#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ACTR3	10096	genome.wustl.edu	37	2	114691892	114691892	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:114691892C>G	ENST00000263238.2	+	6	789	c.469C>G	c.(469-471)Caa>Gaa	p.Q157E	ACTR3_ENST00000535589.2_Missense_Mutation_p.Q106E|ACTR3_ENST00000536059.1_Missense_Mutation_p.Q95E	NM_001277140.1|NM_005721.3	NP_001264069.1|NP_005712.1	P61158	ARP3_HUMAN	ARP3 actin-related protein 3 homolog (yeast)	157					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium morphogenesis (GO:0060271)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neuron differentiation (GO:0045666)|regulation of myosin II filament organization (GO:0043519)|response to antibiotic (GO:0046677)|response to carbohydrate (GO:0009743)|spindle localization (GO:0051653)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|hemidesmosome (GO:0030056)|lamellipodium (GO:0030027)|membrane (GO:0016020)|podosome (GO:0002102)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(2)	15						GACCTCAAGACAAGTAGGAGA	0.398																																																	0													251.0	232.0	238.0					2																	114691892		2203	4300	6503	SO:0001583	missense	0			AF006083	CCDS33277.1, CCDS63000.1	2q14.1	2010-07-20	2001-11-28		ENSG00000115091	ENSG00000115091			170	protein-coding gene	gene with protein product		604222	"""ARP3 (actin-related protein 3, yeast) homolog"""			9230079	Standard	NM_005721		Approved	ARP3	uc002tkx.2	P61158	OTTHUMG00000153497	ENST00000263238.2:c.469C>G	2.37:g.114691892C>G	ENSP00000263238:p.Gln157Glu		P32391|Q53QM2	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related	p.Q157E	ENST00000263238.2	37	c.469	CCDS33277.1	2	.	.	.	.	.	.	.	.	.	.	C	17.69	3.451926	0.63290	.	.	ENSG00000115091	ENST00000263238;ENST00000536059;ENST00000544784;ENST00000535589	D;D;D	0.94758	-3.51;-3.37;-3.43	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	D	0.89701	0.6791	N	0.17723	0.515	0.58432	D	0.999999	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	D	0.84817	0.0794	10	0.29301	T	0.29	-17.7664	18.4376	0.90652	0.0:1.0:0.0:0.0	.	95;157	F5H3P5;P61158	.;ARP3_HUMAN	E	157;95;28;106	ENSP00000263238:Q157E;ENSP00000445257:Q95E;ENSP00000444987:Q106E	ENSP00000263238:Q157E	Q	+	1	0	ACTR3	114408362	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.593000	0.82686	2.592000	0.87571	0.585000	0.79938	CAA	ACTR3	-	pfam_Actin-related,smart_Actin-related	ENSG00000115091		0.398	ACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTR3	HGNC	protein_coding	OTTHUMT00000331366.2	-	0.00	84	0	C	NM_005721		114691892	+1	tier1	-	no_errors	ENST00000263238	ensembl	human	known	74_37	missense	11.43	61	8	SNP	1.000	G
ADCY10P1	221442	genome.wustl.edu	37	6	41077455	41077455	+	RNA	SNP	G	G	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr6:41077455G>C	ENST00000567255.1	+	0	1262					NR_026938.2				adenylate cyclase 10 (soluble) pseudogene 1																		TTTATAGATTGATGAAGGCCA	0.383																																																	0																																												0					6p21.1	2012-07-04			ENSG00000161912	ENSG00000161912			44143	pseudogene	pseudogene							Standard	NR_026938		Approved		uc010jxi.1		OTTHUMG00000014668		6.37:g.41077455G>C				RNA	SNP	-	NULL	ENST00000567255.1	37	NULL		6																																																																																			ADCY10P1	-	-	ENSG00000161912		0.383	ADCY10P1-002	KNOWN	non_canonical_polymorphism|basic	processed_transcript	ADCY10P1	HGNC	pseudogene	OTTHUMT00000436223.1		0.00	67	0	G	NR_026938		41077455	+1			no_errors	ENST00000567255	ensembl	human	known	74_37	rna	5.08	56	3	SNP	1.000	C
AMBP	259	genome.wustl.edu	37	9	116840418	116840418	+	Silent	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr9:116840418C>T	ENST00000265132.3	-	1	334	c.72G>A	c.(70-72)acG>acA	p.T24T		NM_001633.3	NP_001624.1	P02760	AMBP_HUMAN	alpha-1-microglobulin/bikunin precursor	24					cell adhesion (GO:0007155)|female pregnancy (GO:0007565)|heme catabolic process (GO:0042167)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of immune response (GO:0050777)|negative regulation of JNK cascade (GO:0046329)|protein catabolic process (GO:0030163)|protein-chromophore linkage (GO:0018298)|viral process (GO:0016032)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|calcium oxalate binding (GO:0046904)|heme binding (GO:0020037)|IgA binding (GO:0019862)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase inhibitor activity (GO:0004867)|small molecule binding (GO:0036094)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	11					Human Serum Albumin(DB00062)|Serum albumin iodonated(DB00064)	TGTCGGGCGGCGTTGGCACAG	0.617																																																	0													108.0	118.0	114.0					9																	116840418		2203	4300	6503	SO:0001819	synonymous_variant	0			X04494	CCDS6800.1	9q32-q33	2014-01-22			ENSG00000106927	ENSG00000106927		"""Lipocalins"""	453	protein-coding gene	gene with protein product	"""growth-inhibiting protein 19"", ""uristatin"", ""complex-forming glycoprotein heterogeneous in charge"", ""bikunin"", ""inter-alpha-trypsin inhibitor light chain"", ""protein HC"", ""uronic-acid-rich protein"", ""trypstatin"""	176870		ITI, ITIL		1708673, 1385302	Standard	NM_001633		Approved	UTI, HCP, EDC1, HI30, IATIL, ITILC	uc004bie.4	P02760	OTTHUMG00000020534	ENST00000265132.3:c.72G>A	9.37:g.116840418C>T			P00977|P02759|P78491|Q2TU33|Q5TBD7|Q9UC58|Q9UDI8	Silent	SNP	pfam_Prot_inh_Kunz-m,pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m,prints_A1-microglobln,prints_PstgldnD_synth,prints_Prot_inh_Kunz-m,prints_Lipocalin	p.T24	ENST00000265132.3	37	c.72	CCDS6800.1	9																																																																																			AMBP	-	superfamily_Calycin-like	ENSG00000106927		0.617	AMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBP	HGNC	protein_coding	OTTHUMT00000053758.2	-	0.00	71	0	C	NM_001633		116840418	-1	tier1	-	no_errors	ENST00000265132	ensembl	human	known	74_37	silent	12.33	64	9	SNP	0.000	T
ANKRD30A	91074	genome.wustl.edu	37	10	37506796	37506796	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr10:37506796A>C	ENST00000602533.1	+	33	3188	c.3089A>C	c.(3088-3090)aAt>aCt	p.N1030T	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.N1149T|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.N1030T			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1086					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GTAGAAAGTAATTTGAATCAG	0.284																																																	0													54.0	52.0	52.0					10																	37506796		1795	4059	5854	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3089A>C	10.37:g.37506796A>C	ENSP00000473551:p.Asn1030Thr		Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.N1030T	ENST00000602533.1	37	c.3089		10	.	.	.	.	.	.	.	.	.	.	a	6.546	0.469004	0.12461	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.20332	2.08;2.08	2.78	1.62	0.23740	.	.	.	.	.	T	0.15262	0.0368	L	0.41124	1.26	0.09310	N	1	B	0.20671	0.047	B	0.22386	0.039	T	0.30060	-0.9991	9	0.51188	T	0.08	.	2.9645	0.05903	0.5909:0.2594:0.1497:0.0	.	1086	Q9BXX3	AN30A_HUMAN	T	1030;1149	ENSP00000354432:N1030T;ENSP00000363792:N1149T	ENSP00000354432:N1030T	N	+	2	0	ANKRD30A	37546802	0.002000	0.14202	0.001000	0.08648	0.017000	0.09413	1.231000	0.32624	0.207000	0.20607	0.392000	0.25879	AAT	ANKRD30A	-	NULL	ENSG00000148513		0.284	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	-	0.00	79	0	A	NM_052997		37506796	+1	tier1	-	no_errors	ENST00000361713	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.006	C
ARHGAP15	55843	genome.wustl.edu	37	2	144525735	144525735	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:144525735A>C	ENST00000295095.6	+	14	1589	c.1422A>C	c.(1420-1422)gaA>gaC	p.E474D	CTD-2252P21.1_ENST00000548756.1_RNA	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	474					positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		GCTCAGAGGAAGACTGACAGA	0.393																																																	0													103.0	87.0	92.0					2																	144525735		2203	4300	6503	SO:0001583	missense	0			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.1422A>C	2.37:g.144525735A>C	ENSP00000295095:p.Glu474Asp		Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.E474D	ENST00000295095.6	37	c.1422	CCDS2184.1	2	.	.	.	.	.	.	.	.	.	.	A	16.71	3.198987	0.58126	.	.	ENSG00000075884	ENST00000295095	T	0.09350	2.99	5.6	5.6	0.85130	Rho GTPase activation protein (1);	0.311190	0.34460	N	0.003957	T	0.11410	0.0278	L	0.39245	1.2	0.39721	D	0.971467	B	0.28128	0.201	B	0.24155	0.051	T	0.07888	-1.0749	10	0.38643	T	0.18	.	16.0901	0.81086	1.0:0.0:0.0:0.0	.	474	Q53QZ3	RHG15_HUMAN	D	474	ENSP00000295095:E474D	ENSP00000295095:E474D	E	+	3	2	ARHGAP15	144242205	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	6.335000	0.72949	2.260000	0.74910	0.533000	0.62120	GAA	ARHGAP15	-	superfamily_Rho_GTPase_activation_prot	ENSG00000075884		0.393	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP15	HGNC	protein_coding	OTTHUMT00000254793.2	-	0.00	63	0	A	NM_018460		144525735	+1	tier1	-	no_errors	ENST00000295095	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	C
ARHGAP6	395	genome.wustl.edu	37	X	11682517	11682517	+	Silent	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chrX:11682517G>A	ENST00000337414.4	-	1	1304	c.432C>T	c.(430-432)gcC>gcT	p.A144A	ARHGAP6_ENST00000380732.3_Silent_p.A144A|ARHGAP6_ENST00000380718.1_Silent_p.A144A	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	144					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TGGCTGGCCCGGCCAGGACAG	0.617																																																	0													20.0	22.0	22.0					X																	11682517		2201	4300	6501	SO:0001819	synonymous_variant	0			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.432C>T	X.37:g.11682517G>A			B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.A144	ENST00000337414.4	37	c.432	CCDS14140.1	X																																																																																			ARHGAP6	-	NULL	ENSG00000047648		0.617	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	HGNC	protein_coding	OTTHUMT00000055760.2	-	0.00	90	0	G	NM_013427		11682517	-1	tier1	-	no_errors	ENST00000337414	ensembl	human	known	74_37	silent	6.02	77	5	SNP	0.031	A
ARMC6	93436	genome.wustl.edu	37	19	19166105	19166105	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr19:19166105G>A	ENST00000535612.1	+	7	1487	c.1055G>A	c.(1054-1056)cGa>cAa	p.R352Q	ARMC6_ENST00000269932.6_Missense_Mutation_p.R327Q|ARMC6_ENST00000392335.2_Missense_Mutation_p.R327Q|ARMC6_ENST00000546344.1_Missense_Mutation_p.R259Q|ARMC6_ENST00000392336.3_Missense_Mutation_p.R352Q	NM_001199196.1	NP_001186125.1	Q6NXE6	ARMC6_HUMAN	armadillo repeat containing 6	352					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(5)|ovary(1)|prostate(1)	14			OV - Ovarian serous cystadenocarcinoma(5;5.66e-06)|Epithelial(12;0.000391)			AGCACCCTGCGAGCCATCGCA	0.622																																																	0													105.0	88.0	94.0					19																	19166105		2203	4300	6503	SO:0001583	missense	0			BX648486	CCDS32965.1, CCDS56089.1	19p13	2013-02-14				ENSG00000105676		"""Armadillo repeat containing"""	25049	protein-coding gene	gene with protein product						12477932	Standard	NM_033415		Approved	MGC19595	uc002nlc.3	Q6NXE6		ENST00000535612.1:c.1055G>A	19.37:g.19166105G>A	ENSP00000444156:p.Arg352Gln		B4DI98|O94999|Q9BTH5	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.R352Q	ENST00000535612.1	37	c.1055	CCDS56089.1	19	.	.	.	.	.	.	.	.	.	.	G	34	5.360398	0.95877	.	.	ENSG00000105676	ENST00000392335;ENST00000535612;ENST00000269932;ENST00000546344;ENST00000379532;ENST00000392336	T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83	4.88	4.88	0.63580	Armadillo-like helical (1);Armadillo-type fold (1);	0.067487	0.56097	D	0.000028	T	0.63943	0.2554	M	0.72894	2.215	0.58432	D	0.999996	D	0.76494	0.999	P	0.59948	0.866	T	0.63152	-0.6701	10	0.32370	T	0.25	-36.3466	17.0086	0.86400	0.0:0.0:1.0:0.0	.	352	Q6NXE6	ARMC6_HUMAN	Q	327;352;327;259;263;352	ENSP00000376147:R327Q;ENSP00000444156:R352Q;ENSP00000269932:R327Q;ENSP00000444341:R259Q;ENSP00000376148:R352Q	ENSP00000269932:R327Q	R	+	2	0	ARMC6	19027105	0.992000	0.36948	0.996000	0.52242	0.859000	0.49053	5.255000	0.65462	2.271000	0.75665	0.563000	0.77884	CGA	ARMC6	-	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	ENSG00000105676		0.622	ARMC6-001	KNOWN	basic|CCDS	protein_coding	ARMC6	HGNC	protein_coding	OTTHUMT00000403226.1		0.00	78	0	G	NM_033415		19166105	+1			no_errors	ENST00000392336	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	A
BICC1	80114	genome.wustl.edu	37	10	60573753	60573753	+	Intron	SNP	G	G	A	rs9416746	byFrequency	TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr10:60573753G>A	ENST00000373886.3	+	18	2537				BICC1_ENST00000263103.1_Missense_Mutation_p.R473H	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1						multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						TCAAGTGAGCGTTGTGTTTTA	0.428																																																	0													119.0	110.0	113.0					10																	60573753		2203	4300	6503	SO:0001627	intron_variant	0			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.2533+7G>A	10.37:g.60573753G>A				Missense_Mutation	SNP	NULL	p.R473H	ENST00000373886.3	37	c.1418	CCDS31206.1	10	.	.	.	.	.	.	.	.	.	.	T	15.86	2.956719	0.53293	.	.	ENSG00000122870	ENST00000263103	T	0.40756	1.02	5.56	4.42	0.53409	.	.	.	.	.	T	0.24044	0.0582	.	.	.	0.80722	P	0.0	B	0.33904	0.431	B	0.24974	0.057	T	0.25398	-1.0133	6	.	.	.	.	5.9592	0.19291	0.0:0.0849:0.1658:0.7494	.	767	E7EU62	.	H	473	ENSP00000263103:R473H	.	R	+	2	0	BICC1	60243759	0.993000	0.37304	0.867000	0.34043	0.221000	0.24807	0.094000	0.15107	0.399000	0.25367	-0.256000	0.11100	CGT	BICC1	-	NULL	ENSG00000122870		0.428	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	HGNC	protein_coding	OTTHUMT00000048150.2	-	0.00	126	0	G	NM_025044		60573753	+1	tier1	-	no_errors	ENST00000263103	ensembl	human	known	74_37	missense	8.70	84	8	SNP	0.108	A
ERICH3	127254	genome.wustl.edu	37	1	75038472	75038472	+	Silent	SNP	A	A	G			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:75038472A>G	ENST00000326665.5	-	14	3140	c.2922T>C	c.(2920-2922)atT>atC	p.I974I	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		974	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CTCCCCCAAGAATTGCCTCTT	0.522																																																	0													131.0	120.0	124.0					1																	75038472		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000326665.5:c.2922T>C	1.37:g.75038472A>G			Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	NULL	p.I974	ENST00000326665.5	37	c.2922	CCDS30755.1	1																																																																																			C1orf173	-	NULL	ENSG00000178965		0.522	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	-	0.00	56	0	A			75038472	-1	tier1	-	no_errors	ENST00000326665	ensembl	human	known	74_37	silent	10.34	52	6	SNP	0.000	G
ERICH3	127254	genome.wustl.edu	37	1	75086434	75086434	+	Silent	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:75086434G>T	ENST00000326665.5	-	8	1202	c.984C>A	c.(982-984)ggC>ggA	p.G328G	RP4-612J11.1_ENST00000416017.1_RNA|C1orf173_ENST00000420661.2_Silent_p.G131G	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		328										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CAAGTAGTTTGCCTTTGTAGA	0.348																																																	0													106.0	102.0	103.0					1																	75086434		2203	4300	6503	SO:0001819	synonymous_variant	0																														ENST00000326665.5:c.984C>A	1.37:g.75086434G>T			Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	NULL	p.G328	ENST00000326665.5	37	c.984	CCDS30755.1	1																																																																																			C1orf173	-	NULL	ENSG00000178965		0.348	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1		0.00	41	0	G			75086434	-1			no_errors	ENST00000326665	ensembl	human	known	74_37	silent	6.12	46	3	SNP	0.998	T
C2CD3	26005	genome.wustl.edu	37	11	73829364	73829364	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr11:73829364delT	ENST00000334126.7	-	9	1655	c.1429delA	c.(1429-1431)atafs	p.I477fs	C2CD3_ENST00000313663.7_Frame_Shift_Del_p.I477fs			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3	477					brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					GACTGGCTTATTTTTTTAGAA	0.433																																																	0													119.0	112.0	115.0					11																	73829364		2200	4293	6493	SO:0001589	frameshift_variant	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.1429delA	11.37:g.73829364delT	ENSP00000334379:p.Ile477fs		C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	Frame_Shift_Del	DEL	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom	p.I477fs	ENST00000334126.7	37	c.1429		11																																																																																			C2CD3	-	NULL	ENSG00000168014		0.433	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding			0.00	37	0	T	NM_015531		73829364	-1	tier1		no_errors	ENST00000334126	ensembl	human	known	74_37	frame_shift_del	6.06	31	2	DEL	0.966	-
CCDC50	152137	genome.wustl.edu	37	3	191092969	191092969	+	Intron	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr3:191092969G>T	ENST00000392455.3	+	6	1046				CCDC50_ENST00000392456.3_Missense_Mutation_p.E189D	NM_174908.3	NP_777568.1	Q8IVM0	CCD50_HUMAN	coiled-coil domain containing 50							cytoplasm (GO:0005737)	ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|stomach(1)	23	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		ATCCACTGGAGAACTTGGAAG	0.478																																																	0													94.0	85.0	88.0					3																	191092969		2203	4300	6503	SO:0001627	intron_variant	0			AJ416916	CCDS33912.1, CCDS33913.1	3q28	2010-12-24		2005-12-23	ENSG00000152492	ENSG00000152492			18111	protein-coding gene	gene with protein product		611051	"""deafness, autosomal dominant 44"""	C3orf6, DFNA44		16803894, 17503326	Standard	NM_178335		Approved	Ymer	uc003fsv.3	Q8IVM0	OTTHUMG00000156177	ENST00000392455.3:c.449-4979G>T	3.37:g.191092969G>T			Q86VH7	Missense_Mutation	SNP	NULL	p.E189D	ENST00000392455.3	37	c.567	CCDS33913.1	3	.	.	.	.	.	.	.	.	.	.	G	4.541	0.100412	0.08731	.	.	ENSG00000152492	ENST00000392456	T	0.33654	1.4	5.65	3.78	0.43462	.	0.403983	0.24370	N	0.039115	T	0.19167	0.0460	.	.	.	0.23381	N	0.997792	B	0.11235	0.004	B	0.12156	0.007	T	0.16512	-1.0400	9	0.17369	T	0.5	.	7.2551	0.26171	0.0912:0.0:0.7177:0.191	.	189	Q8IVM0-2	.	D	189	ENSP00000376250:E189D	ENSP00000376250:E189D	E	+	3	2	CCDC50	192575663	0.833000	0.29383	0.895000	0.35142	0.090000	0.18270	0.887000	0.28254	1.458000	0.47871	0.650000	0.86243	GAG	CCDC50	-	NULL	ENSG00000152492		0.478	CCDC50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC50	HGNC	protein_coding	OTTHUMT00000343315.1		0.00	43	0	G	NM_174908		191092969	+1			no_errors	ENST00000392456	ensembl	human	known	74_37	missense	5.36	53	3	SNP	0.562	T
CD160	11126	genome.wustl.edu	37	1	145698977	145698977	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:145698977C>G	ENST00000369288.2	-	5	731	c.514G>C	c.(514-516)Gtc>Ctc	p.V172L	CD160_ENST00000369290.1_Missense_Mutation_p.V63L|CD160_ENST00000235933.6_Missense_Mutation_p.V172L|CD160_ENST00000401557.3_Missense_Mutation_p.V172L	NM_007053.2	NP_008984.1	O95971	BY55_HUMAN	CD160 molecule	172					cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|defense response to Gram-negative bacterium (GO:0050829)|regulation of immune response (GO:0050776)	anchored component of plasma membrane (GO:0046658)|plasma membrane (GO:0005886)	MHC class I receptor activity (GO:0032393)|receptor activity (GO:0004872)|receptor binding (GO:0005102)			endometrium(3)|large_intestine(2)|lung(2)	7	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			AGGCTGGTGACCAGCATTACC	0.478																																					Colon(182;1122 1999 4065 44014 53024)												0													147.0	117.0	127.0					1																	145698977		2203	4300	6503	SO:0001583	missense	0			AF060981	CCDS72861.1	1q21.2	2011-01-25	2006-03-28		ENSG00000117281	ENSG00000117281		"""CD molecules"""	17013	protein-coding gene	gene with protein product		604463	"""CD160 antigen"""			9743336, 9973372	Standard	NM_007053		Approved	BY55, NK1, NK28	uc001eol.1	O95971	OTTHUMG00000013749	ENST00000369288.2:c.514G>C	1.37:g.145698977C>G	ENSP00000358294:p.Val172Leu			Missense_Mutation	SNP	NULL	p.V172L	ENST00000369288.2	37	c.514	CCDS923.1	1	.	.	.	.	.	.	.	.	.	.	C	14.28	2.489606	0.44249	.	.	ENSG00000117281	ENST00000235933;ENST00000369288;ENST00000369290;ENST00000401557	T;T;T	0.52057	0.68;0.68;0.68	4.6	0.389	0.16269	.	0.985840	0.08226	N	0.978301	T	0.14270	0.0345	L	0.29908	0.895	0.24516	N	0.994184	B;B	0.17667	0.023;0.008	B;B	0.17722	0.019;0.009	T	0.34054	-0.9844	10	0.87932	D	0	-0.1941	3.3347	0.07097	0.1606:0.3839:0.3594:0.096	.	63;172	Q5T2V6;O95971	.;BY55_HUMAN	L	172;172;63;172	ENSP00000235933:V172L;ENSP00000358294:V172L;ENSP00000385199:V172L	ENSP00000235933:V172L	V	-	1	0	CD160	144410334	0.105000	0.21958	0.959000	0.39883	0.991000	0.79684	-0.150000	0.10189	-0.014000	0.14175	0.655000	0.94253	GTC	CD160	-	NULL	ENSG00000117281		0.478	CD160-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CD160	HGNC	protein_coding	OTTHUMT00000038532.2	-	0.00	102	0	C	NM_007053		145698977	-1	tier1	-	no_errors	ENST00000235933	ensembl	human	known	74_37	missense	7.14	117	9	SNP	0.947	G
CD28	940	genome.wustl.edu	37	2	204591394	204591394	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:204591394G>T	ENST00000324106.8	+	2	240	c.91G>T	c.(91-93)Gcg>Tcg	p.A31S	CD28_ENST00000374481.3_Missense_Mutation_p.A31S|CD28_ENST00000374478.4_Intron|CD28_ENST00000458610.2_Missense_Mutation_p.A45S	NM_001243077.1|NM_006139.3	NP_001230006.1|NP_006130.1	P10747	CD28_HUMAN	CD28 molecule	31	Ig-like V-type.				apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|cytokine biosynthetic process (GO:0042089)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|negative thymic T cell selection (GO:0045060)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of inflammatory response to antigenic stimulus (GO:0002863)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of mitosis (GO:0045840)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of translation (GO:0045727)|positive regulation of viral genome replication (GO:0045070)|regulation of defense response to virus by virus (GO:0050690)|regulatory T cell differentiation (GO:0045066)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	13						CATGCTTGTAGCGTACGACAA	0.433																																																	0													96.0	90.0	92.0					2																	204591394		2203	4300	6503	SO:0001583	missense	0			J02988	CCDS2361.1, CCDS58749.1	2q33	2013-01-11	2006-03-28		ENSG00000178562	ENSG00000178562		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1653	protein-coding gene	gene with protein product	"""T-cell-specific surface glycoprotein"""	186760	"""CD28 antigen (Tp44)"""			1355979	Standard	NM_006139		Approved		uc002vah.4	P10747	OTTHUMG00000132878	ENST00000324106.8:c.91G>T	2.37:g.204591394G>T	ENSP00000324890:p.Ala31Ser		A8KAC1|Q13964|Q52M23|Q70WG0|Q8NI54|Q8NI55|Q8NI56|Q8WXJ2|Q9BYV0	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,prints_CD28	p.A31S	ENST00000324106.8	37	c.91	CCDS2361.1	2	.	.	.	.	.	.	.	.	.	.	G	12.86	2.063992	0.36373	.	.	ENSG00000178562	ENST00000374481;ENST00000458610;ENST00000324106	T;T;T	0.79352	-1.26;-0.2;-0.2	5.78	3.0	0.34707	Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.643200	0.14942	N	0.289435	T	0.77370	0.4120	L	0.52126	1.63	0.22541	N	0.999001	B	0.33318	0.408	P	0.46452	0.517	T	0.64445	-0.6406	10	0.20046	T	0.44	-22.9165	9.8745	0.41195	0.2062:0.0:0.7938:0.0	.	31	P10747	CD28_HUMAN	S	31;45;31	ENSP00000363605:A31S;ENSP00000393648:A45S;ENSP00000324890:A31S	ENSP00000324890:A31S	A	+	1	0	CD28	204299639	0.029000	0.19370	0.517000	0.27799	0.064000	0.16182	1.867000	0.39499	0.802000	0.34089	0.561000	0.74099	GCG	CD28	-	pfam_Ig_V-set	ENSG00000178562		0.433	CD28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD28	HGNC	protein_coding	OTTHUMT00000256366.3	-	0.00	93	0	G	NM_006139		204591394	+1	tier1	-	no_errors	ENST00000324106	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.281	T
CHD9	80205	genome.wustl.edu	37	16	53279275	53279275	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr16:53279275C>T	ENST00000398510.3	+	13	3169	c.3082C>T	c.(3082-3084)Cct>Tct	p.P1028S	CHD9_ENST00000564845.1_Missense_Mutation_p.P1028S|CHD9_ENST00000447540.1_Missense_Mutation_p.P1028S|CHD9_ENST00000566029.1_Missense_Mutation_p.P1028S			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1028	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				GACTGGCACCCCTCTCCAAAA	0.358																																																	0													70.0	63.0	65.0					16																	53279275		1835	4090	5925	SO:0001583	missense	0			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.3082C>T	16.37:g.53279275C>T	ENSP00000381522:p.Pro1028Ser		B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P1028S	ENST00000398510.3	37	c.3082		16	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812443	0.90707	.	.	ENSG00000177200	ENST00000447540;ENST00000398510;ENST00000219084	D;D	0.99766	-6.69;-6.69	5.22	5.22	0.72569	DEAD-like helicase (2);SNF2-related (1);	0.000000	0.53938	D	0.000042	D	0.99900	0.9952	H	0.99347	4.525	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.998	D	0.96092	0.9062	10	0.87932	D	0	-17.5163	19.1419	0.93449	0.0:1.0:0.0:0.0	.	554;1028;1028;1028	B4DR07;Q3L8U1-3;Q3L8U1;Q3L8U1-2	.;.;CHD9_HUMAN;.	S	1028;1028;554	ENSP00000396345:P1028S;ENSP00000381522:P1028S	ENSP00000219084:P554S	P	+	1	0	CHD9	51836776	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.767000	0.85331	2.566000	0.86566	0.655000	0.94253	CCT	CHD9	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000177200		0.358	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1		0.00	82	0	C	NM_025134		53279275	+1			no_errors	ENST00000398510	ensembl	human	known	74_37	missense	5.45	52	3	SNP	1.000	T
CPEB4	80315	genome.wustl.edu	37	5	173317497	173317497	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr5:173317497C>T	ENST00000265085.5	+	1	2215	c.761C>T	c.(760-762)gCc>gTc	p.A254V	CPEB4_ENST00000519835.1_Missense_Mutation_p.A254V|CPEB4_ENST00000334035.5_Missense_Mutation_p.A254V|CPEB4_ENST00000522336.1_5'Flank|CPEB4_ENST00000517880.1_5'Flank|CPEB4_ENST00000520867.1_Missense_Mutation_p.A254V	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	254					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			AGGTCTCCTGCCAGTCCCCAT	0.542																																																	0													125.0	139.0	134.0					5																	173317497		2203	4300	6503	SO:0001583	missense	0			BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.761C>T	5.37:g.173317497C>T	ENSP00000265085:p.Ala254Val		B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A254V	ENST00000265085.5	37	c.761	CCDS4390.1	5	.	.	.	.	.	.	.	.	.	.	C	15.27	2.783253	0.49891	.	.	ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.43322	0.1242	L	0.33485	1.01	0.80722	D	1	B;P;P;P	0.41475	0.266;0.598;0.751;0.751	B;B;B;B	0.42692	0.194;0.355;0.395;0.395	T	0.16453	-1.0402	10	0.20519	T	0.43	-9.5248	19.0156	0.92892	0.0:1.0:0.0:0.0	.	254;254;254;254	B7ZLQ8;Q17RY0-2;E5RJM0;Q17RY0	.;.;.;CPEB4_HUMAN	V	254	ENSP00000265085:A254V;ENSP00000429092:A254V;ENSP00000334533:A254V;ENSP00000429048:A254V	ENSP00000265085:A254V	A	+	2	0	CPEB4	173250103	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.071000	0.71229	2.496000	0.84212	0.557000	0.71058	GCC	CPEB4	-	NULL	ENSG00000113742		0.542	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPEB4	HGNC	protein_coding	OTTHUMT00000252964.2		0.00	45	0	C	NM_030627		173317497	+1			no_errors	ENST00000265085	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
CPO	130749	genome.wustl.edu	37	2	207814400	207814400	+	Missense_Mutation	SNP	A	A	G	rs551716635		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:207814400A>G	ENST00000272852.3	+	2	174	c.128A>G	c.(127-129)gAg>gGg	p.E43G		NM_173077.2	NP_775100.1	Q8IVL8	CBPO_HUMAN	carboxypeptidase O	43						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	14				LUSC - Lung squamous cell carcinoma(261;0.0744)|Epithelial(149;0.0807)|Lung(261;0.142)		TGGAGCCTGGAGACGTATTCC	0.478													A|||	1	0.000199681	0.0008	0.0	5008	,	,		19104	0.0		0.0	False		,,,				2504	0.0																0													144.0	124.0	131.0					2																	207814400		2203	4300	6503	SO:0001583	missense	0				CCDS2372.1	2q34	2012-02-10			ENSG00000144410	ENSG00000144410			21011	protein-coding gene	gene with protein product	"""metallocarboxypeptidase O"", ""metallocarboxypeptidase C"""	609563				11836249	Standard	NM_173077		Approved		uc002vby.2	Q8IVL8	OTTHUMG00000088987	ENST00000272852.3:c.128A>G	2.37:g.207814400A>G	ENSP00000272852:p.Glu43Gly		Q2M277|Q7RTW7	Missense_Mutation	SNP	pfam_Peptidase_M14,smart_Peptidase_M14,prints_Peptidase_M14	p.E43G	ENST00000272852.3	37	c.128	CCDS2372.1	2	.	.	.	.	.	.	.	.	.	.	A	17.04	3.287889	0.59976	.	.	ENSG00000144410	ENST00000272852	T	0.15256	2.44	4.32	4.32	0.51571	.	0.310004	0.27004	N	0.021415	T	0.11110	0.0271	N	0.19112	0.55	0.26264	N	0.978521	B	0.06786	0.001	B	0.04013	0.001	T	0.16837	-1.0389	10	0.28530	T	0.3	.	11.7374	0.51773	1.0:0.0:0.0:0.0	.	43	Q8IVL8	CBPO_HUMAN	G	43	ENSP00000272852:E43G	ENSP00000272852:E43G	E	+	2	0	CPO	207522645	0.137000	0.22531	0.935000	0.37517	0.728000	0.41692	1.292000	0.33342	1.946000	0.56461	0.374000	0.22700	GAG	CPO	-	NULL	ENSG00000144410		0.478	CPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPO	HGNC	protein_coding	OTTHUMT00000202040.2	-	0.00	85	0	A	NM_173077		207814400	+1	tier1	-	no_errors	ENST00000272852	ensembl	human	known	74_37	missense	5.95	79	5	SNP	0.984	G
CSMD3	114788	genome.wustl.edu	37	8	113504850	113504850	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr8:113504850C>T	ENST00000297405.5	-	31	5390	c.5146G>A	c.(5146-5148)Gat>Aat	p.D1716N	CSMD3_ENST00000343508.3_Missense_Mutation_p.D1676N|CSMD3_ENST00000455883.2_Missense_Mutation_p.D1612N|CSMD3_ENST00000352409.3_Missense_Mutation_p.D1716N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1716	Sushi 9. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AATTTATAATCCATTCCAAGT	0.383										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													171.0	153.0	159.0					8																	113504850		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5146G>A	8.37:g.113504850C>T	ENSP00000297405:p.Asp1716Asn		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.D1716N	ENST00000297405.5	37	c.5146	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	31	5.088240	0.94100	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85	4.9	4.9	0.64082	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.40595	0.1123	L	0.31065	0.9	0.45129	D	0.998143	D;D;D	0.71674	0.997;0.997;0.998	D;D;D	0.75484	0.947;0.969;0.986	T	0.14531	-1.0469	10	0.44086	T	0.13	.	18.6241	0.91331	0.0:1.0:0.0:0.0	.	1612;1716;1676	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	N	1676;1716;1056;1612;1716	ENSP00000345799:D1676N;ENSP00000297405:D1716N;ENSP00000341558:D1056N;ENSP00000412263:D1612N;ENSP00000343124:D1716N	ENSP00000297405:D1716N	D	-	1	0	CSMD3	113574026	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.493000	0.81493	2.704000	0.92352	0.585000	0.79938	GAT	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.383	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	72	0	C	NM_052900		113504850	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
CUL7	9820	genome.wustl.edu	37	6	43013045	43013045	+	Silent	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr6:43013045G>T	ENST00000265348.3	-	15	3043	c.2958C>A	c.(2956-2958)cgC>cgA	p.R986R	CUL7_ENST00000535468.1_Silent_p.R1070R|CUL7_ENST00000478630.1_5'Flank			Q14999	CUL7_HUMAN	cullin 7	986	DOC. {ECO:0000255|PROSITE- ProRule:PRU00614}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|epithelial to mesenchymal transition (GO:0001837)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|mitotic cytokinesis (GO:0000281)|placenta development (GO:0001890)|positive regulation of dendrite morphogenesis (GO:0050775)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	3M complex (GO:1990393)|anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|Cul7-RING ubiquitin ligase complex (GO:0031467)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(8)|liver(1)|lung(11)|ovary(3)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	49			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			TGTAGAAGAGGCGTGTGTGAC	0.602																																																	0													141.0	124.0	129.0					6																	43013045		2203	4300	6503	SO:0001819	synonymous_variant	0			BC033647	CCDS4881.1, CCDS55003.1	6p21.1	2011-05-24	2004-03-22	2004-03-22	ENSG00000044090	ENSG00000044090			21024	protein-coding gene	gene with protein product		609577	"""KIAA0076"""	KIAA0076		12481031, 12904573	Standard	NM_014780		Approved	dJ20C7.5	uc011dvb.2	Q14999	OTTHUMG00000014718	ENST00000265348.3:c.2958C>A	6.37:g.43013045G>T			B4DYZ0|F5H0L1|Q5T654	Silent	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.R1070	ENST00000265348.3	37	c.3210	CCDS4881.1	6																																																																																			CUL7	-	NULL	ENSG00000044090		0.602	CUL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL7	HGNC	protein_coding	OTTHUMT00000040575.1	-	0.00	36	0	G	NM_014780		43013045	-1	tier1	-	no_errors	ENST00000535468	ensembl	human	known	74_37	silent	11.76	30	4	SNP	0.999	T
DCT	1638	genome.wustl.edu	37	13	95118847	95118847	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr13:95118847G>A	ENST00000377028.5	-	3	1074	c.661C>T	c.(661-663)Cgg>Tgg	p.R221W	DCT_ENST00000446125.1_Missense_Mutation_p.R221W|AL139318.1_ENST00000390768.1_RNA|DCT_ENST00000490854.1_5'UTR	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	221					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		AAATGGTACCGGTGCCAGGTA	0.383																																																	0													65.0	67.0	66.0					13																	95118847		2203	4300	6503	SO:0001583	missense	0			D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.661C>T	13.37:g.95118847G>A	ENSP00000366227:p.Arg221Trp		Q09GT4	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.R221W	ENST00000377028.5	37	c.661	CCDS9470.1	13	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459048	0.63401	.	.	ENSG00000080166	ENST00000377028;ENST00000446125	D;D	0.99930	-8.15;-8.15	5.64	1.23	0.21249	Tyrosinase (3);Uncharacterised domain, di-copper centre (2);	0.045100	0.85682	D	0.000000	D	0.99937	0.9972	H	0.96365	3.81	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96383	0.9283	10	0.87932	D	0	-24.1295	16.4493	0.83974	0.0:0.0:0.4685:0.5315	.	221;221	Q09GT4;P40126	.;TYRP2_HUMAN	W	221	ENSP00000366227:R221W;ENSP00000392762:R221W	ENSP00000366227:R221W	R	-	1	2	DCT	93916848	1.000000	0.71417	0.997000	0.53966	0.977000	0.68977	0.464000	0.21988	0.016000	0.14998	-1.367000	0.01198	CGG	DCT	-	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	ENSG00000080166		0.383	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCT	HGNC	protein_coding	OTTHUMT00000045461.3	-	0.00	78	0	G			95118847	-1	tier1	-	no_errors	ENST00000446125	ensembl	human	known	74_37	missense	5.43	86	5	SNP	0.992	A
DERA	51071	genome.wustl.edu	37	12	16109898	16109898	+	Silent	SNP	G	G	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr12:16109898G>C	ENST00000428559.2	+	2	272	c.60G>C	c.(58-60)gtG>gtC	p.V20V	DERA_ENST00000532964.1_Silent_p.V20V|DERA_ENST00000526530.1_5'UTR	NM_015954.2	NP_057038.2	Q9Y315	DEOC_HUMAN	deoxyribose-phosphate aldolase (putative)	20					deoxyribonucleoside catabolic process (GO:0046121)|deoxyribonucleotide catabolic process (GO:0009264)|deoxyribose phosphate catabolic process (GO:0046386)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	deoxyribose-phosphate aldolase activity (GO:0004139)			endometrium(1)|large_intestine(2)|lung(3)|skin(1)	7		Hepatocellular(102;0.121)				AAATACAAGTGAATCACCCGG	0.433																																																	0													72.0	71.0	71.0					12																	16109898		1863	4092	5955	SO:0001819	synonymous_variant	0			AF132960	CCDS44838.1, CCDS73451.1	12p12.3	2010-06-24	2010-06-24		ENSG00000023697	ENSG00000023697	4.1.2.4		24269	protein-coding gene	gene with protein product			"""2-deoxyribose-5-phosphate aldolase homolog (C. elegans)"""			12546782	Standard	XM_006719083		Approved	CGI-26, DEOC	uc001rde.3	Q9Y315	OTTHUMG00000165537	ENST00000428559.2:c.60G>C	12.37:g.16109898G>C			Q53HN9|Q6PHW2	Silent	SNP	pfam_DeoC/FbaB/lacD_aldolase,pirsf_DeoC,tigrfam_DeoC	p.V20	ENST00000428559.2	37	c.60	CCDS44838.1	12																																																																																			DERA	-	NULL	ENSG00000023697		0.433	DERA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DERA	HGNC	protein_coding	OTTHUMT00000384731.1	-	0.00	62	0	G	NM_015954		16109898	+1	tier1	-	no_errors	ENST00000428559	ensembl	human	known	74_37	silent	11.11	32	4	SNP	1.000	C
DHX57	90957	genome.wustl.edu	37	2	39085815	39085815	+	Missense_Mutation	SNP	G	G	T	rs150452250		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:39085815G>T	ENST00000295373.6	-	6	1701	c.1575C>A	c.(1573-1575)ttC>ttA	p.F525L	DHX57_ENST00000479345.2_5'UTR	NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	525							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.F525F(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				GTTTCATTCGGAACTGCTTGC	0.413																																					Melanoma(191;1090 2095 4375 23729 47341)												1	Substitution - coding silent(1)	skin(1)											218.0	203.0	208.0					2																	39085815		2203	4300	6503	SO:0001583	missense	0			AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.1575C>A	2.37:g.39085815G>T	ENSP00000295373:p.Phe525Leu		A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	Missense_Mutation	SNP	pfam_RWD-domain,pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Znf_CCCH,superfamily_P-loop_NTPase,superfamily_UBA-like,superfamily_UBQ-conjugating_enzyme/RWD,smart_Znf_CCCH,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.F525L	ENST00000295373.6	37	c.1575	CCDS1800.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.169066	0.78339	.	.	ENSG00000163214	ENST00000295373;ENST00000355320	T	0.09817	2.94	5.7	2.5	0.30297	.	0.116878	0.38217	N	0.001766	T	0.12263	0.0298	L	0.29908	0.895	0.47659	D	0.999488	D;P	0.63880	0.993;0.696	P;B	0.54346	0.749;0.168	T	0.15492	-1.0435	10	0.21540	T	0.41	.	9.382	0.38320	0.3381:0.0:0.6619:0.0	.	525;525	Q6P158-2;Q6P158	.;DHX57_HUMAN	L	525;423	ENSP00000295373:F525L	ENSP00000295373:F525L	F	-	3	2	DHX57	38939319	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.269000	0.51592	0.738000	0.32606	0.655000	0.94253	TTC	DHX57	-	NULL	ENSG00000163214		0.413	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX57	HGNC	protein_coding	OTTHUMT00000219940.2	-	0.00	45	0	G	NM_145646		39085815	-1	tier1	-	no_errors	ENST00000295373	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.956	T
DLG4	1742	genome.wustl.edu	37	17	7106648	7106648	+	Splice_Site	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr17:7106648C>T	ENST00000399506.2	-	7	697	c.506G>A	c.(505-507)gGt>gAt	p.G169D	DLG4_ENST00000399510.2_Splice_Site_p.G212D|DLG4_ENST00000485100.1_Splice_Site_p.G166D|DLG4_ENST00000302955.6_Splice_Site_p.G166D			P78352	DLG4_HUMAN	discs, large homolog 4 (Drosophila)	169	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|axon guidance (GO:0007411)|dendritic spine morphogenesis (GO:0060997)|establishment of protein localization (GO:0045184)|learning (GO:0007612)|locomotory exploration behavior (GO:0035641)|negative regulation of receptor internalization (GO:0002091)|nervous system development (GO:0007399)|neuromuscular process controlling balance (GO:0050885)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synaptic transmission (GO:0050806)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|receptor localization to synapse (GO:0097120)|regulation of grooming behavior (GO:2000821)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|signal transduction (GO:0007165)|social behavior (GO:0035176)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vocalization behavior (GO:0071625)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|juxtaparanode region of axon (GO:0044224)|neuron projection terminus (GO:0044306)|neuron spine (GO:0044309)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	acetylcholine receptor binding (GO:0033130)|beta-1 adrenergic receptor binding (GO:0031697)|D1 dopamine receptor binding (GO:0031748)|ionotropic glutamate receptor binding (GO:0035255)|P2Y1 nucleotide receptor binding (GO:0031812)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein phosphatase binding (GO:0019903)|scaffold protein binding (GO:0097110)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)	18					Guanidine(DB00536)	GAAGCCAAGACCTGGATGGAG	0.562																																																	0													52.0	52.0	52.0					17																	7106648		1994	4178	6172	SO:0001630	splice_region_variant	0			U83192	CCDS45599.1, CCDS45600.1	17p13.1	2008-12-15	2001-12-04		ENSG00000132535	ENSG00000132535			2903	protein-coding gene	gene with protein product		602887				9286702	Standard	NM_001128827		Approved	PSD-95, PSD95, SAP90, SAP-90	uc010cly.3	P78352	OTTHUMG00000134327	ENST00000399506.2:c.506-1G>A	17.37:g.7106648C>T			B7Z1S1|G5E939|Q92941|Q9UKK8	Missense_Mutation	SNP	pirsf_M-assoc_guanylate_kinase,pfam_GK/Ca_channel_bsu,pfam_PDZ,pfam_PDZ_assoc,pfam_MAGUK_PEST_N,pfam_SH3_domain,pfam_SH3_2,pfam_L27_1,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.G212D	ENST00000399506.2	37	c.635		17	.	.	.	.	.	.	.	.	.	.	c	17.34	3.365591	0.61513	.	.	ENSG00000132535	ENST00000399506;ENST00000302955;ENST00000399510;ENST00000293813;ENST00000380912;ENST00000539674;ENST00000451807;ENST00000447163	T;T;T;T	0.53206	0.63;0.63;0.63;1.79	4.99	4.03	0.46877	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.73337	0.3574	M	0.92026	3.265	0.80722	D	1	B;B;D;D;D	0.89917	0.327;0.372;1.0;1.0;1.0	B;B;D;D;D	0.97110	0.373;0.386;1.0;1.0;1.0	T	0.78404	-0.2217	9	0.51188	T	0.08	.	13.3412	0.60545	0.0:0.84:0.16:0.0	.	209;169;166;166;212	B9EGL1;P78352;G5E939;O14909;P78352-2	.;DLG4_HUMAN;.;.;.	D	169;166;212;212;109;212;202;199	ENSP00000382425:G169D;ENSP00000307471:G166D;ENSP00000382428:G212D;ENSP00000388122:G199D	ENSP00000293813:G212D	G	-	2	0	DLG4	7047372	1.000000	0.71417	0.992000	0.48379	0.692000	0.40212	5.785000	0.68998	1.115000	0.41800	-0.224000	0.12420	GGT	DLG4	-	pirsf_M-assoc_guanylate_kinase,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000132535		0.562	DLG4-002	KNOWN	non_canonical_TEC|not_organism_supported|basic|appris_candidate_longest	protein_coding	DLG4	HGNC	protein_coding	OTTHUMT00000259419.2	-	0.00	60	0	C	NM_001365	Missense_Mutation	7106648	-1	tier1	-	no_errors	ENST00000399510	ensembl	human	known	74_37	missense	9.26	49	5	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	21136659	21136659	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr16:21136659G>T	ENST00000261383.3	-	9	1240	c.1241C>A	c.(1240-1242)tCa>tAa	p.S414*	CTC-508F8.1_ENST00000575612.1_RNA|DNAH3_ENST00000415178.1_Nonsense_Mutation_p.S414*	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	414	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CTCCTTCCGTGAGGTAAAAAG	0.512																																																	0													77.0	80.0	79.0					16																	21136659		2201	4300	6501	SO:0001587	stop_gained	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.1241C>A	16.37:g.21136659G>T	ENSP00000261383:p.Ser414*		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.S414*	ENST00000261383.3	37	c.1241	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	G	19.20	3.782302	0.70222	.	.	ENSG00000158486	ENST00000261383;ENST00000415178;ENST00000396036	.	.	.	5.75	5.75	0.90469	.	1.430510	0.04347	N	0.354976	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	.	14.2536	0.66035	0.0:0.0:0.8504:0.1496	.	.	.	.	X	414;414;385	.	ENSP00000261383:S414X	S	-	2	0	DNAH3	21044160	0.884000	0.30299	0.011000	0.14972	0.163000	0.22366	5.593000	0.67550	2.725000	0.93324	0.655000	0.94253	TCA	DNAH3	-	NULL	ENSG00000158486		0.512	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	-	0.00	61	0	G	NM_017539		21136659	-1	tier1	-	no_errors	ENST00000261383	ensembl	human	known	74_37	nonsense	5.33	71	4	SNP	0.037	T
ECE2	9718	genome.wustl.edu	37	3	184008930	184008930	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr3:184008930A>G	ENST00000402825.3	+	17	2291	c.2291A>G	c.(2290-2292)cAa>cGa	p.Q764R	ECE2_ENST00000359140.4_Missense_Mutation_p.Q617R|ECE2_ENST00000357474.5_Missense_Mutation_p.Q692R|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000404464.3_Missense_Mutation_p.Q646R	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	764	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGTACAATCAATACCAGGTC	0.597																																																	0													67.0	71.0	70.0					3																	184008930		2203	4300	6503	SO:0001583	missense	0			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.2291A>G	3.37:g.184008930A>G	ENSP00000384223:p.Gln764Arg		A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.Q764R	ENST00000402825.3	37	c.2291	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	A	6.662	0.490698	0.12702	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52	4.94	3.56	0.40772	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.296529	0.31989	N	0.006755	T	0.64316	0.2587	L	0.28014	0.82	0.36649	D	0.877272	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.09377	0.001;0.004;0.003;0.002;0.001;0.002	T	0.62642	-0.6811	10	0.37606	T	0.19	-18.1577	4.2823	0.10838	0.6517:0.201:0.1473:0.0	.	366;617;646;692;617;764	B4DHU4;B4DKF3;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;ECE2_HUMAN	R	764;617;646;692;638	ENSP00000384223:Q764R;ENSP00000352052:Q617R;ENSP00000385846:Q646R;ENSP00000350066:Q692R;ENSP00000398444:Q638R	ENSP00000350066:Q692R	Q	+	2	0	ECE2	185491624	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	2.935000	0.48963	1.855000	0.53841	0.459000	0.35465	CAA	ECE2	-	pfam_Peptidase_M13_C	ENSG00000145194		0.597	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	-	0.00	88	0	A	NM_014693		184008930	+1	tier1	-	no_errors	ENST00000402825	ensembl	human	known	74_37	missense	9.59	66	7	SNP	1.000	G
EMILIN2	84034	genome.wustl.edu	37	18	2890741	2890741	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr18:2890741G>T	ENST00000254528.3	+	4	775	c.616G>T	c.(616-618)Gct>Tct	p.A206S		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	206					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		GTCTTCCCTTGCTGGAGTGAG	0.527																																																	0													81.0	82.0	82.0					18																	2890741		2203	4300	6503	SO:0001583	missense	0			AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.616G>T	18.37:g.2890741G>T	ENSP00000254528:p.Ala206Ser		B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	pfam_EMI_domain,pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,pfscan_EMI_domain	p.A206S	ENST00000254528.3	37	c.616	CCDS11828.1	18	.	.	.	.	.	.	.	.	.	.	G	6.799	0.516415	0.12944	.	.	ENSG00000132205	ENST00000254528	T	0.36340	1.26	5.41	4.53	0.55603	.	0.155416	0.44285	N	0.000480	T	0.30262	0.0759	L	0.57536	1.79	0.26399	N	0.976451	B	0.16396	0.017	B	0.13407	0.009	T	0.27839	-1.0062	10	0.09338	T	0.73	-7.3514	10.0366	0.42133	0.0718:0.0:0.7897:0.1385	.	206	Q9BXX0	EMIL2_HUMAN	S	206	ENSP00000254528:A206S	ENSP00000254528:A206S	A	+	1	0	EMILIN2	2880741	0.973000	0.33851	0.008000	0.14137	0.984000	0.73092	2.935000	0.48963	1.243000	0.43853	0.557000	0.71058	GCT	EMILIN2	-	NULL	ENSG00000132205		0.527	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN2	HGNC	protein_coding	OTTHUMT00000250337.2	-	0.00	55	0	G	NM_032048		2890741	+1	tier1	-	no_errors	ENST00000254528	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.951	T
LOC101927209	101927209	genome.wustl.edu	37	1	142714102	142714103	+	lincRNA	DEL	AC	AC	-	rs368660230		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	AC	AC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:142714102_142714103delAC	ENST00000610091.1	-	0	1555_1556																											ATAAAAGTAAacacacacacac	0.302																																																	0																																												0																															1.37:g.142714112_142714113delAC				RNA	DEL	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.6	-	-	ENSG00000203849		0.302	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2		0.00	22	0	AC			142714103	-1	tier1		no_errors	ENST00000369381	ensembl	human	known	74_37	rna	15.79	16	3	DEL	0.051:0.060	-
Unknown	0	genome.wustl.edu	37	GL000212.1	65288	65289	+	IGR	DNP	CG	CG	TC			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C|G	C|G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chrGL000212.1:65288_65289CG>TC								None (None upstream) : None (None downstream)																							GCCTCGCTGACGGGGACGCCGT	0.733																																																	0																																										SO:0001628	intergenic_variant	0																															GL000212.1.37:g.65288_65289delinsTC				Missense_Mutation|Silent	SNP	NULL	p.T346M|p.T346		37	c.1037|c.1038		GL000212.1																																																																																			AL356585.1	-	NULL	ENSG00000212857	0	0.733					ENSG00000212857	Clone_based_ensembl_gene			-	0.00	16	0	C|G			65288|65289	+1	tier1	-	no_errors	ENST00000391545	ensembl	human	known	74_37	missense|silent	32.00|33.33	17|16	8	SNP	NULL	T|C
RP11-51O6.1	0	genome.wustl.edu	37	16	61089321	61089321	+	RNA	DEL	A	A	-			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr16:61089321delA	ENST00000591758.1	-	0	547																											ttttttttttAGTTCATGTCT	0.269																																																	0																																												0																															16.37:g.61089321delA				RNA	DEL	-	NULL	ENST00000591758.1	37	NULL		16																																																																																			RP11-51O6.1	-	-	ENSG00000224631		0.269	RP11-51O6.1-002	KNOWN	basic	processed_transcript	ENSG00000224631	Clone_based_vega_gene	pseudogene	OTTHUMT00000460612.1		0.00	12	0	A			61089321	-1			no_errors	ENST00000591758	ensembl	human	known	74_37	rna	50.00	3	3	DEL	0.995	0
BUD13	84811	genome.wustl.edu	37	11	116646336	116646336	+	5'Flank	SNP	T	T	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr11:116646336T>C	ENST00000260210.4	-	0	0				AP006216.11_ENST00000366405.2_lincRNA|AP006216.10_ENST00000439104.1_RNA|BUD13_ENST00000375445.3_5'Flank	NM_032725.3	NP_116114.1	Q9BRD0	BUD13_HUMAN	BUD13 homolog (S. cerevisiae)						mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	nucleus (GO:0005634)|RES complex (GO:0070274)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|pancreas(2)|skin(1)|urinary_tract(1)	22	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		agagtgagactccgtctcaaa	0.448											OREG0003483	type=REGULATORY REGION|Gene=BC035670|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0																																										SO:0001631	upstream_gene_variant	0			BC006350	CCDS8374.1, CCDS53712.1	11q23.3	2012-06-07	2007-01-12		ENSG00000137656	ENSG00000137656			28199	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 71"""		"""BUD13 homolog (yeast)"""			12477932	Standard	NM_032725		Approved	MGC13125, fSAP71, Cwc26	uc001ppn.3	Q9BRD0	OTTHUMG00000045136		11.37:g.116646336T>C	Exception_encountered	1474	A8K0S0|Q96LS7	RNA	SNP	-	NULL	ENST00000260210.4	37	NULL	CCDS8374.1	11																																																																																			AP006216.11	-	-	ENSG00000231611		0.448	BUD13-001	KNOWN	basic|CCDS	protein_coding	ENSG00000231611	Clone_based_vega_gene	protein_coding	OTTHUMT00000104864.1	-	0.00	67	0	T	NM_032725		116646336	-1	tier1	-	no_errors	ENST00000366405	ensembl	human	known	74_37	rna	12.68	62	9	SNP	0.008	C
AC073648.1	0	genome.wustl.edu	37	4	9025165	9025165	+	RNA	SNP	T	T	G			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr4:9025165T>G	ENST00000408553.2	-	0	41																											ccgaaattacttttgcaccaa	0.433																																																	0																																												0																															4.37:g.9025165T>G				RNA	SNP	-	NULL	ENST00000408553.2	37	NULL		4																																																																																			AC073648.1	-	-	ENSG00000238726		0.433	AC073648.1-201	NOVEL	basic	miRNA	ENSG00000238726	Clone_based_ensembl_gene	miRNA		-	0.00	397	0	T			9025165	-1	tier1	-	no_errors	ENST00000408553	ensembl	human	novel	74_37	rna	5.58	389	23	SNP	0.248	G
TBC1D3P3	653017	genome.wustl.edu	37	17	20452507	20452507	+	lincRNA	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr17:20452507C>T	ENST00000591705.1	+	0	3824																											GTCTCTGCTGCCCCTCCCAGT	0.612																																																	0																																												0																															17.37:g.20452507C>T				RNA	SNP	-	NULL	ENST00000591705.1	37	NULL		17																																																																																			RP11-434D2.3	-	-	ENSG00000267075		0.612	RP11-434D2.3-001	KNOWN	basic	lincRNA	ENSG00000267075	Clone_based_vega_gene	lincRNA	OTTHUMT00000441761.2	-	0.00	10	0	C			20452507	+1	tier1	-	no_errors	ENST00000591705	ensembl	human	known	74_37	rna	36.36	7	4	SNP	0.199	T
EPPK1	83481	genome.wustl.edu	37	8	144941006	144941006	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr8:144941006A>G	ENST00000525985.1	-	2	6487	c.6416T>C	c.(6415-6417)cTg>cCg	p.L2139P				P58107	EPIPL_HUMAN	epiplakin 1	2139						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			CATCCTCACCAGCTGGAGCTT	0.512																																																	0													209.0	214.0	213.0					8																	144941006		2068	4200	6268	SO:0001583	missense	0			AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.6416T>C	8.37:g.144941006A>G	ENSP00000436337:p.Leu2139Pro		Q76E58|Q9NSU9	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Plectin_repeat	p.L2139P	ENST00000525985.1	37	c.6416		8	.	.	.	.	.	.	.	.	.	.	A	13.84	2.358527	0.41801	.	.	ENSG00000227184	ENST00000525985	T	0.79352	-1.26	4.39	4.39	0.52855	.	.	.	.	.	D	0.87095	0.6092	M	0.81341	2.54	0.26000	N	0.98213	D	0.76494	0.999	D	0.75484	0.986	T	0.78234	-0.2283	9	0.41790	T	0.15	.	11.6185	0.51104	1.0:0.0:0.0:0.0	.	2139	E9PPU0	.	P	2139	ENSP00000436337:L2139P	ENSP00000436337:L2139P	L	-	2	0	EPPK1	145012994	0.347000	0.24853	0.004000	0.12327	0.024000	0.10985	4.806000	0.62569	1.842000	0.53543	0.377000	0.23210	CTG	EPPK1	-	NULL	ENSG00000227184		0.512	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	EPPK1	HGNC	protein_coding	OTTHUMT00000382675.1		0.00	52	0	A	NM_031308		144941006	-1			no_errors	ENST00000525985	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.055	G
EPRS	2058	genome.wustl.edu	37	1	220160717	220160717	+	Silent	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:220160717G>T	ENST00000366923.3	-	20	3074	c.2805C>A	c.(2803-2805)ctC>ctA	p.L935L	snoU13_ENST00000459217.1_RNA	NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	935	3 X 57 AA approximate repeats.|WHEP-TRS 3.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TTAGCTGAAGGAGTTCTTGAA	0.378																																																	0													71.0	70.0	70.0					1																	220160717		2203	4300	6503	SO:0001819	synonymous_variant	0			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.2805C>A	1.37:g.220160717G>T			A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Silent	SNP	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,pfam_WHEP-TRS,pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Pro-tRNA_ligase_II_C,pfam_Anticodon-bd,superfamily_Ribosomal_L25/Gln-tRNA_synth,superfamily_Anticodon-bd,superfamily_Pro-tRNA_synth_II,superfamily_S15_NS1_RNA-bd,superfamily_Glutathione-S-Trfase_C-like,smart_Pro-tRNA_ligase_II_C,prints_Glu/Gln-tRNA-synth,prints_Pro-tRNA-ligase_IIa,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_Pro-tRNA-ligase_IIa_arc-type,tigrfam_Glu-tRNA-synth_arc/euk	p.L935	ENST00000366923.3	37	c.2805	CCDS31027.1	1																																																																																			EPRS	-	pfam_WHEP-TRS,superfamily_S15_NS1_RNA-bd,pfscan_WHEP-TRS	ENSG00000136628		0.378	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPRS	HGNC	protein_coding	OTTHUMT00000091133.2	-	0.00	45	0	G	NM_004446		220160717	-1	tier1	-	no_errors	ENST00000366923	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.309	T
ETV2	2116	genome.wustl.edu	37	19	36134632	36134632	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr19:36134632G>C	ENST00000403402.1	+	4	998	c.692G>C	c.(691-693)cGa>cCa	p.R231P	ETV2_ENST00000479824.1_Missense_Mutation_p.R138P|ETV2_ENST00000402764.2_Missense_Mutation_p.R231P|ETV2_ENST00000379026.2_Missense_Mutation_p.R259P|ETV2_ENST00000379023.4_Intron			O00321	ETV2_HUMAN	ets variant 2	231					blastocyst development (GO:0001824)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway involved in mesodermal cell fate specification (GO:0060803)|cell differentiation (GO:0030154)|erythrocyte differentiation (GO:0030218)|Notch signaling pathway (GO:0007219)|placenta development (GO:0001890)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of mesoderm development (GO:2000382)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			lung(2)	2	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			AGTTTGGCTCGATGCCCCAAA	0.652																																																	0													45.0	48.0	47.0					19																	36134632		2203	4300	6503	SO:0001583	missense	0			AF000671	CCDS32995.2, CCDS74341.1	19q13.11	2008-09-12	2008-09-12		ENSG00000105672	ENSG00000105672			3491	protein-coding gene	gene with protein product		609358	"""ets variant gene 2"""			1340465	Standard	XM_005258654		Approved	ER71	uc002oar.2	O00321	OTTHUMG00000150545	ENST00000403402.1:c.692G>C	19.37:g.36134632G>C	ENSP00000385369:p.Arg231Pro		A6NFN5|B3KUL0|B9EIN1|Q9UEA0	Missense_Mutation	SNP	pfam_Ets_dom,smart_Ets_dom,prints_Ets_dom,pfscan_Ets_dom	p.R231P	ENST00000403402.1	37	c.692	CCDS32995.2	19	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711671	0.68730	.	.	ENSG00000105672	ENST00000379026;ENST00000402764;ENST00000403402	T;T;T	0.13778	2.56;2.56;2.56	4.93	2.73	0.32206	Winged helix-turn-helix transcription repressor DNA-binding (1);	1.048490	0.07533	N	0.912563	T	0.10380	0.0254	N	0.24115	0.695	0.09310	N	1	B;B;B	0.21821	0.007;0.061;0.007	B;B;B	0.17433	0.003;0.018;0.005	T	0.34825	-0.9813	10	0.40728	T	0.16	.	8.1397	0.31076	0.0:0.1727:0.6482:0.1791	.	230;259;231	O00321;A6NFN5;B9EIN1	ETV2_HUMAN;.;.	P	259;231;231	ENSP00000368312:R259P;ENSP00000384524:R231P;ENSP00000385369:R231P	ENSP00000368312:R259P	R	+	2	0	ETV2	40826472	0.010000	0.17322	0.062000	0.19696	0.972000	0.66771	1.576000	0.36504	0.639000	0.30564	0.555000	0.69702	CGA	ETV2	-	NULL	ENSG00000105672		0.652	ETV2-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	ETV2	HGNC	protein_coding	OTTHUMT00000318848.2	-	0.00	89	0	G	XM_209182		36134632	+1	tier1	-	no_errors	ENST00000402764	ensembl	human	known	74_37	missense	5.04	113	6	SNP	0.003	C
ETV7	51513	genome.wustl.edu	37	6	36336842	36336842	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr6:36336842C>T	ENST00000340181.4	-	6	912	c.671G>A	c.(670-672)cGc>cAc	p.R224H	ETV7_ENST00000538992.1_Missense_Mutation_p.R73H|ETV7_ENST00000373738.1_Missense_Mutation_p.R169H|ETV7_ENST00000339796.5_Missense_Mutation_p.R224H|ETV7_ENST00000373737.4_Missense_Mutation_p.R147H	NM_001207037.1|NM_001207040.1|NM_016135.3	NP_001193966.1|NP_001193969.1|NP_057219.1	Q9Y603	ETV7_HUMAN	ets variant 7	224					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(4)	10						CCACAGCAGGCGGCAGTCTGC	0.542																																																	0													96.0	84.0	88.0					6																	36336842		2203	4300	6503	SO:0001583	missense	0			AF116508	CCDS4819.1, CCDS56422.1, CCDS56423.1, CCDS56424.1, CCDS56425.1, CCDS75440.1, CCDS75441.1	6p21	2008-09-12	2008-09-12		ENSG00000010030	ENSG00000010030			18160	protein-coding gene	gene with protein product	"""TEL2 oncogene"""	605255	"""ets variant gene 7 (TEL2 oncogene)"""			10828014, 11108721	Standard	NM_016135		Approved	TEL2, TEL-2	uc003omb.3	Q9Y603	OTTHUMG00000014594	ENST00000340181.4:c.671G>A	6.37:g.36336842C>T	ENSP00000341843:p.Arg224His		B3KVC2|B4DVB6|B4E1G4|Q5R3L3|Q5R3L4|Q9NZ65|Q9NZ66|Q9NZ68|Q9NZR8|Q9UNJ7|Q9Y5K4|Q9Y604	Missense_Mutation	SNP	pfam_Ets_dom,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.R224H	ENST00000340181.4	37	c.671	CCDS4819.1	6	.	.	.	.	.	.	.	.	.	.	C	20.8	4.042568	0.75732	.	.	ENSG00000010030	ENST00000339796;ENST00000340181;ENST00000373737;ENST00000373738;ENST00000538992	T;T;T;T;T	0.14266	2.52;2.52;2.52;2.52;2.52	4.0	2.18	0.27775	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (3);	0.069380	0.56097	D	0.000035	T	0.17066	0.0410	M	0.62723	1.935	0.38334	D	0.943886	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.997;0.992;0.997;0.995;0.95;0.998	T	0.01666	-1.1300	10	0.44086	T	0.13	.	7.8142	0.29249	0.1611:0.7512:0.0:0.0877	.	165;147;169;224;169;224	Q9Y603-2;Q9Y603-7;Q9Y603-4;Q9Y603;Q9Y603-6;Q9Y603-5	.;.;.;ETV7_HUMAN;.;.	H	224;224;147;169;73	ENSP00000342260:R224H;ENSP00000341843:R224H;ENSP00000362842:R147H;ENSP00000362843:R169H;ENSP00000440592:R73H	ENSP00000342260:R224H	R	-	2	0	ETV7	36444820	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	3.199000	0.51043	0.186000	0.20125	0.655000	0.94253	CGC	ETV7	-	smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	ENSG00000010030		0.542	ETV7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ETV7	HGNC	protein_coding	OTTHUMT00000040341.1		0.00	62	0	C	NM_016135		36336842	-1			no_errors	ENST00000340181	ensembl	human	known	74_37	missense	5.48	68	4	SNP	1.000	T
FAM102B	284611	genome.wustl.edu	37	1	109154834	109154834	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:109154834C>T	ENST00000370035.3	+	4	663	c.323C>T	c.(322-324)gCt>gTt	p.A108V	FAM102B_ENST00000405454.1_Missense_Mutation_p.A108V	NM_001010883.2	NP_001010883.2	Q5T8I3	F102B_HUMAN	family with sequence similarity 102, member B	108										autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	5		all_epithelial(167;5.52e-05)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0217)|Lung(183;0.109)|COAD - Colon adenocarcinoma(174;0.141)|Epithelial(280;0.182)		GCAGAGTTTGCTGGATCAGGA	0.378																																																	0													109.0	108.0	108.0					1																	109154834		2203	4300	6503	SO:0001583	missense	0			CR749397	CCDS30786.2	1p13.3	2012-11-05			ENSG00000162636	ENSG00000162636			27637	protein-coding gene	gene with protein product	"""sym-3 homolog B (C. elegans)"""						Standard	NM_001010883		Approved	DKFZp779B126, SYM-3B	uc010ouy.2	Q5T8I3	OTTHUMG00000010967	ENST00000370035.3:c.323C>T	1.37:g.109154834C>T	ENSP00000359052:p.Ala108Val		A1L1A1|B0QZ46|B0QZ47|Q68DH7	Missense_Mutation	SNP	pfam_NT-C2	p.A108V	ENST00000370035.3	37	c.323	CCDS30786.2	1	.	.	.	.	.	.	.	.	.	.	C	35	5.542270	0.96474	.	.	ENSG00000162636	ENST00000370035;ENST00000405454;ENST00000437902	T;T	0.44881	0.91;0.91	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.64972	0.2647	M	0.90977	3.165	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66188	-0.5986	10	0.19147	T	0.46	-14.6755	19.0387	0.92989	0.0:1.0:0.0:0.0	.	108	Q5T8I3	F102B_HUMAN	V	108	ENSP00000359052:A108V;ENSP00000386084:A108V	ENSP00000359052:A108V	A	+	2	0	FAM102B	108956357	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.805000	0.86005	2.500000	0.84329	0.655000	0.94253	GCT	FAM102B	-	pfam_NT-C2	ENSG00000162636		0.378	FAM102B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM102B	HGNC	protein_coding	OTTHUMT00000030188.3	-	0.00	84	0	C	NM_001010883		109154834	+1	tier1	-	no_errors	ENST00000370035	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
FAM117B	150864	genome.wustl.edu	37	2	203622160	203622160	+	Splice_Site	SNP	A	A	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:203622160A>C	ENST00000392238.2	+	6	1329	c.1329A>C	c.(1327-1329)aaA>aaC	p.K443N	FAM117B_ENST00000303116.6_Splice_Site_p.K199N			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	443										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						CCAGAGATAAAGGTACAGTGC	0.473																																																	0													122.0	111.0	115.0					2																	203622160		2203	4300	6503	SO:0001630	splice_region_variant	0			AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.1330+1A>C	2.37:g.203622160A>C			Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Missense_Mutation	SNP	NULL	p.K443N	ENST00000392238.2	37	c.1329	CCDS33362.2	2	.	.	.	.	.	.	.	.	.	.	A	22.5	4.298139	0.81025	.	.	ENSG00000138439	ENST00000303116;ENST00000392238	.	.	.	5.63	5.63	0.86233	.	0.042369	0.85682	D	0.000000	T	0.63686	0.2532	L	0.49126	1.545	0.80722	D	1	P	0.52316	0.952	P	0.51701	0.677	T	0.65623	-0.6123	9	0.52906	T	0.07	-4.5806	15.8487	0.78910	1.0:0.0:0.0:0.0	.	443	Q6P1L5	F117B_HUMAN	N	199;443	.	ENSP00000306299:K199N	K	+	3	2	FAM117B	203330405	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	8.381000	0.90152	2.145000	0.66743	0.533000	0.62120	AAA	FAM117B	-	NULL	ENSG00000138439		0.473	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM117B	HGNC	protein_coding	OTTHUMT00000335888.3	-	0.00	89	0	A	NM_173511	Missense_Mutation	203622160	+1	tier1	-	no_errors	ENST00000392238	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	C
FAM208B	54906	genome.wustl.edu	37	10	5784218	5784218	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr10:5784218C>T	ENST00000328090.5	+	14	3111	c.2486C>T	c.(2485-2487)aCg>aTg	p.T829M	RP11-336A10.2_ENST00000411512.2_RNA	NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	829																	ATAAATAGCACGTTAGAATCT	0.418																																																	0													111.0	104.0	106.0					10																	5784218		1861	4095	5956	SO:0001583	missense	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.2486C>T	10.37:g.5784218C>T	ENSP00000328426:p.Thr829Met		Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	pfam_DUF3715,pfam_DUF3699	p.T829M	ENST00000328090.5	37	c.2486	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	C	13.44	2.236968	0.39498	.	.	ENSG00000108021	ENST00000328090	D	0.98701	-5.08	5.71	3.88	0.44766	.	0.296244	0.29646	N	0.011566	D	0.97832	0.9288	M	0.69823	2.125	0.18873	N	0.999989	D	0.63046	0.992	P	0.49477	0.612	D	0.94363	0.7589	10	0.72032	D	0.01	.	8.4051	0.32610	0.0:0.7027:0.0:0.2973	.	829	Q5VWN6	F208B_HUMAN	M	829	ENSP00000328426:T829M	ENSP00000328426:T829M	T	+	2	0	C10orf18	5824224	0.019000	0.18553	0.537000	0.28052	0.415000	0.31203	0.355000	0.20163	0.778000	0.33520	-0.140000	0.14226	ACG	FAM208B	-	pfam_DUF3715	ENSG00000108021		0.418	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2		0.00	116	0	C	NM_017782		5784218	+1			no_errors	ENST00000328090	ensembl	human	known	74_37	missense	5.05	94	5	SNP	0.371	T
FAT1	2195	genome.wustl.edu	37	4	187538272	187538272	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr4:187538272T>A	ENST00000441802.2	-	11	9171	c.8962A>T	c.(8962-8964)Aaa>Taa	p.K2988*		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2988	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TTGTCCCTTTTTTCCCTGTCT	0.408										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0													213.0	189.0	197.0					4																	187538272		1878	4107	5985	SO:0001587	stop_gained	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8962A>T	4.37:g.187538272T>A	ENSP00000406229:p.Lys2988*			Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.K2988*	ENST00000441802.2	37	c.8962	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	T	50	16.581229	0.99867	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	.	.	.	4.59	-3.32	0.04973	.	0.350363	0.32041	N	0.006670	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	7.8076	0.29211	0.0:0.2383:0.5709:0.1908	.	.	.	.	X	2988;2990	.	ENSP00000260147:K2990X	K	-	1	0	FAT1	187775266	0.992000	0.36948	0.094000	0.20943	0.738000	0.42128	0.906000	0.28517	-0.597000	0.05813	-0.429000	0.05907	AAA	FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000083857		0.408	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	-	0.00	70	0	T	NM_005245		187538272	-1	tier1	-	no_errors	ENST00000441802	ensembl	human	known	74_37	nonsense	15.62	54	10	SNP	0.982	A
FLG	2312	genome.wustl.edu	37	1	152281402	152281402	+	Missense_Mutation	SNP	C	C	T	rs150720370		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:152281402C>T	ENST00000368799.1	-	3	5995	c.5960G>A	c.(5959-5961)cGt>cAt	p.R1987H	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1987	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.R1987H(1)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCCTGTCCACGAGAGGAAGA	0.572									Ichthyosis																																								1	Substitution - Missense(1)	prostate(1)						C	HIS/ARG	2,4404	4.2+/-10.8	0,2,2201	565.0	449.0	488.0		5960	-3.3	0.0	1	dbSNP_134	488	0,8600		0,0,4300	no	missense	FLG	NM_002016.1	29	0,2,6501	TT,TC,CC		0.0,0.0454,0.0154	benign	1987/4062	152281402	2,13004	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.5960G>A	1.37:g.152281402C>T	ENSP00000357789:p.Arg1987His		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.R1987H	ENST00000368799.1	37	c.5960	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	c	2.436	-0.329840	0.05314	4.54E-4	0.0	ENSG00000143631	ENST00000368799	T	0.00940	5.52	1.66	-3.32	0.04973	.	.	.	.	.	T	0.00271	0.0008	L	0.31926	0.97	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.36432	-0.9748	9	0.39692	T	0.17	.	3.6898	0.08341	0.0:0.2542:0.2119:0.5339	.	1987	P20930	FILA_HUMAN	H	1987	ENSP00000357789:R1987H	ENSP00000357789:R1987H	R	-	2	0	FLG	150548026	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.449000	0.02392	-1.207000	0.02637	-0.915000	0.02750	CGT	FLG	-	NULL	ENSG00000143631		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	323	0	C	NM_002016		152281402	-1	tier1	rs150720370	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	5.14	277	15	SNP	0.000	T
FCAMR	83953	genome.wustl.edu	37	1	207133114	207133114	+	Silent	SNP	G	G	T	rs538455882		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:207133114G>T	ENST00000324852.4	-	7	1957	c.1483C>A	c.(1483-1485)Cgg>Agg	p.R495R	FCAMR_ENST00000486178.1_5'UTR|FCAMR_ENST00000450945.2_Silent_p.L227L|FCAMR_ENST00000400962.3_Silent_p.L227L	NM_001170631.1	NP_001164102.1	Q8WWV6	FCAMR_HUMAN	Fc receptor, IgA, IgM, high affinity	450					immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|stomach(1)	11						GCCAGGGTCCGAGAGCTGCTT	0.517																																					Ovarian(199;1883 2142 16966 44409 45154)												0													127.0	125.0	126.0					1																	207133114		1568	3582	5150	SO:0001819	synonymous_variant	0			AF354295	CCDS41460.1, CCDS53468.1	1q32.1	2013-01-14			ENSG00000162897	ENSG00000162897		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	24692	protein-coding gene	gene with protein product		605484				11779189	Standard	NM_001122979		Approved	FKSG87, FCA/MR, CD351	uc001hfa.4	Q8WWV6	OTTHUMG00000036579	ENST00000324852.4:c.1483C>A	1.37:g.207133114G>T			Q32M82|Q8WWV5|Q96SA2	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.L227	ENST00000324852.4	37	c.681	CCDS53468.1	1																																																																																			FCAMR	-	NULL	ENSG00000162897		0.517	FCAMR-002	NOVEL	basic|appris_principal|CCDS	protein_coding	FCAMR	HGNC	protein_coding	OTTHUMT00000088969.2		0.00	65	0	G	NM_032029		207133114	-1			no_errors	ENST00000400962	ensembl	human	known	74_37	silent	5.71	66	4	SNP	0.000	T
GABRE	2564	genome.wustl.edu	37	X	151130908	151130908	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chrX:151130908A>C	ENST00000370328.3	-	4	603	c.550T>G	c.(550-552)Ttg>Gtg	p.L184V	GABRE_ENST00000393914.3_Missense_Mutation_p.C18W|GABRE_ENST00000370325.1_Missense_Mutation_p.L184V|MIR452_ENST00000385020.1_RNA	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	184					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	ATTGTGTACAACACCTTGCCA	0.468																																																	0													118.0	84.0	96.0					X																	151130908		2203	4300	6503	SO:0001583	missense	0			Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.550T>G	X.37:g.151130908A>C	ENSP00000359353:p.Leu184Val		E7ET93|O15345|O15346|Q6PCD2|Q99520	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAe_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.L184V	ENST00000370328.3	37	c.550	CCDS14703.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.99|16.99	3.272875|3.272875	0.59649|0.59649	.|.	.|.	ENSG00000102287|ENSG00000102287	ENST00000393914|ENST00000370328;ENST00000370325	.|T;T	.|0.79033	.|-1.23;-1.23	5.47|5.47	-1.89|-1.89	0.07689|0.07689	.|Neurotransmitter-gated ion-channel ligand-binding (3);	.|0.000000	.|0.37761	.|N	.|0.001958	D|D	0.84202|0.84202	0.5420|0.5420	M|M	0.69523|0.69523	2.12|2.12	0.34736|0.34736	D|D	0.730258|0.730258	.|D	.|0.76494	.|0.999	.|D	.|0.87578	.|0.998	D|D	0.85918|0.85918	0.1444|0.1444	6|10	0.87932|0.87932	D|D	0|0	.|.	12.0766|12.0766	0.53647|0.53647	0.3692:0.0:0.6308:0.0|0.3692:0.0:0.6308:0.0	.|.	.|184	.|P78334	.|GBRE_HUMAN	W|V	18|184	.|ENSP00000359353:L184V;ENSP00000359350:L184V	ENSP00000377491:C18W|ENSP00000359350:L184V	C|L	-|-	3|1	2|2	GABRE|GABRE	150881564|150881564	0.990000|0.990000	0.36364|0.36364	0.994000|0.994000	0.49952|0.49952	0.877000|0.877000	0.50540|0.50540	1.058000|1.058000	0.30504|0.30504	-0.372000|-0.372000	0.07992|0.07992	0.430000|0.430000	0.28490|0.28490	TGT|TTG	GABRE	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000102287		0.468	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRE	HGNC	protein_coding	OTTHUMT00000060903.1	-	0.00	60	0	A	NM_004961, NM_021990, NM_021984		151130908	-1	tier1	-	no_errors	ENST00000370328	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.881	C
GDF9	2661	genome.wustl.edu	37	5	132197854	132197854	+	Silent	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr5:132197854G>T	ENST00000378673.2	-	3	1658	c.792C>A	c.(790-792)atC>atA	p.I264I	GDF9_ENST00000296875.2_Silent_p.I264I|GDF9_ENST00000464378.1_5'Flank			O60383	GDF9_HUMAN	growth differentiation factor 9	264					female gamete generation (GO:0007292)|negative regulation of cell growth (GO:0030308)|oocyte growth (GO:0001555)|positive regulation of cell proliferation (GO:0008284)|regulation of progesterone secretion (GO:2000870)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(1)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	22		all_cancers(142;0.105)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCAAATATAAGATCAGTGAGG	0.443																																																	0													76.0	75.0	75.0					5																	132197854		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4162.1, CCDS75299.1	5q31.1	2014-01-30			ENSG00000164404	ENSG00000164404		"""Endogenous ligands"""	4224	protein-coding gene	gene with protein product		601918				7760846	Standard	NM_005260		Approved		uc003kxz.1	O60383	OTTHUMG00000059842	ENST00000378673.2:c.792C>A	5.37:g.132197854G>T			Q4VAW5	Silent	SNP	pfam_TGF-b_C,smart_TGF-b_C	p.I264	ENST00000378673.2	37	c.792	CCDS4162.1	5																																																																																			GDF9	-	NULL	ENSG00000164404		0.443	GDF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF9	HGNC	protein_coding	OTTHUMT00000133060.2	-	0.00	80	0	G	NM_005260		132197854	-1	tier1	-	no_errors	ENST00000296875	ensembl	human	known	74_37	silent	5.41	70	4	SNP	0.120	T
GIGYF2	26058	genome.wustl.edu	37	2	233677201	233677201	+	Splice_Site	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:233677201G>T	ENST00000409547.1	+	20	2418	c.2107G>T	c.(2107-2109)Gtt>Ttt	p.V703F	GIGYF2_ENST00000409196.3_Splice_Site_p.V697F|GIGYF2_ENST00000373563.4_Splice_Site_p.V703F|GIGYF2_ENST00000452341.2_Splice_Site_p.V534F|GIGYF2_ENST00000409480.1_Splice_Site_p.V725F|GIGYF2_ENST00000409451.3_Splice_Site_p.V724F|GIGYF2_ENST00000373566.3_Splice_Site_p.V725F	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	703	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		ACAGCCTACAGGTAAAAACTT	0.378																																																	0													61.0	58.0	59.0					2																	233677201		2203	4300	6503	SO:0001630	splice_region_variant	0			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2107+1G>T	2.37:g.233677201G>T			A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.V725F	ENST00000409547.1	37	c.2173	CCDS33401.1	2	.	.	.	.	.	.	.	.	.	.	G	16.80	3.224435	0.58668	.	.	ENSG00000204120	ENST00000373566;ENST00000414511;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000535418;ENST00000423659;ENST00000409196;ENST00000409451;ENST00000440945;ENST00000452341	T;T;T;T;T;T;T;T;T	0.74421	-0.66;-0.66;-0.66;-0.66;-0.83;-0.66;-0.66;-0.84;-0.54	5.05	5.05	0.67936	.	0.275497	0.35615	N	0.003098	D	0.82719	0.5098	M	0.64997	1.995	0.80722	D	1	B;B;P;D	0.67145	0.073;0.086;0.94;0.996	B;B;B;D	0.72982	0.055;0.019;0.272;0.979	T	0.78117	-0.2329	10	0.09843	T	0.71	-3.5841	18.3844	0.90462	0.0:0.0:1.0:0.0	.	534;724;703;697	E9PC50;A6H8W4;Q6Y7W6;E9PBB0	.;.;PERQ2_HUMAN;.	F	725;646;703;725;703;703;646;697;724;697;534	ENSP00000362667:V725F;ENSP00000362664:V703F;ENSP00000386765:V725F;ENSP00000386537:V703F;ENSP00000404195:V646F;ENSP00000387070:V697F;ENSP00000387170:V724F;ENSP00000410297:V697F;ENSP00000411505:V534F	ENSP00000362664:V703F	V	+	1	0	GIGYF2	233385445	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.683000	0.91236	2.328000	0.79073	0.655000	0.94253	GTT	GIGYF2	-	NULL	ENSG00000204120		0.378	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	HGNC	protein_coding	OTTHUMT00000330316.2		0.00	100	0	G	NM_001103146	Missense_Mutation	233677201	+1			no_errors	ENST00000373566	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
GPR63	81491	genome.wustl.edu	37	6	97247216	97247216	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr6:97247216G>C	ENST00000229955.3	-	2	737	c.392C>G	c.(391-393)gCa>gGa	p.A131G	GPR63_ENST00000417980.1_Missense_Mutation_p.A131G	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	131						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		GTTCAGCACTGCAAGCAACAT	0.438																																																	0													80.0	79.0	80.0					6																	97247216		2203	4300	6503	SO:0001583	missense	0			AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.392C>G	6.37:g.97247216G>C	ENSP00000229955:p.Ala131Gly		Q9UJH3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.A131G	ENST00000229955.3	37	c.392	CCDS5036.1	6	.	.	.	.	.	.	.	.	.	.	G	9.564	1.119199	0.20877	.	.	ENSG00000112218	ENST00000536583;ENST00000417980;ENST00000229955;ENST00000369268	T;T;T	0.37235	1.21;1.21;1.21	5.1	5.1	0.69264	GPCR, rhodopsin-like superfamily (1);	0.137147	0.48767	D	0.000175	T	0.10337	0.0253	N	0.16016	0.355	0.80722	D	1	B	0.22983	0.078	B	0.24974	0.057	T	0.10870	-1.0611	10	0.02654	T	1	-6.7176	18.8837	0.92367	0.0:0.0:1.0:0.0	.	131	Q9BZJ6	GPR63_HUMAN	G	155;131;131;131	ENSP00000393170:A131G;ENSP00000229955:A131G;ENSP00000358273:A131G	ENSP00000229955:A131G	A	-	2	0	GPR63	97353937	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	9.420000	0.97426	2.553000	0.86117	0.555000	0.69702	GCA	GPR63	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000112218		0.438	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR63	HGNC	protein_coding	OTTHUMT00000041566.2		0.00	89	0	G			97247216	-1			no_errors	ENST00000229955	ensembl	human	known	74_37	missense	5.77	48	3	SNP	1.000	C
GPR126	57211	genome.wustl.edu	37	6	142718824	142718824	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr6:142718824A>C	ENST00000230173.6	+	10	1975	c.1499A>C	c.(1498-1500)aAg>aCg	p.K500T	GPR126_ENST00000367609.3_Missense_Mutation_p.K500T|GPR126_ENST00000367608.2_Missense_Mutation_p.K472T|GPR126_ENST00000296932.8_Missense_Mutation_p.K472T	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	500					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		ATTCAGCAGAAGCTCCTAAAA	0.373																																																	0													73.0	72.0	72.0					6																	142718824		1819	4076	5895	SO:0001583	missense	0			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.1499A>C	6.37:g.142718824A>C	ENSP00000230173:p.Lys500Thr		Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_CUB_dom,pfam_GPS_dom,pfam_Pentaxin,superfamily_CUB_dom,superfamily_ConA-like_lec_gl_sf,smart_CUB_dom,smart_Pentaxin,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.K500T	ENST00000230173.6	37	c.1499	CCDS47490.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.27|16.27	3.076232|3.076232	0.55646|0.55646	.|.	.|.	ENSG00000112414|ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609|ENST00000508295	T;T;T;T|.	0.48836|.	0.8;0.8;0.8;0.8|.	5.54|5.54	4.37|4.37	0.52481|0.52481	.|.	0.000000|.	0.64402|.	D|.	0.000004|.	T|T	0.43411|0.43411	0.1246|0.1246	L|L	0.58101|0.58101	1.795|1.795	0.33731|0.33731	D|D	0.618258|0.618258	B;B;B;B|.	0.29590|.	0.25;0.25;0.25;0.162|.	B;B;B;B|.	0.28709|.	0.093;0.093;0.093;0.043|.	T|T	0.42616|0.42616	-0.9441|-0.9441	10|5	0.72032|.	D|.	0.01|.	.|.	11.4882|11.4882	0.50367|0.50367	0.9294:0.0:0.0706:0.0|0.9294:0.0:0.0706:0.0	.|.	472;500;472;500|.	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4|.	.;.;.;GP126_HUMAN|.	T|R	500;472;472;500|75	ENSP00000230173:K500T;ENSP00000356580:K472T;ENSP00000296932:K472T;ENSP00000356581:K500T|.	ENSP00000230173:K500T|.	K|S	+|+	2|1	0|0	GPR126|GPR126	142760517|142760517	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	6.058000|6.058000	0.71126|0.71126	1.036000|1.036000	0.39998|0.39998	0.528000|0.528000	0.53228|0.53228	AAG|AGC	GPR126	-	NULL	ENSG00000112414		0.373	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	HGNC	protein_coding	OTTHUMT00000042487.2	-	0.00	85	0	A			142718824	+1	tier1	-	no_errors	ENST00000367609	ensembl	human	known	74_37	missense	10.00	63	7	SNP	1.000	C
GTSE1	51512	genome.wustl.edu	37	22	46708101	46708101	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr22:46708101C>T	ENST00000454366.1	+	5	1038	c.826C>T	c.(826-828)Cgg>Tgg	p.R276W		NM_016426.6	NP_057510	Q9NYZ3	GTSE1_HUMAN	G-2 and S-phase expressed 1	257					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|microtubule-based process (GO:0007017)	cytoplasmic microtubule (GO:0005881)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	27		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00462)		GGAATCCCACCGGGATGTTCT	0.532																																					GBM(153;542 1915 12487 29016 50495)												0													54.0	58.0	56.0					22																	46708101		2203	4300	6503	SO:0001583	missense	0			AF223408	CCDS14074.2	22q13.2-q13.3	2008-06-10			ENSG00000075218	ENSG00000075218			13698	protein-coding gene	gene with protein product		607477				10974554, 10984615, 12750368	Standard	NM_016426		Approved	GTSE-1, B99	uc011aqy.2	Q9NYZ3	OTTHUMG00000150486	ENST00000454366.1:c.826C>T	22.37:g.46708101C>T	ENSP00000415430:p.Arg276Trp		B0QYM3|Q20WK2|Q53GX5|Q5R3I6|Q6DHX4|Q9BRE0|Q9UGZ9|Q9Y557	Missense_Mutation	SNP	NULL	p.R276W	ENST00000454366.1	37	c.826	CCDS14074.2	22	.	.	.	.	.	.	.	.	.	.	C	15.42	2.829692	0.50845	.	.	ENSG00000075218	ENST00000454366;ENST00000361934	T	0.07800	3.16	4.75	-7.6	0.01303	.	0.577883	0.18783	N	0.131289	T	0.12433	0.0302	L	0.39898	1.24	0.09310	N	1	D	0.76494	0.999	D	0.63488	0.915	T	0.02519	-1.1147	10	0.72032	D	0.01	-0.0179	10.5726	0.45209	0.1569:0.3401:0.503:0.0	.	257	Q9NYZ3	GTSE1_HUMAN	W	276;236	ENSP00000415430:R276W	ENSP00000354634:R236W	R	+	1	2	GTSE1	45086765	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.542000	0.02196	-1.773000	0.01290	-0.271000	0.10264	CGG	GTSE1	-	NULL	ENSG00000075218		0.532	GTSE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTSE1	HGNC	protein_coding	OTTHUMT00000318360.2	-	0.00	133	0	C	NM_016426		46708101	+1	tier1	-	no_errors	ENST00000454366	ensembl	human	known	74_37	missense	5.16	147	8	SNP	0.000	T
HACE1	57531	genome.wustl.edu	37	6	105232975	105232975	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr6:105232975C>A	ENST00000262903.4	-	12	1570	c.1294G>T	c.(1294-1296)Gca>Tca	p.A432S	HACE1_ENST00000369125.2_Missense_Mutation_p.A432S|HACE1_ENST00000517995.1_5'Flank	NM_020771.3	NP_065822.2	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1	432					cell cycle (GO:0007049)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)|protein K48-linked ubiquitination (GO:0070936)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|Rac protein signal transduction (GO:0016601)|regulation of cell migration (GO:0030334)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	ligase activity (GO:0016874)|Rab GTPase binding (GO:0017137)|Rac GTPase binding (GO:0048365)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	44		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		TGTCTCCCTGCAAGAGCATCT	0.463																																																	0													99.0	92.0	94.0					6																	105232975		2203	4300	6503	SO:0001583	missense	0			BC034982	CCDS5050.1	6q21	2013-01-10	2012-02-23		ENSG00000085382	ENSG00000085382		"""Ankyrin repeat domain containing"""	21033	protein-coding gene	gene with protein product		610876				10718198	Standard	NM_020771		Approved	KIAA1320	uc003pqu.1	Q8IYU2	OTTHUMG00000015287	ENST00000262903.4:c.1294G>T	6.37:g.105232975C>A	ENSP00000262903:p.Ala432Ser		A8K6U5|B3KY89|B4DFM6|B4DTQ4|B7Z9X6|E9PGP0|Q5VU99|Q5VUA0|Q8ND12|Q9P2M6	Missense_Mutation	SNP	pfam_HECT,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT,prints_Ankyrin_rpt	p.A432S	ENST00000262903.4	37	c.1294	CCDS5050.1	6	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163910	0.38217	.	.	ENSG00000085382	ENST00000262903;ENST00000369125	T;T	0.36699	1.24;1.25	4.8	2.9	0.33743	.	0.667411	0.15926	N	0.237890	T	0.08758	0.0217	N	0.22421	0.69	0.32683	N	0.515225	B;B;B	0.15473	0.0;0.002;0.013	B;B;B	0.21917	0.0;0.004;0.037	T	0.23583	-1.0184	10	0.06891	T	0.86	.	13.3942	0.60840	0.2871:0.7129:0.0:0.0	.	432;432;85	E9PGP0;Q8IYU2;Q8IYU2-3	.;HACE1_HUMAN;.	S	432	ENSP00000262903:A432S;ENSP00000358121:A432S	ENSP00000262903:A432S	A	-	1	0	HACE1	105339668	0.520000	0.26250	0.519000	0.27824	0.922000	0.55478	0.605000	0.24179	0.474000	0.27392	0.460000	0.39030	GCA	HACE1	-	NULL	ENSG00000085382		0.463	HACE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HACE1	HGNC	protein_coding	OTTHUMT00000041643.2	-	0.00	82	0	C	XM_045095		105232975	-1	tier1	-	no_errors	ENST00000262903	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.863	A
HCN1	348980	genome.wustl.edu	37	5	45645328	45645328	+	Nonsense_Mutation	SNP	G	G	A	rs541911994		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr5:45645328G>A	ENST00000303230.4	-	2	865	c.808C>T	c.(808-810)Cga>Tga	p.R270*		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	270					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CTTGAAAGTCGTAATAAACGC	0.328													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17394	0.0		0.0	False		,,,				2504	0.0																0													44.0	44.0	44.0					5																	45645328		2203	4300	6503	SO:0001587	stop_gained	0			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.808C>T	5.37:g.45645328G>A	ENSP00000307342:p.Arg270*			Nonsense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.R270*	ENST00000303230.4	37	c.808	CCDS3952.1	5	.	.	.	.	.	.	.	.	.	.	G	37	6.383656	0.97524	.	.	ENSG00000164588	ENST00000303230	.	.	.	5.5	5.5	0.81552	.	0.000000	0.51477	D	0.000099	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.403	0.94639	0.0:0.0:1.0:0.0	.	.	.	.	X	270	.	ENSP00000307342:R270X	R	-	1	2	HCN1	45681085	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.225000	0.51246	2.589000	0.87451	0.650000	0.86243	CGA	HCN1	-	pfam_Ion_trans_dom	ENSG00000164588		0.328	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN1	HGNC	protein_coding	OTTHUMT00000253847.1	-	0.00	98	0	G	NM_021072		45645328	-1	tier1	-	no_errors	ENST00000303230	ensembl	human	known	74_37	nonsense	16.67	90	18	SNP	1.000	A
HDAC9	9734	genome.wustl.edu	37	7	19015467	19015467	+	Silent	SNP	A	A	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr7:19015467A>C	ENST00000441542.2	+	24	3061	c.3061A>C	c.(3061-3063)Agg>Cgg	p.R1021R	HDAC9_ENST00000401921.1_Silent_p.R977R|HDAC9_ENST00000406451.4_Silent_p.R1018R	NM_178425.2	NP_848512.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	0					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	GGCTGTGCCAAGGGGCTGTGC	0.478																																																	0													117.0	129.0	125.0					7																	19015467		2105	4235	6340	SO:0001819	synonymous_variant	0			AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000441542.2:c.3061A>C	7.37:g.19015467A>C			A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Silent	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.R1021	ENST00000441542.2	37	c.3061	CCDS47553.1	7																																																																																			HDAC9	-	pirsf_Histone_deAcase_II_euk	ENSG00000048052		0.478	HDAC9-021	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HDAC9	HGNC	protein_coding	OTTHUMT00000376088.1	-	0.00	85	0	A			19015467	+1	tier1	-	no_errors	ENST00000441542	ensembl	human	known	74_37	silent	8.99	81	8	SNP	0.999	C
HDDC3	374659	genome.wustl.edu	37	15	91475176	91475176	+	Splice_Site	SNP	T	T	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr15:91475176T>C	ENST00000394272.3	-	3	197		c.e3-2		AC068831.3_ENST00000448987.1_RNA|HDDC3_ENST00000330334.3_Splice_Site|UNC45A_ENST00000394275.2_Intron|HDDC3_ENST00000559898.1_Splice_Site|AC068831.3_ENST00000438890.1_RNA			Q8N4P3	MESH1_HUMAN	HD domain containing 3								guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity (GO:0008893)|metal ion binding (GO:0046872)			NS(1)|ovary(1)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			CAGGGCCGCCTGGGGACAAGT	0.627											OREG0023475	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													64.0	61.0	62.0					15																	91475176		2198	4298	6496	SO:0001630	splice_region_variant	0			AK057584	CCDS10366.1, CCDS66866.1	15q26.1	2005-08-22			ENSG00000184508	ENSG00000184508			30522	protein-coding gene	gene with protein product						12477932	Standard	NM_001286451		Approved	MGC45386	uc002bqe.4	Q8N4P3	OTTHUMG00000141260	ENST00000394272.3:c.169-2A>G	15.37:g.91475176T>C		1282		Splice_Site	SNP	-	e3-2	ENST00000394272.3	37	c.169-2		15	.	.	.	.	.	.	.	.	.	.	T	17.75	3.467007	0.63625	.	.	ENSG00000184508	ENST00000394272;ENST00000330334	.	.	.	4.66	4.66	0.58398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1147	0.59294	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	HDDC3	89276180	1.000000	0.71417	0.964000	0.40570	0.750000	0.42670	7.088000	0.76901	1.957000	0.56846	0.454000	0.30748	.	HDDC3	-	-	ENSG00000184508		0.627	HDDC3-002	KNOWN	basic|appris_principal	protein_coding	HDDC3	HGNC	protein_coding	OTTHUMT00000280403.2	-	0.00	73	0	T	NM_198527	Intron	91475176	-1	tier1	-	no_errors	ENST00000394272	ensembl	human	known	74_37	splice_site	5.26	72	4	SNP	1.000	C
HNRNPR	10236	genome.wustl.edu	37	1	23636874	23636875	+	3'UTR	INS	-	-	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:23636874_23636875insT	ENST00000374612.1	-	0	2097_2098				HNRNPR_ENST00000606561.1_3'UTR|HNRNPR_ENST00000374616.3_3'UTR|HNRNPR_ENST00000427764.2_3'UTR|HNRNPR_ENST00000476660.1_5'UTR|HNRNPR_ENST00000302271.6_3'UTR|HNRNPR_ENST00000478691.1_3'UTR	NM_001102398.1|NM_005826.3	NP_001095868.1|NP_005817.1	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		AGTTAAGCCAATTTTTTTTTTT	0.347																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF000364	CCDS232.1, CCDS44085.1, CCDS60020.1, CCDS72726.1, CCDS72727.1	1p36.12	2013-02-12		2007-08-16	ENSG00000125944	ENSG00000125944		"""RNA binding motif (RRM) containing"""	5047	protein-coding gene	gene with protein product		607201		HNRPR		9421497	Standard	XM_005245711		Approved	hnRNP-R	uc001bgp.4	O43390	OTTHUMG00000003224	ENST00000374612.1:c.*73->A	1.37:g.23636885_23636885dupT			Q2L7G6|Q5TEH1|Q9BV64|S4R3J4	RNA	INS	-	NULL	ENST00000374612.1	37	NULL	CCDS232.1	1																																																																																			HNRNPR	-	-	ENSG00000125944		0.347	HNRNPR-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	HNRNPR	HGNC	protein_coding	OTTHUMT00000008889.1		0.00	36	0	-	NM_005826		23636875	-1	tier1		no_errors	ENST00000476660	ensembl	human	known	74_37	rna	8.33	33	3	INS	0.973:0.936	T
IL19	29949	genome.wustl.edu	37	1	207010152	207010152	+	Splice_Site	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:207010152G>A	ENST00000270218.6	+	3	1083		c.e3+1		IL19_ENST00000340758.2_Splice_Site	NM_013371.3	NP_037503.2	Q9UHD0	IL19_HUMAN	interleukin 19						apoptotic process (GO:0006915)|immune response (GO:0006955)|interleukin-6 biosynthetic process (GO:0042226)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|reactive oxygen species metabolic process (GO:0072593)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)			central_nervous_system(2)|large_intestine(1)|lung(2)|ovary(1)|stomach(1)	7			BRCA - Breast invasive adenocarcinoma(75;0.211)			AAGAGCCATCGTGAGTATGGG	0.438																																																	0													155.0	148.0	150.0					1																	207010152		2203	4300	6503	SO:0001630	splice_region_variant	0			AF192498	CCDS1468.1, CCDS1469.1	1q32.2	2008-07-18			ENSG00000142224	ENSG00000142224		"""Interleukins and interleukin receptors"""	5990	protein-coding gene	gene with protein product	"""melanoma differentiation associated protein-like protein"""	605687				11196675	Standard	NM_153758		Approved	IL-19, MDA1, ZMDA1, IL-10C, NG.1	uc001heo.3	Q9UHD0	OTTHUMG00000036387	ENST00000270218.6:c.144+1G>A	1.37:g.207010152G>A			B6VEV9|Q5VUT3|Q96QR4|Q9NUA0	Splice_Site	SNP	-	e2+1	ENST00000270218.6	37	c.258+1	CCDS1469.1	1	.	.	.	.	.	.	.	.	.	.	G	17.54	3.414954	0.62511	.	.	ENSG00000142224	ENST00000340758;ENST00000270218	.	.	.	5.4	5.4	0.78164	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6813	0.69020	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	IL19	205076775	0.999000	0.42202	0.950000	0.38849	0.902000	0.53008	4.489000	0.60309	2.533000	0.85409	0.561000	0.74099	.	IL19	-	-	ENSG00000142224		0.438	IL19-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL19	HGNC	protein_coding	OTTHUMT00000088567.2	-	0.00	106	0	G	NM_153758	Intron	207010152	+1	tier1	-	no_errors	ENST00000340758	ensembl	human	known	74_37	splice_site	9.20	79	8	SNP	0.981	A
IPO11	51194	genome.wustl.edu	37	5	61778953	61778954	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr5:61778953_61778954insT	ENST00000325324.6	+	10	1023_1024	c.854_855insT	c.(853-858)ccttttfs	p.PF285fs	IPO11_ENST00000409296.3_Frame_Shift_Ins_p.PF325fs|KIF2A_ENST00000509663.2_Intron	NM_016338.4	NP_057422.3	Q9UI26	IPO11_HUMAN	importin 11	285					ribosomal protein import into nucleus (GO:0006610)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			endometrium(2)|kidney(3)|large_intestine(5)|lung(14)|skin(4)|stomach(2)	30		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		GATCAGCATCCTTTTTCATTTA	0.307																																																	0																																										SO:0001589	frameshift_variant	0			AF111109	CCDS34167.1, CCDS47217.1	5q12.1	2008-09-19			ENSG00000086200	ENSG00000086200		"""Importins"""	20628	protein-coding gene	gene with protein product		610889					Standard	NM_016338		Approved	RanBP11	uc011cqr.2	Q9UI26	OTTHUMG00000154400	ENST00000325324.6:c.859dupT	5.37:g.61778958_61778958dupT	ENSP00000316651:p.Pro285fs		A6NGJ5|B4DZ73|D3DW98|Q8N5R2|Q9NSJ6|Q9NVB1	Frame_Shift_Ins	INS	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.S327fs	ENST00000325324.6	37	c.974_975	CCDS34167.1	5																																																																																			IPO11	-	superfamily_ARM-type_fold	ENSG00000086200		0.307	IPO11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO11	HGNC	protein_coding	OTTHUMT00000335062.1		0.00	19	0	-	NM_016338		61778954	+1	tier1		no_errors	ENST00000409296	ensembl	human	known	74_37	frame_shift_ins	13.79	25	4	INS	1.000:0.955	T
IRF1	3659	genome.wustl.edu	37	5	131821980	131821980	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr5:131821980G>T	ENST00000245414.4	-	7	888	c.630C>A	c.(628-630)taC>taA	p.Y210*	IRF1_ENST00000463784.1_5'Flank|IRF1_ENST00000405885.2_Nonsense_Mutation_p.Y210*	NM_002198.2	NP_002189.1	P10914	IRF1_HUMAN	interferon regulatory factor 1	210					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell cycle arrest (GO:0007050)|cellular response to interferon-beta (GO:0035458)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000564)|regulation of cell cycle (GO:0051726)|regulation of innate immune response (GO:0045088)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		CCTGGAAGTTGTACAGATCAC	0.602																																																	0													93.0	99.0	97.0					5																	131821980		2203	4300	6503	SO:0001587	stop_gained	0				CCDS4155.1	5q23-q31	2008-07-18			ENSG00000125347	ENSG00000125347			6116	protein-coding gene	gene with protein product	"""interferon regulatory factor-1"""	147575				2726461, 1680796	Standard	NM_002198		Approved	MAR	uc003kxa.2	P10914	OTTHUMG00000059497	ENST00000245414.4:c.630C>A	5.37:g.131821980G>T	ENSP00000245414:p.Tyr210*		Q96GG7	Nonsense_Mutation	SNP	pfam_Interferon_reg_fact_DNA-bd_dom,smart_Interferon_reg_fact_DNA-bd_dom,pirsf_Interferon_reg_fac-1/2,prints_Interferon_reg_fact_DNA-bd_dom	p.Y210*	ENST00000245414.4	37	c.630	CCDS4155.1	5	.	.	.	.	.	.	.	.	.	.	G	34	5.322668	0.95708	.	.	ENSG00000125347	ENST00000245414;ENST00000405885	.	.	.	5.35	2.56	0.30785	.	0.159722	0.44902	D	0.000419	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.0321	11.1821	0.48633	0.2025:0.0:0.7975:0.0	.	.	.	.	X	210	.	ENSP00000245414:Y210X	Y	-	3	2	IRF1	131849879	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.044000	0.30329	0.466000	0.27193	0.655000	0.94253	TAC	IRF1	-	pirsf_Interferon_reg_fac-1/2	ENSG00000125347		0.602	IRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF1	HGNC	protein_coding	OTTHUMT00000132340.1		0.00	39	0	G	NM_002198		131821980	-1			no_errors	ENST00000245414	ensembl	human	known	74_37	nonsense	5.71	33	2	SNP	1.000	T
ITGB5	3693	genome.wustl.edu	37	3	124482499	124482499	+	Missense_Mutation	SNP	T	T	A	rs150512726|rs140998759|rs547715576	byFrequency	TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr3:124482499T>A	ENST00000296181.4	-	15	2667	c.2371A>T	c.(2371-2373)Aac>Tac	p.N791Y	ITGB5_ENST00000461306.1_5'Flank	NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	791				Missing (in Ref. 2; AAA52707). {ECO:0000305}.	antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		TAGGATTTGTTGAACTTGTTG	0.512																																																	0													190.0	145.0	161.0					3																	124482499		2203	4300	6503	SO:0001583	missense	0			J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.2371A>T	3.37:g.124482499T>A	ENSP00000296181:p.Asn791Tyr		B0LPF8|B2RD70	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_cyt_dom,pfam_Integrin_bsu_tail,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like_fold,smart_Integrin_bsu_N,smart_VWF_A,prints_Integrin_bsu	p.N791Y	ENST00000296181.4	37	c.2371	CCDS3030.1	3	.	.	.	.	.	.	.	.	.	.	T	20.5	3.995203	0.74703	.	.	ENSG00000082781	ENST00000296181	D	0.91237	-2.81	5.68	5.68	0.88126	.	0.335272	0.33895	N	0.004448	D	0.87051	0.6081	N	0.08118	0	0.30790	N	0.741075	D	0.57899	0.981	P	0.54174	0.744	D	0.87377	0.2354	10	0.72032	D	0.01	.	14.5079	0.67764	0.0:0.0:0.0:1.0	.	791	P18084	ITB5_HUMAN	Y	791	ENSP00000296181:N791Y	ENSP00000296181:N791Y	N	-	1	0	ITGB5	125965189	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	3.153000	0.50685	2.172000	0.68678	0.533000	0.62120	AAC	ITGB5	-	NULL	ENSG00000082781		0.512	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB5	HGNC	protein_coding	OTTHUMT00000355286.3		0.00	34	0	T	NM_002213		124482499	-1			no_errors	ENST00000296181	ensembl	human	known	74_37	missense	14.58	40	7	SNP	1.000	A
KCTD7	154881	genome.wustl.edu	37	7	66104098	66104098	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr7:66104098C>T	ENST00000275532.3	+	4	933	c.749C>T	c.(748-750)aCg>aTg	p.T250M	KCTD7_ENST00000443322.1_Missense_Mutation_p.T250M	NM_001167961.2|NM_153033.4	NP_001161433.1|NP_694578.1	Q96MP8	KCTD7_HUMAN	potassium channel tetramerization domain containing 7	250					cell death (GO:0008219)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|urinary_tract(1)	16						TGCCTGGTCACGGACCTCTCG	0.582																																																	0													150.0	105.0	121.0					7																	66104098		2203	4300	6503	SO:0001583	missense	0			AK056631	CCDS5534.1, CCDS55117.1	7q11.21	2014-09-17	2013-06-20		ENSG00000243335	ENSG00000243335			21957	protein-coding gene	gene with protein product		611725	"""potassium channel tetramerisation domain containing 7"""			12477932	Standard	NM_001167961		Approved	FLJ32069, EPM3, CLN14	uc003tve.3	Q96MP8	OTTHUMG00000129543	ENST00000275532.3:c.749C>T	7.37:g.66104098C>T	ENSP00000275532:p.Thr250Met		A4D2M4|Q8IVR0	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.T250M	ENST00000275532.3	37	c.749	CCDS5534.1	7	.	.	.	.	.	.	.	.	.	.	C	7.652	0.683131	0.14907	.	.	ENSG00000243335	ENST00000275532;ENST00000443322	T;T	0.63255	-0.02;-0.03	5.47	5.47	0.80525	.	.	.	.	.	T	0.45135	0.1327	N	0.03983	-0.305	0.80722	D	1	D	0.61080	0.989	P	0.47470	0.548	T	0.46748	-0.9169	9	0.13108	T	0.6	.	18.3248	0.90250	0.0:1.0:0.0:0.0	.	250	Q96MP8	KCTD7_HUMAN	M	250	ENSP00000275532:T250M;ENSP00000411624:T250M	ENSP00000275532:T250M	T	+	2	0	KCTD7	65741533	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.824000	0.62701	2.573000	0.86826	0.655000	0.94253	ACG	KCTD7	-	NULL	ENSG00000243335		0.582	KCTD7-001	KNOWN	basic|CCDS	protein_coding	KCTD7	HGNC	protein_coding	OTTHUMT00000251733.2	-	0.00	42	0	C	NM_153033		66104098	+1	tier1	-	no_errors	ENST00000275532	ensembl	human	known	74_37	missense	12.50	35	5	SNP	1.000	T
KDM5A	5927	genome.wustl.edu	37	12	404795	404795	+	Missense_Mutation	SNP	G	G	A	rs375955542		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr12:404795G>A	ENST00000399788.2	-	26	4761	c.4399C>T	c.(4399-4401)Cgg>Tgg	p.R1467W	KDM5A_ENST00000382815.4_Missense_Mutation_p.R1467W|KDM5A_ENST00000540838.1_5'Flank	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	1467					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						TGCAAAATCCGCCATATGTGT	0.438			T	NUP98	AML																																			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	0								G	TRP/ARG	0,3850		0,0,1925	193.0	186.0	188.0		4399	2.3	1.0	12		188	1,8269		0,1,4134	no	missense	KDM5A	NM_001042603.1	101	0,1,6059	AA,AG,GG		0.0121,0.0,0.0083	probably-damaging	1467/1691	404795	1,12119	1925	4135	6060	SO:0001583	missense	0				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.4399C>T	12.37:g.404795G>A	ENSP00000382688:p.Arg1467Trp		A8MV76|Q4LE72|Q86XZ1	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.R1467W	ENST00000399788.2	37	c.4399	CCDS41736.1	12	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935671	0.73442	0.0	1.21E-4	ENSG00000073614	ENST00000399788;ENST00000382815	D;D	0.89617	-2.54;-2.46	5.42	2.27	0.28462	.	0.000000	0.85682	D	0.000000	D	0.92964	0.7761	M	0.67397	2.05	0.48135	D	0.999599	D;D	0.89917	1.0;1.0	D;D	0.83275	0.99;0.996	D	0.93173	0.6568	10	0.87932	D	0	-14.7528	14.2157	0.65792	0.0:0.0:0.4989:0.5011	.	1467;1467	P29375;P29375-2	KDM5A_HUMAN;.	W	1467	ENSP00000382688:R1467W;ENSP00000372265:R1467W	ENSP00000372265:R1467W	R	-	1	2	KDM5A	275056	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.230000	0.42999	0.693000	0.31634	0.561000	0.74099	CGG	KDM5A	-	NULL	ENSG00000073614		0.438	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5A	HGNC	protein_coding	OTTHUMT00000397812.1		0.00	83	0	G	NM_005056		404795	-1			no_errors	ENST00000399788	ensembl	human	known	74_37	missense	5.95	79	5	SNP	1.000	A
KIAA2026	158358	genome.wustl.edu	37	9	5968044	5968044	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr9:5968044delT	ENST00000399933.3	-	3	2186	c.2187delA	c.(2185-2187)aaafs	p.K729fs	KIAA2026_ENST00000381461.2_Frame_Shift_Del_p.K729fs	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	729	Lys-rich.							p.A730fs*15(1)		breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TGTGTTTTGCTTTTTTTTTGA	0.323																																																	1	Insertion - Frameshift(1)	central_nervous_system(1)								62,50,3390		0,0,62,0,50,1639	21.0	21.0	21.0			5.0	1.0	9		21	131,99,7540		2,0,127,0,99,3657	no	codingComplex	KIAA2026	NM_001017969.2		2,0,189,0,149,5296	A1A1,A1A2,A1R,A2A2,A2R,RR		2.9601,3.1982,3.0341			5968044	193,149,10930	1814	4062	5876	SO:0001589	frameshift_variant	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2187delA	9.37:g.5968044delT	ENSP00000382815:p.Lys729fs		A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Frame_Shift_Del	DEL	superfamily_Bromodomain	p.A730fs	ENST00000399933.3	37	c.2187		9																																																																																			KIAA2026	-	NULL	ENSG00000183354		0.323	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2		0.00	44	0	T	NM_001017969		5968044	-1	tier1		no_errors	ENST00000399933	ensembl	human	novel	74_37	frame_shift_del	10.26	35	4	DEL	1.000	-
KIF6	221458	genome.wustl.edu	37	6	39513390	39513390	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr6:39513390C>T	ENST00000287152.7	-	11	1350	c.1256G>A	c.(1255-1257)cGt>cAt	p.R419H	KIF6_ENST00000373213.4_Missense_Mutation_p.R258H|KIF6_ENST00000373216.3_Missense_Mutation_p.R419H|KIF6_ENST00000538893.1_Missense_Mutation_p.R419H|KIF6_ENST00000373215.3_Missense_Mutation_p.R419H	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	419					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						ATGAACTTTACGCATATCCGC	0.358																																																	0													110.0	107.0	108.0					6																	39513390		2203	4300	6503	SO:0001583	missense	0			AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1256G>A	6.37:g.39513390C>T	ENSP00000287152:p.Arg419His		Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R419H	ENST00000287152.7	37	c.1256	CCDS4844.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.7|22.7	4.326967|4.326967	0.81690|0.81690	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373213;ENST00000373215;ENST00000538893|ENST00000458470	T;T;T;T;T|.	0.73047|.	-0.69;-0.68;-0.53;-0.69;-0.71|.	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	.|.	.|.	.|.	.|.	T|T	0.67439|0.67439	0.2893|0.2893	M|M	0.73217|0.73217	2.22|2.22	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.999;1.0;1.0|.	D;D;D;D|.	0.85130|.	0.997;0.962;0.975;0.994|.	T|T	0.67273|0.67273	-0.5712|-0.5712	9|5	0.56958|.	D|.	0.05|.	.|.	15.0307|15.0307	0.71705|0.71705	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	419;419;419;419|.	E7EUN7;F6VGH2;Q6ZMV9-3;Q6ZMV9|.	.;.;.;KIF6_HUMAN|.	H|I	419;419;258;419;419|311	ENSP00000287152:R419H;ENSP00000362312:R419H;ENSP00000362309:R258H;ENSP00000362311:R419H;ENSP00000441435:R419H|.	ENSP00000287152:R419H|.	R|V	-|-	2|1	0|0	KIF6|KIF6	39621368|39621368	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.889000|0.889000	0.51656|0.51656	4.095000|4.095000	0.57728|0.57728	2.609000|2.609000	0.88269|0.88269	0.561000|0.561000	0.74099|0.74099	CGT|GTA	KIF6	-	NULL	ENSG00000164627		0.358	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF6	HGNC	protein_coding	OTTHUMT00000040455.2	-	0.00	86	0	C	NM_145027		39513390	-1	tier1	-	no_errors	ENST00000287152	ensembl	human	known	74_37	missense	5.77	98	6	SNP	1.000	T
KLF12	11278	genome.wustl.edu	37	13	74518163	74518163	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr13:74518163C>A	ENST00000377669.2	-	2	104	c.78G>T	c.(76-78)atG>atT	p.M26I	KLF12_ENST00000377666.4_Missense_Mutation_p.M26I|KLF12_ENST00000472022.1_5'UTR	NM_007249.4	NP_009180.3	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	26					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		TGACTGCCGGCATCCCATCAA	0.433																																																	0													136.0	120.0	125.0					13																	74518163		2203	4300	6503	SO:0001583	missense	0			AJ243274	CCDS9449.1	13q22	2013-01-08			ENSG00000118922	ENSG00000118922		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6346	protein-coding gene	gene with protein product	"""KLF12 zinc finger transcriptional repressor"", ""AP-2rep transcription factor"", ""AP-2 repressor"""	607531				10704285	Standard	NM_007249		Approved	AP-2rep, HSPC122, AP2REP	uc001vjf.3	Q9Y4X4	OTTHUMG00000017078	ENST00000377669.2:c.78G>T	13.37:g.74518163C>A	ENSP00000366897:p.Met26Ile		A8K5T2|L0R3J4|Q5VZM7|Q9UHZ0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M26I	ENST00000377669.2	37	c.78	CCDS9449.1	13	.	.	.	.	.	.	.	.	.	.	C	17.59	3.427408	0.62733	.	.	ENSG00000118922	ENST00000377669;ENST00000342812;ENST00000377666	T;T	0.01446	4.88;4.88	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.03915	0.0110	L	0.34521	1.04	0.54753	D	0.999988	B	0.30211	0.273	B	0.42214	0.38	T	0.56798	-0.7919	10	0.59425	D	0.04	.	18.2409	0.89967	0.0:1.0:0.0:0.0	.	26	Q9Y4X4	KLF12_HUMAN	I	26	ENSP00000366897:M26I;ENSP00000366894:M26I	ENSP00000344057:M26I	M	-	3	0	KLF12	73416164	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.734000	0.74801	2.623000	0.88846	0.563000	0.77884	ATG	KLF12	-	NULL	ENSG00000118922		0.433	KLF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF12	HGNC	protein_coding	OTTHUMT00000045271.2	-	0.00	60	0	C	NM_007249		74518163	-1	tier1	-	no_errors	ENST00000377666	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
L1TD1	54596	genome.wustl.edu	37	1	62675655	62675657	+	In_Frame_Del	DEL	GGA	GGA	-	rs532563709|rs199552452		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	GGA	GGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:62675655_62675657delGGA	ENST00000498273.1	+	4	1504_1506	c.1209_1211delGGA	c.(1207-1212)ctggag>ctg	p.E409del	Y_RNA_ENST00000363304.1_RNA	NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	409	Glu-rich.									breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						CCTCAGGGCTggaggaggaggag	0.537																																																	0																																										SO:0001651	inframe_deletion	0			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.1209_1211delGGA	1.37:g.62675664_62675666delGGA	ENSP00000419901:p.Glu409del		Q8NDA1|Q9NUV8|Q9NV78	In_Frame_Del	DEL	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	p.E407in_frame_del	ENST00000498273.1	37	c.1209_1211	CCDS619.1	1																																																																																			L1TD1	-	NULL	ENSG00000240563		0.537	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	HGNC	protein_coding	OTTHUMT00000024688.1		0.00	33	0	GGA	NM_019079		62675657	+1	tier1		no_errors	ENST00000498273	ensembl	human	known	74_37	in_frame_del	8.51	43	4	DEL	0.002:0.001:0.000	-
LAMB4	22798	genome.wustl.edu	37	7	107748211	107748211	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr7:107748211G>T	ENST00000388781.3	-	6	539	c.456C>A	c.(454-456)aaC>aaA	p.N152K	LAMB4_ENST00000388780.3_Missense_Mutation_p.N152K|LAMB4_ENST00000414450.2_Missense_Mutation_p.N152K|LAMB4_ENST00000205386.4_Missense_Mutation_p.N152K|LAMB4_ENST00000418464.1_Missense_Mutation_p.N152K	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	152	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						ACACTTTCCAGTTGTGTCCAT	0.433																																																	0													112.0	108.0	109.0					7																	107748211		2203	4300	6503	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.456C>A	7.37:g.107748211G>T	ENSP00000373433:p.Asn152Lys		A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.N152K	ENST00000388781.3	37	c.456	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	G	15.76	2.928419	0.52759	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000388780;ENST00000418464;ENST00000414450	T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;-0.29;-0.29	5.86	-2.55	0.06288	Laminin, N-terminal (3);	0.240212	0.29100	N	0.013156	T	0.50086	0.1595	N	0.14661	0.345	0.19945	N	0.999944	B	0.15141	0.012	B	0.18871	0.023	T	0.41893	-0.9483	10	0.87932	D	0	.	5.5691	0.17187	0.0586:0.2769:0.2891:0.3755	.	152	A4D0S4	LAMB4_HUMAN	K	152	ENSP00000205386:N152K;ENSP00000373433:N152K;ENSP00000373432:N152K;ENSP00000402353:N152K;ENSP00000402265:N152K	ENSP00000205386:N152K	N	-	3	2	LAMB4	107535447	0.957000	0.32711	0.968000	0.41197	0.970000	0.65996	0.022000	0.13511	-0.158000	0.11040	0.655000	0.94253	AAC	LAMB4	-	pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,pfscan_Laminin_N	ENSG00000091128		0.433	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	-	0.00	97	0	G	XM_209857		107748211	-1	tier1	-	no_errors	ENST00000205386	ensembl	human	known	74_37	missense	6.33	74	5	SNP	0.979	T
LDOC1	23641	genome.wustl.edu	37	X	140271053	140271053	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chrX:140271053G>A	ENST00000370526.2	-	1	257	c.154C>T	c.(154-156)Ccc>Tcc	p.P52S	LDOC1_ENST00000460721.1_Intron	NM_012317.2	NP_036449.1	O95751	LDOC1_HUMAN	leucine zipper, down-regulated in cancer 1	52					negative regulation of cell proliferation (GO:0008285)	nucleus (GO:0005634)				endometrium(6)|large_intestine(1)|lung(6)|ovary(1)	14	Acute lymphoblastic leukemia(192;7.65e-05)					TCGGGGAAGGGCACCGGGCAG	0.622																																																	0													38.0	34.0	35.0					X																	140271053		2203	4300	6503	SO:0001583	missense	0			AB019527	CCDS14672.1	Xq27	2008-02-05			ENSG00000182195	ENSG00000182195			6548	protein-coding gene	gene with protein product		300402		BCUR1		10403563, 15716091, 16093683	Standard	NM_012317		Approved	Mar7, Mart7	uc004fbj.3	O95751	OTTHUMG00000022558	ENST00000370526.2:c.154C>T	X.37:g.140271053G>A	ENSP00000359557:p.Pro52Ser		Q6IAR6	Missense_Mutation	SNP	NULL	p.P52S	ENST00000370526.2	37	c.154	CCDS14672.1	X	.	.	.	.	.	.	.	.	.	.	.	14.30	2.494352	0.44352	.	.	ENSG00000182195	ENST00000370526	T	0.34275	1.37	3.61	3.61	0.41365	.	0.122358	0.35378	N	0.003244	T	0.34308	0.0893	L	0.46157	1.445	0.26568	N	0.973607	P	0.47106	0.89	P	0.46758	0.526	T	0.11494	-1.0585	10	0.29301	T	0.29	-9.9458	9.7936	0.40722	0.0:0.0:1.0:0.0	.	52	O95751	LDOC1_HUMAN	S	52	ENSP00000359557:P52S	ENSP00000359557:P52S	P	-	1	0	LDOC1	140098719	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.066000	0.57520	2.060000	0.61445	0.287000	0.19450	CCC	LDOC1	-	NULL	ENSG00000182195		0.622	LDOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDOC1	HGNC	protein_coding	OTTHUMT00000058592.1		0.00	49	0	G	NM_012317		140271053	-1			no_errors	ENST00000370526	ensembl	human	known	74_37	missense	6.35	58	4	SNP	1.000	A
LECT1	11061	genome.wustl.edu	37	13	53277879	53277879	+	Missense_Mutation	SNP	A	A	G	rs370148794		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr13:53277879A>G	ENST00000377962.3	-	7	934	c.856T>C	c.(856-858)Tgt>Cgt	p.C286R	LECT1_ENST00000448904.2_Missense_Mutation_p.C285R			O75829	LECT1_HUMAN	leukocyte cell derived chemotaxin 1	286					cartilage development (GO:0051216)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|proteoglycan metabolic process (GO:0006029)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)		CTCCGCCTACATTCTATACAA	0.473																																																	0								A	ARG/CYS,ARG/CYS	0,4406		0,0,2203	91.0	88.0	89.0		853,856	4.2	0.8	13		89	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	LECT1	NM_001011705.1,NM_007015.2	180,180	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	probably-damaging,probably-damaging	285/334,286/335	53277879	1,13005	2203	4300	6503	SO:0001583	missense	0			AB006000	CCDS9437.1, CCDS45051.1	13q14.3	2012-10-10			ENSG00000136110	ENSG00000136110		"""BRICHOS domain containing"""	17005	protein-coding gene	gene with protein product	"""BRICHOS domain containing 3"""	605147	"""multiple myeloma tumor suppressor 1"""	MYETS1		9731231, 10103018	Standard	XM_006719760		Approved	CHM-I, CHM1, chondromodulin, BRICD3	uc001vhf.2	O75829	OTTHUMG00000016980	ENST00000377962.3:c.856T>C	13.37:g.53277879A>G	ENSP00000367198:p.Cys286Arg		Q5TAM4|Q8TAY6|Q9UM18	Missense_Mutation	SNP	pfam_BRICHOS_dom,pfscan_BRICHOS_dom	p.C286R	ENST00000377962.3	37	c.856	CCDS9437.1	13	.	.	.	.	.	.	.	.	.	.	A	20.4	3.983359	0.74474	0.0	1.16E-4	ENSG00000136110	ENST00000448904;ENST00000377962	T;T	0.66815	-0.19;-0.23	5.45	4.25	0.50352	.	0.043057	0.85682	D	0.000000	T	0.80470	0.4629	M	0.79926	2.475	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.69142	0.962;0.916	T	0.82426	-0.0463	10	0.87932	D	0	.	11.843	0.52366	0.8688:0.0:0.0:0.1312	.	285;286	O75829-2;O75829	.;LECT1_HUMAN	R	285;286	ENSP00000388576:C285R;ENSP00000367198:C286R	ENSP00000367198:C286R	C	-	1	0	LECT1	52175880	1.000000	0.71417	0.791000	0.31998	0.998000	0.95712	8.761000	0.91691	1.055000	0.40461	0.477000	0.44152	TGT	LECT1	-	NULL	ENSG00000136110		0.473	LECT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LECT1	HGNC	protein_coding	OTTHUMT00000045110.3	-	0.00	54	0	A			53277879	-1	tier1	-	no_errors	ENST00000377962	ensembl	human	known	74_37	missense	17.72	65	14	SNP	1.000	G
LECT1	11061	genome.wustl.edu	37	13	53298171	53298171	+	Silent	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr13:53298171C>T	ENST00000377962.3	-	4	507	c.429G>A	c.(427-429)gaG>gaA	p.E143E	LECT1_ENST00000448904.2_Silent_p.E143E			O75829	LECT1_HUMAN	leukocyte cell derived chemotaxin 1	143	BRICHOS. {ECO:0000255|PROSITE- ProRule:PRU00255}.				cartilage development (GO:0051216)|endothelial cell morphogenesis (GO:0001886)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|proteoglycan metabolic process (GO:0006029)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|urinary_tract(1)	15		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.38e-08)		CGGCGCCCACCTCAGGAATAC	0.483																																																	0													158.0	117.0	131.0					13																	53298171		2203	4300	6503	SO:0001819	synonymous_variant	0			AB006000	CCDS9437.1, CCDS45051.1	13q14.3	2012-10-10			ENSG00000136110	ENSG00000136110		"""BRICHOS domain containing"""	17005	protein-coding gene	gene with protein product	"""BRICHOS domain containing 3"""	605147	"""multiple myeloma tumor suppressor 1"""	MYETS1		9731231, 10103018	Standard	XM_006719760		Approved	CHM-I, CHM1, chondromodulin, BRICD3	uc001vhf.2	O75829	OTTHUMG00000016980	ENST00000377962.3:c.429G>A	13.37:g.53298171C>T			Q5TAM4|Q8TAY6|Q9UM18	Silent	SNP	pfam_BRICHOS_dom,pfscan_BRICHOS_dom	p.E143	ENST00000377962.3	37	c.429	CCDS9437.1	13																																																																																			LECT1	-	pfam_BRICHOS_dom,pfscan_BRICHOS_dom	ENSG00000136110		0.483	LECT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LECT1	HGNC	protein_coding	OTTHUMT00000045110.3	-	0.00	42	0	C			53298171	-1	tier1	-	no_errors	ENST00000377962	ensembl	human	known	74_37	silent	16.18	57	11	SNP	0.993	T
LINC00272	388719	genome.wustl.edu	37	1	182377033	182377033	+	lincRNA	SNP	A	A	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:182377033A>C	ENST00000367563.3	+	0	278					NR_034131.1				long intergenic non-protein coding RNA 272																		AAGAAGCCAAAGGTGGTGAAT	0.448																																																	0																																												0			AF508909		1q25.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000203729	ENSG00000203729		"""Long non-coding RNAs"""	26898	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 120"", ""non-protein coding RNA 272"""	C1orf120, NCRNA00272		12801632	Standard	NR_034131		Approved	RP1-223H12.3	uc009wxv.1		OTTHUMG00000037402		1.37:g.182377033A>C				RNA	SNP	-	NULL	ENST00000367563.3	37	NULL		1																																																																																			LINC00272	-	-	ENSG00000203729		0.448	LINC00272-001	KNOWN	basic	lincRNA	LINC00272	HGNC	lincRNA	OTTHUMT00000091036.2	-	0.00	75	0	A	NM_001010899		182377033	+1	tier1	-	no_errors	ENST00000367563	ensembl	human	known	74_37	rna	11.48	54	7	SNP	0.024	C
LOC643733	643733	genome.wustl.edu	37	11	104779415	104779418	+	RNA	DEL	CACA	CACA	-	rs111659193|rs369096286|rs67326622|rs58526794	byFrequency	TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	CACA	CACA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr11:104779415_104779418delCACA	ENST00000532510.1	-	0	14_17																											TTTTTTGCATcacacacacacaca	0.358														1196	0.238818	0.2685	0.3242	5008	,	,		15996	0.1647		0.2227	False		,,,				2504	0.2311																0																																												0																															11.37:g.104779423_104779426delCACA				RNA	DEL	-	NULL	ENST00000532510.1	37	NULL		11																																																																																			RP11-693N9.2	-	-	ENSG00000235505		0.358	RP11-693N9.2-004	KNOWN	basic	processed_transcript	LOC643733	Clone_based_vega_gene	pseudogene	OTTHUMT00000387738.1		0.00	10	0	CACA			104779418	-1	tier1		no_errors	ENST00000530264	ensembl	human	known	74_37	rna	38.46	8	5	DEL	0.000:0.000:0.000:0.000	-
LRP1B	53353	genome.wustl.edu	37	2	141459407	141459407	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:141459407C>T	ENST00000389484.3	-	40	7281	c.6310G>A	c.(6310-6312)Gca>Aca	p.A2104T		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2104					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.A2104S(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GACCCGTTTGCATGTGCTCTG	0.418										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												1	Substitution - Missense(1)	lung(1)											158.0	144.0	149.0					2																	141459407		2203	4300	6503	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6310G>A	2.37:g.141459407C>T	ENSP00000374135:p.Ala2104Thr		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.A2104T	ENST00000389484.3	37	c.6310	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393281	0.62066	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.89939	-2.59	5.24	5.24	0.73138	Six-bladed beta-propeller, TolB-like (1);	0.076531	0.51477	U	0.000083	D	0.83156	0.5193	L	0.51914	1.62	0.37179	D	0.903429	P	0.39282	0.666	B	0.33339	0.162	T	0.83194	-0.0082	10	0.15066	T	0.55	.	13.7473	0.62883	0.1538:0.8462:0.0:0.0	.	2104	Q9NZR2	LRP1B_HUMAN	T	2104;2042	ENSP00000374135:A2104T	ENSP00000374135:A2104T	A	-	1	0	LRP1B	141175877	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.629000	0.54266	2.424000	0.82194	0.563000	0.77884	GCA	LRP1B	-	smart_LDLR_classB_rpt	ENSG00000168702		0.418	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	49	0	C	NM_018557		141459407	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	T
LTBP2	4053	genome.wustl.edu	37	14	75022360	75022360	+	Silent	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr14:75022360C>T	ENST00000261978.4	-	4	1253	c.867G>A	c.(865-867)caG>caA	p.Q289Q	LTBP2_ENST00000556690.1_Silent_p.Q289Q|CTD-2207P18.1_ENST00000554552.1_lincRNA|LTBP2_ENST00000557425.1_Intron	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	289					protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CCACGTGCTGCTGGGAAGGGT	0.662																																																	0													53.0	56.0	55.0					14																	75022360		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.867G>A	14.37:g.75022360C>T			Q99907|Q9NS51	Silent	SNP	pfam_EGF-like_Ca-bd_dom,pfam_TB_dom,pfam_EG-like_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.Q289	ENST00000261978.4	37	c.867	CCDS9831.1	14																																																																																			LTBP2	-	NULL	ENSG00000119681		0.662	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP2	HGNC	protein_coding	OTTHUMT00000413595.1		0.00	34	0	C	NM_000428		75022360	-1			no_errors	ENST00000261978	ensembl	human	known	74_37	silent	5.41	35	2	SNP	1.000	T
LYZ	4069	genome.wustl.edu	37	12	69746033	69746033	+	Missense_Mutation	SNP	C	C	T	rs139882444		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr12:69746033C>T	ENST00000261267.2	+	3	403	c.335C>T	c.(334-336)gCt>gTt	p.A112V	RP11-1143G9.4_ENST00000548900.1_RNA|LYZ_ENST00000549690.1_Intron	NM_000239.2	NP_000230.1	P61626	LYSC_HUMAN	lysozyme	112					cell wall macromolecule catabolic process (GO:0016998)|cytolysis (GO:0019835)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|retina homeostasis (GO:0001895)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|lysozyme activity (GO:0003796)			endometrium(2)|lung(1)|upper_aerodigestive_tract(1)	4	all_epithelial(5;2.98e-35)|Lung NSC(4;9.93e-33)|all_lung(4;5.66e-31)|Breast(13;2.56e-06)|Esophageal squamous(21;0.187)		Epithelial(6;8.26e-19)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00503)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)		L-Aspartic Acid(DB00128)	GATGCTGTAGCTTGTGCAAAG	0.353																																																	0													124.0	111.0	115.0					12																	69746033		2203	4300	6503	SO:0001583	missense	0			X14008	CCDS8989.1	12q15	2014-09-17	2010-04-29			ENSG00000090382	3.2.1.17		6740	protein-coding gene	gene with protein product	"""renal amyloidosis"""	153450	"""lysozyme (renal amyloidosis)"""			8464497, 2546758	Standard	NM_000239		Approved		uc001suw.2	P61626	OTTHUMG00000169342	ENST00000261267.2:c.335C>T	12.37:g.69746033C>T	ENSP00000261267:p.Ala112Val		P00695|Q13170|Q9UCF8	Missense_Mutation	SNP	pfam_Glyco_hydro_22,pfam_TGlycosylase-like_SLT,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22_lys,prints_Glyco_hydro_22	p.A112V	ENST00000261267.2	37	c.335	CCDS8989.1	12	.	.	.	.	.	.	.	.	.	.	C	11.24	1.580976	0.28180	.	.	ENSG00000090382	ENST00000261267	T	0.69926	-0.44	5.95	-4.77	0.03219	Lysozyme-like domain (1);Glycoside hydrolase, family 22, conserved site (1);	2.333380	0.01241	N	0.008600	T	0.56156	0.1966	L	0.56124	1.755	0.24750	N	0.992987	B	0.15141	0.012	B	0.18263	0.021	T	0.27226	-1.0080	9	.	.	.	.	3.2279	0.06739	0.4929:0.201:0.1832:0.123	.	112	P61626	LYSC_HUMAN	V	112	ENSP00000261267:A112V	.	A	+	2	0	LYZ	68032300	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-4.624000	0.00207	-0.396000	0.07703	-0.169000	0.13324	GCT	LYZ	-	pfam_Glyco_hydro_22,superfamily_Lysozyme-like_dom,smart_Glyco_hydro_22,prints_Glyco_hydro_22_lys,prints_Glyco_hydro_22	ENSG00000090382		0.353	LYZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYZ	HGNC	protein_coding	OTTHUMT00000403624.2	-	0.00	77	0	C	NM_000239		69746033	+1	tier1	-	no_errors	ENST00000261267	ensembl	human	known	74_37	missense	7.25	64	5	SNP	0.000	T
MACF1	23499	genome.wustl.edu	37	1	39951255	39951255	+	Missense_Mutation	SNP	G	G	A	rs554832714		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:39951255G>A	ENST00000372915.3	+	97	22043	c.21956G>A	c.(21955-21957)cGa>cAa	p.R7319Q	MACF1_ENST00000361689.2_Missense_Mutation_p.R5361Q|MACF1_ENST00000317713.7_Missense_Mutation_p.R5361Q|MACF1_ENST00000289893.4_Missense_Mutation_p.R5869Q|MACF1_ENST00000567887.1_Missense_Mutation_p.R7523Q|MACF1_ENST00000545844.1_Missense_Mutation_p.R5361Q|MACF1_ENST00000539005.1_Missense_Mutation_p.R5231Q|MACF1_ENST00000564288.1_Missense_Mutation_p.R7486Q			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	7319	4 X 4 AA tandem repeats of [GS]-S-R-[AR].|C-terminal tail. {ECO:0000250}.|Ser-rich.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			gctgggagtcgagccgggagt	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		16059	0.001		0.0	False		,,,				2504	0.0																0													37.0	43.0	41.0					1																	39951255		2203	4300	6503	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.21956G>A	1.37:g.39951255G>A	ENSP00000362006:p.Arg7319Gln		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.R5361Q	ENST00000372915.3	37	c.16082		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.79|14.79	2.641085|2.641085	0.47153|0.47153	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000360115;ENST00000442046|ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893;ENST00000539218	.|T;T;T;T;T;T	.|0.64618	.|-0.08;-0.0;-0.08;-0.11;0.09;1.09	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	.|0.000000	.|0.52532	.|D	.|0.000063	T|T	0.53384|0.53384	0.1793|0.1793	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	.|P;B;B;B	.|0.38745	.|0.645;0.147;0.062;0.005	.|B;B;B;B	.|0.32805	.|0.153;0.038;0.007;0.002	T|T	0.53486|0.53486	-0.8432|-0.8432	5|9	.|.	.|.	.|.	.|.	18.2677|18.2677	0.90057|0.90057	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|7319;5361;5869;298	.|Q9UPN3;F8W8Q1;Q96PK2;B1ANQ7	.|MACF1_HUMAN;.;MACF4_HUMAN;.	K|Q	474;299|5361;7319;5361;5361;5231;5869;275	.|ENSP00000439537:R5361Q;ENSP00000362006:R7319Q;ENSP00000354573:R5361Q;ENSP00000313438:R5361Q;ENSP00000444364:R5231Q;ENSP00000289893:R5869Q	.|.	E|R	+|+	1|2	0|0	MACF1|MACF1	39723842|39723842	0.913000|0.913000	0.31002|0.31002	0.988000|0.988000	0.46212|0.46212	0.991000|0.991000	0.79684|0.79684	2.694000|2.694000	0.47035|0.47035	2.627000|2.627000	0.88993|0.88993	0.655000|0.655000	0.94253|0.94253	GAG|CGA	MACF1	-	NULL	ENSG00000127603		0.542	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	84	0	G	NM_033044		39951255	+1	tier1	-	no_errors	ENST00000317713	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.989	A
MAG	4099	genome.wustl.edu	37	19	35800943	35800943	+	Silent	SNP	C	C	T	rs199807515		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr19:35800943C>T	ENST00000392213.3	+	8	1557	c.1398C>T	c.(1396-1398)agC>agT	p.S466S	MAG_ENST00000361922.4_Silent_p.S466S|MAG_ENST00000593348.1_3'UTR|MAG_ENST00000537831.2_Silent_p.S441S	NM_002361.3	NP_002352.1	P20916	MAG_HUMAN	myelin associated glycoprotein	466	Ig-like C2-type 4.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of axonogenesis (GO:0050770)|substantia nigra development (GO:0021762)	integral component of membrane (GO:0016021)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)	carbohydrate binding (GO:0030246)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(10)|lung(11)|skin(2)|upper_aerodigestive_tract(2)	34	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)	Renal(1328;0.242)	Epithelial(14;3.14e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.5e-18)|all cancers(14;1.5e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			CGGAGCGCAGCGGCCTCGTGC	0.677																																																	0													63.0	56.0	59.0					19																	35800943		2203	4300	6503	SO:0001819	synonymous_variant	0			M29273	CCDS12455.1, CCDS12456.1, CCDS56090.1	19q13.1	2013-01-29			ENSG00000105695	ENSG00000105695		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6783	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 4A"""	159460		GMA		2476987, 8432525	Standard	NM_080600		Approved	SIGLEC4A, SIGLEC-4A, S-MAG	uc002nyy.2	P20916		ENST00000392213.3:c.1398C>T	19.37:g.35800943C>T			B7Z2E5|F5GYC0|Q567S4	Silent	SNP	pfam_Ig_I-set,pfam_CD80_C2-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S466	ENST00000392213.3	37	c.1398	CCDS12455.1	19																																																																																			MAG	-	NULL	ENSG00000105695		0.677	MAG-001	KNOWN	basic|CCDS	protein_coding	MAG	HGNC	protein_coding	OTTHUMT00000466071.1	-	0.00	91	0	C	NM_080600		35800943	+1	tier1	-	no_errors	ENST00000392213	ensembl	human	known	74_37	silent	5.32	89	5	SNP	0.420	T
MDN1	23195	genome.wustl.edu	37	6	90365589	90365589	+	Silent	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr6:90365589G>A	ENST00000369393.3	-	92	15499	c.15384C>T	c.(15382-15384)agC>agT	p.S5128S	MDN1_ENST00000428876.1_Silent_p.S5128S			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	5128					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GCTCGGCATGGCTGTCCGTAT	0.552																																																	0													106.0	76.0	86.0					6																	90365589		2203	4300	6503	SO:0001819	synonymous_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.15384C>T	6.37:g.90365589G>A			O15019|Q5T794	Silent	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.S5128	ENST00000369393.3	37	c.15384	CCDS5024.1	6																																																																																			MDN1	-	pirsf_Midasin	ENSG00000112159		0.552	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	-	0.00	37	0	G			90365589	-1	tier1	-	no_errors	ENST00000369393	ensembl	human	known	74_37	silent	12.12	29	4	SNP	0.002	A
CLEC5A	23601	genome.wustl.edu	37	7	141631634	141631635	+	Intron	INS	-	-	A	rs201568466|rs369908648|rs201042036	byFrequency	TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr7:141631634_141631635insA	ENST00000546910.1	-	6	542				CLEC5A_ENST00000470595.1_Intron|CLEC5A_ENST00000551012.2_Intron|CLEC5A_ENST00000438351.1_Intron|CLEC5A_ENST00000439991.1_Intron|MGAM_ENST00000497554.1_3'UTR	NM_013252.2	NP_037384.1	Q9NY25	CLC5A_HUMAN	C-type lectin domain family 5, member A						cellular defense response (GO:0006968)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myeloid cell apoptotic process (GO:0033033)|osteoblast development (GO:0002076)|positive regulation of cytokine secretion (GO:0050715)|response to virus (GO:0009615)|signal transduction (GO:0007165)|viral process (GO:0016032)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|virus receptor activity (GO:0001618)			endometrium(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	10	Melanoma(164;0.0171)					CTTCTGGAAATAAAAAAAAAAT	0.381													|||unknown(HR)	376	0.0750799	0.0257	0.0735	5008	,	,		18534	0.0685		0.0288	False		,,,				2504	0.1973				GBM(154;1592 2613 3360 42983)												0																																										SO:0001627	intron_variant	0				CCDS5870.1, CCDS75670.1	7q34	2012-10-03	2005-02-09	2005-02-09	ENSG00000258227	ENSG00000258227		"""C-type lectin domain containing"""	2054	protein-coding gene	gene with protein product		604987	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 5"""	CLECSF5		10449773	Standard	NM_013252		Approved	MDL-1	uc003vwv.1	Q9NY25	OTTHUMG00000157173	ENST00000546910.1:c.346-8->T	7.37:g.141631644_141631644dupA			Q52M11|Q9UKQ0	RNA	INS	-	NULL	ENST00000546910.1	37	NULL	CCDS5870.1	7																																																																																			MGAM	-	-	ENSG00000257335		0.381	CLEC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000347756.1		0.00	23	0	-	NM_013252		141631635	+1	tier1		no_errors	ENST00000497554	ensembl	human	known	74_37	rna	11.54	23	3	INS	0.014:0.007	A
MICAL2	9645	genome.wustl.edu	37	11	12278459	12278459	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr11:12278459G>A	ENST00000256194.4	+	24	3371	c.3083G>A	c.(3082-3084)cGc>cAc	p.R1028H	MICAL2_ENST00000537344.1_Missense_Mutation_p.R838H|MICAL2_ENST00000527546.1_Missense_Mutation_p.R838H|MICAL2_ENST00000379612.3_Missense_Mutation_p.R802H|MICAL2_ENST00000342902.5_Missense_Mutation_p.R1007H	NM_001282663.1|NM_014632.2	NP_001269592.1|NP_055447.1	O94851	MICA2_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 2	1028	LIM zinc-binding. {ECO:0000255|PROSITE- ProRule:PRU00125}.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|heart development (GO:0007507)|heart looping (GO:0001947)|oxidation-reduction process (GO:0055114)|positive regulation of transcription via serum response element binding (GO:0010735)|sulfur oxidation (GO:0019417)	nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|NADPH:sulfur oxidoreductase activity (GO:0043914)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	47				Epithelial(150;0.00552)		GAGTGTTTCCGCTGCAGCATC	0.612																																																	0													110.0	89.0	96.0					11																	12278459		2201	4294	6495	SO:0001583	missense	0			AB018293	CCDS7809.1, CCDS60726.1, CCDS60727.1, CCDS60728.1	11p15.3	2014-08-12	2013-03-26		ENSG00000133816	ENSG00000133816			24693	protein-coding gene	gene with protein product		608881				12110185	Standard	XM_005253249		Approved	KIAA0750	uc001mjz.3	O94851	OTTHUMG00000165744	ENST00000256194.4:c.3083G>A	11.37:g.12278459G>A	ENSP00000256194:p.Arg1028His		B4DGZ0|B7Z849|D3DQW5|G3XAC8|Q5KTR3|Q5KTR4|Q7Z3A8	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,pfam_FAD_bind_dom,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.R1028H	ENST00000256194.4	37	c.3083	CCDS7809.1	11	.	.	.	.	.	.	.	.	.	.	G	21.8	4.195190	0.78902	.	.	ENSG00000133816	ENST00000537344;ENST00000544073;ENST00000256194;ENST00000527546;ENST00000342902;ENST00000379612	D;D;D;D;D	0.88124	-2.34;-2.34;-2.34;-2.34;-2.34	5.17	4.25	0.50352	Zinc finger, LIM-type (5);	0.145385	0.40064	N	0.001192	D	0.90796	0.7110	M	0.79011	2.435	0.25573	N	0.986873	D;D;P;P;P;D	0.76494	0.999;0.979;0.95;0.79;0.95;0.987	D;P;P;P;P;P	0.65874	0.939;0.721;0.467;0.77;0.595;0.861	D	0.83465	0.0056	10	0.87932	D	0	.	5.1893	0.15201	0.29:0.0:0.71:0.0	.	371;1007;838;781;802;1028	B4DYS3;G3XAC8;B7Z849;Q5KTR3;Q5KTR4;O94851	.;.;.;.;.;MICA2_HUMAN	H	838;371;1028;838;1007;802	ENSP00000441689:R838H;ENSP00000256194:R1028H;ENSP00000433965:R838H;ENSP00000344894:R1007H;ENSP00000368932:R802H	ENSP00000256194:R1028H	R	+	2	0	MICAL2	12235035	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.742000	0.62103	2.407000	0.81776	0.655000	0.94253	CGC	MICAL2	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	ENSG00000133816		0.612	MICAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL2	HGNC	protein_coding	OTTHUMT00000385993.1		0.00	38	0	G	NM_014632		12278459	+1			no_errors	ENST00000256194	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
CCDC186	55088	genome.wustl.edu	37	10	115933864	115933864	+	5'UTR	SNP	C	C	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr10:115933864C>A	ENST00000369287.3	-	0	115				C10orf118_ENST00000369285.3_5'UTR|C10orf118_ENST00000369286.1_5'UTR|MIR2110_ENST00000459421.1_RNA	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN												NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		TCCAACCAGCCAAGAGTGGGA	0.587																																																	0													42.0	61.0	55.0					10																	115933864		692	1591	2283	SO:0001623	5_prime_UTR_variant	0																														ENST00000369287.3:c.-152G>T	10.37:g.115933864C>A			Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	RNA	SNP	-	NULL	ENST00000369287.3	37	NULL	CCDS7587.1	10	.	.	.	.	.	.	.	.	.	.	C	7.970	0.748901	0.15710	.	.	ENSG00000165813	ENST00000430353	.	.	.	4.27	1.07	0.20283	.	.	.	.	.	T	0.30039	0.0752	.	.	.	0.09310	N	0.999994	.	.	.	.	.	.	T	0.35748	-0.9776	5	0.87932	D	0	.	1.5028	0.02480	0.2068:0.4352:0.2216:0.1364	.	.	.	.	F	14	.	ENSP00000411008:L14F	L	-	3	2	C10orf118	115923854	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.652000	0.05366	0.025000	0.15241	-0.194000	0.12790	TTG	MIR2110	-	-	ENSG00000238742		0.587	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR2110	HGNC	protein_coding	OTTHUMT00000050455.1	-	0.00	258	0	C			115933864	-1	tier1	-	no_errors	ENST00000459421	ensembl	human	known	74_37	rna	9.62	215	23	SNP	0.000	A
MMP14	4323	genome.wustl.edu	37	14	23313594	23313594	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr14:23313594G>T	ENST00000311852.6	+	7	1287	c.1026G>T	c.(1024-1026)tgG>tgT	p.W342C	MMP14_ENST00000548162.1_3'UTR	NM_004995.2	NP_004986.1	P50281	MMP14_HUMAN	matrix metallopeptidase 14 (membrane-inserted)	342					angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|branching morphogenesis of an epithelial tube (GO:0048754)|chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|endodermal cell differentiation (GO:0035987)|endothelial cell proliferation (GO:0001935)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|male gonad development (GO:0008584)|negative regulation of focal adhesion assembly (GO:0051895)|ovarian follicle development (GO:0001541)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|tissue remodeling (GO:0048771)|zymogen activation (GO:0031638)	extracellular matrix (GO:0031012)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|peptidase activator activity (GO:0016504)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)	Marimastat(DB00786)	GCTGGTTCTGGCGGGTGAGGA	0.572																																																	0													151.0	156.0	155.0					14																	23313594		2203	4300	6503	SO:0001583	missense	0				CCDS9577.1	14q11-q12	2011-06-29	2005-08-08		ENSG00000157227	ENSG00000157227			7160	protein-coding gene	gene with protein product	"""membrane type 1 metalloprotease"""	600754	"""matrix metalloproteinase 14 (membrane-inserted)"""			8015608	Standard	NM_004995		Approved	MT1-MMP	uc001whc.3	P50281	OTTHUMG00000028704	ENST00000311852.6:c.1026G>T	14.37:g.23313594G>T	ENSP00000308208:p.Trp342Cys		A8K5L0|Q6GSF3|Q92678	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.W342C	ENST00000311852.6	37	c.1026	CCDS9577.1	14	.	.	.	.	.	.	.	.	.	.	G	22.9	4.348177	0.82132	.	.	ENSG00000157227	ENST00000311852	T	0.09630	2.96	6.06	6.06	0.98353	Hemopexin/matrixin (2);	0.000000	0.85682	D	0.000000	T	0.51991	0.1707	H	0.97465	4.01	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68096	-0.5499	10	0.87932	D	0	.	19.3958	0.94607	0.0:0.0:1.0:0.0	.	342	P50281	MMP14_HUMAN	C	342	ENSP00000308208:W342C	ENSP00000308208:W342C	W	+	3	0	MMP14	22383434	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	9.860000	0.99555	2.879000	0.98667	0.650000	0.86243	TGG	MMP14	-	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,superfamily_Hemopexin-like_dom,smart_Hemopexin-like_repeat	ENSG00000157227		0.572	MMP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP14	HGNC	protein_coding	OTTHUMT00000071660.3	-	0.00	54	0	G	NM_004995		23313594	+1	tier1	-	no_errors	ENST00000311852	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
MON1B	22879	genome.wustl.edu	37	16	77228742	77228742	+	Missense_Mutation	SNP	G	G	A	rs547327074		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr16:77228742G>A	ENST00000248248.3	+	4	1336	c.986G>A	c.(985-987)cGc>cAc	p.R329H	MON1B_ENST00000439557.2_Missense_Mutation_p.R220H|MON1B_ENST00000545553.1_Missense_Mutation_p.R183H|MON1B_ENST00000320859.6_Intron	NM_014940.2	NP_055755.1	Q7L1V2	MON1B_HUMAN	MON1 secretory trafficking family member B	329										breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	17						TGCCTGCCCCGCTTCAACCCT	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		12917	0.0		0.0	False		,,,				2504	0.001																0													74.0	76.0	75.0					16																	77228742		2198	4300	6498	SO:0001583	missense	0			BC024277	CCDS10925.1, CCDS67082.1, CCDS67083.1	16q23.1	2013-08-21	2013-08-21		ENSG00000103111	ENSG00000103111			25020	protein-coding gene	gene with protein product		608954	"""MON1 homolog B (yeast)"""			10048485	Standard	NM_014940		Approved	SAND2, HSRG1, KIAA0872	uc002fez.3	Q7L1V2	OTTHUMG00000137618	ENST00000248248.3:c.986G>A	16.37:g.77228742G>A	ENSP00000248248:p.Arg329His		B4DDZ0|O94949	Missense_Mutation	SNP	pfam_Vacuolar_fusion_protein_MON1,prints_Vacuolar_fusion_protein_MON1	p.R329H	ENST00000248248.3	37	c.986	CCDS10925.1	16	.	.	.	.	.	.	.	.	.	.	G	18.90	3.722416	0.68959	.	.	ENSG00000103111	ENST00000248248;ENST00000439557;ENST00000545553	.	.	.	4.8	3.83	0.44106	.	0.055442	0.64402	D	0.000001	T	0.60728	0.2291	L	0.28192	0.835	0.80722	D	1	B;D;D;D	0.89917	0.304;0.999;0.999;1.0	B;D;D;D	0.71656	0.068;0.974;0.974;0.959	T	0.60424	-0.7266	9	0.42905	T	0.14	.	11.2741	0.49157	0.0923:0.0:0.9077:0.0	.	183;220;209;329	B4DDZ0;E7EW32;Q6ZR87;Q7L1V2	.;.;.;MON1B_HUMAN	H	329;220;183	.	ENSP00000248248:R329H	R	+	2	0	MON1B	75786243	0.936000	0.31750	1.000000	0.80357	0.975000	0.68041	2.190000	0.42630	1.333000	0.45449	0.561000	0.74099	CGC	MON1B	-	pfam_Vacuolar_fusion_protein_MON1,prints_Vacuolar_fusion_protein_MON1	ENSG00000103111		0.637	MON1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON1B	HGNC	protein_coding	OTTHUMT00000269036.2		0.00	59	0	G	NM_014940		77228742	+1			no_errors	ENST00000248248	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
MT-ND5	4540	genome.wustl.edu	37	M	12750	12750	+	Silent	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chrM:12750C>T	ENST00000361567.2	+	1	414	c.414C>T	c.(412-414)ttC>ttT	p.F138F	MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	138					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						AACAACCTATTCCAACTGTTC	0.403																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.414C>T	M.37:g.12750C>T			Q34773|Q8WCY3	Silent	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.F138	ENST00000361567.2	37	c.414		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.403	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	21	0	C	YP_003024036		12750	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	silent	50.00	10	10	SNP	NULL	T
MT-ND5	4540	genome.wustl.edu	37	M	12979	12979	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chrM:12979G>A	ENST00000361567.2	+	1	643	c.643G>A	c.(643-645)Ggc>Agc	p.G215S	MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	215					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CCCCACTACTAGGCCTCCTCC	0.537																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.643G>A	M.37:g.12979G>A	ENSP00000354813:p.Gly215Ser		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.G215S	ENST00000361567.2	37	c.643		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.537	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding			0.00	13	0	G	YP_003024036		12979	+1			no_errors	ENST00000361567	ensembl	human	known	74_37	missense	13.64	19	3	SNP	NULL	A
MT-ND5	4540	genome.wustl.edu	37	M	13998	13998	+	Silent	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chrM:13998C>T	ENST00000361567.2	+	1	1662	c.1662C>T	c.(1660-1662)gaC>gaT	p.D554D	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	554					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CTCCTCCTAGACCTAACCTGA	0.438																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1662C>T	M.37:g.13998C>T			Q34773|Q8WCY3	Silent	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.D554	ENST00000361567.2	37	c.1662		MT																																																																																			MT-ND5	-	pfam_NADH_DH_su5_C	ENSG00000198786		0.438	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding			0.00	27	0	C	YP_003024036		13998	+1			no_errors	ENST00000361567	ensembl	human	known	74_37	silent	8.57	32	3	SNP	NULL	T
MTRF1	9617	genome.wustl.edu	37	13	41826690	41826691	+	Intron	INS	-	-	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr13:41826690_41826691insA	ENST00000379480.4	-	5	798				MTRF1_ENST00000239852.6_5'UTR|MTRF1_ENST00000379477.1_Intron|MTRF1_ENST00000430347.2_Intron	NM_004294.2	NP_004285.2	O75570	RF1M_HUMAN	mitochondrial translational release factor 1						regulation of translational termination (GO:0006449)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)			breast(1)|endometrium(4)|large_intestine(3)|lung(6)	14		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		CCAAAAGTTTCAAAAAAAAATG	0.356																																																	0																																										SO:0001627	intron_variant	0			AF072934	CCDS9378.1	13q14.1-q14.3	2008-07-18			ENSG00000120662	ENSG00000120662			7469	protein-coding gene	gene with protein product	"""mitochontrial peptide chain release factor 1"""	604601				9838146, 10773675	Standard	NM_004294		Approved	RF1, MTTRF1, MGC47721	uc001uxy.3	O75570	OTTHUMG00000016790	ENST00000379480.4:c.697+89->T	13.37:g.41826699_41826699dupA			B4DG01|Q5T6Y5|Q8IUQ6	RNA	INS	-	NULL	ENST00000379480.4	37	NULL	CCDS9378.1	13																																																																																			MTRF1	-	-	ENSG00000120662		0.356	MTRF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MTRF1	HGNC	protein_coding	OTTHUMT00000044666.3		0.00	21	0	-	NM_004294		41826691	-1	tier1		no_errors	ENST00000239852	ensembl	human	known	74_37	rna	7.41	25	2	INS	0.000:0.000	A
MUC4	4585	genome.wustl.edu	37	3	195506357	195506357	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr3:195506357G>A	ENST00000463781.3	-	2	12553	c.12094C>T	c.(12094-12096)Cct>Tct	p.P4032S	MUC4_ENST00000475231.1_Missense_Mutation_p.P4032S|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACAGGAACAGGGGTGGCGTGA	0.582																																																	0													24.0	14.0	17.0					3																	195506357		642	1388	2030	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.12094C>T	3.37:g.195506357G>A	ENSP00000417498:p.Pro4032Ser		O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.P4032S	ENST00000463781.3	37	c.12094	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	g	0.016	-1.533132	0.00951	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.26373	1.74;1.76	0.613	-1.23	0.09465	.	0.517672	0.10370	U	0.682961	T	0.12178	0.0296	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.31861	-0.9928	9	.	.	.	.	2.6297	0.04940	0.246:0.0:0.4872:0.2667	.	3904	E7ESK3	.	S	4032	ENSP00000417498:P4032S;ENSP00000420243:P4032S	.	P	-	1	0	MUC4	196991136	0.001000	0.12720	0.000000	0.03702	0.016000	0.09150	0.009000	0.13219	-1.325000	0.02269	0.064000	0.15345	CCT	MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	-	0.00	23	0	G	NM_018406		195506357	-1	tier1	-	no_errors	ENST00000463781	ensembl	human	known	74_37	missense	50.00	4	4	SNP	0.000	A
MYH14	79784	genome.wustl.edu	37	19	50785036	50785036	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr19:50785036G>A	ENST00000596571.1	+	30	4353	c.4353G>A	c.(4351-4353)atG>atA	p.M1451I	MYH14_ENST00000601313.1_Missense_Mutation_p.M1492I|MYH14_ENST00000440075.2_Missense_Mutation_p.M1492I|MYH14_ENST00000262269.8_Missense_Mutation_p.M1492I|MYH14_ENST00000376970.2_Missense_Mutation_p.M1484I|MYH14_ENST00000598205.1_Missense_Mutation_p.M1459I|MYH14_ENST00000425460.1_Missense_Mutation_p.M1459I			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	1451					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		ACGCCACCATGGACCTGGAGC	0.667																																																	0													14.0	18.0	17.0					19																	50785036		2122	4223	6345	SO:0001583	missense	0			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.4353G>A	19.37:g.50785036G>A	ENSP00000472819:p.Met1451Ile		B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.M1492I	ENST00000596571.1	37	c.4476	CCDS59411.1	19	.	.	.	.	.	.	.	.	.	.	G	12.02	1.813469	0.32053	.	.	ENSG00000105357	ENST00000440075;ENST00000376970;ENST00000425460;ENST00000262269	D;D;D;D	0.82619	-1.63;-1.63;-1.63;-1.63	3.96	3.96	0.45880	Myosin tail (1);	.	.	.	.	T	0.57198	0.2037	N	0.00642	-1.3	0.31245	N	0.694708	B;B;B	0.14438	0.008;0.01;0.004	B;B;B	0.23018	0.025;0.043;0.025	T	0.53158	-0.8478	8	.	.	.	.	13.9772	0.64279	0.0:0.0:1.0:0.0	.	1492;1451;1459	Q7Z406-2;Q7Z406;Q7Z406-6	.;MYH14_HUMAN;.	I	1492;1484;1459;1492	ENSP00000406273:M1492I;ENSP00000366169:M1484I;ENSP00000407879:M1459I;ENSP00000262269:M1492I	.	M	+	3	0	MYH14	55476848	1.000000	0.71417	0.990000	0.47175	0.985000	0.73830	4.084000	0.57650	2.238000	0.73509	0.555000	0.69702	ATG	MYH14	-	pfam_Myosin_tail	ENSG00000105357		0.667	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	HGNC	protein_coding	OTTHUMT00000464710.2	-	0.00	83	0	G	NM_024729		50785036	+1	tier1	-	no_errors	ENST00000262269	ensembl	human	known	74_37	missense	15.49	60	11	SNP	1.000	A
NAA16	79612	genome.wustl.edu	37	13	41932982	41932982	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr13:41932982G>T	ENST00000379406.3	+	12	1618	c.1294G>T	c.(1294-1296)Gat>Tat	p.D432Y	NAA16_ENST00000379367.3_Missense_Mutation_p.D432Y	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	432					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						AAAGTGGATGGATGAAGCACA	0.333																																																	0													87.0	91.0	90.0					13																	41932982		2203	4300	6503	SO:0001583	missense	0			AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.1294G>T	13.37:g.41932982G>T	ENSP00000368716:p.Asp432Tyr		B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Missense_Mutation	SNP	pfam_TPR_2,pfam_NatA_aux_su,pfam_TPR_1,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D432Y	ENST00000379406.3	37	c.1294	CCDS9379.1	13	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327051	0.81690	.	.	ENSG00000172766	ENST00000379367;ENST00000379406	T;T	0.50001	0.76;0.76	4.91	4.91	0.64330	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.64402	D	0.000001	T	0.74596	0.3737	M	0.88105	2.93	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.81050	-0.1108	10	0.87932	D	0	-18.5236	18.0833	0.89449	0.0:0.0:1.0:0.0	.	432	Q6N069	NAA16_HUMAN	Y	432	ENSP00000368674:D432Y;ENSP00000368716:D432Y	ENSP00000368674:D432Y	D	+	1	0	NAA16	40830982	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.171000	0.94802	2.262000	0.75019	0.561000	0.74099	GAT	NAA16	-	smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR-contain_dom	ENSG00000172766		0.333	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA16	HGNC	protein_coding	OTTHUMT00000044672.2	-	0.00	71	0	G	NM_018527		41932982	+1	tier1	-	no_errors	ENST00000379406	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	T
NDFIP1	80762	genome.wustl.edu	37	5	141511526	141511526	+	Intron	DEL	A	A	-	rs556414620		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr5:141511526delA	ENST00000253814.4	+	2	621				NDFIP1_ENST00000509436.1_3'UTR	NM_030571.3	NP_085048.1	Q9BT67	NFIP1_HUMAN	Nedd4 family interacting protein 1						cellular iron ion homeostasis (GO:0006879)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of protein transport (GO:0051224)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transporter activity (GO:0032410)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein ubiquitination (GO:0031398)|regulation of isotype switching to IgG isotypes (GO:0048302)|regulation of lymphocyte differentiation (GO:0045619)|regulation of myeloid leukocyte differentiation (GO:0002761)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cell cortex (GO:0005938)|endosome (GO:0005768)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	signal transducer activity (GO:0004871)			large_intestine(3)|lung(1)|ovary(1)	5		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTACAGTTTAAAAAAAAAAA	0.393																																																	0																																										SO:0001627	intron_variant	0			BC004317	CCDS4273.1	5q31.3	2008-02-05			ENSG00000131507	ENSG00000131507			17592	protein-coding gene	gene with protein product		612050				11042109, 11748237	Standard	NM_030571		Approved	N4WBP5, MGC10924	uc003lmi.4	Q9BT67	OTTHUMG00000129659	ENST00000253814.4:c.151+66A>-	5.37:g.141511526delA			B2RDB8|D3DQF0|Q658T8|Q8N2E3|Q8N2F9	RNA	DEL	-	NULL	ENST00000253814.4	37	NULL	CCDS4273.1	5																																																																																			NDFIP1	-	-	ENSG00000131507		0.393	NDFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDFIP1	HGNC	protein_coding	OTTHUMT00000251859.2		0.00	11	0	A	NM_030571		141511526	+1	tier1		no_errors	ENST00000509436	ensembl	human	known	74_37	rna	22.22	14	4	DEL	0.000	-
NOTCH1	4851	genome.wustl.edu	37	9	139410452	139410452	+	Nonsense_Mutation	SNP	G	G	C	rs371634784		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr9:139410452G>C	ENST00000277541.6	-	10	1725	c.1650C>G	c.(1648-1650)taC>taG	p.Y550*		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	550	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		ACACACAGGTGTAAGTGTTGG	0.632			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													42.0	48.0	46.0					9																	139410452		2044	4189	6233	SO:0001587	stop_gained	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.1650C>G	9.37:g.139410452G>C	ENSP00000277541:p.Tyr550*		Q59ED8|Q5SXM3	Nonsense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_1,prints_Notch_dom	p.Y550*	ENST00000277541.6	37	c.1650	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	G	39	7.312660	0.98203	.	.	ENSG00000148400	ENST00000277541	.	.	.	4.88	3.96	0.45880	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6621	0.56820	0.0823:0.0:0.9177:0.0	.	.	.	.	X	550	.	ENSP00000277541:Y550X	Y	-	3	2	NOTCH1	138530273	1.000000	0.71417	0.989000	0.46669	0.804000	0.45430	3.168000	0.50801	0.992000	0.38840	0.563000	0.77884	TAC	NOTCH1	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom	ENSG00000148400		0.632	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	-	0.00	113	0	G	NM_017617		139410452	-1	tier1	-	no_errors	ENST00000277541	ensembl	human	known	74_37	nonsense	16.16	83	16	SNP	1.000	C
NOTCH1	4851	genome.wustl.edu	37	9	139418432	139418432	+	Splice_Site	SNP	C	C	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr9:139418432C>A	ENST00000277541.6	-	3	216		c.e3-1		NOTCH1_ENST00000491649.1_5'Flank	NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1						anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CCCGCCACAGCTGTTGGCAGA	0.692			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																														Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													5.0	8.0	7.0					9																	139418432		1856	4006	5862	SO:0001630	splice_region_variant	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.141-1G>T	9.37:g.139418432C>A			Q59ED8|Q5SXM3	Splice_Site	SNP	-	e3-1	ENST00000277541.6	37	c.141-1	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	C	13.58	2.280494	0.40294	.	.	ENSG00000148400	ENST00000277541	.	.	.	4.62	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0172	0.80450	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NOTCH1	138538253	1.000000	0.71417	0.999000	0.59377	0.366000	0.29705	6.109000	0.71528	2.103000	0.63969	0.561000	0.74099	.	NOTCH1	-	-	ENSG00000148400		0.692	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1		0.00	12	0	C	NM_017617	Intron	139418432	-1			no_errors	ENST00000277541	ensembl	human	known	74_37	splice_site	10.53	17	2	SNP	1.000	A
NPAP1	23742	genome.wustl.edu	37	15	24921051	24921051	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr15:24921051C>A	ENST00000329468.2	+	1	511	c.37C>A	c.(37-39)Cgc>Agc	p.R13S		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	13					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											ACCCGGGTGCCGCCGCCGGCC	0.667																																																	0													5.0	7.0	6.0					15																	24921051		2010	4047	6057	SO:0001583	missense	0			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.37C>A	15.37:g.24921051C>A	ENSP00000333735:p.Arg13Ser			Missense_Mutation	SNP	NULL	p.R13S	ENST00000329468.2	37	c.37	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	13.25	2.180111	0.38511	.	.	ENSG00000185823	ENST00000329468	T	0.12774	2.65	1.88	-1.29	0.09288	.	.	.	.	.	T	0.06872	0.0175	L	0.29908	0.895	0.09310	N	1	D	0.56287	0.975	B	0.36719	0.231	T	0.33292	-0.9874	9	0.33141	T	0.24	.	5.0254	0.14381	0.0:0.521:0.0:0.479	.	13	Q9NZP6	CO002_HUMAN	S	13	ENSP00000333735:R13S	ENSP00000333735:R13S	R	+	1	0	C15orf2	22472144	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.620000	0.05565	-0.322000	0.08615	0.491000	0.48974	CGC	NPAP1	-	NULL	ENSG00000185823		0.667	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1		0.00	68	0	C	NM_018958		24921051	+1			no_errors	ENST00000329468	ensembl	human	known	74_37	missense	8.16	44	4	SNP	0.000	A
NPBWR1	2831	genome.wustl.edu	37	8	53853167	53853167	+	Missense_Mutation	SNP	C	C	T	rs567536404		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr8:53853167C>T	ENST00000331251.3	+	1	2177	c.700C>T	c.(700-702)Cgg>Tgg	p.R234W		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	234					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)	p.R234W(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				GCATGCCATGCGGCTGGACAG	0.672																																																	1	Substitution - Missense(1)	large_intestine(1)											30.0	17.0	21.0					8																	53853167		2192	4278	6470	SO:0001583	missense	0			BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.700C>T	8.37:g.53853167C>T	ENSP00000330284:p.Arg234Trp		Q6NTC7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Neuropept_B/W_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_Opioid_rcpt	p.R234W	ENST00000331251.3	37	c.700	CCDS6151.1	8	.	.	.	.	.	.	.	.	.	.	C	18.15	3.559979	0.65538	.	.	ENSG00000183729	ENST00000331251	T	0.40476	1.03	5.32	1.22	0.21188	GPCR, rhodopsin-like superfamily (1);	0.488214	0.17373	N	0.176592	T	0.65302	0.2678	M	0.86651	2.83	0.24137	N	0.995741	D	0.76494	0.999	D	0.63192	0.912	T	0.63355	-0.6656	10	0.72032	D	0.01	.	15.133	0.72539	0.4839:0.5161:0.0:0.0	.	234	P48145	NPBW1_HUMAN	W	234	ENSP00000330284:R234W	ENSP00000330284:R234W	R	+	1	2	NPBWR1	54015720	0.997000	0.39634	0.001000	0.08648	0.954000	0.61252	1.637000	0.37155	0.363000	0.24346	-0.834000	0.03071	CGG	NPBWR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Neuropept_B/W_rcpt	ENSG00000183729		0.672	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPBWR1	HGNC	protein_coding	OTTHUMT00000378047.1	-	0.00	59	0	C	NM_005285		53853167	+1	tier1	-	no_errors	ENST00000331251	ensembl	human	known	74_37	missense	8.33	66	6	SNP	0.575	T
NTRK2	4915	genome.wustl.edu	37	9	87325707	87325707	+	Splice_Site	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr9:87325707G>T	ENST00000323115.4	+	5	936		c.e5+1		NTRK2_ENST00000376213.1_Splice_Site|NTRK2_ENST00000395866.2_Splice_Site|NTRK2_ENST00000359847.3_Splice_Site|NTRK2_ENST00000277120.3_Splice_Site|NTRK2_ENST00000304053.6_Splice_Site|NTRK2_ENST00000376214.1_Splice_Site|NTRK2_ENST00000376208.1_Splice_Site|NTRK2_ENST00000395882.1_Splice_Site			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2						activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	CCCAATTGTGGTAATTTATTT	0.398										TSP Lung(25;0.17)																																							0													86.0	85.0	85.0					9																	87325707		2203	4300	6503	SO:0001630	splice_region_variant	0			AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.583+1G>T	9.37:g.87325707G>T			B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Splice_Site	SNP	-	e5+1	ENST00000323115.4	37	c.583+1	CCDS35050.1	9	.	.	.	.	.	.	.	.	.	.	G	22.3	4.274724	0.80580	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000395882;ENST00000376208;ENST00000304053;ENST00000277120;ENST00000323115;ENST00000359847;ENST00000395866	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7637	0.91864	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NTRK2	86515527	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.379000	0.73154	2.740000	0.93945	0.557000	0.71058	.	NTRK2	-	-	ENSG00000148053		0.398	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	HGNC	protein_coding	OTTHUMT00000052882.1		0.00	67	0	G		Intron	87325707	+1			no_errors	ENST00000277120	ensembl	human	known	74_37	splice_site	5.33	71	4	SNP	1.000	T
NUP54	53371	genome.wustl.edu	37	4	77053807	77053807	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr4:77053807G>T	ENST00000264883.3	-	6	916	c.776C>A	c.(775-777)aCa>aAa	p.T259K	NUP54_ENST00000458189.2_Missense_Mutation_p.T79K|NUP54_ENST00000515460.1_5'Flank|NUP54_ENST00000342467.6_Missense_Mutation_p.T79K|NUP54_ENST00000514987.1_Missense_Mutation_p.T211K	NM_017426.2	NP_059122.2	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa	259	9 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein targeting (GO:0006605)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nucleocytoplasmic transporter activity (GO:0005487)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(3)|skin(1)|stomach(1)	19						ATATAGCGTTGTAGCTGGAAC	0.378																																																	0													170.0	158.0	162.0					4																	77053807		2203	4300	6503	SO:0001583	missense	0			AF157322	CCDS3576.1, CCDS63998.1	4q21.1	2008-07-03	2002-08-29		ENSG00000138750	ENSG00000138750			17359	protein-coding gene	gene with protein product		607607	"""nucleoporin 54kD"""			8707840	Standard	NM_017426		Approved		uc003hjs.3	Q7Z3B4	OTTHUMG00000130098	ENST00000264883.3:c.776C>A	4.37:g.77053807G>T	ENSP00000264883:p.Thr259Lys		B2RCK7|B4DT35|Q96EA7|Q9NVL5|Q9P0I1	Missense_Mutation	SNP	NULL	p.T259K	ENST00000264883.3	37	c.776	CCDS3576.1	4	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639451	0.67244	.	.	ENSG00000138750	ENST00000264883;ENST00000342467;ENST00000514987;ENST00000458189	.	.	.	5.46	5.46	0.80206	.	0.146905	0.64402	D	0.000009	T	0.55016	0.1894	L	0.54323	1.7	0.58432	D	0.999993	P;P;P	0.44429	0.835;0.57;0.835	B;B;B	0.41813	0.272;0.367;0.346	T	0.55042	-0.8202	9	0.34782	T	0.22	-2.2859	14.8673	0.70427	0.0:0.1431:0.8569:0.0	.	211;79;259	B4DT35;Q7Z3B4-2;Q7Z3B4	.;.;NUP54_HUMAN	K	259;79;211;79	.	ENSP00000264883:T259K	T	-	2	0	NUP54	77272831	1.000000	0.71417	0.995000	0.50966	0.817000	0.46193	5.059000	0.64306	2.581000	0.87130	0.650000	0.86243	ACA	NUP54	-	NULL	ENSG00000138750		0.378	NUP54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP54	HGNC	protein_coding	OTTHUMT00000252402.3		0.00	74	0	G			77053807	-1			no_errors	ENST00000264883	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
OR10Q1	219960	genome.wustl.edu	37	11	57995652	57995652	+	Missense_Mutation	SNP	G	G	T	rs369464101		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr11:57995652G>T	ENST00000316770.2	-	1	738	c.696C>A	c.(694-696)agC>agA	p.S232R		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S232R(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				CAGAACGGATGCTCAGGATGG	0.622																																																	1	Substitution - Missense(1)	lung(1)											62.0	55.0	57.0					11																	57995652		2201	4295	6496	SO:0001583	missense	0			AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.696C>A	11.37:g.57995652G>T	ENSP00000314324:p.Ser232Arg		Q6IFG4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S232R	ENST00000316770.2	37	c.696	CCDS31547.1	11	.	.	.	.	.	.	.	.	.	.	G	1.208	-0.630618	0.03584	.	.	ENSG00000180475	ENST00000316770	T	0.00019	9.06	4.84	3.9	0.45041	GPCR, rhodopsin-like superfamily (1);	0.330438	0.22050	N	0.065333	T	0.00039	0.0001	N	0.00082	-2.215	0.20821	N	0.999847	B	0.02656	0.0	B	0.01281	0.0	T	0.22941	-1.0202	10	0.05525	T	0.97	.	8.4009	0.32586	0.0:0.318:0.5181:0.1639	.	232	Q8NGQ4	O10Q1_HUMAN	R	232	ENSP00000314324:S232R	ENSP00000314324:S232R	S	-	3	2	OR10Q1	57752228	0.004000	0.15560	1.000000	0.80357	0.146000	0.21551	0.067000	0.14510	1.237000	0.43756	0.580000	0.79431	AGC	OR10Q1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000180475		0.622	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	HGNC	protein_coding	OTTHUMT00000394706.1		0.00	39	0	G	NM_001004471		57995652	-1			no_errors	ENST00000316770	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.968	T
OR1A2	26189	genome.wustl.edu	37	17	3101038	3101038	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr17:3101038G>A	ENST00000381951.1	+	1	226	c.226G>A	c.(226-228)Gta>Ata	p.V76I		NM_012352.1	NP_036484.1	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A, member 2	76					positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V76I(1)		breast(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(4)|stomach(2)	18						CTTCTCATCCGTAACCATCCC	0.488																																																	1	Substitution - Missense(1)	endometrium(1)											220.0	186.0	198.0					17																	3101038		2203	4300	6503	SO:0001583	missense	0			AF155225	CCDS11021.1	17p13.3	2012-08-09			ENSG00000172150	ENSG00000172150		"""GPCR / Class A : Olfactory receptors"""	8180	protein-coding gene	gene with protein product						10673334	Standard	NM_012352		Approved	OR17-6	uc002fvd.1	Q9Y585	OTTHUMG00000090638	ENST00000381951.1:c.226G>A	17.37:g.3101038G>A	ENSP00000371377:p.Val76Ile		Q3KPH3|Q6IFM0|Q6NTD8|Q96R86	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V76I	ENST00000381951.1	37	c.226	CCDS11021.1	17	.	.	.	.	.	.	.	.	.	.	G	8.290	0.817419	0.16607	.	.	ENSG00000172150	ENST00000381951	T	0.00475	7.16	4.09	3.11	0.35812	GPCR, rhodopsin-like superfamily (1);	0.000000	0.44902	D	0.000419	T	0.00412	0.0013	L	0.58810	1.83	0.09310	N	0.999998	D	0.54964	0.969	B	0.38264	0.269	T	0.54675	-0.8258	10	0.87932	D	0	.	8.4274	0.32737	0.196:0.0:0.804:0.0	.	76	Q9Y585	OR1A2_HUMAN	I	76	ENSP00000371377:V76I	ENSP00000371377:V76I	V	+	1	0	OR1A2	3047788	0.000000	0.05858	0.899000	0.35326	0.007000	0.05969	0.476000	0.22180	1.071000	0.40834	-0.199000	0.12753	GTA	OR1A2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172150		0.488	OR1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1A2	HGNC	protein_coding	OTTHUMT00000207293.1	-	0.00	62	0	G	NM_012352		3101038	+1	tier1	-	no_errors	ENST00000381951	ensembl	human	known	74_37	missense	10.00	63	7	SNP	0.523	A
OR6M1	390261	genome.wustl.edu	37	11	123676901	123676901	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr11:123676901G>T	ENST00000309154.2	-	1	194	c.157C>A	c.(157-159)Ctg>Atg	p.L53M		NM_001005325.1	NP_001005325.1	Q8NGM8	OR6M1_HUMAN	olfactory receptor, family 6, subfamily M, member 1	53						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|prostate(2)|skin(5)|urinary_tract(1)	29		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.028)		GGAGTTTGCAGGCGATGATCA	0.428																																																	0													161.0	142.0	148.0					11																	123676901		2202	4299	6501	SO:0001583	missense	0			AB065762	CCDS31696.1	11q24.1	2012-08-09			ENSG00000196099	ENSG00000196099		"""GPCR / Class A : Olfactory receptors"""	14711	protein-coding gene	gene with protein product							Standard	NM_001005325		Approved		uc010rzz.2	Q8NGM8	OTTHUMG00000166012	ENST00000309154.2:c.157C>A	11.37:g.123676901G>T	ENSP00000311038:p.Leu53Met		B2RNK0|Q6IEW9|Q96R37	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L53M	ENST00000309154.2	37	c.157	CCDS31696.1	11	.	.	.	.	.	.	.	.	.	.	G	14.16	2.453738	0.43531	.	.	ENSG00000196099	ENST00000309154	T	0.14391	2.51	3.55	3.55	0.40652	GPCR, rhodopsin-like superfamily (1);	0.000000	0.29699	U	0.011432	T	0.47544	0.1451	H	0.95365	3.66	0.35018	D	0.757585	D	0.89917	1.0	D	0.79108	0.992	T	0.71391	-0.4607	10	0.72032	D	0.01	.	12.6336	0.56671	0.0:0.0:1.0:0.0	.	53	Q8NGM8	OR6M1_HUMAN	M	53	ENSP00000311038:L53M	ENSP00000311038:L53M	L	-	1	2	OR6M1	123182111	1.000000	0.71417	0.061000	0.19648	0.350000	0.29205	4.019000	0.57181	1.787000	0.52448	0.637000	0.83480	CTG	OR6M1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000196099		0.428	OR6M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6M1	HGNC	protein_coding	OTTHUMT00000387437.1	-	0.00	83	0	G	NM_001005325		123676901	-1	tier1	-	no_errors	ENST00000309154	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.990	T
OR8B4	283162	genome.wustl.edu	37	11	124294671	124294671	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr11:124294671C>A	ENST00000356130.3	-	1	118	c.97G>T	c.(97-99)Ggg>Tgg	p.G33W		NM_001005196.1	NP_001005196.1	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B, member 4	33						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(1)|urinary_tract(1)	32		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		ACATAGATCCCTAAGAATAGA	0.453																																																	0													61.0	60.0	60.0					11																	124294671		2201	4299	6500	SO:0001583	missense	0			AB065831	CCDS31710.1	11q24	2012-08-09		2001-06-29	ENSG00000198657	ENSG00000198657		"""GPCR / Class A : Olfactory receptors"""	8473	protein-coding gene	gene with protein product				OR8B4P			Standard	NM_001005196		Approved		uc010sak.2	Q96RC9	OTTHUMG00000165916	ENST00000356130.3:c.97G>T	11.37:g.124294671C>A	ENSP00000348449:p.Gly33Trp		B2RNF8|Q6IFQ7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.G33W	ENST00000356130.3	37	c.97	CCDS31710.1	11	.	.	.	.	.	.	.	.	.	.	c	9.721	1.159565	0.21454	.	.	ENSG00000198657	ENST00000356130	T	0.00446	7.39	4.06	3.1	0.35709	.	0.242372	0.28841	N	0.013974	T	0.00496	0.0016	L	0.56124	1.755	0.09310	N	1	D	0.55172	0.97	P	0.54965	0.765	T	0.52845	-0.8521	10	0.41790	T	0.15	.	4.0815	0.09929	0.1674:0.5804:0.1624:0.0898	.	33	Q96RC9	OR8B4_HUMAN	W	33	ENSP00000348449:G33W	ENSP00000348449:G33W	G	-	1	0	OR8B4	123799881	0.000000	0.05858	0.981000	0.43875	0.226000	0.24999	-2.237000	0.01200	1.238000	0.43771	0.655000	0.94253	GGG	OR8B4	-	prints_GPCR_Rhodpsn	ENSG00000198657		0.453	OR8B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8B4	HGNC	protein_coding	OTTHUMT00000387055.1		0.00	26	0	C	NM_001005196		124294671	-1			no_errors	ENST00000356130	ensembl	human	known	74_37	missense	9.09	30	3	SNP	0.059	A
OTOF	9381	genome.wustl.edu	37	2	26725257	26725257	+	Silent	SNP	A	A	G			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:26725257A>G	ENST00000272371.2	-	7	747	c.621T>C	c.(619-621)caT>caC	p.H207H	OTOF_ENST00000403946.3_Silent_p.H207H	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	207					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAATGGCCAGATGGTCAAGGT	0.542																																					GBM(102;732 1451 20652 24062 31372)												0													99.0	80.0	86.0					2																	26725257		2203	4300	6503	SO:0001819	synonymous_variant	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.621T>C	2.37:g.26725257A>G			B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Silent	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.H207	ENST00000272371.2	37	c.621	CCDS1725.1	2																																																																																			OTOF	-	NULL	ENSG00000115155		0.542	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3		0.00	81	0	A			26725257	-1			no_errors	ENST00000272371	ensembl	human	known	74_37	silent	5.13	74	4	SNP	0.995	G
OTOP2	92736	genome.wustl.edu	37	17	72929582	72929582	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr17:72929582G>A	ENST00000580223.1	+	6	1661	c.1631G>A	c.(1630-1632)gGc>gAc	p.G544D	OTOP2_ENST00000331427.4_Missense_Mutation_p.G544D|OTOP3_ENST00000328801.4_5'Flank			Q7RTS6	OTOP2_HUMAN	otopetrin 2	544						integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|ovary(3)|prostate(4)|skin(1)|urinary_tract(2)	39	all_lung(278;0.172)|Lung NSC(278;0.207)					CTCCCTTTCGGCATCTTCTAC	0.617																																																	0													133.0	99.0	111.0					17																	72929582		2203	4300	6503	SO:0001583	missense	0			BK000567	CCDS11708.1	17q25.3	2006-09-20				ENSG00000183034			19657	protein-coding gene	gene with protein product		607827				12651873	Standard	NM_178160		Approved		uc010wrp.2	Q7RTS6		ENST00000580223.1:c.1631G>A	17.37:g.72929582G>A	ENSP00000463837:p.Gly544Asp			Missense_Mutation	SNP	pfam_Otopetrin	p.G544D	ENST00000580223.1	37	c.1631	CCDS11708.1	17	.	.	.	.	.	.	.	.	.	.	G	29.2	4.982932	0.93044	.	.	ENSG00000183034	ENST00000331427	T	0.21932	1.98	4.96	4.96	0.65561	.	0.056233	0.64402	D	0.000001	T	0.45955	0.1368	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.25882	-1.0119	10	0.27785	T	0.31	-21.7749	18.1943	0.89815	0.0:0.0:1.0:0.0	.	544	Q7RTS6	OTOP2_HUMAN	D	544	ENSP00000332528:G544D	ENSP00000332528:G544D	G	+	2	0	OTOP2	70441177	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.775000	0.98995	2.452000	0.82932	0.561000	0.74099	GGC	OTOP2	-	pfam_Otopetrin	ENSG00000183034		0.617	OTOP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOP2	HGNC	protein_coding	OTTHUMT00000445306.1		0.00	69	0	G	NM_178160		72929582	+1			no_errors	ENST00000331427	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	A
AKAP2	11217	genome.wustl.edu	37	9	112898623	112898623	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr9:112898623G>T	ENST00000259318.7	+	2	313	c.106G>T	c.(106-108)Ggc>Tgc	p.G36C	PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.G267C|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.G267C|AKAP2_ENST00000555236.1_Missense_Mutation_p.G267C|AKAP2_ENST00000434623.2_Missense_Mutation_p.G125C|AKAP2_ENST00000510514.5_Missense_Mutation_p.G267C|AKAP2_ENST00000374525.1_Missense_Mutation_p.G125C	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	36										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						CCCGCATAATGGCCTCCTTAC	0.493																																																	0													181.0	162.0	168.0					9																	112898623		2203	4300	6503	SO:0001583	missense	0			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.106G>T	9.37:g.112898623G>T	ENSP00000259318:p.Gly36Cys		B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	pfam_Paralemmin,pfam_RII_binding_1	p.G267C	ENST00000259318.7	37	c.799	CCDS48003.1	9	.	.	.	.	.	.	.	.	.	.	G	23.7	4.447863	0.84101	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.52057	1.99;1.99;1.99;1.99;1.28;0.7;0.68;1.3	6.17	6.17	0.99709	.	0.182670	0.37906	N	0.001895	T	0.69797	0.3151	M	0.68952	2.095	0.48395	D	0.999647	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999;0.999;0.998	D;D;D;D;D;D;D;D	0.97110	0.994;1.0;1.0;1.0;1.0;0.983;0.983;0.962	T	0.69292	-0.5183	10	0.87932	D	0	-32.2944	19.8676	0.96824	0.0:0.0:1.0:0.0	.	36;125;119;125;126;267;267;85	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	C	267;267;267;267;125;125;85;36	ENSP00000363654:G267C;ENSP00000305861:G267C;ENSP00000451476:G267C;ENSP00000421522:G267C;ENSP00000404782:G125C;ENSP00000363649:G125C;ENSP00000419268:G85C;ENSP00000259318:G36C	ENSP00000259318:G36C	G	+	1	0	PALM2-AKAP2;AKAP2	111938444	1.000000	0.71417	1.000000	0.80357	0.665000	0.39181	7.241000	0.78201	2.941000	0.99782	0.655000	0.94253	GGC	PALM2-AKAP2	-	NULL	ENSG00000157654		0.493	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000346067.3	-	0.00	50	0	G	NM_001004065		112898623	+1	tier1	-	no_errors	ENST00000374530	ensembl	human	known	74_37	missense	7.58	61	5	SNP	1.000	T
PARD3	56288	genome.wustl.edu	37	10	34985330	34985331	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr10:34985330_34985331insA	ENST00000374789.3	-	2	462_463	c.137_138insT	c.(136-138)atafs	p.I46fs	PARD3_ENST00000350537.4_Frame_Shift_Ins_p.I46fs|PARD3_ENST00000340077.5_Frame_Shift_Ins_p.I46fs|PARD3_ENST00000374788.3_Frame_Shift_Ins_p.I46fs|PARD3_ENST00000545260.1_Frame_Shift_Ins_p.I46fs|PARD3_ENST00000346874.4_Frame_Shift_Ins_p.I46fs|PARD3_ENST00000374773.1_Frame_Shift_Ins_p.I46fs|PARD3_ENST00000374790.3_Frame_Shift_Ins_p.I46fs|PARD3_ENST00000374776.1_Frame_Shift_Ins_p.I46fs|PARD3_ENST00000545693.1_Frame_Shift_Ins_p.I46fs|PARD3_ENST00000374794.3_Frame_Shift_Ins_p.I46fs	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	46					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				GATGCACCTGTATCCAGTAGTT	0.406																																																	0																																										SO:0001589	frameshift_variant	0			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.138dupT	10.37:g.34985331_34985331dupA	ENSP00000363921:p.Ile46fs		F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Frame_Shift_Ins	INS	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Q47fs	ENST00000374789.3	37	c.138_137	CCDS7178.1	10																																																																																			PARD3	-	pfam_DUF3534	ENSG00000148498		0.406	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD3	HGNC	protein_coding	OTTHUMT00000047527.1		0.00	63	0	-	NM_019619		34985331	-1	tier1		no_errors	ENST00000374789	ensembl	human	known	74_37	frame_shift_ins	13.46	45	7	INS	1.000:1.000	A
PARD3B	117583	genome.wustl.edu	37	2	206305223	206305223	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:206305223C>G	ENST00000406610.2	+	20	3078	c.2871C>G	c.(2869-2871)aaC>aaG	p.N957K	PARD3B_ENST00000351153.1_Missense_Mutation_p.N888K|PARD3B_ENST00000349953.3_Intron|PARD3B_ENST00000358768.2_Missense_Mutation_p.N895K	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	957					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CCAGAGTGAACCACTTTCGGG	0.473																																																	0													188.0	188.0	188.0					2																	206305223		2024	4185	6209	SO:0001583	missense	0			AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.2871C>G	2.37:g.206305223C>G	ENSP00000385848:p.Asn957Lys		E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.N957K	ENST00000406610.2	37	c.2871		2	.	.	.	.	.	.	.	.	.	.	C	14.84	2.654330	0.47467	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153	T;T;T	0.24908	1.83;1.83;1.83	5.35	2.52	0.30459	.	0.167559	0.37178	N	0.002217	T	0.35335	0.0928	L	0.51422	1.61	0.80722	D	1	D;P;P	0.69078	0.997;0.698;0.884	D;B;B	0.75484	0.986;0.188;0.301	T	0.22347	-1.0219	10	0.14656	T	0.56	.	6.5165	0.22250	0.1275:0.6653:0.0:0.2072	.	957;888;895	Q8TEW8;E9PE87;Q8TEW8-2	PAR3L_HUMAN;.;.	K	957;895;888	ENSP00000385848:N957K;ENSP00000351618:N895K;ENSP00000317261:N888K	ENSP00000317261:N888K	N	+	3	2	PARD3B	206013468	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	0.970000	0.29383	0.310000	0.22990	0.467000	0.42956	AAC	PARD3B	-	NULL	ENSG00000116117		0.473	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	PARD3B	HGNC	protein_coding	OTTHUMT00000335992.1	-	0.00	112	0	C	NM_057177		206305223	+1	tier1	-	no_errors	ENST00000406610	ensembl	human	known	74_37	missense	6.14	107	7	SNP	1.000	G
PDE4D	5144	genome.wustl.edu	37	5	58489358	58489358	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr5:58489358C>T	ENST00000340635.6	-	3	827	c.652G>A	c.(652-654)Gga>Aga	p.G218R	PDE4D_ENST00000507116.1_Missense_Mutation_p.G154R|PDE4D_ENST00000503258.1_Missense_Mutation_p.G88R|PDE4D_ENST00000502484.2_Missense_Mutation_p.G157R|PDE4D_ENST00000546160.1_Missense_Mutation_p.G157R|PDE4D_ENST00000502575.1_Missense_Mutation_p.G154R|PDE4D_ENST00000405755.2_Missense_Mutation_p.G96R|PDE4D_ENST00000360047.5_Missense_Mutation_p.G82R|PDE4D_ENST00000503947.1_5'UTR	NM_001104631.1	NP_001098101.1	Q08499	PDE4D_HUMAN	phosphodiesterase 4D, cAMP-specific	218					adrenergic receptor signaling pathway (GO:0071875)|adrenergic receptor signaling pathway involved in positive regulation of heart rate (GO:0086024)|aging (GO:0007568)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|establishment of endothelial barrier (GO:0061028)|multicellular organism growth (GO:0035264)|negative regulation of heart contraction (GO:0045822)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-5 production (GO:0032754)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901844)|regulation of heart rate (GO:0002027)|regulation of receptor activity (GO:0010469)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|smooth muscle contraction (GO:0006939)|T cell receptor signaling pathway (GO:0050852)	calcium channel complex (GO:0034704)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|ATPase binding (GO:0051117)|beta-2 adrenergic receptor binding (GO:0031698)|cAMP binding (GO:0030552)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|pancreas(1)	15		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Caffeine(DB00201)|Dyphylline(DB00651)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Roflumilast(DB01656)	AAGTCATCTCCGTGTCTGAAA	0.398																																																	0													75.0	71.0	72.0					5																	58489358		1880	4130	6010	SO:0001583	missense	0				CCDS47213.1, CCDS54858.1, CCDS54859.1, CCDS56369.1, CCDS56370.1, CCDS56371.1, CCDS56372.1, CCDS56373.1	5q12	2010-06-24	2010-06-24				3.1.4.17	"""Phosphodiesterases"""	8783	protein-coding gene	gene with protein product	"""phosphodiesterase E3 dunce homolog (Drosophila)"""	600129	"""phosphodiesterase 4D, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E3)"""	DPDE3			Standard	NM_006203		Approved		uc003jsa.2	Q08499		ENST00000340635.6:c.652G>A	5.37:g.58489358C>T	ENSP00000345502:p.Gly218Arg		O43433|Q13549|Q13550|Q13551|Q7Z2L8|Q8IV84|Q8IVA9|Q8IVD2|Q8IVD3|Q96HL4|Q9HCX7	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,prints_PDEase	p.G218R	ENST00000340635.6	37	c.652	CCDS47213.1	5	.	.	.	.	.	.	.	.	.	.	C	19.43	3.826670	0.71143	.	.	ENSG00000113448	ENST00000340635;ENST00000356665;ENST00000360047;ENST00000507116;ENST00000503258;ENST00000405755;ENST00000502484;ENST00000546160;ENST00000502575	T;T;T;T;T;T;T;D	0.82344	-0.32;-0.33;-0.34;-0.32;-0.34;-0.34;-0.34;-1.6	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.89413	0.6708	L	0.46157	1.445	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999;0.999;1.0	D;D;D;D;D;D;D;D	0.87578	0.977;0.996;0.998;0.997;0.998;0.98;0.98;0.998	D	0.89095	0.3485	10	0.72032	D	0.01	.	20.2544	0.98414	0.0:1.0:0.0:0.0	.	98;154;157;218;154;81;96;88	Q9HCX6;Q08499-12;Q08499-11;Q08499;Q08499-6;Q08499-2;Q08499-9;Q08499-10	.;.;.;PDE4D_HUMAN;.;.;.;.	R	218;87;82;154;88;96;157;157;154	ENSP00000345502:G218R;ENSP00000353152:G82R;ENSP00000424852:G154R;ENSP00000425605:G88R;ENSP00000384806:G96R;ENSP00000423094:G157R;ENSP00000442734:G157R;ENSP00000425917:G154R	ENSP00000308485:G154R	G	-	1	0	PDE4D	58525115	1.000000	0.71417	0.994000	0.49952	0.990000	0.78478	5.622000	0.67750	2.885000	0.99019	0.655000	0.94253	GGA	PDE4D	-	NULL	ENSG00000113448		0.398	PDE4D-001	KNOWN	basic|CCDS	protein_coding	PDE4D	HGNC	protein_coding	OTTHUMT00000367940.3	-	0.00	152	0	C			58489358	-1	tier1	-	no_errors	ENST00000340635	ensembl	human	known	74_37	missense	8.81	145	14	SNP	1.000	T
PHF2	5253	genome.wustl.edu	37	9	96428105	96428105	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr9:96428105C>T	ENST00000359246.4	+	15	2442	c.2075C>T	c.(2074-2076)cCc>cTc	p.P692L	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	692					liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		GACGAGTTTCCCATCAGGAGG	0.592																																																	0													101.0	111.0	107.0					9																	96428105		2203	4300	6503	SO:0001583	missense	0			AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.2075C>T	9.37:g.96428105C>T	ENSP00000352185:p.Pro692Leu		Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.P692L	ENST00000359246.4	37	c.2075	CCDS35069.1	9	.	.	.	.	.	.	.	.	.	.	c	20.0	3.930168	0.73327	.	.	ENSG00000197724	ENST00000359246	T	0.21543	2.0	5.22	4.33	0.51752	.	0.168854	0.53938	N	0.000054	T	0.34629	0.0904	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.85130	0.923;0.997	T	0.09185	-1.0686	10	0.08381	T	0.77	-18.8606	14.0202	0.64550	0.0:0.9269:0.0:0.073	.	110;692	Q8N359;O75151	.;PHF2_HUMAN	L	692	ENSP00000352185:P692L	ENSP00000352185:P692L	P	+	2	0	PHF2	95467926	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.622000	0.67750	1.213000	0.43380	-0.185000	0.12909	CCC	PHF2	-	NULL	ENSG00000197724		0.592	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF2	HGNC	protein_coding	OTTHUMT00000053162.1	-	0.00	107	0	C	NM_005392		96428105	+1	tier1	-	no_errors	ENST00000359246	ensembl	human	known	74_37	missense	6.12	92	6	SNP	1.000	T
PIWIL2	55124	genome.wustl.edu	37	8	22147810	22147810	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr8:22147810G>T	ENST00000454009.2	+	10	1641	c.1132G>T	c.(1132-1134)Gct>Tct	p.A378S	PIWIL2_ENST00000356766.6_Missense_Mutation_p.A378S|PIWIL2_ENST00000521356.1_Missense_Mutation_p.A378S	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	378					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		CTTCCTGCTAGCTGATGTCTC	0.478																																																	0													169.0	135.0	146.0					8																	22147810		2203	4300	6503	SO:0001583	missense	0			AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.1132G>T	8.37:g.22147810G>T	ENSP00000406956:p.Ala378Ser		A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.A378S	ENST00000454009.2	37	c.1132	CCDS6029.1	8	.	.	.	.	.	.	.	.	.	.	G	19.15	3.771612	0.69992	.	.	ENSG00000197181	ENST00000356766;ENST00000521356;ENST00000454009	T;T;T	0.10099	2.91;2.91;2.91	5.63	5.63	0.86233	Argonaute/Dicer protein, PAZ (1);	0.058943	0.64402	D	0.000002	T	0.16128	0.0388	L	0.59436	1.845	0.46396	D	0.999027	B;B	0.18741	0.013;0.03	B;B	0.19391	0.017;0.025	T	0.01697	-1.1293	10	0.45353	T	0.12	-11.9649	18.8276	0.92124	0.0:0.0:1.0:0.0	.	378;378	E7ECA4;Q8TC59	.;PIWL2_HUMAN	S	378	ENSP00000349208:A378S;ENSP00000428267:A378S;ENSP00000406956:A378S	ENSP00000349208:A378S	A	+	1	0	PIWIL2	22203755	1.000000	0.71417	0.991000	0.47740	0.951000	0.60555	6.733000	0.74796	2.826000	0.97356	0.655000	0.94253	GCT	PIWIL2	-	superfamily_PAZ_dom	ENSG00000197181		0.478	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PIWIL2	HGNC	protein_coding	OTTHUMT00000375438.1	-	0.00	61	0	G			22147810	+1	tier1	-	no_errors	ENST00000356766	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
PLEKHD1	400224	genome.wustl.edu	37	14	69968523	69968523	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr14:69968523G>T	ENST00000322564.7	+	5	695	c.483G>T	c.(481-483)aaG>aaT	p.K161N		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	161										breast(1)|endometrium(1)|kidney(2)	4						AGTTGGCTAAGGAAAAGCAGG	0.582																																																	0													175.0	173.0	173.0					14																	69968523		692	1591	2283	SO:0001583	missense	0			AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.483G>T	14.37:g.69968523G>T	ENSP00000317175:p.Lys161Asn		B9EJC2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.K161N	ENST00000322564.7	37	c.483	CCDS53903.1	14	.	.	.	.	.	.	.	.	.	.	G	19.73	3.881376	0.72294	.	.	ENSG00000175985	ENST00000322564	.	.	.	5.77	3.96	0.45880	.	.	.	.	.	T	0.69566	0.3125	L	0.59436	1.845	0.42771	D	0.99383	D	0.71674	0.998	D	0.76071	0.987	T	0.68318	-0.5440	7	.	.	.	.	11.5542	0.50737	0.1356:0.0:0.8644:0.0	.	161	B9EJC2	.	N	161	.	.	K	+	3	2	PLEKHD1	69038276	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.811000	0.55620	0.805000	0.34159	0.561000	0.74099	AAG	PLEKHD1	-	NULL	ENSG00000175985		0.582	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHD1	HGNC	protein_coding	OTTHUMT00000412451.2		0.00	94	0	G	NM_001161498		69968523	+1			no_errors	ENST00000322564	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	T
PLXNA1	5361	genome.wustl.edu	37	3	126733428	126733428	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr3:126733428G>T	ENST00000393409.2	+	12	2712	c.2712G>T	c.(2710-2712)aaG>aaT	p.K904N	PLXNA1_ENST00000251772.4_Missense_Mutation_p.K881N	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	904	IPT/TIG 1.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		GCGTGGGCAAGGTGCTGTGCA	0.701																																																	0													76.0	79.0	78.0					3																	126733428		2202	4300	6502	SO:0001583	missense	0			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.2712G>T	3.37:g.126733428G>T	ENSP00000377061:p.Lys904Asn			Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semap_dom,pfam_IPT,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.K904N	ENST00000393409.2	37	c.2712	CCDS33847.2	3	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157987	0.38119	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.74947	-0.89;-0.89	3.78	3.78	0.43462	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.378221	0.24583	N	0.037292	T	0.58566	0.2131	N	0.20845	0.615	0.43457	D	0.995651	B	0.27765	0.188	B	0.36766	0.232	T	0.58165	-0.7684	10	0.45353	T	0.12	.	3.4413	0.07465	0.1591:0.0:0.5917:0.2492	.	904	Q9UIW2	PLXA1_HUMAN	N	904;881	ENSP00000377061:K904N;ENSP00000251772:K881N	ENSP00000251772:K881N	K	+	3	2	PLXNA1	128216118	1.000000	0.71417	1.000000	0.80357	0.848000	0.48234	1.020000	0.30027	2.125000	0.65367	0.484000	0.47621	AAG	PLXNA1	-	pfam_IPT,superfamily_Ig_E-set,smart_IPT	ENSG00000114554		0.701	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	HGNC	protein_coding	OTTHUMT00000356451.1	-	0.00	67	0	G	NM_032242		126733428	+1	tier1	-	no_errors	ENST00000393409	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
POTEE	445582	genome.wustl.edu	37	2	131976381	131976381	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:131976381C>T	ENST00000356920.5	+	1	500	c.406C>T	c.(406-408)Cgt>Tgt	p.R136C	POTEE_ENST00000358087.5_Missense_Mutation_p.R136C|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	136					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											GTACCACGTCCGTGGAGAAGA	0.592																																																	0													67.0	70.0	69.0					2																	131976381		2203	4300	6503	SO:0001583	missense	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.406C>T	2.37:g.131976381C>T	ENSP00000439189:p.Arg136Cys		Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.R136C	ENST00000356920.5	37	c.406	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	13.20	2.166157	0.38217	.	.	ENSG00000188219	ENST00000356920;ENST00000358087	T;T	0.53423	0.62;0.62	1.05	1.05	0.20165	.	.	.	.	.	T	0.38772	0.1053	L	0.27053	0.805	0.09310	N	1	D	0.71674	0.998	P	0.49953	0.627	T	0.21314	-1.0249	9	0.87932	D	0	.	5.4993	0.16819	0.0:1.0:0.0:0.0	.	136	Q6S8J3	POTEE_HUMAN	C	136	ENSP00000439189:R136C;ENSP00000443049:R136C	ENSP00000439189:R136C	R	+	1	0	AC131180.1	131692851	0.002000	0.14202	0.007000	0.13788	0.100000	0.18952	-0.304000	0.08199	0.878000	0.35920	0.162000	0.16502	CGT	POTEE	-	NULL	ENSG00000188219		0.592	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	HGNC	protein_coding		-	0.00	284	0	C	NM_001083538		131976381	+1	tier1	-	no_errors	ENST00000356920	ensembl	human	known	74_37	missense	6.15	290	19	SNP	0.008	T
POTEE	445582	genome.wustl.edu	37	2	132021238	132021238	+	Missense_Mutation	SNP	G	G	A	rs549330020	byFrequency	TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:132021238G>A	ENST00000356920.5	+	15	2304	c.2210G>A	c.(2209-2211)cGc>cAc	p.R737H	POTEE_ENST00000358087.5_3'UTR|PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	737	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											ATCGTGGGGCGCCCCAGGCAG	0.637													.|||	2	0.000399361	0.0008	0.0014	5008	,	,		19253	0.0		0.0	False		,,,				2504	0.0																0													3.0	4.0	4.0					2																	132021238		1150	2572	3722	SO:0001583	missense	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2210G>A	2.37:g.132021238G>A	ENSP00000439189:p.Arg737His		Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.R737H	ENST00000356920.5	37	c.2210	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	7.308	0.614449	0.14129	.	.	ENSG00000188219	ENST00000356920	D	0.92048	-2.96	.	.	.	.	.	.	.	.	D	0.88262	0.6389	M	0.81497	2.545	0.80722	D	1	B	0.22146	0.065	B	0.08055	0.003	T	0.67436	-0.5671	8	0.38643	T	0.18	.	4.5331	0.12015	0.3248:0.0:0.6752:0.0	.	737	Q6S8J3	POTEE_HUMAN	H	737	ENSP00000439189:R737H	ENSP00000439189:R737H	R	+	2	0	AC131180.1	131737708	1.000000	0.71417	0.053000	0.19242	0.054000	0.15201	4.782000	0.62396	-1.702000	0.01411	-1.713000	0.00713	CGC	POTEE	-	pfam_Actin-related,smart_Actin-related	ENSG00000188219		0.637	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	HGNC	protein_coding		-	0.00	48	0	G	NM_001083538		132021238	+1	tier1	-	no_errors	ENST00000356920	ensembl	human	known	74_37	missense	12.50	42	6	SNP	1.000	A
PTGIR	5739	genome.wustl.edu	37	19	47124901	47124901	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr19:47124901G>T	ENST00000291294.2	-	3	930	c.797C>A	c.(796-798)cCt>cAt	p.P266H	PTGIR_ENST00000598865.1_Missense_Mutation_p.P54H|PTGIR_ENST00000597185.1_De_novo_Start_OutOfFrame|PTGIR_ENST00000594275.1_Missense_Mutation_p.P23H	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	266					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.P266R(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	GCTGCTGTCAGGGGCGACAGC	0.642																																																	1	Substitution - Missense(1)	urinary_tract(1)											37.0	33.0	35.0					19																	47124901		2163	4238	6401	SO:0001583	missense	0				CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.797C>A	19.37:g.47124901G>T	ENSP00000291294:p.Pro266His			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_IP_rcpt,prints_Prostanoid_rcpt,prints_Thbox_rcpt	p.P266H	ENST00000291294.2	37	c.797	CCDS12686.1	19	.	.	.	.	.	.	.	.	.	.	G	13.67	2.306641	0.40795	.	.	ENSG00000160013	ENST00000291294	T	0.43688	0.94	4.39	4.39	0.52855	GPCR, rhodopsin-like superfamily (1);	0.148588	0.44902	D	0.000401	T	0.41627	0.1167	L	0.55990	1.75	0.19945	N	0.99994	P	0.42248	0.774	P	0.44897	0.463	T	0.34229	-0.9837	10	0.42905	T	0.14	-16.044	9.6702	0.40008	0.0:0.0:0.7924:0.2076	.	266	P43119	PI2R_HUMAN	H	266	ENSP00000291294:P266H	ENSP00000291294:P266H	P	-	2	0	PTGIR	51816741	1.000000	0.71417	0.905000	0.35620	0.359000	0.29487	5.479000	0.66813	2.252000	0.74401	0.561000	0.74099	CCT	PTGIR	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_IP_rcpt	ENSG00000160013		0.642	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGIR	HGNC	protein_coding	OTTHUMT00000466581.1		0.00	51	0	G			47124901	-1			no_errors	ENST00000291294	ensembl	human	known	74_37	missense	6.12	46	3	SNP	0.185	T
RBMXL3	139804	genome.wustl.edu	37	X	114425012	114425012	+	Silent	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chrX:114425012G>A	ENST00000424776.3	+	1	1050	c.1008G>A	c.(1006-1008)tcG>tcA	p.S336S	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	336							nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						AGGGCAACTCGCCCGATGCCT	0.657																																																	0													33.0	34.0	34.0					X																	114425012		692	1591	2283	SO:0001819	synonymous_variant	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1008G>A	X.37:g.114425012G>A			B4DXC0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S336	ENST00000424776.3	37	c.1008	CCDS55478.1	X																																																																																			RBMXL3	-	NULL	ENSG00000175718		0.657	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	-	0.00	45	0	G	NM_001145346		114425012	+1	tier1	-	no_errors	ENST00000424776	ensembl	human	known	74_37	silent	10.87	41	5	SNP	0.010	A
RCE1	9986	genome.wustl.edu	37	11	66613012	66613012	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr11:66613012G>T	ENST00000309657.3	+	7	777	c.733G>T	c.(733-735)Gct>Tct	p.A245S	RCE1_ENST00000524506.1_Intron|RCE1_ENST00000525356.1_Missense_Mutation_p.A122S	NM_001032279.1|NM_005133.2	NP_001027450.1|NP_005124.1	Q9Y256	FACE2_HUMAN	Ras converting CAAX endopeptidase 1	245					CAAX-box protein processing (GO:0071586)|proteolysis (GO:0006508)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cysteine-type endopeptidase activity (GO:0004197)|metalloendopeptidase activity (GO:0004222)			breast(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10						TGCCTACACTGCTTTCCTCTT	0.597																																																	0													153.0	124.0	134.0					11																	66613012		2200	4295	6495	SO:0001583	missense	0			AF121951	CCDS8151.1	11q13	2013-10-18	2013-10-18	2001-06-29	ENSG00000173653	ENSG00000173653			13721	protein-coding gene	gene with protein product	"""farnesylated protein-converting enzyme 2"", ""prenyl protein-specific endoprotease 2"", ""RCE1 homolog, prenyl protein protease"", ""CAAX prenyl protease 2"""	605385	"""RCE1 (S. Cerevisiae) homolog, prenyl protein protease"", ""RCE1 homolog, prenyl protein peptidase (S. cerevisiae)"", ""RCE1 homolog, prenyl protein protease (S. cerevisiae)"""	RCE1A, RCE1B		10085068, 10373325	Standard	NM_005133		Approved	hRCE1, FACE-2, FACE2	uc001ojk.1	Q9Y256	OTTHUMG00000167098	ENST00000309657.3:c.733G>T	11.37:g.66613012G>T	ENSP00000309163:p.Ala245Ser		Q52LZ9	Missense_Mutation	SNP	pfam_CAAX_protease	p.A245S	ENST00000309657.3	37	c.733	CCDS8151.1	11	.	.	.	.	.	.	.	.	.	.	G	18.68	3.676819	0.67928	.	.	ENSG00000173653	ENST00000309657;ENST00000525356	.	.	.	5.46	5.46	0.80206	.	0.129731	0.50627	D	0.000107	T	0.56277	0.1974	L	0.45051	1.395	0.80722	D	1	B	0.19706	0.038	B	0.17979	0.02	T	0.51092	-0.8749	9	0.35671	T	0.21	-2.8195	16.8044	0.85622	0.0:0.0:1.0:0.0	.	245	Q9Y256	FACE2_HUMAN	S	245;122	.	ENSP00000309163:A245S	A	+	1	0	RCE1	66369588	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.133000	0.94460	2.577000	0.86979	0.655000	0.94253	GCT	RCE1	-	pfam_CAAX_protease	ENSG00000173653		0.597	RCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCE1	HGNC	protein_coding	OTTHUMT00000393105.1		0.00	30	0	G	NM_005133		66613012	+1			no_errors	ENST00000309657	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
RFC3	5983	genome.wustl.edu	37	13	34405463	34405463	+	Missense_Mutation	SNP	G	G	T	rs137956836		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr13:34405463G>T	ENST00000380071.3	+	7	911	c.781G>T	c.(781-783)Gct>Tct	p.A261S	RNU5A-4P_ENST00000516588.1_RNA|RFC3_ENST00000434425.1_Missense_Mutation_p.A261S	NM_002915.3	NP_002906.1	P40938	RFC3_HUMAN	replication factor C (activator 1) 3, 38kDa	261					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to organophosphorus (GO:0046683)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	DNA clamp loader activity (GO:0003689)			lung(2)|skin(1)	3		Hepatocellular(188;0.0191)|Lung SC(185;0.0548)		all cancers(112;5.09e-06)|Epithelial(112;6.52e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00107)|OV - Ovarian serous cystadenocarcinoma(117;0.0285)|GBM - Glioblastoma multiforme(144;0.123)		GACTGCAAATGCTATTGTCAG	0.363																																																	0													113.0	108.0	109.0					13																	34405463		2203	4300	6503	SO:0001583	missense	0				CCDS9352.1, CCDS45025.1	13q13.2	2010-04-21	2002-08-29		ENSG00000133119	ENSG00000133119		"""ATPases / AAA-type"""	9971	protein-coding gene	gene with protein product	"""RFC, 38 kD subunit"", ""A1 38 kDa subunit"""	600405	"""replication factor C (activator 1) 3 (38kD)"""			7774928	Standard	NM_002915		Approved	RFC38, MGC5276	uc001uuz.3	P40938	OTTHUMG00000016715	ENST00000380071.3:c.781G>T	13.37:g.34405463G>T	ENSP00000369411:p.Ala261Ser		C9JU95|O15252|Q5W0E8	Missense_Mutation	SNP	pfam_ATPase_AAA_core,superfamily_P-loop_NTPase,superfamily_DNA_pol3_clamp-load_cplx_C,smart_AAA+_ATPase	p.A261S	ENST00000380071.3	37	c.781	CCDS9352.1	13	.	.	.	.	.	.	.	.	.	.	G	14.48	2.546638	0.45383	.	.	ENSG00000133119	ENST00000380071;ENST00000434425	T;T	0.40225	1.04;1.04	5.93	5.93	0.95920	DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal (1);DNA polymerase III, clamp-loader complex, subunit E, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.31071	0.0785	N	0.20483	0.58	0.80722	D	1	B;B;B	0.32781	0.384;0.271;0.173	B;B;B	0.33121	0.124;0.158;0.158	T	0.07309	-1.0779	10	0.12430	T	0.62	-18.485	19.3303	0.94283	0.0:0.0:1.0:0.0	.	261;261;261	B4DKE6;C9JU95;P40938	.;.;RFC3_HUMAN	S	261	ENSP00000369411:A261S;ENSP00000401001:A261S	ENSP00000369411:A261S	A	+	1	0	RFC3	33303463	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.194000	0.94962	2.810000	0.96702	0.655000	0.94253	GCT	RFC3	-	superfamily_DNA_pol3_clamp-load_cplx_C	ENSG00000133119		0.363	RFC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC3	HGNC	protein_coding	OTTHUMT00000044450.2	-	0.00	52	0	G	NM_002915		34405463	+1	tier1	-	no_errors	ENST00000380071	ensembl	human	known	74_37	missense	7.81	59	5	SNP	1.000	T
RFX3	5991	genome.wustl.edu	37	9	3270497	3270497	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr9:3270497G>T	ENST00000382004.3	-	12	1542	c.1231C>A	c.(1231-1233)Ccg>Acg	p.P411T	RFX3_ENST00000302303.1_Missense_Mutation_p.P411T|RFX3_ENST00000358730.2_Missense_Mutation_p.P411T	NM_001282116.1|NM_134428.1	NP_001269045.1|NP_602304.1	P48380	RFX3_HUMAN	regulatory factor X, 3 (influences HLA class II expression)	411					cell maturation (GO:0048469)|cilium assembly (GO:0042384)|cilium-dependent cell motility (GO:0060285)|endocrine pancreas development (GO:0031018)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of insulin secretion (GO:0050796)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(11)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		TTTGCTTTCGGAAGTCGACTT	0.378																																																	0													94.0	85.0	88.0					9																	3270497		2203	4300	6503	SO:0001583	missense	0			AI811824	CCDS6449.1, CCDS6450.1, CCDS75809.1	9p24.2	2008-02-05			ENSG00000080298	ENSG00000080298			9984	protein-coding gene	gene with protein product		601337				8289803	Standard	XM_005251534		Approved		uc003zhr.3	P48380	OTTHUMG00000019456	ENST00000382004.3:c.1231C>A	9.37:g.3270497G>T	ENSP00000371434:p.Pro411Thr		A8K0H5|D3DRH8|D3DRH9|Q5JTL7|Q5JTL8|Q6NW13|Q8WTU4|Q95HL5|Q95HL6	Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.P411T	ENST00000382004.3	37	c.1231	CCDS6449.1	9	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284819	0.59867	.	.	ENSG00000080298	ENST00000382004;ENST00000358730;ENST00000302303	T;T;T	0.07021	3.23;3.23;3.23	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.14485	0.0350	M	0.65498	2.005	0.80722	D	1	B;B	0.26400	0.022;0.148	B;B	0.25405	0.06;0.051	T	0.02251	-1.1188	10	0.38643	T	0.18	-13.4452	19.8769	0.96880	0.0:0.0:1.0:0.0	.	411;411	P48380-2;P48380	.;RFX3_HUMAN	T	411	ENSP00000371434:P411T;ENSP00000351574:P411T;ENSP00000303847:P411T	ENSP00000303847:P411T	P	-	1	0	RFX3	3260497	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.025000	0.88777	2.712000	0.92718	0.650000	0.86243	CCG	RFX3	-	NULL	ENSG00000080298		0.378	RFX3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX3	HGNC	protein_coding	OTTHUMT00000051545.1	-	0.00	74	0	G	NM_002919		3270497	-1	tier1	-	no_errors	ENST00000382004	ensembl	human	known	74_37	missense	6.45	58	4	SNP	1.000	T
RHBDD2	57414	genome.wustl.edu	37	7	75517670	75517670	+	3'UTR	SNP	G	G	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr7:75517670G>C	ENST00000006777.6	+	0	1233				RHBDD2_ENST00000468304.1_3'UTR|RHBDD2_ENST00000428119.1_3'UTR|RHBDD2_ENST00000318622.4_3'UTR	NM_001040456.1	NP_001035546.1	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2							Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|lung(4)|prostate(1)	6						TGCCCTGAGAGAATTTCTAGG	0.557																																																	0													45.0	47.0	46.0					7																	75517670		1872	4097	5969	SO:0001624	3_prime_UTR_variant	0			AF226732	CCDS43602.1, CCDS43603.1	7q11	2008-09-04	2006-02-22	2006-02-22	ENSG00000005486	ENSG00000005486			23082	protein-coding gene	gene with protein product		615203	"""rhomboid, veinlet-like 7 (Drosophila)"""	RHBDL7		12838346	Standard	XM_005250511		Approved	NPD007	uc003udw.1	Q6NTF9	OTTHUMG00000156435	ENST00000006777.6:c.*3G>C	7.37:g.75517670G>C			Q7L534|Q9H5W6|Q9HBK7|Q9UDT2	RNA	SNP	-	NULL	ENST00000006777.6	37	NULL	CCDS43602.1	7	.	.	.	.	.	.	.	.	.	.	G	7.622	0.677043	0.14841	.	.	ENSG00000005486	ENST00000413229	.	.	.	4.85	-1.51	0.08664	.	.	.	.	.	T	0.34193	0.0889	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.37291	-0.9712	5	0.62326	D	0.03	.	3.3063	0.07001	0.3405:0.0:0.371:0.2885	.	.	.	.	T	410	.	ENSP00000407074:R410T	R	+	2	0	RHBDD2	75355606	0.002000	0.14202	0.000000	0.03702	0.071000	0.16799	0.680000	0.25306	-0.524000	0.06400	-0.181000	0.13052	AGA	RHBDD2	-	-	ENSG00000005486		0.557	RHBDD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHBDD2	HGNC	protein_coding	OTTHUMT00000344176.1	-	0.00	90	0	G	NM_020684		75517670	+1	tier1	-	no_errors	ENST00000468304	ensembl	human	putative	74_37	rna	6.06	62	4	SNP	0.000	C
RIMS1	22999	genome.wustl.edu	37	6	73000537	73000537	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr6:73000537C>T	ENST00000521978.1	+	25	3710	c.3710C>T	c.(3709-3711)tCg>tTg	p.S1237L	RIMS1_ENST00000538414.1_Intron|RIMS1_ENST00000517827.1_Intron|RIMS1_ENST00000264839.7_Intron|RIMS1_ENST00000518273.1_Intron|RIMS1_ENST00000348717.5_Intron|RIMS1_ENST00000491071.2_Intron|RIMS1_ENST00000522291.1_Intron|RIMS1_ENST00000523963.1_Intron|RIMS1_ENST00000401910.3_Intron|RIMS1_ENST00000520567.1_Intron|RIMS1_ENST00000517960.1_Intron|RIMS1_ENST00000425662.2_Intron	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1237					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CCTGGAGGGTCGGCGCCACCT	0.552																																																	0													77.0	81.0	79.0					6																	73000537		2123	4224	6347	SO:0001583	missense	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.3710C>T	6.37:g.73000537C>T	ENSP00000428417:p.Ser1237Leu		A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.S1237L	ENST00000521978.1	37	c.3710	CCDS47449.1	6	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980133	0.74474	.	.	ENSG00000079841	ENST00000521978	T	0.16073	2.37	5.4	5.4	0.78164	.	0.000000	0.42821	D	0.000655	T	0.03390	0.0098	N	0.08118	0	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.39563	-0.9608	10	0.20519	T	0.43	-8.6371	11.4397	0.50090	0.0:0.9158:0.0:0.0842	.	1237	Q86UR5	RIMS1_HUMAN	L	1237	ENSP00000428417:S1237L	ENSP00000428417:S1237L	S	+	2	0	RIMS1	73057258	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	3.698000	0.54771	2.530000	0.85305	0.563000	0.77884	TCG	RIMS1	-	NULL	ENSG00000079841		0.552	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1	-	0.00	75	0	C			73000537	+1	tier1	-	no_errors	ENST00000521978	ensembl	human	known	74_37	missense	10.23	79	9	SNP	1.000	T
RIMS2	9699	genome.wustl.edu	37	8	104987676	104987676	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr8:104987676C>T	ENST00000436393.2	+	14	2444	c.2203C>T	c.(2203-2205)Cga>Tga	p.R735*	RIMS2_ENST00000406091.3_Nonsense_Mutation_p.R957*|RIMS2_ENST00000507740.1_Nonsense_Mutation_p.R749*|RIMS2_ENST00000262231.10_Nonsense_Mutation_p.R796*			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1019	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GTCTCCTCATCGAGTAGATGT	0.418										HNSCC(12;0.0054)																																							0													109.0	106.0	107.0					8																	104987676		1915	4122	6037	SO:0001587	stop_gained	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2203C>T	8.37:g.104987676C>T	ENSP00000390665:p.Arg735*		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Nonsense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.R957*	ENST00000436393.2	37	c.2869		8	.	.	.	.	.	.	.	.	.	.	C	38	7.101383	0.98063	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	.	.	.	4.98	3.1	0.35709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.3175	0.54966	0.3328:0.6672:0.0:0.0	.	.	.	.	X	957;972;957;1019;796;749;749;735	.	ENSP00000262231:R796X	R	+	1	2	RIMS2	105056852	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	2.753000	0.47524	0.551000	0.29008	0.561000	0.74099	CGA	RIMS2	-	NULL	ENSG00000176406		0.418	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	66	0	C	NM_001100117		104987676	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	nonsense	10.71	50	6	SNP	1.000	T
RNF26	79102	genome.wustl.edu	37	11	119206725	119206725	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr11:119206725C>T	ENST00000311413.4	+	1	1489	c.893C>T	c.(892-894)gCg>gTg	p.A298V	C1QTNF5_ENST00000525657.1_5'Flank|RP11-334E6.10_ENST00000501918.2_RNA	NM_032015.4	NP_114404.1	Q9BY78	RNF26_HUMAN	ring finger protein 26	298						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;3.8e-05)		CTGCAGCTGGCGAGTTGGCCA	0.632																																																	0													27.0	31.0	29.0					11																	119206725		2199	4295	6494	SO:0001583	missense	0			AB055622	CCDS8419.1	11q23	2008-07-21				ENSG00000173456		"""RING-type (C3HC4) zinc fingers"""	14646	protein-coding gene	gene with protein product	"""ring finger protein with leucine zipper"""	606130				11352657	Standard	NM_032015		Approved	MGC2642	uc001pwh.3	Q9BY78		ENST00000311413.4:c.893C>T	11.37:g.119206725C>T	ENSP00000312439:p.Ala298Val		Q542Y8	Missense_Mutation	SNP	pfscan_Znf_RING	p.A298V	ENST00000311413.4	37	c.893	CCDS8419.1	11	.	.	.	.	.	.	.	.	.	.	C	11.48	1.650263	0.29336	.	.	ENSG00000173456	ENST00000311413	T	0.31769	1.48	5.42	4.44	0.53790	.	0.499266	0.18939	N	0.126992	T	0.23727	0.0574	L	0.44542	1.39	0.31641	N	0.648085	B	0.11235	0.004	B	0.06405	0.002	T	0.17471	-1.0368	10	0.27082	T	0.32	-8.5103	7.6492	0.28337	0.0:0.7445:0.1587:0.0968	.	298	Q9BY78	RNF26_HUMAN	V	298	ENSP00000312439:A298V	ENSP00000312439:A298V	A	+	2	0	RNF26	118711935	0.956000	0.32656	0.810000	0.32431	0.284000	0.27059	2.065000	0.41442	1.142000	0.42291	0.491000	0.48974	GCG	RNF26	-	NULL	ENSG00000173456		0.632	RNF26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF26	HGNC	protein_coding	OTTHUMT00000388220.1	-	0.00	74	0	C	NM_032015		119206725	+1	tier1	-	no_errors	ENST00000311413	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.983	T
RUNDC1	146923	genome.wustl.edu	37	17	41143372	41143372	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr17:41143372G>T	ENST00000361677.1	+	5	1493	c.1481G>T	c.(1480-1482)cGg>cTg	p.R494L		NM_173079.2	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	494	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.							p.R494Q(1)		breast(1)|large_intestine(2)|lung(4)|prostate(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		TCCCCAGCCCGGAAGCTCTCC	0.582																																																	1	Substitution - Missense(1)	large_intestine(1)											69.0	69.0	69.0					17																	41143372		2203	4300	6503	SO:0001583	missense	0			AL831813	CCDS11448.1	17q21.31	2004-02-27				ENSG00000198863			25418	protein-coding gene	gene with protein product						12477932	Standard	NM_173079		Approved	DKFZp761H0421	uc002ici.1	Q96C34		ENST00000361677.1:c.1481G>T	17.37:g.41143372G>T	ENSP00000354622:p.Arg494Leu		Q6Y2K8|Q8IXT9|Q8N3W1	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.R494L	ENST00000361677.1	37	c.1481	CCDS11448.1	17	.	.	.	.	.	.	.	.	.	.	G	31	5.059722	0.93846	.	.	ENSG00000198863	ENST00000361677	T	0.33654	1.4	5.02	5.02	0.67125	RUN (2);	0.000000	0.85682	D	0.000000	T	0.64907	0.2641	M	0.82323	2.585	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.70200	-0.4937	10	0.72032	D	0.01	-28.2317	18.5295	0.90986	0.0:0.0:1.0:0.0	.	494	Q96C34	RUND1_HUMAN	L	494	ENSP00000354622:R494L	ENSP00000354622:R494L	R	+	2	0	RUNDC1	38396898	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.609000	0.74173	2.598000	0.87819	0.655000	0.94253	CGG	RUNDC1	-	pfam_Run,pfscan_Run	ENSG00000198863		0.582	RUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUNDC1	HGNC	protein_coding	OTTHUMT00000452464.1		0.00	42	0	G	NM_173079		41143372	+1			no_errors	ENST00000361677	ensembl	human	known	74_37	missense	7.32	38	3	SNP	1.000	T
SAP130	79595	genome.wustl.edu	37	2	128699655	128699655	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:128699655G>T	ENST00000259235.3	-	20	3201	c.3072C>A	c.(3070-3072)gaC>gaA	p.D1024E	SAP130_ENST00000357702.5_Missense_Mutation_p.D1059E|SAP130_ENST00000259234.6_Missense_Mutation_p.D1032E	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	1024	Interactions with SIN3A and HDAC1.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)	p.D1024D(1)		NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		TCAGGACACGGTCTTTATGAT	0.408																																																	1	Substitution - coding silent(1)	large_intestine(1)											175.0	154.0	161.0					2																	128699655		2203	4300	6503	SO:0001583	missense	0			BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.3072C>A	2.37:g.128699655G>T	ENSP00000259235:p.Asp1024Glu		B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Missense_Mutation	SNP	NULL	p.D1059E	ENST00000259235.3	37	c.3177	CCDS2153.1	2	.	.	.	.	.	.	.	.	.	.	.	6.232	0.410891	0.11812	.	.	ENSG00000136715	ENST00000357702;ENST00000259235;ENST00000259234	.	.	.	5.96	-7.9	0.01169	.	0.135265	0.64402	N	0.000003	T	0.10723	0.0262	N	0.12182	0.205	0.28448	N	0.916453	B;B;B;B	0.12013	0.002;0.002;0.001;0.005	B;B;B;B	0.14023	0.006;0.006;0.006;0.01	T	0.34229	-0.9837	9	0.07482	T	0.82	-20.2835	4.666	0.12666	0.5898:0.0767:0.1311:0.2024	.	1059;1024;589;661	B7ZLM3;Q9H0E3;Q9H0E3-2;B3KRT9	.;SP130_HUMAN;.;.	E	1059;1024;1032	.	ENSP00000259234:D1032E	D	-	3	2	SAP130	128416125	0.009000	0.17119	0.331000	0.25455	0.070000	0.16714	-1.287000	0.02785	-1.226000	0.02574	-1.261000	0.01458	GAC	SAP130	-	NULL	ENSG00000136715		0.408	SAP130-001	KNOWN	basic|CCDS	protein_coding	SAP130	HGNC	protein_coding	OTTHUMT00000254436.3		0.00	41	0	G	NM_024545		128699655	-1			no_errors	ENST00000357702	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.104	T
SCAP	22937	genome.wustl.edu	37	3	47462600	47462600	+	Intron	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr3:47462600C>T	ENST00000265565.5	-	11	1658				SCAP_ENST00000545718.1_Intron|SCAP_ENST00000465628.1_5'UTR|SCAP_ENST00000441517.2_Intron	NM_012235.2	NP_036367.2	Q12770	SCAP_HUMAN	SREBF chaperone						aging (GO:0007568)|cholesterol metabolic process (GO:0008203)|negative regulation of cholesterol biosynthetic process (GO:0045541)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|regulation of fatty acid biosynthetic process (GO:0042304)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)|SREBP signaling pathway (GO:0032933)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|protein complex (GO:0043234)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	26				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		CGGACTGCAGCCACCTCATAA	0.607											OREG0015548	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Pancreas(149;978 1908 29304 37806 46700)												0																																										SO:0001627	intron_variant	0			BC020987	CCDS2755.2	3p21.31	2013-01-10			ENSG00000114650	ENSG00000114650		"""WD repeat domain containing"""	30634	protein-coding gene	gene with protein product	"""SREBP cleavage activating protein"""	601510				8898195, 8724849, 10570913	Standard	XM_005264967		Approved	KIAA0199	uc003crh.1	Q12770	OTTHUMG00000125539	ENST00000265565.5:c.1246-81G>A	3.37:g.47462600C>T		947	Q8N2E0|Q8WUA1	RNA	SNP	-	NULL	ENST00000265565.5	37	NULL	CCDS2755.2	3																																																																																			SCAP	-	-	ENSG00000114650		0.607	SCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAP	HGNC	protein_coding	OTTHUMT00000246872.2	-	0.00	20	0	C	NM_012235		47462600	-1	tier1	-	no_errors	ENST00000465628	ensembl	human	known	74_37	rna	16.22	31	6	SNP	0.000	T
SLC2A10	81031	genome.wustl.edu	37	20	45354253	45354253	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr20:45354253C>T	ENST00000359271.2	+	2	828	c.578C>T	c.(577-579)gCa>gTa	p.A193V		NM_030777.3	NP_110404.1	O95528	GTR10_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 10	193					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sugar:proton symporter activity (GO:0005351)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|liver(2)|lung(13)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	34		Myeloproliferative disorder(115;0.0122)				GATGAGACTGCAACACACAAG	0.632																																																	0													77.0	57.0	64.0					20																	45354253		2203	4300	6503	SO:0001583	missense	0			AL137188	CCDS13402.1	20q13.12	2013-05-22			ENSG00000197496	ENSG00000197496		"""Solute carriers"""	13444	protein-coding gene	gene with protein product		606145				11247674	Standard	NM_030777		Approved	GLUT10	uc002xsl.3	O95528	OTTHUMG00000032657	ENST00000359271.2:c.578C>T	20.37:g.45354253C>T	ENSP00000352216:p.Ala193Val		A8K4J6|Q3MIX5|Q9H4I6	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt	p.A193V	ENST00000359271.2	37	c.578	CCDS13402.1	20	.	.	.	.	.	.	.	.	.	.	C	4.484	0.089682	0.08632	.	.	ENSG00000197496	ENST00000359271	D	0.84070	-1.8	5.67	3.65	0.41850	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.744030	0.02391	N	0.079670	T	0.77011	0.4068	L	0.49513	1.565	0.09310	N	1	P	0.38677	0.642	B	0.34991	0.193	T	0.62895	-0.6757	10	0.15952	T	0.53	1.4557	5.3744	0.16156	0.229:0.5895:0.1036:0.0779	.	193	O95528	GTR10_HUMAN	V	193	ENSP00000352216:A193V	ENSP00000352216:A193V	A	+	2	0	SLC2A10	44787660	0.000000	0.05858	0.008000	0.14137	0.016000	0.09150	0.131000	0.15870	1.553000	0.49476	0.609000	0.83330	GCA	SLC2A10	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000197496		0.632	SLC2A10-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	SLC2A10	HGNC	protein_coding	OTTHUMT00000079578.2	-	0.00	36	0	C			45354253	+1	tier1	-	no_errors	ENST00000359271	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.010	T
SLC35A2	7355	genome.wustl.edu	37	X	48762485	48762485	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chrX:48762485C>T	ENST00000247138.5	-	4	704	c.701G>A	c.(700-702)cGc>cAc	p.R234H	SLC35A2_ENST00000452555.2_Missense_Mutation_p.R262H|SLC35A2_ENST00000413561.2_Missense_Mutation_p.R173H|SLC35A2_ENST00000445167.2_Intron|SLC35A2_ENST00000376521.1_Missense_Mutation_p.R234H|SLC35A2_ENST00000376515.3_Intron|SLC35A2_ENST00000376529.3_Intron	NM_005660.1	NP_005651.1	P78381	S35A2_HUMAN	solute carrier family 35 (UDP-galactose transporter), member A2	234					galactose metabolic process (GO:0006012)|transmembrane transport (GO:0055085)|UDP-galactose transport (GO:0015785)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	sugar:proton symporter activity (GO:0005351)|UDP-galactose transmembrane transporter activity (GO:0005459)			breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(2)	15						TTGCAGGTTGCGCAGCCACAC	0.637																																																	0													24.0	18.0	20.0					X																	48762485		2201	4293	6494	SO:0001583	missense	0			D88146	CCDS14311.1, CCDS35247.1, CCDS43937.1, CCDS65253.1, CCDS65254.1, CCDS75973.1, CCDS75974.1, CCDS75975.1	Xp11.23-p11.22	2013-05-22			ENSG00000102100	ENSG00000102100		"""Solute carriers"""	11022	protein-coding gene	gene with protein product		314375	"""solute carrier family 35 (UDP-galactose transporter), member 2"""	UGALT		8128316	Standard	NM_001042498		Approved	UGAT, UGT, UGT1, UGT2, UGTL	uc004dlo.1	P78381	OTTHUMG00000024129	ENST00000247138.5:c.701G>A	X.37:g.48762485C>T	ENSP00000247138:p.Arg234His		A8K2L9|A8K9V1|B4DE11|B4DPT2|E7EW45|Q8IV21|Q92553	Missense_Mutation	SNP	pfam_Nuc_sug_transpt,pfam_UAA,pfam_DMT,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	p.R262H	ENST00000247138.5	37	c.785	CCDS14311.1	X	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325184	0.81580	.	.	ENSG00000102100	ENST00000247138;ENST00000376521;ENST00000413561;ENST00000452555;ENST00000446885	T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52	5.86	4.99	0.66335	.	0.055859	0.64402	D	0.000003	T	0.79257	0.4415	H	0.96080	3.765	0.58432	D	0.999995	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.996;1.0;1.0;0.999;0.998	D	0.84228	0.0465	10	0.87932	D	0	-10.9149	10.3961	0.44201	0.0:0.9072:0.0:0.0928	.	173;262;247;234;234	B4DE11;E7EW45;B4DE15;P78381-2;P78381	.;.;.;.;S35A2_HUMAN	H	234;234;173;262;162	ENSP00000247138:R234H;ENSP00000365704:R234H;ENSP00000393233:R173H;ENSP00000416002:R262H;ENSP00000415518:R162H	ENSP00000247138:R234H	R	-	2	0	SLC35A2	48647429	0.939000	0.31865	1.000000	0.80357	0.982000	0.71751	4.217000	0.58547	2.447000	0.82792	0.600000	0.82982	CGC	SLC35A2	-	pfam_Nuc_sug_transpt,pfam_UAA,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	ENSG00000102100		0.637	SLC35A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC35A2	HGNC	protein_coding	OTTHUMT00000060790.1		0.00	53	0	C	NM_005660		48762485	-1			no_errors	ENST00000452555	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	T
SLC39A8	64116	genome.wustl.edu	37	4	103226180	103226180	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr4:103226180C>T	ENST00000394833.2	-	4	1117	c.641G>A	c.(640-642)aGa>aAa	p.R214K	SLC39A8_ENST00000510255.1_5'UTR|SLC39A8_ENST00000424970.2_Missense_Mutation_p.R214K|SLC39A8_ENST00000356736.4_Missense_Mutation_p.R214K	NM_001135148.1|NM_022154.5	NP_001128620.1|NP_071437.3	Q9C0K1	S39A8_HUMAN	solute carrier family 39 (zinc transporter), member 8	214					transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|organelle membrane (GO:0031090)|plasma membrane (GO:0005886)	metal ion transmembrane transporter activity (GO:0046873)			large_intestine(1)|lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Hepatocellular(203;0.217)		all cancers(1;9.78e-10)|OV - Ovarian serous cystadenocarcinoma(123;1.52e-09)|GBM - Glioblastoma multiforme(1;0.000142)		CTTTAGCATTCTTTCAAAAAA	0.333																																																	0													59.0	61.0	61.0					4																	103226180		2202	4300	6502	SO:0001583	missense	0				CCDS3656.1, CCDS47117.1	4q22-q24	2013-05-22			ENSG00000138821	ENSG00000138821		"""Solute carriers"""	20862	protein-coding gene	gene with protein product		608732	"""solute carrier family 39 (metal ion transporter), member 8"""			12504855, 12659941	Standard	NM_001135146		Approved	BIGM103	uc003hwc.2	Q9C0K1	OTTHUMG00000131120	ENST00000394833.2:c.641G>A	4.37:g.103226180C>T	ENSP00000378310:p.Arg214Lys		B4E2H3|Q96SM9|Q9BVC0|Q9NSA4	Missense_Mutation	SNP	pfam_ZIP	p.R214K	ENST00000394833.2	37	c.641	CCDS3656.1	4	.	.	.	.	.	.	.	.	.	.	C	10.56	1.384107	0.25031	.	.	ENSG00000138821	ENST00000424970;ENST00000356736;ENST00000394833	T;T;T	0.43688	0.94;0.94;0.94	5.26	5.26	0.73747	.	0.103796	0.64402	D	0.000007	T	0.25901	0.0631	N	0.05554	-0.025	0.46725	D	0.999179	B;B;B	0.27140	0.166;0.169;0.102	B;B;B	0.34180	0.097;0.177;0.105	T	0.08953	-1.0697	10	0.02654	T	1	-16.6538	17.8607	0.88780	0.0:1.0:0.0:0.0	.	214;214;147	B4E2H3;Q9C0K1;Q9C0K1-2	.;S39A8_HUMAN;.	K	214	ENSP00000394548:R214K;ENSP00000349174:R214K;ENSP00000378310:R214K	ENSP00000349174:R214K	R	-	2	0	SLC39A8	103445203	1.000000	0.71417	0.999000	0.59377	0.986000	0.74619	4.205000	0.58466	2.469000	0.83416	0.655000	0.94253	AGA	SLC39A8	-	pfam_ZIP	ENSG00000138821		0.333	SLC39A8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC39A8	HGNC	protein_coding	OTTHUMT00000253798.1	-	0.00	134	0	C	NM_022154		103226180	-1	tier1	-	no_errors	ENST00000356736	ensembl	human	known	74_37	missense	8.33	98	9	SNP	0.996	T
SLC7A14	57709	genome.wustl.edu	37	3	170198789	170198789	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr3:170198789G>A	ENST00000231706.5	-	7	1597	c.1282C>T	c.(1282-1284)Ctc>Ttc	p.L428F	CLDN11_ENST00000451576.1_Intron|CLDN11_ENST00000486975.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	428					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TATCGAAGGAGCAAGACACAG	0.517																																																	0													136.0	116.0	123.0					3																	170198789		2203	4300	6503	SO:0001583	missense	0			BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1282C>T	3.37:g.170198789G>A	ENSP00000231706:p.Leu428Phe		B3KV33|Q9HCF9	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom	p.L428F	ENST00000231706.5	37	c.1282	CCDS33892.1	3	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725554	0.68959	.	.	ENSG00000013293	ENST00000231706	D	0.89875	-2.58	5.03	5.03	0.67393	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.91267	0.7247	L	0.29908	0.895	0.80722	D	1	D	0.71674	0.998	D	0.72338	0.977	D	0.92717	0.6188	10	0.87932	D	0	.	18.3552	0.90355	0.0:0.0:1.0:0.0	.	428	Q8TBB6	S7A14_HUMAN	F	428	ENSP00000231706:L428F	ENSP00000231706:L428F	L	-	1	0	SLC7A14	171681483	1.000000	0.71417	1.000000	0.80357	0.642000	0.38348	7.393000	0.79851	2.337000	0.79520	0.655000	0.94253	CTC	SLC7A14	-	pfam_AA-permease/SLC12A_dom	ENSG00000013293		0.517	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A14	HGNC	protein_coding	OTTHUMT00000352598.2	-	0.00	34	0	G	NM_020949		170198789	-1	tier1	-	no_errors	ENST00000231706	ensembl	human	known	74_37	missense	12.24	43	6	SNP	1.000	A
SMPDL3B	27293	genome.wustl.edu	37	1	28271750	28271750	+	Silent	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:28271750C>T	ENST00000373894.3	+	2	260	c.69C>T	c.(67-69)ttC>ttT	p.F23F	SMPDL3B_ENST00000373888.4_Silent_p.F23F|RP11-460I13.2_ENST00000448015.1_RNA|SMPDL3B_ENST00000549094.1_Silent_p.F23F|SMPDL3B_ENST00000466793.1_3'UTR	NM_014474.2	NP_055289.2	Q92485	ASM3B_HUMAN	sphingomyelin phosphodiesterase, acid-like 3B	23					sphingomyelin catabolic process (GO:0006685)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	16		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000431)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0419)|OV - Ovarian serous cystadenocarcinoma(117;5.68e-24)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00303)|BRCA - Breast invasive adenocarcinoma(304;0.00587)|READ - Rectum adenocarcinoma(331;0.055)		CAGGGAAGTTCTGGCACATCG	0.602																																																	0													66.0	63.0	64.0					1																	28271750		2203	4300	6503	SO:0001819	synonymous_variant	0			Y08134	CCDS30655.1, CCDS30656.1	1p35.3	2008-02-05			ENSG00000130768	ENSG00000130768			21416	protein-coding gene	gene with protein product							Standard	NM_014474		Approved	ASML3B	uc001bpg.3	Q92485	OTTHUMG00000003910	ENST00000373894.3:c.69C>T	1.37:g.28271750C>T			B7ZB35|Q5T0Z0|Q96CB7	Silent	SNP	pfam_PEstase_dom,pirsf_ASM-like_Pdiesterase_prd	p.F23	ENST00000373894.3	37	c.69	CCDS30655.1	1																																																																																			SMPDL3B	-	pfam_PEstase_dom,pirsf_ASM-like_Pdiesterase_prd	ENSG00000130768		0.602	SMPDL3B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMPDL3B	HGNC	protein_coding	OTTHUMT00000011170.1	-	0.00	37	0	C	NM_014474		28271750	+1	tier1	-	no_errors	ENST00000373894	ensembl	human	known	74_37	silent	9.30	39	4	SNP	1.000	T
SRRT	51593	genome.wustl.edu	37	7	100484984	100484984	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr7:100484984G>T	ENST00000347433.4	+	16	2177	c.2019G>T	c.(2017-2019)ttG>ttT	p.L673F	SRRT_ENST00000457580.2_Missense_Mutation_p.L673F|SRRT_ENST00000388793.4_Missense_Mutation_p.L672F|SRRT_ENST00000432932.1_Missense_Mutation_p.L672F			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	673					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						TCACGCCGTTGCTGAGTGTGC	0.567																																																	0													95.0	99.0	97.0					7																	100484984		2203	4300	6503	SO:0001583	missense	0				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2019G>T	7.37:g.100484984G>T	ENSP00000314491:p.Leu673Phe		A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	pfam_Arsenite-R_2,pfam_DUF3546	p.L672F	ENST00000347433.4	37	c.2016	CCDS34709.1	7	.	.	.	.	.	.	.	.	.	.	G	11.13	1.547928	0.27652	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000342198;ENST00000432932;ENST00000347433;ENST00000448764	.	.	.	4.56	3.68	0.42216	Arsenite-resistance protein 2 (1);	0.000000	0.64402	D	0.000001	T	0.60663	0.2286	L	0.35414	1.06	0.58432	D	0.999993	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.87578	0.994;0.996;0.996;0.998	T	0.54309	-0.8313	9	0.15952	T	0.53	.	10.3343	0.43841	0.0976:0.0:0.9024:0.0	.	672;672;673;673	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	F	673;672;38;672;673;303	.	ENSP00000344670:L38F	L	+	3	2	SRRT	100322920	1.000000	0.71417	0.927000	0.36925	0.375000	0.29983	1.676000	0.37565	1.132000	0.42129	0.297000	0.19635	TTG	SRRT	-	pfam_Arsenite-R_2	ENSG00000087087		0.567	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	SRRT	HGNC	protein_coding	OTTHUMT00000347168.1	-	0.00	55	0	G	NM_015908		100484984	+1	tier1	-	no_errors	ENST00000388793	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	T
ST3GAL6	10402	genome.wustl.edu	37	3	98491723	98491723	+	Missense_Mutation	SNP	C	C	A	rs143638537		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr3:98491723C>A	ENST00000483910.1	+	4	523	c.234C>A	c.(232-234)agC>agA	p.S78R	ST3GAL6_ENST00000394162.1_Missense_Mutation_p.S78R|ST3GAL6_ENST00000462152.1_3'UTR|ST3GAL6_ENST00000468553.1_Missense_Mutation_p.S78R|ST3GAL6_ENST00000265261.6_5'UTR	NM_001271146.1	NP_001258075.1	Q9Y274	SIA10_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 6	78					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|cellular response to interleukin-6 (GO:0071354)|glycolipid metabolic process (GO:0006664)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,3-sialyltransferase activity (GO:0052798)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(1)	19						TGTATGGTAGCGATAAGTTTG	0.393																																																	0													219.0	199.0	206.0					3																	98491723		2203	4300	6503	SO:0001583	missense	0			AF119391	CCDS2933.1, CCDS59452.1, CCDS74968.1	3q12.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000064225	ENSG00000064225		"""Sialyltransferases"""	18080	protein-coding gene	gene with protein product		607156	"""sialyltransferase 10 (alpha-2,3-sialyltransferase VI)"""	SIAT10		10206952	Standard	NM_006100		Approved	ST3GALVI	uc010hpd.4	Q9Y274	OTTHUMG00000159047	ENST00000483910.1:c.234C>A	3.37:g.98491723C>A	ENSP00000417376:p.Ser78Arg		B2RCH2|B3KMI1|D3DN39|F8W6U0	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.S78R	ENST00000483910.1	37	c.234	CCDS2933.1	3	.	.	.	.	.	.	.	.	.	.	C	18.96	3.733239	0.69189	.	.	ENSG00000064225	ENST00000483910;ENST00000460774;ENST00000497008;ENST00000486334;ENST00000394162;ENST00000468553;ENST00000485391;ENST00000492254;ENST00000477574	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	5.85	0.434	0.16539	.	0.171233	0.52532	D	0.000070	T	0.38983	0.1061	L	0.49350	1.555	0.58432	D	0.999997	D;D	0.67145	0.996;0.959	D;P	0.66847	0.947;0.811	T	0.18745	-1.0327	10	0.16420	T	0.52	-18.1622	9.0512	0.36378	0.0:0.5835:0.0:0.4165	.	101;78	C9J480;Q9Y274	.;SIA10_HUMAN	R	78;78;78;78;78;78;78;101;43	ENSP00000417376:S78R;ENSP00000418896:S78R;ENSP00000377717:S78R;ENSP00000417201:S101R;ENSP00000419987:S43R	ENSP00000377717:S78R	S	+	3	2	ST3GAL6	99974413	0.934000	0.31675	0.969000	0.41365	0.993000	0.82548	-0.174000	0.09839	0.116000	0.18110	0.650000	0.86243	AGC	ST3GAL6	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000064225		0.393	ST3GAL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL6	HGNC	protein_coding	OTTHUMT00000353013.2	-	0.00	88	0	C	NM_006100		98491723	+1	tier1	-	no_errors	ENST00000394162	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.750	A
STAB2	55576	genome.wustl.edu	37	12	104102305	104102305	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr12:104102305T>G	ENST00000388887.2	+	39	4483	c.4279T>G	c.(4279-4281)Tgt>Ggt	p.C1427G		NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						AGGAGTGCATTGTGACAATGG	0.438																																																	0													206.0	187.0	193.0					12																	104102305		2203	4300	6503	SO:0001583	missense	0			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.4279T>G	12.37:g.104102305T>G	ENSP00000373539:p.Cys1427Gly			Missense_Mutation	SNP	pfam_FAS1_domain,pfam_Link,superfamily_C-type_lectin_fold,superfamily_FAS1_domain,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_EGF_laminin,smart_EGF-like_Ca-bd_dom,smart_FAS1_domain,smart_Link,pfscan_EG-like_dom,pfscan_FAS1_domain,pfscan_Link	p.C1427G	ENST00000388887.2	37	c.4279	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	T	21.0	4.088015	0.76642	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	D	0.87650	-2.28	5.4	5.4	0.78164	Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.105637	0.64402	D	0.000004	D	0.96106	0.8731	H	0.98089	4.145	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.97684	1.0174	10	0.72032	D	0.01	.	15.7275	0.77774	0.0:0.0:0.0:1.0	.	1427	Q8WWQ8	STAB2_HUMAN	G	1427;114	ENSP00000373539:C1427G	ENSP00000258495:C114G	C	+	1	0	STAB2	102626435	1.000000	0.71417	0.696000	0.30242	0.070000	0.16714	6.963000	0.76055	2.164000	0.68074	0.533000	0.62120	TGT	STAB2	-	smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000136011		0.438	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	HGNC	protein_coding	OTTHUMT00000407089.1	-	0.00	91	0	T			104102305	+1	tier1	-	no_errors	ENST00000388887	ensembl	human	known	74_37	missense	5.62	84	5	SNP	0.998	G
STRBP	55342	genome.wustl.edu	37	9	125898354	125898354	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr9:125898354G>A	ENST00000348403.5	-	16	2168	c.1739C>T	c.(1738-1740)gCg>gTg	p.A580V	STRBP_ENST00000447404.2_Missense_Mutation_p.A580V|STRBP_ENST00000360998.3_Missense_Mutation_p.A566V	NM_018387.4	NP_060857.2	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	580					cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)	p.A580V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						ATTATTTGCCGCATTGGGTCC	0.398																																																	1	Substitution - Missense(1)	endometrium(1)											121.0	118.0	119.0					9																	125898354		2203	4300	6503	SO:0001583	missense	0			AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000348403.5:c.1739C>T	9.37:g.125898354G>A	ENSP00000321347:p.Ala580Val		Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	Missense_Mutation	SNP	pfam_DZF,pfam_dsRNA-bd_dom,smart_DZF,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.A580V	ENST00000348403.5	37	c.1739	CCDS6851.1	9	.	.	.	.	.	.	.	.	.	.	G	29.5	5.010221	0.93346	.	.	ENSG00000165209	ENST00000447404;ENST00000348403;ENST00000360998	T;T;T	0.18960	2.44;2.44;2.18	5.63	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.21590	0.0520	L	0.32530	0.975	0.58432	D	0.999997	D;D	0.65815	0.991;0.995	B;P	0.46237	0.311;0.508	T	0.01341	-1.1380	10	0.49607	T	0.09	-13.414	14.512	0.67794	0.0698:0.0:0.9302:0.0	.	580;566	Q96SI9;Q96SI9-2	STRBP_HUMAN;.	V	580;580;566	ENSP00000415968:A580V;ENSP00000321347:A580V;ENSP00000354271:A566V	ENSP00000321347:A580V	A	-	2	0	STRBP	124938175	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	1.389000	0.46526	0.655000	0.94253	GCG	STRBP	-	NULL	ENSG00000165209		0.398	STRBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRBP	HGNC	protein_coding	OTTHUMT00000053982.1	-	0.00	59	0	G			125898354	-1	tier1	-	no_errors	ENST00000348403	ensembl	human	known	74_37	missense	7.55	49	4	SNP	1.000	A
TBC1D31	93594	genome.wustl.edu	37	8	124089435	124089435	+	Silent	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr8:124089435C>T	ENST00000287380.1	+	2	252	c.162C>T	c.(160-162)ggC>ggT	p.G54G	TBC1D31_ENST00000522420.1_5'UTR|TBC1D31_ENST00000521676.1_5'UTR|TBC1D31_ENST00000327098.5_Silent_p.G54G|TBC1D31_ENST00000309336.3_Silent_p.G54G|TBC1D31_ENST00000378080.2_5'UTR	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	54						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										ATGGCACAGGCGACTGCTTAA	0.358																																																	0													137.0	131.0	133.0					8																	124089435		2203	4300	6503	SO:0001819	synonymous_variant	0			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.162C>T	8.37:g.124089435C>T			B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.G54	ENST00000287380.1	37	c.162	CCDS6338.1	8																																																																																			TBC1D31	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000156787		0.358	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D31	HGNC	protein_coding	OTTHUMT00000381721.1	-	0.00	69	0	C	NM_145647		124089435	+1	tier1	-	no_errors	ENST00000287380	ensembl	human	known	74_37	silent	9.84	55	6	SNP	0.690	T
TDRD5	163589	genome.wustl.edu	37	1	179631288	179631288	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:179631288A>C	ENST00000367614.1	+	14	2569	c.2210A>C	c.(2209-2211)gAt>gCt	p.D737A	TDRD5_ENST00000444136.1_Missense_Mutation_p.D791A|TDRD5_ENST00000294848.8_Missense_Mutation_p.D737A	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	737					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						ACCATAGGTGATGATATTTGG	0.423																																																	0													168.0	143.0	152.0					1																	179631288		2203	4300	6503	SO:0001583	missense	0			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2210A>C	1.37:g.179631288A>C	ENSP00000356586:p.Asp737Ala		A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.D791A	ENST00000367614.1	37	c.2372	CCDS1332.1	1	.	.	.	.	.	.	.	.	.	.	A	14.49	2.550520	0.45383	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136;ENST00000417329	T;T;T;T	0.38077	2.11;2.11;2.42;1.16	5.41	3.11	0.35812	.	0.218599	0.36409	N	0.002608	T	0.32912	0.0845	M	0.64997	1.995	0.28936	N	0.89126	P;B	0.43662	0.814;0.209	B;B	0.40864	0.342;0.053	T	0.22730	-1.0208	10	0.44086	T	0.13	-24.2926	6.9004	0.24279	0.8162:0.0:0.1838:0.0	.	791;737	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	A	737;737;791;247	ENSP00000356586:D737A;ENSP00000294848:D737A;ENSP00000406052:D791A;ENSP00000410744:D247A	ENSP00000294848:D737A	D	+	2	0	TDRD5	177897911	1.000000	0.71417	0.995000	0.50966	0.999000	0.98932	1.290000	0.33319	0.458000	0.26988	0.528000	0.53228	GAT	TDRD5	-	NULL	ENSG00000162782		0.423	TDRD5-002	KNOWN	basic|CCDS	protein_coding	TDRD5	HGNC	protein_coding	OTTHUMT00000085295.1	-	0.00	125	0	A	NM_173533		179631288	+1	tier1	-	no_errors	ENST00000444136	ensembl	human	known	74_37	missense	14.41	95	16	SNP	0.998	C
THSD1	55901	genome.wustl.edu	37	13	52960252	52960252	+	Missense_Mutation	SNP	C	C	T	rs142793367	byFrequency	TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr13:52960252C>T	ENST00000258613.4	-	4	1269	c.1091G>A	c.(1090-1092)cGc>cAc	p.R364H	THSD1_ENST00000349258.4_Intron|THSD1_ENST00000544466.1_5'UTR	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	364	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		ACACACTCGGCGACGCTCTCT	0.542																																																	0								C	HIS/ARG,	1,4405	2.1+/-5.4	0,1,2202	190.0	177.0	181.0		1091,	2.8	1.0	13	dbSNP_134	181	1,8599	1.2+/-3.3	0,1,4299	no	missense,intron	THSD1	NM_018676.3,NM_199263.2	29,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	benign,	364/853,	52960252	2,13004	2203	4300	6503	SO:0001583	missense	0			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.1091G>A	13.37:g.52960252C>T	ENSP00000258613:p.Arg364His		A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.R364H	ENST00000258613.4	37	c.1091	CCDS9432.1	13	.	.	.	.	.	.	.	.	.	.	C	10.30	1.311991	0.23821	2.27E-4	1.16E-4	ENSG00000136114	ENST00000258613;ENST00000378095	T	0.53423	0.62	4.91	2.79	0.32731	.	0.335919	0.28606	N	0.014745	T	0.19886	0.0478	N	0.04880	-0.145	0.80722	D	1	B	0.14012	0.009	B	0.12156	0.007	T	0.04229	-1.0967	10	0.15952	T	0.53	-14.9007	3.8561	0.08976	0.3199:0.4678:0.0:0.2123	.	364	Q9NS62	THSD1_HUMAN	H	364	ENSP00000258613:R364H	ENSP00000258613:R364H	R	-	2	0	THSD1	51858253	0.782000	0.28689	0.997000	0.53966	0.995000	0.86356	0.026000	0.13599	0.920000	0.36970	0.563000	0.77884	CGC	THSD1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000136114		0.542	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD1	HGNC	protein_coding	OTTHUMT00000045058.3	-	0.00	41	0	C			52960252	-1	tier1	rs142793367	no_errors	ENST00000258613	ensembl	human	known	74_37	missense	15.09	45	8	SNP	0.984	T
TIA1	7072	genome.wustl.edu	37	2	70443921	70443921	+	Intron	SNP	T	T	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:70443921T>C	ENST00000433529.2	-	8	794				TIA1_ENST00000415783.2_Intron|TIA1_ENST00000482876.1_Intron|C2orf42_ENST00000470096.1_Intron|TIA1_ENST00000416149.2_3'UTR|TIA1_ENST00000445587.1_Intron|TIA1_ENST00000282574.4_Intron	NM_022173.2	NP_071505.2	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein						apoptotic process (GO:0006915)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of translation (GO:0017148)|regulation of mRNA splicing, via spliceosome (GO:0048024)	cytoplasmic stress granule (GO:0010494)|nuclear stress granule (GO:0097165)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	17						TTCTCATCTATTTCTGCAATA	0.294																																																	0																																										SO:0001627	intron_variant	0				CCDS1900.1, CCDS1901.1	2p13	2013-02-12	2001-11-28		ENSG00000116001	ENSG00000116001		"""RNA binding motif (RRM) containing"""	11802	protein-coding gene	gene with protein product	"""T-cell-restricted intracellular antigen-1"", ""nucleolysin TIA-1 isoform p40"""	603518	"""TIA1 cytotoxic granule-associated RNA-binding protein"""			8176212, 12486009	Standard	NM_022173		Approved		uc002sgj.4	P31483	OTTHUMG00000129644	ENST00000433529.2:c.583+96A>G	2.37:g.70443921T>C			Q53SS9	RNA	SNP	-	NULL	ENST00000433529.2	37	NULL	CCDS1901.1	2	.	.	.	.	.	.	.	.	.	.	T	16.88	3.243878	0.58995	.	.	ENSG00000116001	ENST00000477807	.	.	.	5.34	4.13	0.48395	.	.	.	.	.	T	0.56292	0.1975	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51204	-0.8735	5	0.28530	T	0.3	.	9.3901	0.38367	0.0:0.0:0.1785:0.8215	.	.	.	.	V	261	.	ENSP00000445092:I261V	I	-	1	0	TIA1	70297425	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.372000	0.34261	2.245000	0.73994	0.533000	0.62120	ATA	TIA1	-	-	ENSG00000116001		0.294	TIA1-001	KNOWN	basic|CCDS	protein_coding	TIA1	HGNC	protein_coding	OTTHUMT00000251842.2	-	0.00	40	0	T	NM_022037		70443921	-1	tier1	-	no_errors	ENST00000468787	ensembl	human	known	74_37	rna	13.79	25	4	SNP	1.000	C
TIAM2	26230	genome.wustl.edu	37	6	155465783	155465783	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr6:155465783G>T	ENST00000461783.3	+	8	2947	c.1674G>T	c.(1672-1674)atG>atT	p.M558I	TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000529824.2_Missense_Mutation_p.M558I|TIAM2_ENST00000456144.1_Missense_Mutation_p.M558I|TIAM2_ENST00000318981.5_Missense_Mutation_p.M558I|TIAM2_ENST00000360366.4_Missense_Mutation_p.M558I			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	558	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		AGAATTCCATGGATCAGAGCA	0.488																																																	0													115.0	111.0	113.0					6																	155465783		2203	4300	6503	SO:0001583	missense	0				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1674G>T	6.37:g.155465783G>T	ENSP00000437188:p.Met558Ile		B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,superfamily_HR1_rho-bd,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.M558I	ENST00000461783.3	37	c.1674	CCDS34558.1	6	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.088832	0.00367	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18;-1.18	5.81	0.736	0.18307	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.836473	0.11403	N	0.567604	T	0.25344	0.0616	N	0.03608	-0.345	0.80722	D	1	B;B	0.22003	0.063;0.032	B;B	0.24974	0.034;0.057	T	0.21280	-1.0250	10	0.09084	T	0.74	.	2.4207	0.04447	0.1317:0.2347:0.3919:0.2418	.	558;558	Q8IVF5-2;Q8IVF5	.;TIAM2_HUMAN	I	558;804;558;558;558;558;558	ENSP00000437188:M558I;ENSP00000434901:M558I;ENSP00000407746:M558I;ENSP00000327315:M558I;ENSP00000353528:M558I;ENSP00000433348:M558I	ENSP00000327315:M558I	M	+	3	0	TIAM2	155507475	0.673000	0.27539	0.004000	0.12327	0.066000	0.16364	0.963000	0.29293	-0.153000	0.11137	-0.175000	0.13238	ATG	TIAM2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000146426		0.488	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	TIAM2	HGNC	protein_coding	OTTHUMT00000387980.2		0.00	36	0	G	NM_012454		155465783	+1			no_errors	ENST00000456144	ensembl	human	known	74_37	missense	7.89	35	3	SNP	0.018	T
TMEM184A	202915	genome.wustl.edu	37	7	1588289	1588292	+	Frame_Shift_Del	DEL	TAGA	TAGA	-			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	TAGA	TAGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr7:1588289_1588292delTAGA	ENST00000297477.5	-	7	993_996	c.677_680delTCTA	c.(676-681)atctacfs	p.IY226fs	TMEM184A_ENST00000449955.1_5'Flank	NM_001097620.1	NP_001091089.1	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	226					germ-line sex determination (GO:0018992)|regulation of protein localization (GO:0032880)|regulation of secretion (GO:0051046)	early endosome membrane (GO:0031901)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		GGAGGCGTTGTAGATGAGGGTCAC	0.642																																																	0																																										SO:0001589	frameshift_variant	0				CCDS43537.1	7p22.3	2008-05-02			ENSG00000164855	ENSG00000164855			28797	protein-coding gene	gene with protein product						12477932	Standard	NM_001097620		Approved	MGC9712	uc003skv.4	Q6ZMB5	OTTHUMG00000119025	ENST00000297477.5:c.677_680delTCTA	7.37:g.1588289_1588292delTAGA	ENSP00000297477:p.Ile226fs		Q8TBQ6	Frame_Shift_Del	DEL	pfam_Ost-alpha	p.I226fs	ENST00000297477.5	37	c.680_677	CCDS43537.1	7																																																																																			TMEM184A	-	pfam_Ost-alpha	ENSG00000164855		0.642	TMEM184A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM184A	HGNC	protein_coding	OTTHUMT00000239229.4		0.00	130	0	TAGA	NM_152689		1588292	-1			no_errors	ENST00000297477	ensembl	human	known	74_37	frame_shift_del	6.67	112	8	DEL	1.000:1.000:1.000:1.000	0
TNKS2	80351	genome.wustl.edu	37	10	93621795	93621795	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr10:93621795C>A	ENST00000371627.4	+	26	3700	c.3321C>A	c.(3319-3321)ttC>ttA	p.F1107L		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	1107	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				GAAAGTCTTTCCTGCAGTTCA	0.423																																																	0													168.0	158.0	162.0					10																	93621795		2203	4300	6503	SO:0001583	missense	0			AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.3321C>A	10.37:g.93621795C>A	ENSP00000360689:p.Phe1107Leu		B2RBD3|Q9H8F2|Q9HAS4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_Poly(ADP-ribose)pol_cat_dom,prints_Ankyrin_rpt	p.F1107L	ENST00000371627.4	37	c.3321	CCDS7417.1	10	.	.	.	.	.	.	.	.	.	.	C	26.2	4.716034	0.89205	.	.	ENSG00000107854	ENST00000371627	T	0.13196	2.61	5.59	4.69	0.59074	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.64402	D	0.000008	T	0.31765	0.0807	L	0.60067	1.865	0.58432	D	0.999993	D	0.76494	0.999	D	0.75484	0.986	T	0.02909	-1.1095	10	0.87932	D	0	.	11.5085	0.50481	0.0:0.856:0.0:0.144	.	1107	Q9H2K2	TNKS2_HUMAN	L	1107	ENSP00000360689:F1107L	ENSP00000360689:F1107L	F	+	3	2	TNKS2	93611775	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.791000	0.38744	1.380000	0.46344	0.585000	0.79938	TTC	TNKS2	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000107854		0.423	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS2	HGNC	protein_coding	OTTHUMT00000049374.1	-	0.00	99	0	C	NM_025235		93621795	+1	tier1	-	no_errors	ENST00000371627	ensembl	human	known	74_37	missense	8.79	83	8	SNP	1.000	A
TTC24	164118	genome.wustl.edu	37	1	156551658	156551658	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr1:156551658G>T	ENST00000368237.3	+	1	502	c.502G>T	c.(502-504)Gga>Tga	p.G168*	TTC24_ENST00000368236.3_Nonsense_Mutation_p.G168*			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	168										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCAGGCTCTGGGACAGCCTGA	0.652																																																	0													8.0	10.0	9.0					1																	156551658		686	1587	2273	SO:0001587	stop_gained	0				CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.502G>T	1.37:g.156551658G>T	ENSP00000357220:p.Gly168*		Q5T3H7	Nonsense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G168*	ENST00000368237.3	37	c.502	CCDS53379.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.522585	0.96431	.	.	ENSG00000187862	ENST00000368236;ENST00000368237	.	.	.	4.58	4.58	0.56647	.	0.000000	0.40222	N	0.001145	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	6.4368	0.21827	0.097:0.1862:0.7168:0.0	.	.	.	.	X	168	.	ENSP00000357219:G168X	G	+	1	0	TTC24	154818282	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.586000	0.53950	2.392000	0.81423	0.462000	0.41574	GGA	TTC24	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000187862		0.652	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	TTC24	HGNC	protein_coding	OTTHUMT00000158547.1		0.00	64	0	G	XM_089384		156551658	+1			no_errors	ENST00000368236	ensembl	human	known	74_37	nonsense	5.88	64	4	SNP	0.997	T
TTN	7273	genome.wustl.edu	37	2	179428548	179428548	+	Silent	SNP	A	A	G			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:179428548A>G	ENST00000591111.1	-	276	77612	c.77388T>C	c.(77386-77388)ggT>ggC	p.G25796G	TTN_ENST00000342992.6_Silent_p.G24869G|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Silent_p.G27437G|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Silent_p.G18372G|TTN_ENST00000342175.6_Silent_p.G18564G|TTN_ENST00000359218.5_Silent_p.G18497G|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25796	Fibronectin type-III 87. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTACTCATTACCAGGAAGAA	0.443																																																	0													101.0	94.0	96.0					2																	179428548		1875	4120	5995	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.77388T>C	2.37:g.179428548A>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.G24869	ENST00000591111.1	37	c.74607		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.443	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	77	0	A	NM_133378		179428548	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	5.88	64	4	SNP	0.954	G
TTN	7273	genome.wustl.edu	37	2	179644145	179644145	+	Silent	SNP	A	A	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:179644145A>T	ENST00000591111.1	-	23	3998	c.3774T>A	c.(3772-3774)atT>atA	p.I1258I	RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000342992.6_Silent_p.I1258I|TTN_ENST00000589042.1_Silent_p.I1258I|TTN_ENST00000460472.2_Silent_p.I1212I|TTN_ENST00000342175.6_Silent_p.I1212I|TTN_ENST00000360870.5_Silent_p.I1258I|TTN_ENST00000359218.5_Silent_p.I1212I			Q8WZ42	TITIN_HUMAN	titin	33463					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCTATATTCAATTTCTTTAA	0.289																																																	0													21.0	22.0	22.0					2																	179644145		2183	4261	6444	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.3774T>A	2.37:g.179644145A>T			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.I1258	ENST00000591111.1	37	c.3774		2																																																																																			TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.289	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	58	0	A	NM_133378		179644145	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	12.77	41	6	SNP	1.000	T
UBR1	197131	genome.wustl.edu	37	15	43244495	43244495	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr15:43244495C>T	ENST00000290650.4	-	45	5065	c.4987G>A	c.(4987-4989)Gga>Aga	p.G1663R	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1663					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		ATGCAGACTCCGGCTCCACAG	0.473																																																	0													115.0	121.0	119.0					15																	43244495		2203	4299	6502	SO:0001583	missense	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.4987G>A	15.37:g.43244495C>T	ENSP00000290650:p.Gly1663Arg		O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.G1663R	ENST00000290650.4	37	c.4987	CCDS10091.1	15	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701465	0.88924	.	.	ENSG00000159459	ENST00000290650	T	0.56941	0.43	4.72	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.78181	0.4243	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83357	0.0000	10	0.66056	D	0.02	-13.9513	17.8752	0.88823	0.0:1.0:0.0:0.0	.	1663	Q8IWV7	UBR1_HUMAN	R	1663	ENSP00000290650:G1663R	ENSP00000290650:G1663R	G	-	1	0	UBR1	41031787	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.647000	0.83462	2.432000	0.82394	0.467000	0.42956	GGA	UBR1	-	NULL	ENSG00000159459		0.473	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1		0.00	34	0	C	NM_174916		43244495	-1			no_errors	ENST00000290650	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
UGT2B15	7366	genome.wustl.edu	37	4	69513073	69513073	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr4:69513073T>C	ENST00000338206.5	-	6	1351	c.1342A>G	c.(1342-1344)Aga>Gga	p.R448G		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	448					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	TGATGAATTCTTGATAATTTC	0.388																																																	0													105.0	112.0	110.0					4																	69513073		2203	4296	6499	SO:0001583	missense	0			AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.1342A>G	4.37:g.69513073T>C	ENSP00000341045:p.Arg448Gly		A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.R448G	ENST00000338206.5	37	c.1342	CCDS3524.1	4	.	.	.	.	.	.	.	.	.	.	t	9.760	1.169828	0.21621	.	.	ENSG00000196620	ENST00000338206	T	0.62232	0.04	2.96	1.77	0.24775	.	0.300125	0.25241	U	0.032099	T	0.64983	0.2648	M	0.93241	3.395	0.22961	N	0.9985	B	0.12013	0.005	B	0.17433	0.018	T	0.63287	-0.6671	10	0.62326	D	0.03	.	3.1666	0.06538	0.0:0.1402:0.2477:0.6121	.	448	P54855	UDB15_HUMAN	G	448	ENSP00000341045:R448G	ENSP00000341045:R448G	R	-	1	2	UGT2B15	69195668	0.000000	0.05858	0.833000	0.33012	0.827000	0.46813	-0.262000	0.08682	0.261000	0.21753	0.451000	0.29950	AGA	UGT2B15	-	pfam_UDP_glucos_trans	ENSG00000196620		0.388	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B15	HGNC	protein_coding	OTTHUMT00000365172.1	-	0.00	162	0	T	NM_001076		69513073	-1	tier1	-	no_errors	ENST00000338206	ensembl	human	known	74_37	missense	5.78	162	10	SNP	0.994	C
CCDC144A	9720	genome.wustl.edu	37	17	16691337	16691337	+	3'UTR	DEL	G	G	-	rs377009881|rs11355675|rs145545906	byFrequency	TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr17:16691337delG	ENST00000443444.2	+	0	5610				USP32P1_ENST00000393005.2_RNA|RP11-219A15.4_ENST00000602730.1_RNA|RP11-92B11.3_ENST00000578710.1_RNA|RP11-219A15.1_ENST00000448331.3_3'UTR			A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A																		TCCTGGGGCCGGGGGGAAGCA	0.557													GGGGG|GGGGGG|GGGGG|insertion	918	0.183307	0.326	0.0922	5008	,	,		21840	0.1855		0.0288	False		,,,				2504	0.2117																0																																										SO:0001624	3_prime_UTR_variant	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000443444.2:c.*1186G>-	17.37:g.16691337delG			O60311|Q6ZU57	RNA	DEL	-	NULL	ENST00000443444.2	37	NULL	CCDS45621.1	17																																																																																			USP32P1	-	-	ENSG00000188933		0.557	CCDC144A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP32P1	HGNC	protein_coding			0.00	25	0	G			16691337	+1	tier1		no_errors	ENST00000393005	ensembl	human	known	74_37	rna	15.00	17	3	DEL	0.998	-
USP6	9098	genome.wustl.edu	37	17	5066217	5066217	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr17:5066217G>A	ENST00000574788.1	+	33	5184	c.2954G>A	c.(2953-2955)aGa>aAa	p.R985K	USP6_ENST00000304328.5_Missense_Mutation_p.R668K|USP6_ENST00000332776.4_3'UTR|USP6_ENST00000250066.6_Missense_Mutation_p.R985K			P35125	UBP6_HUMAN	ubiquitin specific peptidase 6	985	USP.				cellular protein modification process (GO:0006464)|protein deubiquitination (GO:0016579)|regulation of vesicle-mediated transport (GO:0060627)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	calmodulin binding (GO:0005516)|cysteine-type endopeptidase activity (GO:0004197)|nucleic acid binding (GO:0003676)|Rab GTPase activator activity (GO:0005097)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	34						GGGGAAGACAGAGCTTTCATT	0.413			T	"""COL1A1, CDH11, ZNF9, OMD"""	aneurysmal bone cysts																																			Dom	yes		17	17p13	9098	ubiquitin specific peptidase 6 (Tre-2 oncogene)		M	0													148.0	153.0	151.0					17																	5066217		2203	4300	6503	SO:0001583	missense	0			X63547	CCDS11069.2	17p13	2014-06-12	2014-06-12		ENSG00000129204	ENSG00000129204	3.4.19.12	"""Ubiquitin-specific peptidases"""	12629	protein-coding gene	gene with protein product	"""ubiquitin carboxyl-terminal hydrolase 6"", ""TBC1D3 and USP32 fusion"", ""Tre-2 oncogene"""	604334	"""ubiquitin specific protease 6 (Tre-2 oncogene)"", ""TRE oncogene, Smith Magenis syndrome chromosome region"", ""ubiquitin specific peptidase 6 (Tre-2 oncogene)"""	HRP1, TRESMCR		12838346, 1349106	Standard	NM_004505		Approved	Tre-2, TRE17, Tre2	uc002gav.1	P35125	OTTHUMG00000099449	ENST00000574788.1:c.2954G>A	17.37:g.5066217G>A	ENSP00000460380:p.Arg985Lys		Q15634|Q86WP6|Q8IWT4	Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Peptidase_C19/C67	p.R985K	ENST00000574788.1	37	c.2954	CCDS11069.2	17	.	.	.	.	.	.	.	.	.	.	G	2.070	-0.413174	0.04799	.	.	ENSG00000129204	ENST00000250066;ENST00000304328	T;T	0.12879	3.03;2.64	3.0	2.02	0.26589	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.176737	0.64402	N	0.000011	T	0.08268	0.0206	L	0.37750	1.13	0.38926	D	0.95783	B;B	0.15930	0.004;0.015	B;B	0.12837	0.004;0.008	T	0.23226	-1.0194	10	0.06494	T	0.89	.	7.5534	0.27810	0.136:0.0:0.864:0.0	.	668;985	P35125-2;P35125	.;UBP6_HUMAN	K	985;668	ENSP00000250066:R985K;ENSP00000305473:R668K	ENSP00000250066:R985K	R	+	2	0	USP6	5006941	0.999000	0.42202	1.000000	0.80357	0.437000	0.31866	3.086000	0.50159	0.454000	0.26884	0.194000	0.17425	AGA	USP6	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000129204		0.413	USP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP6	HGNC	protein_coding	OTTHUMT00000438990.1	-	0.00	181	0	G	NM_004505		5066217	+1	tier1	-	no_errors	ENST00000250066	ensembl	human	known	74_37	missense	7.73	167	14	SNP	1.000	A
VIPR1	7433	genome.wustl.edu	37	3	42569359	42569359	+	Intron	SNP	C	C	T	rs574157610		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr3:42569359C>T	ENST00000325123.4	+	6	616				VIPR1_ENST00000543411.1_Intron|VIPR1-AS1_ENST00000593611.1_RNA|VIPR1-AS1_ENST00000602176.1_RNA|VIPR1_ENST00000438259.2_Intron|VIPR1_ENST00000473575.1_3'UTR|VIPR1-AS1_ENST00000452639.3_RNA|VIPR1-AS1_ENST00000596630.1_RNA|VIPR1-AS1_ENST00000600342.1_RNA|VIPR1-AS1_ENST00000601312.1_RNA|VIPR1-AS1_ENST00000593621.1_RNA|VIPR1_ENST00000433647.1_Intron|VIPR1-AS1_ENST00000598837.1_RNA	NM_001251885.1|NM_004624.3	NP_001238814.1|NP_004615.2	P32241	VIPR1_HUMAN	vasoactive intestinal peptide receptor 1						digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|muscle contraction (GO:0006936)|positive regulation of cell proliferation (GO:0008284)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	vasoactive intestinal polypeptide receptor activity (GO:0004999)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|ovary(2)|skin(1)|urinary_tract(3)	18				KIRC - Kidney renal clear cell carcinoma(284;0.241)		CCCTTTGAGGCGGGGCCTGCC	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		15871	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001627	intron_variant	0			AH005329	CCDS2698.1, CCDS58827.1, CCDS58828.1, CCDS58829.1	3p22	2012-08-10			ENSG00000114812	ENSG00000114812		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12694	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 1"""	192321				7708752	Standard	NM_004624		Approved	VPAC1, RDC1, HVR1, VPAC1R	uc003clf.2	P32241	OTTHUMG00000131792	ENST00000325123.4:c.504-124C>T	3.37:g.42569359C>T			A5JUT9|B3KPV1|B4DEB5|B4DGI4|F5H1F5|G3V0I1|Q15871|Q6P2M6	RNA	SNP	-	NULL	ENST00000325123.4	37	NULL	CCDS2698.1	3																																																																																			VIPR1	-	-	ENSG00000114812		0.647	VIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPR1	HGNC	protein_coding	OTTHUMT00000254728.4	-	0.00	30	0	C	NM_004624		42569359	+1	tier1	-	no_errors	ENST00000473575	ensembl	human	known	74_37	rna	11.76	30	4	SNP	0.000	T
VNN1	8876	genome.wustl.edu	37	6	133032958	133032958	+	Silent	SNP	A	A	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr6:133032958A>C	ENST00000367928.4	-	2	244	c.231T>G	c.(229-231)acT>acG	p.T77T		NM_004666.2	NP_004657.2	O95497	VNN1_HUMAN	vanin 1	77	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				acute inflammatory response (GO:0002526)|cellular component movement (GO:0006928)|chronic inflammatory response (GO:0002544)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|pantothenate metabolic process (GO:0015939)|positive regulation of T cell differentiation in thymus (GO:0033089)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	GPI anchor binding (GO:0034235)|pantetheine hydrolase activity (GO:0017159)			NS(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)	31	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		CATCTTCTGGAGTCACAATAA	0.463																																																	0													111.0	112.0	111.0					6																	133032958		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ132099	CCDS5159.1	6q23-q24	2013-02-13			ENSG00000112299	ENSG00000112299	3.5.1.92	"""Vanins"""	12705	protein-coding gene	gene with protein product		603570				9790769	Standard	NM_004666		Approved	Tiff66	uc003qdo.3	O95497	OTTHUMG00000015587	ENST00000367928.4:c.231T>G	6.37:g.133032958A>C			A8K310|Q4JFW6|Q4VAS7|Q4VAS8|Q4VAS9|Q9UF16|Q9UJF4	Silent	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	p.T77	ENST00000367928.4	37	c.231	CCDS5159.1	6																																																																																			VNN1	-	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	ENSG00000112299		0.463	VNN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VNN1	HGNC	protein_coding	OTTHUMT00000042263.1	-	0.00	109	0	A			133032958	-1	tier1	-	no_errors	ENST00000367928	ensembl	human	known	74_37	silent	5.88	96	6	SNP	1.000	C
XDH	7498	genome.wustl.edu	37	2	31605937	31605937	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr2:31605937T>C	ENST00000379416.3	-	11	1016	c.968A>G	c.(967-969)aAg>aGg	p.K323R	XDH_ENST00000491727.1_5'UTR	NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	323	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	CACCTCTGTCTTTTGGGCAGG	0.572																																					Colon(66;682 1445 30109 40147)												0													87.0	79.0	82.0					2																	31605937		2203	4300	6503	SO:0001583	missense	0			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.968A>G	2.37:g.31605937T>C	ENSP00000368727:p.Lys323Arg		Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Xanthine_DH_ssu	p.K323R	ENST00000379416.3	37	c.968	CCDS1775.1	2	.	.	.	.	.	.	.	.	.	.	T	21.8	4.206380	0.79127	.	.	ENSG00000158125	ENST00000379416	T	0.23147	1.92	5.65	4.45	0.53987	FAD-binding, type 2 (2);CO dehydrogenase flavoprotein-like, FAD-binding, subdomain 2 (1);Xanthine dehydrogenase, small subunit (1);Molybdopterin dehydrogenase, FAD-binding (1);	0.193799	0.56097	N	0.000034	T	0.19446	0.0467	N	0.25245	0.725	0.28749	N	0.901546	B	0.14805	0.011	B	0.25291	0.059	T	0.13388	-1.0511	10	0.54805	T	0.06	.	11.604	0.51020	0.0:0.0716:0.0:0.9284	.	323	P47989	XDH_HUMAN	R	323	ENSP00000368727:K323R	ENSP00000368727:K323R	K	-	2	0	XDH	31459441	0.971000	0.33674	0.054000	0.19295	0.656000	0.38851	2.779000	0.47734	0.928000	0.37168	0.368000	0.22195	AAG	XDH	-	pfam_Mopterin_DH_FAD-bd,superfamily_FAD-bd_2,pirsf_Ald_Oxase/xanthine_DH,tigrfam_Xanthine_DH_ssu	ENSG00000158125		0.572	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XDH	HGNC	protein_coding	OTTHUMT00000216840.1	-	0.00	85	0	T	NM_000379		31605937	-1	tier1	-	no_errors	ENST00000379416	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.696	C
ZBTB38	253461	genome.wustl.edu	37	3	141163939	141163939	+	Silent	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr3:141163939C>T	ENST00000514251.1	+	4	2988	c.2709C>T	c.(2707-2709)ttC>ttT	p.F903F	ZBTB38_ENST00000441582.2_Silent_p.F903F|ZBTB38_ENST00000321464.5_Silent_p.F904F					zinc finger and BTB domain containing 38									p.F903F(1)		breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						GTGAAGTGTTCGATGACGCAA	0.507																																																	1	Substitution - coding silent(1)	lung(1)											57.0	59.0	58.0					3																	141163939		1994	4167	6161	SO:0001819	synonymous_variant	0			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.2709C>T	3.37:g.141163939C>T				Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.F904	ENST00000514251.1	37	c.2712	CCDS43157.1	3																																																																																			ZBTB38	-	NULL	ENSG00000177311		0.507	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB38	HGNC	protein_coding	OTTHUMT00000359329.2		0.00	41	0	C			141163939	+1			no_errors	ENST00000321464	ensembl	human	known	74_37	silent	5.00	38	2	SNP	0.391	T
ZNF284	342909	genome.wustl.edu	37	19	44590074	44590074	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr19:44590074A>G	ENST00000421176.3	+	5	659	c.443A>G	c.(442-444)gAg>gGg	p.E148G	ZNF223_ENST00000591793.1_3'UTR|RNU6-902P_ENST00000517212.1_RNA	NM_001037813.2	NP_001032902.1	Q2VY69	ZN284_HUMAN	zinc finger protein 284	148					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0435)				ACACCTTCTGAGCATGGGAAG	0.428																																																	0													66.0	64.0	64.0					19																	44590074		2154	4282	6436	SO:0001583	missense	0			AY166789	CCDS46099.1	19q13.32	2013-01-08				ENSG00000186026		"""Zinc fingers, C2H2-type"", ""-"""	13078	protein-coding gene	gene with protein product						12743021	Standard	NM_001037813		Approved	DKFZp781F1775	uc002oyg.1	Q2VY69		ENST00000421176.3:c.443A>G	19.37:g.44590074A>G	ENSP00000411032:p.Glu148Gly		Q86WM1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E148G	ENST00000421176.3	37	c.443	CCDS46099.1	19	.	.	.	.	.	.	.	.	.	.	A	9.419	1.082420	0.20309	.	.	ENSG00000186026	ENST00000421176	T	0.29917	1.55	2.15	1.02	0.19986	.	.	.	.	.	T	0.19248	0.0462	L	0.35487	1.065	0.09310	N	1	P	0.37864	0.61	B	0.32583	0.148	T	0.10314	-1.0635	9	0.51188	T	0.08	.	6.5466	0.22410	0.7855:0.0:0.0:0.2145	.	148	Q2VY69	ZN284_HUMAN	G	148	ENSP00000411032:E148G	ENSP00000411032:E148G	E	+	2	0	ZNF284	49281914	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	0.508000	0.22692	0.045000	0.15804	0.379000	0.24179	GAG	ZNF284	-	NULL	ENSG00000186026		0.428	ZNF284-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF284	HGNC	protein_coding	OTTHUMT00000460473.1		0.00	45	0	A	NM_001037813		44590074	+1			no_errors	ENST00000421176	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.002	G
ZNF516	9658	genome.wustl.edu	37	18	74153868	74153868	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr18:74153868C>A	ENST00000443185.2	-	3	1460	c.1143G>T	c.(1141-1143)caG>caT	p.Q381H	ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	381					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		GGAGGAAGAACTGCTTGGTGT	0.716																																																	0													10.0	12.0	11.0					18																	74153868		1996	4119	6115	SO:0001583	missense	0			D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.1143G>T	18.37:g.74153868C>A	ENSP00000394757:p.Gln381His			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q381H	ENST00000443185.2	37	c.1143		18	.	.	.	.	.	.	.	.	.	.	C	15.03	2.710866	0.48517	.	.	ENSG00000101493	ENST00000443185	T	0.09630	2.96	4.98	3.09	0.35607	.	0.405610	0.23282	N	0.049892	T	0.23370	0.0565	.	.	.	0.31547	N	0.659212	D	0.57899	0.981	P	0.57371	0.819	T	0.12268	-1.0554	9	0.40728	T	0.16	-11.331	13.3706	0.60711	0.0:0.6975:0.3025:0.0	.	381	Q92618	ZN516_HUMAN	H	381	ENSP00000394757:Q381H	ENSP00000394757:Q381H	Q	-	3	2	ZNF516	72282856	0.893000	0.30496	0.914000	0.36105	0.977000	0.68977	0.772000	0.26647	0.618000	0.30179	0.655000	0.94253	CAG	ZNF516	-	NULL	ENSG00000101493		0.716	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	ZNF516	HGNC	protein_coding		-	0.00	36	0	C	NM_014643		74153868	-1	tier1	-	no_errors	ENST00000443185	ensembl	human	known	74_37	missense	11.11	40	5	SNP	0.927	A
ZNF835	90485	genome.wustl.edu	37	19	57175168	57175168	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr19:57175168C>T	ENST00000537055.2	-	2	1630	c.1399G>A	c.(1399-1401)Gtg>Atg	p.V467M		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	467					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CCGGTGTGCACGATGTGGTGC	0.667																																																	0													97.0	106.0	103.0					19																	57175168		2202	4300	6502	SO:0001583	missense	0			AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.1399G>A	19.37:g.57175168C>T	ENSP00000444747:p.Val467Met		B7Z5Y0|G3V1S0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V467M	ENST00000537055.2	37	c.1399	CCDS56105.1	19	.	.	.	.	.	.	.	.	.	.	C	15.27	2.784153	0.49997	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.20069	2.1	2.32	-1.23	0.09465	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.20740	0.0499	L	0.35644	1.08	0.09310	N	1	D	0.57257	0.979	P	0.53490	0.727	T	0.13548	-1.0505	9	0.72032	D	0.01	.	2.3245	0.04219	0.4193:0.2952:0.0:0.2855	.	489	Q9Y2P0	ZN835_HUMAN	M	489;467	ENSP00000444747:V467M	ENSP00000341756:V489M	V	-	1	0	ZNF835	61866980	0.000000	0.05858	0.002000	0.10522	0.664000	0.39144	-1.387000	0.02535	-0.214000	0.10078	0.561000	0.74099	GTG	ZNF835	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000127903		0.667	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF835	HGNC	protein_coding	OTTHUMT00000459800.1	-	0.00	53	0	C	NM_001005850		57175168	-1	tier1	-	no_errors	ENST00000537055	ensembl	human	known	74_37	missense	10.34	52	6	SNP	0.000	T
ZNF551	90233	genome.wustl.edu	37	19	58197860	58197860	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr19:58197860G>A	ENST00000282296.5	+	3	402	c.217G>A	c.(217-219)Gga>Aga	p.G73R	AC003006.7_ENST00000594684.1_Intron|ZNF551_ENST00000599402.1_3'UTR|ZNF551_ENST00000596085.1_Intron|ZNF551_ENST00000356715.4_Missense_Mutation_p.G57R|AC003006.7_ENST00000599221.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	73	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TTATTGCCATGGAATGGAGAA	0.433																																																	0													84.0	79.0	80.0					19																	58197860		2203	4300	6503	SO:0001583	missense	0			BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.217G>A	19.37:g.58197860G>A	ENSP00000282296:p.Gly73Arg		B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G73R	ENST00000282296.5	37	c.217	CCDS12959.2	19	.	.	.	.	.	.	.	.	.	.	G	8.467	0.856726	0.17106	.	.	ENSG00000204519	ENST00000356715;ENST00000282296	.	.	.	2.08	1.03	0.20045	Krueppel-associated box (3);	.	.	.	.	T	0.21347	0.0514	L	0.29908	0.895	0.09310	N	1	P	0.39847	0.691	B	0.37833	0.259	T	0.13019	-1.0525	8	0.13470	T	0.59	.	6.636	0.22883	0.1601:0.0:0.8399:0.0	.	73	Q7Z340	ZN551_HUMAN	R	73;57	.	ENSP00000282296:G57R	G	+	1	0	ZNF551	62889672	0.004000	0.15560	0.002000	0.10522	0.006000	0.05464	0.639000	0.24690	0.437000	0.26423	0.555000	0.69702	GGA	ZNF551	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000204519		0.433	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF551	HGNC	protein_coding	OTTHUMT00000466803.2		0.00	79	0	G	NM_138347		58197860	+1			no_errors	ENST00000282296	ensembl	human	known	74_37	missense	5.49	86	5	SNP	0.011	A
ZNHIT1	10467	genome.wustl.edu	37	7	100866996	100866996	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr7:100866996G>A	ENST00000305105.2	+	4	844	c.316G>A	c.(316-318)Gcg>Acg	p.A106T	ZNHIT1_ENST00000492315.1_3'UTR	NM_006349.2	NP_006340.1	O43257	ZNHI1_HUMAN	zinc finger, HIT-type containing 1	106	Interaction with NR1D2.				negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of histone deacetylation (GO:0031063)|regulation of T cell proliferation (GO:0042129)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)	11	Lung NSC(181;0.168)|all_lung(186;0.215)					GACGGCCTGTGCGGGACCCCC	0.662																																																	0													48.0	53.0	52.0					7																	100866996		2203	4300	6503	SO:0001583	missense	0			AF093571	CCDS5716.1	7q22.1	2010-09-15	2010-09-15	2003-08-08	ENSG00000106400	ENSG00000106400		"""Zinc fingers, HIT-type"""	21688	protein-coding gene	gene with protein product	"""putative cyclin G1 interacting protein"""		"""zinc finger protein, subfamily 4A (HIT domain containing), member 1"", ""zinc finger, HIT domain containing 1"""	ZNFN4A1			Standard	NM_006349		Approved	CG1I, H_DJ0747G18.14	uc003uye.3	O43257	OTTHUMG00000157113	ENST00000305105.2:c.316G>A	7.37:g.100866996G>A	ENSP00000304593:p.Ala106Thr		Q6IB12	Missense_Mutation	SNP	pfam_Znf_HIT,pfscan_Znf_HIT	p.A106T	ENST00000305105.2	37	c.316	CCDS5716.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.628954	0.96671	.	.	ENSG00000106400	ENST00000305105	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.74627	0.3741	M	0.78456	2.415	0.80722	D	1	D	0.54772	0.968	P	0.54856	0.762	T	0.76979	-0.2758	9	0.49607	T	0.09	-22.3848	16.3684	0.83344	0.0:0.0:1.0:0.0	.	106	O43257	ZNHI1_HUMAN	T	106	.	ENSP00000304593:A106T	A	+	1	0	ZNHIT1	100653716	1.000000	0.71417	0.935000	0.37517	0.913000	0.54294	6.955000	0.76007	2.475000	0.83589	0.549000	0.68633	GCG	ZNHIT1	-	NULL	ENSG00000106400		0.662	ZNHIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNHIT1	HGNC	protein_coding	OTTHUMT00000347488.1		0.00	29	0	G	NM_006349		100866996	+1			no_errors	ENST00000305105	ensembl	human	known	74_37	missense	8.00	23	2	SNP	1.000	A
ZSCAN1	284312	genome.wustl.edu	37	19	58549469	58549469	+	Missense_Mutation	SNP	G	G	A	rs148253808		TCGA-L5-A88T-01A-11D-A351-09	TCGA-L5-A88T-11A-11D-A351-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	0c0de631-e459-4b8a-9a6d-12ef96cd4db6	568152ed-685a-4d60-b2aa-bd470368a875	g.chr19:58549469G>A	ENST00000282326.1	+	3	512	c.265G>A	c.(265-267)Gcg>Acg	p.A89T	ZSCAN1_ENST00000601162.1_Missense_Mutation_p.A89T|ZSCAN1_ENST00000391700.1_Missense_Mutation_p.A89T	NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	89	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)	p.A89T(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		GTTCCTGGGCGCGCTGCCCAG	0.692													G|||	1	0.000199681	0.0	0.0	5008	,	,		10629	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	prostate(1)						G	THR/ALA	1,4393		0,1,2196	17.0	17.0	17.0		265	-1.9	0.0	19	dbSNP_134	17	0,8588		0,0,4294	no	missense	ZSCAN1	NM_182572.3	58	0,1,6490	AA,AG,GG		0.0,0.0228,0.0077	benign	89/409	58549469	1,12981	2197	4294	6491	SO:0001583	missense	0			AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.265G>A	19.37:g.58549469G>A	ENSP00000282326:p.Ala89Thr		Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A89T	ENST00000282326.1	37	c.265	CCDS12969.1	19	.	.	.	.	.	.	.	.	.	.	G	17.39	3.378188	0.61735	2.28E-4	0.0	ENSG00000152467	ENST00000391700;ENST00000282326	T;T	0.04360	3.64;3.64	2.08	-1.9	0.07665	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	.	.	.	.	T	0.05502	0.0145	L	0.38733	1.17	0.09310	N	1	P;P	0.52170	0.95;0.951	P;B	0.51999	0.687;0.404	T	0.32375	-0.9909	9	0.27082	T	0.32	.	1.9367	0.03338	0.3721:0.0:0.362:0.2659	.	89;89	Q8NBB4;Q8NBB4-2	ZSCA1_HUMAN;.	T	89	ENSP00000375581:A89T;ENSP00000282326:A89T	ENSP00000282326:A89T	A	+	1	0	ZSCAN1	63241281	0.000000	0.05858	0.034000	0.17996	0.964000	0.63967	0.070000	0.14573	-0.194000	0.10399	0.393000	0.25936	GCG	ZSCAN1	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000152467		0.692	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN1	HGNC	protein_coding	OTTHUMT00000466427.1		0.00	58	0	G	NM_182572		58549469	+1			no_errors	ENST00000282326	ensembl	human	known	74_37	missense	10.81	66	8	SNP	0.002	A
