0.4840	10	0.72032	D	0.01	.	13.6672	0.62403	0.0:0.8451:0.1549:0.0	.	492	Q96NZ8	WFKN1_HUMAN	S	492	ENSP00000324763:P492S	ENSP00000324763:P492S	P	+	1	0	WFIKKN1	623885	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	5.856000	0.69518	2.480000	0.83734	0.556000	0.70494	CCC	WFIKKN1	-	pfam_Netrin_module_non-TIMP,superfamily_TIMP-like_OB-fold,pfscan_Netrin_domain	ENSG00000127578		0.672	WFIKKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFIKKN1	HGNC	protein_coding	OTTHUMT00000206731.2	-	0.00	66	0	C	NM_053284		683884	+1	tier1	-	no_errors	ENST00000319070	ensembl	human	known	74_37	missense	22.00	39	11	SNP	1.000	T
XCR1	2829	genome.wustl.edu	37	3	46062567	46062567	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:46062567C>T	ENST00000309285.3	-	2	1229	c.873G>A	c.(871-873)ggG>ggA	p.G291G	XCR1_ENST00000542109.1_Silent_p.G291G	NM_001024644.1	NP_001019815.1	P46094	XCR1_HUMAN	chemokine (C motif) receptor 1	291					chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|release of sequestered calcium ion into cytosol (GO:0051209)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			NS(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(2)	14				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		GGAACTTGACCCCCACGAAGA	0.612																																																	0													75.0	78.0	77.0					3																	46062567		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2736.1	3p21.3-p21.1	2012-11-19	2006-01-13	2002-08-23	ENSG00000173578	ENSG00000173578		"""GPCR / Class A : Chemokine receptors : X-C motif"""	1625	protein-coding gene	gene with protein product		600552	"""chemokine (C motif) XC receptor 1"""	GPR5, CCXCR1		7832990, 10400311	Standard	NM_005283		Approved		uc003cpf.3	P46094	OTTHUMG00000133449	ENST00000309285.3:c.873G>A	3.37:g.46062567C>T				Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_XCR1,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Brdyknn_rcpt	p.G291	ENST00000309285.3	37	c.873	CCDS2736.1	3																																																																																			XCR1	-	prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Brdyknn_rcpt	ENSG00000173578		0.612	XCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XCR1	HGNC	protein_coding	OTTHUMT00000257322.2	-	0.00	54	0	C			46062567	-1	tier1	-	no_errors	ENST00000309285	ensembl	human	known	74_37	silent	13.64	57	9	SNP	0.986	T
ZC3H4	23211	genome.wustl.edu	37	19	47589768	47589768	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:47589768C>A	ENST00000253048.5	-	6	780	c.743G>T	c.(742-744)aGg>aTg	p.R248M	ZC3H4_ENST00000594019.1_Intron	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	248	Gly-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		TCCTCGGCCCCTGTAGCCCCG	0.652																																																	0													33.0	38.0	36.0					19																	47589768		1928	4117	6045	SO:0001583	missense	0			AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.743G>T	19.37:g.47589768C>A	ENSP00000253048:p.Arg248Met		Q9Y420	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.R248M	ENST00000253048.5	37	c.743	CCDS42582.1	19	.	.	.	.	.	.	.	.	.	.	C	15.05	2.718086	0.48622	.	.	ENSG00000130749	ENST00000253048	T	0.28454	1.61	5.12	5.12	0.69794	.	0.691975	0.13544	N	0.379948	T	0.48429	0.1499	L	0.47716	1.5	0.51482	D	0.999929	D	0.76494	0.999	P	0.61328	0.887	T	0.37267	-0.9713	10	0.51188	T	0.08	.	17.7009	0.88294	0.0:1.0:0.0:0.0	.	248	Q9UPT8	ZC3H4_HUMAN	M	248	ENSP00000253048:R248M	ENSP00000253048:R248M	R	-	2	0	ZC3H4	52281608	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.429000	0.52800	2.540000	0.85666	0.655000	0.94253	AGG	ZC3H4	-	NULL	ENSG00000130749		0.652	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	ZC3H4	HGNC	protein_coding	OTTHUMT00000466667.1	-	0.00	43	0	C			47589768	-1	tier1	-	no_errors	ENST00000253048	ensembl	human	known	74_37	missense	30.77	45	20	SNP	0.998	A
ZDHHC11	79844	genome.wustl.edu	37	5	710914	710914	+	Intron	SNP	T	T	A	rs374638240		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr5:710914T>A	ENST00000424784.2	-	14	2007				ZDHHC11B_ENST00000522356.1_5'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			TGTGCTCCCATTTCCGAATAC	0.512																																																	0																																										SO:0001627	intron_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1236+9A>T	5.37:g.710914T>A			Q6UWR9	RNA	SNP	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			ZDHHC11B	-	-	ENSG00000206077		0.512	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	HGNC	protein_coding		-	0.00	75	0	T	NM_024786		710914	-1	tier1	-	no_errors	ENST00000522356	ensembl	human	known	74_37	rna	5.13	296	16	SNP	0.006	A
ZFHX4	79776	genome.wustl.edu	37	8	77616566	77616566	+	Silent	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:77616566C>A	ENST00000521891.2	+	2	691	c.243C>A	c.(241-243)ccC>ccA	p.P81P	ZFHX4_ENST00000455469.2_Silent_p.P81P|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Silent_p.P81P|ZFHX4_ENST00000518282.1_Silent_p.P81P	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	81					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGGAGATACCCTGCAACGAAT	0.502										HNSCC(33;0.089)																																							0													161.0	161.0	161.0					8																	77616566		2084	4215	6299	SO:0001819	synonymous_variant	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.243C>A	8.37:g.77616566C>A			G3V138|Q18PS0|Q6ZN20	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.P81	ENST00000521891.2	37	c.243	CCDS47878.2	8																																																																																			ZFHX4	-	smart_Znf_C2H2-like	ENSG00000091656		0.502	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	35	0	C	NM_024721		77616566	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	silent	10.91	49	6	SNP	1.000	A
ZFHX4	79776	genome.wustl.edu	37	8	77763524	77763524	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr8:77763524T>G	ENST00000521891.2	+	10	4815	c.4367T>G	c.(4366-4368)cTt>cGt	p.L1456R	ZFHX4_ENST00000455469.2_Missense_Mutation_p.L1411R|ZFHX4_ENST00000050961.6_Missense_Mutation_p.L1411R|ZFHX4_ENST00000518282.1_Missense_Mutation_p.L1430R	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	1411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GAAGCTGAACTTCAACAGCTA	0.507										HNSCC(33;0.089)																																							0													43.0	41.0	42.0					8																	77763524		1989	4176	6165	SO:0001583	missense	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.4367T>G	8.37:g.77763524T>G	ENSP00000430497:p.Leu1456Arg		G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.L1456R	ENST00000521891.2	37	c.4367	CCDS47878.2	8	.	.	.	.	.	.	.	.	.	.	T	13.88	2.370346	0.42003	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.52983	0.64;0.68;0.65;0.64	5.01	3.86	0.44501	.	0.000000	0.39909	U	0.001229	T	0.40767	0.1130	N	0.22421	0.69	0.43863	D	0.996462	P;P;P	0.46220	0.61;0.874;0.729	B;P;P	0.48141	0.28;0.568;0.471	T	0.35226	-0.9797	10	0.72032	D	0.01	.	10.5029	0.44817	0.0:0.0759:0.0:0.9241	.	1411;1411;1456	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	R	1456;1456;1411;1411;1430	ENSP00000430497:L1456R;ENSP00000399605:L1411R;ENSP00000050961:L1411R;ENSP00000430848:L1430R	ENSP00000050961:L1411R	L	+	2	0	ZFHX4	77926079	1.000000	0.71417	0.986000	0.45419	0.906000	0.53458	7.868000	0.87116	0.955000	0.37878	0.449000	0.29647	CTT	ZFHX4	-	NULL	ENSG00000091656		0.507	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	-	0.00	39	0	T	NM_024721		77763524	+1	tier1	-	no_errors	ENST00000521891	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	G
ZFP92	139735	genome.wustl.edu	37	X	152686804	152686804	+	Silent	SNP	C	C	T			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chrX:152686804C>T	ENST00000338647.5	+	4	970	c.969C>T	c.(967-969)cgC>cgT	p.R323R	U82695.10_ENST00000569962.1_lincRNA	NM_001136273.1	NP_001129745.1	A6NM28	ZFP92_HUMAN	ZFP92 zinc finger protein	323					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)	6						TCGCGTGCCGCGAGTGCGGCA	0.711																																																	0													8.0	9.0	8.0					X																	152686804		677	1549	2226	SO:0001819	synonymous_variant	0			U82695	CCDS59177.1	Xq28	2013-01-08	2012-11-27		ENSG00000189420	ENSG00000189420		"""Zinc fingers, C2H2-type"", ""-"""	12865	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp92 in mouse"", ""zinc finger protein 92 homolog (mouse)"""				Standard	NM_001136273		Approved	ZNF897	uc011myo.2	A6NM28	OTTHUMG00000024198	ENST00000338647.5:c.969C>T	X.37:g.152686804C>T				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R323	ENST00000338647.5	37	c.969	CCDS59177.1	X																																																																																			ZFP92	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000189420		0.711	ZFP92-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP92	HGNC	protein_coding	OTTHUMT00000332220.2	-	0.00	15	0	C			152686804	+1	tier1	-	no_errors	ENST00000338647	ensembl	human	known	74_37	silent	44.44	20	16	SNP	0.000	T
ZIC1	7545	genome.wustl.edu	37	3	147128795	147128795	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr3:147128795A>G	ENST00000282928.4	+	1	1625	c.896A>G	c.(895-897)gAg>gGg	p.E299G		NM_003412.3	NP_003403.2	Q15915	ZIC1_HUMAN	Zic family member 1	299					adult walking behavior (GO:0007628)|brain development (GO:0007420)|cell differentiation (GO:0030154)|inner ear morphogenesis (GO:0042472)|pattern specification process (GO:0007389)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord development (GO:0021510)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(4)|cervix(1)|endometrium(2)|large_intestine(8)|lung(38)|ovary(1)|prostate(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	63						CACACGGGCGAGAAGCCCTTT	0.557																																																	0													90.0	94.0	93.0					3																	147128795		2203	4300	6503	SO:0001583	missense	0			D76435	CCDS3136.1	3q24	2013-01-08	2011-05-19		ENSG00000152977	ENSG00000152977		"""Zinc fingers, C2H2-type"""	12872	protein-coding gene	gene with protein product		600470	"""Zic family member 1 (odd-paired Drosophila homolog)"", ""Zic family member 1 (odd-paired homolog, Drosophila)"""			8542595	Standard	NM_003412		Approved	ZIC, ZNF201	uc003ewe.3	Q15915	OTTHUMG00000159456	ENST00000282928.4:c.896A>G	3.37:g.147128795A>G	ENSP00000282928:p.Glu299Gly		Q2M3N1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E299G	ENST00000282928.4	37	c.896	CCDS3136.1	3	.	.	.	.	.	.	.	.	.	.	A	19.87	3.906534	0.72868	.	.	ENSG00000152977	ENST00000282928	D	0.91407	-2.84	3.89	3.89	0.44902	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.93752	0.8003	M	0.64567	1.98	0.80722	D	1	D	0.64830	0.994	D	0.75484	0.986	D	0.94208	0.7456	10	0.87932	D	0	.	12.9855	0.58590	1.0:0.0:0.0:0.0	.	299	Q15915	ZIC1_HUMAN	G	299	ENSP00000282928:E299G	ENSP00000282928:E299G	E	+	2	0	ZIC1	148611485	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	8.998000	0.93550	1.517000	0.48917	0.459000	0.35465	GAG	ZIC1	-	pfscan_Znf_C2H2	ENSG00000152977		0.557	ZIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC1	HGNC	protein_coding	OTTHUMT00000355497.1	-	0.00	47	0	A	NM_003412		147128795	+1	tier1	-	no_errors	ENST00000282928	ensembl	human	known	74_37	missense	22.08	60	17	SNP	1.000	G
ZNF208	7757	genome.wustl.edu	37	19	22156826	22156826	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:22156826C>A	ENST00000397126.4	-	4	1158	c.1010G>T	c.(1009-1011)gGa>gTa	p.G337V	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GGGCTTCTCTCCAGCATGAAT	0.393																																																	0													52.0	54.0	53.0					19																	22156826		2042	4195	6237	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1010G>T	19.37:g.22156826C>A	ENSP00000380315:p.Gly337Val			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G337V	ENST00000397126.4	37	c.1010	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	C	12.48	1.951028	0.34471	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.23552	1.9	2.69	0.368	0.16146	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42040	0.1185	.	.	.	0.31263	N	0.692646	D	0.76494	0.999	D	0.70227	0.968	T	0.45101	-0.9284	8	0.87932	D	0	.	4.522	0.11964	0.0:0.5759:0.1825:0.2416	.	337	O43345	ZN208_HUMAN	V	337	ENSP00000380315:G337V	ENSP00000380315:G337V	G	-	2	0	ZNF208	21948666	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	1.182000	0.32029	-0.244000	0.09639	-0.643000	0.03959	GGA	ZNF208	-	pfscan_Znf_C2H2	ENSG00000160321		0.393	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	62	0	C	NM_007153		22156826	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	19.72	57	14	SNP	0.350	A
ZNF33A	7581	genome.wustl.edu	37	10	38343629	38343629	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr10:38343629G>A	ENST00000458705.2	+	5	732	c.574G>A	c.(574-576)Gtt>Att	p.V192I	ZNF33A_ENST00000307441.9_Missense_Mutation_p.V192I|ZNF33A_ENST00000374618.3_Missense_Mutation_p.V193I|ZNF33A_ENST00000469037.2_Intron|ZNF33A_ENST00000432900.2_Missense_Mutation_p.V199I			Q06730	ZN33A_HUMAN	zinc finger protein 33A	192					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|large_intestine(8)|liver(2)|lung(27)|ovary(2)|prostate(1)|skin(2)	46						GAAAAATGAAGTTTTGAAAAA	0.323																																																	0													69.0	69.0	69.0					10																	38343629		2203	4300	6503	SO:0001583	missense	0			D31763	CCDS31182.1, CCDS60514.1, CCDS73088.1, CCDS73089.1	10p11.2	2013-01-08	2005-03-18		ENSG00000189180	ENSG00000189180		"""Zinc fingers, C2H2-type"", ""-"""	13096	protein-coding gene	gene with protein product	"""zinc finger and ZAK associated protein with KRAB domain"""	194521	"""zinc finger protein 33a (KOX 31)"", ""zinc finger protein 11A"""	ZNF33, ZNF11A		2014798, 8464732	Standard	NM_006974		Approved	KOX5, KOX31, KIAA0065, FLJ23404, ZZAPK	uc031pui.1	Q06730	OTTHUMG00000017983	ENST00000458705.2:c.574G>A	10.37:g.38343629G>A	ENSP00000387713:p.Val192Ile		A8K9X9|B4E0M8|F6TH33|F8WAJ5|P17013|Q5VZ86	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V199I	ENST00000458705.2	37	c.595	CCDS31182.1	10	.	.	.	.	.	.	.	.	.	.	G	3.170	-0.170292	0.06461	.	.	ENSG00000189180	ENST00000374618;ENST00000432900;ENST00000458705;ENST00000307441	T;T;T;T	0.05513	3.43;3.44;3.44;3.44	1.68	-1.21	0.09524	.	1.273790	0.05825	N	0.616497	T	0.03695	0.0105	N	0.08118	0	0.09310	N	1	B;B;B	0.28933	0.228;0.085;0.206	B;B;B	0.27076	0.058;0.026;0.076	T	0.45041	-0.9288	10	0.52906	T	0.07	.	6.9783	0.24688	0.0:0.0:0.4846:0.5154	.	199;192;193	F6TH33;Q06730;F8WAJ5	.;ZN33A_HUMAN;.	I	193;199;192;192	ENSP00000363747:V193I;ENSP00000402467:V199I;ENSP00000387713:V192I;ENSP00000304268:V192I	ENSP00000304268:V192I	V	+	1	0	ZNF33A	38383635	0.006000	0.16342	0.013000	0.15412	0.031000	0.12232	-0.112000	0.10791	-0.312000	0.08741	-0.535000	0.04281	GTT	ZNF33A	-	NULL	ENSG00000189180		0.323	ZNF33A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF33A	HGNC	protein_coding	OTTHUMT00000047614.1	-	0.00	39	0	G	NM_006974		38343629	+1	tier1	-	no_errors	ENST00000432900	ensembl	human	known	74_37	missense	8.06	57	5	SNP	0.050	A
ZNF408	79797	genome.wustl.edu	37	11	46726758	46726758	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr11:46726758G>A	ENST00000311764.2	+	5	1738	c.1508G>A	c.(1507-1509)cGg>cAg	p.R503Q		NM_001184751.1|NM_024741.2	NP_001171680.1|NP_079017.1	Q9H9D4	ZN408_HUMAN	zinc finger protein 408	503					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CACTGTGGCCGGGCGTTTCGT	0.662																																					Pancreas(79;698 1390 6545 18745 34127)|Esophageal Squamous(120;1014 1625 12837 24601 49525)												0													58.0	58.0	58.0					11																	46726758		2199	4297	6496	SO:0001583	missense	0			AF346626	CCDS7923.1	11p11.2	2008-02-05			ENSG00000175213	ENSG00000175213		"""Zinc fingers, C2H2-type"""	20041	protein-coding gene	gene with protein product						15231747	Standard	NM_024741		Approved	FLJ12827	uc010rgw.2	Q9H9D4	OTTHUMG00000166568	ENST00000311764.2:c.1508G>A	11.37:g.46726758G>A	ENSP00000309606:p.Arg503Gln			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R503Q	ENST00000311764.2	37	c.1508	CCDS7923.1	11	.	.	.	.	.	.	.	.	.	.	G	14.25	2.480026	0.44044	.	.	ENSG00000175213	ENST00000311764	T	0.18960	2.18	5.68	3.77	0.43336	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.175952	0.27336	N	0.019831	T	0.08313	0.0207	N	0.10707	0.03	0.22446	N	0.999099	B;B	0.33477	0.413;0.413	B;B	0.27887	0.084;0.084	T	0.14727	-1.0462	10	0.54805	T	0.06	-25.4682	3.9089	0.09194	0.2755:0.1878:0.5367:0.0	.	495;503	B4DXY4;Q9H9D4	.;ZN408_HUMAN	Q	503	ENSP00000309606:R503Q	ENSP00000309606:R503Q	R	+	2	0	ZNF408	46683334	0.004000	0.15560	0.999000	0.59377	0.632000	0.37999	0.999000	0.29757	1.509000	0.48786	0.563000	0.77884	CGG	ZNF408	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000175213		0.662	ZNF408-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF408	HGNC	protein_coding	OTTHUMT00000390485.2	-	0.00	53	0	G	NM_024741		46726758	+1	tier1	-	no_errors	ENST00000311764	ensembl	human	known	74_37	missense	46.67	24	21	SNP	0.997	A
ZNF415	55786	genome.wustl.edu	37	19	53613064	53613064	+	Missense_Mutation	SNP	T	T	A	rs139795456	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:53613064T>A	ENST00000500065.4	-	4	567	c.234A>T	c.(232-234)aaA>aaT	p.K78N	ZNF415_ENST00000601493.1_5'UTR|ZNF415_ENST00000421033.1_Missense_Mutation_p.K90N|ZNF415_ENST00000448501.1_Missense_Mutation_p.K126N|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000455735.2_Missense_Mutation_p.K126N|ZNF415_ENST00000595813.1_3'UTR|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000243643.4_Missense_Mutation_p.K78N|ZNF415_ENST00000601215.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.K65N|ZNF415_ENST00000594011.1_3'UTR	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	126					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		CAATGTCATGTTTTTCATGTT	0.388																																																	0													159.0	138.0	145.0					19																	53613064		2203	4300	6503	SO:0001583	missense	0			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.234A>T	19.37:g.53613064T>A	ENSP00000439435:p.Lys78Asn		F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2	p.K126N	ENST00000500065.4	37	c.378	CCDS54313.1	19	.	.	.	.	.	.	.	.	.	.	T	10.66	1.412677	0.25465	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.07567	3.3;3.29;3.18;3.19;3.18;3.23	2.5	-1.97	0.07503	.	.	.	.	.	T	0.03520	0.0101	N	0.08118	0	0.09310	N	1	B;P;B;B;B;B	0.39326	0.006;0.668;0.006;0.014;0.006;0.011	B;B;B;B;B;B	0.39660	0.015;0.306;0.006;0.001;0.015;0.015	T	0.35375	-0.9791	9	0.29301	T	0.29	.	2.4264	0.04460	0.4319:0.0:0.3253:0.2429	.	78;126;126;78;65;90	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	N	78;78;126;90;126;65	ENSP00000243643:K78N;ENSP00000439435:K78N;ENSP00000396492:K126N;ENSP00000395055:K90N;ENSP00000388787:K126N;ENSP00000414601:K65N	ENSP00000243643:K78N	K	-	3	2	ZNF415	58304876	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-2.212000	0.01225	-0.454000	0.07066	0.260000	0.18958	AAA	ZNF415	-	NULL	ENSG00000170954		0.388	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF415	HGNC	protein_coding	OTTHUMT00000464043.1	-	0.00	81	0	T	NM_018355		53613064	-1	tier1	-	no_errors	ENST00000448501	ensembl	human	known	74_37	missense	5.26	108	6	SNP	0.000	A
ZNF469	84627	genome.wustl.edu	37	16	88501491	88501491	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr16:88501491G>A	ENST00000437464.1	+	2	7529	c.7529G>A	c.(7528-7530)aGa>aAa	p.R2510K	ZNF469_ENST00000565624.1_Missense_Mutation_p.R2538K	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2510					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						GGGAAGGAGAGACCAAATCAC	0.652																																																	0													38.0	46.0	43.0					16																	88501491		691	1590	2281	SO:0001583	missense	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7529G>A	16.37:g.88501491G>A	ENSP00000402343:p.Arg2510Lys			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R2510K	ENST00000437464.1	37	c.7529	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	G	9.897	1.205739	0.22205	.	.	ENSG00000225614	ENST00000437464	T	0.38887	1.11	4.22	-1.02	0.10135	.	.	.	.	.	T	0.16642	0.0400	N	0.12182	0.205	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.28964	-1.0027	9	0.02654	T	1	.	4.1872	0.10404	0.5608:0.1761:0.2631:0.0	.	2510	Q96JG9	ZN469_HUMAN	K	2510	ENSP00000402343:R2510K	ENSP00000402343:R2510K	R	+	2	0	ZNF469	87028992	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.046000	0.11983	-0.515000	0.06479	0.491000	0.48974	AGA	ZNF469	-	NULL	ENSG00000225614		0.652	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		-	0.00	44	0	G	NG_012236		88501491	+1	tier1	-	no_errors	ENST00000437464	ensembl	human	known	74_37	missense	10.34	52	6	SNP	0.007	A
ZNF470	388566	genome.wustl.edu	37	19	57088951	57088951	+	Missense_Mutation	SNP	G	G	A	rs141373983	byFrequency	TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:57088951G>A	ENST00000330619.8	+	6	1840	c.1154G>A	c.(1153-1155)cGt>cAt	p.R385H	ZNF470_ENST00000601902.1_Intron|ZNF470_ENST00000391709.3_Missense_Mutation_p.R385H	NM_001001668.3	NP_001001668.3	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R385H(1)|p.R385P(1)		endometrium(7)|large_intestine(12)|lung(11)|ovary(1)|pancreas(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	41		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		TCTCTTATACGTCATCGGCGA	0.418																																																	2	Substitution - Missense(2)	large_intestine(1)|pancreas(1)											94.0	87.0	90.0					19																	57088951		2203	4300	6503	SO:0001583	missense	0			AK129686	CCDS33122.1	19q13.43	2013-01-08				ENSG00000197016		"""Zinc fingers, C2H2-type"", ""-"""	22220	protein-coding gene	gene with protein product						15302581	Standard	NM_001001668		Approved	CZF-1, FLJ26175	uc002qnl.4	Q6ECI4		ENST00000330619.8:c.1154G>A	19.37:g.57088951G>A	ENSP00000333223:p.Arg385His		A8MTW0|B9EGU1|Q6ZPA1|Q9Y2N9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R385H	ENST00000330619.8	37	c.1154	CCDS33122.1	19	.	.	.	.	.	.	.	.	.	.	-	8.503	0.864750	0.17250	.	.	ENSG00000197016	ENST00000391709;ENST00000330619	T;T	0.26810	1.71;1.71	4.17	0.555	0.17247	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21022	0.0506	N	0.25060	0.705	0.09310	N	1	D	0.60575	0.988	P	0.52598	0.703	T	0.11817	-1.0572	9	0.45353	T	0.12	.	3.6782	0.08299	0.1002:0.1658:0.5639:0.1701	.	385	Q6ECI4	ZN470_HUMAN	H	385	ENSP00000375590:R385H;ENSP00000333223:R385H	ENSP00000333223:R385H	R	+	2	0	ZNF470	61780763	0.000000	0.05858	0.510000	0.27712	0.064000	0.16182	-0.779000	0.04659	0.929000	0.37192	0.590000	0.80494	CGT	ZNF470	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197016		0.418	ZNF470-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF470	HGNC	protein_coding	OTTHUMT00000459707.2	-	0.00	33	0	G	NM_001001668		57088951	+1	tier1	-	no_errors	ENST00000330619	ensembl	human	known	74_37	missense	27.78	39	15	SNP	0.000	A
ZNF518B	85460	genome.wustl.edu	37	4	10446830	10446830	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr4:10446830C>A	ENST00000326756.3	-	3	1561	c.1123G>T	c.(1123-1125)Ggg>Tgg	p.G375W		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	375					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						TTATCCCTCCCAGCTTCAAGG	0.398																																																	0													167.0	172.0	170.0					4																	10446830		2203	4300	6503	SO:0001583	missense	0			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.1123G>T	4.37:g.10446830C>A	ENSP00000317614:p.Gly375Trp		Q96LN8	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G375W	ENST00000326756.3	37	c.1123	CCDS33960.1	4	.	.	.	.	.	.	.	.	.	.	C	17.74	3.464363	0.63513	.	.	ENSG00000178163	ENST00000326756	T	0.01767	4.65	6.17	-1.48	0.08745	.	0.792060	0.10937	N	0.617694	T	0.03651	0.0104	L	0.29908	0.895	0.09310	N	1	D	0.61697	0.99	P	0.58577	0.841	T	0.40194	-0.9576	10	0.87932	D	0	-2.0608	10.843	0.46726	0.0:0.4473:0.0:0.5527	.	375	Q9C0D4	Z518B_HUMAN	W	375	ENSP00000317614:G375W	ENSP00000317614:G375W	G	-	1	0	ZNF518B	10055928	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-0.282000	0.08445	-0.688000	0.05155	-0.150000	0.13652	GGG	ZNF518B	-	NULL	ENSG00000178163		0.398	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF518B	HGNC	protein_coding	OTTHUMT00000359040.1	-	0.00	46	0	C	NM_053042		10446830	-1	tier1	-	no_errors	ENST00000326756	ensembl	human	known	74_37	missense	19.57	37	9	SNP	0.000	A
ZNF521	25925	genome.wustl.edu	37	18	22805695	22805695	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr18:22805695T>G	ENST00000361524.3	-	4	2335	c.2187A>C	c.(2185-2187)gaA>gaC	p.E729D	ZNF521_ENST00000584787.1_Missense_Mutation_p.E509D|ZNF521_ENST00000538137.2_Missense_Mutation_p.E729D|ZNF521_ENST00000579111.1_5'Flank	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	729					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					AGTCAAAAACTTCCTGGCAGA	0.473			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													71.0	74.0	73.0					18																	22805695		2203	4300	6503	SO:0001583	missense	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.2187A>C	18.37:g.22805695T>G	ENSP00000354794:p.Glu729Asp		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E729D	ENST00000361524.3	37	c.2187	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	T	9.136	1.012700	0.19277	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T;T	0.28666	1.6;1.6	6.17	-3.77	0.04346	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	T	0.44095	0.1277	L	0.45581	1.43	0.34944	D	0.750559	D	0.89917	1.0	D	0.76575	0.988	T	0.54563	-0.8275	10	0.87932	D	0	-25.9811	16.4839	0.84179	0.0:0.7171:0.0:0.2829	.	729	Q96K83	ZN521_HUMAN	D	729;763;729	ENSP00000354794:E729D;ENSP00000382352:E729D	ENSP00000354794:E729D	E	-	3	2	ZNF521	21059693	0.062000	0.20869	0.860000	0.33809	0.888000	0.51559	-0.712000	0.05013	-0.589000	0.05874	0.533000	0.62120	GAA	ZNF521	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198795		0.473	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	37	0	T	NM_015461		22805695	-1	tier1	-	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	10.71	50	6	SNP	0.992	G
ZNF564	163050	genome.wustl.edu	37	19	12637330	12637330	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:12637330T>A	ENST00000339282.7	-	4	1788	c.1592A>T	c.(1591-1593)aAa>aTa	p.K531I	ZNF709_ENST00000428311.1_Intron|CTD-2192J16.20_ENST00000593682.1_3'UTR	NM_144976.3	NP_659413.1	Q8TBZ8	ZN564_HUMAN	zinc finger protein 564	531					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18						TACGTAAGGTTTATCTCCATT	0.368																																																	0													94.0	98.0	97.0					19																	12637330		2112	4260	6372	SO:0001583	missense	0			BC028367	CCDS42505.1	19p13.2	2013-09-19			ENSG00000249709	ENSG00000249709		"""Zinc fingers, C2H2-type"", ""-"""	31106	protein-coding gene	gene with protein product							Standard	NM_144976		Approved	MGC26914		Q8TBZ8	OTTHUMG00000156418	ENST00000339282.7:c.1592A>T	19.37:g.12637330T>A	ENSP00000340004:p.Lys531Ile		B9EGT4|Q6P1K6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K531I	ENST00000339282.7	37	c.1592	CCDS42505.1	19	.	.	.	.	.	.	.	.	.	.	T	14.01	2.408948	0.42715	.	.	ENSG00000249709	ENST00000339282	T	0.02345	4.33	1.6	1.6	0.23607	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13030	0.0316	M	0.82630	2.6	0.80722	D	1	P	0.49696	0.927	D	0.69307	0.963	T	0.00834	-1.1547	9	0.87932	D	0	.	8.5942	0.33705	0.0:0.0:0.0:1.0	.	531	Q8TBZ8	ZN564_HUMAN	I	531	ENSP00000340004:K531I	ENSP00000340004:K531I	K	-	2	0	ZNF564	12498330	0.032000	0.19561	0.008000	0.14137	0.039000	0.13416	0.248000	0.18198	1.010000	0.39314	0.523000	0.50628	AAA	ZNF564	-	pfscan_Znf_C2H2	ENSG00000249709		0.368	ZNF564-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF564	HGNC	protein_coding	OTTHUMT00000344120.2	-	0.00	21	0	T	NM_144976		12637330	-1	tier1	-	no_errors	ENST00000339282	ensembl	human	known	74_37	missense	15.91	37	7	SNP	0.982	A
ZNF536	9745	genome.wustl.edu	37	19	30936157	30936157	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:30936157A>C	ENST00000355537.3	+	2	1835	c.1688A>C	c.(1687-1689)aAg>aCg	p.K563T		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	563					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GATAAGGAGAAGCGGGAGTAC	0.532																																																	0													83.0	89.0	87.0					19																	30936157		2203	4300	6503	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1688A>C	19.37:g.30936157A>C	ENSP00000347730:p.Lys563Thr		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K563T	ENST00000355537.3	37	c.1688	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	A	17.05	3.289433	0.59976	.	.	ENSG00000198597	ENST00000355537	T	0.45668	0.89	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.61148	0.2324	L	0.58101	1.795	0.54753	D	0.999986	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.62609	-0.6818	10	0.54805	T	0.06	-34.7656	15.6549	0.77126	1.0:0.0:0.0:0.0	.	563;563	A7E228;O15090	.;ZN536_HUMAN	T	563	ENSP00000347730:K563T	ENSP00000347730:K563T	K	+	2	0	ZNF536	35627997	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	8.924000	0.92827	2.087000	0.62958	0.533000	0.62120	AAG	ZNF536	-	NULL	ENSG00000198597		0.532	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	-	0.00	41	0	A	NM_014717		30936157	+1	tier1	-	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	23.40	36	11	SNP	1.000	C
ZNF594	84622	genome.wustl.edu	37	17	5085463	5085463	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr17:5085463G>A	ENST00000399604.4	-	1	2229	c.2089C>T	c.(2089-2091)Caa>Taa	p.Q697*	ZNF594_ENST00000575779.1_Nonsense_Mutation_p.Q697*			Q96JF6	ZN594_HUMAN	zinc finger protein 594	697					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						CTCCGATGTTGAATAAGGAGG	0.478																																																	0													78.0	83.0	81.0					17																	5085463		2167	4288	6455	SO:0001587	stop_gained	0			AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.2089C>T	17.37:g.5085463G>A	ENSP00000382513:p.Gln697*		Q6RFS0	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q697*	ENST00000399604.4	37	c.2089	CCDS42241.1	17	.	.	.	.	.	.	.	.	.	.	g	23.2	4.389350	0.82902	.	.	ENSG00000180626	ENST00000399604	.	.	.	0.876	-1.53	0.08611	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	.	5.1106	0.14808	0.0:0.0:0.6692:0.3308	.	.	.	.	X	697	.	ENSP00000382513:Q697X	Q	-	1	0	ZNF594	5026187	0.000000	0.05858	0.016000	0.15963	0.289000	0.27227	-5.994000	0.00086	0.293000	0.22520	0.298000	0.19748	CAA	ZNF594	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180626		0.478	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF594	HGNC	protein_coding	OTTHUMT00000438996.1	-	0.00	73	0	G	XM_290737		5085463	-1	tier1	-	no_errors	ENST00000399604	ensembl	human	known	74_37	nonsense	6.74	83	6	SNP	0.001	A
ZNF99	7652	genome.wustl.edu	37	19	22940992	22940992	+	Silent	SNP	A	A	G	rs369557719		TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:22940992A>G	ENST00000596209.1	-	4	1809	c.1719T>C	c.(1717-1719)gcT>gcC	p.A573A	ZNF99_ENST00000397104.3_Silent_p.A482A	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	573					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				ATTGCTTAAAAGCTTTGCCAC	0.358																																																	0								A		0,4190		0,0,2095	50.0	54.0	52.0		1446	1.4	0.0	19		52	5,8455		0,5,4225	no	coding-synonymous	ZNF99	NM_001080409.2		0,5,6320	GG,GA,AA		0.0591,0.0,0.0395		482/912	22940992	5,12645	2095	4230	6325	SO:0001819	synonymous_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.1719T>C	19.37:g.22940992A>G			M0R335	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A482	ENST00000596209.1	37	c.1446	CCDS59369.1	19																																																																																			ZNF99	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.358	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	-	0.00	34	0	A	XM_065124		22940992	-1	tier1	-	no_errors	ENST00000397104	ensembl	human	known	74_37	silent	15.91	37	7	SNP	0.055	G
ZNF766	90321	genome.wustl.edu	37	19	52793491	52793491	+	Silent	SNP	T	T	G			TCGA-L5-A4OW-01A-11D-A28B-09	TCGA-L5-A4OW-11A-11D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	ee548b30-729e-4ee2-abd7-33e6661fa4bc	ca4efbd8-835c-4a24-b3f9-4a6e7b01995e	g.chr19:52793491T>G	ENST00000439461.1	+	4	490	c.447T>G	c.(445-447)ctT>ctG	p.L149L	ZNF766_ENST00000599581.1_3'UTR|ZNF766_ENST00000593612.1_Silent_p.L164L|CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000359102.4_Silent_p.L164L	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	149					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		TTTCGCCACTTCAAAGAATTT	0.363																																																	0													60.0	61.0	60.0					19																	52793491		1889	4124	6013	SO:0001819	synonymous_variant	0			AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.447T>G	19.37:g.52793491T>G			B2RNE0|Q7Z326	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L164	ENST00000439461.1	37	c.492	CCDS46163.1	19																																																																																			ZNF766	-	NULL	ENSG00000196214		0.363	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF766	HGNC	protein_coding	OTTHUMT00000462764.1		0.00	11	0	T	NM_001010851		52793491	+1			no_errors	ENST00000359102	ensembl	human	known	74_37	silent	18.75	13	3	SNP	0.000	G
