#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCC9	10060	genome.wustl.edu	37	12	22059129	22059129	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:22059129T>G	ENST00000261201.4	-	10	1548	c.1549A>C	c.(1549-1551)Agt>Cgt	p.S517R	ABCC9_ENST00000261200.4_Missense_Mutation_p.S517R|ABCC9_ENST00000345162.2_Missense_Mutation_p.S517R	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	517	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	TCCTCCACACTTTTGCAGAAA	0.363																																																	0													170.0	152.0	158.0					12																	22059129		2203	4300	6503	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.1549A>C	12.37:g.22059129T>G	ENSP00000261201:p.Ser517Arg		O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2	p.S517R	ENST00000261201.4	37	c.1549	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	T	8.486	0.860980	0.17178	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	4.96	4.96	0.65561	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.222035	0.52532	D	0.000065	T	0.68348	0.2991	N	0.01751	-0.74	0.37448	D	0.914686	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.67401	-0.5680	10	0.09590	T	0.72	-15.715	14.8169	0.70041	0.0:0.0:0.0:1.0	.	517;517	O60706;O60706-2	ABCC9_HUMAN;.	R	517;180;517;517	ENSP00000261200:S517R;ENSP00000440521:S180R;ENSP00000261201:S517R;ENSP00000261202:S517R	ENSP00000261200:S517R	S	-	1	0	ABCC9	21950396	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	3.878000	0.56130	2.072000	0.62099	0.533000	0.62120	AGT	ABCC9	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000069431		0.363	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	-	0.00	63	0	T	NM_005691		22059129	-1	tier1	-	no_errors	ENST00000261200	ensembl	human	known	74_37	missense	23.91	35	11	SNP	1.000	G
ABCC9	10060	genome.wustl.edu	37	12	22069971	22069971	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:22069971G>A	ENST00000261201.4	-	4	472	c.473C>T	c.(472-474)tCt>tTt	p.S158F	ABCC9_ENST00000261200.4_Missense_Mutation_p.S158F|ABCC9_ENST00000345162.2_Missense_Mutation_p.S158F	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	158					defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	GTCCAAGCCAGACTGACAGTA	0.408																																																	0													190.0	184.0	186.0					12																	22069971		2203	4300	6503	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.473C>T	12.37:g.22069971G>A	ENSP00000261201:p.Ser158Phe		O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2	p.S158F	ENST00000261201.4	37	c.473	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	G	3.052	-0.195221	0.06259	.	.	ENSG00000069431	ENST00000261200;ENST00000261201;ENST00000345162	D;D;D	0.97186	-4.28;-4.28;-4.28	5.09	-5.47	0.02600	.	2.648130	0.00757	N	0.001107	D	0.89532	0.6742	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.80848	-0.1199	10	0.59425	D	0.04	0.1269	0.429	0.00468	0.3187:0.2561:0.1279:0.2973	.	158;158	O60706;O60706-2	ABCC9_HUMAN;.	F	158	ENSP00000261200:S158F;ENSP00000261201:S158F;ENSP00000261202:S158F	ENSP00000261200:S158F	S	-	2	0	ABCC9	21961238	0.002000	0.14202	0.021000	0.16686	0.008000	0.06430	0.532000	0.23067	-0.586000	0.05898	-0.852000	0.03032	TCT	ABCC9	-	NULL	ENSG00000069431		0.408	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	-	0.00	64	0	G	NM_005691		22069971	-1	tier1	-	no_errors	ENST00000261200	ensembl	human	known	74_37	missense	20.45	35	9	SNP	0.000	A
ABI3BP	25890	genome.wustl.edu	37	3	100508347	100508347	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:100508347A>C	ENST00000284322.5	-	24	2089	c.1980T>G	c.(1978-1980)ttT>ttG	p.F660L	ABI3BP_ENST00000471714.1_Missense_Mutation_p.F1337L|ABI3BP_ENST00000383691.4_Missense_Mutation_p.F614L	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	660	Pro-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						CAGTAGTATAAAATCTGTGTG	0.428																																																	0													71.0	64.0	67.0					3																	100508347		1839	4093	5932	SO:0001583	missense	0			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1980T>G	3.37:g.100508347A>C	ENSP00000284322:p.Phe660Leu		B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.F660L	ENST00000284322.5	37	c.1980	CCDS46880.1	3	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	0.008|0.008|0.008	-1.877533|-1.877533|-1.877533	0.00537|0.00537|0.00537	.|.|.	.|.|.	ENSG00000154175|ENSG00000154175|ENSG00000154175	ENST00000495591;ENST00000471901|ENST00000471714;ENST00000284322;ENST00000383692;ENST00000429331;ENST00000383691;ENST00000486770|ENST00000497395	T|T;T;T|.	0.23147|0.19532|.	1.92|2.46;2.16;2.14|.	5.7|5.7|5.7	-1.15|-1.15|-1.15	0.09709|0.09709|0.09709	.|.|.	0.819360|0.819360|.	0.11197|0.11197|.	N|N|.	0.589268|0.589268|.	T|T|T	0.05823|0.05823|0.05823	0.0152|0.0152|0.0152	N|N|N	0.00289|0.00289|0.00289	-1.7|-1.7|-1.7	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|B;B;B;B|.	.|0.15719|.	.|0.0;0.0;0.014;0.001|.	.|B;B;B;B|.	.|0.06405|.	.|0.0;0.0;0.002;0.001|.	T|T|T	0.39643|0.39643|0.39643	-0.9604|-0.9604|-0.9604	8|10|5	0.54805|0.07813|.	T|T|.	0.06|0.8|.	-1.9099|-1.9099|-1.9099	4.5214|4.5214|4.5214	0.11960|0.11960|0.11960	0.1596:0.3651:0.0:0.4753|0.1596:0.3651:0.0:0.4753|0.1596:0.3651:0.0:0.4753	.|.|.	.|614;660;1337;344|.	.|B4DSV9;Q7Z7G0;D3YTG3;D3YTD6|.	.|.;TARSH_HUMAN;.;.|.	C|L|V	716;240|1337;660;344;46;614;72|76	ENSP00000418817:F716C|ENSP00000420524:F1337L;ENSP00000284322:F660L;ENSP00000373189:F614L|.	ENSP00000418024:F240C|ENSP00000284322:F660L|.	F|F|L	-|-|-	2|3|1	0|2|2	ABI3BP|ABI3BP|ABI3BP	101991037|101991037|101991037	0.013000|0.013000|0.013000	0.17824|0.17824|0.17824	0.052000|0.052000|0.052000	0.19188|0.19188|0.19188	0.137000|0.137000|0.137000	0.21094|0.21094|0.21094	0.096000|0.096000|0.096000	0.15147|0.15147|0.15147	-0.070000|-0.070000|-0.070000	0.12908|0.12908|0.12908	-1.263000|-1.263000|-1.263000	0.01449|0.01449|0.01449	TTT|TTT|TTA	ABI3BP	-	NULL	ENSG00000154175		0.428	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	HGNC	protein_coding	OTTHUMT00000353260.1	-	0.00	60	0	A			100508347	-1	tier1	-	no_errors	ENST00000284322	ensembl	human	known	74_37	missense	57.14	15	20	SNP	0.004	C
ACAN	176	genome.wustl.edu	37	15	89401826	89401826	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr15:89401826T>A	ENST00000561243.1	+	11	6010	c.6010T>A	c.(6010-6012)Ttt>Att	p.F2004I	ACAN_ENST00000352105.7_Missense_Mutation_p.F2004I|ACAN_ENST00000559004.1_Missense_Mutation_p.F2004I|ACAN_ENST00000439576.2_Missense_Mutation_p.F2004I			P16112	PGCA_HUMAN	aggrecan	2014	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TACTCCATATTTTAGTGGGGA	0.527																																																	0													47.0	47.0	47.0					15																	89401826		1860	4099	5959	SO:0001583	missense	0			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.6010T>A	15.37:g.89401826T>A	ENSP00000453342:p.Phe2004Ile		Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EG-like_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.F2004I	ENST00000561243.1	37	c.6010	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	T	5.414	0.261481	0.10239	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.03330	4.23;3.97	5.15	2.76	0.32466	.	0.254509	0.20808	N	0.085306	T	0.13798	0.0334	M	0.81497	2.545	0.18873	N	0.999986	D;D	0.89917	1.0;0.995	D;D	0.85130	0.997;0.992	T	0.13150	-1.0520	10	0.22109	T	0.4	-6.045	6.9115	0.24338	0.2582:0.0:0.1345:0.6073	.	2004;2004	E7ENV9;E7EX88	.;.	I	2004;2004;1890	ENSP00000387356:F2004I;ENSP00000341615:F2004I	ENSP00000268134:F1890I	F	+	1	0	ACAN	87202830	1.000000	0.71417	0.940000	0.37924	0.048000	0.14542	2.388000	0.44398	0.259000	0.21709	-0.313000	0.08912	TTT	ACAN	-	NULL	ENSG00000157766		0.527	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	-	0.00	25	0	T	NM_001135		89401826	+1	tier1	-	no_errors	ENST00000439576	ensembl	human	known	74_37	missense	20.00	20	5	SNP	0.481	A
ACSM2A	123876	genome.wustl.edu	37	16	20488699	20488699	+	Silent	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:20488699T>G	ENST00000573854.1	+	9	1221	c.1107T>G	c.(1105-1107)acT>acG	p.T369T	ACSM2A_ENST00000219054.6_Silent_p.T369T|ACSM2A_ENST00000575690.1_Silent_p.T369T|ACSM2A_ENST00000396104.2_Silent_p.T369T|ACSM2A_ENST00000417235.2_Silent_p.T290T|ACSM2A_ENST00000575558.1_3'UTR|ACSM2A_ENST00000536134.1_Silent_p.T141T	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	369					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						AGGGATTAACTTGCATGGTTT	0.463																																																	0													48.0	45.0	46.0					16																	20488699		2202	4280	6482	SO:0001819	synonymous_variant	0			AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1107T>G	16.37:g.20488699T>G			B3KTT9|O75202	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.T369	ENST00000573854.1	37	c.1107	CCDS32401.1	16																																																																																			ACSM2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000183747		0.463	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2A	HGNC	protein_coding	OTTHUMT00000436764.1		0.00	86	0	T	NM_001010845		20488699	+1			no_errors	ENST00000219054	ensembl	human	known	74_37	silent	5.80	65	4	SNP	0.032	G
ACSM2B	348158	genome.wustl.edu	37	16	20557788	20557788	+	Silent	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:20557788A>C	ENST00000329697.6	-	9	1275	c.1107T>G	c.(1105-1107)acT>acG	p.T369T	ACSM2B_ENST00000565322.1_Silent_p.T290T|ACSM2B_ENST00000567288.1_5'UTR|ACSM2B_ENST00000567001.1_Silent_p.T369T|ACSM2B_ENST00000565232.1_Silent_p.T369T	NM_001105069.1	NP_001098539.1	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member 2B	369					fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(4)|lung(33)|ovary(1)|prostate(1)|skin(5)	57						AAACCATGCAAGTTAATCCCT	0.468																																																	0													51.0	51.0	51.0					16																	20557788		2199	4279	6478	SO:0001819	synonymous_variant	0			AY160217	CCDS10586.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000066813	ENSG00000066813		"""Acyl-CoA synthetase family"""	30931	protein-coding gene	gene with protein product	"""xenobiotic/medium chain fatty acid:CoA ligase"""	614359	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2		12616642	Standard	NM_182617		Approved	HXMA, HYST1046	uc002dhk.4	Q68CK6	OTTHUMG00000131555	ENST00000329697.6:c.1107T>G	16.37:g.20557788A>C			Q86YT1	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.T369	ENST00000329697.6	37	c.1107	CCDS10586.1	16																																																																																			ACSM2B	-	pfam_AMP-dep_Synth/Lig	ENSG00000066813		0.468	ACSM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2B	HGNC	protein_coding	OTTHUMT00000254417.2	-	0.00	47	0	A	NM_182617		20557788	-1	tier1	-	no_errors	ENST00000329697	ensembl	human	known	74_37	silent	28.12	46	18	SNP	0.038	C
ACTL7A	10881	genome.wustl.edu	37	9	111624721	111624721	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:111624721G>A	ENST00000333999.3	+	1	119	c.119G>A	c.(118-120)cGg>cAg	p.R40Q		NM_006687.2	NP_006678.1	Q9Y615	ACL7A_HUMAN	actin-like 7A	40	Required for interaction with TES.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|male germ cell nucleus (GO:0001673)|motile cilium (GO:0031514)|nucleus (GO:0005634)|protein complex (GO:0043234)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|endometrium(2)|large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CCGGCGAAGCGGGCCGTGTGG	0.617																																					Esophageal Squamous(177;1480 3591 17554)												0													42.0	46.0	45.0					9																	111624721		2203	4300	6503	SO:0001583	missense	0			BC014610	CCDS6772.1	9q31	2008-02-05			ENSG00000187003	ENSG00000187003			161	protein-coding gene	gene with protein product		604303				10373328	Standard	NM_006687		Approved		uc004bdj.1	Q9Y615	OTTHUMG00000020461	ENST00000333999.3:c.119G>A	9.37:g.111624721G>A	ENSP00000334300:p.Arg40Gln		B2RC83|Q5JSV0	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.R40Q	ENST00000333999.3	37	c.119	CCDS6772.1	9	.	.	.	.	.	.	.	.	.	.	G	12.04	1.820007	0.32145	.	.	ENSG00000187003	ENST00000333999	D	0.94613	-3.47	5.62	4.54	0.55810	.	1.219030	0.06376	N	0.714307	D	0.88265	0.6390	N	0.08118	0	0.29206	N	0.874894	D	0.58268	0.982	B	0.42087	0.375	T	0.81611	-0.0854	10	0.46703	T	0.11	.	10.3024	0.43661	0.1035:0.0:0.8965:0.0	.	40	Q9Y615	ACL7A_HUMAN	Q	40	ENSP00000334300:R40Q	ENSP00000334300:R40Q	R	+	2	0	ACTL7A	110664542	0.998000	0.40836	0.998000	0.56505	0.669000	0.39330	0.564000	0.23563	2.643000	0.89663	0.655000	0.94253	CGG	ACTL7A	-	NULL	ENSG00000187003		0.617	ACTL7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL7A	HGNC	protein_coding	OTTHUMT00000053570.1	-	0.00	64	0	G	NM_006687		111624721	+1	tier1	-	no_errors	ENST00000333999	ensembl	human	known	74_37	missense	27.91	30	12	SNP	0.981	A
ACTL9	284382	genome.wustl.edu	37	19	8808052	8808052	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:8808052A>C	ENST00000324436.3	-	1	1120	c.1000T>G	c.(1000-1002)Ttg>Gtg	p.L334V		NM_178525.3	NP_848620.3	Q8TC94	ACTL9_HUMAN	actin-like 9	334						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(15)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	36						TTTTGGGCCAAGTCCGCGCGC	0.662																																																	0													36.0	37.0	37.0					19																	8808052		2202	4296	6498	SO:0001583	missense	0				CCDS12207.1	19p13.2	2014-08-08			ENSG00000181786	ENSG00000181786			28494	protein-coding gene	gene with protein product							Standard	NM_178525		Approved	MGC33407	uc002mkl.2	Q8TC94	OTTHUMG00000182194	ENST00000324436.3:c.1000T>G	19.37:g.8808052A>C	ENSP00000316674:p.Leu334Val		A8K893|Q6X960	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.L334V	ENST00000324436.3	37	c.1000	CCDS12207.1	19	.	.	.	.	.	.	.	.	.	.	a	3.633	-0.075105	0.07184	.	.	ENSG00000181786	ENST00000324436	D	0.97941	-4.62	4.45	-0.242	0.13039	.	1.060040	0.07531	N	0.912254	D	0.95166	0.8433	M	0.62016	1.91	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	D	0.87047	0.2144	10	0.87932	D	0	.	1.545	0.02563	0.4169:0.29:0.1271:0.166	.	334	Q8TC94	ACTL9_HUMAN	V	334	ENSP00000316674:L334V	ENSP00000316674:L334V	L	-	1	2	ACTL9	8669052	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-0.801000	0.04550	-0.017000	0.14103	0.255000	0.18592	TTG	ACTL9	-	pfam_Actin-related,smart_Actin-related	ENSG00000181786		0.662	ACTL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL9	HGNC	protein_coding	OTTHUMT00000459953.1	-	0.00	82	0	A	NM_178525		8808052	-1	tier1	-	no_errors	ENST00000324436	ensembl	human	known	74_37	missense	32.14	38	18	SNP	0.012	C
ADAMTS20	80070	genome.wustl.edu	37	12	43886311	43886311	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:43886311G>T	ENST00000389420.3	-	6	1072	c.1073C>A	c.(1072-1074)aCt>aAt	p.T358N	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.T358N	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	358	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ATCATACCTAGTGATAAGAAC	0.373																																																	0													145.0	124.0	131.0					12																	43886311		2203	4300	6503	SO:0001583	missense	0			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1073C>A	12.37:g.43886311G>T	ENSP00000374071:p.Thr358Asn		A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.T358N	ENST00000389420.3	37	c.1073	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404142	0.62288	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	D;D	0.90385	-2.66;-2.66	4.69	4.69	0.59074	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.50627	D	0.000108	D	0.97126	0.9061	H	0.96861	3.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98498	1.0613	10	0.87932	D	0	.	18.4952	0.90863	0.0:0.0:1.0:0.0	.	358	P59510	ATS20_HUMAN	N	358	ENSP00000374071:T358N;ENSP00000448341:T358N	ENSP00000374068:T358N	T	-	2	0	ADAMTS20	42172578	1.000000	0.71417	0.988000	0.46212	0.252000	0.25951	9.136000	0.94489	2.529000	0.85273	0.557000	0.71058	ACT	ADAMTS20	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000173157		0.373	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	-	0.00	61	0	G	NM_025003		43886311	-1	tier1	-	no_errors	ENST00000389420	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
ADCK5	203054	genome.wustl.edu	37	8	145617857	145617857	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr8:145617857G>A	ENST00000308860.6	+	13	1509	c.1465G>A	c.(1465-1467)Gct>Act	p.A489T	CPSF1_ENST00000531727.1_5'Flank|MIR939_ENST00000401314.1_RNA	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5	489						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CACCGTGCGCGCTATCAACGT	0.697																																																	0													16.0	17.0	17.0					8																	145617857		2178	4292	6470	SO:0001583	missense	0			BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.1465G>A	8.37:g.145617857G>A	ENSP00000310547:p.Ala489Thr		B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Missense_Mutation	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.A489T	ENST00000308860.6	37	c.1465	CCDS34965.1	8	.	.	.	.	.	.	.	.	.	.	G	14.84	2.656684	0.47467	.	.	ENSG00000173137	ENST00000308860	T	0.75821	-0.97	5.05	0.376	0.16193	.	0.237530	0.41605	D	0.000848	T	0.71600	0.3359	M	0.68593	2.085	0.80722	D	1	P	0.41232	0.743	B	0.41412	0.356	T	0.71994	-0.4424	10	0.51188	T	0.08	-13.95	13.0452	0.58922	0.0:0.0:0.2573:0.7427	.	489	Q3MIX3	ADCK5_HUMAN	T	489	ENSP00000310547:A489T	ENSP00000310547:A489T	A	+	1	0	ADCK5	145588665	0.457000	0.25752	0.610000	0.28997	0.118000	0.20060	1.077000	0.30741	0.122000	0.18314	0.561000	0.74099	GCT	ADCK5	-	NULL	ENSG00000173137		0.697	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK5	HGNC	protein_coding	OTTHUMT00000382556.2		0.00	32	0	G	NM_174922		145617857	+1			no_errors	ENST00000308860	ensembl	human	known	74_37	missense	23.53	13	4	SNP	0.972	A
AEBP1	165	genome.wustl.edu	37	7	44153778	44153780	+	In_Frame_Del	DEL	AGA	AGA	-	rs13928	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	AGA	AGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:44153778_44153780delAGA	ENST00000223357.3	+	21	3700_3702	c.3395_3397delAGA	c.(3394-3399)gagaaa>gaa	p.K1133del	AEBP1_ENST00000450684.2_In_Frame_Del_p.K708del	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	1133	Glu-rich.|Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for transcriptional repression. {ECO:0000250}.		K -> E (in dbSNP:rs13928). {ECO:0000269|Ref.3}.		cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						gaggaggaggagaaagaggagga	0.552																																																	0																																										SO:0001651	inframe_deletion	0			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.3395_3397delAGA	7.37:g.44153778_44153780delAGA	ENSP00000223357:p.Lys1133del		Q14113|Q59ER7|Q6ZSC7|Q7KZ79	In_Frame_Del	DEL	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.K1133in_frame_del	ENST00000223357.3	37	c.3395_3397	CCDS5476.1	7																																																																																			AEBP1	-	NULL	ENSG00000106624		0.552	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2		0.00	43	0	AGA	NM_001129		44153780	+1	tier1		no_errors	ENST00000223357	ensembl	human	known	74_37	in_frame_del	11.11	16	2	DEL	0.009:0.011:0.010	-
AHSP	51327	genome.wustl.edu	37	16	31539954	31539954	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:31539954A>C	ENST00000302312.4	+	3	354	c.251A>C	c.(250-252)aAg>aCg	p.K84T	AHSP_ENST00000569954.1_3'UTR	NM_016633.2	NP_057717.1	Q9NZD4	AHSP_HUMAN	alpha hemoglobin stabilizing protein	84					hemoglobin metabolic process (GO:0020027)|hemopoiesis (GO:0030097)|protein folding (GO:0006457)|protein stabilization (GO:0050821)	hemoglobin complex (GO:0005833)	hemoglobin binding (GO:0030492)|unfolded protein binding (GO:0051082)			lung(2)	2						TTCCTGGCCAAGTACAGGGAC	0.592																																																	0													53.0	48.0	50.0					16																	31539954		2197	4300	6497	SO:0001583	missense	0			AF208865	CCDS10716.1	16p11.1	2009-10-07	2009-10-07	2009-10-07	ENSG00000169877	ENSG00000169877			18075	protein-coding gene	gene with protein product	"""alpha hemoglobin stabilising protein"""	605821	"""erythroid associated factor"""	ERAF		11231637, 12066189	Standard	XM_005255352		Approved	EDRF	uc002ecj.3	Q9NZD4	OTTHUMG00000132461	ENST00000302312.4:c.251A>C	16.37:g.31539954A>C	ENSP00000307199:p.Lys84Thr		Q8TD01	Missense_Mutation	SNP	pfam_A_Hb_stabilising_prot,superfamily_A_Hb_stabilising_prot	p.K84T	ENST00000302312.4	37	c.251	CCDS10716.1	16	.	.	.	.	.	.	.	.	.	.	A	15.77	2.931242	0.52866	.	.	ENSG00000169877	ENST00000302312	D	0.82255	-1.59	5.54	4.46	0.54185	.	0.202110	0.34411	N	0.004000	D	0.83677	0.5306	L	0.36672	1.1	0.28535	N	0.912379	D	0.53151	0.958	P	0.61592	0.891	T	0.77651	-0.2508	10	0.87932	D	0	.	8.067	0.30667	0.908:0.0:0.092:0.0	.	84	Q9NZD4	AHSP_HUMAN	T	84	ENSP00000307199:K84T	ENSP00000307199:K84T	K	+	2	0	AHSP	31447455	1.000000	0.71417	0.140000	0.22221	0.176000	0.22953	2.520000	0.45554	0.939000	0.37446	0.533000	0.62120	AAG	AHSP	-	pfam_A_Hb_stabilising_prot,superfamily_A_Hb_stabilising_prot	ENSG00000169877		0.592	AHSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHSP	HGNC	protein_coding	OTTHUMT00000255624.1	-	0.00	58	0	A	NM_016633		31539954	+1	tier1	-	no_errors	ENST00000302312	ensembl	human	known	74_37	missense	26.00	37	13	SNP	0.877	C
AIDA	64853	genome.wustl.edu	37	1	222843058	222843059	+	3'UTR	DEL	GT	GT	-	rs4011740|rs370811999	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	GT	GT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:222843058_222843059delGT	ENST00000340020.6	-	0	1303_1304				AIDA_ENST00000474863.1_5'UTR|AIDA_ENST00000355727.2_3'UTR|AIDA_ENST00000541237.1_3'UTR	NM_022831.2	NP_073742.2	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated						dorsal/ventral pattern formation (GO:0009953)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|regulation of protein homodimerization activity (GO:0043496)	cytoplasm (GO:0005737)				kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10						CTATACGTCAGTGTGATGTGCT	0.411														199	0.0397364	0.0477	0.0159	5008	,	,		20709	0.0645		0.007	False		,,,				2504	0.0542																0																																										SO:0001624	3_prime_UTR_variant	0			BC043142	CCDS1533.1	1q41	2008-05-22	2008-05-22	2008-05-22	ENSG00000186063	ENSG00000186063			25761	protein-coding gene	gene with protein product	"""axin interaction partner and dorsalization antagonist"""	612375	"""chromosome 1 open reading frame 80"""	C1orf80		8619474, 9110174, 17681137	Standard	NM_022831		Approved	FLJ12806	uc001hnn.3	Q96BJ3	OTTHUMG00000037653	ENST00000340020.6:c.*177AC>-	1.37:g.222843060_222843061delGT			A8K1F0|Q49A81|Q5JRA4|Q658P1|Q9H9E8	RNA	DEL	-	NULL	ENST00000340020.6	37	NULL	CCDS1533.1	1																																																																																			AIDA	-	-	ENSG00000186063		0.411	AIDA-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AIDA	HGNC	protein_coding	OTTHUMT00000091818.1		0.00	14	0	GT	NM_022831		222843059	-1	tier1		no_errors	ENST00000474863	ensembl	human	known	74_37	rna	50.00	3	3	DEL	0.001:0.002	-
ALDH1A1	216	genome.wustl.edu	37	9	75526890	75526890	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:75526890C>T	ENST00000297785.3	-	10	1238	c.1184G>A	c.(1183-1185)cGc>cAc	p.R395H		NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	395					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	TTTGGCAATGCGCATCTCATC	0.438																																																	0													148.0	126.0	133.0					9																	75526890		2203	4300	6503	SO:0001583	missense	0			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.1184G>A	9.37:g.75526890C>T	ENSP00000297785:p.Arg395His		O00768|Q5SYR1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH	p.R395H	ENST00000297785.3	37	c.1184	CCDS6644.1	9	.	.	.	.	.	.	.	.	.	.	C	25.2	4.618039	0.87359	.	.	ENSG00000165092	ENST00000297785	T	0.78126	-1.15	5.91	5.91	0.95273	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.071288	0.64402	D	0.000014	D	0.89047	0.6604	M	0.90145	3.09	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.61275	0.886;0.797	D	0.90613	0.4553	10	0.72032	D	0.01	.	15.8535	0.78956	0.1362:0.8638:0.0:0.0	.	316;395	B4DDF8;P00352	.;AL1A1_HUMAN	H	395	ENSP00000297785:R395H	ENSP00000297785:R395H	R	-	2	0	ALDH1A1	74716710	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.915000	0.48805	2.813000	0.96785	0.655000	0.94253	CGC	ALDH1A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000165092		0.438	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A1	HGNC	protein_coding	OTTHUMT00000052679.1		0.00	55	0	C			75526890	-1			no_errors	ENST00000297785	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
ALG10B	144245	genome.wustl.edu	37	12	38714844	38714844	+	Silent	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:38714844C>T	ENST00000308742.4	+	3	1567	c.1251C>T	c.(1249-1251)taC>taT	p.Y417Y	ALG10B_ENST00000551464.1_Intron|AC117372.1_ENST00000401168.2_RNA	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	417					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)			breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				AATTTCGTTACTTCATTTTAC	0.328																																																	0													193.0	193.0	193.0					12																	38714844		2203	4300	6503	SO:0001819	synonymous_variant	0			AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.1251C>T	12.37:g.38714844C>T			B2RPF4	Silent	SNP	pfam_Alg10,pirsf_Alg10	p.Y417	ENST00000308742.4	37	c.1251	CCDS31772.1	12																																																																																			ALG10B	-	pfam_Alg10,pirsf_Alg10	ENSG00000175548		0.328	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG10B	HGNC	protein_coding	OTTHUMT00000403349.1	-	0.00	82	0	C	NM_001013620		38714844	+1	tier1	-	no_errors	ENST00000308742	ensembl	human	known	74_37	silent	69.77	13	30	SNP	1.000	T
ALKBH2	121642	genome.wustl.edu	37	12	109526081	109526081	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:109526081G>C	ENST00000429722.2	-	4	1079	c.716C>G	c.(715-717)cCc>cGc	p.P239R	ALKBH2_ENST00000343075.3_Missense_Mutation_p.P239R|ALKBH2_ENST00000440112.2_3'UTR	NM_001145374.1	NP_001138846.1	Q6NS38	ALKB2_HUMAN	alkB, alkylation repair homolog 2 (E. coli)	239	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|oxidative demethylation (GO:0070989)|oxidative DNA demethylation (GO:0035511)	nucleoplasm (GO:0005654)	cytosine C-5 DNA demethylase activity (GO:0051747)|DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)			endometrium(1)|kidney(3)|large_intestine(1)|lung(3)	8					Vitamin C(DB00126)	CTTTCTCACGGGAAGACTGTG	0.483								Direct reversal of damage																																									0													116.0	117.0	117.0					12																	109526081		2203	4300	6503	SO:0001583	missense	0			AY754389	CCDS31897.1, CCDS55883.1	12q24.11	2008-04-24			ENSG00000189046	ENSG00000189046		"""Alkylation repair homologs"""	32487	protein-coding gene	gene with protein product		610602					Standard	NM_001145374		Approved	MGC90512, ABH2	uc010sxj.1	Q6NS38	OTTHUMG00000169246	ENST00000429722.2:c.716C>G	12.37:g.109526081G>C	ENSP00000398181:p.Pro239Arg		A4PET2|Q5XLE3	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase	p.P239R	ENST00000429722.2	37	c.716	CCDS31897.1	12	.	.	.	.	.	.	.	.	.	.	G	19.50	3.838751	0.71373	.	.	ENSG00000189046	ENST00000429722;ENST00000343075;ENST00000435370	T;T	0.16743	2.32;2.32	5.62	5.62	0.85841	Oxoglutarate/iron-dependent oxygenase (2);	0.000000	0.85682	D	0.000000	T	0.46367	0.1389	M	0.79343	2.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.44636	-0.9315	10	0.87932	D	0	-23.3927	18.6495	0.91425	0.0:0.0:1.0:0.0	.	239	Q6NS38	ALKB2_HUMAN	R	239	ENSP00000398181:P239R;ENSP00000343021:P239R	ENSP00000343021:P239R	P	-	2	0	ALKBH2	108010464	1.000000	0.71417	0.845000	0.33349	0.415000	0.31203	9.198000	0.94994	2.633000	0.89246	0.655000	0.94253	CCC	ALKBH2	-	pfam_Oxoglu/Fe-dep_dioxygenase	ENSG00000189046		0.483	ALKBH2-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ALKBH2	HGNC	protein_coding	OTTHUMT00000403063.2	-	0.00	79	0	G	NM_001001655		109526081	-1	tier1	-	no_errors	ENST00000343075	ensembl	human	known	74_37	missense	46.67	16	14	SNP	1.000	C
GMPPB	29925	genome.wustl.edu	37	3	49756121	49756121	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:49756121G>A	ENST00000480687.1	-	0	4263				RNF123_ENST00000497099.1_Intron|AMIGO3_ENST00000535833.1_Missense_Mutation_p.R260C|RNF123_ENST00000433785.1_Intron|RNF123_ENST00000327697.6_Intron|AMIGO3_ENST00000320431.7_Missense_Mutation_p.R260C			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AAGCGCACGCGGGACGCGGGT	0.667																																																	0													25.0	28.0	27.0					3																	49756121		2202	4300	6502	SO:0001624	3_prime_UTR_variant	0			AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.*3064C>T	3.37:g.49756121G>A			A8K6N5|Q9H7U3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R260C	ENST00000480687.1	37	c.778	CCDS2803.1	3	.	.	.	.	.	.	.	.	.	.	G	13.40	2.225719	0.39300	.	.	ENSG00000176020	ENST00000320431;ENST00000535833	T;T	0.61274	0.12;0.12	5.4	3.5	0.40072	.	0.451624	0.23105	N	0.051878	T	0.54175	0.1842	M	0.63428	1.95	0.36897	D	0.890202	D	0.65815	0.995	B	0.40534	0.332	T	0.64774	-0.6328	10	0.59425	D	0.04	-15.9821	14.3209	0.66487	0.0:0.3411:0.6589:0.0	.	260	Q86WK7	AMGO3_HUMAN	C	260	ENSP00000323096:R260C;ENSP00000439268:R260C	ENSP00000323096:R260C	R	-	1	0	AMIGO3	49731125	0.553000	0.26513	0.193000	0.23327	0.319000	0.28217	0.877000	0.28106	0.532000	0.28657	0.462000	0.41574	CGC	AMIGO3	-	NULL	ENSG00000176020		0.667	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMIGO3	HGNC	protein_coding	OTTHUMT00000350291.1	-	0.00	36	0	G	NM_013334		49756121	-1	tier1	-	no_errors	ENST00000320431	ensembl	human	known	74_37	missense	37.50	25	15	SNP	0.444	A
ANKRA2	57763	genome.wustl.edu	37	5	72849286	72849286	+	Silent	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:72849286T>C	ENST00000296785.3	-	8	1489	c.831A>G	c.(829-831)gaA>gaG	p.E277E		NM_023039.4	NP_075526.1	Q9H9E1	ANRA2_HUMAN	ankyrin repeat, family A (RFXANK-like), 2	277						cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	low-density lipoprotein particle binding (GO:0030169)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		Lung NSC(167;0.0378)|Ovarian(174;0.0908)		OV - Ovarian serous cystadenocarcinoma(47;3.71e-54)		CAGAGTCAGTTTCAATTGTTG	0.358																																																	0													83.0	77.0	79.0					5																	72849286		2203	4299	6502	SO:0001819	synonymous_variant	0			AA442702	CCDS4020.1	5q12-q13	2013-01-10			ENSG00000164331	ENSG00000164331		"""Ankyrin repeat domain containing"""	13208	protein-coding gene	gene with protein product		605787				10965114	Standard	NM_023039		Approved		uc003kcu.2	Q9H9E1	OTTHUMG00000102030	ENST00000296785.3:c.831A>G	5.37:g.72849286T>C				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E277	ENST00000296785.3	37	c.831	CCDS4020.1	5																																																																																			ANKRA2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	ENSG00000164331		0.358	ANKRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRA2	HGNC	protein_coding	OTTHUMT00000219814.2	-	0.00	23	0	T	NM_023039		72849286	-1	tier1	-	no_errors	ENST00000296785	ensembl	human	known	74_37	silent	16.00	21	4	SNP	1.000	C
ANKRA2	57763	genome.wustl.edu	37	5	72857076	72857076	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:72857076A>C	ENST00000296785.3	-	3	985	c.327T>G	c.(325-327)atT>atG	p.I109M		NM_023039.4	NP_075526.1	Q9H9E1	ANRA2_HUMAN	ankyrin repeat, family A (RFXANK-like), 2	109						cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	low-density lipoprotein particle binding (GO:0030169)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8		Lung NSC(167;0.0378)|Ovarian(174;0.0908)		OV - Ovarian serous cystadenocarcinoma(47;3.71e-54)		GCCTTACTTGAATTCCCGGAG	0.378																																																	0													224.0	198.0	207.0					5																	72857076		2203	4300	6503	SO:0001583	missense	0			AA442702	CCDS4020.1	5q12-q13	2013-01-10			ENSG00000164331	ENSG00000164331		"""Ankyrin repeat domain containing"""	13208	protein-coding gene	gene with protein product		605787				10965114	Standard	NM_023039		Approved		uc003kcu.2	Q9H9E1	OTTHUMG00000102030	ENST00000296785.3:c.327T>G	5.37:g.72857076A>C	ENSP00000296785:p.Ile109Met			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.I109M	ENST00000296785.3	37	c.327	CCDS4020.1	5	.	.	.	.	.	.	.	.	.	.	A	17.58	3.424798	0.62733	.	.	ENSG00000164331	ENST00000296785	T	0.40225	1.04	5.03	1.33	0.21861	Ankyrin repeat-containing domain (1);	0.095769	0.64402	D	0.000001	T	0.32882	0.0844	L	0.44542	1.39	0.50632	D	0.999887	B	0.29085	0.232	B	0.32533	0.147	T	0.05632	-1.0873	10	0.33940	T	0.23	-10.8454	9.0076	0.36122	0.5843:0.0:0.4157:0.0	.	109	Q9H9E1	ANRA2_HUMAN	M	109	ENSP00000296785:I109M	ENSP00000296785:I109M	I	-	3	3	ANKRA2	72892832	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	1.384000	0.34396	-0.005000	0.14395	0.374000	0.22700	ATT	ANKRA2	-	NULL	ENSG00000164331		0.378	ANKRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRA2	HGNC	protein_coding	OTTHUMT00000219814.2	-	0.00	83	0	A	NM_023039		72857076	-1	tier1	-	no_errors	ENST00000296785	ensembl	human	known	74_37	missense	21.88	50	14	SNP	0.994	C
ANKRD36	375248	genome.wustl.edu	37	2	97866072	97866072	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:97866072G>A	ENST00000461153.2	+	45	3001	c.2757G>A	c.(2755-2757)gtG>gtA	p.V919V	ANKRD36_ENST00000420699.2_Splice_Site_p.V919V			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	919										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GCTTTTCAGTGTCTTCTCGGA	0.358																																																	0													273.0	253.0	259.0					2																	97866072		692	1591	2283	SO:0001630	splice_region_variant	0			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.2756-1G>A	2.37:g.97866072G>A			B4E3I8|Q6UX02|Q86X62|Q9HCD1	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.V919	ENST00000461153.2	37	c.2757	CCDS54379.1	2																																																																																			ANKRD36	-	NULL	ENSG00000135976		0.358	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	-	0.00	167	0	G		Silent	97866072	+1	tier1	-	no_errors	ENST00000420699	ensembl	human	known	74_37	silent	17.76	88	19	SNP	0.025	A
APC2	10297	genome.wustl.edu	37	19	1466955	1466955	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:1466955G>A	ENST00000535453.1	+	14	5368	c.3655G>A	c.(3655-3657)Gcg>Acg	p.A1219T	APC2_ENST00000238483.4_Missense_Mutation_p.A945T|APC2_ENST00000233607.2_Missense_Mutation_p.A1219T|C19orf25_ENST00000588427.1_Intron			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTGGCGCCCGCGCCACAGGG	0.721																																																	0													9.0	11.0	10.0					19																	1466955		2160	4258	6418	SO:0001583	missense	0				CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.3655G>A	19.37:g.1466955G>A	ENSP00000442954:p.Ala1219Thr		C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_APC_dom,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Armadillo	p.A1219T	ENST00000535453.1	37	c.3655	CCDS12068.1	19	.	.	.	.	.	.	.	.	.	.	G	1.320	-0.599632	0.03744	.	.	ENSG00000115266	ENST00000233607;ENST00000238483;ENST00000535453	D;D;D	0.92348	-3.02;-2.67;-3.02	4.55	3.49	0.39957	.	0.488453	0.21913	N	0.067264	T	0.80221	0.4583	N	0.17474	0.49	0.80722	D	1	P;P	0.46327	0.876;0.804	B;B	0.28709	0.093;0.043	T	0.77789	-0.2456	10	0.19147	T	0.46	-5.8176	13.4937	0.61411	0.0:0.1588:0.8412:0.0	.	1218;1219	O95996-3;O95996	.;APC2_HUMAN	T	1219;945;1219	ENSP00000233607:A1219T;ENSP00000238483:A945T;ENSP00000442954:A1219T	ENSP00000233607:A1219T	A	+	1	0	APC2	1417955	0.009000	0.17119	0.003000	0.11579	0.004000	0.04260	1.728000	0.38105	1.001000	0.39076	0.511000	0.50034	GCG	APC2	-	NULL	ENSG00000115266		0.721	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	APC2	HGNC	protein_coding	OTTHUMT00000449539.2	-	0.00	23	0	G	NM_005883		1466955	+1	tier1	-	no_errors	ENST00000233607	ensembl	human	known	74_37	missense	60.00	4	6	SNP	0.164	A
ARHGAP5	394	genome.wustl.edu	37	14	32559920	32559920	+	Silent	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr14:32559920C>T	ENST00000345122.3	+	2	360	c.45C>T	c.(43-45)atC>atT	p.I15I	ARHGAP5_ENST00000433497.1_Intron|ARHGAP5_ENST00000396582.2_Intron|ARHGAP5_ENST00000539826.2_Silent_p.I15I|ARHGAP5_ENST00000432921.1_Silent_p.I15I|ARHGAP5_ENST00000556611.1_Silent_p.I15I	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	15					cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		CCTATACCATCAGTATAGTTG	0.398																																					NSCLC(9;77 350 3443 29227 41353)												0													94.0	91.0	92.0					14																	32559920		2203	4300	6503	SO:0001819	synonymous_variant	0			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.45C>T	14.37:g.32559920C>T			A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Silent	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_P-loop_NTPase,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.I15	ENST00000345122.3	37	c.45	CCDS32062.1	14																																																																																			ARHGAP5	-	superfamily_P-loop_NTPase	ENSG00000100852		0.398	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	-	0.00	73	0	C	NM_001030055		32559920	+1	tier1	-	no_errors	ENST00000345122	ensembl	human	known	74_37	silent	26.56	47	17	SNP	1.000	T
ARID5B	84159	genome.wustl.edu	37	10	63816992	63816992	+	Silent	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:63816992A>G	ENST00000279873.7	+	6	1373	c.963A>G	c.(961-963)gaA>gaG	p.E321E	ARID5B_ENST00000309334.5_Silent_p.E78E	NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	321	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					GGGCAGATGAACAAGCCTTCT	0.393																																																	0													116.0	123.0	120.0					10																	63816992		2203	4300	6503	SO:0001819	synonymous_variant	0			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.963A>G	10.37:g.63816992A>G			B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Silent	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.E321	ENST00000279873.7	37	c.963	CCDS31208.1	10																																																																																			ARID5B	-	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	ENSG00000150347		0.393	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID5B	HGNC	protein_coding	OTTHUMT00000048233.1		0.00	55	0	A	XM_084482		63816992	+1			no_errors	ENST00000279873	ensembl	human	known	74_37	silent	6.00	47	3	SNP	0.999	G
ASB17	127247	genome.wustl.edu	37	1	76387872	76387872	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:76387872C>T	ENST00000284142.6	-	2	713	c.574G>A	c.(574-576)Gta>Ata	p.V192I		NM_080868.2	NP_543144.1	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box containing 17	192					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	21						ATTACTCTTACTCTCGAAGGG	0.363																																																	0													111.0	92.0	99.0					1																	76387872		2203	4300	6503	SO:0001583	missense	0			AF403035	CCDS671.1	1p22.3	2013-01-11	2011-01-25		ENSG00000154007	ENSG00000154007		"""Ankyrin repeat domain containing"""	19769	protein-coding gene	gene with protein product			"""ankyrin repeat and SOCS box-containing 17"""			12076535	Standard	NM_080868		Approved		uc001dhe.2	Q8WXJ9	OTTHUMG00000009787	ENST00000284142.6:c.574G>A	1.37:g.76387872C>T	ENSP00000284142:p.Val192Ile		B1APB8|Q8N0X5	Missense_Mutation	SNP	pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_SOCS_C,pfscan_SOCS_C	p.V192I	ENST00000284142.6	37	c.574	CCDS671.1	1	.	.	.	.	.	.	.	.	.	.	C	12.94	2.089227	0.36855	.	.	ENSG00000154007	ENST00000284142	T	0.32988	1.43	4.81	4.81	0.61882	.	0.131649	0.33712	N	0.004627	T	0.26738	0.0654	N	0.24115	0.695	0.31214	N	0.698288	D	0.58970	0.984	D	0.65443	0.935	T	0.04796	-1.0926	10	0.46703	T	0.11	.	13.7808	0.63081	0.0:1.0:0.0:0.0	.	192	Q8WXJ9	ASB17_HUMAN	I	192	ENSP00000284142:V192I	ENSP00000284142:V192I	V	-	1	0	ASB17	76160460	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	1.730000	0.38125	2.403000	0.81681	0.460000	0.39030	GTA	ASB17	-	NULL	ENSG00000154007		0.363	ASB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB17	HGNC	protein_coding	OTTHUMT00000026982.1	-	0.00	92	0	C	NM_080868		76387872	-1	tier1	-	no_errors	ENST00000284142	ensembl	human	known	74_37	missense	48.00	39	36	SNP	1.000	T
ATP10B	23120	genome.wustl.edu	37	5	160033953	160033953	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:160033953T>G	ENST00000327245.5	-	19	3825	c.2979A>C	c.(2977-2979)gaA>gaC	p.E993D		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	993					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCAATCCAGCTTCTGGAACCA	0.478																																																	0													131.0	125.0	127.0					5																	160033953		1972	4146	6118	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2979A>C	5.37:g.160033953T>G	ENSP00000313600:p.Glu993Asp		Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.E993D	ENST00000327245.5	37	c.2979	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	T	4.142	0.024649	0.08054	.	.	ENSG00000118322	ENST00000327245	T	0.62941	-0.01	5.05	-10.1	0.00402	HAD-like domain (1);	0.869670	0.10489	N	0.668607	T	0.24774	0.0601	N	0.05383	-0.06	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.15321	-1.0441	9	.	.	.	.	0.6329	0.00797	0.2988:0.2579:0.2444:0.1989	.	993	O94823	AT10B_HUMAN	D	993	ENSP00000313600:E993D	.	E	-	3	2	ATP10B	159966531	0.000000	0.05858	0.026000	0.17262	0.610000	0.37248	-1.711000	0.01886	-1.229000	0.02564	0.460000	0.39030	GAA	ATP10B	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000118322		0.478	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	-	0.00	85	0	T	NM_025153		160033953	-1	tier1	-	no_errors	ENST00000327245	ensembl	human	known	74_37	missense	22.22	42	12	SNP	0.001	G
ATP10D	57205	genome.wustl.edu	37	4	47593309	47593309	+	Missense_Mutation	SNP	T	T	G	rs536235043	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:47593309T>G	ENST00000273859.3	+	23	4461	c.4192T>G	c.(4192-4194)Tta>Gta	p.L1398V		NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	1398					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						GCAAGGAAACTTATCTCTGTG	0.458																																																	0													144.0	143.0	143.0					4																	47593309		2203	4299	6502	SO:0001583	missense	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.4192T>G	4.37:g.47593309T>G	ENSP00000273859:p.Leu1398Val		A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.L1398V	ENST00000273859.3	37	c.4192	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	T	10.03	1.239183	0.22711	.	.	ENSG00000145246	ENST00000273859	T	0.38722	1.12	4.33	-8.66	0.00866	.	4.506970	0.00166	N	0.000015	T	0.31040	0.0784	L	0.46157	1.445	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30736	-0.9968	10	0.10636	T	0.68	11.4644	9.5229	0.39147	0.4141:0.0:0.4591:0.1268	.	1398	Q9P241	AT10D_HUMAN	V	1398	ENSP00000273859:L1398V	ENSP00000273859:L1398V	L	+	1	2	ATP10D	47288066	0.000000	0.05858	0.000000	0.03702	0.435000	0.31806	-2.282000	0.01156	-3.824000	0.00102	-0.898000	0.02899	TTA	ATP10D	-	NULL	ENSG00000145246		0.458	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	-	0.00	35	0	T	NM_020453		47593309	+1	tier1	-	no_errors	ENST00000273859	ensembl	human	known	74_37	missense	40.00	12	8	SNP	0.000	G
ATP11C	286410	genome.wustl.edu	37	X	138897121	138897121	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:138897121G>T	ENST00000327569.3	-	5	449	c.351C>A	c.(349-351)caC>caA	p.H117Q	ATP11C_ENST00000359686.2_Missense_Mutation_p.H117Q|ATP11C_ENST00000370557.1_Missense_Mutation_p.H114Q|ATP11C_ENST00000370543.1_Missense_Mutation_p.H117Q|ATP11C_ENST00000361648.2_Missense_Mutation_p.H117Q	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	117					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					TGTCAGCTCTGTGTCTCAGAC	0.303																																																	0													90.0	77.0	82.0					X																	138897121		2202	4296	6498	SO:0001583	missense	0			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.351C>A	X.37:g.138897121G>T	ENSP00000332756:p.His117Gln		Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.H117Q	ENST00000327569.3	37	c.351	CCDS14668.1	X	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772804	0.49680	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	D;D;D;D;D	0.89617	-2.54;-2.54;-2.54;-2.54;-2.54	4.29	2.39	0.29439	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.93729	0.7996	M	0.87900	2.915	0.41300	D	0.987031	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.999	D	0.91708	0.5379	10	0.66056	D	0.02	.	7.9919	0.30246	0.3321:0.0:0.6679:0.0	.	117;117	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	Q	114;117;117;117;117	ENSP00000359588:H114Q;ENSP00000355165:H117Q;ENSP00000332756:H117Q;ENSP00000359574:H117Q;ENSP00000352715:H117Q	ENSP00000332756:H117Q	H	-	3	2	ATP11C	138724787	1.000000	0.71417	0.999000	0.59377	0.905000	0.53344	4.009000	0.57110	0.056000	0.16144	-1.268000	0.01426	CAC	ATP11C	-	pfam_ATPase_P-typ_transduc_dom_A,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000101974		0.303	ATP11C-008	KNOWN	basic|CCDS	protein_coding	ATP11C	HGNC	protein_coding	OTTHUMT00000354945.1	-	0.00	50	0	G	NM_173694		138897121	-1	tier1	-	no_errors	ENST00000327569	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
ATP6V1A	523	genome.wustl.edu	37	3	113499971	113499971	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:113499971G>T	ENST00000273398.3	+	3	265	c.157G>T	c.(157-159)Gag>Tag	p.E53*	ATP6V1A_ENST00000538620.1_Nonsense_Mutation_p.E20*	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	53					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	ATTGGTTGGAGAGATTATTCG	0.433																																																	0													181.0	167.0	171.0					3																	113499971		2203	4300	6503	SO:0001587	stop_gained	0			L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.157G>T	3.37:g.113499971G>T	ENSP00000273398:p.Glu53*		B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Nonsense_Mutation	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1_a/bsu_N,superfamily_P-loop_NTPase,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1_a/bsu_N,tigrfam_ATPase_V1-cplx_asu	p.E53*	ENST00000273398.3	37	c.157	CCDS2976.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.636364	0.96693	.	.	ENSG00000114573	ENST00000273398;ENST00000538620;ENST00000496747;ENST00000475322	.	.	.	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-20.0751	19.653	0.95825	0.0:0.0:1.0:0.0	.	.	.	.	X	53;20;20;53	.	ENSP00000273398:E53X	E	+	1	0	ATP6V1A	114982661	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.147000	0.94646	2.634000	0.89283	0.591000	0.81541	GAG	ATP6V1A	-	pfam_ATPase_F1_a/bsu_N,superfamily_ATPase_F1_a/bsu_N,tigrfam_ATPase_V1-cplx_asu	ENSG00000114573		0.433	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1A	HGNC	protein_coding	OTTHUMT00000354457.1		0.00	54	0	G	NM_001690		113499971	+1			no_errors	ENST00000273398	ensembl	human	known	74_37	nonsense	7.41	25	2	SNP	1.000	T
ATP8B5P	158381	genome.wustl.edu	37	9	35449617	35449617	+	RNA	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:35449617A>G	ENST00000430846.1	+	0	2468									ATPase, class I, type 8B, member 5, pseudogene																		TTCCTTTCACAGGAGAAATGG	0.358																																																	0																																												0					9p13.3	2010-09-22			ENSG00000179766	ENSG00000179766		"""ATPases / P-type"""	27245	pseudogene	pseudogene	"""flippase expressed in testis splicing form A pseudogene"""					20210903, 19657017	Standard	NR_003582		Approved	FetA	uc010mkn.2		OTTHUMG00000019862		9.37:g.35449617A>G				Splice_Site	SNP	-	NULL	ENST00000430846.1	37	c.NULL		9																																																																																			ATP8B5P	-	-	ENSG00000179766		0.358	ATP8B5P-002	KNOWN	basic	processed_transcript	ATP8B5P	HGNC	pseudogene	OTTHUMT00000052312.1	-	0.00	19	0	A	NR_003581.1		35449617	+1	tier1	-	no_errors	ENST00000430846	ensembl	human	known	74_37	splice_site	35.48	20	11	SNP	0.000	G
ATRX	546	genome.wustl.edu	37	X	76763679	76763679	+	3'UTR	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:76763679T>A	ENST00000373344.5	-	0	7843				ATRX_ENST00000395603.3_3'UTR|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						ATGCCCTATTTAAAAAAAAAA	0.313			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	0																																										SO:0001624	3_prime_UTR_variant	0			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.*150A>T	X.37:g.76763679T>A			D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	RNA	SNP	-	NULL	ENST00000373344.5	37	NULL	CCDS14434.1	X																																																																																			ATRX	-	-	ENSG00000085224		0.313	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	-	0.00	30	0	T	NM_000489		76763679	-1	tier1	-	no_errors	ENST00000480283	ensembl	human	known	74_37	rna	22.22	14	4	SNP	0.018	A
AUTS2	26053	genome.wustl.edu	37	7	70254984	70254984	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:70254984G>A	ENST00000342771.4	+	19	3103	c.2782G>A	c.(2782-2784)Gcc>Acc	p.A928T	AUTS2_ENST00000406775.2_Missense_Mutation_p.A904T	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	928										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CGAGGGGCGCGCCGCGGGCGA	0.716																																																	0													13.0	15.0	14.0					7																	70254984		2181	4272	6453	SO:0001583	missense	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.2782G>A	7.37:g.70254984G>A	ENSP00000344087:p.Ala928Thr		A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	prints_AUTS2	p.A928T	ENST00000342771.4	37	c.2782	CCDS5539.1	7	.	.	.	.	.	.	.	.	.	.	G	8.885	0.952596	0.18431	.	.	ENSG00000158321	ENST00000406775;ENST00000342771	T;T	0.29397	1.57;1.57	4.28	1.42	0.22433	.	0.311579	0.33092	N	0.005286	T	0.15609	0.0376	L	0.27053	0.805	0.09310	N	1	B;B;B	0.24963	0.0;0.115;0.115	B;B;B	0.10450	0.001;0.005;0.005	T	0.14755	-1.0461	9	.	.	.	-3.6824	5.0907	0.14706	0.3254:0.1421:0.5325:0.0	.	380;904;928	B4DLG0;Q8WXX7-2;Q8WXX7	.;.;AUTS2_HUMAN	T	904;928	ENSP00000385263:A904T;ENSP00000344087:A928T	.	A	+	1	0	AUTS2	69892920	0.002000	0.14202	0.066000	0.19879	0.875000	0.50365	1.077000	0.30741	0.466000	0.27193	0.655000	0.94253	GCC	AUTS2	-	NULL	ENSG00000158321		0.716	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	-	0.00	33	0	G			70254984	+1	tier1	-	no_errors	ENST00000342771	ensembl	human	known	74_37	missense	26.32	14	5	SNP	0.002	A
AZGP1P1	646282	genome.wustl.edu	37	7	99580920	99580920	+	RNA	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:99580920C>A	ENST00000425474.1	+	0	241					NR_036679.1				alpha-2-glycoprotein 1, zinc-binding pseudogene 1																		TGGAGACATGCGGAAGGAGTA	0.537																																																	0																																												0			AW995302		7q22.1	2010-04-16	2006-11-07		ENSG00000214313	ENSG00000214313			911	pseudogene	pseudogene			"""alpha-2-glycoprotein 1, zinc pseudogene 1"""			8241150, 8307568	Standard	NR_036679		Approved		uc003usi.2		OTTHUMG00000156513		7.37:g.99580920C>A				RNA	SNP	-	NULL	ENST00000425474.1	37	NULL		7																																																																																			AZGP1P1	-	-	ENSG00000214313		0.537	AZGP1P1-002	KNOWN	basic	processed_transcript	AZGP1P1	HGNC	pseudogene	OTTHUMT00000344467.1	-	0.00	119	0	C			99580920	+1	tier1	-	no_errors	ENST00000425474	ensembl	human	known	74_37	rna	5.80	65	4	SNP	0.002	A
B4GALT1	2683	genome.wustl.edu	37	9	33116035	33116035	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:33116035T>G	ENST00000379731.4	-	4	1099	c.913A>C	c.(913-915)Aat>Cat	p.N305H	B4GALT1_ENST00000541851.1_Missense_Mutation_p.N52H|B4GALT1_ENST00000535206.1_Intron	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	305					acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)			endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	CAATAATTATTAGGAAATCCA	0.383																																																	0													99.0	91.0	94.0					9																	33116035		2203	4300	6503	SO:0001583	missense	0			X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.913A>C	9.37:g.33116035T>G	ENSP00000369055:p.Asn305His		B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	Missense_Mutation	SNP	pfam_Galactosyl_T_C,prints_Galactosyl_T	p.N305H	ENST00000379731.4	37	c.913	CCDS6535.1	9	.	.	.	.	.	.	.	.	.	.	T	21.8	4.199177	0.79015	.	.	ENSG00000086062	ENST00000379731;ENST00000541701;ENST00000541851	T;T	0.36340	1.26;1.26	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.71074	0.3297	H	0.95260	3.645	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80362	-0.1414	10	0.87932	D	0	-15.629	14.2189	0.65812	0.0:0.0:0.0:1.0	.	305	P15291	B4GT1_HUMAN	H	305;262;52	ENSP00000369055:N305H;ENSP00000445037:N52H	ENSP00000369055:N305H	N	-	1	0	B4GALT1	33106035	1.000000	0.71417	1.000000	0.80357	0.757000	0.42996	7.996000	0.88334	2.240000	0.73641	0.533000	0.62120	AAT	B4GALT1	-	pfam_Galactosyl_T_C,prints_Galactosyl_T	ENSG00000086062		0.383	B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT1	HGNC	protein_coding	OTTHUMT00000052039.1	-	0.00	112	0	T	NM_001497		33116035	-1	tier1	-	no_errors	ENST00000379731	ensembl	human	known	74_37	missense	18.18	63	14	SNP	1.000	G
BANK1	55024	genome.wustl.edu	37	4	102984282	102984282	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:102984282A>C	ENST00000322953.4	+	13	2473	c.2199A>C	c.(2197-2199)gaA>gaC	p.E733D	BANK1_ENST00000428908.1_Missense_Mutation_p.E600D|BANK1_ENST00000444316.2_Missense_Mutation_p.E703D|BANK1_ENST00000504592.1_Missense_Mutation_p.E718D|BANK1_ENST00000508653.1_Missense_Mutation_p.E600D	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	733					B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		GGCCAGAAGAAGAAAATGTCT	0.358																																																	0													97.0	99.0	99.0					4																	102984282		2203	4300	6503	SO:0001583	missense	0			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.2199A>C	4.37:g.102984282A>C	ENSP00000320509:p.Glu733Asp		A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.E733D	ENST00000322953.4	37	c.2199	CCDS34038.1	4	.	.	.	.	.	.	.	.	.	.	A	8.402	0.842170	0.16963	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.17370	2.96;2.96;2.28;2.28;2.96	5.58	1.42	0.22433	.	0.378307	0.26979	N	0.021540	T	0.08268	0.0206	N	0.19112	0.55	0.22961	N	0.998504	B;B;B	0.14012	0.001;0.009;0.009	B;B;B	0.15484	0.006;0.013;0.013	T	0.37174	-0.9717	10	0.16896	T	0.51	.	5.1017	0.14762	0.486:0.1528:0.0:0.3612	.	600;733;718	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	D	718;733;600;600;703	ENSP00000421443:E718D;ENSP00000320509:E733D;ENSP00000412748:E600D;ENSP00000422314:E600D;ENSP00000388817:E703D	ENSP00000320509:E733D	E	+	3	2	BANK1	103203305	1.000000	0.71417	0.992000	0.48379	0.829000	0.46940	1.023000	0.30065	0.009000	0.14813	0.459000	0.35465	GAA	BANK1	-	NULL	ENSG00000153064		0.358	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BANK1	HGNC	protein_coding	OTTHUMT00000363161.1	-	0.00	72	0	A	NM_017935		102984282	+1	tier1	-	no_errors	ENST00000322953	ensembl	human	known	74_37	missense	50.00	25	25	SNP	1.000	C
BCHE	590	genome.wustl.edu	37	3	165547508	165547508	+	Silent	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:165547508T>G	ENST00000264381.3	-	2	1480	c.1314A>C	c.(1312-1314)tcA>tcC	p.S438S	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	438					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	TTCCCCATTCTGAGAACTTCT	0.433																																																	0													97.0	102.0	100.0					3																	165547508		2203	4300	6503	SO:0001819	synonymous_variant	0			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1314A>C	3.37:g.165547508T>G			A8K7P8	Silent	SNP	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.S438	ENST00000264381.3	37	c.1314	CCDS3198.1	3																																																																																			BCHE	-	pfam_CarbesteraseB	ENSG00000114200		0.433	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1	-	0.00	45	0	T			165547508	-1	tier1	-	no_errors	ENST00000264381	ensembl	human	known	74_37	silent	73.85	17	48	SNP	0.061	G
BCHE	590	genome.wustl.edu	37	3	165548672	165548672	+	Silent	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:165548672A>C	ENST00000264381.3	-	2	316	c.150T>G	c.(148-150)ggT>ggG	p.G50G	BCHE_ENST00000540653.1_Intron	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	50					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	TTACCGTGCCACCAAAAACTG	0.423																																																	0													116.0	107.0	110.0					3																	165548672		2203	4300	6503	SO:0001819	synonymous_variant	0			M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.150T>G	3.37:g.165548672A>C			A8K7P8	Silent	SNP	pfam_CarbesteraseB,pfam_AChE_tetra,pfam_AB_hydrolase_3,prints_Cholinesterase	p.G50	ENST00000264381.3	37	c.150	CCDS3198.1	3																																																																																			BCHE	-	pfam_CarbesteraseB	ENSG00000114200		0.423	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCHE	HGNC	protein_coding	OTTHUMT00000350254.1	-	0.00	74	0	A			165548672	-1	tier1	-	no_errors	ENST00000264381	ensembl	human	known	74_37	silent	12.50	56	8	SNP	0.449	C
BCL10	8915	genome.wustl.edu	37	1	85736511	85736511	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:85736511delT	ENST00000370580.1	-	2	873	c.136delA	c.(136-138)atafs	p.I46fs		NM_003921.4	NP_003912.1	O95999	BCL10_HUMAN	B-cell CLL/lymphoma 10	46	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				adaptive immune response (GO:0002250)|B cell apoptotic process (GO:0001783)|cell death (GO:0008219)|cellular defense response (GO:0006968)|cellular response to mechanical stimulus (GO:0071260)|Fc-epsilon receptor signaling pathway (GO:0038095)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|interleukin-6 biosynthetic process (GO:0042226)|lymphotoxin A biosynthetic process (GO:0042109)|negative regulation of mature B cell apoptotic process (GO:0002906)|neural tube closure (GO:0001843)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of mast cell cytokine production (GO:0032765)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell activation (GO:0050870)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein oligomerization (GO:0051259)|regulation of T cell receptor signaling pathway (GO:0050856)|response to food (GO:0032094)|response to fungus (GO:0009620)|response to molecule of bacterial origin (GO:0002237)|T cell apoptotic process (GO:0070231)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor signaling pathway (GO:0002224)	CBM complex (GO:0032449)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|lysosome (GO:0005764)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme binding (GO:0019899)|kinase binding (GO:0019900)|NF-kappaB binding (GO:0051059)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|protein kinase B binding (GO:0043422)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)	p.I46fs*4(1)		haematopoietic_and_lymphoid_tissue(7)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	19				all cancers(265;0.0114)|Epithelial(280;0.0311)		CTACTGAGTATTTTTTTTGCA	0.343			T	IGH@	MALT																																NSCLC(34;993 1034 12176 32621 50182)			Dom	yes		1	1p22	8915	B-cell CLL/lymphoma 10		L	1	Insertion - Frameshift(1)	ovary(1)											83.0	90.0	87.0					1																	85736511		2203	4300	6503	SO:0001589	frameshift_variant	0			AJ006288	CCDS704.1	1p22	2008-07-18			ENSG00000142867	ENSG00000142867			989	protein-coding gene	gene with protein product	"""CARD-like apoptotic protein"", ""CARD-containing apoptotic signaling protein"", ""CARD containing molecule enhancing NF-kB"", ""caspase-recruiting domain-containing protein"", ""CARD-containing proapoptotic protein"""	603517				9989495	Standard	NM_003921		Approved	CARMEN, CIPER, mE10, c-E10, CLAP	uc021opd.1	O95999	OTTHUMG00000009965	ENST00000370580.1:c.136delA	1.37:g.85736511delT	ENSP00000359612:p.Ile46fs		Q5VUF1	Frame_Shift_Del	DEL	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	p.I46fs	ENST00000370580.1	37	c.136	CCDS704.1	1																																																																																			BCL10	-	pfam_CARD,superfamily_DEATH-like_dom,pfscan_CARD	ENSG00000142867		0.343	BCL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL10	HGNC	protein_coding	OTTHUMT00000027612.1		0.00	70	0	T	NM_003921		85736511	-1	tier1		no_errors	ENST00000370580	ensembl	human	known	74_37	frame_shift_del	9.38	29	3	DEL	1.000	-
BCL2L12	83596	genome.wustl.edu	37	19	50169243	50169243	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:50169243G>C	ENST00000246785.3	+	1	421	c.163G>C	c.(163-165)Gtt>Ctt	p.V55L	IRF3_ENST00000596822.1_5'Flank|IRF3_ENST00000601291.1_5'Flank|BCL2L12_ENST00000441864.2_Missense_Mutation_p.V55L|IRF3_ENST00000597198.1_5'Flank|IRF3_ENST00000377135.4_5'Flank|IRF3_ENST00000377139.3_5'Flank|BCL2L12_ENST00000246784.3_Missense_Mutation_p.V55L|IRF3_ENST00000599144.1_5'Flank|IRF3_ENST00000596765.1_5'Flank|IRF3_ENST00000600911.1_5'Flank|IRF3_ENST00000600022.1_5'Flank|IRF3_ENST00000598808.1_5'Flank|IRF3_ENST00000309877.7_5'Flank|IRF3_ENST00000599223.1_5'Flank|IRF3_ENST00000442265.2_5'Flank|IRF3_ENST00000593922.1_5'Flank	NM_001040668.1|NM_138639.1	NP_001035758.1|NP_619580.1	Q9HB09	B2L12_HUMAN	BCL2-like 12 (proline rich)	55					inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	8		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.000681)|GBM - Glioblastoma multiforme(134;0.0214)		GCGCGGGAAAGTTGAACTAAT	0.612																																																	0													19.0	20.0	20.0					19																	50169243		2202	4297	6499	SO:0001583	missense	0			AF289220	CCDS12776.1, CCDS46144.1, CCDS74424.1, CCDS74423.1	19q13.3	2014-03-07				ENSG00000126453			13787	protein-coding gene	gene with protein product		610837					Standard	NM_001040668		Approved		uc002ppa.3	Q9HB09		ENST00000246785.3:c.163G>C	19.37:g.50169243G>C	ENSP00000246785:p.Val55Leu		Q3SY11|Q3SY13|Q96I96|Q9HB08	Missense_Mutation	SNP	NULL	p.V55L	ENST00000246785.3	37	c.163	CCDS12776.1	19	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369250	0.82463	.	.	ENSG00000126453	ENST00000246785;ENST00000441864;ENST00000246784	T;T;T	0.55052	0.75;0.75;0.54	3.42	3.42	0.39159	.	0.355725	0.16549	U	0.209568	T	0.50120	0.1597	N	0.08118	0	0.26679	N	0.971575	D;D	0.61697	0.99;0.99	D;D	0.72625	0.978;0.978	T	0.41875	-0.9484	10	0.87932	D	0	-0.3092	10.6177	0.45460	0.0:0.0:1.0:0.0	.	55;55	Q3SY13;Q9HB09	.;B2L12_HUMAN	L	55	ENSP00000246785:V55L;ENSP00000393803:V55L;ENSP00000246784:V55L	ENSP00000246784:V55L	V	+	1	0	BCL2L12	54861055	0.998000	0.40836	0.999000	0.59377	0.859000	0.49053	2.669000	0.46825	2.237000	0.73441	0.467000	0.42956	GTT	BCL2L12	-	NULL	ENSG00000126453		0.612	BCL2L12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L12	HGNC	protein_coding	OTTHUMT00000465770.1	-	0.00	43	0	G	NM_052842		50169243	+1	tier1	-	no_errors	ENST00000246785	ensembl	human	known	74_37	missense	48.08	27	25	SNP	0.999	C
BDNF	627	genome.wustl.edu	37	11	27678626	27678627	+	3'UTR	INS	-	-	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:27678626_27678627insT	ENST00000525528.1	-	0	2578_2579				BDNF_ENST00000418212.1_3'UTR|BDNF_ENST00000533246.1_3'UTR|BDNF_ENST00000530861.1_3'UTR|BDNF_ENST00000420794.1_3'UTR|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000356660.4_3'UTR|BDNF_ENST00000533131.1_3'UTR|BDNF_ENST00000438929.1_3'UTR|BDNF_ENST00000395980.2_3'UTR|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000525950.1_3'UTR|BDNF_ENST00000584049.1_5'UTR|BDNF_ENST00000395981.3_3'UTR|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000439476.2_3'UTR|BDNF-AS_ENST00000499008.3_RNA|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000395986.2_3'UTR|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000395978.3_3'UTR|BDNF_ENST00000532997.1_3'UTR|BDNF_ENST00000314915.6_3'UTR|BDNF_ENST00000395983.3_3'UTR|BDNF-AS_ENST00000500662.2_RNA|BDNF-AS_ENST00000530313.1_RNA	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						GAGTGTGAGCATTTTTTTGTTC	0.426																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.*742->A	11.37:g.27678633_27678633dupT			A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	RNA	INS	-	NULL	ENST00000525528.1	37	NULL	CCDS7866.1	11																																																																																			BDNF	-	-	ENSG00000176697		0.426	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BDNF	HGNC	protein_coding	OTTHUMT00000388135.1		0.00	11	0	-	NM_170735		27678627	-1	tier1		no_errors	ENST00000584049	ensembl	human	known	74_37	rna	66.67	3	6	INS	0.024:0.026	T
Unknown	0	genome.wustl.edu	37	16	33489973	33489973	+	IGR	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:33489973T>C								RP11-23E10.4 (123160 upstream) : BMS1P8 (7189 downstream)																							TCCTTGGCCTTCTTCATCTTC	0.522																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.33489973T>C				RNA	SNP	-	NULL		37	NULL		16																																																																																			BMS1P8	-	-	ENSG00000260518	0	0.522					BMS1P8	HGNC			-	0.00	40	0	T			33489973	-1	tier1	-	no_errors	ENST00000567036	ensembl	human	known	74_37	rna	20.00	20	5	SNP	1.000	C
BTBD2	55643	genome.wustl.edu	37	19	1990135	1990135	+	Missense_Mutation	SNP	C	C	T	rs36020359		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:1990135C>T	ENST00000255608.4	-	5	872	c.856G>A	c.(856-858)Gtt>Att	p.V286I	AC005306.3_ENST00000587498.1_RNA|AC005306.3_ENST00000588480.1_RNA|BTBD2_ENST00000590646.1_5'Flank	NM_017797.3	NP_060267.2	Q9BX70	BTBD2_HUMAN	BTB (POZ) domain containing 2	286						cytoplasmic mRNA processing body (GO:0000932)				endometrium(5)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)	12		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCGGACAACGGCATTGAAC	0.652																																																	0								C	ILE/VAL	0,4404		0,0,2202	37.0	31.0	33.0		856	4.3	0.0	19	dbSNP_126	33	1,8599	1.2+/-3.3	0,1,4299	no	missense	BTBD2	NM_017797.3	29	0,1,6501	TT,TC,CC		0.0116,0.0,0.0077	benign	286/526	1990135	1,13003	2202	4300	6502	SO:0001583	missense	0			AF355797	CCDS12078.1	19p13.3	2013-10-02			ENSG00000133243	ENSG00000133243		"""BTB/POZ domain containing"""	15504	protein-coding gene	gene with protein product		608531				11179693	Standard	XM_005259593		Approved		uc002lup.1	Q9BX70	OTTHUMG00000180017	ENST00000255608.4:c.856G>A	19.37:g.1990135C>T	ENSP00000255608:p.Val286Ile		O60418|O75248|Q4VBZ1|Q6IAC5|Q7Z5W0|Q96SX8|Q9NPS1|Q9NX81	Missense_Mutation	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.V286I	ENST00000255608.4	37	c.856	CCDS12078.1	19	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140577	0.56936	0.0	1.16E-4	ENSG00000133243	ENST00000255608	T	0.71579	-0.58	4.34	4.34	0.51931	BTB/Kelch-associated (2);	0.061145	0.64402	D	0.000004	T	0.66915	0.2838	L	0.58354	1.805	0.52501	D	0.999956	P	0.35551	0.509	B	0.33568	0.166	T	0.70274	-0.4917	10	0.44086	T	0.13	-21.947	16.0152	0.80434	0.0:1.0:0.0:0.0	rs36020359	286	Q9BX70	BTBD2_HUMAN	I	286	ENSP00000255608:V286I	ENSP00000255608:V286I	V	-	1	0	BTBD2	1941135	1.000000	0.71417	0.036000	0.18154	0.718000	0.41266	7.495000	0.81514	2.257000	0.74773	0.549000	0.68633	GTT	BTBD2	-	pfam_BACK,smart_BACK	ENSG00000133243		0.652	BTBD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD2	HGNC	protein_coding	OTTHUMT00000449300.2	-	0.00	124	0	C			1990135	-1	tier1	rs36020359	no_errors	ENST00000255608	ensembl	human	known	74_37	missense	42.22	52	38	SNP	0.967	T
C10orf71	118461	genome.wustl.edu	37	10	50530604	50530604	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:50530604A>C	ENST00000374144.3	+	3	302	c.14A>C	c.(13-15)aAt>aCt	p.N5T	C10orf71_ENST00000323868.4_Missense_Mutation_p.N5T			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	5										endometrium(1)	1						ATGCAAGGAAATAAGAAGTGC	0.547																																																	0													36.0	37.0	37.0					10																	50530604		2126	4241	6367	SO:0001583	missense	0			AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.14A>C	10.37:g.50530604A>C	ENSP00000363259:p.Asn5Thr		A0AVL8	Missense_Mutation	SNP	NULL	p.N5T	ENST00000374144.3	37	c.14	CCDS44387.1	10	.	.	.	.	.	.	.	.	.	.	A	13.15	2.152194	0.38021	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.18810	2.19;3.32	5.13	1.42	0.22433	.	0.111112	0.39544	N	0.001340	T	0.28632	0.0709	L	0.53249	1.67	0.30329	N	0.786859	D	0.58620	0.983	P	0.54544	0.755	T	0.15723	-1.0427	10	0.72032	D	0.01	.	7.8863	0.29653	0.7492:0.0:0.2508:0.0	.	5	Q711Q0-3	.	T	5	ENSP00000318713:N5T;ENSP00000363259:N5T	ENSP00000318713:N5T	N	+	2	0	C10orf71	50200610	1.000000	0.71417	0.931000	0.37212	0.701000	0.40568	2.794000	0.47853	0.297000	0.22615	0.455000	0.32223	AAT	C10orf71	-	NULL	ENSG00000177354		0.547	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C10orf71	HGNC	protein_coding	OTTHUMT00000047984.2	-	0.00	48	0	A	NM_199459		50530604	+1	tier1	-	no_errors	ENST00000374144	ensembl	human	known	74_37	missense	29.73	26	11	SNP	0.983	C
ACSM6	142827	genome.wustl.edu	37	10	96971633	96971633	+	Splice_Site	SNP	A	A	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:96971633A>T	ENST00000394005.3	+	5	764		c.e5-1		C10orf129_ENST00000341686.3_Splice_Site|C10orf129_ENST00000430183.1_Splice_Site			Q6P461	ACSM6_HUMAN							fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		CTTTCTCTTTAGACGGTGGAT	0.468																																																	0													111.0	99.0	103.0					10																	96971633		2203	4300	6503	SO:0001630	splice_region_variant	0																														ENST00000394005.3:c.756-1A>T	10.37:g.96971633A>T			A4FU95|A4IF38|Q5VZX2|Q6ZTX1	Splice_Site	SNP	-	e5-2	ENST00000394005.3	37	c.756-2	CCDS7440.2	10	.	.	.	.	.	.	.	.	.	.	A	13.17	2.158077	0.38119	.	.	ENSG00000173124	ENST00000539707;ENST00000341686;ENST00000430183;ENST00000394005	.	.	.	1.84	1.84	0.25277	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.7666	0.28982	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C10orf129	96961623	0.993000	0.37304	0.100000	0.21137	0.331000	0.28603	3.867000	0.56047	0.832000	0.34804	0.372000	0.22366	.	C10orf129	-	-	ENSG00000173124		0.468	C10orf129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf129	HGNC	protein_coding	OTTHUMT00000049506.2	-	0.00	59	0	A		Intron	96971633	+1	tier1	-	no_errors	ENST00000341686	ensembl	human	known	74_37	splice_site	19.05	34	8	SNP	0.965	T
C3orf58	205428	genome.wustl.edu	37	3	143697305	143697305	+	Intron	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:143697305C>A	ENST00000315691.3	+	1	1192				C3orf58_ENST00000441925.2_Intron|C3orf58_ENST00000495414.1_Intron|C3orf58_ENST00000493396.1_Intron	NM_173552.3	NP_775823.1	Q8NDZ4	DIA1_HUMAN	chromosome 3 open reading frame 58						cardiac muscle cell proliferation (GO:0060038)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	COPI vesicle coat (GO:0030126)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						TGTTACAAGGCATTTGGATTG	0.328																																																	0																																										SO:0001627	intron_variant	0			AK095161	CCDS3130.1, CCDS46929.1	3q24	2013-12-06			ENSG00000181744	ENSG00000181744			28490	protein-coding gene	gene with protein product	"""deleted in autism 1"", ""hypoxia and Akt induced stem cell factor"""	612200				21283809, 23784961, 24269490	Standard	NM_173552		Approved	MGC33365, DIA1, HASF	uc003evo.3	Q8NDZ4	OTTHUMG00000159380	ENST00000315691.3:c.657+5474C>A	3.37:g.143697305C>A			B2RCF2|B7Z1W3	RNA	SNP	-	NULL	ENST00000315691.3	37	NULL	CCDS3130.1	3																																																																																			C3orf58	-	-	ENSG00000181744		0.328	C3orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf58	HGNC	protein_coding	OTTHUMT00000355038.1	-	0.00	33	0	C	NM_173552		143697305	+1	tier1	-	no_errors	ENST00000491798	ensembl	human	putative	74_37	rna	56.52	10	13	SNP	0.212	A
CABIN1	23523	genome.wustl.edu	37	22	24561508	24561508	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr22:24561508C>T	ENST00000398319.2	+	31	5306	c.4921C>T	c.(4921-4923)Cga>Tga	p.R1641*	CABIN1_ENST00000263119.5_Nonsense_Mutation_p.R1641*|CABIN1_ENST00000405822.2_Nonsense_Mutation_p.R1562*|CABIN1_ENST00000337989.7_Nonsense_Mutation_p.R66*	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1641					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)	p.R1641*(1)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GAAGTATCTGCGAGATGCTGA	0.612																																																	1	Substitution - Nonsense(1)	large_intestine(1)											83.0	59.0	67.0					22																	24561508		2201	4300	6501	SO:0001587	stop_gained	0			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.4921C>T	22.37:g.24561508C>T	ENSP00000381364:p.Arg1641*		G5E9F3|Q6PHY0|Q9Y460	Nonsense_Mutation	SNP	pfam_MEF2_binding,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R1641*	ENST00000398319.2	37	c.4921	CCDS13823.1	22	.	.	.	.	.	.	.	.	.	.	C	38	7.186191	0.98121	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319;ENST00000337989;ENST00000403176	.	.	.	4.47	4.47	0.54385	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.5994	0.84807	0.0:1.0:0.0:0.0	.	.	.	.	X	1641;1562;1641;66;66	.	ENSP00000263119:R1641X	R	+	1	2	CABIN1	22891508	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	4.701000	0.61810	2.240000	0.73641	0.650000	0.86243	CGA	CABIN1	-	NULL	ENSG00000099991		0.612	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	HGNC	protein_coding	OTTHUMT00000320161.2		0.00	26	0	C	NM_012295		24561508	+1			no_errors	ENST00000263119	ensembl	human	known	74_37	nonsense	9.09	20	2	SNP	1.000	T
CALCOCO2	10241	genome.wustl.edu	37	17	46919216	46919216	+	Silent	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:46919216C>T	ENST00000258947.3	+	2	248	c.147C>T	c.(145-147)atC>atT	p.I49I	CALCOCO2_ENST00000416445.2_Silent_p.I49I|CALCOCO2_ENST00000448105.2_Silent_p.I49I|CALCOCO2_ENST00000508679.1_Intron|CALCOCO2_ENST00000509507.1_Silent_p.I49I	NM_001261390.1|NM_001261391.1|NM_001261393.1|NM_001261395.1|NM_005831.4	NP_001248319.1|NP_001248320.1|NP_001248322.1|NP_001248324.1|NP_005822.1	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2	49					response to interferon-gamma (GO:0034341)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	15						AGCATTTCATCCCTCGTCGAA	0.428																																																	0													165.0	147.0	153.0					17																	46919216		2203	4300	6503	SO:0001819	synonymous_variant	0			BC004130	CCDS11538.1, CCDS58558.1, CCDS58559.1, CCDS58560.1, CCDS58561.1	17q21.32	2006-02-09				ENSG00000136436			29912	protein-coding gene	gene with protein product		604587				7540613	Standard	NM_001261390		Approved	MGC17318, NDP52	uc010wlr.3	Q13137		ENST00000258947.3:c.147C>T	17.37:g.46919216C>T			B2RBT0|B4DDC4|B4DDT4|B4DP36|B4E0C0|E7ENK0|E7ETP5|E9PBE5|Q53FQ5|Q53HB5|Q6IBN9|Q9BTF7	Silent	SNP	pfam_CoCoA	p.I49	ENST00000258947.3	37	c.147	CCDS11538.1	17																																																																																			CALCOCO2	-	pfam_CoCoA	ENSG00000136436		0.428	CALCOCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALCOCO2	HGNC	protein_coding	OTTHUMT00000360866.1	-	0.00	66	0	C	NM_005831		46919216	+1	tier1	-	no_errors	ENST00000258947	ensembl	human	known	74_37	silent	20.97	49	13	SNP	0.111	T
CCDC154	645811	genome.wustl.edu	37	16	1485995	1485995	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:1485995G>A	ENST00000389176.3	-	14	1773	c.1607C>T	c.(1606-1608)gCg>gTg	p.A536V	CCDC154_ENST00000409671.1_Missense_Mutation_p.A382V	NM_001143980.1	NP_001137452.1	A6NI56	CC154_HUMAN	coiled-coil domain containing 154	536						endosome (GO:0005768)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)	5						CTGCATCTCCGCGATCTTCCG	0.657																																																	0													46.0	41.0	42.0					16																	1485995		692	1591	2283	SO:0001583	missense	0					16p13.3	2012-12-13			ENSG00000197599	ENSG00000197599			34454	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 29"""	C16orf29			Standard	NM_001143980		Approved	LOC645811	uc010uve.2	A6NI56	OTTHUMG00000154097	ENST00000389176.3:c.1607C>T	16.37:g.1485995G>A	ENSP00000373828:p.Ala536Val		G9JV18	Missense_Mutation	SNP	NULL	p.A536V	ENST00000389176.3	37	c.1607		16	.	.	.	.	.	.	.	.	.	.	G	16.40	3.113864	0.56398	.	.	ENSG00000197599	ENST00000409671;ENST00000389176	.	.	.	4.87	4.87	0.63330	.	0.000000	0.48767	D	0.000168	T	0.56321	0.1977	L	0.32530	0.975	0.32064	N	0.595283	D	0.89917	1.0	D	0.87578	0.998	T	0.61008	-0.7149	9	0.42905	T	0.14	-16.6248	13.3515	0.60605	0.0:0.0:1.0:0.0	.	536	A6NI56	CC154_HUMAN	V	382;536	.	ENSP00000373828:A536V	A	-	2	0	CCDC154	1425996	0.834000	0.29399	0.487000	0.27428	0.207000	0.24258	2.125000	0.42016	2.538000	0.85594	0.491000	0.48974	GCG	CCDC154	-	NULL	ENSG00000197599		0.657	CCDC154-201	KNOWN	basic|appris_candidate_longest	protein_coding	CCDC154	HGNC	protein_coding		-	0.00	121	0	G	NM_001143980		1485995	-1	tier1	-	no_errors	ENST00000389176	ensembl	human	known	74_37	missense	14.29	150	25	SNP	0.696	A
CCDC180	100499483	genome.wustl.edu	37	9	100071871	100071871	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:100071871A>C	ENST00000357054.1	+	17	1729	c.794A>C	c.(793-795)aAc>aCc	p.N265T	CCDC180_ENST00000529487.1_Missense_Mutation_p.N126T|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Missense_Mutation_p.N126T|CCDC180_ENST00000395220.1_Missense_Mutation_p.N265T|CCDC180_ENST00000411667.2_Missense_Mutation_p.N126T|CCDC180_ENST00000460482.2_3'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	265						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											ATCATGGAAAACCCTGTTCTC	0.527																																																	0													87.0	66.0	73.0					9																	100071871		2203	4300	6503	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.794A>C	9.37:g.100071871A>C	ENSP00000349562:p.Asn265Thr		Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.N126T	ENST00000357054.1	37	c.377		9	.	.	.	.	.	.	.	.	.	.	A	12.31	1.900659	0.33535	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T;T	0.26660	2.46;1.72;2.42;2.11;2.42	4.71	4.71	0.59529	.	0.000000	0.41823	D	0.000807	T	0.48429	0.1499	M	0.73598	2.24	0.34540	D	0.710184	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.62946	-0.6746	10	0.49607	T	0.09	-24.4691	10.8908	0.46994	1.0:0.0:0.0:0.0	.	126;265;126;265	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	T	265;265;126;126;149;126	ENSP00000349562:N265T;ENSP00000378646:N265T;ENSP00000364348:N126T;ENSP00000414000:N126T;ENSP00000434727:N126T	ENSP00000349562:N265T	N	+	2	0	C9orf174	99111692	1.000000	0.71417	1.000000	0.80357	0.255000	0.26057	5.050000	0.64251	1.902000	0.55061	0.459000	0.35465	AAC	CCDC180	-	NULL	ENSG00000197816		0.527	CCDC180-201	KNOWN	basic	protein_coding	CCDC180	HGNC	protein_coding		-	0.00	57	0	A	NM_020893		100071871	+1	tier1	-	no_errors	ENST00000375202	ensembl	human	known	74_37	missense	23.53	26	8	SNP	1.000	C
CCDC30	728621	genome.wustl.edu	37	1	42948562	42948563	+	Intron	INS	-	-	A	rs202122677	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:42948562_42948563insA	ENST00000428554.2	+	4	746				CCDC30_ENST00000475614.2_3'UTR			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30							extracellular vesicular exosome (GO:0070062)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						TGGAACATGAGAAAAAAAAAAA	0.366																																																	0																																										SO:0001627	intron_variant	0			AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000428554.2:c.-398+75->A	1.37:g.42948573_42948573dupA			Q14F06|Q5VVM5	RNA	INS	-	NULL	ENST00000428554.2	37	NULL	CCDS30690.1	1																																																																																			CCDC30	-	-	ENSG00000186409		0.366	CCDC30-203	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC30	HGNC	protein_coding			0.00	22	0	-	NM_025030		42948563	+1	tier1		no_errors	ENST00000475614	ensembl	human	known	74_37	rna	21.05	15	4	INS	0.001:0.003	A
CCDC38	120935	genome.wustl.edu	37	12	96310928	96310928	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:96310928G>T	ENST00000344280.3	-	4	840	c.283C>A	c.(283-285)Ccg>Acg	p.P95T	CCDC38_ENST00000549752.1_5'Flank	NM_182496.2	NP_872302.2	Q502W7	CCD38_HUMAN	coiled-coil domain containing 38	95										breast(1)|endometrium(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CTAGGAATCGGAGCAGGACCT	0.383																																																	0													81.0	78.0	79.0					12																	96310928		2203	4300	6503	SO:0001583	missense	0			AK097408	CCDS9056.1	12q23.1	2005-11-02				ENSG00000165972			26843	protein-coding gene	gene with protein product							Standard	NM_182496		Approved	FLJ40089	uc001tek.2	Q502W7	OTTHUMG00000170352	ENST00000344280.3:c.283C>A	12.37:g.96310928G>T	ENSP00000345470:p.Pro95Thr		Q8N835	Missense_Mutation	SNP	NULL	p.P95T	ENST00000344280.3	37	c.283	CCDS9056.1	12	.	.	.	.	.	.	.	.	.	.	G	3.532	-0.095425	0.07010	.	.	ENSG00000165972	ENST00000344280;ENST00000546947	T	0.28069	1.63	5.54	3.63	0.41609	.	0.083607	0.46442	D	0.000288	T	0.16085	0.0387	N	0.14661	0.345	0.19300	N	0.999974	B	0.18166	0.026	B	0.15052	0.012	T	0.18587	-1.0332	10	0.12430	T	0.62	-6.5776	11.3472	0.49567	0.0:0.0:0.6734:0.3266	.	95	Q502W7	CCD38_HUMAN	T	95;55	ENSP00000345470:P95T	ENSP00000345470:P95T	P	-	1	0	CCDC38	94835059	0.094000	0.21725	0.014000	0.15608	0.000000	0.00434	1.208000	0.32345	1.563000	0.49615	-0.175000	0.13238	CCG	CCDC38	-	NULL	ENSG00000165972		0.383	CCDC38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC38	HGNC	protein_coding	OTTHUMT00000408634.1		0.00	125	0	G	NM_182496		96310928	-1			no_errors	ENST00000344280	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.011	T
CCL20	6364	genome.wustl.edu	37	2	228681989	228681989	+	3'UTR	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:228681989A>C	ENST00000358813.4	+	0	539				CCL20_ENST00000473642.1_3'UTR|CCL20_ENST00000409189.3_3'UTR			P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20						cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|chemokinesis (GO:0042466)|chemotaxis (GO:0006935)|defense response to bacterium (GO:0042742)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of T cell migration (GO:2000406)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)			cervix(1)|lung(2)	3		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		CATCACATTAAAGTTAAACTG	0.294																																																	0																																										SO:0001624	3_prime_UTR_variant	0			D86955	CCDS2469.1, CCDS46536.1	2q36.3	2013-02-25	2002-08-22	2002-08-23	ENSG00000115009	ENSG00000115009		"""Chemokine ligands"", ""Endogenous ligands"""	10619	protein-coding gene	gene with protein product		601960	"""small inducible cytokine subfamily A (Cys-Cys), member 20"""	SCYA20		9038201, 11352563	Standard	NM_004591		Approved	LARC, MIP-3a, exodus-1, ST38, CKb4	uc002vpl.2	P78556	OTTHUMG00000133189	ENST00000358813.4:c.*190A>C	2.37:g.228681989A>C			Q53S51|Q99664	RNA	SNP	-	NULL	ENST00000358813.4	37	NULL	CCDS2469.1	2																																																																																			CCL20	-	-	ENSG00000115009		0.294	CCL20-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCL20	HGNC	protein_coding	OTTHUMT00000331641.1	-	0.00	17	0	A	NM_004591		228681989	+1	tier1	-	no_errors	ENST00000473642	ensembl	human	known	74_37	rna	50.00	8	8	SNP	0.000	C
CD1E	913	genome.wustl.edu	37	1	158325955	158325955	+	Intron	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:158325955G>T	ENST00000368167.3	+	4	1143				CD1E_ENST00000444681.2_Intron|CD1E_ENST00000368163.3_Intron|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000368156.1_Intron|CD1E_ENST00000368165.3_Intron|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368160.3_Intron|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000434258.1_Missense_Mutation_p.V320L|CD1E_ENST00000368161.3_Intron|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368157.1_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule						antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					GCTTTTGAGTGTGGGGCTGAG	0.438																																																	0																																										SO:0001627	intron_variant	0			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.904+60G>T	1.37:g.158325955G>T			B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.V320L	ENST00000368167.3	37	c.958	CCDS41417.1	1	.	.	.	.	.	.	.	.	.	.	G	7.748	0.702719	0.15172	.	.	ENSG00000158488	ENST00000434258	T	0.01455	4.87	3.56	1.59	0.23543	.	.	.	.	.	T	0.00412	0.0013	.	.	.	0.09310	N	1	B;B;B	0.10296	0.001;0.001;0.003	B;B;B	0.06405	0.002;0.0;0.001	T	0.41288	-0.9517	7	.	.	.	.	6.0062	0.19547	0.2508:0.0:0.7492:0.0	.	133;223;320	B4E057;B4E042;E7ET31	.;.;.	L	320	ENSP00000401957:V320L	.	V	+	1	0	CD1E	156592579	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.180000	0.09754	0.292000	0.22492	0.563000	0.77884	GTG	CD1E	-	NULL	ENSG00000158488		0.438	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	-	0.00	74	0	G	NM_030893		158325955	+1	tier1	-	no_errors	ENST00000434258	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.001	T
CDH11	1009	genome.wustl.edu	37	16	65022113	65022113	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:65022113A>C	ENST00000268603.4	-	7	1561	c.946T>G	c.(946-948)Ttt>Gtt	p.F316V	CDH11_ENST00000566827.1_Missense_Mutation_p.F190V|CDH11_ENST00000394156.3_Missense_Mutation_p.F316V	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	316	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GTGATTTCAAACGATTCCATA	0.443			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													369.0	309.0	329.0					16																	65022113		2203	4300	6503	SO:0001583	missense	0			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.946T>G	16.37:g.65022113A>C	ENSP00000268603:p.Phe316Val		A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F316V	ENST00000268603.4	37	c.946	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	A	26.7	4.765797	0.90020	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.71817	-0.6;-0.6	5.65	5.65	0.86999	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.86797	0.6019	M	0.89715	3.055	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.995	D	0.89536	0.3789	10	0.87932	D	0	.	15.0511	0.71872	1.0:0.0:0.0:0.0	.	316;316	P55287-2;P55287	.;CAD11_HUMAN	V	316;316;299	ENSP00000268603:F316V;ENSP00000377711:F316V	ENSP00000268603:F316V	F	-	1	0	CDH11	63579614	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.152000	0.67230	0.528000	0.53228	TTT	CDH11	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000140937		0.443	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	-	0.00	55	0	A	NM_033664		65022113	-1	tier1	-	no_errors	ENST00000268603	ensembl	human	known	74_37	missense	65.62	11	21	SNP	1.000	C
CDH11	1009	genome.wustl.edu	37	16	65032509	65032509	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:65032509A>G	ENST00000268603.4	-	4	1094	c.479T>C	c.(478-480)cTg>cCg	p.L160P	CDH11_ENST00000566827.1_Missense_Mutation_p.L34P|CDH11_ENST00000394156.3_Missense_Mutation_p.L160P	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	160	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GGTCTCGTGCAGGAACTCCGG	0.592			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													139.0	121.0	127.0					16																	65032509		2203	4300	6503	SO:0001583	missense	0			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.479T>C	16.37:g.65032509A>G	ENSP00000268603:p.Leu160Pro		A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L160P	ENST00000268603.4	37	c.479	CCDS10803.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.23|12.23	1.876851|1.876851	0.33162|0.33162	.|.	.|.	ENSG00000140937|ENSG00000140937	ENST00000536902|ENST00000268603;ENST00000394156;ENST00000538390	.|T;T	.|0.61158	.|0.22;0.13	5.24|5.24	5.24|5.24	0.73138|0.73138	.|Cadherin (3);Cadherin-like (1);	.|0.068797	.|0.56097	.|D	.|0.000025	T|T	0.45357|0.45357	0.1338|0.1338	N|N	0.25485|0.25485	0.75|0.75	0.80722|0.80722	D|D	1|1	.|B;B	.|0.22480	.|0.07;0.0	.|B;B	.|0.18871	.|0.023;0.002	T|T	0.35500|0.35500	-0.9786|-0.9786	6|10	0.87932|0.37606	D|T	0|0.19	.|.	14.7646|14.7646	0.69629|0.69629	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|160;160	.|P55287-2;P55287	.|.;CAD11_HUMAN	R|P	154|160;160;143	.|ENSP00000268603:L160P;ENSP00000377711:L160P	ENSP00000442264:C154R|ENSP00000268603:L160P	C|L	-|-	1|2	0|0	CDH11|CDH11	63590010|63590010	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	4.222000|4.222000	0.58580|0.58580	2.326000|2.326000	0.78906|0.78906	0.533000|0.533000	0.62120|0.62120	TGC|CTG	CDH11	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000140937		0.592	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	-	0.00	32	0	A	NM_033664		65032509	-1	tier1	-	no_errors	ENST00000268603	ensembl	human	known	74_37	missense	64.29	10	18	SNP	1.000	G
CDH23	64072	genome.wustl.edu	37	10	73501725	73501725	+	Intron	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:73501725G>T	ENST00000224721.6	+	37	4865					NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23						calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						GGCCAGGGCAGCTCCGCCTCC	0.607																																																	0													6.0	7.0	7.0					10																	73501725		2038	4165	6203	SO:0001627	intron_variant	0			AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.4860+47G>T	10.37:g.73501725G>T			C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	RNA	SNP	-	NULL	ENST00000224721.6	37	NULL		10	.	.	.	.	.	.	.	.	.	.	G	7.814	0.716381	0.15306	.	.	ENSG00000107736	ENST00000398792	.	.	.	3.62	1.71	0.24356	.	.	.	.	.	T	0.23451	0.0567	.	.	.	0.24203	N	0.995501	B	0.02656	0.0	B	0.04013	0.001	T	0.21827	-1.0234	6	.	.	.	.	5.4252	0.16421	0.1075:0.0:0.6944:0.1981	.	451	E7ERT0	.	I	451	.	.	S	+	2	0	CDH23	73171731	0.001000	0.12720	0.003000	0.11579	0.002000	0.02628	0.450000	0.21762	0.332000	0.23536	-0.181000	0.13052	AGC	CDH23	-	-	ENSG00000107736		0.607	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	CDH23	HGNC	protein_coding	OTTHUMT00000051227.4	-	0.00	34	0	G	NM_052836		73501725	+1	tier1	-	no_errors	ENST00000398792	ensembl	human	known	74_37	rna	8.33	44	4	SNP	0.014	T
CDH9	1007	genome.wustl.edu	37	5	26902779	26902779	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:26902779G>T	ENST00000231021.4	-	7	1231	c.1059C>A	c.(1057-1059)caC>caA	p.H353Q		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	353	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GTGGATCAGGGTGAGTGTTAC	0.353																																					Melanoma(8;187 585 15745 40864 52829)												0													96.0	94.0	95.0					5																	26902779		2203	4300	6503	SO:0001583	missense	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1059C>A	5.37:g.26902779G>T	ENSP00000231021:p.His353Gln		Q3B7I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.H353Q	ENST00000231021.4	37	c.1059	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	G	15.89	2.965732	0.53507	.	.	ENSG00000113100	ENST00000231021	T	0.37584	1.19	5.62	-4.19	0.03835	Cadherin (4);Cadherin-like (1);	0.100023	0.64402	D	0.000003	T	0.35682	0.0940	M	0.64170	1.965	0.37130	D	0.901222	B	0.27656	0.184	B	0.37144	0.242	T	0.30650	-0.9971	9	.	.	.	.	14.6495	0.68786	0.7384:0.0:0.2616:0.0	.	353	Q9ULB4	CADH9_HUMAN	Q	353	ENSP00000231021:H353Q	.	H	-	3	2	CDH9	26938536	0.003000	0.15002	0.933000	0.37362	0.992000	0.81027	-0.425000	0.07017	-0.720000	0.04935	0.650000	0.86243	CAC	CDH9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113100		0.353	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1		0.00	59	0	G	NM_016279		26902779	-1			no_errors	ENST00000231021	ensembl	human	known	74_37	missense	7.32	37	3	SNP	0.890	T
CDH6	1004	genome.wustl.edu	37	5	31305342	31305342	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:31305342T>G	ENST00000265071.2	+	7	1326	c.1061T>G	c.(1060-1062)gTt>gGt	p.V354G	CDH6_ENST00000514738.1_Missense_Mutation_p.V299G	NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	354	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						AATCCTTATGTTGAGCCACGA	0.458																																																	0													92.0	90.0	91.0					5																	31305342		2203	4300	6503	SO:0001583	missense	0			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.1061T>G	5.37:g.31305342T>G	ENSP00000265071:p.Val354Gly		A8K5H5|Q9BWS0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V354G	ENST00000265071.2	37	c.1061	CCDS3894.1	5	.	.	.	.	.	.	.	.	.	.	T	18.71	3.681590	0.68042	.	.	ENSG00000113361	ENST00000514738;ENST00000265071	T;T	0.36878	1.23;1.23	5.88	4.73	0.59995	Cadherin (4);Cadherin-like (1);	0.528423	0.20511	N	0.090892	T	0.35219	0.0924	L	0.41079	1.255	0.22412	N	0.999122	P;P	0.39940	0.607;0.696	B;B	0.43838	0.395;0.433	T	0.27905	-1.0060	10	0.62326	D	0.03	.	11.3785	0.49743	0.0:0.0702:0.0:0.9298	.	354;354	P55285;P55285-2	CADH6_HUMAN;.	G	299;354	ENSP00000424843:V299G;ENSP00000265071:V354G	ENSP00000265071:V354G	V	+	2	0	CDH6	31341099	0.287000	0.24315	0.020000	0.16555	0.968000	0.65278	3.133000	0.50531	2.243000	0.73865	0.533000	0.62120	GTT	CDH6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113361		0.458	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	HGNC	protein_coding	OTTHUMT00000207355.2	-	0.00	141	0	T	NM_004932		31305342	+1	tier1	-	no_errors	ENST00000265071	ensembl	human	known	74_37	missense	43.30	55	42	SNP	0.016	G
CDPF1	150383	genome.wustl.edu	37	22	46643007	46643007	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr22:46643007C>T	ENST00000314567.3	-	3	648	c.225G>A	c.(223-225)ccG>ccA	p.P75P	CDPF1_ENST00000404744.1_Silent_p.P75P|CDPF1_ENST00000475605.1_Intron|CDPF1_ENST00000404583.1_Intron	NM_207327.4	NP_997210.3	Q6NVV7	CDPF1_HUMAN	cysteine-rich, DPF motif domain containing 1	75																	GCTTACCCACCGGGCCCACAC	0.612																																																	0													61.0	54.0	56.0					22																	46643007		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS33670.1	22q13.31	2012-07-18	2012-07-18	2012-07-18	ENSG00000205643	ENSG00000205643			33710	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 40"""	C22orf40			Standard	NM_207327		Approved	LOC150383	uc003bhe.3	Q6NVV7	OTTHUMG00000030672	ENST00000314567.3:c.225+1G>A	22.37:g.46643007C>T			A6NCA1|A9IU12|A9IU16|Q3ZCR8	Silent	SNP	pfam_Cys-rich_DPF,prints_Cys-rich_DPF	p.P75	ENST00000314567.3	37	c.225	CCDS33670.1	22																																																																																			CDPF1	-	pfam_Cys-rich_DPF,prints_Cys-rich_DPF	ENSG00000205643		0.612	CDPF1-001	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	CDPF1	HGNC	protein_coding	OTTHUMT00000075560.4	-	0.00	38	0	C	NM_207327	Silent	46643007	-1	tier1	-	no_errors	ENST00000381037	ensembl	human	known	74_37	silent	25.49	37	13	SNP	1.000	T
CELSR3	1951	genome.wustl.edu	37	3	48697920	48697920	+	Silent	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:48697920A>C	ENST00000164024.4	-	1	2428	c.2148T>G	c.(2146-2148)cgT>cgG	p.R716R	CELSR3_ENST00000544264.1_Silent_p.R716R	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	716	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCACAGACTCACGGTCCAGGG	0.557																																																	0													65.0	62.0	63.0					3																	48697920		2203	4300	6503	SO:0001819	synonymous_variant	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.2148T>G	3.37:g.48697920A>C			O75092	Silent	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.R716	ENST00000164024.4	37	c.2148	CCDS2775.1	3																																																																																			CELSR3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000008300		0.557	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	-	0.00	52	0	A	NM_001407		48697920	-1	tier1	-	no_errors	ENST00000544264	ensembl	human	known	74_37	silent	26.32	14	5	SNP	0.558	C
CFHR2	3080	genome.wustl.edu	37	1	196875999	196875999	+	Intron	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:196875999G>A	ENST00000367421.3	+	2	135				CFHR4_ENST00000251424.4_Intron|CFHR4_ENST00000367418.2_Intron|CFHR4_ENST00000367416.2_Missense_Mutation_p.D149N|CFHR4_ENST00000608469.1_Intron			P36980	FHR2_HUMAN	complement factor H-related 2							extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						AGAATTTTGTGATATGCCTGT	0.353																																																	0																																										SO:0001627	intron_variant	0			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367421.3:c.59-42586G>A	1.37:g.196875999G>A			Q14310|Q5T9T1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.D149N	ENST00000367421.3	37	c.445		1	.	.	.	.	.	.	.	.	.	.	.	10.02	1.236220	0.22626	.	.	ENSG00000134365	ENST00000367416	T	0.65178	-0.14	2.96	1.01	0.19927	.	.	.	.	.	T	0.59335	0.2186	M	0.80746	2.51	0.09310	N	1	B;D	0.53885	0.256;0.963	B;P	0.44732	0.143;0.459	T	0.50668	-0.8801	9	0.18276	T	0.48	.	5.1508	0.15009	0.2938:0.0:0.7062:0.0	.	149;150	C9J7J7;Q5DVJ7	.;.	N	149	ENSP00000356386:D149N	ENSP00000356386:D149N	D	+	1	0	CFHR4	195142622	0.999000	0.42202	0.017000	0.16124	0.044000	0.14063	3.358000	0.52284	0.146000	0.19002	-0.450000	0.05554	GAT	CFHR4	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP	ENSG00000134365		0.353	CFHR2-201	KNOWN	basic|appris_principal	protein_coding	CFHR4	HGNC	protein_coding		-	0.00	83	0	G	NM_005666		196875999	+1	tier1	-	no_errors	ENST00000367416	ensembl	human	known	74_37	missense	15.12	72	13	SNP	0.076	A
CHST15	51363	genome.wustl.edu	37	10	125805569	125805569	+	Silent	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:125805569A>G	ENST00000346248.5	-	2	802	c.160T>C	c.(160-162)Ttg>Ctg	p.L54L	CHST15_ENST00000435907.1_Silent_p.L54L|CHST15_ENST00000421115.1_Silent_p.L54L|CHST15_ENST00000462406.1_5'UTR	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15	54					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						ACAGCAAGCAAGTTCATCTGC	0.517																																																	0													85.0	74.0	78.0					10																	125805569		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.160T>C	10.37:g.125805569A>G			O60338|O60474|Q86VM4	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.L54	ENST00000346248.5	37	c.160	CCDS7638.1	10																																																																																			CHST15	-	NULL	ENSG00000182022		0.517	CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST15	HGNC	protein_coding	OTTHUMT00000050856.1	-	0.00	68	0	A	NM_015892		125805569	-1	tier1	-	no_errors	ENST00000346248	ensembl	human	known	74_37	silent	35.62	47	26	SNP	1.000	G
CHST9	83539	genome.wustl.edu	37	18	24496569	24496569	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr18:24496569T>G	ENST00000284224.8	-	6	1263	c.986A>C	c.(985-987)aAg>aCg	p.K329T	AQP4-AS1_ENST00000578701.1_RNA|CHST9_ENST00000580774.1_3'UTR|AQP4-AS1_ENST00000568797.1_RNA|AQP4-AS1_ENST00000579964.1_RNA|AQP4-AS1_ENST00000582605.1_RNA|CHST9_ENST00000581714.1_Missense_Mutation_p.K329T	NM_031422.5	NP_113610.2	Q7L1S5	CHST9_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9	329					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|skin(3)	28	all_lung(6;0.0145)|Ovarian(20;0.124)					CTCTTTGAACTTGACTCCAGA	0.418																																																	0													142.0	137.0	138.0					18																	24496569		1904	4110	6014	SO:0001583	missense	0			AF239821	CCDS42422.1, CCDS58618.1	18q11.2	2011-04-28			ENSG00000154080	ENSG00000154080		"""Sulfotransferases, membrane-bound"""	19898	protein-coding gene	gene with protein product		610191				11139592, 11445554	Standard	NM_031422		Approved	GALNAC4ST-2, GALNAC-4-ST2	uc002kwe.4	Q7L1S5		ENST00000284224.8:c.986A>C	18.37:g.24496569T>G	ENSP00000284224:p.Lys329Thr		Q6UX69|Q9BXH3|Q9BXH4|Q9BZW9	Missense_Mutation	SNP	pfam_Sulfotransferase	p.K329T	ENST00000284224.8	37	c.986	CCDS42422.1	18	.	.	.	.	.	.	.	.	.	.	T	1.575	-0.533017	0.04112	.	.	ENSG00000154080	ENST00000284224	T	0.72615	-0.67	6.17	2.49	0.30216	.	0.214382	0.41938	D	0.000787	T	0.43986	0.1272	N	0.02158	-0.66	0.80722	D	1	B	0.09022	0.002	B	0.17098	0.017	T	0.11616	-1.0580	10	0.31617	T	0.26	-12.2193	13.2521	0.60057	0.0:0.1491:0.0:0.8509	.	329	Q7L1S5	CHST9_HUMAN	T	329	ENSP00000284224:K329T	ENSP00000284224:K329T	K	-	2	0	CHST9	22750567	0.999000	0.42202	0.993000	0.49108	0.700000	0.40528	1.620000	0.36976	-0.021000	0.14009	-1.715000	0.00711	AAG	CHST9	-	pfam_Sulfotransferase	ENSG00000154080		0.418	CHST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST9	HGNC	protein_coding	OTTHUMT00000446549.1	-	0.00	57	0	T	NM_031422		24496569	-1	tier1	-	no_errors	ENST00000284224	ensembl	human	known	74_37	missense	35.90	25	14	SNP	0.769	G
CHSY3	337876	genome.wustl.edu	37	5	129520931	129520931	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:129520931T>G	ENST00000305031.4	+	3	2454	c.2096T>G	c.(2095-2097)cTt>cGt	p.L699R		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	699					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		TCCAGAGGTCTTGGTCTTGAA	0.433																																																	0													88.0	83.0	84.0					5																	129520931		2203	4300	6503	SO:0001583	missense	0			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.2096T>G	5.37:g.129520931T>G	ENSP00000302629:p.Leu699Arg		B2RP97|Q76L22|Q86Y52	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.L699R	ENST00000305031.4	37	c.2096	CCDS34223.1	5	.	.	.	.	.	.	.	.	.	.	T	16.27	3.076978	0.55753	.	.	ENSG00000198108	ENST00000305031	T	0.31510	1.49	4.33	4.33	0.51752	.	0.000000	0.44688	D	0.000433	T	0.26846	0.0657	L	0.37507	1.11	0.58432	D	0.999999	P	0.42123	0.771	B	0.41135	0.348	T	0.03166	-1.1065	9	.	.	.	-4.8226	14.5729	0.68224	0.0:0.0:0.0:1.0	.	699	Q70JA7	CHSS3_HUMAN	R	699	ENSP00000302629:L699R	.	L	+	2	0	CHSY3	129548830	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.087000	0.71362	2.171000	0.68590	0.528000	0.53228	CTT	CHSY3	-	pfam_Chond_GalNAc	ENSG00000198108		0.433	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY3	HGNC	protein_coding	OTTHUMT00000371453.1	-	0.00	28	0	T	NM_175856		129520931	+1	tier1	-	no_errors	ENST00000305031	ensembl	human	known	74_37	missense	33.33	10	5	SNP	1.000	G
CLEC6A	93978	genome.wustl.edu	37	12	8629933	8629933	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:8629933A>T	ENST00000382073.3	+	6	689	c.503A>T	c.(502-504)gAg>gTg	p.E168V		NM_001007033.1	NP_001007034.1	Q6EIG7	CLC6A_HUMAN	C-type lectin domain family 6, member A	168	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|large_intestine(2)|lung(7)	10	Lung SC(5;0.184)					CACCTAGGTGAGCCCAATCAT	0.388																																																	0													155.0	146.0	149.0					12																	8629933		2203	4300	6503	SO:0001583	missense	0			AY321309	CCDS31739.1	12p13	2005-09-21	2005-02-09	2005-02-11	ENSG00000205846	ENSG00000205846		"""C-type lectin domain containing"""	14556	protein-coding gene	gene with protein product		613579	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 10"""	CLECSF10			Standard	NM_001007033		Approved	dectin-2	uc001qum.1	Q6EIG7	OTTHUMG00000168672	ENST00000382073.3:c.503A>T	12.37:g.8629933A>T	ENSP00000371505:p.Glu168Val		A2RUK3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.E168V	ENST00000382073.3	37	c.503	CCDS31739.1	12	.	.	.	.	.	.	.	.	.	.	A	11.40	1.626553	0.28978	.	.	ENSG00000205846	ENST00000382073	T	0.21543	2.0	3.39	3.39	0.38822	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.35970	N	0.002873	T	0.50973	0.1647	M	0.92507	3.315	0.41129	D	0.985878	D	0.89917	1.0	D	0.91635	0.999	T	0.59627	-0.7419	10	0.87932	D	0	.	8.5056	0.33186	1.0:0.0:0.0:0.0	.	168	Q6EIG7	CLC6A_HUMAN	V	168	ENSP00000371505:E168V	ENSP00000371505:E168V	E	+	2	0	CLEC6A	8521200	0.403000	0.25319	0.794000	0.32065	0.007000	0.05969	2.466000	0.45084	1.784000	0.52394	0.533000	0.62120	GAG	CLEC6A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000205846		0.388	CLEC6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC6A	HGNC	protein_coding	OTTHUMT00000400562.1	-	0.00	93	0	A	NM_001007033		8629933	+1	tier1	-	no_errors	ENST00000382073	ensembl	human	known	74_37	missense	40.68	35	24	SNP	0.819	T
CNNM2	54805	genome.wustl.edu	37	10	104828465	104828465	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:104828465delT	ENST00000369878.4	+	5	2341	c.2153delT	c.(2152-2154)ctgfs	p.L718fs	CNNM2_ENST00000433628.2_Frame_Shift_Del_p.L718fs|CNNM2_ENST00000475511.1_3'UTR	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	718					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GTGATGGCCCTGACAGCCTCT	0.522																																																	0													68.0	70.0	69.0					10																	104828465		1975	4162	6137	SO:0001589	frameshift_variant	0			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.2153delT	10.37:g.104828465delT	ENSP00000358894:p.Leu718fs		Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Frame_Shift_Del	DEL	pfam_DUF21,superfamily_cNMP-bd-like	p.L718fs	ENST00000369878.4	37	c.2153	CCDS44474.1	10																																																																																			CNNM2	-	superfamily_cNMP-bd-like	ENSG00000148842		0.522	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3		0.00	57	0	T	NM_017649		104828465	+1	tier1		no_errors	ENST00000369878	ensembl	human	known	74_37	frame_shift_del	11.11	16	2	DEL	1.000	-
CNOT1	23019	genome.wustl.edu	37	16	58585583	58585583	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:58585583G>T	ENST00000317147.5	-	23	3443	c.3111C>A	c.(3109-3111)agC>agA	p.S1037R	CNOT1_ENST00000569240.1_Missense_Mutation_p.S1032R|CNOT1_ENST00000245138.4_5'Flank|CNOT1_ENST00000569732.1_5'UTR|CNOT1_ENST00000441024.2_Missense_Mutation_p.S1037R	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1037					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		TTACCATAGTGCTAACTTGAC	0.498																																																	0													147.0	137.0	140.0					16																	58585583		2198	4300	6498	SO:0001583	missense	0			AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.3111C>A	16.37:g.58585583G>T	ENSP00000320949:p.Ser1037Arg		Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	pfam_CCR4-Not_Not1_C,superfamily_ARM-type_fold	p.S1037R	ENST00000317147.5	37	c.3111	CCDS10799.1	16	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286274	0.80803	.	.	ENSG00000125107	ENST00000317147;ENST00000422872;ENST00000394200;ENST00000441024	T;T	0.46819	0.88;0.86	5.41	5.41	0.78517	.	0.037076	0.85682	D	0.000000	T	0.50446	0.1616	N	0.14661	0.345	0.80722	D	1	B;P;D	0.67145	0.13;0.766;0.996	B;B;D	0.66497	0.075;0.243;0.944	T	0.44544	-0.9321	10	0.17832	T	0.49	.	19.189	0.93656	0.0:0.0:1.0:0.0	.	1037;1037;1032	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	R	1037;466;1032;1037	ENSP00000320949:S1037R;ENSP00000413113:S1037R	ENSP00000320949:S1037R	S	-	3	2	CNOT1	57143084	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.930000	0.63462	2.540000	0.85666	0.563000	0.77884	AGC	CNOT1	-	NULL	ENSG00000125107		0.498	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNOT1	HGNC	protein_coding	OTTHUMT00000257385.3		0.00	49	0	G	NM_016284		58585583	-1			no_errors	ENST00000317147	ensembl	human	known	74_37	missense	8.82	31	3	SNP	1.000	T
COL21A1	81578	genome.wustl.edu	37	6	55926451	55926451	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:55926451C>T	ENST00000244728.5	-	25	2598	c.2201G>A	c.(2200-2202)gGa>gAa	p.G734E	COL21A1_ENST00000370819.1_Missense_Mutation_p.G731E|COL21A1_ENST00000535941.1_Missense_Mutation_p.G734E|COL21A1_ENST00000370808.2_Missense_Mutation_p.G134E|COL21A1_ENST00000467045.1_5'UTR	NM_030820.3	NP_110447.2	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1	734	Collagen-like 5.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|prostate(2)	41	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			ACATACCTCTCCTTTTGCACC	0.338																																																	0													59.0	58.0	58.0					6																	55926451		1814	4075	5889	SO:0001583	missense	0			AF330693	CCDS55025.1	6p12.3-p11.2	2013-01-16			ENSG00000124749	ENSG00000124749		"""Collagens"""	17025	protein-coding gene	gene with protein product		610002				11566190	Standard	XR_241922		Approved		uc003pcs.3	Q96P44	OTTHUMG00000014907	ENST00000244728.5:c.2201G>A	6.37:g.55926451C>T	ENSP00000244728:p.Gly734Glu		A6NIX5|B2R8J9|Q49A51|Q71RF4|Q8WXV8|Q9H0V3	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.G734E	ENST00000244728.5	37	c.2201	CCDS55025.1	6	.	.	.	.	.	.	.	.	.	.	C	14.76	2.630808	0.46944	.	.	ENSG00000124749	ENST00000244728;ENST00000370819;ENST00000535941;ENST00000370811;ENST00000370808	D;D;D;D	0.99488	-6.0;-6.0;-6.0;-6.0	5.46	5.46	0.80206	.	0.000000	0.56097	D	0.000037	D	0.99739	0.9897	H	0.96970	3.915	0.51767	D	0.99993	D;D;D	0.89917	0.979;0.983;1.0	P;P;D	0.97110	0.74;0.831;1.0	D	0.97324	0.9946	10	0.87932	D	0	.	16.0328	0.80593	0.0:1.0:0.0:0.0	.	134;734;734	Q96P44-2;B7ZLK3;Q96P44	.;.;COLA1_HUMAN	E	734;731;734;731;134	ENSP00000244728:G734E;ENSP00000359855:G731E;ENSP00000444384:G734E;ENSP00000359844:G134E	ENSP00000244728:G734E	G	-	2	0	COL21A1	56034410	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	3.807000	0.55591	2.568000	0.86640	0.579000	0.79373	GGA	COL21A1	-	pfam_Collagen	ENSG00000124749		0.338	COL21A1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	COL21A1	HGNC	protein_coding	OTTHUMT00000041004.2		0.00	97	0	C			55926451	-1			no_errors	ENST00000244728	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	T
COL5A1	1289	genome.wustl.edu	37	9	137700837	137700837	+	Intron	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:137700837A>C	ENST00000371817.3	+	43	3780					NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1						axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		atgcaccagaagttcatggtc	0.542																																																	0																																										SO:0001627	intron_variant	0			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.3367-192A>C	9.37:g.137700837A>C			Q15094|Q5SUX4	RNA	SNP	-	NULL	ENST00000371817.3	37	NULL	CCDS6982.1	9																																																																																			COL5A1	-	-	ENSG00000130635		0.542	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2	-	0.00	15	0	A	NM_000093		137700837	+1	tier1	-	no_errors	ENST00000463925	ensembl	human	putative	74_37	rna	62.50	6	10	SNP	0.001	C
COX20	116228	genome.wustl.edu	37	1	245005261	245005261	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:245005261G>A	ENST00000411948.2	+	2	451	c.58G>A	c.(58-60)Gga>Aga	p.G20R	COX20_ENST00000498262.1_3'UTR|COX20_ENST00000366528.3_Missense_Mutation_p.G32R	NM_198076.4	NP_932342.1	Q5RI15	COX20_HUMAN	COX20 cytochrome C oxidase assembly factor	20						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)											TAAGCTCCTAGGATTTTTAGA	0.373																																																	0													68.0	62.0	64.0					1																	245005261		2203	4300	6503	SO:0001583	missense	0			BC062419	CCDS31080.1	1q44	2013-05-24	2013-05-23	2012-02-24	ENSG00000203667	ENSG00000203667		"""Mitochondrial respiratory chain complex assembly factors"""	26970	protein-coding gene	gene with protein product		614698	"""family with sequence similarity 36, member A"", ""COX20 Cox2 chaperone homolog (S. cerevisiae)"""	FAM36A		22356826, 23125284	Standard	NM_198076		Approved	FLJ43269	uc001iar.3	Q5RI15	OTTHUMG00000040401	ENST00000411948.2:c.58G>A	1.37:g.245005261G>A	ENSP00000406327:p.Gly20Arg		Q8WV86	Missense_Mutation	SNP	pfam_Cox20/FAM36A,prints_FAM36A	p.G20R	ENST00000411948.2	37	c.58	CCDS31080.1	1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.889218	0.91889	.	.	ENSG00000203667	ENST00000411948;ENST00000366528	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	D	0.84946	0.5585	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85820	0.1385	9	0.72032	D	0.01	-26.7066	20.4024	0.99000	0.0:0.0:1.0:0.0	.	20	Q5RI15	FA36A_HUMAN	R	20;32	.	ENSP00000355486:G32R	G	+	1	0	FAM36A	243071884	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.601000	0.82783	2.827000	0.97445	0.650000	0.86243	GGA	COX20	-	pfam_Cox20/FAM36A	ENSG00000203667		0.373	COX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX20	HGNC	protein_coding	OTTHUMT00000097174.1	-	0.00	127	0	G	NM_198076		245005261	+1	tier1	-	no_errors	ENST00000411948	ensembl	human	known	74_37	missense	11.92	133	18	SNP	1.000	A
CPM	1368	genome.wustl.edu	37	12	69252767	69252767	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:69252767G>A	ENST00000551568.1	-	8	1085	c.1025C>T	c.(1024-1026)cCc>cTc	p.P342L	CPM_ENST00000338356.3_Missense_Mutation_p.P342L|CPM_ENST00000546373.1_Missense_Mutation_p.P342L	NM_001005502.2|NM_198320.3	NP_001005502.1|NP_938079.1	P14384	CBPM_HUMAN	carboxypeptidase M	342					anatomical structure morphogenesis (GO:0009653)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(6)|prostate(2)	9	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			GGTTCTATAGGGGCAGATATG	0.333																																																	0													106.0	104.0	104.0					12																	69252767		2203	4299	6502	SO:0001583	missense	0			AF368463	CCDS8987.1	12q15	2012-02-10			ENSG00000135678	ENSG00000135678	3.4.17.12		2311	protein-coding gene	gene with protein product	"""renal carboxypeptidase"", ""urinary carboxypeptidase B"""	114860				8586455	Standard	NM_001874		Approved		uc001suq.3	P14384	OTTHUMG00000169300	ENST00000551568.1:c.1025C>T	12.37:g.69252767G>A	ENSP00000448517:p.Pro342Leu		B2R800|Q9H2K9	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Aste_AspA,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.P342L	ENST00000551568.1	37	c.1025	CCDS8987.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.1|25.1	4.601122|4.601122	0.87055|0.87055	.|.	.|.	ENSG00000135678|ENSG00000135678	ENST00000551568;ENST00000338356;ENST00000546373|ENST00000551897	T;T;T|T	0.42513|0.38401	0.97;0.97;0.97|1.14	5.51|5.51	5.51|5.51	0.81932|0.81932	Peptidase M14, carboxypeptidase A (1);Carboxypeptidase-like, regulatory domain (1);Carboxypeptidase, regulatory domain (1);|.	0.053425|0.053425	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.57125|0.57125	0.2032|0.2032	M|M	0.71036|0.71036	2.16|2.16	0.80722|0.80722	D|D	1|1	P|.	0.48834|.	0.916|.	P|.	0.57720|.	0.826|.	T|T	0.52480|0.52480	-0.8570|-0.8570	9|7	.|.	.|.	.|.	-16.281|-16.281	19.4019|19.4019	0.94634|0.94634	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	342|.	P14384|.	CBPM_HUMAN|.	L|S	342|145	ENSP00000448517:P342L;ENSP00000339157:P342L;ENSP00000447255:P342L|ENSP00000447455:P145S	.|.	P|P	-|-	2|1	0|0	CPM|CPM	67539034|67539034	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.902000|0.902000	0.53008|0.53008	8.477000|8.477000	0.90424|0.90424	2.765000|2.765000	0.95021|0.95021	0.557000|0.557000	0.71058|0.71058	CCC|CCT	CPM	-	superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14	ENSG00000135678		0.333	CPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPM	HGNC	protein_coding	OTTHUMT00000403355.1	-	0.00	101	0	G	NM_198320		69252767	-1	tier1	-	no_errors	ENST00000338356	ensembl	human	known	74_37	missense	8.84	536	52	SNP	1.000	A
CRAT	1384	genome.wustl.edu	37	9	131860909	131860909	+	Missense_Mutation	SNP	C	C	T	rs527857954		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:131860909C>T	ENST00000318080.2	-	9	1400	c.1106G>A	c.(1105-1107)cGg>cAg	p.R369Q	RP11-247A12.1_ENST00000434250.1_RNA	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	369					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	CAGGGGAGACCGCACAAGCTC	0.607													C|||	1	0.000199681	0.0	0.0	5008	,	,		16667	0.0		0.0	False		,,,				2504	0.001																0													124.0	109.0	114.0					9																	131860909		2203	4300	6503	SO:0001583	missense	0			X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.1106G>A	9.37:g.131860909C>T	ENSP00000315013:p.Arg369Gln		Q5T952|Q9BW16	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.R369Q	ENST00000318080.2	37	c.1106	CCDS6919.1	9	.	.	.	.	.	.	.	.	.	.	C	13.76	2.332541	0.41297	.	.	ENSG00000095321	ENST00000351352;ENST00000318080	T	0.42513	0.97	5.13	4.2	0.49525	.	0.056122	0.64402	D	0.000002	T	0.26666	0.0652	L	0.28192	0.835	0.53005	D	0.999969	B	0.20459	0.045	B	0.08055	0.003	T	0.06267	-1.0836	10	0.17832	T	0.49	-40.4196	9.9537	0.41653	0.0:0.7815:0.1408:0.0776	.	369	P43155	CACP_HUMAN	Q	288;369	ENSP00000315013:R369Q	ENSP00000315013:R369Q	R	-	2	0	CRAT	130900730	0.020000	0.18652	0.829000	0.32907	0.782000	0.44232	1.726000	0.38085	1.331000	0.45412	0.561000	0.74099	CGG	CRAT	-	pfam_Carn_acyl_trans	ENSG00000095321		0.607	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAT	HGNC	protein_coding	OTTHUMT00000253700.1	-	0.00	35	0	C			131860909	-1	tier1	-	no_errors	ENST00000318080	ensembl	human	known	74_37	missense	28.57	15	6	SNP	0.740	T
CSMD3	114788	genome.wustl.edu	37	8	113358340	113358340	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr8:113358340A>G	ENST00000297405.5	-	41	6672	c.6428T>C	c.(6427-6429)cTa>cCa	p.L2143P	CSMD3_ENST00000455883.2_Missense_Mutation_p.L2039P|CSMD3_ENST00000352409.3_Missense_Mutation_p.L2073P|CSMD3_ENST00000343508.3_Missense_Mutation_p.L2103P	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2143	CUB 12. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ACCTATGGGTAGATTTATTGT	0.363										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													104.0	108.0	107.0					8																	113358340		2203	4300	6503	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6428T>C	8.37:g.113358340A>G	ENSP00000297405:p.Leu2143Pro		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.L2143P	ENST00000297405.5	37	c.6428	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	A	18.09	3.547154	0.65311	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58	5.39	5.39	0.77823	CUB (5);	0.000000	0.52532	D	0.000062	T	0.52041	0.1710	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.97110	1.0;0.992;0.997	T	0.44559	-0.9320	10	0.30854	T	0.27	.	15.5781	0.76408	1.0:0.0:0.0:0.0	.	2039;2143;2103	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	P	2103;2143;1413;2039;2073	ENSP00000345799:L2103P;ENSP00000297405:L2143P;ENSP00000341558:L1413P;ENSP00000412263:L2039P;ENSP00000343124:L2073P	ENSP00000297405:L2143P	L	-	2	0	CSMD3	113427516	0.996000	0.38824	0.993000	0.49108	0.539000	0.34962	9.097000	0.94193	2.260000	0.74910	0.528000	0.53228	CTA	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.363	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	46	0	A	NM_052900		113358340	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	38.78	30	19	SNP	1.000	G
CTBP2	1488	genome.wustl.edu	37	10	126682492	126682492	+	Silent	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:126682492T>C	ENST00000337195.5	-	8	1242	c.843A>G	c.(841-843)ttA>ttG	p.L281L	CTBP2_ENST00000309035.6_Silent_p.L821L|CTBP2_ENST00000411419.2_Silent_p.L281L|CTBP2_ENST00000334808.6_Silent_p.L349L|CTBP2_ENST00000494626.2_Silent_p.L281L|CTBP2_ENST00000531469.1_Silent_p.L281L	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2	281					negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		GGGCTTGTGCTAAGGCTTTCT	0.617																																																	0													92.0	95.0	94.0					10																	126682492		2203	4300	6503	SO:0001819	synonymous_variant	0			AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.843A>G	10.37:g.126682492T>C			A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Silent	SNP	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom	p.L821	ENST00000337195.5	37	c.2463	CCDS7643.1	10																																																																																			CTBP2	-	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom	ENSG00000175029		0.617	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTBP2	HGNC	protein_coding	OTTHUMT00000050900.3	-	0.00	34	0	T	NM_001083914		126682492	-1	tier1	-	no_errors	ENST00000309035	ensembl	human	known	74_37	silent	40.00	18	12	SNP	0.991	C
CTNNA1	1495	genome.wustl.edu	37	5	138221961	138221961	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:138221961A>G	ENST00000302763.7	+	8	1213	c.1123A>G	c.(1123-1125)Acc>Gcc	p.T375A	CTNNA1_ENST00000355078.5_Missense_Mutation_p.T272A|CTNNA1_ENST00000540387.1_Missense_Mutation_p.T5A|CTNNA1_ENST00000520400.1_3'UTR|CTNNA1_ENST00000518825.1_Missense_Mutation_p.T375A	NM_001903.2	NP_001894.2	P35221	CTNA1_HUMAN	catenin (cadherin-associated protein), alpha 1, 102kDa	375	Interaction with alpha-actinin.				adherens junction organization (GO:0034332)|aging (GO:0007568)|apical junction assembly (GO:0043297)|axon regeneration (GO:0031103)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular protein localization (GO:0034613)|cellular response to indole-3-methanol (GO:0071681)|epithelial cell-cell adhesion (GO:0090136)|establishment or maintenance of cell polarity (GO:0007163)|gap junction assembly (GO:0016264)|male gonad development (GO:0008584)|muscle cell differentiation (GO:0042692)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell motility (GO:2000146)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|negative regulation of neuroblast proliferation (GO:0007406)|odontogenesis of dentin-containing tooth (GO:0042475)|ovarian follicle development (GO:0001541)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of smoothened signaling pathway (GO:0045880)|protein heterooligomerization (GO:0051291)|response to estrogen (GO:0043627)	acrosomal vesicle (GO:0001669)|actin cytoskeleton (GO:0015629)|catenin complex (GO:0016342)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|zonula adherens (GO:0005915)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|gamma-catenin binding (GO:0045295)|poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)|vinculin binding (GO:0017166)			NS(1)|breast(7)|cervix(2)|endometrium(4)|kidney(6)|large_intestine(16)|lung(9)|oesophagus(2)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	52			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GACCAAGAAGACCAGGGACTT	0.363																																																	0													145.0	154.0	151.0					5																	138221961		2203	4300	6503	SO:0001583	missense	0			D13866	CCDS34243.1, CCDS75315.1	5q31.2	2008-02-05	2002-08-29			ENSG00000044115			2509	protein-coding gene	gene with protein product		116805	"""catenin (cadherin-associated protein), alpha 1 (102kD)"""			1924379	Standard	XM_005271898		Approved	CAP102	uc003ldh.3	P35221		ENST00000302763.7:c.1123A>G	5.37:g.138221961A>G	ENSP00000304669:p.Thr375Ala		Q12795|Q8N1C0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.T375A	ENST00000302763.7	37	c.1123	CCDS34243.1	5	.	.	.	.	.	.	.	.	.	.	A	19.14	3.769816	0.69992	.	.	ENSG00000044115	ENST00000355078;ENST00000302763;ENST00000537034;ENST00000541863;ENST00000518825;ENST00000518381;ENST00000522013;ENST00000520260;ENST00000523298;ENST00000520865;ENST00000519634;ENST00000517533;ENST00000523685;ENST00000519768;ENST00000517656;ENST00000521683;ENST00000521640;ENST00000519116;ENST00000540387;ENST00000520522	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.40756	1.02;1.02;1.02;1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.40862	0.1134	L	0.55017	1.72	0.80722	D	1	B;B;B	0.27732	0.187;0.06;0.016	B;B;B	0.31495	0.131;0.078;0.093	T	0.22138	-1.0225	10	0.16420	T	0.52	-18.8373	15.6152	0.76760	1.0:0.0:0.0:0.0	.	375;252;375	G3XAM7;B4DKT9;P35221	.;.;CTNA1_HUMAN	A	272;375;375;360;375;5;5;5;5;5;5;5;5;5;5;5;5;5;5;5	ENSP00000347190:T272A;ENSP00000304669:T375A;ENSP00000427821:T375A;ENSP00000429738:T5A;ENSP00000430379:T5A;ENSP00000429569:T5A;ENSP00000428044:T5A;ENSP00000430841:T5A;ENSP00000428088:T5A;ENSP00000431118:T5A;ENSP00000430240:T5A;ENSP00000430177:T5A;ENSP00000430981:T5A;ENSP00000430623:T5A;ENSP00000428894:T5A;ENSP00000438476:T5A;ENSP00000428710:T5A	ENSP00000304669:T375A	T	+	1	0	CTNNA1	138249860	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.288000	0.96055	2.170000	0.68504	0.460000	0.39030	ACC	CTNNA1	-	pfam_Vinculin/catenin,prints_Alpha_catenin	ENSG00000044115		0.363	CTNNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA1	HGNC	protein_coding	OTTHUMT00000373868.1	-	0.00	62	0	A	NM_001903		138221961	+1	tier1	-	no_errors	ENST00000302763	ensembl	human	known	74_37	missense	26.79	41	15	SNP	1.000	G
CYLC1	1538	genome.wustl.edu	37	X	83129079	83129079	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:83129079A>C	ENST00000329312.4	+	4	1400	c.1363A>C	c.(1363-1365)Aaa>Caa	p.K455Q		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	455					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						GGGAGATTCAAAAAAGGGTAA	0.333																																																	0													28.0	24.0	26.0					X																	83129079		2201	4296	6497	SO:0001583	missense	0			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.1363A>C	X.37:g.83129079A>C	ENSP00000331556:p.Lys455Gln		A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	NULL	p.K455Q	ENST00000329312.4	37	c.1363	CCDS35341.1	X	.	.	.	.	.	.	.	.	.	.	a	8.555	0.876443	0.17395	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.26810	1.71	3.56	2.38	0.29361	.	.	.	.	.	T	0.38612	0.1047	M	0.76574	2.34	0.09310	N	1	D;D	0.63046	0.992;0.992	P;P	0.55824	0.785;0.785	T	0.16070	-1.0415	9	0.49607	T	0.09	-7.382	4.9574	0.14048	0.8579:0.0:0.1421:0.0	.	455;455	P35663;F5H4V5	CYLC1_HUMAN;.	Q	455	ENSP00000331556:K455Q	ENSP00000331556:K455Q	K	+	1	0	CYLC1	83015735	0.577000	0.26708	0.007000	0.13788	0.086000	0.17979	2.306000	0.43673	0.562000	0.29204	0.486000	0.48141	AAA	CYLC1	-	NULL	ENSG00000183035		0.333	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYLC1	HGNC	protein_coding	OTTHUMT00000057371.1	-	0.00	35	0	A	NM_021118		83129079	+1	tier1	-	no_errors	ENST00000329312	ensembl	human	known	74_37	missense	77.27	5	17	SNP	0.054	C
CYTH2	9266	genome.wustl.edu	37	19	48978119	48978119	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:48978119G>T	ENST00000452733.2	+	8	1197	c.721G>T	c.(721-723)Gag>Tag	p.E241*	CYTH2_ENST00000427476.1_Nonsense_Mutation_p.E241*			Q99418	CYH2_HUMAN	cytohesin 2	241					actin cytoskeleton organization (GO:0030036)|endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|inositol 1,4,5 trisphosphate binding (GO:0070679)|lipid binding (GO:0008289)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						CATCCGAAATGAGCCCTTCAA	0.612																																																	0													149.0	124.0	132.0					19																	48978119		2203	4300	6503	SO:0001587	stop_gained	0			X99753	CCDS12722.1	19q13.32	2014-05-02	2008-08-14	2008-08-14	ENSG00000105443	ENSG00000105443		"""Pleckstrin homology (PH) domain containing"""	9502	protein-coding gene	gene with protein product		602488	"""pleckstrin homology, Sec7 and coiled/coil domains 2 (cytohesin-2)"", ""pleckstrin homology, Sec7 and coiled-coil domains 2"""	PSCD2L, PSCD2		8706128, 8945478, 20525696	Standard	NM_004228		Approved	CTS18.1, Sec7p-L, ARNO, Sec7p-like, cytohesin-2	uc002pjj.4	Q99418	OTTHUMG00000150245	ENST00000452733.2:c.721G>T	19.37:g.48978119G>T	ENSP00000408236:p.Glu241*		A8K8P0|Q8IXY9|Q92958	Nonsense_Mutation	SNP	pfam_Sec7_dom,pfam_Pleckstrin_homology,superfamily_Sec7_dom,smart_Sec7_dom,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7_dom	p.E241*	ENST00000452733.2	37	c.721	CCDS12722.1	19	.	.	.	.	.	.	.	.	.	.	G	39	7.624629	0.98396	.	.	ENSG00000105443	ENST00000452733;ENST00000427476	.	.	.	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	14.7596	0.69596	0.0:0.0:1.0:0.0	.	.	.	.	X	241	.	ENSP00000375753:E241X	E	+	1	0	CYTH2	53669931	1.000000	0.71417	0.963000	0.40424	0.991000	0.79684	9.648000	0.98483	2.421000	0.82119	0.491000	0.48974	GAG	CYTH2	-	pfam_Sec7_dom,superfamily_Sec7_dom,smart_Sec7_dom,pfscan_Sec7_dom	ENSG00000105443		0.612	CYTH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYTH2	HGNC	protein_coding	OTTHUMT00000317060.1	-	0.00	71	0	G	NM_004228		48978119	+1	tier1	-	no_errors	ENST00000427476	ensembl	human	known	74_37	nonsense	32.08	36	17	SNP	1.000	T
DACH1	1602	genome.wustl.edu	37	13	72147054	72147054	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr13:72147054T>C	ENST00000359684.2	-	5	1378	c.1379A>G	c.(1378-1380)aAc>aGc	p.N460S	DACH1_ENST00000354591.4_Intron|DACH1_ENST00000313174.7_Intron|DACH1_ENST00000305425.4_Missense_Mutation_p.N408S			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	460					cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		GCTGAGGTGGTTCATCTGGCT	0.443																																																	0													100.0	104.0	102.0					13																	72147054		2092	4258	6350	SO:0001583	missense	0			AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.1379A>G	13.37:g.72147054T>C	ENSP00000352712:p.Asn460Ser		D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.N460S	ENST00000359684.2	37	c.1379		13	.	.	.	.	.	.	.	.	.	.	T	25.5	4.643273	0.87859	.	.	ENSG00000165659	ENST00000305425;ENST00000359684;ENST00000377826	T;T	0.37411	1.34;1.2	5.72	5.72	0.89469	.	0.082250	0.85682	D	0.000000	T	0.50154	0.1599	L	0.56769	1.78	0.80722	D	1	D	0.60575	0.988	P	0.54815	0.761	T	0.50600	-0.8809	10	0.56958	D	0.05	-19.9739	15.9465	0.79799	0.0:0.0:0.0:1.0	.	406	Q9UI36-2	.	S	408;460;460	ENSP00000304994:N408S;ENSP00000352712:N460S	ENSP00000304994:N408S	N	-	2	0	DACH1	71045055	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.553000	0.82203	2.306000	0.77630	0.482000	0.46254	AAC	DACH1	-	NULL	ENSG00000165659		0.443	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	DACH1	HGNC	protein_coding	OTTHUMT00000045240.1	-	0.00	57	0	T	NM_004392		72147054	-1	tier1	-	no_errors	ENST00000359684	ensembl	human	known	74_37	missense	17.78	37	8	SNP	1.000	C
DCDC1	341019	genome.wustl.edu	37	11	31263046	31263046	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:31263046A>C	ENST00000597505.1	-	7	1171	c.1172T>G	c.(1171-1173)cTt>cGt	p.L391R				P59894	DCDC1_HUMAN	doublecortin domain containing 1	0					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					CAGGGCCAAAAGAACTCCTTG	0.378																																																	0																																										SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.1172T>G	11.37:g.31263046A>C	ENSP00000472625:p.Leu391Arg		A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Doublecortin_dom,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.L391R	ENST00000597505.1	37	c.1172		11																																																																																			DCDC1	-	NULL	ENSG00000170959		0.378	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	-	0.00	60	0	A	NM_181807		31263046	-1	tier1	-	no_errors	ENST00000597505	ensembl	human	putative	74_37	missense	15.38	44	8	SNP	1.000	C
DCLK1	9201	genome.wustl.edu	37	13	36429667	36429667	+	Intron	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr13:36429667G>A	ENST00000360631.3	-	6	1152				DCLK1_ENST00000379892.4_Intron|DCLK1_ENST00000379893.1_5'UTR|DCLK1_ENST00000255448.4_Intron|DCLK1_ENST00000460982.1_5'UTR			O15075	DCLK1_HUMAN	doublecortin-like kinase 1						axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		TTCTAACATGGACACAGTCTT	0.463																																																	0													28.0	25.0	26.0					13																	36429667		876	1991	2867	SO:0001627	intron_variant	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.941-937C>T	13.37:g.36429667G>A			B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	RNA	SNP	-	NULL	ENST00000360631.3	37	NULL		13																																																																																			DCLK1	-	-	ENSG00000133083		0.463	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	HGNC	protein_coding	OTTHUMT00000044487.1	-	0.00	34	0	G	NM_004734		36429667	-1	tier1	-	no_errors	ENST00000460982	ensembl	human	known	74_37	rna	37.93	18	11	SNP	1.000	A
DDC	1644	genome.wustl.edu	37	7	50596980	50596980	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:50596980G>A	ENST00000444124.2	-	5	696	c.496C>T	c.(496-498)Cgg>Tgg	p.R166W	DDC_ENST00000380984.4_Missense_Mutation_p.R166W|DDC_ENST00000357936.5_Missense_Mutation_p.R166W|DDC_ENST00000431062.1_Intron|AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000426377.1_Missense_Mutation_p.R88W|DDC_ENST00000489162.1_5'UTR	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	166	2 X approximate tandem repeats.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)	p.R166W(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	GCCTGCAGCCGATGGATCACT	0.562																																																	1	Substitution - Missense(1)	ovary(1)																																								SO:0001583	missense	0				CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.496C>T	7.37:g.50596980G>A	ENSP00000403644:p.Arg166Trp		C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase,prints_Aromatic_deC	p.R166W	ENST00000444124.2	37	c.496	CCDS5511.1	7	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456282	0.26161	.	.	ENSG00000132437	ENST00000357936;ENST00000426377;ENST00000444124;ENST00000380984	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.15	4.27	0.50696	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.540481	0.20832	N	0.084878	T	0.53594	0.1806	L	0.53671	1.685	0.18873	N	0.999989	D	0.71674	0.998	D	0.66084	0.941	T	0.44267	-0.9339	10	0.87932	D	0	-25.3651	7.8243	0.29305	0.0827:0.0:0.7568:0.1605	.	166	P20711	DDC_HUMAN	W	166;88;166;166	ENSP00000350616:R166W;ENSP00000395069:R88W;ENSP00000403644:R166W;ENSP00000370371:R166W	ENSP00000350616:R166W	R	-	1	2	DDC	50564474	0.001000	0.12720	0.153000	0.22517	0.004000	0.04260	0.960000	0.29253	1.406000	0.46857	-0.136000	0.14681	CGG	DDC	-	pfam_PyrdxlP-dep_de-COase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase	ENSG00000132437		0.562	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DDC	HGNC	protein_coding	OTTHUMT00000342593.1	-	0.00	47	0	G			50596980	-1	tier1	-	no_errors	ENST00000357936	ensembl	human	known	74_37	missense	37.04	17	10	SNP	0.074	A
DDX1	1653	genome.wustl.edu	37	2	15768947	15768947	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:15768947C>T	ENST00000381341.2	+	24	2248	c.1859C>T	c.(1858-1860)gCa>gTa	p.A620V	DDX1_ENST00000233084.3_Missense_Mutation_p.A620V			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	620	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Necessary for interaction with HNRNPK.|Necessary for interaction with replicase polyprotein 1ab nsp14 of IBV.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		TCCCTGGTGGCAACAGAAAAA	0.343																																																	0													93.0	93.0	93.0					2																	15768947		2203	4300	6503	SO:0001583	missense	0			X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.1859C>T	2.37:g.15768947C>T	ENSP00000370745:p.Ala620Val		B4DME8|B4DPN6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_SPRY_rcpt,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_ConA-like_lec_gl_sf,smart_Helicase_ATP-bd,smart_SPla/RYanodine_receptor_subgr,smart_Helicase_C,pfscan_B30.2/SPRY,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.A620V	ENST00000381341.2	37	c.1859	CCDS1686.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.720019	0.96839	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	T;T	0.04862	3.54;3.54	6.17	6.17	0.99709	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.20007	0.0481	L	0.58669	1.825	0.80722	D	1	D	0.56287	0.975	P	0.55455	0.776	T	0.00001	-1.2717	10	0.72032	D	0.01	-20.3038	20.8794	0.99867	0.0:1.0:0.0:0.0	.	620	Q92499	DDX1_HUMAN	V	620;620;604	ENSP00000370745:A620V;ENSP00000233084:A620V	ENSP00000233084:A620V	A	+	2	0	DDX1	15686398	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.646000	0.67916	2.941000	0.99782	0.655000	0.94253	GCA	DDX1	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000079785		0.343	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX1	HGNC	protein_coding	OTTHUMT00000207141.2		0.00	53	0	C	NM_004939		15768947	+1			no_errors	ENST00000233084	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
DHX9	1660	genome.wustl.edu	37	1	182844088	182844088	+	Splice_Site	SNP	A	A	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:182844088A>T	ENST00000367549.3	+	16	1924	c.1814A>T	c.(1813-1815)gAt>gTt	p.D605V		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	605					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						gaggatgatgatgTAAGTGAA	0.353																																					Colon(69;210 1162 3697 13559 39565)												0													105.0	109.0	108.0					1																	182844088		1924	4130	6054	SO:0001630	splice_region_variant	0			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.1815+1A>T	1.37:g.182844088A>T			B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	pfam_dsRNA-bd_dom,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_dsRNA-bd_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom	p.D605V	ENST00000367549.3	37	c.1814	CCDS41444.1	1	.	.	.	.	.	.	.	.	.	.	A	16.46	3.130016	0.56721	.	.	ENSG00000135829	ENST00000367549	T	0.04119	3.7	5.28	5.28	0.74379	.	0.064498	0.56097	D	0.000024	T	0.07773	0.0195	L	0.54965	1.715	0.80722	D	1	B	0.30584	0.286	B	0.32211	0.142	T	0.20571	-1.0271	10	0.36615	T	0.2	.	15.1778	0.72927	1.0:0.0:0.0:0.0	.	605	Q08211	DHX9_HUMAN	V	605	ENSP00000356520:D605V	ENSP00000356520:D605V	D	+	2	0	DHX9	181110711	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.821000	0.86641	2.113000	0.64589	0.528000	0.53228	GAT	DHX9	-	superfamily_P-loop_NTPase	ENSG00000135829		0.353	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX9	HGNC	protein_coding	OTTHUMT00000085522.2	-	0.00	81	0	A	NM_030588	Missense_Mutation	182844088	+1	tier1	-	no_errors	ENST00000367549	ensembl	human	known	74_37	missense	72.00	27	72	SNP	1.000	T
DLG2	1740	genome.wustl.edu	37	11	84245712	84245712	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:84245712T>G	ENST00000532653.1	-	2	407	c.105A>C	c.(103-105)gaA>gaC	p.E35D	DLG2_ENST00000376104.2_Missense_Mutation_p.E140D|DLG2_ENST00000543673.1_Missense_Mutation_p.E140D|DLG2_ENST00000398309.2_Missense_Mutation_p.E35D|DLG2_ENST00000524982.1_Missense_Mutation_p.E35D			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)	p.E35E(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GGCCTCTTACTTCGTGGGTTA	0.403																																																	1	Substitution - coding silent(1)	pancreas(1)											192.0	178.0	182.0					11																	84245712		1868	4118	5986	SO:0001583	missense	0			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.105A>C	11.37:g.84245712T>G	ENSP00000435849:p.Glu35Asp		B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	pfam_PDZ,pfam_GK/Ca_channel_bsu,pfam_MAGUK_PEST_N,pfam_PDZ_assoc,pfam_L27_1,pfam_SH3_2,pfam_SH3_domain,superfamily_P-loop_NTPase,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_GK/Ca_channel_bsu,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin-like	p.E140D	ENST00000532653.1	37	c.420		11	.	.	.	.	.	.	.	.	.	.	T	21.9	4.222627	0.79464	.	.	ENSG00000150672	ENST00000398309;ENST00000376104;ENST00000543673;ENST00000524982;ENST00000532653;ENST00000546021;ENST00000527088	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.88	4.75	0.60458	Membrane-associated guanylate kinase (MAGUK), PEST domain, N-terminal (1);	0.000000	0.64402	D	0.000010	T	0.21962	0.0529	N	0.12831	0.26	0.80722	D	1	B;B;B;B	0.14012	0.001;0.009;0.004;0.004	B;B;B;B	0.17979	0.01;0.02;0.009;0.013	T	0.06881	-1.0802	9	.	.	.	.	6.9398	0.24486	0.1329:0.07:0.0:0.7971	.	35;35;140;35	B7Z2T4;E9PN83;Q15700-2;Q15700	.;.;.;DLG2_HUMAN	D	35;140;140;35;35;140;56	ENSP00000381355:E35D;ENSP00000365272:E140D;ENSP00000441994:E140D;ENSP00000432894:E35D;ENSP00000435849:E35D;ENSP00000435809:E56D	.	E	-	3	2	DLG2	83923360	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.305000	0.43664	1.042000	0.40150	0.533000	0.62120	GAA	DLG2	-	pfam_MAGUK_PEST_N,pirsf_M-assoc_guanylate_kinase	ENSG00000150672		0.403	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000259253.2	-	0.00	72	0	T	NM_001364		84245712	-1	tier1	-	no_errors	ENST00000376104	ensembl	human	known	74_37	missense	29.73	26	11	SNP	1.000	G
DNAH10	196385	genome.wustl.edu	37	12	124319972	124319972	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:124319972G>T	ENST00000409039.3	+	27	4470	c.4445G>T	c.(4444-4446)aGa>aTa	p.R1482I		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1482	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R74I(1)|p.R1482I(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TTGGTTCAGAGAAAATGGATG	0.378																																																	2	Substitution - Missense(2)	large_intestine(2)											124.0	111.0	115.0					12																	124319972		1873	4108	5981	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.4445G>T	12.37:g.124319972G>T	ENSP00000386770:p.Arg1482Ile		C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_PyrdxlP-dep_Trfase,smart_AAA+_ATPase	p.R1482I	ENST00000409039.3	37	c.4445	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.228404	0.79576	.	.	ENSG00000197653	ENST00000409039	T	0.64618	-0.11	5.69	5.69	0.88448	Dynein heavy chain, domain-2 (1);	0.073622	0.52532	U	0.000069	D	0.84547	0.5496	M	0.93150	3.385	0.80722	D	1	D	0.56746	0.977	D	0.65323	0.934	D	0.87870	0.2670	10	0.72032	D	0.01	.	19.8155	0.96566	0.0:0.0:1.0:0.0	.	1482	Q8IVF4	DYH10_HUMAN	I	1482	ENSP00000386770:R1482I	ENSP00000386770:R1482I	R	+	2	0	DNAH10	122885925	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.396000	0.73234	2.682000	0.91365	0.650000	0.86243	AGA	DNAH10	-	pfam_Dynein_heavy_dom-2	ENSG00000197653		0.378	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	-	0.00	92	0	G			124319972	+1	tier1	-	no_errors	ENST00000409039	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
DNAH12	201625	genome.wustl.edu	37	3	57509603	57509603	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:57509603C>T	ENST00000351747.2	-	3	359	c.179G>A	c.(178-180)gGa>gAa	p.G60E	DNAH12_ENST00000311202.6_Missense_Mutation_p.G60E|DNAH12_ENST00000389536.4_Missense_Mutation_p.G60E	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	60	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TCTTTTGGCTCCATCAATTCT	0.299																																																	0													90.0	91.0	91.0					3																	57509603		2203	4289	6492	SO:0001583	missense	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.179G>A	3.37:g.57509603C>T	ENSP00000295937:p.Gly60Glu		A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.G60E	ENST00000351747.2	37	c.179		3	.	.	.	.	.	.	.	.	.	.	C	1.642	-0.516279	0.04200	.	.	ENSG00000174844	ENST00000351747;ENST00000495027;ENST00000389536;ENST00000311202	T;T;T;T	0.20200	2.24;2.09;3.74;3.2	4.28	-0.782	0.10961	.	0.831650	0.10530	N	0.663992	T	0.11750	0.0286	L	0.36672	1.1	0.58432	D	0.999995	B;B	0.10296	0.003;0.0	B;B	0.12156	0.007;0.0	T	0.34502	-0.9826	10	0.06757	T	0.87	.	4.6806	0.12732	0.0:0.464:0.1566:0.3794	.	60;60	Q6ZR08-4;Q6ZR08	.;DYH12_HUMAN	E	60	ENSP00000295937:G60E;ENSP00000418137:G60E;ENSP00000374187:G60E;ENSP00000312554:G60E	ENSP00000312554:G60E	G	-	2	0	DNAH12	57484643	0.944000	0.32072	0.589000	0.28718	0.958000	0.62258	0.065000	0.14466	-0.075000	0.12798	-0.136000	0.14681	GGA	DNAH12	-	NULL	ENSG00000174844		0.299	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		-	0.00	66	0	C	NM_178504		57509603	-1	tier1	-	no_errors	ENST00000351747	ensembl	human	known	74_37	missense	21.62	58	16	SNP	0.672	T
DNAH14	127602	genome.wustl.edu	37	1	225562479	225562479	+	Intron	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:225562479C>T	ENST00000445597.2	+	54	9205				DNAH14_ENST00000430092.1_Silent_p.Y4043Y|DNAH14_ENST00000439375.2_Silent_p.Y4043Y			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AAGTGATTTACGGTGGCCGGG	0.458																																																	0													142.0	121.0	127.0					1																	225562479		692	1591	2283	SO:0001627	intron_variant	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.9206-2479C>T	1.37:g.225562479C>T			A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Tautomerase/MIF_sf,smart_AAA+_ATPase	p.Y4043	ENST00000445597.2	37	c.12129		1																																																																																			DNAH14	-	pfam_Dynein_heavy_dom	ENSG00000185842		0.458	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3		0.00	51	0	C	XM_059166		225562479	+1			no_errors	ENST00000430092	ensembl	human	known	74_37	silent	5.17	55	3	SNP	0.922	T
DNAH5	1767	genome.wustl.edu	37	5	13824430	13824430	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:13824430A>C	ENST00000265104.4	-	39	6561	c.6457T>G	c.(6457-6459)Ttt>Gtt	p.F2153V		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2153	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CGCAGGCCAAAGTCATAATGA	0.403									Kartagener syndrome																																								0													98.0	92.0	94.0					5																	13824430		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6457T>G	5.37:g.13824430A>C	ENSP00000265104:p.Phe2153Val		Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.F2153V	ENST00000265104.4	37	c.6457	CCDS3882.1	5	.	.	.	.	.	.	.	.	.	.	A	28.9	4.962445	0.92791	.	.	ENSG00000039139	ENST00000265104	T	0.09723	2.95	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.48696	0.1514	H	0.97131	3.945	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.67114	-0.5752	10	0.87932	D	0	.	16.0095	0.80391	1.0:0.0:0.0:0.0	.	2153	Q8TE73	DYH5_HUMAN	V	2153	ENSP00000265104:F2153V	ENSP00000265104:F2153V	F	-	1	0	DNAH5	13877430	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.339000	0.96797	2.178000	0.69098	0.528000	0.53228	TTT	DNAH5	-	superfamily_P-loop_NTPase	ENSG00000039139		0.403	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	49	0	A	NM_001369		13824430	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	missense	37.50	25	15	SNP	1.000	C
DNAH7	56171	genome.wustl.edu	37	2	196737077	196737077	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:196737077A>G	ENST00000312428.6	-	40	6630	c.6530T>C	c.(6529-6531)tTg>tCg	p.L2177S		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2177	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GAGGTTGAACAAGTAGTGAGA	0.393																																																	0													175.0	162.0	166.0					2																	196737077		1866	4098	5964	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6530T>C	2.37:g.196737077A>G	ENSP00000311273:p.Leu2177Ser		B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_P-loop_NTPase,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_hand_dom	p.L2177S	ENST00000312428.6	37	c.6530	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	A	19.29	3.799532	0.70567	.	.	ENSG00000118997	ENST00000312428	T	0.38240	1.15	4.53	4.53	0.55603	.	0.000000	0.64402	D	0.000005	T	0.61899	0.2384	M	0.83483	2.645	0.80722	D	1	D	0.69078	0.997	D	0.76071	0.987	T	0.67503	-0.5654	10	0.56958	D	0.05	.	13.973	0.64252	1.0:0.0:0.0:0.0	.	2177	Q8WXX0	DYH7_HUMAN	S	2177	ENSP00000311273:L2177S	ENSP00000311273:L2177S	L	-	2	0	DNAH7	196445322	0.859000	0.29813	0.998000	0.56505	0.984000	0.73092	3.515000	0.53429	2.029000	0.59856	0.528000	0.53228	TTG	DNAH7	-	superfamily_P-loop_NTPase	ENSG00000118997		0.393	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	-	0.00	99	0	A	NM_018897		196737077	-1	tier1	-	no_errors	ENST00000312428	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.967	G
DNAJC6	9829	genome.wustl.edu	37	1	65878666	65878666	+	Silent	SNP	C	C	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:65878666C>G	ENST00000395325.3	+	19	2857	c.2700C>G	c.(2698-2700)gcC>gcG	p.A900A	DNAJC6_ENST00000263441.7_Silent_p.A887A|DNAJC6_ENST00000371069.4_Silent_p.A957A|RNU2-15P_ENST00000410692.1_RNA	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	900	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						TCAATGATGCCTGGTCTGAAT	0.408																																																	0													151.0	152.0	151.0					1																	65878666		2203	4300	6503	SO:0001819	synonymous_variant	0			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.2700C>G	1.37:g.65878666C>G			B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Silent	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_domain,superfamily_DnaJ_domain,superfamily_C2_dom,smart_DnaJ_domain,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_domain	p.A957	ENST00000395325.3	37	c.2871	CCDS30739.1	1																																																																																			DNAJC6	-	pfam_DnaJ_domain,superfamily_DnaJ_domain,smart_DnaJ_domain,pfscan_DnaJ_domain	ENSG00000116675		0.408	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DNAJC6	HGNC	protein_coding	OTTHUMT00000025134.1	-	0.00	82	0	C			65878666	+1	tier1	-	no_errors	ENST00000371069	ensembl	human	known	74_37	silent	35.44	51	28	SNP	1.000	G
DOCK2	1794	genome.wustl.edu	37	5	169423113	169423113	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:169423113A>C	ENST00000256935.8	+	30	3097	c.3017A>C	c.(3016-3018)aAg>aCg	p.K1006T	DOCK2_ENST00000520908.1_Missense_Mutation_p.K498T|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.K67T	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1006	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GCTATCAACAAGTTTGCAGAA	0.478																																																	0													110.0	101.0	104.0					5																	169423113		2203	4300	6503	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3017A>C	5.37:g.169423113A>C	ENSP00000256935:p.Lys1006Thr		Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.K1006T	ENST00000256935.8	37	c.3017	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	A	15.10	2.734284	0.48939	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.20738	2.05;2.05;2.05	5.76	5.76	0.90799	.	0.056160	0.64402	D	0.000001	T	0.15609	0.0376	N	0.22421	0.69	0.43242	D	0.995159	B;B	0.17852	0.024;0.004	B;B	0.14023	0.01;0.003	T	0.06807	-1.0806	10	0.28530	T	0.3	.	14.0363	0.64646	1.0:0.0:0.0:0.0	.	498;1006	E7ERW7;Q92608	.;DOCK2_HUMAN	T	1006;498;67	ENSP00000256935:K1006T;ENSP00000429283:K498T;ENSP00000438827:K67T	ENSP00000256935:K1006T	K	+	2	0	DOCK2	169355691	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.694000	0.61760	2.191000	0.70037	0.533000	0.62120	AAG	DOCK2	-	superfamily_ARM-type_fold,superfamily_Ferritin-like_SF	ENSG00000134516		0.478	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	-	0.00	63	0	A	NM_004946		169423113	+1	tier1	-	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	43.18	25	19	SNP	1.000	C
DOCK3	1795	genome.wustl.edu	37	3	51317601	51317601	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:51317601T>A	ENST00000266037.9	+	27	2911	c.2888T>A	c.(2887-2889)cTc>cAc	p.L963H		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	963					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TTCCAGCACCTCCTGGACAAC	0.532																																																	0													71.0	72.0	72.0					3																	51317601		2075	4207	6282	SO:0001583	missense	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.2888T>A	3.37:g.51317601T>A	ENSP00000266037:p.Leu963His		O15017	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.L963H	ENST00000266037.9	37	c.2888	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	T	26.5	4.744434	0.89663	.	.	ENSG00000088538	ENST00000266037	T	0.77620	-1.11	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	D	0.87366	0.6159	M	0.75777	2.31	0.58432	D	0.999999	D	0.89917	1.0	D	0.81914	0.995	D	0.88106	0.2822	10	0.52906	T	0.07	.	15.5413	0.76052	0.0:0.0:0.0:1.0	.	963	Q8IZD9	DOCK3_HUMAN	H	963	ENSP00000266037:L963H	ENSP00000266037:L963H	L	+	2	0	DOCK3	51292641	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	7.948000	0.87774	2.063000	0.61619	0.533000	0.62120	CTC	DOCK3	-	superfamily_ARM-type_fold	ENSG00000088538		0.532	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	-	0.00	84	0	T	NM_004947		51317601	+1	tier1	-	no_errors	ENST00000266037	ensembl	human	known	74_37	missense	37.70	38	23	SNP	1.000	A
DOCK3	1795	genome.wustl.edu	37	3	51387791	51387791	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:51387791T>G	ENST00000266037.9	+	40	4098	c.4075T>G	c.(4075-4077)Ttc>Gtc	p.F1359V		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1359	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TCGGGTCGGCTTCTATGGCAG	0.433																																																	0													164.0	164.0	164.0					3																	51387791		1897	4121	6018	SO:0001583	missense	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.4075T>G	3.37:g.51387791T>G	ENSP00000266037:p.Phe1359Val		O15017	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.F1359V	ENST00000266037.9	37	c.4075	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	T	28.5	4.921781	0.92319	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	T	0.17054	2.3	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.48892	0.1525	M	0.88512	2.96	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.59247	-0.7490	10	0.87932	D	0	.	15.2623	0.73634	0.0:0.0:0.0:1.0	.	1359	Q8IZD9	DOCK3_HUMAN	V	1359;155	ENSP00000266037:F1359V	ENSP00000266037:F1359V	F	+	1	0	DOCK3	51362831	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.972000	0.88022	2.002000	0.58637	0.477000	0.44152	TTC	DOCK3	-	NULL	ENSG00000088538		0.433	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	-	0.00	67	0	T	NM_004947		51387791	+1	tier1	-	no_errors	ENST00000266037	ensembl	human	known	74_37	missense	45.45	36	30	SNP	1.000	G
DROSHA	29102	genome.wustl.edu	37	5	31424571	31424571	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:31424571C>T	ENST00000511367.2	-	27	3468	c.3224G>A	c.(3223-3225)cGc>cAc	p.R1075H	DROSHA_ENST00000442743.1_Missense_Mutation_p.R1038H|DROSHA_ENST00000513349.1_Missense_Mutation_p.R1038H|DROSHA_ENST00000344624.3_Missense_Mutation_p.R1075H	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	1075	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)			breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						CCAGACTTCGCGCAGGTCCTG	0.423																																																	0													105.0	106.0	105.0					5																	31424571		1940	4145	6085	SO:0001583	missense	0			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.3224G>A	5.37:g.31424571C>T	ENSP00000425979:p.Arg1075His		E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_dsRNA-bd_dom,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.R1075H	ENST00000511367.2	37	c.3224	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	C	15.84	2.950818	0.53186	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075;ENST00000382188	T;T;T;T	0.46819	1.44;1.44;0.86;0.86	5.41	5.41	0.78517	Ribonuclease III (2);	0.056790	0.64402	D	0.000003	T	0.34193	0.0889	N	0.19112	0.55	0.58432	D	0.999999	B;B	0.17852	0.024;0.017	B;B	0.17433	0.008;0.018	T	0.12372	-1.0550	10	0.13470	T	0.59	-16.8708	17.7429	0.88412	0.0:1.0:0.0:0.0	.	1038;1075	E7EMP9;Q9NRR4	.;RNC_HUMAN	H	1075;1075;1038;1038;1000;1031	ENSP00000425979:R1075H;ENSP00000339845:R1075H;ENSP00000409335:R1038H;ENSP00000424161:R1038H	ENSP00000265075:R1000H	R	-	2	0	DROSHA	31460328	1.000000	0.71417	0.966000	0.40874	0.992000	0.81027	4.861000	0.62969	2.691000	0.91804	0.650000	0.86243	CGC	DROSHA	-	superfamily_RNase_III_dom,smart_RNase_III_dom	ENSG00000113360		0.423	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	-	0.00	57	0	C	NM_013235		31424571	-1	tier1	-	no_errors	ENST00000344624	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
DYM	54808	genome.wustl.edu	37	18	46889556	46889556	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr18:46889556G>A	ENST00000269445.6	-	6	926	c.469C>T	c.(469-471)Cag>Tag	p.Q157*	DYM_ENST00000578396.1_Nonsense_Mutation_p.Q2*|DYM_ENST00000442713.2_Intron	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	157					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						GTGATCAACTGCATCAAACAG	0.348																																																	0													112.0	108.0	110.0					18																	46889556		2203	4300	6503	SO:0001587	stop_gained	0			AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.469C>T	18.37:g.46889556G>A	ENSP00000269445:p.Gln157*		A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Nonsense_Mutation	SNP	pfam_Dymeclin,superfamily_ARM-type_fold	p.Q157*	ENST00000269445.6	37	c.469	CCDS11937.1	18	.	.	.	.	.	.	.	.	.	.	G	21.5	4.153340	0.78114	.	.	ENSG00000141627	ENST00000269445	.	.	.	5.52	3.48	0.39840	.	0.222920	0.47455	D	0.000226	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-2.8555	9.28	0.37722	0.0:0.1471:0.6822:0.1707	.	.	.	.	X	157	.	ENSP00000269445:Q157X	Q	-	1	0	DYM	45143554	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.195000	0.42677	1.286000	0.44565	0.650000	0.86243	CAG	DYM	-	pfam_Dymeclin	ENSG00000141627		0.348	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYM	HGNC	protein_coding	OTTHUMT00000255912.3	-	0.00	26	0	G	NM_017653		46889556	-1	tier1	-	no_errors	ENST00000269445	ensembl	human	known	74_37	nonsense	16.00	21	4	SNP	0.999	A
E2F1	1869	genome.wustl.edu	37	20	32265042	32265042	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr20:32265042G>T	ENST00000343380.5	-	6	1074	c.935C>A	c.(934-936)cCa>cAa	p.P312Q	RP1-63M2.5_ENST00000606866.1_RNA|NECAB3_ENST00000375238.4_5'Flank|NECAB3_ENST00000246190.6_5'Flank	NM_005225.2	NP_005216.1	Q01094	E2F1_HUMAN	E2F transcription factor 1	312	Required for interaction with TRIM28.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|DNA damage checkpoint (GO:0000077)|forebrain development (GO:0030900)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lens fiber cell apoptotic process (GO:1990086)|mitotic cell cycle (GO:0000278)|mRNA stabilization (GO:0048255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Rb-E2F complex (GO:0035189)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.P312L(1)		NS(2)|breast(1)|endometrium(3)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	16						CTCCTGGGATGGGGTCTTCCC	0.562																																																	1	Substitution - Missense(1)	NS(1)											115.0	102.0	107.0					20																	32265042		2203	4300	6503	SO:0001583	missense	0				CCDS13224.1	20q11	2008-05-14			ENSG00000101412	ENSG00000101412			3113	protein-coding gene	gene with protein product		189971		RBBP3		8964493	Standard	NM_005225		Approved	RBP3	uc002wzu.4	Q01094	OTTHUMG00000032265	ENST00000343380.5:c.935C>A	20.37:g.32265042G>T	ENSP00000345571:p.Pro312Gln		Q13143|Q92768	Missense_Mutation	SNP	pfam_E2F_TDP	p.P312Q	ENST00000343380.5	37	c.935	CCDS13224.1	20	.	.	.	.	.	.	.	.	.	.	G	6.984	0.551539	0.13374	.	.	ENSG00000101412	ENST00000343380	T	0.38722	1.12	4.78	3.84	0.44239	.	1.014100	0.07866	N	0.967039	T	0.37839	0.1018	L	0.51422	1.61	0.09310	N	1	P	0.48230	0.907	B	0.41988	0.372	T	0.08452	-1.0721	10	0.10902	T	0.67	-1.1943	11.101	0.48174	0.0869:0.0:0.9131:0.0	.	312	Q01094	E2F1_HUMAN	Q	312	ENSP00000345571:P312Q	ENSP00000345571:P312Q	P	-	2	0	E2F1	31728703	0.471000	0.25862	0.080000	0.20451	0.097000	0.18754	2.078000	0.41567	1.254000	0.44035	0.407000	0.27541	CCA	E2F1	-	NULL	ENSG00000101412		0.562	E2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	E2F1	HGNC	protein_coding	OTTHUMT00000078731.2	-	0.00	68	0	G			32265042	-1	tier1	-	no_errors	ENST00000343380	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.081	T
EFCAB6	64800	genome.wustl.edu	37	22	43936111	43936111	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr22:43936111G>T	ENST00000262726.7	-	28	4028	c.3775C>A	c.(3775-3777)Cag>Aag	p.Q1259K	EFCAB6_ENST00000461800.1_5'UTR|EFCAB6_ENST00000396231.2_Missense_Mutation_p.Q1107K	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	1259					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				CTCCCTCTCTGGGCCACGGCC	0.607																																																	0													95.0	78.0	84.0					22																	43936111		2203	4300	6503	SO:0001583	missense	0			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.3775C>A	22.37:g.43936111G>T	ENSP00000262726:p.Gln1259Lys		A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	pfam_EF_hand_Ca-bd_contain_6,smart_EF_hand_dom,pfscan_EF_hand_dom	p.Q1259K	ENST00000262726.7	37	c.3775	CCDS14049.1	22	.	.	.	.	.	.	.	.	.	.	G	12.96	2.093054	0.36952	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.14391	2.52;2.51	5.49	5.49	0.81192	EF-hand calcium-binding domain-containing protein 6 (1);	0.436160	0.22874	N	0.054600	T	0.25975	0.0633	M	0.70595	2.14	0.80722	D	1	D	0.53312	0.959	P	0.55508	0.777	T	0.06215	-1.0839	10	0.05351	T	0.99	-26.4634	15.2372	0.73441	0.0:0.0:1.0:0.0	.	1259	Q5THR3	EFCB6_HUMAN	K	1107;1259	ENSP00000379533:Q1107K;ENSP00000262726:Q1259K	ENSP00000262726:Q1259K	Q	-	1	0	EFCAB6	42267444	0.993000	0.37304	0.997000	0.53966	0.500000	0.33767	4.271000	0.58902	2.731000	0.93534	0.650000	0.86243	CAG	EFCAB6	-	pfam_EF_hand_Ca-bd_contain_6	ENSG00000186976		0.607	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB6	HGNC	protein_coding	OTTHUMT00000353176.1	-	0.00	42	0	G	NM_022785		43936111	-1	tier1	-	no_errors	ENST00000262726	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.999	T
EGFLAM	133584	genome.wustl.edu	37	5	38406988	38406988	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:38406988A>C	ENST00000354891.3	+	8	1233	c.887A>C	c.(886-888)aAg>aCg	p.K296T	EGFLAM_ENST00000336740.6_Missense_Mutation_p.K62T|EGFLAM_ENST00000397202.2_Intron|EGFLAM_ENST00000322350.5_Missense_Mutation_p.K296T	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	296					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GAAAGCAAGAAGATGTCTATA	0.483																																					Colon(62;485 1295 3347 17454)												0													131.0	125.0	127.0					5																	38406988		2203	4300	6503	SO:0001583	missense	0			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.887A>C	5.37:g.38406988A>C	ENSP00000346964:p.Lys296Thr		A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.K296T	ENST00000354891.3	37	c.887	CCDS56363.1	5	.	.	.	.	.	.	.	.	.	.	A	6.613	0.481449	0.12581	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	T;T;T	0.79141	0.87;0.7;-1.24	5.69	-7.42	0.01388	.	0.880465	0.10473	N	0.670565	T	0.50034	0.1592	N	0.22421	0.69	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.43589	-0.9382	10	0.13853	T	0.58	-19.636	1.3109	0.02097	0.4145:0.1225:0.1353:0.3277	.	62;296;296	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	T	296;296;62;62	ENSP00000346964:K296T;ENSP00000313084:K296T;ENSP00000337607:K62T	ENSP00000313084:K296T	K	+	2	0	EGFLAM	38442745	0.008000	0.16893	0.001000	0.08648	0.068000	0.16541	-0.066000	0.11598	-0.996000	0.03455	-1.545000	0.00906	AAG	EGFLAM	-	NULL	ENSG00000164318		0.483	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	HGNC	protein_coding	OTTHUMT00000367323.1	-	0.00	41	0	A	NM_152403		38406988	+1	tier1	-	no_errors	ENST00000354891	ensembl	human	known	74_37	missense	29.17	17	7	SNP	0.002	C
ELF4	2000	genome.wustl.edu	37	X	129200949	129200949	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:129200949delG	ENST00000308167.5	-	9	2118	c.1739delC	c.(1738-1740)ccafs	p.P580fs	ELF4_ENST00000335997.7_Frame_Shift_Del_p.P580fs	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)											breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						CACCTGGGTTGGAAGTGGCTG	0.617			T	ERG	AML																																			Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	0													90.0	94.0	93.0					X																	129200949		2203	4300	6503	SO:0001589	frameshift_variant	0			U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.1739delC	X.37:g.129200949delG	ENSP00000311280:p.Pro580fs			Frame_Shift_Del	DEL	pfam_TF_Elf_N,pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.P580fs	ENST00000308167.5	37	c.1739	CCDS14617.1	X																																																																																			ELF4	-	NULL	ENSG00000102034		0.617	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF4	HGNC	protein_coding	OTTHUMT00000058243.1		0.00	69	0	G	NM_001421		129200949	-1	tier1		no_errors	ENST00000308167	ensembl	human	known	74_37	frame_shift_del	73.33	12	33	DEL	1.000	-
ELMO1	9844	genome.wustl.edu	37	7	37243820	37243820	+	Intron	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:37243820A>C	ENST00000310758.4	-	13	1734				ELMO1_ENST00000448602.1_Intron|ELMO1_ENST00000442504.1_Intron|ELMO1_ENST00000341056.3_Missense_Mutation_p.L29R	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1						actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						gctgacttcaagaatgaagcc	0.493																																																	0																																										SO:0001627	intron_variant	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1086+7170T>G	7.37:g.37243820A>C			A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	pfam_Engulfment_cell_motility_ELMO	p.L29R	ENST00000310758.4	37	c.86	CCDS5449.1	7	.	.	.	.	.	.	.	.	.	.	A	0.461	-0.889061	0.02511	.	.	ENSG00000155849	ENST00000341056	T	0.36878	1.23	0.158	0.158	0.14942	.	.	.	.	.	T	0.34571	0.0902	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34153	-0.9840	5	0.72032	D	0.01	.	.	.	.	.	.	.	.	R	29	ENSP00000342142:L29R	ENSP00000342142:L29R	L	-	2	0	ELMO1	37210345	0.074000	0.21230	0.054000	0.19295	0.054000	0.15201	0.238000	0.18004	0.175000	0.19841	0.172000	0.16884	CTT	ELMO1	-	NULL	ENSG00000155849		0.493	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4	-	0.00	13	0	A	NM_130442		37243820	-1	tier1	-	no_errors	ENST00000341056	ensembl	human	known	74_37	missense	70.59	5	12	SNP	0.060	C
ELMO1	9844	genome.wustl.edu	37	7	37382289	37382289	+	Silent	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:37382289C>A	ENST00000310758.4	-	2	653	c.6G>T	c.(4-6)ccG>ccT	p.P2P	ELMO1_ENST00000448602.1_Silent_p.P2P|ELMO1_ENST00000442504.1_Silent_p.P2P	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	2					actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						CCGCGGGTGGCGGCATTGTAA	0.502																																																	0													109.0	113.0	112.0					7																	37382289		2203	4300	6503	SO:0001819	synonymous_variant	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.6G>T	7.37:g.37382289C>A			A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Silent	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.P2	ENST00000310758.4	37	c.6	CCDS5449.1	7																																																																																			ELMO1	-	NULL	ENSG00000155849		0.502	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4	-	0.00	31	0	C	NM_130442		37382289	-1	tier1	-	no_errors	ENST00000310758	ensembl	human	known	74_37	silent	56.00	11	14	SNP	0.929	A
EML4	27436	genome.wustl.edu	37	2	42508029	42508029	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:42508029T>A	ENST00000318522.5	+	7	969	c.707T>A	c.(706-708)aTt>aAt	p.I236N	EML4_ENST00000402711.2_Missense_Mutation_p.I178N|EML4_ENST00000401738.3_Missense_Mutation_p.I247N	NM_019063.3	NP_061936	Q9HC35	EMAL4_HUMAN	echinoderm microtubule associated protein like 4	236					microtubule-based process (GO:0007017)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|mitotic spindle (GO:0072686)			EML4/ALK(543)	NS(2)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	12						GGTCGGCCAATTACCATGTTC	0.403			T	ALK	NSCLC																																			Dom	yes		2	2p21	27436	echinoderm microtubule associated protein like 4		E	0													103.0	92.0	96.0					2																	42508029		2203	4300	6503	SO:0001583	missense	0			AF177377	CCDS1807.1, CCDS46266.1	2p21	2013-01-10		2002-02-15	ENSG00000143924	ENSG00000143924		"""WD repeat domain containing"""	1316	protein-coding gene	gene with protein product		607442		C2orf2			Standard	NM_019063		Approved	ROPP120, ELP120	uc002rsi.3	Q9HC35	OTTHUMG00000128603	ENST00000318522.5:c.707T>A	2.37:g.42508029T>A	ENSP00000320663:p.Ile236Asn		A6H8Y6|B2RBK3|B2RTW7|B5MCW9|Q3SWW0|Q53R29|Q53TW8|Q6PJ45|Q9NV40	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I236N	ENST00000318522.5	37	c.707	CCDS1807.1	2	.	.	.	.	.	.	.	.	.	.	T	26.6	4.753154	0.89753	.	.	ENSG00000143924	ENST00000318522;ENST00000402711;ENST00000401738	T;T;T	0.31247	1.5;1.5;1.5	5.24	5.24	0.73138	HELP (1);	0.045792	0.85682	D	0.000000	T	0.55497	0.1924	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.91635	0.979;0.999	T	0.59836	-0.7379	10	0.72032	D	0.01	-13.7084	15.4338	0.75125	0.0:0.0:0.0:1.0	.	178;236	B5MCW9;Q9HC35	.;EMAL4_HUMAN	N	236;178;247	ENSP00000320663:I236N;ENSP00000385059:I178N;ENSP00000384939:I247N	ENSP00000320663:I236N	I	+	2	0	EML4	42361533	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.967000	0.87967	2.086000	0.62901	0.528000	0.53228	ATT	EML4	-	pfam_HELP	ENSG00000143924		0.403	EML4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EML4	HGNC	protein_coding	OTTHUMT00000250463.3	-	0.00	48	0	T	NM_019063		42508029	+1	tier1	-	no_errors	ENST00000318522	ensembl	human	known	74_37	missense	29.27	29	12	SNP	1.000	A
EMR1	2015	genome.wustl.edu	37	19	6906515	6906515	+	Missense_Mutation	SNP	G	G	T	rs149695793	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:6906515G>T	ENST00000312053.4	+	9	1058	c.1021G>T	c.(1021-1023)Gca>Tca	p.A341S	EMR1_ENST00000381404.4_Missense_Mutation_p.A289S|EMR1_ENST00000381407.5_Missense_Mutation_p.A200S|EMR1_ENST00000250572.8_Missense_Mutation_p.A341S|EMR1_ENST00000450315.3_Missense_Mutation_p.A164S	NM_001974.4	NP_001965.3	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 1	341	Ser/Thr-rich.				cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(8)	62	all_hematologic(4;0.166)					AGAGGGAACCGCAGTGAAACC	0.388																																																	0													119.0	114.0	116.0					19																	6906515		2203	4300	6503	SO:0001583	missense	0			X81479	CCDS12175.1, CCDS58643.1, CCDS58644.1, CCDS58645.1, CCDS58646.1	19p13.3	2014-08-08	2003-11-26					"""-"", ""GPCR / Class B : Orphans"""	3336	protein-coding gene	gene with protein product		600493	"""egf-like module containing, mucin-like, hormone receptor-like sequence 1"""	TM7LN3		7601460, 9500513	Standard	NM_001974		Approved		uc002mfw.4	Q14246		ENST00000312053.4:c.1021G>T	19.37:g.6906515G>T	ENSP00000311545:p.Ala341Ser		A6NHV2|B7Z486|B7Z489|E7EPX9|E9PD45|H9KV79|Q2I7G5|Q6ZMN0|Q8NGA7	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like	p.A341S	ENST00000312053.4	37	c.1021	CCDS12175.1	19	.	.	.	.	.	.	.	.	.	.	g	1.169	-0.641476	0.03531	.	.	ENSG00000174837	ENST00000543519;ENST00000312053;ENST00000381404;ENST00000250572;ENST00000381407;ENST00000450315	T;T;T;T;T	0.77620	-1.07;-1.08;-1.11;0.08;0.4	2.86	-0.585	0.11698	.	.	.	.	.	T	0.68174	0.2972	L	0.60455	1.87	0.09310	N	1	B;B;B;B;B	0.26445	0.149;0.019;0.027;0.05;0.016	B;B;B;B;B	0.30716	0.119;0.015;0.017;0.017;0.013	T	0.52200	-0.8607	9	0.12103	T	0.63	.	5.9931	0.19478	0.1324:0.1945:0.673:0.0	.	164;200;341;289;341	E7EPX9;B7Z486;Q14246-2;E9PD45;Q14246	.;.;.;.;EMR1_HUMAN	S	341;341;289;341;200;164	ENSP00000311545:A341S;ENSP00000370811:A289S;ENSP00000250572:A341S;ENSP00000370814:A200S;ENSP00000405974:A164S	ENSP00000250572:A341S	A	+	1	0	EMR1	6857515	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.466000	0.06672	-0.032000	0.13758	-1.057000	0.02308	GCA	EMR1	-	NULL	ENSG00000174837		0.388	EMR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR1	HGNC	protein_coding	OTTHUMT00000458485.1	-	0.00	137	0	G			6906515	+1	tier1	-	no_errors	ENST00000312053	ensembl	human	known	74_37	missense	31.87	62	29	SNP	0.000	T
EMR4P	326342	genome.wustl.edu	37	19	6972314	6972314	+	RNA	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:6972314A>C	ENST00000600751.1	-	0	982					NR_024075.1		Q86SQ3	EMR4_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 4 pseudogene						G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)										ATTTGGTGTAAGAACCGTTGC	0.537																																																	0																																												0			AY181245		19p13.2	2014-08-08	2008-06-06	2008-06-06	ENSG00000268758	ENSG00000268758		"""-"", ""GPCR / Class B : Orphans"""	19240	pseudogene	pseudogene		612305	"""G protein-coupled receptor 127"", ""egf-like module containing, mucin-like, hormone receptor-like 4"""	GPR127, EMR4		12565841	Standard	NR_024075		Approved	PGR16	uc010xjk.2	Q86SQ3	OTTHUMG00000177251		19.37:g.6972314A>C			Q86SP1	RNA	SNP	-	NULL	ENST00000600751.1	37	NULL		19																																																																																			EMR4P	-	-	ENSG00000268758		0.537	EMR4P-002	KNOWN	basic	processed_transcript	EMR4P	HGNC	pseudogene	OTTHUMT00000436007.1	-	0.00	67	0	A	NR_024075		6972314	-1	tier1	-	no_errors	ENST00000600751	ensembl	human	known	74_37	rna	35.71	36	20	SNP	0.000	C
ENGASE	64772	genome.wustl.edu	37	17	77078179	77078179	+	Intron	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:77078179C>T	ENST00000579016.1	+	7	1038				ENGASE_ENST00000584568.1_Intron|ENGASE_ENST00000539857.2_Missense_Mutation_p.P172S	NM_001042573.2	NP_001036038.1	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase							cytoplasm (GO:0005737)	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity (GO:0033925)			breast(2)|endometrium(4)|large_intestine(1)|lung(15)|prostate(2)|skin(1)	25						GGCCAGCGGCCCAGTGCCTCC	0.597																																																	0													60.0	78.0	72.0					17																	77078179		2101	4211	6312	SO:0001627	intron_variant	0			AF512564	CCDS42394.1	17q25.3	2009-03-03			ENSG00000167280	ENSG00000167280	3.2.1.96		24622	protein-coding gene	gene with protein product	"""Mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase"", ""Di-N-acetylchitobiosyl beta-N-acetylglucosaminidase"""	611898				12114544, 18586680	Standard	NM_001042573		Approved	FLJ21865	uc002jwv.4	Q8NFI3	OTTHUMG00000167714	ENST00000579016.1:c.1038+34C>T	17.37:g.77078179C>T			Q659F0|Q8TB86|Q9H6U4	Missense_Mutation	SNP	pfam_Glyco_hydro_85	p.P172S	ENST00000579016.1	37	c.514	CCDS42394.1	17																																																																																			ENGASE	-	NULL	ENSG00000167280		0.597	ENGASE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENGASE	HGNC	protein_coding	OTTHUMT00000395807.1	-	0.00	78	0	C	NM_022759		77078179	+1	tier1	-	no_errors	ENST00000539857	ensembl	human	known	74_37	missense	23.53	26	8	SNP	0.004	T
AAK1	22848	genome.wustl.edu	37	2	69685840	69685841	+	IGR	DEL	CA	CA	-	rs550880792|rs542320825|rs142247580		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:69685840_69685841delCA	ENST00000409068.1	-	0	2606				RP11-427H3.3_ENST00000606389.2_lincRNA			Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1						endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						GATGAATGAGcacacacacaca	0.421																																																	0																																										SO:0001628	intergenic_variant	0			AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648		2.37:g.69685850_69685851delCA			Q4ZFZ3|Q53RX6|Q9UPV4	RNA	DEL	-	NULL	ENST00000409068.1	37	NULL		2																																																																																			RP11-427H3.3	-	-	ENSG00000188971		0.421	AAK1-011	PUTATIVE	basic	protein_coding	ENSG00000188971	Clone_based_vega_gene	protein_coding	OTTHUMT00000333994.1		0.00	41	0	CA	NM_014911		69685841	-1	tier1		no_errors	ENST00000606389	ensembl	human	known	74_37	rna	7.41	25	2	DEL	0.000:0.000	-
LOC101927209	101927209	genome.wustl.edu	37	1	142620750	142620750	+	lincRNA	SNP	A	A	G	rs74944479		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:142620750A>G	ENST00000610091.1	-	0	6733				RP11-417J8.3_ENST00000426408.1_lincRNA																							GGTAATACATATTTTTATTCA	0.244																																																	0																																												0																															1.37:g.142620750A>G				RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			RP11-417J8.6	-	-	ENSG00000203849		0.244	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2		0.00	45	0	A			142620750	-1			no_errors	ENST00000369381	ensembl	human	known	74_37	rna	12.50	42	6	SNP	0.021	G
ZNF971P	100419895	genome.wustl.edu	37	16	34681602	34681602	+	RNA	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:34681602T>G	ENST00000568619.1	-	0	877																											CCAGTATGAGTTCTGTCATGT	0.373																																																	0																																												0																															16.37:g.34681602T>G				RNA	SNP	-	NULL	ENST00000568619.1	37	NULL		16	.	.	.	.	.	.	.	.	.	.	t	3.814	-0.039096	0.07497	.	.	ENSG00000214581	ENST00000398617	.	.	.	0.245	0.245	0.15512	.	.	.	.	.	T	0.30417	0.0764	.	.	.	.	.	.	.	.	.	.	.	.	T	0.36016	-0.9765	3	.	.	.	.	4.9563	0.14041	0.0:2.0E-4:0.0:0.9998	.	.	.	.	D	81	.	.	E	-	3	2	AC018558.1	34539103	0.015000	0.18098	0.070000	0.20053	0.068000	0.16541	2.116000	0.41930	0.317000	0.23160	0.311000	0.20440	GAA	RP11-80F22.10	-	-	ENSG00000214581		0.373	RP11-80F22.10-002	KNOWN	basic	processed_transcript	ENSG00000214581	Clone_based_vega_gene	pseudogene	OTTHUMT00000431371.1	-	0.00	60	0	T			34681602	-1	tier1	-	no_errors	ENST00000568619	ensembl	human	known	74_37	rna	53.85	12	14	SNP	0.991	G
Unknown	0	genome.wustl.edu	37	GL000241.1	11536	11536	+	IGR	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrGL000241.1:11536T>G								None (None upstream) : None (None downstream)																							tgggatatacttacactgaaa	0.299																																																	0																																										SO:0001628	intergenic_variant	0																															GL000241.1.37:g.11536T>G				RNA	SNP	-	NULL		37	NULL		GL000241.1																																																																																			CU459211.1	-	-	ENSG00000222670	0	0.299					ENSG00000222670	Clone_based_ensembl_gene			-	0.00	276	0	T			11536	-1	tier1	-	no_errors	ENST00000410738	ensembl	human	known	74_37	rna	6.54	143	10	SNP	NULL	G
RP11-51O6.1	0	genome.wustl.edu	37	16	61089587	61089587	+	RNA	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:61089587T>G	ENST00000591758.1	-	0	281																											CTTCCTTTTCTTAGCACCACC	0.418																																																	0																																												0																															16.37:g.61089587T>G				RNA	SNP	-	NULL	ENST00000591758.1	37	NULL		16																																																																																			RP11-51O6.1	-	-	ENSG00000224631		0.418	RP11-51O6.1-002	KNOWN	basic	processed_transcript	ENSG00000224631	Clone_based_vega_gene	pseudogene	OTTHUMT00000460612.1	-	0.00	35	0	T			61089587	-1	tier1	-	no_errors	ENST00000591758	ensembl	human	known	74_37	rna	71.43	4	10	SNP	1.000	G
DLG5	9231	genome.wustl.edu	37	10	79551102	79551102	+	3'UTR	DEL	A	A	-	rs78250856		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:79551102delA	ENST00000372391.2	-	0	6861				DLG5_ENST00000372388.2_3'UTR|RP13-39P12.3_ENST00000601701.1_RNA|DLG5_ENST00000459739.1_5'Flank|RP13-39P12.3_ENST00000434097.2_RNA	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)						apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			TCAGAAGTGCAAAAAAAAAAA	0.418																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.*1096T>-	10.37:g.79551102delA			A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	RNA	DEL	-	NULL	ENST00000372391.2	37	NULL	CCDS7353.2	10																																																																																			RP13-39P12.3	-	-	ENSG00000228748		0.418	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000228748	Clone_based_vega_gene	protein_coding	OTTHUMT00000048900.2		0.00	42	0	A			79551102	+1	tier1		no_errors	ENST00000601701	ensembl	human	known	74_37	rna	9.09	30	3	DEL	0.981	-
CUBNP1	728064	genome.wustl.edu	37	10	43197667	43197667	+	lincRNA	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:43197667A>C	ENST00000439913.1	+	0	895																											CAATCAAATCAAAATGTCTCC	0.408																																																	0																																												0																															10.37:g.43197667A>C				RNA	SNP	-	NULL	ENST00000439913.1	37	NULL		10																																																																																			AL022344.5	-	-	ENSG00000234864		0.408	AL022344.5-001	KNOWN	basic	lincRNA	ENSG00000234864	Clone_based_vega_gene	lincRNA	OTTHUMT00000047688.1	-	0.00	40	0	A			43197667	+1	tier1	-	no_errors	ENST00000439913	ensembl	human	known	74_37	rna	33.33	28	14	SNP	0.001	C
Unknown	0	genome.wustl.edu	37	GL000224.1	166772	166772	+	IGR	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrGL000224.1:166772T>G								None (None upstream) : None (None downstream)																							ctcgtagcagttttctggaat	0.453																																																	0																																										SO:0001628	intergenic_variant	0																															GL000224.1.37:g.166772T>G				RNA	SNP	-	NULL		37	NULL		GL000224.1																																																																																			AL591856.2	-	-	ENSG00000239051	0	0.453					ENSG00000239051	Clone_based_ensembl_gene			-	0.00	41	0	T			166772	+1	tier1	-	no_errors	ENST00000458962	ensembl	human	novel	74_37	rna	50.00	3	3	SNP	NULL	G
LINC01330	646168	genome.wustl.edu	37	3	167621203	167621203	+	lincRNA	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:167621203T>A	ENST00000481578.1	+	0	247																											GAGAAGAACATTCCACCCACG	0.343																																																	0																																												0																															3.37:g.167621203T>A				RNA	SNP	-	NULL	ENST00000481578.1	37	NULL		3																																																																																			RP11-298O21.5	-	-	ENSG00000244227		0.343	RP11-298O21.5-002	KNOWN	basic	lincRNA	ENSG00000244227	Clone_based_vega_gene	lincRNA	OTTHUMT00000351188.1	-	0.00	33	0	T			167621203	+1	tier1	-	no_errors	ENST00000459923	ensembl	human	known	74_37	rna	7.14	52	4	SNP	0.000	A
USP8	9101	genome.wustl.edu	37	15	50789208	50789208	+	Intron	SNP	G	G	A	rs202190406	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr15:50789208G>A	ENST00000396444.3	+	18	3233				USP8_ENST00000307179.4_Intron|USP8_ENST00000425032.3_Intron|RP11-562A8.4_ENST00000560380.1_RNA|RP11-562A8.5_ENST00000560159.1_lincRNA|USP8_ENST00000433963.1_Intron	NM_001128610.1|NM_005154.3	NP_001122082.1|NP_005145.3	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8						cell proliferation (GO:0008283)|endosome organization (GO:0007032)|mitotic cytokinesis (GO:0000281)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|Ras protein signal transduction (GO:0007265)|ubiquitin-dependent protein catabolic process (GO:0006511)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|midbody (GO:0030496)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		cctgcagagtgactaactaaa	0.393																																																	0																																										SO:0001627	intron_variant	0			D29956	CCDS10137.1, CCDS61632.1	15q21.1	2014-03-03	2005-08-08		ENSG00000138592	ENSG00000138592		"""Ubiquitin-specific peptidases"""	12631	protein-coding gene	gene with protein product		603158	"""ubiquitin specific protease 8"""			12838346, 9582025, 24482476	Standard	NM_005154		Approved	HumORF8, KIAA0055, UBPY, SPG59	uc001zyl.4	P40818	OTTHUMG00000131645	ENST00000396444.3:c.2896-78G>A	15.37:g.50789208G>A			B4DKA8|Q2TB31|Q7Z3U2|Q86VA0|Q8IWI7	RNA	SNP	-	NULL	ENST00000396444.3	37	NULL	CCDS10137.1	15																																																																																			RP11-562A8.5	-	-	ENSG00000259618		0.393	USP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259618	Clone_based_vega_gene	protein_coding	OTTHUMT00000254541.1	-	0.00	37	0	G	NM_005154		50789208	-1	tier1	-	no_errors	ENST00000560159	ensembl	human	known	74_37	rna	21.57	40	11	SNP	0.000	A
TK2	7084	genome.wustl.edu	37	16	66584128	66584129	+	5'UTR	INS	-	-	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:66584128_66584129insT	ENST00000451102.2	-	0	186_187				TK2_ENST00000299697.7_5'UTR|CKLF-CMTM1_ENST00000527729.1_5'Flank|TK2_ENST00000417693.3_5'Flank|TK2_ENST00000527800.1_5'Flank|TK2_ENST00000564917.1_5'Flank|TK2_ENST00000545043.2_5'Flank|TK2_ENST00000563369.2_5'Flank|CKLF-CMTM1_ENST00000532838.1_5'Flank|TK2_ENST00000544898.1_5'Flank|TK2_ENST00000527284.1_Intron|CKLF_ENST00000351137.4_5'Flank|Y_RNA_ENST00000563151.1_lincRNA|CKLF_ENST00000362093.4_5'Flank|CKLF_ENST00000417030.2_5'Flank|CKLF_ENST00000264001.4_5'Flank|CKLF_ENST00000345436.4_5'Flank|TK2_ENST00000525974.1_5'Flank			O00142	KITM_HUMAN	thymidine kinase 2, mitochondrial						deoxyribonucleoside monophosphate biosynthetic process (GO:0009157)|DNA replication (GO:0006260)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|thymidine kinase activity (GO:0004797)			large_intestine(1)|lung(2)|urinary_tract(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0736)|Epithelial(162;0.237)		GAAGGGAGAGGTTCGCCGCTGG	0.584																																																	0									,,,	3,3883		0,3,1940					,,,	-1.3	0.0			13	3,7701		1,1,3850	no	utr-5,utr-5,utr-5,intron	TK2	NM_004614.4,NM_001172645.1,NM_001172644.1,NM_001172643.1	,,,	1,4,5790	A1A1,A1R,RR		0.0389,0.0772,0.0518	,,,	,,,		6,11584				SO:0001623	5_prime_UTR_variant	0				CCDS10805.1, CCDS10805.2, CCDS54016.1, CCDS54017.1, CCDS54018.1, CCDS61955.1	16q22-q23.1	2012-10-02			ENSG00000166548	ENSG00000166548	2.7.1.21		11831	protein-coding gene	gene with protein product		188250					Standard	NM_004614		Approved		uc002eos.3	O00142	OTTHUMG00000137499	ENST00000451102.2:c.-165->A	16.37:g.66584130_66584130dupT			B4DGJ7|B4DZK7|B7ZAB1|E9PH08|O15238	RNA	INS	-	NULL	ENST00000451102.2	37	NULL	CCDS10805.2	16																																																																																			Y_RNA	-	-	ENSG00000261519		0.584	TK2-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ENSG00000261519	RFAM	protein_coding	OTTHUMT00000268806.4		0.00	79	0	-			66584129	+1	tier1		no_errors	ENST00000563151	ensembl	human	known	74_37	rna	48.48	17	16	INS	0.000:0.000	T
EPHA3	2042	genome.wustl.edu	37	3	89448604	89448604	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:89448604A>C	ENST00000336596.2	+	7	1793	c.1568A>C	c.(1567-1569)aAg>aCg	p.K523T	EPHA3_ENST00000452448.2_Missense_Mutation_p.K523T|EPHA3_ENST00000494014.1_Missense_Mutation_p.K523T	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	523	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		AACAGCCGCAAGTTTGAGTTT	0.458										TSP Lung(6;0.00050)																																							0													106.0	99.0	101.0					3																	89448604		2203	4300	6503	SO:0001583	missense	0			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.1568A>C	3.37:g.89448604A>C	ENSP00000337451:p.Lys523Thr		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.K523T	ENST00000336596.2	37	c.1568	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	A	12.46	1.944970	0.34283	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.52057	0.68;0.68;0.68	5.53	5.53	0.82687	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.151132	0.64402	D	0.000010	T	0.32734	0.0839	N	0.16567	0.415	0.47778	D	0.999515	B;B	0.13594	0.001;0.008	B;B	0.15052	0.003;0.012	T	0.11591	-1.0581	9	.	.	.	.	15.6643	0.77213	1.0:0.0:0.0:0.0	.	523;523	P29320;P29320-2	EPHA3_HUMAN;.	T	523	ENSP00000337451:K523T;ENSP00000399926:K523T;ENSP00000419190:K523T	.	K	+	2	0	EPHA3	89531294	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	4.023000	0.57211	2.107000	0.64212	0.460000	0.39030	AAG	EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000044524		0.458	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1	-	0.00	51	0	A	NM_005233		89448604	+1	tier1	-	no_errors	ENST00000336596	ensembl	human	known	74_37	missense	40.00	18	12	SNP	1.000	C
ESF1	51575	genome.wustl.edu	37	20	13740342	13740342	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr20:13740342G>T	ENST00000202816.1	-	9	1932	c.1825C>A	c.(1825-1827)Cca>Aca	p.P609T		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	609	Lys-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						TTCTTACCTGGAACCCATTTA	0.338																																																	0													81.0	79.0	79.0					20																	13740342		2203	4295	6498	SO:0001583	missense	0				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.1825C>A	20.37:g.13740342G>T	ENSP00000202816:p.Pro609Thr		Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Missense_Mutation	SNP	pfam_NUC153	p.P609T	ENST00000202816.1	37	c.1825	CCDS13117.1	20	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936980	0.73557	.	.	ENSG00000089048	ENST00000202816	T	0.48522	0.81	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.69540	0.3122	M	0.71296	2.17	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.67213	-0.5727	10	0.42905	T	0.14	.	19.8087	0.96539	0.0:0.0:1.0:0.0	.	609	Q9H501	ESF1_HUMAN	T	609	ENSP00000202816:P609T	ENSP00000202816:P609T	P	-	1	0	ESF1	13688342	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.734000	0.91543	2.757000	0.94681	0.655000	0.94253	CCA	ESF1	-	NULL	ENSG00000089048		0.338	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESF1	HGNC	protein_coding	OTTHUMT00000078049.1	-	0.00	47	0	G	NM_016649		13740342	-1	tier1	-	no_errors	ENST00000202816	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
EVL	51466	genome.wustl.edu	37	14	100594927	100594927	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr14:100594927delC	ENST00000402714.2	+	6	1157	c.553delC	c.(553-555)cccfs	p.P189fs	EVL_ENST00000544450.2_Frame_Shift_Del_p.P195fs|EVL_ENST00000392920.3_Frame_Shift_Del_p.P191fs			Q9UI08	EVL_HUMAN	Enah/Vasp-like	189	Pro-rich.				actin filament organization (GO:0007015)|actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ruffle assembly (GO:1900028)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of stress fiber assembly (GO:0051496)|protein homotetramerization (GO:0051289)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)	profilin binding (GO:0005522)|SH3 domain binding (GO:0017124)	p.P189fs*41(1)		cervix(1)|large_intestine(5)|lung(3)|ovary(3)|urinary_tract(2)	14		Melanoma(154;0.152)				Gcctccaccgccccccccacc	0.692																																																	1	Deletion - Frameshift(1)	large_intestine(1)								66,97,4015		1,1,63,3,90,1931	13.0	14.0	14.0			-0.6	1.0	14		14	76,160,7746		4,0,68,6,148,3765	no	codingComplex	EVL	NM_016337.2		5,1,131,9,238,5696	A1A1,A1A2,A1R,A2A2,A2R,RR		2.9567,3.9014,3.2812			100594927	142,257,11761	2199	4289	6488	SO:0001589	frameshift_variant	0			AF112209	CCDS9955.1	14q32.2	2014-08-13			ENSG00000196405	ENSG00000196405			20234	protein-coding gene	gene with protein product						10945997, 10993894	Standard	NM_016337		Approved	RNB6	uc001ygu.3	Q9UI08	OTTHUMG00000171530	ENST00000402714.2:c.553delC	14.37:g.100594927delC	ENSP00000384720:p.Pro189fs		A8K105|O95884|Q7Z522|Q8TBV1|Q9UF25|Q9UIC2	Frame_Shift_Del	DEL	pfam_WH1/EVH1,pfam_VASP_tetra,smart_WH1/EVH1,pirsf_Vasodilator_phosphoprotein,pfscan_WH1/EVH1	p.P189fs	ENST00000402714.2	37	c.559		14																																																																																			EVL	-	pirsf_Vasodilator_phosphoprotein	ENSG00000196405		0.692	EVL-006	KNOWN	basic|appris_candidate	protein_coding	EVL	HGNC	protein_coding	OTTHUMT00000413958.1		0.00	77	0	C			100594927	+1	tier1		no_errors	ENST00000392920	ensembl	human	known	74_37	frame_shift_del	21.05	45	12	DEL	1.000	-
EXOC2	55770	genome.wustl.edu	37	6	497386	497386	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:497386C>T	ENST00000230449.4	-	25	2675	c.2540G>A	c.(2539-2541)aGc>aAc	p.S847N	EXOC2_ENST00000448181.3_Missense_Mutation_p.S442N	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	847					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		TCCATTTTTGCTGAAGGATGA	0.358																																																	0													106.0	106.0	106.0					6																	497386		2203	4300	6503	SO:0001583	missense	0			AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.2540G>A	6.37:g.497386C>T	ENSP00000230449:p.Ser847Asn		B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Missense_Mutation	SNP	pfam_IPT,superfamily_Ig_E-set,superfamily_Cullin_repeat-like_dom	p.S847N	ENST00000230449.4	37	c.2540	CCDS34327.1	6	.	.	.	.	.	.	.	.	.	.	C	15.79	2.937580	0.52972	.	.	ENSG00000112685	ENST00000230449;ENST00000448181	T;T	0.45668	0.89;0.89	6.06	4.26	0.50523	.	0.000000	0.85682	D	0.000000	T	0.34687	0.0906	L	0.46157	1.445	0.58432	D	0.999999	D	0.64830	0.994	P	0.56278	0.795	T	0.08269	-1.0730	10	0.30854	T	0.27	-8.5379	11.3724	0.49708	0.127:0.808:0.0:0.065	.	847	Q96KP1	EXOC2_HUMAN	N	847;442	ENSP00000230449:S847N;ENSP00000398113:S442N	ENSP00000230449:S847N	S	-	2	0	EXOC2	442386	1.000000	0.71417	0.991000	0.47740	0.410000	0.31052	7.487000	0.81328	0.867000	0.35654	0.650000	0.86243	AGC	EXOC2	-	NULL	ENSG00000112685		0.358	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC2	HGNC	protein_coding	OTTHUMT00000039627.1		0.00	56	0	C	NM_018303		497386	-1			no_errors	ENST00000230449	ensembl	human	known	74_37	missense	7.69	36	3	SNP	1.000	T
EXOC2	55770	genome.wustl.edu	37	6	572547	572547	+	Silent	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:572547G>T	ENST00000230449.4	-	13	1551	c.1416C>A	c.(1414-1416)tcC>tcA	p.S472S	EXOC2_ENST00000448181.3_Silent_p.S67S	NM_018303.5	NP_060773.3	Q96KP1	EXOC2_HUMAN	exocyst complex component 2	472					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|membrane organization (GO:0061024)|protein transport (GO:0015031)	exocyst (GO:0000145)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|liver(1)|lung(16)|ovary(4)|pancreas(1)|prostate(2)	46	Ovarian(93;0.0733)	Breast(5;0.0014)|all_lung(73;0.0697)|all_hematologic(90;0.0897)		OV - Ovarian serous cystadenocarcinoma(45;0.0507)|BRCA - Breast invasive adenocarcinoma(62;0.14)		CATTAACGTAGGAGATCCAGA	0.458																																																	0													101.0	93.0	95.0					6																	572547		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ420556	CCDS34327.1	6p25.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000112685	ENSG00000112685			24968	protein-coding gene	gene with protein product		615329	"""SEC5-like 1 (S. cerevisiae)"""	SEC5L1		12575951, 12459492	Standard	NM_018303		Approved	FLJ11026, Sec5p	uc003mtd.4	Q96KP1	OTTHUMG00000137437	ENST00000230449.4:c.1416C>A	6.37:g.572547G>T			B2RBE6|Q5JPC8|Q96AN6|Q9NUZ8|Q9UJM7	Silent	SNP	pfam_IPT,superfamily_Ig_E-set,superfamily_Cullin_repeat-like_dom	p.S472	ENST00000230449.4	37	c.1416	CCDS34327.1	6																																																																																			EXOC2	-	NULL	ENSG00000112685		0.458	EXOC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC2	HGNC	protein_coding	OTTHUMT00000039627.1	-	0.00	72	0	G	NM_018303		572547	-1	tier1	-	no_errors	ENST00000230449	ensembl	human	known	74_37	silent	5.33	71	4	SNP	0.095	T
FAM104B	90736	genome.wustl.edu	37	X	55172586	55172586	+	Intron	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:55172586G>A	ENST00000358460.4	-	3	405				FAM104B_ENST00000478918.1_5'Flank|FAM104B_ENST00000332132.4_Intron|FAM104B_ENST00000477847.2_Silent_p.S90S|FAM104B_ENST00000472571.2_3'UTR|FAM104B_ENST00000489298.1_Silent_p.S92S|FAM104B_ENST00000425133.2_Silent_p.S94S			Q5XKR9	F104B_HUMAN	family with sequence similarity 104, member B									p.S94S(1)		endometrium(3)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	8						GGTTGATATGGGAGTAAAGAC	0.478																																																	1	Substitution - coding silent(1)	endometrium(1)											78.0	66.0	70.0					X																	55172586		2203	4297	6500	SO:0001627	intron_variant	0			BC000919	CCDS35305.1, CCDS35305.2, CCDS55422.1, CCDS55423.1, CCDS55424.1, CCDS55425.1, CCDS55426.1	Xp11.22	2008-02-05	2006-05-16	2006-05-16	ENSG00000182518	ENSG00000182518			25085	protein-coding gene	gene with protein product			"""chromosome X open reading frame 44"""	CXorf44		12477932	Standard	NM_138362		Approved	FLJ20434	uc004dug.2	Q5XKR9	OTTHUMG00000021646	ENST00000358460.4:c.251+27C>T	X.37:g.55172586G>A			A6NEH1|B4DSV6|D6R9S5|D6RDJ5|E9PH40|Q8WVU5|Q9BRA1	Silent	SNP	NULL	p.S94	ENST00000358460.4	37	c.282	CCDS35305.2	X																																																																																			FAM104B	-	NULL	ENSG00000182518		0.478	FAM104B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM104B	HGNC	protein_coding	OTTHUMT00000056851.1		0.00	42	0	G	NM_138362		55172586	-1			no_errors	ENST00000425133	ensembl	human	known	74_37	silent	7.69	36	3	SNP	0.008	A
FAM117A	81558	genome.wustl.edu	37	17	47810056	47810056	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:47810056C>A	ENST00000240364.2	-	2	302	c.223G>T	c.(223-225)Gaa>Taa	p.E75*	FAM117A_ENST00000513602.1_5'UTR|FAM117A_ENST00000514018.1_5'UTR	NM_030802.3	NP_110429.1	Q9C073	F117A_HUMAN	family with sequence similarity 117, member A	75										haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	17						ACTGACTTTTCTGGGGCCACC	0.597																																																	0													96.0	70.0	79.0					17																	47810056		2203	4300	6503	SO:0001587	stop_gained	0			BC037572	CCDS11553.1	17q21.33	2006-04-26				ENSG00000121104			24179	protein-coding gene	gene with protein product	"""C/EBP induced protein"""					12477932	Standard	NM_030802		Approved		uc002ipk.3	Q9C073		ENST00000240364.2:c.223G>T	17.37:g.47810056C>A	ENSP00000240364:p.Glu75*		B7Z7Q3	Nonsense_Mutation	SNP	NULL	p.E75*	ENST00000240364.2	37	c.223	CCDS11553.1	17	.	.	.	.	.	.	.	.	.	.	C	37	6.281732	0.97440	.	.	ENSG00000121104	ENST00000240364;ENST00000506156	.	.	.	5.28	5.28	0.74379	.	0.129591	0.50627	D	0.000110	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-13.1277	16.8737	0.86046	0.0:1.0:0.0:0.0	.	.	.	.	X	75	.	ENSP00000240364:E75X	E	-	1	0	FAM117A	45165055	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.116000	0.57871	2.746000	0.94184	0.655000	0.94253	GAA	FAM117A	-	NULL	ENSG00000121104		0.597	FAM117A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM117A	HGNC	protein_coding	OTTHUMT00000365736.1	-	0.00	39	0	C	NM_030802		47810056	-1	tier1	-	no_errors	ENST00000240364	ensembl	human	known	74_37	nonsense	36.67	19	11	SNP	1.000	A
FAM193B	54540	genome.wustl.edu	37	5	176951252	176951252	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:176951252A>T	ENST00000514747.1	-	6	2278	c.2230T>A	c.(2230-2232)Ttg>Atg	p.L744M	FAM193B_ENST00000443375.2_Missense_Mutation_p.L711M|FAM193B_ENST00000508298.1_5'Flank|FAM193B_ENST00000329540.5_Missense_Mutation_p.L370M	NM_001190946.1	NP_001177875.1	Q96PV7	F193B_HUMAN	family with sequence similarity 193, member B	824						cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)	4						CCCTGGGGCAAGCTCTGTGGC	0.682																																																	0													13.0	16.0	15.0					5																	176951252		2065	4189	6254	SO:0001583	missense	0				CCDS54954.1	5q35	2010-02-17			ENSG00000146067	ENSG00000146067			25524	protein-coding gene	gene with protein product		615813				11572484	Standard	NR_024019		Approved	KIAA1931, FLJ10404	uc003mhu.3	Q96PV7	OTTHUMG00000163396	ENST00000514747.1:c.2230T>A	5.37:g.176951252A>T	ENSP00000422131:p.Leu744Met		E9PET5|Q9NW00	Missense_Mutation	SNP	NULL	p.L711M	ENST00000514747.1	37	c.2131	CCDS54954.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.52|15.52	2.857279|2.857279	0.51376|0.51376	.|.	.|.	ENSG00000146067|ENSG00000146067	ENST00000524677|ENST00000514747;ENST00000443375;ENST00000329540	.|T;T;T	.|0.42900	.|0.96;0.96;0.96	5.59|5.59	4.43|4.43	0.53597|0.53597	.|.	0.431719|0.431719	0.25813|0.25813	N|N	0.028125|0.028125	T|T	0.43831|0.43831	0.1265|0.1265	L|L	0.40543|0.40543	1.245|1.245	0.09310|0.09310	N|N	1|1	.|P;P;P	.|0.50617	.|0.755;0.937;0.731	.|P;P;B	.|0.52267	.|0.465;0.694;0.444	T|T	0.24119|0.24119	-1.0169|-1.0169	6|10	.|0.35671	.|T	.|0.21	-2.3923|-2.3923	11.2059|11.2059	0.48769|0.48769	0.9287:0.0:0.0713:0.0|0.9287:0.0:0.0713:0.0	.|.	.|744;370;711	.|E9PET5;E7ER81;E9PEZ8	.|.;.;.	H|M	429|744;711;370	.|ENSP00000422131:L744M;ENSP00000410098:L711M;ENSP00000332014:L370M	.|ENSP00000332014:L370M	L|L	-|-	2|1	0|2	FAM193B|FAM193B	176883858|176883858	0.927000|0.927000	0.31430|0.31430	0.994000|0.994000	0.49952|0.49952	0.937000|0.937000	0.57800|0.57800	2.284000|2.284000	0.43478|0.43478	0.960000|0.960000	0.38005|0.38005	0.459000|0.459000	0.35465|0.35465	CTT|TTG	FAM193B	-	NULL	ENSG00000146067		0.682	FAM193B-003	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM193B	HGNC	protein_coding	OTTHUMT00000373121.1	-	0.00	68	0	A	NM_019057		176951252	-1	tier1	-	no_errors	ENST00000443375	ensembl	human	known	74_37	missense	23.40	72	22	SNP	0.037	T
FAM217B	63939	genome.wustl.edu	37	20	58519165	58519165	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr20:58519165C>G	ENST00000358293.3	+	5	582	c.167C>G	c.(166-168)gCa>gGa	p.A56G	FAM217B_ENST00000360816.3_Missense_Mutation_p.A56G|FAM217B_ENST00000469084.1_Intron	NM_001190826.1	NP_001177755.1	Q9NTX9	F217B_HUMAN	family with sequence similarity 217, member B	56																	TCCCCGGAAGCAAGACGCAAA	0.463																																																	0													53.0	54.0	53.0					20																	58519165		2203	4300	6503	SO:0001583	missense	0			AL109928	CCDS13484.1	20q13.33	2012-02-07	2012-02-07	2012-02-07	ENSG00000196227	ENSG00000196227			16170	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 177"""	C20orf177			Standard	NM_022106		Approved	dJ551D2.5	uc002ybc.3	Q9NTX9	OTTHUMG00000032873	ENST00000358293.3:c.167C>G	20.37:g.58519165C>G	ENSP00000351040:p.Ala56Gly		B3KWH1|Q9NTA3	Missense_Mutation	SNP	NULL	p.A56G	ENST00000358293.3	37	c.167	CCDS13484.1	20	.	.	.	.	.	.	.	.	.	.	C	0.322	-0.961501	0.02249	.	.	ENSG00000196227	ENST00000358293;ENST00000360816	T;T	0.26518	1.73;1.73	5.32	1.21	0.21127	.	0.585904	0.15787	N	0.244653	T	0.03477	0.0100	N	0.00210	-1.845	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36986	-0.9725	10	0.02654	T	1	-4.5356	0.8381	0.01144	0.3298:0.1649:0.3503:0.155	.	56	Q9NTX9	CT177_HUMAN	G	56	ENSP00000351040:A56G;ENSP00000354056:A56G	ENSP00000351040:A56G	A	+	2	0	C20orf177	57952560	0.000000	0.05858	0.001000	0.08648	0.000000	0.00434	0.058000	0.14301	0.244000	0.21351	-0.950000	0.02660	GCA	FAM217B	-	NULL	ENSG00000196227		0.463	FAM217B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM217B	HGNC	protein_coding	OTTHUMT00000268139.1	-	0.00	40	0	C	NM_022106		58519165	+1	tier1	-	no_errors	ENST00000358293	ensembl	human	known	74_37	missense	24.44	34	11	SNP	0.000	G
FAM47C	442444	genome.wustl.edu	37	X	37026951	37026951	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:37026951G>C	ENST00000358047.3	+	1	520	c.468G>C	c.(466-468)gaG>gaC	p.E156D		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	156										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						TGGACCCTGAGAGGAAGCTGG	0.572																																																	0													56.0	50.0	52.0					X																	37026951		2202	4300	6502	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.468G>C	X.37:g.37026951G>C	ENSP00000367913:p.Glu156Asp		Q6ZU46	Missense_Mutation	SNP	NULL	p.E156D	ENST00000358047.3	37	c.468	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	G	2.885	-0.230849	0.05983	.	.	ENSG00000198173	ENST00000358047	T	0.19532	2.14	0.502	-0.96	0.10340	.	.	.	.	.	T	0.16257	0.0391	L	0.41573	1.285	0.09310	N	1	B	0.29481	0.245	B	0.39738	0.308	T	0.43130	-0.9410	8	0.08837	T	0.75	.	.	.	.	.	156	Q5HY64	FA47C_HUMAN	D	156	ENSP00000367913:E156D	ENSP00000367913:E156D	E	+	3	2	FAM47C	36936872	0.044000	0.20184	0.068000	0.19968	0.056000	0.15407	0.165000	0.16564	-0.522000	0.06417	0.292000	0.19580	GAG	FAM47C	-	NULL	ENSG00000198173		0.572	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	-	0.00	91	0	G	NM_001013736		37026951	+1	tier1	-	no_errors	ENST00000358047	ensembl	human	known	74_37	missense	74.07	21	60	SNP	0.067	C
FAM63B	54629	genome.wustl.edu	37	15	59064332	59064332	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr15:59064332G>T	ENST00000559228.1	+	1	820	c.738G>T	c.(736-738)aaG>aaT	p.K246N	FAM63B_ENST00000450403.2_Missense_Mutation_p.K246N|RP11-30K9.6_ENST00000500929.2_lincRNA			Q8NBR6	FA63B_HUMAN	family with sequence similarity 63, member B	246										central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	15						ATCACATCAAGTGGATCCAGT	0.582																																																	0													75.0	84.0	81.0					15																	59064332		2096	4231	6327	SO:0001583	missense	0			AK075319	CCDS42046.1, CCDS45268.1	15q21.3	2005-08-09							26954	protein-coding gene	gene with protein product						10574461	Standard	NM_001040450		Approved	KIAA1164	uc002afj.3	Q8NBR6		ENST00000559228.1:c.738G>T	15.37:g.59064332G>T	ENSP00000452885:p.Lys246Asn		B2RTT8|Q9ULQ6	Missense_Mutation	SNP	pfam_DUF544	p.K246N	ENST00000559228.1	37	c.738	CCDS42046.1	15	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914931	0.72983	.	.	ENSG00000128923	ENST00000316848;ENST00000450403	T	0.61742	0.08	4.84	3.91	0.45181	.	0.000000	0.85682	D	0.000000	T	0.75049	0.3797	M	0.85299	2.745	0.50039	D	0.999844	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.76170	-0.3057	10	0.62326	D	0.03	-9.182	8.6655	0.34118	0.1754:0.0:0.8246:0.0	.	246;246	Q8NBR6;Q8NBR6-2	FA63B_HUMAN;.	N	246	ENSP00000393231:K246N	ENSP00000326194:K246N	K	+	3	2	FAM63B	56851624	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.404000	0.52623	0.996000	0.38943	0.585000	0.79938	AAG	FAM63B	-	NULL	ENSG00000128923		0.582	FAM63B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM63B	HGNC	protein_coding	OTTHUMT00000416230.1	-	0.00	60	0	G	NM_019092		59064332	+1	tier1	-	no_errors	ENST00000559228	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
FBXL7	23194	genome.wustl.edu	37	5	15936643	15936643	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:15936643G>A	ENST00000504595.1	+	4	1305	c.824G>A	c.(823-825)cGc>cAc	p.R275H	FBXL7_ENST00000329673.7_Missense_Mutation_p.R263H|MIR887_ENST00000401258.1_RNA|FBXL7_ENST00000510662.1_Missense_Mutation_p.R228H	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	275					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.R275H(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						ATTTCCATCCGCTACCTGGAC	0.592																																																	1	Substitution - Missense(1)	large_intestine(1)											71.0	72.0	72.0					5																	15936643		2181	4280	6461	SO:0001583	missense	0			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.824G>A	5.37:g.15936643G>A	ENSP00000423630:p.Arg275His		B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.R275H	ENST00000504595.1	37	c.824	CCDS54833.1	5	.	.	.	.	.	.	.	.	.	.	G	15.08	2.727909	0.48833	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.01981	4.52;4.52;4.52	5.16	5.16	0.70880	.	0.048221	0.85682	D	0.000000	T	0.02193	0.0068	N	0.12182	0.205	0.54753	D	0.999987	B	0.22003	0.063	B	0.15052	0.012	T	0.61569	-0.7036	10	0.48119	T	0.1	.	18.6513	0.91431	0.0:0.0:1.0:0.0	.	275	Q9UJT9	FBXL7_HUMAN	H	275;228;263	ENSP00000423630:R275H;ENSP00000425184:R228H;ENSP00000329632:R263H	ENSP00000329632:R263H	R	+	2	0	FBXL7	15989643	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.785000	0.85724	2.414000	0.81942	0.655000	0.94253	CGC	FBXL7	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000183580		0.592	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL7	HGNC	protein_coding	OTTHUMT00000366117.1		0.00	41	0	G	NM_012304		15936643	+1			no_errors	ENST00000504595	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	A
FBN2	2201	genome.wustl.edu	37	5	127642855	127642855	+	Silent	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:127642855G>T	ENST00000508053.1	-	48	6368	c.5394C>A	c.(5392-5394)acC>acA	p.T1798T	FBN2_ENST00000262464.4_Silent_p.T1798T			P35556	FBN2_HUMAN	fibrillin 2	1798					anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GAATGTCAAAGGTGAATCCAG	0.289																																																	0													94.0	99.0	97.0					5																	127642855		2203	4296	6499	SO:0001819	synonymous_variant	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.5394C>A	5.37:g.127642855G>T			B4DU01|Q59ES6	Silent	SNP	pirsf_FBN,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.T1798	ENST00000508053.1	37	c.5394	CCDS34222.1	5																																																																																			FBN2	-	pirsf_FBN,superfamily_TB_dom	ENSG00000138829		0.289	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	-	0.00	81	0	G	NM_001999		127642855	-1	tier1	-	no_errors	ENST00000262464	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	T
FAM71B	153745	genome.wustl.edu	37	5	156590064	156590064	+	Missense_Mutation	SNP	G	G	T	rs150872087	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:156590064G>T	ENST00000302938.4	-	2	1307	c.1212C>A	c.(1210-1212)agC>agA	p.S404R		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	404						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGTAGCCTTCGCTTTGCAAGG	0.507																																																	0													77.0	80.0	79.0					5																	156590064		2203	4300	6503	SO:0001583	missense	0				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.1212C>A	5.37:g.156590064G>T	ENSP00000305596:p.Ser404Arg		Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	pfam_DUF3699	p.S404R	ENST00000302938.4	37	c.1212	CCDS4335.1	5	.	.	.	.	.	.	.	.	.	.	G	9.221	1.033472	0.19590	.	.	ENSG00000170613	ENST00000302938	T	0.18657	2.2	4.16	-4.82	0.03171	.	0.000000	0.47455	D	0.000238	T	0.27559	0.0677	M	0.78049	2.395	0.30752	N	0.745042	D	0.57899	0.981	P	0.48815	0.591	T	0.32402	-0.9908	10	0.56958	D	0.05	-7.3399	11.9891	0.53166	0.3414:0.0:0.6586:0.0	.	404	Q8TC56	FA71B_HUMAN	R	404	ENSP00000305596:S404R	ENSP00000305596:S404R	S	-	3	2	FAM71B	156522642	0.281000	0.24258	0.693000	0.30195	0.014000	0.08584	-1.228000	0.02948	-1.048000	0.03238	-0.367000	0.07326	AGC	FAM71B	-	NULL	ENSG00000170613		0.507	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71B	HGNC	protein_coding	OTTHUMT00000252570.2		0.00	47	0	G	NM_130899		156590064	-1			no_errors	ENST00000302938	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.916	T
FBXO21	23014	genome.wustl.edu	37	12	117604812	117604812	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:117604812C>T	ENST00000330622.5	-	8	1083	c.1084G>A	c.(1084-1086)Gaa>Aaa	p.E362K	FBXO21_ENST00000427718.2_Missense_Mutation_p.E362K			O94952	FBX21_HUMAN	F-box protein 21	362					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)			breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		TACTCGCATTCTTTCACTGTC	0.478																																					GBM(168;452 2038 13535 17701 43680)												0													179.0	147.0	157.0					12																	117604812		2203	4300	6503	SO:0001583	missense	0			AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.1084G>A	12.37:g.117604812C>T	ENSP00000328187:p.Glu362Lys		B3KMF0|Q5BJG0|Q9H087	Missense_Mutation	SNP	pfam_Hemimethylated_DNA-bd_dom,superfamily_Hemimethylated_DNA-bd_dom,superfamily_F-box_dom,tigrfam_Hemimethylated_DNA-bd_dom	p.E362K	ENST00000330622.5	37	c.1084	CCDS9184.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.777481	0.96929	.	.	ENSG00000135108	ENST00000427718;ENST00000257563;ENST00000330622;ENST00000548840	T;T	0.48201	0.83;0.82	5.93	5.93	0.95920	F-box domain, Skp2-like (1);	0.000000	0.85682	D	0.000000	T	0.74160	0.3680	M	0.86502	2.82	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.81914	0.995;0.991	T	0.72475	-0.4282	10	0.35671	T	0.21	-11.2355	20.3539	0.98825	0.0:1.0:0.0:0.0	.	362;362	O94952;O94952-1	FBX21_HUMAN;.	K	362;278;362;14	ENSP00000414468:E362K;ENSP00000328187:E362K	ENSP00000257563:E278K	E	-	1	0	FBXO21	116089195	1.000000	0.71417	0.772000	0.31596	0.980000	0.70556	7.433000	0.80362	2.826000	0.97356	0.655000	0.94253	GAA	FBXO21	-	superfamily_F-box_dom	ENSG00000135108		0.478	FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXO21	HGNC	protein_coding	OTTHUMT00000404409.1	-	0.00	81	0	C	NM_033624		117604812	-1	tier1	-	no_errors	ENST00000330622	ensembl	human	known	74_37	missense	68.42	6	13	SNP	1.000	T
FER1L6	654463	genome.wustl.edu	37	8	125033831	125033831	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr8:125033831G>T	ENST00000522917.1	+	17	2261	c.2055G>T	c.(2053-2055)caG>caT	p.Q685H	FER1L6_ENST00000399018.1_Missense_Mutation_p.Q685H|FER1L6-AS1_ENST00000518567.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	685						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TTCAGCAGCAGAAGAAAAAGT	0.433																																																	0													127.0	125.0	126.0					8																	125033831		1957	4157	6114	SO:0001583	missense	0			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2055G>T	8.37:g.125033831G>T	ENSP00000428280:p.Gln685His			Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,superfamily_ABC1_TM_dom,smart_C2_dom,pfscan_C2_dom	p.Q685H	ENST00000522917.1	37	c.2055	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	G	15.50	2.852498	0.51270	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.81739	-1.53;-1.53	5.77	2.59	0.31030	.	0.181068	0.37809	U	0.001925	D	0.83603	0.5290	M	0.77103	2.36	0.39965	D	0.974719	D	0.71674	0.998	P	0.62089	0.898	T	0.80276	-0.1450	10	0.15066	T	0.55	.	4.9854	0.14187	0.252:0.1768:0.5712:0.0	.	685	Q2WGJ9	FR1L6_HUMAN	H	685	ENSP00000428280:Q685H;ENSP00000381982:Q685H	ENSP00000381982:Q685H	Q	+	3	2	FER1L6	125103012	1.000000	0.71417	0.999000	0.59377	0.965000	0.64279	1.537000	0.36083	0.777000	0.33496	0.591000	0.81541	CAG	FER1L6	-	NULL	ENSG00000214814		0.433	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	-	0.00	62	0	G	NM_001039112		125033831	+1	tier1	-	no_errors	ENST00000399018	ensembl	human	known	74_37	missense	5.63	67	4	SNP	1.000	T
FGD3	89846	genome.wustl.edu	37	9	95772661	95772661	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:95772661C>T	ENST00000375482.3	+	7	1467	c.971C>T	c.(970-972)gCg>gTg	p.A324V	FGD3_ENST00000416701.2_Missense_Mutation_p.A324V|FGD3_ENST00000337352.6_Missense_Mutation_p.A324V	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	324	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						CGGAAGGATGCGGAGAGTGAG	0.657																																																	0													16.0	19.0	18.0					9																	95772661		1969	4158	6127	SO:0001583	missense	0			AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.971C>T	9.37:g.95772661C>T	ENSP00000364631:p.Ala324Val		F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.A324V	ENST00000375482.3	37	c.971	CCDS43849.1	9	.	.	.	.	.	.	.	.	.	.	C	18.91	3.722708	0.68959	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352	T;T;T	0.61980	0.06;0.06;0.06	4.29	4.29	0.51040	Dbl homology (DH) domain (5);	0.000000	0.37857	N	0.001905	T	0.76371	0.3978	M	0.62088	1.915	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.77557	0.983;0.988;0.99	T	0.79785	-0.1657	10	0.87932	D	0	.	16.2015	0.82084	0.0:1.0:0.0:0.0	.	324;324;324	Q5JSP0-2;F8W7P2;Q5JSP0	.;.;FGD3_HUMAN	V	324	ENSP00000364631:A324V;ENSP00000413833:A324V;ENSP00000336914:A324V	ENSP00000336914:A324V	A	+	2	0	FGD3	94812482	1.000000	0.71417	0.924000	0.36721	0.014000	0.08584	7.407000	0.80029	2.332000	0.79248	0.561000	0.74099	GCG	FGD3	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000127084		0.657	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGD3	HGNC	protein_coding	OTTHUMT00000055493.1		0.00	43	0	C	NM_033086		95772661	+1			no_errors	ENST00000337352	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
FGFR4	2264	genome.wustl.edu	37	5	176523718	176523718	+	Missense_Mutation	SNP	G	G	A	rs140492176		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:176523718G>A	ENST00000292408.4	+	16	2374	c.2129G>A	c.(2128-2130)cGa>cAa	p.R710Q	FGFR4_ENST00000292410.3_Missense_Mutation_p.R670Q|FGFR4_ENST00000502906.1_Missense_Mutation_p.R710Q|FGFR4_ENST00000393648.2_Missense_Mutation_p.R642Q|FGFR4_ENST00000393637.1_Missense_Mutation_p.R670Q	NM_002011.3|NM_213647.1	NP_002002.3|NP_998812.1	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4	710	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphate ion homeostasis (GO:0055062)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of proteolysis (GO:0045862)|protein autophosphorylation (GO:0046777)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cholesterol homeostasis (GO:2000188)|regulation of extracellular matrix disassembly (GO:0010715)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	34	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)|Ponatinib(DB08901)	CGGATGGACCGACCCCCACAC	0.657										TSP Lung(9;0.080)																																							0									GLN/ARG,GLN/ARG,GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	48.0	49.0	49.0		2129,2009,2129	4.4	1.0	5	dbSNP_134	49	0,8600		0,0,4300	no	missense,missense,missense	FGFR4	NM_002011.3,NM_022963.2,NM_213647.1	43,43,43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign,benign,benign	710/803,670/763,710/803	176523718	1,13005	2203	4300	6503	SO:0001583	missense	0			AF202063	CCDS4410.1, CCDS4411.1	5q35.2	2013-09-19			ENSG00000160867	ENSG00000160867		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3691	protein-coding gene	gene with protein product		134935					Standard	XM_005265837		Approved	JTK2, CD334	uc003mfm.3	P22455	OTTHUMG00000151523	ENST00000292408.4:c.2129G>A	5.37:g.176523718G>A	ENSP00000292408:p.Arg710Gln		G3JVM2|G3JVM5|G3JVM7|G3JVM9|O43785|Q14309|Q71TW8|Q8TDA0|Q96KE5	Missense_Mutation	SNP	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R710Q	ENST00000292408.4	37	c.2129	CCDS4410.1	5	.	.	.	.	.	.	.	.	.	.	g	18.70	3.679122	0.68042	2.27E-4	0.0	ENSG00000160867	ENST00000292408;ENST00000393648;ENST00000502906;ENST00000292410;ENST00000393637;ENST00000377207	D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59	4.43	4.43	0.53597	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.060646	0.64402	D	0.000003	T	0.65471	0.2694	N	0.02765	-0.5	0.32754	N	0.506039	D;D;D	0.58268	0.982;0.977;0.966	P;B;P	0.46585	0.521;0.386;0.489	T	0.73122	-0.4082	10	0.45353	T	0.12	.	8.0674	0.30669	0.1846:0.0:0.8154:0.0	.	642;670;710	B4DVP5;P22455-2;P22455	.;.;FGFR4_HUMAN	Q	710;642;710;670;670;938	ENSP00000292408:R710Q;ENSP00000377259:R642Q;ENSP00000424960:R710Q;ENSP00000292410:R670Q;ENSP00000377254:R670Q	ENSP00000292408:R710Q	R	+	2	0	FGFR4	176456324	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.187000	0.65087	2.010000	0.58986	0.556000	0.70494	CGA	FGFR4	-	pirsf_FGF_rcpt_fam,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000160867		0.657	FGFR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGFR4	HGNC	protein_coding	OTTHUMT00000253410.1	-	0.00	93	0	G			176523718	+1	tier1	rs140492176	no_errors	ENST00000292408	ensembl	human	known	74_37	missense	67.14	23	47	SNP	1.000	A
FIGNL1	63979	genome.wustl.edu	37	7	50514642	50514642	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:50514642A>G	ENST00000419119.1	-	2	1897	c.344T>C	c.(343-345)gTa>gCa	p.V115A	FIGNL1_ENST00000433017.1_Missense_Mutation_p.V115A|FIGNL1_ENST00000435566.1_3'UTR|FIGNL1_ENST00000395556.2_Missense_Mutation_p.V115A|FIGNL1_ENST00000356889.4_Missense_Mutation_p.V115A			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	115					ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				CATCTTCTGTACACTACTCAT	0.383																																																	0													92.0	93.0	93.0					7																	50514642		2203	4300	6503	SO:0001583	missense	0			AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.344T>C	7.37:g.50514642A>G	ENSP00000410811:p.Val115Ala		D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.V115A	ENST00000419119.1	37	c.344	CCDS5510.1	7	.	.	.	.	.	.	.	.	.	.	A	18.54	3.646662	0.67358	.	.	ENSG00000132436	ENST00000356889;ENST00000395556;ENST00000433017;ENST00000419119;ENST00000436590	T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89	5.22	4.06	0.47325	.	0.144791	0.44285	N	0.000476	T	0.27489	0.0675	L	0.61387	1.9	0.80722	D	1	B	0.13145	0.007	B	0.12156	0.007	T	0.06807	-1.0806	10	0.72032	D	0.01	-11.5374	11.0491	0.47876	0.9263:0.0:0.0737:0.0	.	115	Q6PIW4	FIGL1_HUMAN	A	115	ENSP00000349356:V115A;ENSP00000378924:V115A;ENSP00000399997:V115A;ENSP00000410811:V115A;ENSP00000394070:V115A	ENSP00000349356:V115A	V	-	2	0	FIGNL1	50482136	1.000000	0.71417	0.140000	0.22221	0.976000	0.68499	6.964000	0.76061	0.929000	0.37192	0.460000	0.39030	GTA	FIGNL1	-	NULL	ENSG00000132436		0.383	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FIGNL1	HGNC	protein_coding	OTTHUMT00000342579.1	-	0.00	36	0	A	NM_001042762		50514642	-1	tier1	-	no_errors	ENST00000356889	ensembl	human	known	74_37	missense	27.78	26	10	SNP	0.952	G
FIP1L1	81608	genome.wustl.edu	37	4	54319248	54319249	+	Frame_Shift_Del	DEL	AG	AG	-	rs143671659		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:54319248_54319249delAG	ENST00000337488.6	+	16	1641_1642	c.1447_1448delAG	c.(1447-1449)agafs	p.R483fs	FIP1L1_ENST00000358575.5_Frame_Shift_Del_p.R477fs|FIP1L1_ENST00000306932.6_Frame_Shift_Del_p.R409fs|FIP1L1_ENST00000507166.1_Intron	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	483	Arg-rich.|Glu-rich.|Sufficient for interaction with CPSF1 and CSTF3.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R487fs*3(2)		large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			agaACGCACCAGAGAGAGAGAG	0.47			T	PDGFRA	idiopathic hypereosinophilic syndrome																																			Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	2	Deletion - Frameshift(2)	large_intestine(1)|kidney(1)																																								SO:0001589	frameshift_variant	0			AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.1447_1448delAG	4.37:g.54319258_54319259delAG	ENSP00000336752:p.Arg483fs		B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Frame_Shift_Del	DEL	pfam_Fip1	p.E486fs	ENST00000337488.6	37	c.1447_1448	CCDS3491.1	4																																																																																			FIP1L1	-	NULL	ENSG00000145216		0.470	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	FIP1L1	HGNC	protein_coding	OTTHUMT00000250602.1		0.00	40	0	AG	NM_030917		54319249	+1	tier1		no_errors	ENST00000337488	ensembl	human	known	74_37	frame_shift_del	10.26	35	4	DEL	0.975:0.991	-
FLG	2312	genome.wustl.edu	37	1	152282747	152282747	+	Missense_Mutation	SNP	T	T	G	rs536230632		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:152282747T>G	ENST00000368799.1	-	3	4650	c.4615A>C	c.(4615-4617)Agt>Cgt	p.S1539R	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1539	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.S1539R(2)		autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGCTTGCACTTCTGGGTCCT	0.572									Ichthyosis				T|||	1	0.000199681	0.0	0.0	5008	,	,		20676	0.0		0.0	False		,,,				2504	0.001																2	Substitution - Missense(2)	large_intestine(1)|lung(1)											303.0	293.0	296.0					1																	152282747		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4615A>C	1.37:g.152282747T>G	ENSP00000357789:p.Ser1539Arg		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S1539R	ENST00000368799.1	37	c.4615	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	T	9.888	1.203497	0.22121	.	.	ENSG00000143631	ENST00000368799	T	0.01821	4.62	2.67	-0.792	0.10925	.	.	.	.	.	T	0.00784	0.0026	M	0.75447	2.3	0.09310	N	1	B	0.17852	0.024	B	0.15870	0.014	T	0.42050	-0.9474	9	0.25106	T	0.35	.	5.1967	0.15243	0.0:0.4182:0.0:0.5818	.	1539	P20930	FILA_HUMAN	R	1539	ENSP00000357789:S1539R	ENSP00000357789:S1539R	S	-	1	0	FLG	150549371	0.003000	0.15002	0.000000	0.03702	0.169000	0.22640	0.226000	0.17776	-0.281000	0.09141	0.397000	0.26171	AGT	FLG	-	NULL	ENSG00000143631		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	199	0	T	NM_002016		152282747	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	17.72	129	28	SNP	0.000	G
FLG2	388698	genome.wustl.edu	37	1	152327672	152327672	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:152327672T>G	ENST00000388718.5	-	3	2662	c.2590A>C	c.(2590-2592)Agt>Cgt	p.S864R	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	864	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTCCCGAACTTGACCCATGT	0.502																																																	0													382.0	334.0	351.0					1																	152327672		2203	4299	6502	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.2590A>C	1.37:g.152327672T>G	ENSP00000373370:p.Ser864Arg		Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.S864R	ENST00000388718.5	37	c.2590	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	T	8.989	0.977268	0.18812	.	.	ENSG00000143520	ENST00000388718	T	0.20598	2.06	4.6	-6.99	0.01605	.	.	.	.	.	T	0.04003	0.0112	L	0.40543	1.245	0.09310	N	1	B	0.22909	0.077	B	0.12837	0.008	T	0.37126	-0.9719	9	0.20046	T	0.44	0.2728	8.7803	0.34787	0.1058:0.2114:0.0:0.6828	.	864	Q5D862	FILA2_HUMAN	R	864	ENSP00000373370:S864R	ENSP00000373370:S864R	S	-	1	0	FLG2	150594296	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-4.762000	0.00189	-1.253000	0.02488	-0.417000	0.06048	AGT	FLG2	-	NULL	ENSG00000143520		0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	-	0.00	161	0	T	NM_001014342		152327672	-1	tier1	-	no_errors	ENST00000388718	ensembl	human	known	74_37	missense	16.89	123	25	SNP	0.000	G
LOC400867	400867	genome.wustl.edu	37	21	40250362	40250362	+	lincRNA	DEL	A	A	-	rs528877348	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr21:40250362delA	ENST00000380931.2	-	0	2675																											tttgaaaatTAAAAAAAAAAA	0.284																																																	0																																												0																															21.37:g.40250362delA				RNA	DEL	-	NULL	ENST00000380931.2	37	NULL		21																																																																																			AF064858.6	-	-	ENSG00000205622		0.284	AF064858.6-001	KNOWN	basic	lincRNA	FLJ45139	Clone_based_vega_gene	lincRNA	OTTHUMT00000141410.2		0.00	14	0	A			40250362	-1	tier1		no_errors	ENST00000380931	ensembl	human	known	74_37	rna	33.33	22	11	DEL	0.001	-
DMBT1P1	375940	genome.wustl.edu	37	10	124539665	124539665	+	RNA	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:124539665C>T	ENST00000439464.2	+	0	1667					NR_003570.1																						GCACCGTGTGCGACGACCTGT	0.672																																																	0																																												0																															10.37:g.124539665C>T				RNA	SNP	-	NULL	ENST00000439464.2	37	NULL		10																																																																																			RP11-318C4.2	-	-	ENSG00000176584		0.672	RP11-318C4.2-001	KNOWN	basic	processed_transcript	FLJ46361	Clone_based_vega_gene	pseudogene	OTTHUMT00000471298.1	-	0.00	97	0	C			124539665	+1	tier1	-	no_errors	ENST00000439464	ensembl	human	known	74_37	rna	5.80	65	4	SNP	0.982	T
FLRT2	23768	genome.wustl.edu	37	14	86089605	86089605	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr14:86089605C>T	ENST00000330753.4	+	2	2514	c.1747C>T	c.(1747-1749)Cgg>Tgg	p.R583W	FLRT2_ENST00000554746.1_Missense_Mutation_p.R583W	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	583					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)	p.R583W(1)		NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		CAACCGGGGCCGGCGGAAAGA	0.502																																																	1	Substitution - Missense(1)	lung(1)											82.0	90.0	87.0					14																	86089605		2203	4300	6503	SO:0001583	missense	0			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1747C>T	14.37:g.86089605C>T	ENSP00000332879:p.Arg583Trp		A0AV84|B7ZLP3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.R583W	ENST00000330753.4	37	c.1747	CCDS9877.1	14	.	.	.	.	.	.	.	.	.	.	C	16.34	3.096101	0.56075	.	.	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	T;T	0.63417	-0.04;-0.04	6.17	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.76983	0.4064	L	0.59436	1.845	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.79727	-0.1682	10	0.87932	D	0	-18.9898	17.0036	0.86387	0.1285:0.8715:0.0:0.0	.	583	O43155	FLRT2_HUMAN	W	583;583;236	ENSP00000332879:R583W;ENSP00000451050:R583W	ENSP00000332879:R583W	R	+	1	2	FLRT2	85159358	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.397000	0.34543	1.611000	0.50210	0.655000	0.94253	CGG	FLRT2	-	NULL	ENSG00000185070		0.502	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	HGNC	protein_coding	OTTHUMT00000413193.1	-	0.00	28	0	C			86089605	+1	tier1	-	no_errors	ENST00000330753	ensembl	human	known	74_37	missense	31.82	15	7	SNP	1.000	T
FREM1	158326	genome.wustl.edu	37	9	14846024	14846024	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:14846024C>T	ENST00000380880.3	-	8	2110	c.1327G>A	c.(1327-1329)Gac>Aac	p.D443N	FREM1_ENST00000380881.4_Missense_Mutation_p.D444N|FREM1_ENST00000422223.2_Missense_Mutation_p.D443N			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	443					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		CCAATGTCGTCATTGTCGACA	0.488																																																	0													62.0	67.0	65.0					9																	14846024		2098	4234	6332	SO:0001583	missense	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.1327G>A	9.37:g.14846024C>T	ENSP00000370262:p.Asp443Asn		B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.D444N	ENST00000380880.3	37	c.1330	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	C	12.82	2.051622	0.36181	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.51325	0.71;0.71;0.71	4.91	4.02	0.46733	.	0.142736	0.64402	D	0.000007	T	0.60418	0.2267	M	0.93106	3.38	0.47441	D	0.999425	B	0.22983	0.078	B	0.29524	0.103	T	0.65721	-0.6099	10	0.62326	D	0.03	-15.3493	13.7303	0.62783	0.0:0.9247:0.0:0.0753	.	443	Q5H8C1	FREM1_HUMAN	N	444;443;443	ENSP00000370263:D444N;ENSP00000412940:D443N;ENSP00000370262:D443N	ENSP00000370257:D446N	D	-	1	0	FREM1	14836024	1.000000	0.71417	1.000000	0.80357	0.044000	0.14063	5.699000	0.68310	1.201000	0.43203	-0.448000	0.05591	GAC	FREM1	-	NULL	ENSG00000164946		0.488	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	-	0.00	43	0	C	NM_144966		14846024	-1	tier1	-	no_errors	ENST00000380881	ensembl	human	known	74_37	missense	54.55	15	18	SNP	1.000	T
FREM3	166752	genome.wustl.edu	37	4	144616997	144616997	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:144616997T>C	ENST00000329798.5	-	1	4831	c.4832A>G	c.(4831-4833)gAc>gGc	p.D1611G		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1611					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						CTCACTGCCGTCATGCTTGTA	0.498																																																	0													205.0	167.0	179.0					4																	144616997		692	1591	2283	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.4832A>G	4.37:g.144616997T>C	ENSP00000332886:p.Asp1611Gly			Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.D1611G	ENST00000329798.5	37	c.4832	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	T	13.49	2.254022	0.39896	.	.	ENSG00000183090	ENST00000329798	T	0.51817	0.69	4.03	4.03	0.46877	.	0.140304	0.44483	D	0.000445	T	0.69033	0.3066	M	0.89840	3.065	0.58432	D	0.999998	.	.	.	.	.	.	T	0.75105	-0.3435	8	0.54805	T	0.06	-2.6421	12.0807	0.53669	0.0:0.0:0.0:1.0	.	.	.	.	G	1611	ENSP00000332886:D1611G	ENSP00000332886:D1611G	D	-	2	0	FREM3	144836447	1.000000	0.71417	0.192000	0.23308	0.003000	0.03518	7.146000	0.77373	1.686000	0.51046	0.460000	0.39030	GAC	FREM3	-	NULL	ENSG00000183090		0.498	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	-	0.00	30	0	T	XM_094074		144616997	-1	tier1	-	no_errors	ENST00000329798	ensembl	human	putative	74_37	missense	31.43	24	11	SNP	1.000	C
FREM3	166752	genome.wustl.edu	37	4	144620168	144620168	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:144620168A>C	ENST00000329798.5	-	1	1660	c.1661T>G	c.(1660-1662)cTc>cGc	p.L554R	RP13-578N3.3_ENST00000499587.2_RNA	NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	554					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						CCCTTCAGTGAGTGAGAGTCC	0.517																																																	0													72.0	68.0	69.0					4																	144620168		692	1591	2283	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.1661T>G	4.37:g.144620168A>C	ENSP00000332886:p.Leu554Arg			Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.L554R	ENST00000329798.5	37	c.1661	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	A	11.83	1.754949	0.31046	.	.	ENSG00000183090	ENST00000329798	T	0.33654	1.4	4.16	4.16	0.48862	.	0.438823	0.19895	N	0.103660	T	0.44117	0.1278	L	0.53671	1.685	0.18873	N	0.999988	.	.	.	.	.	.	T	0.38286	-0.9668	8	0.87932	D	0	-0.5759	12.3145	0.54948	1.0:0.0:0.0:0.0	.	.	.	.	R	554	ENSP00000332886:L554R	ENSP00000332886:L554R	L	-	2	0	FREM3	144839618	0.907000	0.30839	0.002000	0.10522	0.014000	0.08584	8.235000	0.89803	1.742000	0.51746	0.533000	0.62120	CTC	FREM3	-	NULL	ENSG00000183090		0.517	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	-	0.00	68	0	A	XM_094074		144620168	-1	tier1	-	no_errors	ENST00000329798	ensembl	human	putative	74_37	missense	34.78	30	16	SNP	0.078	C
FSIP2	401024	genome.wustl.edu	37	2	186665416	186665416	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:186665416C>A	ENST00000424728.1	+	17	11383	c.11383C>A	c.(11383-11385)Caa>Aaa	p.Q3795K	FSIP2_ENST00000343098.5_Missense_Mutation_p.Q3884K|AC008174.3_ENST00000436557.1_RNA|AC008174.3_ENST00000429929.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	3795										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AAAAATGCTTCAAAGTGTAGA	0.388																																																	0																																										SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.11383C>A	2.37:g.186665416C>A	ENSP00000401306:p.Gln3795Lys		Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.Q3884K	ENST00000424728.1	37	c.11650		2	.	.	.	.	.	.	.	.	.	.	C	6.351	0.432913	0.12045	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.51325	0.71;0.71	4.96	3.09	0.35607	.	.	.	.	.	T	0.32406	0.0828	N	0.14661	0.345	0.19300	N	0.999978	.	.	.	.	.	.	T	0.23332	-1.0191	7	0.62326	D	0.03	.	6.8402	0.23959	0.0:0.7283:0.1762:0.0955	.	.	.	.	K	3884;3795	ENSP00000344403:Q3884K;ENSP00000401306:Q3795K	ENSP00000344403:Q3884K	Q	+	1	0	FSIP2	186373661	0.341000	0.24801	0.294000	0.24946	0.036000	0.12997	0.341000	0.19909	0.620000	0.30215	0.460000	0.39030	CAA	FSIP2	-	NULL	ENSG00000188738		0.388	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	-	0.00	22	0	C	NM_173651		186665416	+1	tier1	-	no_errors	ENST00000343098	ensembl	human	known	74_37	missense	33.33	12	6	SNP	0.796	A
FTLP10	100130017	genome.wustl.edu	37	4	69048154	69048154	+	RNA	SNP	G	G	A	rs368186529		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:69048154G>A	ENST00000503647.1	+	0	145					NR_015446.1				ferritin, light polypeptide pseudogene 10																		CTACCGCGACGACGTGACCCT	0.632																																																	0																																												0					4q13.2	2010-03-12			ENSG00000250426	ENSG00000250426			37959	pseudogene	pseudogene							Standard	NR_015446		Approved		uc010iho.1		OTTHUMG00000160804		4.37:g.69048154G>A				RNA	SNP	-	NULL	ENST00000503647.1	37	NULL		4																																																																																			FTLP10	-	-	ENSG00000250426		0.632	FTLP10-002	KNOWN	basic	processed_transcript	FTLP10	HGNC	pseudogene	OTTHUMT00000362415.1	-	0.00	121	0	G	NR_015446		69048154	+1	tier1	-	no_errors	ENST00000503647	ensembl	human	known	74_37	rna	34.85	43	23	SNP	0.000	A
FURIN	5045	genome.wustl.edu	37	15	91420846	91420846	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr15:91420846G>A	ENST00000268171.3	+	7	946		c.e7+1			NM_002569.2	NP_002560.1	P09958	FURIN_HUMAN	furin (paired basic amino acid cleaving enzyme)						cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of low-density lipoprotein particle receptor catabolic process (GO:0032804)|negative regulation of transforming growth factor beta1 production (GO:0032911)|nerve growth factor processing (GO:0032455)|nerve growth factor production (GO:0032902)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|peptidyl-glutamic acid carboxylation (GO:0017187)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-translational protein modification (GO:0043687)|protein processing (GO:0016485)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)|regulation of protein catabolic process (GO:0042176)|secretion by cell (GO:0032940)|signal peptide processing (GO:0006465)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	endopeptidase activity (GO:0004175)|metal ion binding (GO:0046872)|nerve growth factor binding (GO:0048406)|peptidase activity (GO:0008233)|peptide binding (GO:0042277)|protease binding (GO:0002020)|serine-type endopeptidase activity (GO:0004252)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(4)|endometrium(4)|large_intestine(3)|liver(2)|lung(13)|ovary(2)|prostate(3)|skin(1)|urinary_tract(3)	36	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			CGCATTGGAGGTGAGTGTGGG	0.637																																																	0													60.0	41.0	47.0					15																	91420846		2181	4280	6461	SO:0001630	splice_region_variant	0			X17094	CCDS10364.1	15q26.1	2007-01-24	2002-12-04	2002-12-06	ENSG00000140564	ENSG00000140564			8568	protein-coding gene	gene with protein product		136950	"""paired basic amino acid cleaving enzyme (furin, membrane associated receptor protein)"""	PCSK3, FUR, PACE		2251280, 1741956	Standard	NM_002569		Approved	SPC1	uc002bpu.1	P09958	OTTHUMG00000149831	ENST00000268171.3:c.667+1G>A	15.37:g.91420846G>A			Q14336|Q6LBS3|Q9UCZ5	Splice_Site	SNP	-	e6+1	ENST00000268171.3	37	c.667+1	CCDS10364.1	15	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893429	0.52121	.	.	ENSG00000140564	ENST00000268171	.	.	.	3.92	2.94	0.34122	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1783	0.59639	0.0:0.1607:0.8393:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FURIN	89221850	1.000000	0.71417	1.000000	0.80357	0.705000	0.40729	9.168000	0.94781	2.028000	0.59812	0.650000	0.86243	.	FURIN	-	-	ENSG00000140564		0.637	FURIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FURIN	HGNC	protein_coding	OTTHUMT00000313492.1	-	0.00	34	0	G	NM_002569	Intron	91420846	+1	tier1	-	no_errors	ENST00000268171	ensembl	human	known	74_37	splice_site	15.91	37	7	SNP	1.000	A
FZD2	2535	genome.wustl.edu	37	17	42635388	42635388	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:42635388G>A	ENST00000315323.3	+	1	464	c.332G>A	c.(331-333)cGc>cAc	p.R111H		NM_001466.3	NP_001457.1	Q14332	FZD2_HUMAN	frizzled class receptor 2	111	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cell-cell signaling (GO:0007267)|cochlea morphogenesis (GO:0090103)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|inner ear receptor cell development (GO:0060119)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of cGMP metabolic process (GO:0030825)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|sensory perception of smell (GO:0007608)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(8)	33		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CCGCCGTGCCGCTCTATCTGT	0.662																																																	0													63.0	67.0	65.0					17																	42635388		2203	4300	6503	SO:0001583	missense	0			L37882	CCDS11484.1	17q21.1	2014-01-29	2014-01-29			ENSG00000180340		"""GPCR / Class F : Frizzled receptors"""	4040	protein-coding gene	gene with protein product		600667	"""frizzled (Drosophila) homolog 2"", ""frizzled homolog 2 (Drosophila)"", ""frizzled 2, seven transmembrane spanning receptor"", ""frizzled family receptor 2"""			7558010, 9813155	Standard	NM_001466		Approved		uc002igx.2	Q14332		ENST00000315323.3:c.332G>A	17.37:g.42635388G>A	ENSP00000323901:p.Arg111His		Q0VG82	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.R111H	ENST00000315323.3	37	c.332	CCDS11484.1	17	.	.	.	.	.	.	.	.	.	.	g	22.7	4.319593	0.81469	.	.	ENSG00000180340	ENST00000541149;ENST00000315323	D	0.84070	-1.8	3.99	3.99	0.46301	Frizzled domain (5);	0.000000	0.85682	D	0.000000	D	0.93070	0.7794	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.95121	0.8246	10	0.87932	D	0	.	15.7054	0.77577	0.0:0.0:1.0:0.0	.	111	Q14332	FZD2_HUMAN	H	187;111	ENSP00000323901:R111H	ENSP00000323901:R111H	R	+	2	0	FZD2	39990914	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.666000	0.83877	1.753000	0.51906	0.462000	0.41574	CGC	FZD2	-	pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom	ENSG00000180340		0.662	FZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD2	HGNC	protein_coding	OTTHUMT00000457806.1		0.00	53	0	G	NM_001466		42635388	+1			no_errors	ENST00000315323	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
GABRA1	2554	genome.wustl.edu	37	5	161277886	161277886	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:161277886A>G	ENST00000428797.2	+	3	425	c.70A>G	c.(70-72)Aga>Gga	p.R24G	GABRA1_ENST00000444819.1_Missense_Mutation_p.R24G|GABRA1_ENST00000420560.1_Missense_Mutation_p.R24G|GABRA1_ENST00000023897.6_Missense_Mutation_p.R24G|GABRA1_ENST00000393943.4_Missense_Mutation_p.R24G|GABRA1_ENST00000437025.2_Missense_Mutation_p.R24G	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	24					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	ACTGACTGGAAGAAGGTGGGG	0.413																																																	0													84.0	80.0	81.0					5																	161277886		2203	4300	6503	SO:0001583	missense	0				CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.70A>G	5.37:g.161277886A>G	ENSP00000393097:p.Arg24Gly		D3DQK6|Q8N629	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa1_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.R24G	ENST00000428797.2	37	c.70	CCDS4357.1	5	.	.	.	.	.	.	.	.	.	.	A	10.29	1.309209	0.23821	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000521339;ENST00000420560;ENST00000522651;ENST00000444819;ENST00000519621	T;T;T;T;T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-0.45;-1.19;-0.46;-1.19;-0.45	5.41	4.25	0.50352	.	0.215494	0.32357	N	0.006216	T	0.60314	0.2259	N	0.19112	0.55	0.36358	D	0.860521	B	0.17038	0.02	B	0.12156	0.007	T	0.56098	-0.8035	10	0.17832	T	0.49	.	9.1583	0.37007	0.9139:0.0:0.0861:0.0	.	24	P14867	GBRA1_HUMAN	G	24;24;24;24;30;24;24;24;24	ENSP00000023897:R24G;ENSP00000393097:R24G;ENSP00000377517:R24G;ENSP00000415441:R24G;ENSP00000430895:R30G;ENSP00000408041:R24G;ENSP00000430507:R24G;ENSP00000414232:R24G;ENSP00000430435:R24G	ENSP00000023897:R24G	R	+	1	2	GABRA1	161210464	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.331000	0.59273	0.887000	0.36136	0.528000	0.53228	AGA	GABRA1	-	prints_GABBAa1_rcpt,tigrfam_Neur_channel	ENSG00000022355		0.413	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA1	HGNC	protein_coding	OTTHUMT00000252702.2	-	0.00	55	0	A	NM_000806.5		161277886	+1	tier1	-	no_errors	ENST00000023897	ensembl	human	known	74_37	missense	26.83	30	11	SNP	1.000	G
GALNT13	114805	genome.wustl.edu	37	2	154801092	154801092	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:154801092T>G	ENST00000392825.3	+	3	649	c.82T>G	c.(82-84)Ttc>Gtc	p.F28V	GALNT13_ENST00000409237.1_Missense_Mutation_p.F28V	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	28					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)	p.F28L(1)		NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						ACTGCTGTACTTCAGTGAATG	0.418																																																	1	Substitution - Missense(1)	large_intestine(1)											254.0	225.0	235.0					2																	154801092		2203	4300	6503	SO:0001583	missense	0			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.82T>G	2.37:g.154801092T>G	ENSP00000376570:p.Phe28Val		Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.F28V	ENST00000392825.3	37	c.82	CCDS2199.1	2	.	.	.	.	.	.	.	.	.	.	T	28.1	4.892888	0.91889	.	.	ENSG00000144278	ENST00000392825;ENST00000409237	T;T	0.60171	0.29;0.21	5.43	5.43	0.79202	.	.	.	.	.	T	0.72637	0.3485	M	0.73962	2.25	0.80722	D	1	D;P	0.58970	0.984;0.695	P;B	0.61477	0.889;0.206	T	0.74839	-0.3528	9	0.49607	T	0.09	.	14.2927	0.66289	0.0:0.0:0.0:1.0	.	28;28	Q08ER7;Q8IUC8	.;GLT13_HUMAN	V	28	ENSP00000376570:F28V;ENSP00000387239:F28V	ENSP00000376570:F28V	F	+	1	0	GALNT13	154509338	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.968000	0.87980	2.056000	0.61249	0.477000	0.44152	TTC	GALNT13	-	NULL	ENSG00000144278		0.418	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT13	HGNC	protein_coding	OTTHUMT00000254870.2	-	0.00	83	0	T	NM_052917		154801092	+1	tier1	-	no_errors	ENST00000409237	ensembl	human	known	74_37	missense	49.25	34	33	SNP	1.000	G
GALNT18	374378	genome.wustl.edu	37	11	11362428	11362428	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:11362428C>T	ENST00000227756.4	-	7	1627	c.1216G>A	c.(1216-1218)Gct>Act	p.A406T		NM_198516.2	NP_940918.2	Q6P9A2	GLT18_HUMAN	polypeptide N-acetylgalactosaminyltransferase 18	406					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										CAGACTTCAGCCACCCTGAGA	0.572																																																	0													205.0	206.0	205.0					11																	11362428		2201	4294	6495	SO:0001583	missense	0			AK055111	CCDS7807.1	11p15	2014-03-13	2014-03-13	2013-01-25	ENSG00000110328	ENSG00000110328	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	30488	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 18"""	615136	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 4"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 18"""	GALNTL4		22186971	Standard	NM_198516		Approved	MGC71806, GALNT15, GalNAc-T18	uc001mjo.2	Q6P9A2	OTTHUMG00000165707	ENST00000227756.4:c.1216G>A	11.37:g.11362428C>T	ENSP00000227756:p.Ala406Thr		O95903|Q8NDY9	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.A406T	ENST00000227756.4	37	c.1216	CCDS7807.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.514197	0.96402	.	.	ENSG00000110328	ENST00000227756	T	0.72051	-0.62	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.88537	0.6463	M	0.94063	3.49	0.80722	D	1	D	0.63880	0.993	D	0.74674	0.984	D	0.90888	0.4759	10	0.87932	D	0	.	18.4818	0.90815	0.0:1.0:0.0:0.0	.	406	Q6P9A2	GLTL4_HUMAN	T	406	ENSP00000227756:A406T	ENSP00000227756:A406T	A	-	1	0	GALNTL4	11319004	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.968000	0.70413	2.716000	0.92895	0.561000	0.74099	GCT	GALNT18	-	NULL	ENSG00000110328		0.572	GALNT18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT18	HGNC	protein_coding	OTTHUMT00000385848.1	-	0.00	49	0	C	NM_198516		11362428	-1	tier1	-	no_errors	ENST00000227756	ensembl	human	known	74_37	missense	50.00	18	18	SNP	1.000	T
GCH1	2643	genome.wustl.edu	37	14	55309802	55309802	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr14:55309802C>T	ENST00000491895.2	-	0	1874				GCH1_ENST00000254299.4_5'UTR|GCH1_ENST00000536224.2_Intron|GCH1_ENST00000395514.1_Intron|GCH1_ENST00000543643.2_Intron	NM_000161.2	NP_000152.1	P30793	GCH1_HUMAN	GTP cyclohydrolase 1						7,8-dihydroneopterin 3'-triphosphate biosynthetic process (GO:0035998)|dopamine biosynthetic process (GO:0042416)|GTP catabolic process (GO:0006184)|metabolic process (GO:0008152)|negative regulation of blood pressure (GO:0045776)|neuromuscular process controlling posture (GO:0050884)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric-oxide synthase activity (GO:0051000)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|pteridine-containing compound biosynthetic process (GO:0042559)|regulation of blood pressure (GO:0008217)|regulation of lung blood pressure (GO:0014916)|regulation of nitric-oxide synthase activity (GO:0050999)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|response to pain (GO:0048265)|response to tumor necrosis factor (GO:0034612)|small molecule metabolic process (GO:0044281)|tetrahydrobiopterin biosynthetic process (GO:0006729)|tetrahydrofolate biosynthetic process (GO:0046654)|vasodilation (GO:0042311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|protein complex (GO:0043234)	calcium ion binding (GO:0005509)|coenzyme binding (GO:0050662)|GTP binding (GO:0005525)|GTP cyclohydrolase I activity (GO:0003934)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(2)|lung(7)|skin(2)	11						TCAAATGTTTCTGGAAATACT	0.378																																					Pancreas(198;1245 2204 4807 21567 38372)												0													48.0	45.0	46.0					14																	55309802		1820	4083	5903	SO:0001624	3_prime_UTR_variant	0			U19523	CCDS9720.1, CCDS41954.1, CCDS45110.1	14q22.1-q22.2	2014-04-01	2008-08-01		ENSG00000131979	ENSG00000131979	3.5.4.16		4193	protein-coding gene	gene with protein product	"""dopa-responsive dystonia"""	600225	"""dystonia 14"""	GCH, DYT5, DYT14		7874165, 8695054	Standard	XM_005267530		Approved	GTPCH1, DYT5a	uc001xbi.1	P30793	OTTHUMG00000029754	ENST00000491895.2:c.*933G>A	14.37:g.55309802C>T			Q6FHY7|Q9Y4I8	RNA	SNP	-	NULL	ENST00000491895.2	37	NULL	CCDS9720.1	14																																																																																			GCH1	-	-	ENSG00000131979		0.378	GCH1-002	NOVEL	basic|appris_principal|CCDS	protein_coding	GCH1	HGNC	protein_coding	OTTHUMT00000276895.3	-	0.00	46	0	C			55309802	-1	tier1	-	no_errors	ENST00000254299	ensembl	human	known	74_37	rna	11.76	30	4	SNP	0.001	T
GDPD5	81544	genome.wustl.edu	37	11	75148017	75148017	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:75148017C>T	ENST00000336898.3	-	16	2470	c.1633G>A	c.(1633-1635)Gac>Aac	p.D545N	GDPD5_ENST00000529721.1_Missense_Mutation_p.D545N|GDPD5_ENST00000533784.1_Missense_Mutation_p.D426N|GDPD5_ENST00000526177.1_Missense_Mutation_p.D407N|GDPD5_ENST00000376282.3_Missense_Mutation_p.D426N|GDPD5_ENST00000533805.1_Missense_Mutation_p.D300N|GDPD5_ENST00000443276.2_3'UTR	NM_030792.6	NP_110419.5	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain containing 5	545					cerebral cortex neuron differentiation (GO:0021895)|glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)|negative regulation of Notch signaling pathway (GO:0045746)|neuron projection development (GO:0031175)|positive regulation of neuron differentiation (GO:0045666)|regulation of timing of cell differentiation (GO:0048505)|spinal cord motor neuron differentiation (GO:0021522)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|skin(2)	20						ATGCTGACGTCCCGGCTGGTC	0.622																																																	0													73.0	65.0	68.0					11																	75148017		2200	4293	6493	SO:0001583	missense	0			AF318377	CCDS8238.1	11q13.4-q13.5	2011-01-25				ENSG00000158555			28804	protein-coding gene	gene with protein product		609632				18667693, 17275818	Standard	NM_030792		Approved	PP1665, GDE2	uc001owp.4	Q8WTR4		ENST00000336898.3:c.1633G>A	11.37:g.75148017C>T	ENSP00000337972:p.Asp545Asn		Q49AQ5|Q6UX76|Q7Z4S0|Q8N781|Q8NCB7|Q8TB77	Missense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.D545N	ENST00000336898.3	37	c.1633	CCDS8238.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.343336	0.95783	.	.	ENSG00000158555	ENST00000526177;ENST00000533784;ENST00000529721;ENST00000336898;ENST00000533805;ENST00000376282;ENST00000534322	T;T;T;T;T;T;T	0.48522	1.63;1.7;1.79;1.79;1.7;1.7;0.81	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.65657	0.2712	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.68032	-0.5516	10	0.66056	D	0.02	-24.9822	16.1297	0.81418	0.0:1.0:0.0:0.0	.	426;545	Q8WTR4-2;Q8WTR4	.;GDPD5_HUMAN	N	407;426;545;545;300;426;134	ENSP00000434050:D407N;ENSP00000437049:D426N;ENSP00000433214:D545N;ENSP00000337972:D545N;ENSP00000435196:D300N;ENSP00000365459:D426N;ENSP00000435728:D134N	ENSP00000337972:D545N	D	-	1	0	GDPD5	74825665	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.212000	0.77941	2.388000	0.81334	0.462000	0.41574	GAC	GDPD5	-	NULL	ENSG00000158555		0.622	GDPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPD5	HGNC	protein_coding	OTTHUMT00000384409.1	-	0.00	40	0	C	NM_030792		75148017	-1	tier1	-	no_errors	ENST00000336898	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	T
GLIPR1	11010	genome.wustl.edu	37	12	75884283	75884283	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:75884283G>C	ENST00000266659.3	+	3	719	c.518G>C	c.(517-519)tGc>tCc	p.C173S	RP11-585P4.5_ENST00000547326.1_RNA	NM_006851.2	NP_006842.2	P48060	GLIP1_HUMAN	GLI pathogenesis-related 1	173	SCP.				cellular lipid metabolic process (GO:0044255)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|skin(1)	14						CATTTTATATGCAACTACGGA	0.443																																																	0													86.0	81.0	83.0					12																	75884283		2203	4300	6503	SO:0001583	missense	0			U16307	CCDS9011.1	12q14.1	2008-08-15	2008-08-15			ENSG00000139278			17001	protein-coding gene	gene with protein product		602692	"""GLI pathogenesis-related 1 (glioma)"""			7607567, 8973356	Standard	NM_006851		Approved	RTVP1, GliPR	uc001sxs.3	P48060	OTTHUMG00000169757	ENST00000266659.3:c.518G>C	12.37:g.75884283G>C	ENSP00000266659:p.Cys173Ser		A7YET6|F8VUC2|Q15409|Q969K2	Missense_Mutation	SNP	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1,prints_V5_allergen	p.C173S	ENST00000266659.3	37	c.518	CCDS9011.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.4|20.4	3.980226|3.980226	0.74474|0.74474	.|.	.|.	ENSG00000139278|ENSG00000139278	ENST00000456650;ENST00000550491|ENST00000266659	T|T	0.14640|0.68765	2.49|-0.35	5.61|5.61	5.61|5.61	0.85477|0.85477	.|Allergen V5/Tpx-1-related, conserved site (1);CAP domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.89399|0.89399	0.6704|0.6704	H|H	0.98559|0.98559	4.265|4.265	0.80722|0.80722	D|D	1|1	D|D	0.76494|0.89917	0.999|1.0	D|D	0.69142|0.91635	0.962|0.999	D|D	0.93230|0.93230	0.6616|0.6616	9|10	0.87932|0.87932	D|D	0|0	.|.	17.824|17.824	0.88658|0.88658	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	197|173	F6VVE8|P48060	.|GLIP1_HUMAN	P|S	197;56|173	ENSP00000391144:A197P|ENSP00000266659:C173S	ENSP00000391144:A197P|ENSP00000266659:C173S	A|C	+|+	1|2	0|0	GLIPR1|GLIPR1	74170550|74170550	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.880000|7.880000	0.87243|0.87243	2.638000|2.638000	0.89438|0.89438	0.655000|0.655000	0.94253|0.94253	GCA|TGC	GLIPR1	-	pfam_CAP_domain,superfamily_CAP_domain,smart_Allrgn_V5/Tpx1,prints_Allrgn_V5/Tpx1	ENSG00000139278		0.443	GLIPR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIPR1	HGNC	protein_coding	OTTHUMT00000405722.1	-	0.00	75	0	G	NM_006851		75884283	+1	tier1	-	no_errors	ENST00000266659	ensembl	human	known	74_37	missense	63.89	13	23	SNP	1.000	C
GNA15	2769	genome.wustl.edu	37	19	3151744	3151744	+	Silent	SNP	C	C	T	rs372177672		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:3151744C>T	ENST00000262958.3	+	4	783	c.525C>T	c.(523-525)taC>taT	p.Y175Y	AC005264.2_ENST00000587587.1_RNA	NM_002068.2	NP_002059.2	P30679	GNA15_HUMAN	guanine nucleotide binding protein (G protein), alpha 15 (Gq class)	175					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			large_intestine(5)|lung(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.04e-05)|OV - Ovarian serous cystadenocarcinoma(105;5.08e-113)|Epithelial(107;6.19e-111)|all cancers(105;6.19e-103)|BRCA - Breast invasive adenocarcinoma(158;0.00145)|STAD - Stomach adenocarcinoma(1328;0.184)		AGGAGGGCTACGTCCCCACAG	0.642																																																	0										0,4406		0,0,2203	122.0	104.0	110.0		525	1.2	0.1	19		110	2,8598	818.5+/-406.9	0,2,4298	no	coding-synonymous	GNA15	NM_002068.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		175/375	3151744	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12104.1	19p13.3	2008-07-16				ENSG00000060558			4383	protein-coding gene	gene with protein product		139314				1302014	Standard	NM_002068		Approved	GNA16	uc002lxf.2	P30679		ENST00000262958.3:c.525C>T	19.37:g.3151744C>T			E9KL40|E9KL47|O75247|Q53XK2	Silent	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha_Q	p.Y175	ENST00000262958.3	37	c.525	CCDS12104.1	19																																																																																			GNA15	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su	ENSG00000060558		0.642	GNA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA15	HGNC	protein_coding	OTTHUMT00000452320.2		0.00	46	0	C	NM_002068		3151744	+1			no_errors	ENST00000262958	ensembl	human	known	74_37	silent	6.25	30	2	SNP	0.938	T
GOLGA8T	653075	genome.wustl.edu	37	15	30434527	30434527	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr15:30434527A>C	ENST00000569052.1	+	13	1142	c.1142A>C	c.(1141-1143)aAc>aCc	p.N381T	AC120045.2_ENST00000408858.1_RNA|RN7SL469P_ENST00000491512.2_RNA					golgin A8 family, member T																		AACAATGAGAACAAGAACGCA	0.562																																																	0																																										SO:0001583	missense	0					15q13.2	2013-01-17			ENSG00000261247	ENSG00000261247			44410	other	unknown							Standard	NR_033933		Approved		uc021sha.1		OTTHUMG00000175638	ENST00000569052.1:c.1142A>C	15.37:g.30434527A>C	ENSP00000455826:p.Asn381Thr			Missense_Mutation	SNP	NULL	p.N381T	ENST00000569052.1	37	c.1142		15																																																																																			GOLGA8T	-	NULL	ENSG00000261247		0.562	GOLGA8T-001	NOVEL	basic|appris_principal	protein_coding	GOLGA8T	HGNC	protein_coding	OTTHUMT00000430690.1	-	0.00	79	0	A	NR_033933		30434527	+1	tier1	-	no_errors	ENST00000569052	ensembl	human	novel	74_37	missense	23.64	42	13	SNP	1.000	C
GPATCH1	55094	genome.wustl.edu	37	19	33585137	33585137	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:33585137G>T	ENST00000170564.2	+	5	829	c.515G>T	c.(514-516)gGt>gTt	p.G172V		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	172	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					CAAGGAGTTGGTCCTCGAGTA	0.383																																					Pancreas(67;88 1713 4567 18227)												0													110.0	114.0	112.0					19																	33585137		2203	4300	6503	SO:0001583	missense	0			AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.515G>T	19.37:g.33585137G>T	ENSP00000170564:p.Gly172Val		Q8IZV6|Q8N3B7|Q9NW94	Missense_Mutation	SNP	pfam_DUF1604,pfam_G_patch_dom,superfamily_C-type_lectin_fold,pfscan_G_patch_dom	p.G172V	ENST00000170564.2	37	c.515	CCDS12428.1	19	.	.	.	.	.	.	.	.	.	.	G	25.5	4.646863	0.87958	.	.	ENSG00000076650	ENST00000170564	D	0.99270	-5.66	5.46	5.46	0.80206	D111/G-patch (3);	0.000000	0.85682	D	0.000000	D	0.99501	0.9822	M	0.88512	2.96	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98628	1.0670	10	0.62326	D	0.03	-18.9296	18.3148	0.90217	0.0:0.0:1.0:0.0	.	172	Q9BRR8	GPTC1_HUMAN	V	172	ENSP00000170564:G172V	ENSP00000170564:G172V	G	+	2	0	GPATCH1	38276977	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.536000	0.90627	2.574000	0.86865	0.460000	0.39030	GGT	GPATCH1	-	pfam_G_patch_dom,superfamily_C-type_lectin_fold,pfscan_G_patch_dom	ENSG00000076650		0.383	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH1	HGNC	protein_coding	OTTHUMT00000450834.1		0.00	109	0	G	NM_018025		33585137	+1			no_errors	ENST00000170564	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	T
GPR37L1	9283	genome.wustl.edu	37	1	202097525	202097527	+	In_Frame_Del	DEL	CTG	CTG	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	CTG	CTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:202097525_202097527delCTG	ENST00000367282.5	+	2	1393_1395	c.1287_1289delCTG	c.(1285-1290)gactgc>gac	p.C436del		NM_004767.3	NP_004758.3	O60883	ETBR2_HUMAN	G protein-coupled receptor 37 like 1	436	Cys-rich.				negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	18						CCTTCCTGGActgctgctgctgc	0.626																																																	0										2,128,4136		0,0,2,9,110,2012						3.1	1.0			46	5,240,8007		0,0,5,10,220,3891	no	codingComplex	GPR37L1	NM_004767.3		0,0,7,19,330,5903	A1A1,A1A2,A1R,A2A2,A2R,RR		2.969,3.0474,2.9957				7,368,12143				SO:0001651	inframe_deletion	0			AJ310210	CCDS1420.1	1q32	2012-08-21	2006-02-15		ENSG00000170075	ENSG00000170075		"""GPCR / Class A : Orphans"""	14923	protein-coding gene	gene with protein product						9539149	Standard	NM_004767		Approved	ETBR-LP-2	uc001gxj.3	O60883	OTTHUMG00000035924	ENST00000367282.5:c.1287_1289delCTG	1.37:g.202097534_202097536delCTG	ENSP00000356251:p.Cys436del		B2R7M9|Q5SXP7|Q86VP7	In_Frame_Del	DEL	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR37_orph,prints_GPCR_Rhodpsn	p.C433in_frame_del	ENST00000367282.5	37	c.1287_1289	CCDS1420.1	1																																																																																			GPR37L1	-	NULL	ENSG00000170075		0.626	GPR37L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37L1	HGNC	protein_coding	OTTHUMT00000087496.2		0.00	49	0	CTG	NM_004767		202097527	+1			no_errors	ENST00000367282	ensembl	human	known	74_37	in_frame_del	8.05	80	7	DEL	0.998:0.998:0.996	0
GPR83	10888	genome.wustl.edu	37	11	94113737	94113737	+	Missense_Mutation	SNP	G	G	A	rs200087801		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:94113737G>A	ENST00000243673.2	-	4	1021	c.850C>T	c.(850-852)Cgg>Tgg	p.R284W	GPR83_ENST00000539203.2_Missense_Mutation_p.R242W	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	284					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTTTTGCGCCGCAGGGCAAAG	0.542																																																	0													105.0	76.0	86.0					11																	94113737		2201	4298	6499	SO:0001583	missense	0			AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.850C>T	11.37:g.94113737G>A	ENSP00000243673:p.Arg284Trp		B0M0K5|Q6NWR4|Q9P1Y8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.R284W	ENST00000243673.2	37	c.850	CCDS8297.1	11	.	.	.	.	.	.	.	.	.	.	G	17.27	3.347455	0.61183	.	.	ENSG00000123901	ENST00000243673;ENST00000539203	T;T	0.72942	-0.7;-0.7	5.21	3.31	0.37934	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.86171	0.5869	M	0.92219	3.285	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	D	0.87170	0.2220	10	0.48119	T	0.1	.	13.3304	0.60483	0.0:0.0:0.7134:0.2866	.	284	Q9NYM4	GPR83_HUMAN	W	284;242	ENSP00000243673:R284W;ENSP00000441550:R242W	ENSP00000243673:R284W	R	-	1	2	GPR83	93753385	1.000000	0.71417	0.999000	0.59377	0.819000	0.46315	2.265000	0.43311	0.565000	0.29255	-0.152000	0.13540	CGG	GPR83	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000123901		0.542	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	HGNC	protein_coding	OTTHUMT00000396232.1	-	0.00	36	0	G	NM_016540		94113737	-1	tier1	rs200087801	no_errors	ENST00000243673	ensembl	human	known	74_37	missense	45.45	12	10	SNP	1.000	A
GPRC5B	51704	genome.wustl.edu	37	16	19873217	19873217	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:19873217G>A	ENST00000300571.2	-	3	1300	c.1109C>T	c.(1108-1110)cCg>cTg	p.P370L	GPRC5B_ENST00000537135.1_Missense_Mutation_p.P396L|GPRC5B_ENST00000535671.1_Missense_Mutation_p.P370L|GPRC5B_ENST00000569479.1_Missense_Mutation_p.P370L|GPRC5B_ENST00000569847.1_Missense_Mutation_p.P370L	NM_016235.1	NP_057319.1	Q9NZH0	GPC5B_HUMAN	G protein-coupled receptor, class C, group 5, member B	370					glucose homeostasis (GO:0042593)|locomotory behavior (GO:0007626)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein tyrosine kinase activity (GO:0061098)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|G-protein coupled receptor binding (GO:0001664)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)	p.P370R(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25						GCTTCTAAACGGAGCGCTGGG	0.562																																																	1	Substitution - Missense(1)	lung(1)											121.0	100.0	107.0					16																	19873217		2197	4300	6497	SO:0001583	missense	0			AF202640	CCDS10581.1	16p12	2014-01-30	2014-01-30		ENSG00000167191	ENSG00000167191		"""GPCR / Class C : Orphans"""	13308	protein-coding gene	gene with protein product		605948	"""G protein-coupled receptor, family C, group 1, member B"", ""G protein-coupled receptor, family C, group 5, member B"""			10493829, 10783259	Standard	XM_005255357		Approved	RAIG-2	uc002dgt.3	Q9NZH0	OTTHUMG00000131460	ENST00000300571.2:c.1109C>T	16.37:g.19873217G>A	ENSP00000300571:p.Pro370Leu		D2DFB0|O75205|Q8NBZ8	Missense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.P396L	ENST00000300571.2	37	c.1187	CCDS10581.1	16	.	.	.	.	.	.	.	.	.	.	G	24.2	4.505899	0.85282	.	.	ENSG00000167191	ENST00000300571;ENST00000535671;ENST00000538074;ENST00000537135	T;T;T	0.27720	1.67;1.66;1.65	5.31	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.46718	0.1407	L	0.48642	1.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.32693	-0.9897	9	.	.	.	.	13.0052	0.58701	0.0775:0.0:0.9225:0.0	.	396;370	B7Z831;Q9NZH0	.;GPC5B_HUMAN	L	370;370;219;396	ENSP00000300571:P370L;ENSP00000442858:P370L;ENSP00000441775:P396L	.	P	-	2	0	GPRC5B	19780718	1.000000	0.71417	0.528000	0.27938	0.966000	0.64601	9.071000	0.93980	1.245000	0.43885	-0.136000	0.14681	CCG	GPRC5B	-	NULL	ENSG00000167191		0.562	GPRC5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRC5B	HGNC	protein_coding	OTTHUMT00000254285.1	-	0.00	48	0	G			19873217	-1	tier1	-	no_errors	ENST00000537135	ensembl	human	known	74_37	missense	29.27	29	12	SNP	0.997	A
GUCY1A2	2977	genome.wustl.edu	37	11	106680878	106680878	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:106680878T>G	ENST00000526355.2	-	5	2001	c.1533A>C	c.(1531-1533)caA>caC	p.Q511H	GUCY1A2_ENST00000282249.2_Missense_Mutation_p.Q511H|GUCY1A2_ENST00000347596.2_Missense_Mutation_p.Q532H	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	511					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	TGGCCTGTACTTGCTGCCCTT	0.458																																																	0													129.0	123.0	125.0					11																	106680878		2201	4298	6499	SO:0001583	missense	0			X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.1533A>C	11.37:g.106680878T>G	ENSP00000431245:p.Gln511His		A1L4C4|B7ZLT5	Missense_Mutation	SNP	pfam_Haem_no_assoc-bd,pfam_A/G_cyclase,pfam_Heme_NO-bd,superfamily_A/G_cyclase,superfamily_NO_sig/Golgi_transp_ligand-bd,smart_A/G_cyclase,pfscan_A/G_cyclase	p.Q511H	ENST00000526355.2	37	c.1533	CCDS8335.1	11	.	.	.	.	.	.	.	.	.	.	T	15.47	2.842105	0.51057	.	.	ENSG00000152402	ENST00000526355;ENST00000282249;ENST00000347596	D;D;D	0.86865	-1.85;-2.18;-1.85	5.57	0.559	0.17272	Adenylyl cyclase class-3/4/guanylyl cyclase (3);	0.000000	0.43747	U	0.000528	D	0.83876	0.5349	L	0.27975	0.815	0.34768	D	0.733456	D;P;P	0.53151	0.958;0.931;0.947	P;P;B	0.55161	0.535;0.77;0.339	D	0.83797	0.0234	10	0.40728	T	0.16	.	10.7048	0.45948	0.0:0.4605:0.0:0.5395	.	532;511;511	B7ZLT5;P33402-2;P33402	.;.;GCYA2_HUMAN	H	511;511;532	ENSP00000431245:Q511H;ENSP00000282249:Q511H;ENSP00000344874:Q532H	ENSP00000282249:Q511H	Q	-	3	2	GUCY1A2	106186088	0.988000	0.35896	0.997000	0.53966	0.935000	0.57460	0.212000	0.17497	-0.133000	0.11537	-0.268000	0.10319	CAA	GUCY1A2	-	superfamily_A/G_cyclase,smart_A/G_cyclase	ENSG00000152402		0.458	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	GUCY1A2	HGNC	protein_coding	OTTHUMT00000389003.2	-	0.00	44	0	T			106680878	-1	tier1	-	no_errors	ENST00000282249	ensembl	human	known	74_37	missense	21.21	26	7	SNP	0.962	G
GYPB	2994	genome.wustl.edu	37	4	144922415	144922415	+	Missense_Mutation	SNP	A	A	G	rs189622883	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:144922415A>G	ENST00000502664.1	-	2	110	c.59T>C	c.(58-60)tTa>tCa	p.L20S	GYPB_ENST00000510196.2_5'UTR|GYPB_ENST00000429670.2_Missense_Mutation_p.L20S|GYPB_ENST00000283126.7_Missense_Mutation_p.L20S|RP11-673E1.4_ENST00000506982.1_RNA|GYPB_ENST00000513128.1_Intron	NM_002100.4	NP_002091	P06028	GLPB_HUMAN	glycophorin B (MNS blood group)	20						integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					AGTGGTACTTAATGCTGATAT	0.353																																																	0													129.0	161.0	150.0					4																	144922415		2196	4300	6496	SO:0001583	missense	0				CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028		ENST00000502664.1:c.59T>C	4.37:g.144922415A>G	ENSP00000427690:p.Leu20Ser		B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	Missense_Mutation	SNP	pfam_Glycophorin	p.L20S	ENST00000502664.1	37	c.59	CCDS54809.1	4	.	.	.	.	.	.	.	.	.	.	G	4.940	0.174631	0.09391	.	.	ENSG00000250361	ENST00000283126;ENST00000502664;ENST00000429670	T;T;T	0.04406	4.6;4.6;3.63	1.55	0.248	0.15526	.	.	.	.	.	T	0.03520	0.0101	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.43621	-0.9380	8	0.51188	T	0.08	.	2.4243	0.04455	0.2725:0.0:0.2871:0.4404	.	20	E2QBW7	.	S	20	ENSP00000283126:L20S;ENSP00000427690:L20S;ENSP00000394200:L20S	ENSP00000283126:L20S	L	-	2	0	GYPB	145141865	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-4.249000	0.00266	-0.311000	0.08754	-1.389000	0.01157	TTA	GYPB	-	NULL	ENSG00000250361		0.353	GYPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYPB	HGNC	protein_coding	OTTHUMT00000364791.1	-	0.00	187	0	A	NM_002100		144922415	-1	tier1	-	no_errors	ENST00000283126	ensembl	human	known	74_37	missense	33.83	88	45	SNP	0.000	G
HBE1	3046	genome.wustl.edu	37	11	5290750	5290750	+	Silent	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:5290750C>T	ENST00000380237.1	-	4	593	c.249G>A	c.(247-249)aaG>aaA	p.K83K	HBG2_ENST00000380259.2_Intron|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000292896.2_Silent_p.K83K			P02100	HBE_HUMAN	hemoglobin, epsilon 1	83					blood coagulation (GO:0007596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein heterooligomerization (GO:0051291)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|hemoglobin complex (GO:0005833)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|oxygen transporter activity (GO:0005344)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|skin(1)	20		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.34e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAAAGGCGGGCTTGAGGTTGT	0.517																																																	0													144.0	131.0	135.0					11																	5290750		2201	4297	6498	SO:0001819	synonymous_variant	0			BC015537	CCDS7756.1	11p15.5	2012-10-02			ENSG00000213931	ENSG00000213931			4830	protein-coding gene	gene with protein product		142100				2649166	Standard	NM_005330		Approved	HBE	uc001mal.1	P02100	OTTHUMG00000066675	ENST00000380237.1:c.249G>A	11.37:g.5290750C>T			Q6FH44	Silent	SNP	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b,prints_Myoglobin	p.K83	ENST00000380237.1	37	c.249	CCDS7756.1	11																																																																																			HBE1	-	pfam_Globin,superfamily_Globin-like,pfscan_Globin,prints_Haemoglobin_b	ENSG00000213931		0.517	HBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBE1	HGNC	protein_coding	OTTHUMT00000142973.2	-	0.00	121	0	C	NM_005330		5290750	-1	tier1	-	no_errors	ENST00000292896	ensembl	human	known	74_37	silent	61.97	27	44	SNP	0.175	T
HIP1R	9026	genome.wustl.edu	37	12	123335423	123335423	+	Frame_Shift_Del	DEL	A	A	-	rs201745943		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:123335423delA	ENST00000253083.4	+	6	605	c.480delA	c.(478-480)gtafs	p.V160fs		NM_003959.1	NP_003950.1	O75146	HIP1R_HUMAN	huntingtin interacting protein 1 related	160					receptor-mediated endocytosis (GO:0006898)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(5)|kidney(6)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	26	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;4.6e-05)|Epithelial(86;0.000119)|BRCA - Breast invasive adenocarcinoma(302;0.2)		CAGATGAGGTACTGGAGAAGG	0.627																																																	0													86.0	70.0	75.0					12																	123335423		2203	4300	6503	SO:0001589	frameshift_variant	0			AB013384	CCDS31922.1	12q24	2007-12-07			ENSG00000130787	ENSG00000130787			18415	protein-coding gene	gene with protein product		605613				16415883	Standard	NM_003959		Approved	KIAA0655, HIP3, HIP12, FLJ14000, ILWEQ	uc001udj.1	O75146	OTTHUMG00000168765	ENST00000253083.4:c.480delA	12.37:g.123335423delA	ENSP00000253083:p.Val160fs		A6NHQ6|Q6NXG8|Q9UED9	Frame_Shift_Del	DEL	pfam_ANTH_dom,pfam_ILWEQ_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_ILWEQ_dom,pfscan_Epsin-like_N,pfscan_ILWEQ_dom	p.L161fs	ENST00000253083.4	37	c.480	CCDS31922.1	12																																																																																			HIP1R	-	pfam_ANTH_dom	ENSG00000130787		0.627	HIP1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1R	HGNC	protein_coding	OTTHUMT00000400935.1		0.00	27	0	A	NM_003959		123335423	+1	tier1		no_errors	ENST00000253083	ensembl	human	known	74_37	frame_shift_del	22.22	7	2	DEL	0.467	-
HLA-G	3135	genome.wustl.edu	37	6	29797279	29797279	+	Missense_Mutation	SNP	C	C	T	rs147620137		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:29797279C>T	ENST00000360323.6	+	4	728	c.704C>T	c.(703-705)gCg>gTg	p.A235V	HLA-G_ENST00000376818.3_Missense_Mutation_p.A143V|HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000376828.2_Missense_Mutation_p.A240V|HLA-G_ENST00000428701.1_Missense_Mutation_p.A235V			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	235	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						TTCTACCCTGCGGAGATCATA	0.617																																																	0								C	VAL/ALA	4,4402		0,4,2199	81.0	83.0	82.0		704	-3.4	0.2	6	dbSNP_134	82	0,8594		0,0,4297	no	missense	HLA-G	NM_002127.5	64	0,4,6496	TT,TC,CC		0.0,0.0908,0.0308	probably-damaging	235/339	29797279	4,12996	2203	4297	6500	SO:0001583	missense	0				CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.704C>T	6.37:g.29797279C>T	ENSP00000353472:p.Ala235Val			Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.A240V	ENST00000360323.6	37	c.719	CCDS4668.1	6	.	.	.	.	.	.	.	.	.	.	.	3.530	-0.095879	0.07010	9.08E-4	0.0	ENSG00000204632	ENST00000376828;ENST00000428701;ENST00000360323;ENST00000376818	T;T;T;T	0.15372	2.43;2.43;2.43;4.06	1.72	-3.44	0.04796	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.433805	0.16471	U	0.212974	T	0.04815	0.0130	M	0.81239	2.535	0.09310	N	1	P;B;B	0.45634	0.863;0.236;0.378	B;B;B	0.35114	0.196;0.001;0.031	T	0.09058	-1.0692	10	0.87932	D	0	.	1.4516	0.02376	0.4733:0.232:0.1609:0.1338	.	240;143;235	Q5RJ85;Q31611;P17693	.;.;HLAG_HUMAN	V	240;235;235;143	ENSP00000366024:A240V;ENSP00000412927:A235V;ENSP00000353472:A235V;ENSP00000366014:A143V	ENSP00000353472:A235V	A	+	2	0	HLA-G	29905258	0.000000	0.05858	0.249000	0.24280	0.243000	0.25628	-1.433000	0.02428	-2.174000	0.00772	-0.901000	0.02856	GCG	HLA-G	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000204632		0.617	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-G	HGNC	protein_coding	OTTHUMT00000076286.2	-	0.00	107	0	C	NM_002127		29797279	+1	tier1	rs147620137	no_errors	ENST00000376828	ensembl	human	known	74_37	missense	78.15	26	93	SNP	0.292	T
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29975966	29975967	+	RNA	INS	-	-	C	rs3835310|rs371303258|rs555413243	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:29975966_29975967insC	ENST00000376797.3	-	0	1053				ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|HLA-J_ENST00000462773.1_RNA|ZNRD1-AS1_ENST00000448093.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		TTCCTTTCAGACCCCCCCCAAG	0.574																																																	0																																												0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29975974_29975974dupC				RNA	INS	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.574	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1		0.00	101	0	-	NR_026751		29975967	+1	tier1		no_errors	ENST00000462773	ensembl	human	known	74_37	rna	45.00	33	27	INS	0.073:0.011	C
HIVEP2	3097	genome.wustl.edu	37	6	143092548	143092548	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:143092548G>T	ENST00000367604.1	-	4	3967	c.3328C>A	c.(3328-3330)Cac>Aac	p.H1110N	HIVEP2_ENST00000367603.2_Missense_Mutation_p.H1110N|HIVEP2_ENST00000012134.2_Missense_Mutation_p.H1110N			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1110					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GCATGCAGGTGCTCCAGCTGC	0.627																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0													43.0	49.0	47.0					6																	143092548		2119	4248	6367	SO:0001583	missense	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3328C>A	6.37:g.143092548G>T	ENSP00000356576:p.His1110Asn		Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H1110N	ENST00000367604.1	37	c.3328	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	G	11.27	1.587920	0.28268	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.44482	0.92;0.92;0.92	5.67	5.67	0.87782	.	0.229191	0.52532	D	0.000064	T	0.27967	0.0689	M	0.61703	1.905	0.80722	D	1	B	0.31383	0.321	B	0.23275	0.045	T	0.09207	-1.0685	10	0.22109	T	0.4	-0.8158	19.7763	0.96395	0.0:0.0:1.0:0.0	.	1110	P31629	ZEP2_HUMAN	N	1110	ENSP00000356576:H1110N;ENSP00000356575:H1110N;ENSP00000012134:H1110N	ENSP00000012134:H1110N	H	-	1	0	HIVEP2	143134241	1.000000	0.71417	0.935000	0.37517	0.277000	0.26821	8.620000	0.90943	2.687000	0.91594	0.563000	0.77884	CAC	HIVEP2	-	NULL	ENSG00000010818		0.627	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1		0.00	55	0	G			143092548	-1			no_errors	ENST00000012134	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
HMCN1	83872	genome.wustl.edu	37	1	186086206	186086206	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:186086206G>A	ENST00000271588.4	+	76	11871	c.11642G>A	c.(11641-11643)gGt>gAt	p.G3881D	HMCN1_ENST00000367492.2_Missense_Mutation_p.G3881D	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3881	Ig-like C2-type 37.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GTGACAAACGGTGCTGGAGAT	0.403																																																	0													163.0	148.0	153.0					1																	186086206		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.11642G>A	1.37:g.186086206G>A	ENSP00000271588:p.Gly3881Asp		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.G3881D	ENST00000271588.4	37	c.11642	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	3.012	-0.203717	0.06180	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.66638	-0.22;-0.22	5.35	2.84	0.33178	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.181514	0.64402	N	0.000017	T	0.35856	0.0946	N	0.03268	-0.37	0.32504	N	0.53849	B	0.06786	0.001	B	0.08055	0.003	T	0.29058	-1.0024	10	0.12430	T	0.62	.	7.2426	0.26104	0.7749:0.1405:0.0846:0.0	.	3881	Q96RW7	HMCN1_HUMAN	D	3881	ENSP00000271588:G3881D;ENSP00000356462:G3881D	ENSP00000271588:G3881D	G	+	2	0	HMCN1	184352829	1.000000	0.71417	0.572000	0.28498	0.448000	0.32197	3.690000	0.54713	0.339000	0.23719	-0.345000	0.07892	GGT	HMCN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143341		0.403	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	49	0	G	NM_031935		186086206	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	22.22	35	10	SNP	0.998	A
HMGB1P5	10354	genome.wustl.edu	37	3	22423973	22423973	+	RNA	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:22423973T>A	ENST00000451497.1	+	0	538									high mobility group box 1 pseudogene 5																		CGCAGTTTTTTTTCTTGTCTA	0.353																																																	0																																												0			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22423973T>A				RNA	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			HMGB1P5	-	-	ENSG00000132967		0.353	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1	-	0.00	37	0	T	NG_000897		22423973	+1	tier1	-	no_errors	ENST00000451497	ensembl	human	known	74_37	rna	33.33	22	11	SNP	1.000	A
HMGB1P5	10354	genome.wustl.edu	37	3	22424272	22424272	+	RNA	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:22424272T>C	ENST00000451497.1	+	0	837									high mobility group box 1 pseudogene 5																		TCATCTTCAGTTGTCTCTGAT	0.353																																																	0																																												0			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22424272T>C				RNA	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			HMGB1P5	-	-	ENSG00000132967		0.353	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1		0.00	31	0	T	NG_000897		22424272	+1			no_errors	ENST00000451497	ensembl	human	known	74_37	rna	12.00	22	3	SNP	0.995	C
HMGB1P5	10354	genome.wustl.edu	37	3	22424293	22424293	+	RNA	SNP	C	C	G	rs141464414	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:22424293C>G	ENST00000451497.1	+	0	858									high mobility group box 1 pseudogene 5																		GCAGCTTATACGAAATAATTG	0.333																																																	0																																												0			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22424293C>G				RNA	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			HMGB1P5	-	-	ENSG00000132967		0.333	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1		0.00	27	0	C	NG_000897		22424293	+1			no_errors	ENST00000451497	ensembl	human	known	74_37	rna	12.00	22	3	SNP	0.996	G
HMGB4	127540	genome.wustl.edu	37	1	34330011	34330011	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:34330011A>C	ENST00000522796.1	+	4	2124	c.219A>C	c.(217-219)gaA>gaC	p.E73D	HMGB4_ENST00000425537.1_3'UTR|CSMD2_ENST00000373381.4_Intron|HMGB4_ENST00000519684.1_Missense_Mutation_p.E73D			Q8WW32	HMGB4_HUMAN	high mobility group box 4	73						chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GATACCAGGAAGAAATGATGA	0.478																																																	0													125.0	143.0	137.0					1																	34330011		2203	4300	6503	SO:0001583	missense	0				CCDS30668.1	1p35.1	2011-07-01	2011-04-05		ENSG00000176256	ENSG00000176256		"""High-mobility group / Canonical"""	24954	protein-coding gene	gene with protein product			"""high-mobility group box 4"""				Standard	NR_033264		Approved	FLJ40388	uc001bxp.3	Q8WW32	OTTHUMG00000013143	ENST00000522796.1:c.219A>C	1.37:g.34330011A>C	ENSP00000430919:p.Glu73Asp		B2R4X7|Q0QWA4	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.E73D	ENST00000522796.1	37	c.219	CCDS30668.1	1	.	.	.	.	.	.	.	.	.	.	A	14.93	2.682478	0.47991	.	.	ENSG00000176256	ENST00000519684;ENST00000522796	T;T	0.14022	2.54;2.54	5.58	-2.09	0.07232	.	0.351458	0.27886	N	0.017458	T	0.08268	0.0206	N	0.21617	0.685	0.27685	N	0.946307	B	0.09022	0.002	B	0.10450	0.005	T	0.18398	-1.0338	10	0.52906	T	0.07	.	10.319	0.43753	0.5171:0.0:0.4829:0.0	.	73	B2R4X7	.	D	73	ENSP00000429214:E73D;ENSP00000430919:E73D	ENSP00000429214:E73D	E	+	3	2	HMGB4	34102598	1.000000	0.71417	0.106000	0.21319	0.916000	0.54674	1.014000	0.29950	-0.545000	0.06224	-0.363000	0.07495	GAA	HMGB4	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000176256		0.478	HMGB4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	HMGB4	HGNC	protein_coding	OTTHUMT00000375773.1	-	0.00	38	0	A	NM_145205		34330011	+1	tier1	-	no_errors	ENST00000519684	ensembl	human	known	74_37	missense	45.71	19	16	SNP	0.782	C
HMGB4	127540	genome.wustl.edu	37	1	34330225	34330225	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:34330225A>G	ENST00000522796.1	+	4	2338	c.433A>G	c.(433-435)Aga>Gga	p.R145G	HMGB4_ENST00000425537.1_3'UTR|CSMD2_ENST00000373381.4_Intron|HMGB4_ENST00000519684.1_Missense_Mutation_p.R145G			Q8WW32	HMGB4_HUMAN	high mobility group box 4	145						chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(1)|large_intestine(1)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TTATGAGCAAAGAGTGGCTCT	0.522																																																	0													56.0	61.0	60.0					1																	34330225		2203	4300	6503	SO:0001583	missense	0				CCDS30668.1	1p35.1	2011-07-01	2011-04-05		ENSG00000176256	ENSG00000176256		"""High-mobility group / Canonical"""	24954	protein-coding gene	gene with protein product			"""high-mobility group box 4"""				Standard	NR_033264		Approved	FLJ40388	uc001bxp.3	Q8WW32	OTTHUMG00000013143	ENST00000522796.1:c.433A>G	1.37:g.34330225A>G	ENSP00000430919:p.Arg145Gly		B2R4X7|Q0QWA4	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.R145G	ENST00000522796.1	37	c.433	CCDS30668.1	1	.	.	.	.	.	.	.	.	.	.	A	15.55	2.868137	0.51588	.	.	ENSG00000176256	ENST00000519684;ENST00000522796	D;D	0.94138	-3.36;-3.36	5.24	4.09	0.47781	.	0.302724	0.32533	N	0.005969	D	0.89660	0.6779	L	0.60957	1.885	0.28992	N	0.887995	P	0.39717	0.684	B	0.34536	0.185	D	0.85756	0.1346	10	0.87932	D	0	.	8.9829	0.35977	0.8131:0.1869:0.0:0.0	.	145	B2R4X7	.	G	145	ENSP00000429214:R145G;ENSP00000430919:R145G	ENSP00000429214:R145G	R	+	1	2	HMGB4	34102812	1.000000	0.71417	0.001000	0.08648	0.035000	0.12851	4.785000	0.62418	0.980000	0.38523	0.496000	0.49642	AGA	HMGB4	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000176256		0.522	HMGB4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	HMGB4	HGNC	protein_coding	OTTHUMT00000375773.1	-	0.00	34	0	A	NM_145205		34330225	+1	tier1	-	no_errors	ENST00000519684	ensembl	human	known	74_37	missense	21.88	25	7	SNP	0.881	G
HPGDS	27306	genome.wustl.edu	37	4	95223334	95223334	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:95223334G>A	ENST00000295256.5	-	5	488	c.398C>T	c.(397-399)aCa>aTa	p.T133I	HPGDS_ENST00000514774.1_5'Flank	NM_014485.2	NP_055300.1	O60760	HPGDS_HUMAN	hematopoietic prostaglandin D synthase	133	GST C-terminal.				arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|glutathione derivative biosynthetic process (GO:1901687)|locomotory behavior (GO:0007626)|prostaglandin metabolic process (GO:0006693)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	calcium ion binding (GO:0005509)|glutathione transferase activity (GO:0004364)|magnesium ion binding (GO:0000287)|prostaglandin-D synthase activity (GO:0004667)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|lung(3)|ovary(1)|urinary_tract(1)	7					Glutathione(DB00143)	CCCTAAATATGTGTCCAAGTC	0.353																																					Colon(86;1802 1843 17863 46794)												0													155.0	159.0	158.0					4																	95223334		2203	4300	6503	SO:0001583	missense	0			D82073	CCDS3640.1	4q22.2	2012-06-21			ENSG00000163106	ENSG00000163106		"""Glutathione S-transferases / Soluble"""	17890	protein-coding gene	gene with protein product	"""glutathione S-transferase sigma"""	602598				9323136, 9353279, 11672424	Standard	XM_005262932		Approved	GSTS, PGDS, H-PGDS, PGD2, GSTS1-1	uc003hte.1	O60760	OTTHUMG00000130974	ENST00000295256.5:c.398C>T	4.37:g.95223334G>A	ENSP00000295256:p.Thr133Ile		Q6FHT9	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.T133I	ENST00000295256.5	37	c.398	CCDS3640.1	4	.	.	.	.	.	.	.	.	.	.	G	11.43	1.637437	0.29157	.	.	ENSG00000163106	ENST00000295256	T	0.02140	4.43	5.49	2.28	0.28536	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.504148	0.19056	N	0.123908	T	0.03348	0.0097	M	0.68952	2.095	0.19300	N	0.999975	B	0.29531	0.247	B	0.30646	0.118	T	0.32561	-0.9902	10	0.54805	T	0.06	.	5.8325	0.18588	0.1689:0.0:0.5605:0.2706	.	133	O60760	HPGDS_HUMAN	I	133	ENSP00000295256:T133I	ENSP00000295256:T133I	T	-	2	0	HPGDS	95442357	0.048000	0.20356	0.998000	0.56505	0.782000	0.44232	0.064000	0.14437	0.648000	0.30732	0.563000	0.77884	ACA	HPGDS	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000163106		0.353	HPGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPGDS	HGNC	protein_coding	OTTHUMT00000253587.1	-	0.00	65	0	G	NM_014485		95223334	-1	tier1	-	no_errors	ENST00000295256	ensembl	human	known	74_37	missense	34.04	31	16	SNP	0.092	A
HS1BP3	64342	genome.wustl.edu	37	2	20838373	20838373	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:20838373T>A	ENST00000304031.3	-	4	471	c.446A>T	c.(445-447)gAt>gTt	p.D149V	HS1BP3_ENST00000402541.1_Missense_Mutation_p.D149V	NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	149							phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACAGAGGAATCTCTGCTGGT	0.557																																																	0													101.0	96.0	98.0					2																	20838373		2203	4300	6503	SO:0001583	missense	0				CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.446A>T	2.37:g.20838373T>A	ENSP00000305193:p.Asp149Val		B2RAW2|D6W529|Q86VC2|Q8N367	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.D149V	ENST00000304031.3	37	c.446	CCDS1700.1	2	.	.	.	.	.	.	.	.	.	.	T	15.69	2.908919	0.52439	.	.	ENSG00000118960	ENST00000304031;ENST00000402541	T	0.20069	2.1	4.59	3.4	0.38934	Phox homologous domain (1);	0.572438	0.17629	N	0.167450	T	0.23410	0.0566	L	0.57536	1.79	0.22050	N	0.999397	P;P	0.48694	0.874;0.914	P;P	0.46758	0.491;0.526	T	0.06588	-1.0818	10	0.30078	T	0.28	-8.0145	7.1917	0.25828	0.0:0.109:0.0:0.891	.	149;149	F6TR53;Q53T59	.;H1BP3_HUMAN	V	149	ENSP00000305193:D149V	ENSP00000305193:D149V	D	-	2	0	HS1BP3	20701854	0.766000	0.28496	0.806000	0.32338	0.751000	0.42716	1.275000	0.33144	1.812000	0.52913	0.397000	0.26171	GAT	HS1BP3	-	superfamily_Phox	ENSG00000118960		0.557	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS1BP3	HGNC	protein_coding	OTTHUMT00000242863.1	-	0.00	56	0	T	NM_022460		20838373	-1	tier1	-	no_errors	ENST00000304031	ensembl	human	known	74_37	missense	21.05	29	8	SNP	0.217	A
HS6ST2	90161	genome.wustl.edu	37	X	132090940	132090940	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:132090940G>T	ENST00000370836.2	-	3	1258	c.843C>A	c.(841-843)ttC>ttA	p.F281L	HS6ST2_ENST00000521489.1_Missense_Mutation_p.F281L|HS6ST2_ENST00000370833.2_Missense_Mutation_p.F135L	NM_147175.3	NP_671704.3	Q96MM7	H6ST2_HUMAN	heparan sulfate 6-O-sulfotransferase 2	281					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)	9	Acute lymphoblastic leukemia(192;0.000127)					AGCCCGTGGAGAACCTGGAGA	0.657																																																	0													18.0	22.0	21.0					X																	132090940		2178	4256	6434	SO:0001583	missense	0			AB067776	CCDS48169.1, CCDS48170.1	Xq26.2	2008-02-05			ENSG00000171004	ENSG00000171004		"""Sulfotransferases, membrane-bound"""	19133	protein-coding gene	gene with protein product		300545				10644753	Standard	NM_147175		Approved		uc011mvd.1	Q96MM7	OTTHUMG00000022430	ENST00000370836.2:c.843C>A	X.37:g.132090940G>T	ENSP00000359873:p.Phe281Leu		B9WRT4|B9WRT5|E9PDY5|Q2TB13|Q4VC07|Q6PIC4|Q86SM9|Q8N3T4|Q8NBN4|Q96SJ4	Missense_Mutation	SNP	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.F281L	ENST00000370836.2	37	c.843	CCDS48169.1	X	.	.	.	.	.	.	.	.	.	.	g	16.40	3.113437	0.56398	.	.	ENSG00000171004	ENST00000370837;ENST00000370836;ENST00000521489;ENST00000370833;ENST00000319809	T;T;T;T	0.74421	1.2;1.2;-0.84;-0.84	4.56	3.7	0.42460	.	0.000000	0.85682	D	0.000000	T	0.76962	0.4061	M	0.85945	2.785	0.80722	D	1	B;B	0.29378	0.027;0.243	B;B	0.33846	0.109;0.171	T	0.77078	-0.2721	10	0.87932	D	0	0.111	10.4945	0.44770	0.0983:0.0:0.9017:0.0	.	281;281	Q96MM7;E9PDY5	H6ST2_HUMAN;.	L	135;281;281;135;122	ENSP00000359874:F135L;ENSP00000359873:F281L;ENSP00000429473:F281L;ENSP00000359870:F135L	ENSP00000324617:F122L	F	-	3	2	HS6ST2	131918622	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.161000	0.64935	0.926000	0.37118	0.525000	0.51046	TTC	HS6ST2	-	pfam_Sulfotransferase,superfamily_P-loop_NTPase	ENSG00000171004		0.657	HS6ST2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HS6ST2	HGNC	protein_coding	OTTHUMT00000058332.3	-	0.00	28	0	G	NM_147174		132090940	-1	tier1	-	no_errors	ENST00000521489	ensembl	human	known	74_37	missense	80.56	7	29	SNP	1.000	T
IMPG2	50939	genome.wustl.edu	37	3	100976494	100976494	+	Missense_Mutation	SNP	T	T	G	rs34375459	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:100976494T>G	ENST00000193391.7	-	10	1219	c.1032A>C	c.(1030-1032)aaA>aaC	p.K344N		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	344	SEA 1. {ECO:0000255|PROSITE- ProRule:PRU00188}.		K -> N (in dbSNP:rs34375459).		visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	CAACAGTGGGTTTATCATCCA	0.438																																																	0													119.0	116.0	117.0					3																	100976494		2203	4300	6503	SO:0001583	missense	0			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.1032A>C	3.37:g.100976494T>G	ENSP00000193391:p.Lys344Asn		A8MWT5|Q9UKD4|Q9UKK5	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.K344N	ENST00000193391.7	37	c.1032	CCDS2940.1	3	.	.	.	.	.	.	.	.	.	.	T	13.57	2.276537	0.40294	.	.	ENSG00000081148	ENST00000193391	T	0.23348	1.91	5.51	-1.86	0.07760	SEA (1);	0.075437	0.56097	D	0.000039	T	0.14874	0.0359	L	0.39898	1.24	0.35828	D	0.825065	B;B	0.33171	0.4;0.4	B;B	0.34873	0.191;0.113	T	0.14755	-1.0461	10	0.23891	T	0.37	-17.3853	3.8071	0.08782	0.1258:0.1889:0.1119:0.5734	rs34375459	344;344	F1T0J3;Q9BZV3	.;IMPG2_HUMAN	N	344	ENSP00000193391:K344N	ENSP00000193391:K344N	K	-	3	2	IMPG2	102459184	0.003000	0.15002	0.988000	0.46212	0.916000	0.54674	-1.684000	0.01932	-0.451000	0.07097	0.379000	0.24179	AAA	IMPG2	-	smart_SEA_dom	ENSG00000081148		0.438	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG2	HGNC	protein_coding	OTTHUMT00000353256.3	-	0.00	43	0	T			100976494	-1	tier1	rs34375459	no_errors	ENST00000193391	ensembl	human	known	74_37	missense	70.59	5	12	SNP	0.968	G
IPP	3652	genome.wustl.edu	37	1	46193439	46193439	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:46193439C>T	ENST00000396478.3	-	5	1014	c.912G>A	c.(910-912)tgG>tgA	p.W304*		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	304						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					TGCTATCACTCCAGCGACCCC	0.448																																																	0													153.0	150.0	151.0					1																	46193439		2203	4300	6503	SO:0001587	stop_gained	0			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.912G>A	1.37:g.46193439C>T	ENSP00000379739:p.Trp304*		A2A6V4|D3DQ11|Q8N5C3	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.W304*	ENST00000396478.3	37	c.912	CCDS30702.1	1	.	.	.	.	.	.	.	.	.	.	C	37	6.613391	0.97705	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	.	.	.	5.86	5.86	0.93980	.	0.262714	0.43579	D	0.000554	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.5632	0.99335	0.0:1.0:0.0:0.0	.	.	.	.	X	304	.	ENSP00000353024:W304X	W	-	3	0	IPP	45966026	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.524000	0.81866	2.937000	0.99478	0.650000	0.86243	TGG	IPP	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000197429		0.448	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	IPP	HGNC	protein_coding	OTTHUMT00000021974.3	-	0.00	46	0	C	NM_005897		46193439	-1	tier1	-	no_errors	ENST00000396478	ensembl	human	known	74_37	nonsense	35.71	18	10	SNP	1.000	T
ITGAX	3687	genome.wustl.edu	37	16	31374554	31374554	+	Silent	SNP	G	G	A	rs144979651		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:31374554G>A	ENST00000268296.4	+	14	1690	c.1569G>A	c.(1567-1569)gcG>gcA	p.A523A	ITGAX_ENST00000562522.1_Silent_p.A523A	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	523					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						GCTTTGGGGCGGCTCTGACAG	0.617																																																	0								G		1,4393	2.1+/-5.4	0,1,2196	108.0	118.0	114.0		1569	-5.1	1.0	16	dbSNP_134	114	0,8600		0,0,4300	no	coding-synonymous	ITGAX	NM_000887.3		0,1,6496	AA,AG,GG		0.0,0.0228,0.0077		523/1164	31374554	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.1569G>A	16.37:g.31374554G>A			Q8IVA6	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.A523	ENST00000268296.4	37	c.1569	CCDS10711.1	16																																																																																			ITGAX	-	pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	ENSG00000140678		0.617	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	-	0.00	137	0	G	NM_000887		31374554	+1	tier1	rs144979651	no_errors	ENST00000268296	ensembl	human	known	74_37	silent	31.79	102	48	SNP	0.025	A
ITGAX	3687	genome.wustl.edu	37	16	31391152	31391152	+	Silent	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:31391152T>C	ENST00000268296.4	+	25	3064	c.2943T>C	c.(2941-2943)gcT>gcC	p.A981A	ITGAX_ENST00000562522.1_Silent_p.A981A	NM_000887.3	NP_000878.2	P20702	ITAX_HUMAN	integrin, alpha X (complement component 3 receptor 4 subunit)	981					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|organ morphogenesis (GO:0009887)	cell surface (GO:0009986)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(42)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	77						ACCAGGAGGCTGTGTGGATGG	0.587																																																	0													60.0	50.0	53.0					16																	31391152		2197	4300	6497	SO:0001819	synonymous_variant	0			BC038237	CCDS10711.1, CCDS67014.1	16p11.2	2010-03-23	2006-02-10		ENSG00000140678	ENSG00000140678		"""CD molecules"", ""Complement system"", ""Integrins"""	6152	protein-coding gene	gene with protein product		151510	"""integrin, alpha X (antigen CD11C (p150), alpha polypeptide)"""	CD11C		3284962, 2303426	Standard	NM_001286375		Approved	CD11c	uc002ebu.1	P20702	OTTHUMG00000132465	ENST00000268296.4:c.2943T>C	16.37:g.31391152T>C			Q8IVA6	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.A981	ENST00000268296.4	37	c.2943	CCDS10711.1	16																																																																																			ITGAX	-	pfam_Integrin_alpha-2	ENSG00000140678		0.587	ITGAX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAX	HGNC	protein_coding	OTTHUMT00000255628.2	-	0.00	57	0	T	NM_000887		31391152	+1	tier1	-	no_errors	ENST00000268296	ensembl	human	known	74_37	silent	28.85	37	15	SNP	0.038	C
ITK	3702	genome.wustl.edu	37	5	156608051	156608051	+	Silent	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:156608051T>G	ENST00000422843.3	+	1	215	c.63T>G	c.(61-63)acT>acG	p.T21T		NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	21	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.T21T(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	AGAGAAGAACTTCTCCCTCGA	0.438			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)			Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	1	Substitution - coding silent(1)	lung(1)											115.0	106.0	109.0					5																	156608051		2203	4300	6503	SO:0001819	synonymous_variant	0			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.63T>G	5.37:g.156608051T>G			B2R752|Q32ML7	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.T21	ENST00000422843.3	37	c.63	CCDS4336.1	5																																																																																			ITK	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000113263		0.438	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	HGNC	protein_coding	OTTHUMT00000252569.2	-	0.00	58	0	T			156608051	+1	tier1	-	no_errors	ENST00000422843	ensembl	human	known	74_37	silent	10.81	33	4	SNP	0.628	G
ITK	3702	genome.wustl.edu	37	5	156671346	156671346	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:156671346A>C	ENST00000422843.3	+	13	1459	c.1307A>C	c.(1306-1308)gAg>gCg	p.E436A	ITK_ENST00000519749.1_3'UTR	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	436	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	CTGGTGTTTGAGTTCATGGAG	0.567			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)			Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	0													93.0	91.0	92.0					5																	156671346		2203	4300	6503	SO:0001583	missense	0			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1307A>C	5.37:g.156671346A>C	ENSP00000398655:p.Glu436Ala		B2R752|Q32ML7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.E436A	ENST00000422843.3	37	c.1307	CCDS4336.1	5	.	.	.	.	.	.	.	.	.	.	A	32	5.148301	0.94603	.	.	ENSG00000113263	ENST00000422843	T	0.76709	-1.04	6.08	6.08	0.98989	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.91831	0.7415	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93996	0.7271	10	0.87932	D	0	.	16.6512	0.85203	1.0:0.0:0.0:0.0	.	436	Q08881	ITK_HUMAN	A	436	ENSP00000398655:E436A	ENSP00000398655:E436A	E	+	2	0	ITK	156603924	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.158000	0.94723	2.333000	0.79357	0.482000	0.46254	GAG	ITK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000113263		0.567	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	HGNC	protein_coding	OTTHUMT00000252569.2	-	0.00	44	0	A			156671346	+1	tier1	-	no_errors	ENST00000422843	ensembl	human	known	74_37	missense	17.86	23	5	SNP	1.000	C
IVL	3713	genome.wustl.edu	37	1	152882878	152882878	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:152882878A>G	ENST00000368764.3	+	2	669	c.605A>G	c.(604-606)cAg>cGg	p.Q202R	IVL_ENST00000392667.2_Missense_Mutation_p.Q56R			P07476	INVO_HUMAN	involucrin	202	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			caggaggggcagctggagctc	0.697																																																	0													1.0	1.0	1.0					1																	152882878		332	651	983	SO:0001583	missense	0			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.605A>G	1.37:g.152882878A>G	ENSP00000357753:p.Gln202Arg		Q5T7P4	Missense_Mutation	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.Q202R	ENST00000368764.3	37	c.605	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	A	8.868	0.948657	0.18356	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.11169	3.04;2.8	3.41	-3.37	0.04898	.	.	.	.	.	T	0.02156	0.0067	L	0.55481	1.735	0.09310	N	1	B	0.30068	0.267	B	0.28139	0.086	T	0.44174	-0.9345	9	0.24483	T	0.36	.	0.8731	0.01218	0.4764:0.1606:0.2065:0.1566	.	202	P07476	INVO_HUMAN	R	202;56	ENSP00000357753:Q202R;ENSP00000376435:Q56R	ENSP00000357753:Q202R	Q	+	2	0	IVL	151149502	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.424000	0.07025	-0.742000	0.04790	-0.496000	0.04628	CAG	IVL	-	pfam_Involucrin_rpt	ENSG00000163207		0.697	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1		0.00	53	0	A	NM_005547		152882878	+1			no_errors	ENST00000368764	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.000	G
IVL	3713	genome.wustl.edu	37	1	152883121	152883121	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:152883121T>C	ENST00000368764.3	+	2	912	c.848T>C	c.(847-849)cTg>cCg	p.L283P	IVL_ENST00000392667.2_Missense_Mutation_p.L137P			P07476	INVO_HUMAN	involucrin	283	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ATGGGGCAGCTGAAGTACCTG	0.637																																																	0													18.0	16.0	17.0					1																	152883121		2045	4021	6066	SO:0001583	missense	0			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.848T>C	1.37:g.152883121T>C	ENSP00000357753:p.Leu283Pro		Q5T7P4	Missense_Mutation	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.L283P	ENST00000368764.3	37	c.848	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	t	6.872	0.530365	0.13127	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.13089	2.78;2.62	3.44	0.763	0.18459	.	.	.	.	.	T	0.06371	0.0164	L	0.53249	1.67	0.09310	N	1	D	0.53619	0.961	P	0.47915	0.561	T	0.27536	-1.0071	9	0.30078	T	0.28	.	6.8427	0.23971	0.6222:0.0:0.0:0.3778	.	283	P07476	INVO_HUMAN	P	283;137	ENSP00000357753:L283P;ENSP00000376435:L137P	ENSP00000357753:L283P	L	+	2	0	IVL	151149745	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.345000	0.02637	-0.088000	0.12506	0.163000	0.16589	CTG	IVL	-	pfam_Involucrin_rpt	ENSG00000163207		0.637	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1	-	0.00	208	0	T	NM_005547		152883121	+1	tier1	-	no_errors	ENST00000368764	ensembl	human	known	74_37	missense	17.05	106	22	SNP	0.000	C
KAT6B	23522	genome.wustl.edu	37	10	76790462	76790462	+	Silent	SNP	G	G	A	rs200498444		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:76790462G>A	ENST00000287239.4	+	18	6369	c.5880G>A	c.(5878-5880)acG>acA	p.T1960T	KAT6B_ENST00000372711.1_Silent_p.T1777T|KAT6B_ENST00000372724.1_Silent_p.T1668T|KAT6B_ENST00000372714.1_Silent_p.T1668T|KAT6B_ENST00000372725.1_Silent_p.T1668T	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1960	Interaction with RUNX1 and RUNX2.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GGACTTTAACGATGCAAAGAG	0.527																																																	0													147.0	139.0	142.0					10																	76790462		2203	4300	6503	SO:0001819	synonymous_variant	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.5880G>A	10.37:g.76790462G>A			O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,pfam_Histone_H1/H5_H15,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5_H15,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.T1960	ENST00000287239.4	37	c.5880	CCDS7345.1	10																																																																																			KAT6B	-	NULL	ENSG00000156650		0.527	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6B	HGNC	protein_coding	OTTHUMT00000048771.1	-	0.00	36	0	G	NM_012330		76790462	+1	tier1	rs200498444	no_errors	ENST00000287239	ensembl	human	known	74_37	silent	41.67	21	15	SNP	0.131	A
KCNA1	3736	genome.wustl.edu	37	12	5021359	5021359	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:5021359A>G	ENST00000382545.3	+	2	1922	c.815A>G	c.(814-816)gAg>gGg	p.E272G	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	272					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)			NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CTGGGCACCGAGATAGCTGAG	0.517																																																	0													71.0	74.0	73.0					12																	5021359		2203	4300	6503	SO:0001583	missense	0			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.815A>G	12.37:g.5021359A>G	ENSP00000371985:p.Glu272Gly		A6NM83|Q3MIQ9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.E272G	ENST00000382545.3	37	c.815	CCDS8535.1	12	.	.	.	.	.	.	.	.	.	.	A	14.89	2.669674	0.47677	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	D	0.98493	-4.96	4.97	4.97	0.65823	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96873	0.8979	L	0.58510	1.815	0.80722	D	1	B	0.14012	0.009	B	0.23716	0.048	D	0.95380	0.8472	10	0.59425	D	0.04	.	14.2907	0.66275	1.0:0.0:0.0:0.0	.	272	Q09470	KCNA1_HUMAN	G	272	ENSP00000371985:E272G	ENSP00000228858:E272G	E	+	2	0	KCNA1	4891620	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.021000	0.93673	2.209000	0.71365	0.533000	0.62120	GAG	KCNA1	-	pfam_Ion_trans_dom	ENSG00000111262		0.517	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	HGNC	protein_coding	OTTHUMT00000103343.2	-	0.00	45	0	A	NM_000217		5021359	+1	tier1	-	no_errors	ENST00000382545	ensembl	human	known	74_37	missense	28.12	23	9	SNP	1.000	G
KCNA3	3738	genome.wustl.edu	37	1	111216923	111216923	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:111216923C>T	ENST00000369769.2	-	1	732	c.509G>A	c.(508-510)cGc>cAc	p.R170H		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	170					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	GACCGGCCGGCGGATGCGGCC	0.622																																																	0													56.0	67.0	63.0					1																	111216923		2203	4300	6503	SO:0001583	missense	0			L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.509G>A	1.37:g.111216923C>T	ENSP00000358784:p.Arg170His		Q5VWN2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.3,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.R170H	ENST00000369769.2	37	c.509	CCDS828.2	1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350967	0.82132	.	.	ENSG00000177272	ENST00000369769	T	0.75477	-0.94	4.67	4.67	0.58626	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	U	0.000000	T	0.76097	0.3940	L	0.33710	1.025	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.80696	-0.1267	10	0.87932	D	0	.	17.1304	0.86725	0.0:1.0:0.0:0.0	.	170	P22001	KCNA3_HUMAN	H	170	ENSP00000358784:R170H	ENSP00000358784:R170H	R	-	2	0	KCNA3	111018446	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.716000	0.84723	2.139000	0.66308	0.462000	0.41574	CGC	KCNA3	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000177272		0.622	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA3	HGNC	protein_coding	OTTHUMT00000083391.1	-	0.00	131	0	C	NM_002232		111216923	-1	tier1	-	no_errors	ENST00000369769	ensembl	human	known	74_37	missense	19.39	79	19	SNP	1.000	T
KCNU1	157855	genome.wustl.edu	37	8	36671732	36671732	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr8:36671732A>C	ENST00000399881.3	+	8	777	c.740A>C	c.(739-741)aAt>aCt	p.N247T		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	247					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		CAGGTGGAAAATTCTGGTGAT	0.368																																																	0													55.0	52.0	53.0					8																	36671732		1824	4077	5901	SO:0001583	missense	0			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.740A>C	8.37:g.36671732A>C	ENSP00000382770:p.Asn247Thr			Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_Ca-activ_BK_asu	p.N247T	ENST00000399881.3	37	c.740	CCDS55220.1	8	.	.	.	.	.	.	.	.	.	.	A	20.9	4.058956	0.76074	.	.	ENSG00000215262	ENST00000523973;ENST00000399881	D;D	0.97529	-4.42;-4.42	5.0	5.0	0.66597	Ion transport (1);	0.000000	0.40222	U	0.001148	D	0.97120	0.9059	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97523	1.0074	10	0.54805	T	0.06	-5.1984	13.687	0.62522	1.0:0.0:0.0:0.0	.	247	A8MYU2	KCNU1_HUMAN	T	247	ENSP00000429951:N247T;ENSP00000382770:N247T	ENSP00000382770:N247T	N	+	2	0	KCNU1	36790890	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.512000	0.90538	1.874000	0.54306	0.383000	0.25322	AAT	KCNU1	-	pfam_2pore_dom_K_chnl_dom	ENSG00000215262		0.368	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCNU1	HGNC	protein_coding	OTTHUMT00000376631.1	-	0.00	75	0	A	NM_001031836		36671732	+1	tier1	-	no_errors	ENST00000399881	ensembl	human	known	74_37	missense	41.54	38	27	SNP	1.000	C
KCNQ3	3786	genome.wustl.edu	37	8	133187785	133187785	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr8:133187785T>C	ENST00000388996.4	-	5	1268	c.848A>G	c.(847-849)gAg>gGg	p.E283G	KCNQ3_ENST00000519445.1_Missense_Mutation_p.E283G|KCNQ3_ENST00000521134.1_Missense_Mutation_p.E163G	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	283					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	GACGTCTTTCTCAACCAGGTA	0.488																																																	0													125.0	120.0	121.0					8																	133187785		2203	4300	6503	SO:0001583	missense	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.848A>G	8.37:g.133187785T>C	ENSP00000373648:p.Glu283Gly		A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.E283G	ENST00000388996.4	37	c.848	CCDS34943.1	8	.	.	.	.	.	.	.	.	.	.	T	28.1	4.889540	0.91889	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.98649	-5.05;-5.05;-5.05	5.39	5.39	0.77823	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99196	0.9721	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.99353	1.0915	10	0.66056	D	0.02	-29.8912	14.8797	0.70522	0.0:0.0:0.0:1.0	.	283;283	E7ET42;O43525	.;KCNQ3_HUMAN	G	283;163;283;272;162	ENSP00000373648:E283G;ENSP00000429799:E163G;ENSP00000428790:E283G	ENSP00000373648:E283G	E	-	2	0	KCNQ3	133256967	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.036000	0.88901	2.159000	0.67721	0.533000	0.62120	GAG	KCNQ3	-	pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl	ENSG00000184156		0.488	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	-	0.00	64	0	T	NM_004519		133187785	-1	tier1	-	no_errors	ENST00000388996	ensembl	human	known	74_37	missense	32.26	42	20	SNP	1.000	C
KCTD15	79047	genome.wustl.edu	37	19	34292163	34292163	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:34292163A>C	ENST00000430256.3	+	3	566	c.158A>C	c.(157-159)aAg>aCg	p.K53T	KCTD15_ENST00000589786.1_Missense_Mutation_p.K53T|KCTD15_ENST00000284006.6_Missense_Mutation_p.K53T|KCTD15_ENST00000588881.1_Missense_Mutation_p.K53T			Q96SI1	KCD15_HUMAN	potassium channel tetramerization domain containing 15	53					multicellular organismal development (GO:0007275)|protein homooligomerization (GO:0051260)					endometrium(1)|lung(2)|pancreas(1)|urinary_tract(1)	5	Esophageal squamous(110;0.162)					CAGCTCACCAAGTCCAATGCA	0.622																																					Melanoma(36;646 1094 5145 14504 45302)|GBM(25;193 541 1518 14388 52178)												0													78.0	69.0	72.0					19																	34292163		2203	4300	6503	SO:0001583	missense	0			AK025590	CCDS12434.1, CCDS46039.1	19q13.12	2013-06-20	2013-06-20			ENSG00000153885			23297	protein-coding gene	gene with protein product		615240	"""potassium channel tetramerisation domain containing 15"""			12477932	Standard	NM_024076		Approved	MGC25497	uc002nuw.4	Q96SI1		ENST00000430256.3:c.158A>C	19.37:g.34292163A>C	ENSP00000394390:p.Lys53Thr		A8K600|Q9BVI6	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.K53T	ENST00000430256.3	37	c.158	CCDS46039.1	19	.	.	.	.	.	.	.	.	.	.	A	25.3	4.623130	0.87460	.	.	ENSG00000153885	ENST00000430256;ENST00000284006;ENST00000422820	T;T	0.76578	0.83;-1.03	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.78610	0.4310	L	0.29908	0.895	0.80722	D	1	D;D	0.67145	0.996;0.97	P;P	0.58454	0.835;0.839	T	0.78262	-0.2272	10	0.37606	T	0.19	.	14.7156	0.69265	1.0:0.0:0.0:0.0	.	53;53	Q96SI1;Q96SI1-2	KCD15_HUMAN;.	T	53;53;56	ENSP00000394390:K53T;ENSP00000284006:K53T	ENSP00000284006:K53T	K	+	2	0	KCTD15	38984003	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.904000	0.92590	2.078000	0.62432	0.533000	0.62120	AAG	KCTD15	-	NULL	ENSG00000153885		0.622	KCTD15-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCTD15	HGNC	protein_coding	OTTHUMT00000451462.2	-	0.00	68	0	A	NM_024076		34292163	+1	tier1	-	no_errors	ENST00000430256	ensembl	human	known	74_37	missense	23.94	54	17	SNP	1.000	C
KIAA1429	25962	genome.wustl.edu	37	8	95501071	95501071	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr8:95501071G>A	ENST00000297591.5	-	24	5377	c.5302C>T	c.(5302-5304)Cgg>Tgg	p.R1768W	KIAA1429_ENST00000437199.1_3'UTR	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1768					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.R1768W(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			GCACGGTCCCGAGGACTTGGG	0.468																																																	1	Substitution - Missense(1)	endometrium(1)											99.0	88.0	92.0					8																	95501071		2203	4300	6503	SO:0001583	missense	0			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.5302C>T	8.37:g.95501071G>A	ENSP00000297591:p.Arg1768Trp		Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R1768W	ENST00000297591.5	37	c.5302	CCDS34923.1	8	.	.	.	.	.	.	.	.	.	.	G	27.4	4.829751	0.91036	.	.	ENSG00000164944	ENST00000297591	T	0.53206	0.63	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.58864	0.2152	N	0.24115	0.695	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.62859	-0.6765	10	0.87932	D	0	-10.9985	19.8632	0.96793	0.0:0.0:1.0:0.0	.	1768	Q69YN4	VIR_HUMAN	W	1768	ENSP00000297591:R1768W	ENSP00000297591:R1768W	R	-	1	2	KIAA1429	95570247	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.802000	0.85969	2.699000	0.92147	0.655000	0.94253	CGG	KIAA1429	-	NULL	ENSG00000164944		0.468	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	HGNC	protein_coding	OTTHUMT00000378720.2	-	0.00	22	0	G	NM_015496		95501071	-1	tier1	-	no_errors	ENST00000297591	ensembl	human	known	74_37	missense	44.44	10	8	SNP	1.000	A
KIF2B	84643	genome.wustl.edu	37	17	51901450	51901450	+	Silent	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:51901450C>T	ENST00000268919.4	+	1	1212	c.1056C>T	c.(1054-1056)gtC>gtT	p.V352V		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	352	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ACCTCAAAGTCTATGGGACAT	0.453																																																	0													100.0	106.0	104.0					17																	51901450		2203	4300	6503	SO:0001819	synonymous_variant	0			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.1056C>T	17.37:g.51901450C>T			Q96MA2|Q9BXG6	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V352	ENST00000268919.4	37	c.1056	CCDS32685.1	17																																																																																			KIF2B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000141200		0.453	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2B	HGNC	protein_coding	OTTHUMT00000438854.1	-	0.00	22	0	C	NM_032559		51901450	+1	tier1	-	no_errors	ENST00000268919	ensembl	human	known	74_37	silent	19.05	17	4	SNP	1.000	T
KIF4B	285643	genome.wustl.edu	37	5	154395563	154395563	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:154395563A>C	ENST00000435029.4	+	1	2304	c.2144A>C	c.(2143-2145)aAg>aCg	p.K715T		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	715	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			AAGCGACTCAAGGATGCTCTC	0.483																																																	0													89.0	90.0	90.0					5																	154395563		2203	4300	6503	SO:0001583	missense	0			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2144A>C	5.37:g.154395563A>C	ENSP00000387875:p.Lys715Thr			Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K715T	ENST00000435029.4	37	c.2144	CCDS47324.1	5	.	.	.	.	.	.	.	.	.	.	a	15.54	2.864159	0.51482	.	.	ENSG00000226650	ENST00000435029	T	0.17054	2.3	2.54	-0.147	0.13428	.	.	.	.	.	T	0.36054	0.0953	M	0.83603	2.65	0.49798	D	0.999828	D	0.71674	0.998	D	0.66716	0.946	T	0.18366	-1.0339	9	0.87932	D	0	.	6.1208	0.20151	0.7073:0.0:0.2927:0.0	.	715	Q2VIQ3	KIF4B_HUMAN	T	715	ENSP00000387875:K715T	ENSP00000387875:K715T	K	+	2	0	KIF4B	154375756	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	2.312000	0.43726	0.075000	0.16796	0.460000	0.39030	AAG	KIF4B	-	NULL	ENSG00000226650		0.483	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	HGNC	protein_coding	OTTHUMT00000377478.1	-	0.00	83	0	A			154395563	+1	tier1	-	no_errors	ENST00000435029	ensembl	human	known	74_37	missense	54.00	23	27	SNP	1.000	C
KLRD1	3824	genome.wustl.edu	37	12	10464127	10464127	+	Silent	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:10464127C>A	ENST00000381907.4	+	5	430	c.228C>A	c.(226-228)tcC>tcA	p.S76S	KLRD1_ENST00000543777.1_Silent_p.S55S|KLRD1_ENST00000350274.5_Silent_p.S45S|KLRD1_ENST00000336164.4_Silent_p.S76S|KLRD1_ENST00000381908.3_Silent_p.S76S|KLRD1_ENST00000538997.1_3'UTR|KLRD1_ENST00000543420.1_Silent_p.S76S	NM_001114396.1	NP_001107868	Q13241	KLRD1_HUMAN	killer cell lectin-like receptor subfamily D, member 1	76	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	10						ACTTCATTTCCAGTGAACAGA	0.448																																																	0													125.0	114.0	118.0					12																	10464127		2203	4300	6503	SO:0001819	synonymous_variant	0			U30610	CCDS8621.1, CCDS8622.1	12p13	2009-12-03						"""Killer cell lectin-like receptors"", ""CD molecules"""	6378	protein-coding gene	gene with protein product		602894		CD94		7589107	Standard	NM_002262		Approved		uc001qxx.4	Q13241		ENST00000381907.4:c.228C>A	12.37:g.10464127C>A			O43321|O43773|Q9UBE3|Q9UEQ0	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.S76	ENST00000381907.4	37	c.228	CCDS8621.1	12																																																																																			KLRD1	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000134539		0.448	KLRD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KLRD1	HGNC	protein_coding	OTTHUMT00000399684.2		0.00	80	0	C	NM_002262		10464127	+1			no_errors	ENST00000381908	ensembl	human	known	74_37	silent	6.52	43	3	SNP	0.067	A
KLRC3	3823	genome.wustl.edu	37	12	10572176	10572176	+	Intron	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:10572176A>C	ENST00000396439.2	-	2	331				KLRC3_ENST00000381903.2_Intron|NKG2-E_ENST00000539033.1_Intron|KLRC3_ENST00000381904.2_Missense_Mutation_p.N101K	NM_002261.2	NP_002252.2	Q07444	NKG2E_HUMAN	killer cell lectin-like receptor subfamily C, member 3						cellular defense response (GO:0006968)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11						TTGGGGAAGAATTGTTCTGCT	0.249																																																	0													27.0	28.0	28.0					12																	10572176		872	1986	2858	SO:0001627	intron_variant	0			L14542	CCDS31744.1, CCDS41755.1	12p13	2008-08-05			ENSG00000205810	ENSG00000205810		"""Killer cell lectin-like receptors"""	6376	protein-coding gene	gene with protein product		602892				9598306	Standard	NM_002261		Approved	NKG2-E	uc001qyi.1	Q07444	OTTHUMG00000167149	ENST00000396439.2:c.286+288T>G	12.37:g.10572176A>C			Q8WXA4|Q96RL0|Q9UP04	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.N101K	ENST00000396439.2	37	c.303	CCDS41755.1	12	.	.	.	.	.	.	.	.	.	.	-	8.997	0.979241	0.18812	.	.	ENSG00000205810	ENST00000381904	T	0.10288	2.89	1.25	-0.178	0.13303	.	.	.	.	.	T	0.08133	0.0203	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36841	-0.9731	6	0.36615	T	0.2	.	3.1272	0.06411	0.6145:0.0:0.0:0.3855	.	.	.	.	K	101	ENSP00000371329:N101K	ENSP00000371329:N101K	N	-	3	2	KLRC3	10463443	0.000000	0.05858	0.000000	0.03702	0.050000	0.14768	-0.602000	0.05680	-0.032000	0.13758	0.347000	0.21830	AAT	KLRC3	-	pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold	ENSG00000205810		0.249	KLRC3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KLRC3	HGNC	protein_coding	OTTHUMT00000393471.1	-	0.00	103	0	A	NM_002261		10572176	-1	tier1	-	no_errors	ENST00000381904	ensembl	human	known	74_37	missense	20.63	100	26	SNP	0.000	C
KMT2E	55904	genome.wustl.edu	37	7	104748371	104748371	+	Splice_Site	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:104748371A>G	ENST00000311117.3	+	22	4012	c.3467A>G	c.(3466-3468)aAg>aGg	p.K1156R	KMT2E_ENST00000334914.7_Splice_Site_p.K211R|KMT2E_ENST00000257745.4_Splice_Site_p.K1156R|CTB-152G17.6_ENST00000607968.1_RNA|SRPK2_ENST00000493638.1_5'Flank|KMT2E_ENST00000334877.4_Splice_Site_p.K1156R	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1156					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										CAAAAGAAAAAGGTTACAAAT	0.343																																																	0													28.0	30.0	29.0					7																	104748371		2182	4294	6476	SO:0001630	splice_region_variant	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.3468+1A>G	7.37:g.104748371A>G			B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.K1156R	ENST00000311117.3	37	c.3467	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	A	27.8	4.867904	0.91587	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.54334	0.1852	L	0.34521	1.04	0.53688	D	0.999973	D	0.69078	0.997	D	0.75020	0.985	T	0.55082	-0.8196	10	0.52906	T	0.07	.	16.2375	0.82384	1.0:0.0:0.0:0.0	.	1156	Q8IZD2	MLL5_HUMAN	R	1156;1156;1156;1076;1156;211	ENSP00000312379:K1156R;ENSP00000335599:K1156R;ENSP00000257745:K1156R;ENSP00000333986:K211R	ENSP00000257745:K1156R	K	+	2	0	MLL5	104535607	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.476000	0.90421	2.222000	0.72286	0.533000	0.62120	AAG	KMT2E	-	NULL	ENSG00000005483		0.343	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	HGNC	protein_coding	OTTHUMT00000348697.1	-	0.00	59	0	A		Missense_Mutation	104748371	+1	tier1	-	no_errors	ENST00000257745	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	G
LAD1	3898	genome.wustl.edu	37	1	201355983	201355984	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	CT	CT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:201355983_201355984delCT	ENST00000391967.2	-	3	806_807	c.505_506delAG	c.(505-507)aggfs	p.R169fs	LAD1_ENST00000367313.3_Frame_Shift_Del_p.R183fs	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	169						basement membrane (GO:0005604)	structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						CCCTTTCTTCCTCTCTTCTGGC	0.584																																																	0																																										SO:0001589	frameshift_variant	0			U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.505_506delAG	1.37:g.201355987_201355988delCT	ENSP00000375829:p.Arg169fs		O95614|Q96GD8	Frame_Shift_Del	DEL	pirsf_Ladinin_1	p.R183fs	ENST00000391967.2	37	c.548_547	CCDS1410.1	1																																																																																			LAD1	-	pirsf_Ladinin_1	ENSG00000159166		0.584	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAD1	HGNC	protein_coding	OTTHUMT00000086946.1		0.00	25	0	CT	NM_005558		201355984	-1	tier1		no_errors	ENST00000367313	ensembl	human	known	74_37	frame_shift_del	20.00	16	4	DEL	0.000:0.000	-
LAMA2	3908	genome.wustl.edu	37	6	129581967	129581967	+	Splice_Site	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:129581967A>C	ENST00000421865.2	+	15	2257	c.2208A>C	c.(2206-2208)gaA>gaC	p.E736D		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	736	Laminin EGF-like 5; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CCTCTTGTGAAGTAAGCTTGC	0.403																																																	0													161.0	141.0	148.0					6																	129581967		2203	4300	6503	SO:0001630	splice_region_variant	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.2208+1A>C	6.37:g.129581967A>C			Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.E736D	ENST00000421865.2	37	c.2208	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	A	14.36	2.513029	0.44660	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.53857	0.6	5.58	1.51	0.23008	EGF-like, laminin (1);	0.063918	0.64402	D	0.000009	T	0.62938	0.2469	M	0.87456	2.885	0.53005	D	0.999966	D;D	0.76494	0.999;0.996	D;D	0.80764	0.994;0.987	T	0.65553	-0.6140	10	0.46703	T	0.11	.	9.7192	0.40293	0.7554:0.0:0.2446:0.0	.	736;736	A6NF00;P24043	.;LAMA2_HUMAN	D	736	ENSP00000400365:E736D	ENSP00000346769:E736D	E	+	3	2	LAMA2	129623660	1.000000	0.71417	1.000000	0.80357	0.073000	0.16967	1.797000	0.38804	0.414000	0.25790	-0.256000	0.11100	GAA	LAMA2	-	pfam_EGF_laminin	ENSG00000196569		0.403	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	-	0.00	39	0	A		Missense_Mutation	129581967	+1	tier1	-	no_errors	ENST00000421865	ensembl	human	known	74_37	missense	34.55	36	19	SNP	1.000	C
LAMA4	3910	genome.wustl.edu	37	6	112521374	112521374	+	Intron	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:112521374A>C	ENST00000230538.7	-	5	901				LAMA4_ENST00000389463.4_Intron|LAMA4_ENST00000524032.1_Intron|LAMA4_ENST00000424408.2_Intron|LAMA4_ENST00000522006.1_Intron	NM_001105206.2	NP_001098676.2	Q16363	LAMA4_HUMAN	laminin, alpha 4						blood vessel development (GO:0001568)|brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(42)|ovary(4)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(8)	100		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TCTGTGGAGAAGGCCTTTCTT	0.443																																																	0													62.0	55.0	57.0					6																	112521374		876	1991	2867	SO:0001627	intron_variant	0				CCDS34514.1, CCDS43491.1, CCDS43492.1	6q21	2014-09-17			ENSG00000112769	ENSG00000112769		"""Laminins"""	6484	protein-coding gene	gene with protein product		600133				7959779	Standard	NM_001105206		Approved	LAMA3	uc003pvu.3	Q16363	OTTHUMG00000015386	ENST00000230538.7:c.503+1434T>G	6.37:g.112521374A>C			Q14731|Q14735|Q15335|Q4LE44|Q5SZG8|Q9BTB8|Q9UE18|Q9UJN9	RNA	SNP	-	NULL	ENST00000230538.7	37	NULL	CCDS43491.1	6																																																																																			LAMA4	-	-	ENSG00000112769		0.443	LAMA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAMA4	HGNC	protein_coding	OTTHUMT00000041876.2	-	0.00	37	0	A	NM_001105206		112521374	-1	tier1	-	no_errors	ENST00000423735	ensembl	human	known	74_37	rna	33.33	16	8	SNP	0.001	C
LAMA2	3908	genome.wustl.edu	37	6	129837421	129837421	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:129837421C>T	ENST00000421865.2	+	65	9347	c.9298C>T	c.(9298-9300)Cca>Tca	p.P3100S		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	3100	Laminin G-like 5. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CACAGGCAAGCCACTGGAGGT	0.488																																																	0													98.0	92.0	94.0					6																	129837421		2203	4300	6503	SO:0001583	missense	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.9298C>T	6.37:g.129837421C>T	ENSP00000400365:p.Pro3100Ser		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.P3100S	ENST00000421865.2	37	c.9298	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	C	6.264	0.416874	0.11870	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.45276	0.9	5.79	4.89	0.63831	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.109618	0.64402	D	0.000006	T	0.21761	0.0524	L	0.46157	1.445	0.43574	D	0.995906	B;B	0.32731	0.382;0.382	B;B	0.23275	0.045;0.045	T	0.03403	-1.1040	9	.	.	.	.	16.9083	0.86134	0.0:0.8724:0.1276:0.0	.	3101;3100	A6NF00;P24043	.;LAMA2_HUMAN	S	3100;3099;3100	ENSP00000400365:P3100S	.	P	+	1	0	LAMA2	129879114	0.998000	0.40836	0.912000	0.35992	0.091000	0.18340	1.057000	0.30492	2.734000	0.93682	0.655000	0.94253	CCA	LAMA2	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000196569		0.488	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	-	0.00	86	0	C			129837421	+1	tier1	-	no_errors	ENST00000421865	ensembl	human	known	74_37	missense	47.22	38	34	SNP	0.896	T
LCE1B	353132	genome.wustl.edu	37	1	152785167	152785167	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:152785167G>A	ENST00000360090.3	+	1	721	c.245G>A	c.(244-246)cGc>cAc	p.R82H		NM_178349.1	NP_848126.1	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B	82	Gly-rich.				keratinization (GO:0031424)					breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|skin(2)	18	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			CACCACAGGCGCCGTAGGTCC	0.687																																																	0													33.0	41.0	38.0					1																	152785167		2202	4296	6498	SO:0001583	missense	0			BI670515	CCDS1027.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000196734	ENSG00000196734		"""Late cornified envelopes"""	16611	protein-coding gene	gene with protein product		612604	"""small proline rich-like (epidermal differentiation complex) 2A"""	SPRL2A		11698679	Standard	NM_178349		Approved	LEP2	uc001faq.3	Q5T7P3	OTTHUMG00000014402	ENST00000360090.3:c.245G>A	1.37:g.152785167G>A	ENSP00000353203:p.Arg82His		A4IF40	Missense_Mutation	SNP	NULL	p.R82H	ENST00000360090.3	37	c.245	CCDS1027.1	1	.	.	.	.	.	.	.	.	.	.	g	3.689	-0.063943	0.07273	.	.	ENSG00000196734	ENST00000360090;ENST00000439693	T	0.03772	3.81	4.12	-4.4	0.03600	.	0.950758	0.08600	N	0.921643	T	0.01124	0.0037	N	0.26042	0.785	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.49771	-0.8904	10	0.87932	D	0	.	7.7837	0.29080	0.2847:0.5424:0.173:0.0	.	82	Q5T7P3	LCE1B_HUMAN	H	82;74	ENSP00000353203:R82H	ENSP00000353203:R82H	R	+	2	0	LCE1B	151051791	0.000000	0.05858	0.092000	0.20876	0.199000	0.23934	-1.304000	0.02741	-0.657000	0.05373	-0.127000	0.14921	CGC	LCE1B	-	NULL	ENSG00000196734		0.687	LCE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1B	HGNC	protein_coding	OTTHUMT00000040060.1	-	0.00	107	0	G	NM_178349		152785167	+1	tier1	-	no_errors	ENST00000360090	ensembl	human	known	74_37	missense	16.67	85	17	SNP	0.020	A
ZNF512B	57473	genome.wustl.edu	37	20	62669225	62669225	+	Intron	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr20:62669225C>T	ENST00000450537.1	-	1	56				ZNF512B_ENST00000217130.3_Intron|LINC00176_ENST00000444463.1_lincRNA			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GGGCTGGCTGCTCCCTGTGCT	0.627																																																	0																																										SO:0001627	intron_variant	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.4+10832G>A	20.37:g.62669225C>T			Q08AK9|Q9ULM4	RNA	SNP	-	NULL	ENST00000450537.1	37	NULL	CCDS13548.1	20																																																																																			LINC00176	-	-	ENSG00000196421		0.627	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LINC00176	HGNC	protein_coding	OTTHUMT00000080246.1		0.00	83	0	C	NM_020713		62669225	+1			no_errors	ENST00000431158	ensembl	human	known	74_37	rna	6.94	67	5	SNP	0.000	T
LINC00238	440184	genome.wustl.edu	37	14	66958769	66958769	+	lincRNA	SNP	A	A	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr14:66958769A>T	ENST00000556874.1	-	0	643				LINC00238_ENST00000389594.3_RNA																							ATTCTCTTTCAGAATGATTTT	0.363																																																	0																																												0																															14.37:g.66958769A>T				Splice_Site	SNP	-	NULL	ENST00000556874.1	37	c.NULL		14																																																																																			LINC00238	-	-	ENSG00000196553		0.363	RP11-72M17.1-001	KNOWN	basic	lincRNA	LINC00238	HGNC	lincRNA	OTTHUMT00000412209.1	-	0.00	48	0	A			66958769	+1	tier1	-	no_errors	ENST00000359454	ensembl	human	known	74_37	splice_site	21.57	40	11	SNP	0.970	T
LINC00839	84856	genome.wustl.edu	37	10	42982441	42982441	+	lincRNA	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:42982441G>A	ENST00000429940.2	+	0	535					NR_026827.1				long intergenic non-protein coding RNA 839																		actgggttggggtctccacga	0.542																																																	0																																												0					10q11.21	2012-12-20			ENSG00000185904	ENSG00000185904		"""Long non-coding RNAs"""	28269	protein-coding gene	gene with protein product						12477932	Standard	NR_026827		Approved		uc001izy.3		OTTHUMG00000018010		10.37:g.42982441G>A				RNA	SNP	-	NULL	ENST00000429940.2	37	NULL		10																																																																																			LINC00839	-	-	ENSG00000185904		0.542	LINC00839-001	KNOWN	basic	lincRNA	LINC00839	HGNC	lincRNA	OTTHUMT00000047672.2	-	0.00	41	0	G	NR_026827		42982441	+1	tier1	-	no_errors	ENST00000424751	ensembl	human	known	74_37	rna	17.39	19	4	SNP	0.064	A
LOC101926969	101926969	genome.wustl.edu	37	2	91768861	91768861	+	lincRNA	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:91768861C>A	ENST00000567067.1	+	0	469																											AAGTTTTAATCATTTTTAAGT	0.244																																																	0																																												0																															2.37:g.91768861C>A				RNA	SNP	-	NULL	ENST00000567067.1	37	NULL		2																																																																																			RP11-575H3.1	-	-	ENSG00000261600		0.244	RP11-575H3.1-001	KNOWN	basic	lincRNA	LOC101926969	Clone_based_vega_gene	lincRNA	OTTHUMT00000431417.1	-	0.00	141	0	C			91768861	+1	tier1	-	no_errors	ENST00000567067	ensembl	human	known	74_37	rna	13.45	103	16	SNP	0.798	A
FIRRE	286467	genome.wustl.edu	37	X	130929839	130929839	+	lincRNA	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:130929839G>T	ENST00000427391.1	-	0	1082					NR_026975.1																						TGCCGCACCTGCTGCCAGGCT	0.667																																																	0																																												0																															X.37:g.130929839G>T				RNA	SNP	-	NULL	ENST00000427391.1	37	NULL		X																																																																																			RP11-453F18__B.1	-	-	ENSG00000213468		0.667	RP11-453F18__B.1-001	KNOWN	basic	lincRNA	LOC286467	Clone_based_vega_gene	lincRNA	OTTHUMT00000058303.1	-	0.00	25	0	G			130929839	-1	tier1	-	no_errors	ENST00000427391	ensembl	human	known	74_37	rna	20.00	12	3	SNP	0.555	T
GOLGA2P9	440518	genome.wustl.edu	37	19	22782991	22782991	+	RNA	SNP	C	C	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:22782991C>G	ENST00000600260.1	+	0	498				RN7SL860P_ENST00000473738.2_RNA|AC011467.1_ENST00000408863.1_RNA	NR_033899.1																						GCCCTGGCACCCCCAGCAAGG	0.562																																																	0																																												0																															19.37:g.22782991C>G				RNA	SNP	-	NULL	ENST00000600260.1	37	NULL		19																																																																																			CTC-457E21.3	-	-	ENSG00000269332		0.562	CTC-457E21.3-001	KNOWN	basic	processed_transcript	LOC440518	Clone_based_vega_gene	pseudogene	OTTHUMT00000464572.1	-	0.00	136	0	C			22782991	+1	tier1	-	no_errors	ENST00000597408	ensembl	human	known	74_37	rna	41.11	53	37	SNP	0.583	G
LOC441666	441666	genome.wustl.edu	37	10	42833270	42833270	+	RNA	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:42833270A>G	ENST00000609841.1	-	0	633					NR_024380.1																						ATGTATAGTAAGACCTGAAGA	0.353																																																	0																																												0																															10.37:g.42833270A>G				RNA	SNP	-	NULL	ENST00000609841.1	37	NULL		10																																																																																			RP11-313J2.1	-	-	ENSG00000215146		0.353	RP11-313J2.1-002	KNOWN	basic	processed_transcript	LOC441666	Clone_based_vega_gene	pseudogene	OTTHUMT00000472483.1	-	0.00	185	0	A			42833270	-1	tier1	-	no_errors	ENST00000609034	ensembl	human	known	74_37	rna	43.01	110	83	SNP	0.003	G
LOXHD1	125336	genome.wustl.edu	37	18	44140204	44140204	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr18:44140204T>G	ENST00000398722.4	-	12	2068	c.2069A>C	c.(2068-2070)gAg>gCg	p.E690A	LOXHD1_ENST00000300591.6_5'Flank|LOXHD1_ENST00000536736.1_Missense_Mutation_p.E968A|LOXHD1_ENST00000582408.1_5'Flank|LOXHD1_ENST00000441551.2_Intron|LOXHD1_ENST00000441893.2_5'Flank			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	690	Glu-rich.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						ttccatctcctcctcctcTGA	0.602																																																	0													74.0	75.0	74.0					18																	44140204		692	1591	2283	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2069A>C	18.37:g.44140204T>G	ENSP00000381707:p.Glu690Ala		B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,pfscan_PLAT/LH2_dom	p.E968A	ENST00000398722.4	37	c.2903		18	.	.	.	.	.	.	.	.	.	.	T	7.996	0.754299	0.15778	.	.	ENSG00000167210	ENST00000398722;ENST00000536736;ENST00000335730	T;T	0.07021	3.23;3.23	4.71	4.71	0.59529	.	0.000000	0.64402	D	0.000019	T	0.08447	0.0210	L	0.27053	0.805	0.80722	D	1	P;P	0.50819	0.939;0.939	B;P	0.49361	0.43;0.608	T	0.31696	-0.9934	10	0.08599	T	0.76	.	11.67	0.51395	0.0:0.0:0.0:1.0	.	968;690	F5GZB4;Q8IVV2-2	.;.	A	690;968;690	ENSP00000381707:E690A;ENSP00000444586:E968A	ENSP00000338222:E690A	E	-	2	0	LOXHD1	42394202	1.000000	0.71417	0.997000	0.53966	0.200000	0.23975	4.268000	0.58883	1.982000	0.57802	0.368000	0.22195	GAG	LOXHD1	-	NULL	ENSG00000167210		0.602	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		-	0.00	48	0	T	NM_144612		44140204	-1	tier1	-	no_errors	ENST00000536736	ensembl	human	known	74_37	missense	61.90	8	13	SNP	1.000	G
LOXL2	4017	genome.wustl.edu	37	8	23155605	23155605	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr8:23155605delT	ENST00000389131.3	-	14	2645	c.2276delA	c.(2275-2277)aagfs	p.K759fs		NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	759					aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		GTGCTCAAACTTTTTTTCCGT	0.537																																																	0													75.0	72.0	73.0					8																	23155605		2203	4300	6503	SO:0001589	frameshift_variant	0			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.2276delA	8.37:g.23155605delT	ENSP00000373783:p.Lys759fs		B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Frame_Shift_Del	DEL	pfam_Lysyl_oxidase,pfam_SRCR,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR,prints_Lysyl_oxidase,prints_SRCR	p.K759fs	ENST00000389131.3	37	c.2276	CCDS34864.1	8																																																																																			LOXL2	-	NULL	ENSG00000134013		0.537	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL2	HGNC	protein_coding	OTTHUMT00000375603.1		0.00	53	0	T			23155605	-1	tier1		no_errors	ENST00000389131	ensembl	human	known	74_37	frame_shift_del	6.67	28	2	DEL	0.994	-
LRP4	4038	genome.wustl.edu	37	11	46900815	46900815	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:46900815C>T	ENST00000378623.1	-	21	3108	c.2866G>A	c.(2866-2868)Gag>Aag	p.E956K		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	956					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		TAGATGCGCTCTCCATAGAGG	0.567																																																	0													65.0	66.0	66.0					11																	46900815		2201	4299	6500	SO:0001583	missense	0			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.2866G>A	11.37:g.46900815C>T	ENSP00000367888:p.Glu956Lys		B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.E956K	ENST00000378623.1	37	c.2866	CCDS31478.1	11	.	.	.	.	.	.	.	.	.	.	C	15.27	2.784243	0.49997	.	.	ENSG00000134569	ENST00000378623	D	0.90900	-2.75	5.51	4.58	0.56647	Six-bladed beta-propeller, TolB-like (1);	0.110837	0.64402	D	0.000006	D	0.84284	0.5438	L	0.31926	0.97	0.41246	D	0.986671	B	0.02656	0.0	B	0.09377	0.004	T	0.79371	-0.1831	10	0.35671	T	0.21	.	10.6625	0.45710	0.0:0.7893:0.1383:0.0724	.	956	O75096	LRP4_HUMAN	K	956	ENSP00000367888:E956K	ENSP00000367888:E956K	E	-	1	0	LRP4	46857391	0.999000	0.42202	1.000000	0.80357	0.983000	0.72400	4.050000	0.57404	1.428000	0.47296	0.462000	0.41574	GAG	LRP4	-	smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000134569		0.567	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	HGNC	protein_coding	OTTHUMT00000391133.1	-	0.00	48	0	C	NM_002334		46900815	-1	tier1	-	no_errors	ENST00000378623	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
LRRIQ4	344657	genome.wustl.edu	37	3	169540181	169540181	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:169540181C>T	ENST00000340806.6	+	1	472	c.472C>T	c.(472-474)Ccc>Tcc	p.P158S		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	158										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						GAAATGTCTGCCCAAGGAAAT	0.512																																																	0													56.0	58.0	57.0					3																	169540181		1965	4157	6122	SO:0001583	missense	0				CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.472C>T	3.37:g.169540181C>T	ENSP00000342188:p.Pro158Ser			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.P158S	ENST00000340806.6	37	c.472	CCDS46951.1	3	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487432	0.84854	.	.	ENSG00000188306	ENST00000340806	T	0.29917	1.55	5.56	5.56	0.83823	.	0.000000	0.64402	D	0.000001	T	0.59797	0.2220	M	0.78801	2.425	0.54753	D	0.999987	D	0.89917	1.0	D	0.97110	1.0	T	0.62407	-0.6861	10	0.66056	D	0.02	.	19.1287	0.93396	0.0:1.0:0.0:0.0	.	158	A6NIV6	LRIQ4_HUMAN	S	158	ENSP00000342188:P158S	ENSP00000342188:P158S	P	+	1	0	LRRIQ4	171022875	0.994000	0.37717	1.000000	0.80357	0.988000	0.76386	2.233000	0.43027	2.631000	0.89168	0.462000	0.41574	CCC	LRRIQ4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000188306		0.512	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRIQ4	HGNC	protein_coding	OTTHUMT00000378698.1	-	0.00	53	0	C	NM_001080460		169540181	+1	tier1	-	no_errors	ENST00000340806	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
LRRK1	79705	genome.wustl.edu	37	15	101549050	101549050	+	Silent	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr15:101549050T>A	ENST00000388948.3	+	7	1130	c.771T>A	c.(769-771)cgT>cgA	p.R257R	LRRK1_ENST00000284395.5_Silent_p.R254R	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AGGCTCTCCGTGTGAAATGGT	0.542											OREG0023521	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													105.0	102.0	103.0					15																	101549050		2033	4187	6220	SO:0001819	synonymous_variant	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.771T>A	15.37:g.101549050T>A		1359		Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.R257	ENST00000388948.3	37	c.771	CCDS42086.1	15																																																																																			LRRK1	-	NULL	ENSG00000154237		0.542	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2		0.00	28	0	T	NM_024652		101549050	+1			no_errors	ENST00000388948	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.591	A
LRRN3	54674	genome.wustl.edu	37	7	110763556	110763556	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:110763556T>C	ENST00000422987.3	+	2	1559	c.728T>C	c.(727-729)tTt>tCt	p.F243S	IMMP2L_ENST00000450877.1_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.F243S|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000489381.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.F243S|IMMP2L_ENST00000415362.1_Intron|IMMP2L_ENST00000452895.1_Intron	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	243					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		AGCATCTCTTTTTACGATAAC	0.348																																																	0													57.0	61.0	59.0					7																	110763556		2203	4298	6501	SO:0001583	missense	0			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.728T>C	7.37:g.110763556T>C	ENSP00000412417:p.Phe243Ser		O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.F243S	ENST00000422987.3	37	c.728	CCDS5754.1	7	.	.	.	.	.	.	.	.	.	.	T	17.07	3.294595	0.60086	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987;ENST00000421101	T;T;T;T	0.58652	0.32;0.32;0.32;0.32	5.96	5.96	0.96718	.	0.000000	0.64402	D	0.000009	T	0.76593	0.4009	M	0.75085	2.285	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79305	-0.1858	10	0.87932	D	0	.	16.4447	0.83919	0.0:0.0:0.0:1.0	.	243	Q9H3W5	LRRN3_HUMAN	S	243	ENSP00000312001:F243S;ENSP00000397312:F243S;ENSP00000412417:F243S;ENSP00000407927:F243S	ENSP00000312001:F243S	F	+	2	0	LRRN3	110550792	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	8.040000	0.89188	2.284000	0.76573	0.528000	0.53228	TTT	LRRN3	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000173114		0.348	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN3	HGNC	protein_coding	OTTHUMT00000338171.2	-	0.00	64	0	T	NM_018334		110763556	+1	tier1	-	no_errors	ENST00000308478	ensembl	human	known	74_37	missense	25.00	24	8	SNP	1.000	C
LSM14A	26065	genome.wustl.edu	37	19	34706131	34706131	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:34706131G>T	ENST00000433627.5	+	5	716	c.641G>T	c.(640-642)aGa>aTa	p.R214I	LSM14A_ENST00000544216.3_Missense_Mutation_p.R214I|LSM14A_ENST00000540746.2_Missense_Mutation_p.R173I	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)	214					cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					GCTGTTGGGAGAAGGAGTCCT	0.537																																																	0													76.0	70.0	72.0					19																	34706131		2203	4300	6503	SO:0001583	missense	0			AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.641G>T	19.37:g.34706131G>T	ENSP00000413964:p.Arg214Ile		B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Missense_Mutation	SNP	pfam_FDF_dom,superfamily_LSM_dom	p.R214I	ENST00000433627.5	37	c.641	CCDS46040.1	19	.	.	.	.	.	.	.	.	.	.	g	20.8	4.055369	0.75960	.	.	ENSG00000257103	ENST00000544216;ENST00000433627;ENST00000540746	T;T;T	0.32988	1.43;1.43;1.44	5.77	5.77	0.91146	.	0.138323	0.64402	D	0.000003	T	0.57562	0.2062	M	0.73598	2.24	0.80722	D	1	B;D;D	0.61697	0.105;0.99;0.988	B;D;P	0.69142	0.097;0.962;0.775	T	0.50524	-0.8818	10	0.38643	T	0.18	-21.3453	20.3626	0.98863	0.0:0.0:1.0:0.0	.	173;214;214	B4DTG6;Q8ND56;Q8ND56-2	.;LS14A_HUMAN;.	I	214;214;173	ENSP00000446271:R214I;ENSP00000413964:R214I;ENSP00000446451:R173I	ENSP00000314768:R214I	R	+	2	0	LSM14A	39397971	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.374000	0.66167	2.885000	0.99019	0.655000	0.94253	AGA	LSM14A	-	NULL	ENSG00000257103		0.537	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LSM14A	HGNC	protein_coding	OTTHUMT00000451576.3	-	0.00	67	0	G	NM_015578		34706131	+1	tier1	-	no_errors	ENST00000433627	ensembl	human	known	74_37	missense	10.28	96	11	SNP	1.000	T
MALAT1	378938	genome.wustl.edu	37	11	65270090	65270091	+	lincRNA	INS	-	-	T	rs3842272	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:65270090_65270091insT	ENST00000534336.1	+	0	4858_4859					NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		GGAGGGGAAACTTTTTTTTTTT	0.371																																																	0																																												0			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65270101_65270101dupT				RNA	INS	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-	ENSG00000251562		0.371	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1		0.00	45	0	-	NR_002819		65270091	+1	tier1		no_errors	ENST00000534336	ensembl	human	known	74_37	rna	18.75	26	6	INS	0.929:0.911	T
MAP2	4133	genome.wustl.edu	37	2	210561678	210561678	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:210561678A>C	ENST00000360351.4	+	9	4931	c.4425A>C	c.(4423-4425)gaA>gaC	p.E1475D	MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000475600.1_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.E1471D|MAP2_ENST00000199940.6_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1475					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAAAAACAGAAGTTCAGGCCC	0.388																																					Pancreas(27;423 979 28787 29963)												0													53.0	56.0	55.0					2																	210561678		2203	4300	6503	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4425A>C	2.37:g.210561678A>C	ENSP00000353508:p.Glu1475Asp		Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_MAP_tubulin-bd_rpt	p.E1475D	ENST00000360351.4	37	c.4425	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	A	12.42	1.933095	0.34096	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.24723	1.84;1.84	5.56	5.56	0.83823	MAP2/Tau projection (1);	0.000000	0.64402	D	0.000007	T	0.26702	0.0653	L	0.39633	1.23	0.32497	N	0.539334	P;P	0.46784	0.884;0.592	P;P	0.46758	0.509;0.526	T	0.32903	-0.9889	10	0.36615	T	0.2	-25.1725	10.8951	0.47019	0.8598:0.0:0.0:0.1402	.	1471;1475	P11137-3;P11137	.;MAP2_HUMAN	D	1475;1471	ENSP00000353508:E1475D;ENSP00000392164:E1471D	ENSP00000353508:E1475D	E	+	3	2	MAP2	210269923	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.619000	0.46401	2.123000	0.65237	0.528000	0.53228	GAA	MAP2	-	pfam_MAP2_projctn	ENSG00000078018		0.388	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	-	0.00	42	0	A	NM_001039538		210561678	+1	tier1	-	no_errors	ENST00000360351	ensembl	human	known	74_37	missense	27.08	35	13	SNP	1.000	C
MAT1A	4143	genome.wustl.edu	37	10	82036155	82036155	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:82036155G>A	ENST00000372213.3	-	6	1005	c.745C>T	c.(745-747)Cgg>Tgg	p.R249W	MAT1A_ENST00000485270.1_5'Flank	NM_000429.2	NP_000420.1	Q00266	METK1_HUMAN	methionine adenosyltransferase I, alpha	249					cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			endometrium(4)|large_intestine(7)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26			Colorectal(32;0.229)		L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	ATGACAAACCGCCCACTGGGC	0.577																																																	0			GRCh37	CM055977	MAT1A	M							90.0	85.0	87.0					10																	82036155		2203	4300	6503	SO:0001583	missense	0				CCDS7365.1	10q22	2008-08-01			ENSG00000151224	ENSG00000151224			6903	protein-coding gene	gene with protein product	"""S-adenosylmethionine synthetase"""	610550				8393662	Standard	XM_005269842		Approved	MAT, SAMS, MATA1, SAMS1	uc001kbw.3	Q00266	OTTHUMG00000018613	ENST00000372213.3:c.745C>T	10.37:g.82036155G>A	ENSP00000361287:p.Arg249Trp		D3DWD5|Q5QP09	Missense_Mutation	SNP	pfam_S-AdoMet_synt_C,pfam_S-AdoMet_synt_central,pfam_S-AdoMet_synt_N,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	p.R249W	ENST00000372213.3	37	c.745	CCDS7365.1	10	.	.	.	.	.	.	.	.	.	.	G	26.3	4.722770	0.89298	.	.	ENSG00000151224	ENST00000372213;ENST00000372206	D	0.84298	-1.83	4.84	4.84	0.62591	S-adenosylmethionine synthetase, central domain (1);S-adenosylmethionine synthetase superfamily (1);	0.099413	0.64402	D	0.000001	D	0.93314	0.7869	H	0.97732	4.065	0.80722	D	1	D	0.67145	0.996	P	0.52793	0.709	D	0.95434	0.8519	10	0.87932	D	0	-35.2808	15.8349	0.78791	0.0:0.0:1.0:0.0	.	249	Q00266	METK1_HUMAN	W	249	ENSP00000361287:R249W	ENSP00000361280:R249W	R	-	1	2	MAT1A	82026135	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	7.435000	0.80391	2.677000	0.91161	0.655000	0.94253	CGG	MAT1A	-	pfam_S-AdoMet_synt_central,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	ENSG00000151224		0.577	MAT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAT1A	HGNC	protein_coding	OTTHUMT00000049070.1	-	0.00	36	0	G	NM_000429		82036155	-1	tier1	-	no_errors	ENST00000372213	ensembl	human	known	74_37	missense	86.36	3	19	SNP	1.000	A
MATN3	4148	genome.wustl.edu	37	2	20205632	20205632	+	Silent	SNP	G	G	A	rs369658011		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:20205632G>A	ENST00000407540.3	-	2	725	c.663C>T	c.(661-663)ggC>ggT	p.G221G	AC079145.4_ENST00000416575.1_RNA|MATN3_ENST00000421259.2_Silent_p.G221G	NM_002381.4	NP_002372.1	O15232	MATN3_HUMAN	matrilin 3	221	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCCGGTCCACGCCCACAGCAT	0.562																																																	0								G		0,4032		0,0,2016	27.0	30.0	29.0		663	-10.4	0.7	2		29	1,8347		0,1,4173	no	coding-synonymous	MATN3	NM_002381.4		0,1,6189	AA,AG,GG		0.012,0.0,0.0081		221/487	20205632	1,12379	2016	4174	6190	SO:0001819	synonymous_variant	0			AJ001047	CCDS46226.1	2p24-p23	2008-06-03			ENSG00000132031	ENSG00000132031			6909	protein-coding gene	gene with protein product		602109				9287130, 9350998	Standard	NM_002381		Approved	EDM5, HOA	uc002rdl.3	O15232	OTTHUMG00000151788	ENST00000407540.3:c.663C>T	2.37:g.20205632G>A			B2CPU0|Q4ZG02	Silent	SNP	pfam_VWF_A,pfam_Matrilin_coiled-coil_trimer,pfam_EGF-like_Ca-bd_dom,smart_VWF_A,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_A	p.G221	ENST00000407540.3	37	c.663	CCDS46226.1	2																																																																																			MATN3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000132031		0.562	MATN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN3	HGNC	protein_coding	OTTHUMT00000323925.1	-	0.00	74	0	G	NM_002381		20205632	-1	tier1	-	no_errors	ENST00000407540	ensembl	human	known	74_37	silent	35.00	25	14	SNP	0.016	A
MCCC1	56922	genome.wustl.edu	37	3	182737954	182737954	+	Silent	SNP	G	G	T	rs199528231	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:182737954G>T	ENST00000265594.4	-	17	2087	c.1941C>A	c.(1939-1941)ggC>ggA	p.G647G	MCCC1-AS1_ENST00000471731.2_RNA|MCCC1_ENST00000539926.1_3'UTR|MCCC1_ENST00000489909.1_5'Flank|MCCC1_ENST00000492597.1_Silent_p.G538G	NM_020166.3	NP_064551.3	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-CoA carboxylase 1 (alpha)	647	Biotinyl-binding. {ECO:0000255|PROSITE- ProRule:PRU01066}.				biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(17)|ovary(1)|pancreas(2)|prostate(1)|skin(2)	40	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	CTAAGGGGCCGCCCTGAGTTT	0.398																																																	0													93.0	97.0	95.0					3																	182737954		2203	4300	6503	SO:0001819	synonymous_variant	0			AF310972	CCDS3241.1	3q27.1	2010-04-30	2010-04-30		ENSG00000078070	ENSG00000078070	6.4.1.4		6936	protein-coding gene	gene with protein product		609010	"""methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)"""			11170888	Standard	XR_241502		Approved	MCCA	uc003fle.3	Q96RQ3	OTTHUMG00000158355	ENST00000265594.4:c.1941C>A	3.37:g.182737954G>T			Q59ES4|Q9H959|Q9NS97	Silent	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_carboxylate-amine,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_DUF201-type,superfamily_PreATP-grasp_dom,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_Biotin_lipoyl	p.G647	ENST00000265594.4	37	c.1941	CCDS3241.1	3																																																																																			MCCC1	-	superfamily_Single_hybrid_motif,pfscan_Biotin_lipoyl	ENSG00000078070		0.398	MCCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCCC1	HGNC	protein_coding	OTTHUMT00000350775.1		0.00	38	0	G	NM_020166		182737954	-1			no_errors	ENST00000265594	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.180	T
MCF2L	23263	genome.wustl.edu	37	13	113634042	113634042	+	Intron	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr13:113634042C>T	ENST00000375608.3	+	3	227				MCF2L_ENST00000375601.3_Missense_Mutation_p.R21C|MCF2L_ENST00000397030.1_Intron|MCF2L_ENST00000535094.2_Intron|MCF2L_ENST00000375604.2_Intron|MCF2L_ENST00000421756.1_Missense_Mutation_p.R21C|MCF2L_ENST00000442652.2_Intron			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GCCCAGGAGGCGCCGGGGAAC	0.672																																																	0													23.0	29.0	27.0					13																	113634042		1568	3580	5148	SO:0001627	intron_variant	0			AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.170-35035C>T	13.37:g.113634042C>T			A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	pfam_DH-domain,pfam_Spectrin_repeat,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.R21C	ENST00000375608.3	37	c.61		13	.	.	.	.	.	.	.	.	.	.	C	16.60	3.169308	0.57584	.	.	ENSG00000126217	ENST00000421756;ENST00000375601	T;T	0.36878	1.28;1.23	3.45	1.71	0.24356	.	.	.	.	.	T	0.35364	0.0929	.	.	.	0.19945	N	0.999946	.	.	.	.	.	.	T	0.30357	-0.9981	6	0.87932	D	0	.	5.9821	0.19413	0.0:0.769:0.0:0.231	.	.	.	.	C	21	ENSP00000397285:R21C;ENSP00000364751:R21C	ENSP00000364751:R21C	R	+	1	0	MCF2L	112682043	0.002000	0.14202	0.069000	0.20011	0.262000	0.26303	0.182000	0.16900	0.459000	0.27016	0.478000	0.44815	CGC	MCF2L	-	NULL	ENSG00000126217		0.672	MCF2L-001	KNOWN	basic	protein_coding	MCF2L	HGNC	protein_coding	OTTHUMT00000045849.4		0.00	192	0	C			113634042	+1			no_errors	ENST00000375601	ensembl	human	known	74_37	missense	6.00	93	6	SNP	0.073	T
MDGA2	161357	genome.wustl.edu	37	14	47311204	47311204	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr14:47311204A>C	ENST00000399232.2	-	17	3165	c.2801T>G	c.(2800-2802)gTt>gGt	p.V934G	MDGA2_ENST00000399222.3_Missense_Mutation_p.V136G|MDGA2_ENST00000439988.3_Missense_Mutation_p.V1003G|MDGA2_ENST00000357362.3_Missense_Mutation_p.V705G|MDGA2_ENST00000426342.1_Missense_Mutation_p.V705G	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	934					pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						CAAAATCCCAACAGCACCATC	0.373																																																	0													83.0	76.0	78.0					14																	47311204		1848	4092	5940	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2801T>G	14.37:g.47311204A>C	ENSP00000382178:p.Val934Gly		F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.V1003G	ENST00000399232.2	37	c.3008		14	.	.	.	.	.	.	.	.	.	.	A	1.815	-0.473704	0.04414	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000399222;ENST00000357362	T;T;T;T;T	0.65549	0.01;0.25;-0.16;2.97;0.25	5.97	4.81	0.61882	.	0.291489	0.23614	U	0.046312	T	0.40322	0.1112	N	0.08118	0	0.54753	D	0.999988	B	0.02656	0.0	B	0.01281	0.0	T	0.18713	-1.0328	10	0.41790	T	0.15	.	9.594	0.39563	0.72:0.0:0.0:0.28	.	934	Q7Z553	MDGA2_HUMAN	G	934;705;1003;136;705	ENSP00000400011:V934G;ENSP00000405456:V705G;ENSP00000382178:V1003G;ENSP00000382168:V136G;ENSP00000349925:V705G	ENSP00000349925:V705G	V	-	2	0	MDGA2	46380954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.165000	0.31822	1.054000	0.40438	0.528000	0.53228	GTT	MDGA2	-	NULL	ENSG00000272781		0.373	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	-	0.00	68	0	A	NM_182830		47311204	-1	tier1	-	no_errors	ENST00000439988	ensembl	human	known	74_37	missense	40.82	29	20	SNP	1.000	C
C17orf107	100130311	genome.wustl.edu	37	17	4800531	4800531	+	5'Flank	SNP	C	C	T	rs368980803		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:4800531C>T	ENST00000381365.3	+	0	0				C17orf107_ENST00000521575.1_5'Flank|MINK1_ENST00000347992.7_Silent_p.S1287S|MINK1_ENST00000453408.3_Silent_p.S1296S|MINK1_ENST00000355280.6_Silent_p.S1316S	NM_001145536.1	NP_001139008.1	Q6ZR85	CQ107_HUMAN	chromosome 17 open reading frame 107											endometrium(2)	2						CTGGGGGCAGCAGCCAAGTTT	0.602																																																	0								C	,,,	0,3846		0,0,1923	67.0	70.0	69.0		3888,3837,3948,3861	4.1	1.0	17		69	2,8274		0,2,4136	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	MINK1	NM_001024937.3,NM_015716.4,NM_153827.4,NM_170663.4	,,,	0,2,6059	TT,TC,CC		0.0242,0.0,0.0165	,,,	1296/1313,1279/1296,1316/1333,1287/1304	4800531	2,12120	1923	4138	6061	SO:0001631	upstream_gene_variant	0			AK128415	CCDS45591.1	17p13.2	2009-09-30			ENSG00000205710	ENSG00000205710			37238	protein-coding gene	gene with protein product							Standard	NM_001145536		Approved		uc002fzl.3	Q6ZR85	OTTHUMG00000164838		17.37:g.4800531C>T	Exception_encountered			Silent	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.S1316	ENST00000381365.3	37	c.3948	CCDS45591.1	17																																																																																			MINK1	-	NULL	ENSG00000141503		0.602	C17orf107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MINK1	HGNC	protein_coding	OTTHUMT00000380556.1	-	0.00	77	0	C	NM_001145536		4800531	+1	tier1	-	no_errors	ENST00000355280	ensembl	human	known	74_37	silent	7.02	53	4	SNP	1.000	T
MIR181A1	406995	genome.wustl.edu	37	1	198828087	198828087	+	RNA	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:198828087T>C	ENST00000385026.1	-	0	110				MIR181B1_ENST00000385240.1_RNA	NR_029626.1				microRNA 181a-1																		GATTGTGACCTTTTAAAAAAT	0.458																																																	0													149.0	138.0	141.0					1																	198828087		1568	3582	5150			0					1q32.1	2011-09-12	2006-05-16	2008-12-18	ENSG00000207759	ENSG00000207759		"""ncRNAs / Micro RNAs"""	31590	non-coding RNA	RNA, micro		612742	"""microRNA 213"""	MIRN213, MIRN181A1			Standard	NR_029626		Approved	hsa-mir-213	uc001guy.3				1.37:g.198828087T>C				RNA	SNP	-	NULL	ENST00000385026.1	37	NULL		1																																																																																			MIR181B1	-	-	ENSG00000207975		0.458	MIR181A1-201	KNOWN	basic	miRNA	MIR181B1	HGNC	miRNA			0.00	70	0	T	NR_029626		198828087	-1			no_errors	ENST00000385240	ensembl	human	known	74_37	rna	5.80	65	4	SNP	1.000	C
GNAS-AS1	149775	genome.wustl.edu	37	20	57392495	57392495	+	RNA	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr20:57392495A>C	ENST00000424094.2	-	0	2312				MIR296_ENST00000385215.1_lincRNA|MIR298_ENST00000401212.1_RNA	NR_002785.2				GNAS antisense RNA 1																		GGTAGGTAAAACTCCCGGCAG	0.687																																																	0																																												0			AJ251759		20q13.32	2012-10-19	2012-08-15	2010-11-25	ENSG00000235590	ENSG00000235590		"""Long non-coding RNAs"", ""-"""	24872	non-coding RNA	RNA, long non-coding	"""GNAS antisense"", ""non-protein coding RNA 75"""	610540	"""GNAS antisense RNA (non-protein coding)"", ""GNAS antisense RNA 1 (non-protein coding)"""	GNASAS, GNAS-AS		10749992	Standard	NR_002785		Approved	SANG, NESP-AS, NESPAS, GNAS1AS, NCRNA00075	uc002xzs.2		OTTHUMG00000060481		20.37:g.57392495A>C				RNA	SNP	-	NULL	ENST00000424094.2	37	NULL		20																																																																																			MIR296	-	-	ENSG00000268649		0.687	GNAS-AS1-001	KNOWN	basic	antisense	MIR296	HGNC	antisense	OTTHUMT00000133891.2	-	0.00	34	0	A	NR_002785		57392495	-1	tier1	-	no_errors	ENST00000596276	ensembl	human	known	74_37	rna	40.62	19	13	SNP	0.000	C
MMP25	64386	genome.wustl.edu	37	16	3100089	3100089	+	Silent	SNP	G	G	T	rs143114141		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:3100089G>T	ENST00000336577.4	+	3	549	c.312G>T	c.(310-312)cgG>cgT	p.R104R	MMP25_ENST00000570755.1_3'UTR|RP11-473M20.7_ENST00000576250.1_RNA	NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25	119					negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	TGGTCAGGCGGCGTCGCCGGT	0.701																																					NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)												0								G		1,4393		0,1,2196	53.0	58.0	56.0		312	-7.1	0.0	16	dbSNP_134	56	1,8595	1.2+/-3.3	0,1,4297	no	coding-synonymous	MMP25	NM_022468.4		0,2,6493	TT,TG,GG		0.0116,0.0228,0.0154		104/563	3100089	2,12988	2197	4298	6495	SO:0001819	synonymous_variant	0			AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.312G>T	16.37:g.3100089G>T			Q96F04|Q96TE2	Silent	SNP	pirsf_Pept_M10A_Metazoans,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin-like_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.R104	ENST00000336577.4	37	c.312	CCDS10492.1	16																																																																																			MMP25	-	pirsf_Pept_M10A_Metazoans	ENSG00000008516		0.701	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP25	HGNC	protein_coding	OTTHUMT00000437116.1	-	0.00	75	0	G	NM_022468		3100089	+1	tier1	rs143114141	no_errors	ENST00000336577	ensembl	human	known	74_37	silent	23.81	48	15	SNP	0.003	T
MN1	4330	genome.wustl.edu	37	22	28194934	28194936	+	In_Frame_Del	DEL	TGC	TGC	-	rs34890218|rs45480998|rs45597040	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr22:28194934_28194936delTGC	ENST00000302326.4	-	1	2550_2552	c.1596_1598delGCA	c.(1594-1599)cagcaa>caa	p.532_533QQ>Q		NM_002430.2	NP_002421.3	Q10571	MN1_HUMAN	meningioma (disrupted in balanced translocation) 1	532	Poly-Gln.				intramembranous ossification (GO:0001957)			p.Q532Q(1)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	45						ctgctgctgttgctgctgctgct	0.65			T	ETV6	"""AML, meningioma"""																																			Dom	yes		22	22q13	4330	meningioma (disrupted in balanced translocation) 1		"""L, O"""	1	Substitution - coding silent(1)	prostate(1)								226,138,2110		41,6,138,37,58,957						-0.4	1.0		dbSNP_126	5	429,825,4222		34,24,337,178,445,1720	no	codingComplex	MN1	NM_002430.2		75,30,475,215,503,2677	A1A1,A1A2,A1R,A2A2,A2R,RR		22.8999,14.713,20.3522				655,963,6332				SO:0001651	inframe_deletion	0			X82209	CCDS42998.1	22q12.1	2010-09-29			ENSG00000169184	ENSG00000169184			7180	protein-coding gene	gene with protein product	"""probable tumor suppressor protein MN1"""	156100	"""meningioma chromosome region"""	MGCR		7731706, 12569362	Standard	NM_002430		Approved	MGCR1-PEN, MGCR1	uc003adj.3	Q10571	OTTHUMG00000150975	ENST00000302326.4:c.1596_1598delGCA	22.37:g.28194943_28194945delTGC	ENSP00000304956:p.Gln550del		A9Z1V9	In_Frame_Del	DEL	NULL	p.Q536in_frame_del	ENST00000302326.4	37	c.1598_1596	CCDS42998.1	22																																																																																			MN1	-	NULL	ENSG00000169184		0.650	MN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MN1	HGNC	protein_coding	OTTHUMT00000320737.1		0.00	45	0	TGC	NM_002430		28194936	-1	tier1		no_errors	ENST00000302326	ensembl	human	known	74_37	in_frame_del	10.81	33	4	DEL	1.000:1.000:0.998	-
MOCOS	55034	genome.wustl.edu	37	18	33779985	33779985	+	Silent	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr18:33779985G>T	ENST00000261326.5	+	4	660	c.639G>T	c.(637-639)ctG>ctT	p.L213L		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase									p.L213L(1)		breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GATACCCCCTGTCCTGGATAG	0.577																																																	1	Substitution - coding silent(1)	lung(1)											74.0	75.0	75.0					18																	33779985		2203	4300	6503	SO:0001819	synonymous_variant	0			AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.639G>T	18.37:g.33779985G>T				Silent	SNP	pfam_MOSC_N,pfam_MoCF_Sase_C,pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase,superfamily_Pyrv_Knase-like_insert_dom	p.L213	ENST00000261326.5	37	c.639	CCDS11919.1	18																																																																																			MOCOS	-	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase	ENSG00000075643		0.577	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOCOS	HGNC	protein_coding	OTTHUMT00000255801.1		0.00	49	0	G			33779985	+1			no_errors	ENST00000261326	ensembl	human	known	74_37	silent	9.52	19	2	SNP	0.061	T
MPDZ	8777	genome.wustl.edu	37	9	13205984	13205984	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:13205984C>T	ENST00000319217.7	-	11	1652	c.1405G>A	c.(1405-1407)Gag>Aag	p.E469K	MPDZ_ENST00000381022.2_Missense_Mutation_p.E469K|MPDZ_ENST00000381015.4_Missense_Mutation_p.E469K|MPDZ_ENST00000447879.1_Missense_Mutation_p.E469K|MPDZ_ENST00000546205.1_Missense_Mutation_p.E469K|MPDZ_ENST00000536827.1_Missense_Mutation_p.E469K|MPDZ_ENST00000541718.1_Missense_Mutation_p.E469K	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	469					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)	p.E469*(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		GACATGAGCTCGGCTTCCTGC	0.428																																																	1	Substitution - Nonsense(1)	prostate(1)											186.0	178.0	181.0					9																	13205984		1935	4139	6074	SO:0001583	missense	0			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.1405G>A	9.37:g.13205984C>T	ENSP00000320006:p.Glu469Lys		A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_PDZ,pfscan_L27,pfscan_PDZ	p.E469K	ENST00000319217.7	37	c.1405		9	.	.	.	.	.	.	.	.	.	.	C	13.15	2.151391	0.38021	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205	T;T;T;T;T;T;T	0.11169	2.84;2.8;2.8;2.8;2.85;2.84;2.84	6.17	5.26	0.73747	.	0.157201	0.29676	N	0.011499	T	0.05090	0.0136	N	0.14661	0.345	0.38908	D	0.95747	B;P;P	0.36465	0.419;0.554;0.554	B;B;B	0.27887	0.038;0.058;0.084	T	0.46693	-0.9173	10	0.21540	T	0.41	.	9.0263	0.36232	0.1292:0.6342:0.2366:0.0	.	469;469;469	B7ZMI4;O75970-3;O75970-2	.;.;.	K	469	ENSP00000320006:E469K;ENSP00000439807:E469K;ENSP00000370410:E469K;ENSP00000444151:E469K;ENSP00000415208:E469K;ENSP00000370403:E469K;ENSP00000446358:E469K	ENSP00000320006:E469K	E	-	1	0	MPDZ	13195984	0.118000	0.22208	0.188000	0.23233	0.016000	0.09150	2.143000	0.42187	2.941000	0.99782	0.655000	0.94253	GAG	MPDZ	-	superfamily_PDZ	ENSG00000107186		0.428	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	MPDZ	HGNC	protein_coding	OTTHUMT00000055485.2		0.00	58	0	C	NM_003829		13205984	-1			no_errors	ENST00000319217	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.177	T
MROH2A	339766	genome.wustl.edu	37	2	234710881	234710881	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:234710881G>A	ENST00000389758.3	+	15	1794	c.1628G>A	c.(1627-1629)tGt>tAt	p.C543Y				A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A	573																	ACTCCTATCTGTATCAGCCTC	0.557																																																	0																																										SO:0001583	missense	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.1628G>A	2.37:g.234710881G>A	ENSP00000374408:p.Cys543Tyr			Missense_Mutation	SNP	superfamily_ARM-type_fold	p.C543Y	ENST00000389758.3	37	c.1628		2	.	.	.	.	.	.	.	.	.	.	G	20.5	4.002489	0.74932	.	.	ENSG00000185038	ENST00000389758	T	0.08984	3.03	5.5	5.5	0.81552	.	0.000000	0.45126	D	0.000397	T	0.23926	0.0579	M	0.69823	2.125	0.38322	D	0.943567	.	.	.	.	.	.	T	0.00834	-1.1547	8	0.72032	D	0.01	.	14.8886	0.70590	0.0:0.0:1.0:0.0	.	.	.	.	Y	543	ENSP00000374408:C543Y	ENSP00000374408:C543Y	C	+	2	0	HEATR7B1	234375620	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.357000	0.59436	2.584000	0.87258	0.655000	0.94253	TGT	MROH2A	-	superfamily_ARM-type_fold	ENSG00000185038		0.557	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	MROH2A	HGNC	protein_coding	OTTHUMT00000130646.6	-	0.00	54	0	G	XM_291007		234710881	+1	tier1	-	no_errors	ENST00000389758	ensembl	human	novel	74_37	missense	8.33	44	4	SNP	1.000	A
MROH9	80133	genome.wustl.edu	37	1	170965775	170965775	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:170965775T>G	ENST00000367758.3	+	14	1564	c.1465T>G	c.(1465-1467)Ttt>Gtt	p.F489V	MROH9_ENST00000367759.4_Missense_Mutation_p.F489V	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	489																	TGGAGTCTGCTTTATTGCTAA	0.428																																																	0													204.0	192.0	196.0					1																	170965775		1861	4098	5959	SO:0001583	missense	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.1465T>G	1.37:g.170965775T>G	ENSP00000356732:p.Phe489Val		A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.F489V	ENST00000367758.3	37	c.1465	CCDS41436.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	11.06|11.06	1.526302|1.526302	0.27299|0.27299	.|.	.|.	ENSG00000117501|ENSG00000117501	ENST00000367759;ENST00000367758|ENST00000426136	T;T|.	0.12984|.	4.29;2.63|.	5.75|5.75	1.45|1.45	0.22620|0.22620	.|.	0.236564|.	0.30134|.	N|.	0.010337|.	T|T	0.07954|0.07954	0.0199|0.0199	N|N	0.22421|0.22421	0.69|0.69	0.09310|0.09310	N|N	1|1	B;B|.	0.21225|.	0.053;0.053|.	B;B|.	0.21708|.	0.036;0.036|.	T|T	0.33879|0.33879	-0.9851|-0.9851	10|5	0.62326|.	D|.	0.03|.	-6.8967|-6.8967	2.9668|2.9668	0.05910|0.05910	0.1432:0.559:0.1388:0.1591|0.1432:0.559:0.1388:0.1591	.|.	489;489|.	F5GWX6;Q5TGP6|.	.;CA129_HUMAN|.	V|R	489|95	ENSP00000356733:F489V;ENSP00000356732:F489V|.	ENSP00000356732:F489V|.	F|L	+|+	1|2	0|0	C1orf129|C1orf129	169232399|169232399	0.006000|0.006000	0.16342|0.16342	0.003000|0.003000	0.11579|0.11579	0.000000|0.000000	0.00434|0.00434	0.001000|0.001000	0.13038|0.13038	0.344000|0.344000	0.23847|0.23847	-1.118000|-1.118000	0.02043|0.02043	TTT|CTT	MROH9	-	superfamily_ARM-type_fold	ENSG00000117501		0.428	MROH9-001	KNOWN	basic|CCDS	protein_coding	MROH9	HGNC	protein_coding	OTTHUMT00000099327.1	-	0.00	66	0	T	NM_025063		170965775	+1	tier1	-	no_errors	ENST00000367759	ensembl	human	known	74_37	missense	14.29	60	10	SNP	0.009	G
MRPL39	54148	genome.wustl.edu	37	21	26965201	26965201	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr21:26965201C>T	ENST00000352957.4	-	8	885	c.844G>A	c.(844-846)Gca>Aca	p.A282T	MRPL39_ENST00000307301.7_Missense_Mutation_p.A282T	NM_017446.3	NP_059142	Q9NYK5	RM39_HUMAN	mitochondrial ribosomal protein L39	282						mitochondrial ribosome (GO:0005761)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	10						TTGTGAACTGCTGATACTTCA	0.378																																																	0													93.0	87.0	89.0					21																	26965201		2203	4300	6503	SO:0001583	missense	0			AB051346	CCDS13573.1, CCDS33522.1	21q11.2-q21	2012-09-13			ENSG00000154719	ENSG00000154719		"""Mitochondrial ribosomal proteins / large subunits"""	14027	protein-coding gene	gene with protein product		611845				11543634	Standard	NM_080794		Approved	RPML5, MRP-L5, MGC104174, PRED66, PRED22, C21orf92, L39mt, MSTP003, MGC3400, FLJ20451	uc002yln.3	Q9NYK5	OTTHUMG00000078371	ENST00000352957.4:c.844G>A	21.37:g.26965201C>T	ENSP00000284967:p.Ala282Thr		C9JYA5|Q32Q74|Q5QTR3|Q96Q65|Q9BSQ7|Q9BZV6|Q9NX44	Missense_Mutation	SNP	superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_TGS-like	p.A282T	ENST00000352957.4	37	c.844	CCDS13573.1	21	.	.	.	.	.	.	.	.	.	.	C	27.5	4.838633	0.91117	.	.	ENSG00000154719	ENST00000352957;ENST00000307301;ENST00000419219	T;T;T	0.52983	0.69;0.69;0.64	5.39	5.39	0.77823	Threonyl/alanyl tRNA synthetase, class II-like, putative editing domain (1);	0.106736	0.64402	D	0.000005	T	0.58807	0.2148	M	0.77486	2.375	0.58432	D	0.999999	P;P	0.37985	0.613;0.55	B;B	0.42495	0.389;0.358	T	0.63269	-0.6675	10	0.62326	D	0.03	-20.6679	18.9269	0.92549	0.0:1.0:0.0:0.0	.	282;282	Q9NYK5;Q9NYK5-2	RM39_HUMAN;.	T	282;282;272	ENSP00000284967:A282T;ENSP00000305682:A282T;ENSP00000404426:A272T	ENSP00000305682:A282T	A	-	1	0	MRPL39	25887072	1.000000	0.71417	0.995000	0.50966	0.951000	0.60555	5.475000	0.66787	2.799000	0.96334	0.655000	0.94253	GCA	MRPL39	-	superfamily_Thr/Ala-tRNA-synth_IIc_edit	ENSG00000154719		0.378	MRPL39-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MRPL39	HGNC	protein_coding	OTTHUMT00000171194.1	-	0.00	66	0	C	NM_017446		26965201	-1	tier1	-	no_errors	ENST00000307301	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
MSH3	4437	genome.wustl.edu	37	5	79966124	79966124	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:79966124C>T	ENST00000265081.6	+	4	868	c.788C>T	c.(787-789)gCa>gTa	p.A263V		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	263	Interaction with EXO1.				ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		GGGGAAGATGCAGAGGTAAGT	0.343								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)												0													132.0	135.0	134.0					5																	79966124		2203	4300	6503	SO:0001583	missense	0			U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.788C>T	5.37:g.79966124C>T	ENSP00000265081:p.Ala263Val		A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mmatch_repair_MutS_con_dom,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_P-loop_NTPase,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mmatch_repair_MutS_con_dom,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.A263V	ENST00000265081.6	37	c.788	CCDS34195.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.331882	0.95733	.	.	ENSG00000113318	ENST00000265081;ENST00000535995	D	0.96554	-4.05	5.67	5.67	0.87782	DNA mismatch repair protein MutS, N-terminal (2);DNA mismatch repair protein MutS-like, N-terminal (1);	0.112937	0.64402	D	0.000019	D	0.99004	0.9660	H	0.98256	4.185	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.99218	1.0878	9	.	.	.	-19.1845	19.3818	0.94540	0.0:1.0:0.0:0.0	.	263	P20585	MSH3_HUMAN	V	263;254	ENSP00000265081:A263V	.	A	+	2	0	MSH3	80001880	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.402000	0.79972	2.666000	0.90696	0.655000	0.94253	GCA	MSH3	-	pfam_DNA_mismatch_repair_MutS-lik_N,superfamily_DNA_mismatch_repair_MutS_N	ENSG00000113318		0.343	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	HGNC	protein_coding	OTTHUMT00000369471.1	-	0.00	38	0	C	NM_002439		79966124	+1	tier1	-	no_errors	ENST00000265081	ensembl	human	known	74_37	missense	12.50	21	3	SNP	1.000	T
MUC15	143662	genome.wustl.edu	37	11	26582672	26582672	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:26582672T>G	ENST00000455601.2	-	4	1063	c.945A>C	c.(943-945)gaA>gaC	p.E315D	ANO3_ENST00000256737.3_Intron|ANO3_ENST00000525139.1_Intron|MUC15_ENST00000436318.2_Missense_Mutation_p.E342D|ANO3_ENST00000531568.1_Intron|MUC15_ENST00000281268.8_Missense_Mutation_p.E292D|ANO3_ENST00000537978.1_Intron|ANO3_ENST00000529242.1_Intron|MUC15_ENST00000529533.1_Missense_Mutation_p.E342D|MUC15_ENST00000527569.1_Missense_Mutation_p.E292D	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	315					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						GTGCATTTTCTTCACTTTCTG	0.408																																																	0													188.0	169.0	175.0					11																	26582672		2203	4300	6503	SO:0001583	missense	0			AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.945A>C	11.37:g.26582672T>G	ENSP00000397339:p.Glu315Asp		B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	NULL	p.E342D	ENST00000455601.2	37	c.1026	CCDS7859.1	11	.	.	.	.	.	.	.	.	.	.	T	10.05	1.245075	0.22796	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000281268;ENST00000529533;ENST00000527569	T;T;T;T;T	0.23950	1.9;1.89;1.88;1.89;1.88	5.33	4.03	0.46877	.	1.812460	0.03040	N	0.153296	T	0.13970	0.0338	N	0.08118	0	0.09310	N	0.999996	B;B;B	0.13594	0.002;0.003;0.008	B;B;B	0.13407	0.006;0.009;0.009	T	0.23833	-1.0177	10	0.16420	T	0.52	-6.9608	5.1177	0.14843	0.0:0.1236:0.1787:0.6977	.	292;315;342	F8W945;Q8N387;E9PII6	.;MUC15_HUMAN;.	D	315;342;292;342;292	ENSP00000397339:E315D;ENSP00000416753:E342D;ENSP00000281268:E292D;ENSP00000431983:E342D;ENSP00000431945:E292D	ENSP00000281268:E292D	E	-	3	2	MUC15	26539248	0.236000	0.23804	0.862000	0.33874	0.035000	0.12851	0.839000	0.27586	2.142000	0.66516	0.482000	0.46254	GAA	MUC15	-	NULL	ENSG00000169550		0.408	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC15	HGNC	protein_coding	OTTHUMT00000387866.1	-	0.00	66	0	T	NM_145650		26582672	-1	tier1	-	no_errors	ENST00000436318	ensembl	human	known	74_37	missense	39.13	28	18	SNP	0.545	G
MYCBP2	23077	genome.wustl.edu	37	13	77636817	77636817	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr13:77636817C>T	ENST00000544440.2	-	74	12591	c.12574G>A	c.(12574-12576)Gca>Aca	p.A4192T	MYCBP2_ENST00000407578.2_Missense_Mutation_p.A4230T|MYCBP2_ENST00000357337.6_Missense_Mutation_p.A4192T					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CATAGGGATGCGAGAGCAAGC	0.443																																																	0													143.0	128.0	133.0					13																	77636817		2203	4300	6503	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.12574G>A	13.37:g.77636817C>T	ENSP00000444596:p.Ala4192Thr			Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_RCC1/BLIP-II,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.A4230T	ENST00000544440.2	37	c.12688		13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.302445|5.302445	0.95601|0.95601	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440|ENST00000429715	T;T;T|.	0.50813|.	0.74;0.73;0.74|.	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75997|0.75997	0.3926|0.3926	M|M	0.68593|0.68593	2.085|2.085	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.71184|.	0.972|.	T|T	0.72636|0.72636	-0.4233|-0.4233	10|5	0.87932|.	D|.	0|.	.|.	20.27|20.27	0.98469|0.98469	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	4192|.	O75592|.	MYCB2_HUMAN|.	T|H	4192;4230;4192|612	ENSP00000349892:A4192T;ENSP00000384288:A4230T;ENSP00000444596:A4192T|.	ENSP00000349892:A4192T|.	A|R	-|-	1|2	0|0	MYCBP2|MYCBP2	76534818|76534818	1.000000|1.000000	0.71417|0.71417	0.488000|0.488000	0.27440|0.27440	0.824000|0.824000	0.46624|0.46624	7.752000|7.752000	0.85141|0.85141	2.854000|2.854000	0.98071|0.98071	0.655000|0.655000	0.94253|0.94253	GCA|CGC	MYCBP2	-	NULL	ENSG00000005810		0.443	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1		0.00	47	0	C	NM_015057		77636817	-1			no_errors	ENST00000407578	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	T
MYH2	4620	genome.wustl.edu	37	17	10426981	10426981	+	Silent	SNP	G	G	A	rs1126624|rs562803081		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:10426981G>A	ENST00000245503.5	-	37	5688	c.5304C>T	c.(5302-5304)gcC>gcT	p.A1768A	MYH2_ENST00000532183.2_Intron|MYH2_ENST00000397183.2_Silent_p.A1768A|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	1768					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CCATCATGGCGGCCTAAATAG	0.488													g|||	1	0.000199681	0.0	0.0	5008	,	,		19396	0.0		0.0	False		,,,				2504	0.001																0													104.0	106.0	106.0					17																	10426981		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.5304C>T	17.37:g.10426981G>A			A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1768	ENST00000245503.5	37	c.5304	CCDS11156.1	17																																																																																			MYH2	-	pfam_Myosin_tail	ENSG00000125414		0.488	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	-	0.00	110	0	G	NM_017534		10426981	-1	tier1	-	no_errors	ENST00000245503	ensembl	human	known	74_37	silent	73.24	18	52	SNP	0.061	A
MYOM1	8736	genome.wustl.edu	37	18	3067396	3067396	+	Nonsense_Mutation	SNP	G	G	T	rs374904841		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr18:3067396G>T	ENST00000356443.4	-	38	5255	c.4922C>A	c.(4921-4923)tCg>tAg	p.S1641*	MYOM1_ENST00000261606.7_Nonsense_Mutation_p.S1545*|MYOM1_ENST00000400569.3_Nonsense_Mutation_p.S1641*	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1641	Ig-like C2-type 5.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GTATTTGCCCGAGTCAGCGGT	0.602																																																	0													77.0	81.0	80.0					18																	3067396		2203	4300	6503	SO:0001587	stop_gained	0			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4922C>A	18.37:g.3067396G>T	ENSP00000348821:p.Ser1641*		Q14BD6|Q6H969|Q6ZUU0	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S1641*	ENST00000356443.4	37	c.4922	CCDS45824.1	18	.	.	.	.	.	.	.	.	.	.	G	46	12.617811	0.99683	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	.	.	.	5.79	5.79	0.91817	.	0.171467	0.52532	D	0.000063	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.0371	0.97565	0.0:0.0:1.0:0.0	.	.	.	.	X	1641;1641;1545	.	ENSP00000261606:S1545X	S	-	2	0	MYOM1	3057396	1.000000	0.71417	0.963000	0.40424	0.594000	0.36715	7.896000	0.87350	2.734000	0.93682	0.655000	0.94253	TCG	MYOM1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000101605		0.602	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYOM1	HGNC	protein_coding	OTTHUMT00000441037.2		0.00	56	0	G	NM_003803		3067396	-1			no_errors	ENST00000356443	ensembl	human	known	74_37	nonsense	9.09	40	4	SNP	1.000	T
NACA	4666	genome.wustl.edu	37	12	57106968	57106968	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:57106968C>T	ENST00000454682.1	-	7	6258	c.5977G>A	c.(5977-5979)Gat>Aat	p.D1993N	NACA_ENST00000550952.1_Missense_Mutation_p.D840N|NACA_ENST00000552540.1_Missense_Mutation_p.D130N|NACA_ENST00000551793.1_5'Flank|NACA_ENST00000548563.1_Missense_Mutation_p.D51N|NACA_ENST00000356769.3_Missense_Mutation_p.D130N|NACA_ENST00000393891.4_Missense_Mutation_p.D130N|NACA_ENST00000546392.1_Missense_Mutation_p.D130N	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1993	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						TGGGATAAATCTTCGATCTAC	0.383			T	BCL6	NHL																																			Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0													54.0	50.0	51.0					12																	57106968		2203	4300	6503	SO:0001583	missense	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.5977G>A	12.37:g.57106968C>T	ENSP00000403817:p.Asp1993Asn			Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx_dom	p.D1993N	ENST00000454682.1	37	c.5977		12	.	.	.	.	.	.	.	.	.	.	C	24.5	4.539714	0.85917	.	.	ENSG00000196531	ENST00000550920;ENST00000454682;ENST00000550952;ENST00000356769;ENST00000552540;ENST00000393891;ENST00000548563;ENST00000546392;ENST00000549259;ENST00000552055;ENST00000546862	T;T;T;T;T;T;T;T;T	0.69175	0.33;-0.08;-0.38;0.34;0.34;0.34;0.34;0.24;0.16	5.31	5.31	0.75309	Nascent polypeptide-associated complex NAC (2);	0.051063	0.85682	D	0.000000	D	0.82926	0.5143	M	0.83852	2.665	0.80722	D	1	P;D;B	0.69078	0.743;0.997;0.124	D;D;B	0.69824	0.916;0.966;0.09	D	0.84668	0.0710	10	0.54805	T	0.06	.	17.7494	0.88430	0.0:1.0:0.0:0.0	.	1993;840;130	E9PAV3;F8VU71;Q13765	.;.;NACA_HUMAN	N	128;1993;840;130;130;130;51;130;130;126;51	ENSP00000448039:D128N;ENSP00000403817:D1993N;ENSP00000448035:D840N;ENSP00000349212:D130N;ENSP00000447821:D130N;ENSP00000377469:D130N;ENSP00000446801:D130N;ENSP00000447133:D130N;ENSP00000450383:D126N	ENSP00000349212:D130N	D	-	1	0	NACA	55393235	1.000000	0.71417	0.948000	0.38648	0.291000	0.27294	7.593000	0.82686	2.491000	0.84063	0.557000	0.71058	GAT	NACA	-	pfam_Nas_poly-pep-assoc_cplx_dom,pfscan_Nas_poly-pep-assoc_cplx_dom	ENSG00000196531		0.383	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding		-	0.00	84	0	C	NM_005594		57106968	-1	tier1	-	no_errors	ENST00000454682	ensembl	human	known	74_37	missense	41.57	52	37	SNP	1.000	T
NADK	65220	genome.wustl.edu	37	1	1688592	1688594	+	Intron	DEL	AGG	AGG	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:1688592_1688594delAGG	ENST00000341426.5	-	4	615				NADK_ENST00000344463.4_In_Frame_Del_p.244_245AW>G|NADK_ENST00000492768.1_Intron|NADK_ENST00000378625.1_In_Frame_Del_p.244_245AW>G|NADK_ENST00000341991.3_Intron|NADK_ENST00000342348.5_Intron	NM_023018.4	NP_075394.3	O95544	NADK_HUMAN	NAD kinase						ATP metabolic process (GO:0046034)|NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)|phosphorylation (GO:0016310)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			NS(1)|autonomic_ganglia(1)|endometrium(4)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|stomach(1)|urinary_tract(1)	17	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;8.75e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.33e-23)|GBM - Glioblastoma multiforme(42;1.35e-07)|Colorectal(212;0.000203)|COAD - Colon adenocarcinoma(227;0.000225)|Kidney(185;0.00265)|STAD - Stomach adenocarcinoma(132;0.00655)|BRCA - Breast invasive adenocarcinoma(365;0.00855)|KIRC - Kidney renal clear cell carcinoma(229;0.0382)|Lung(427;0.207)		TGTGCACCCCAGGCCCCCTTCCC	0.626																																																	0									,,,	28,3504		4,20,1742					,,,	2.2	0.0			5	129,6821		0,129,3346	no	intron,intron,coding,intron	NADK	NM_023018.4,NM_001198995.1,NM_001198994.1,NM_001198993.1	,,,	4,149,5088	A1A1,A1R,RR		1.8561,0.7928,1.4978	,,,	,,,		157,10325				SO:0001627	intron_variant	0			BC001709	CCDS30565.1, CCDS55561.1, CCDS55562.1	1p36.33	2013-04-29			ENSG00000008130	ENSG00000008130	2.7.1.23		29831	protein-coding gene	gene with protein product		611616				11594753	Standard	NM_023018		Approved	FLJ13052	uc001aie.3	O95544	OTTHUMG00000000942	ENST00000341426.5:c.393+25CCT>-	1.37:g.1688592_1688594delAGG			A6NNN3|A8K296|B7Z434|F5GXR5|Q5QPS4|Q9H2P2|Q9H931	In_Frame_Del	DEL	pfam_PolyP/ATP_NADK_prd,superfamily_ATP-NAD_kinase_PpnK-typ	p.AW244in_frame_delG	ENST00000341426.5	37	c.733_731	CCDS30565.1	1																																																																																			NADK	-	NULL	ENSG00000008130		0.626	NADK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	NADK	HGNC	protein_coding	OTTHUMT00000002769.1		0.00	35	0	AGG	NM_023018		1688594	-1			no_errors	ENST00000344463	ensembl	human	known	74_37	in_frame_del	12.73	48	7	DEL	0.001:0.002:0.002	0
NBEA	26960	genome.wustl.edu	37	13	35615243	35615243	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr13:35615243A>C	ENST00000400445.3	+	2	1002	c.468A>C	c.(466-468)gaA>gaC	p.E156D	NBEA_ENST00000310336.4_Missense_Mutation_p.E156D|NBEA_ENST00000540320.1_Missense_Mutation_p.E156D|NBEA_ENST00000379939.2_Missense_Mutation_p.E156D	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	156					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CTAGCACAGAAGTTGGGCTAA	0.383																																																	0													75.0	70.0	71.0					13																	35615243		1893	4133	6026	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.468A>C	13.37:g.35615243A>C	ENSP00000383295:p.Glu156Asp		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.E156D	ENST00000400445.3	37	c.468	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	A	19.03	3.748342	0.69533	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.51817	0.69;0.69;0.69;0.69	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.60222	0.2252	L	0.42245	1.32	0.80722	D	1	D	0.63880	0.993	D	0.70016	0.967	T	0.58109	-0.7694	10	0.37606	T	0.19	.	15.5012	0.75700	1.0:0.0:0.0:0.0	.	156	Q5T321	.	D	156	ENSP00000440951:E156D;ENSP00000383295:E156D;ENSP00000369271:E156D;ENSP00000308534:E156D	ENSP00000308534:E156D	E	+	3	2	NBEA	34513243	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.760000	0.55235	2.058000	0.61347	0.477000	0.44152	GAA	NBEA	-	NULL	ENSG00000172915		0.383	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	66	0	A	NM_015678		35615243	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	31.82	45	21	SNP	1.000	C
NCAM1	4684	genome.wustl.edu	37	11	113144211	113144211	+	Intron	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:113144211G>A	ENST00000397957.4	+	19	2667				NCAM1-AS1_ENST00000526229.1_RNA|NCAM1-AS1_ENST00000533638.1_RNA|NCAM1_ENST00000316851.7_Intron			P13591	NCAM1_HUMAN	neural cell adhesion molecule 1						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		GCCCGGAGCCGCGAAGAGCCC	0.677																																																	0																																										SO:0001627	intron_variant	0				CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000397957.4:c.2667+1613G>A	11.37:g.113144211G>A			A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	RNA	SNP	-	NULL	ENST00000397957.4	37	NULL		11																																																																																			NCAM1	-	-	ENSG00000149294		0.677	NCAM1-001	KNOWN	basic	processed_transcript	NCAM1	HGNC	protein_coding	OTTHUMT00000393677.2	-	0.00	42	0	G	NM_000615		113144211	+1	tier1	-	no_errors	ENST00000528158	ensembl	human	putative	74_37	rna	54.55	10	12	SNP	0.009	A
NCAPD3	23310	genome.wustl.edu	37	11	134048529	134048529	+	Splice_Site	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:134048529C>A	ENST00000534548.2	-	22	2846	c.2782G>T	c.(2782-2784)Ggt>Tgt	p.G928C	RP11-700F16.3_ENST00000531710.1_RNA	NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	928					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TTTTTCTTACCTAAGGTAATG	0.542																																																	0													94.0	97.0	96.0					11																	134048529		2201	4297	6498	SO:0001630	splice_region_variant	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2782+1G>T	11.37:g.134048529C>A			A6NFS2|Q4KMQ9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pirsf_NCAPD3	p.G928C	ENST00000534548.2	37	c.2782	CCDS31723.1	11	.	.	.	.	.	.	.	.	.	.	C	32	5.183638	0.94885	.	.	ENSG00000151503	ENST00000534548	T	0.43688	0.94	6.03	6.03	0.97812	Armadillo-like helical (1);Armadillo-type fold (1);	0.044871	0.85682	D	0.000000	T	0.71392	0.3334	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70543	-0.4843	10	0.41790	T	0.15	-25.7545	20.5568	0.99304	0.0:1.0:0.0:0.0	.	928	P42695	CNDD3_HUMAN	C	928	ENSP00000433681:G928C	ENSP00000434168:G928C	G	-	1	0	NCAPD3	133553739	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.046000	0.76592	2.861000	0.98227	0.655000	0.94253	GGT	NCAPD3	-	superfamily_ARM-type_fold,pirsf_NCAPD3	ENSG00000151503		0.542	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2	-	0.00	38	0	C	NM_015261	Missense_Mutation	134048529	-1	tier1	-	no_errors	ENST00000534548	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	A
NCAPD3	23310	genome.wustl.edu	37	11	134078847	134078848	+	Splice_Site	INS	-	-	A	rs531031092	byFrequency	TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:134078847_134078848insA	ENST00000534548.2	-	7	859		c.e7-2			NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3						mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		TTAAGAGCTCTAAAAAAAAAAG	0.337																																																	0																																										SO:0001630	splice_region_variant	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.795-2->T	11.37:g.134078857_134078857dupA			A6NFS2|Q4KMQ9	Splice_Site	INS	-	e7-2	ENST00000534548.2	37	c.795-3_795-2	CCDS31723.1	11																																																																																			NCAPD3	-	-	ENSG00000151503		0.337	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2		0.00	56	0	-	NM_015261	Intron	134078848	-1	tier1		no_errors	ENST00000534548	ensembl	human	known	74_37	splice_site_ins	9.38	29	3	INS	1.000:0.997	A
NCKAP5	344148	genome.wustl.edu	37	2	133543120	133543120	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:133543120T>G	ENST00000409261.1	-	14	1637	c.1264A>C	c.(1264-1266)Acc>Ccc	p.T422P	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.T422P|NCKAP5_ENST00000405974.3_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	422										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CCCCATTTGGTTATCACTGAT	0.418																																																	0													99.0	92.0	94.0					2																	133543120		1839	4095	5934	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.1264A>C	2.37:g.133543120T>G	ENSP00000387128:p.Thr422Pro		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.T422P	ENST00000409261.1	37	c.1264	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	t	14.87	2.664973	0.47572	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.11930	2.73;2.73	5.23	5.23	0.72850	.	0.495643	0.14552	U	0.312630	T	0.08403	0.0209	N	0.14661	0.345	0.80722	D	1	B	0.25390	0.125	B	0.21917	0.037	T	0.20739	-1.0266	10	0.48119	T	0.1	.	7.2897	0.26360	0.1421:0.0:0.1481:0.7097	.	422	O14513	NCKP5_HUMAN	P	422	ENSP00000387128:T422P;ENSP00000380603:T422P	ENSP00000380603:T422P	T	-	1	0	NCKAP5	133259590	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	2.149000	0.42244	2.191000	0.70037	0.524000	0.50904	ACC	NCKAP5	-	NULL	ENSG00000176771		0.418	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	-	0.00	52	0	T	NM_207481		133543120	-1	tier1	-	no_errors	ENST00000317721	ensembl	human	known	74_37	missense	51.11	22	23	SNP	1.000	G
NDN	4692	genome.wustl.edu	37	15	23931967	23931967	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr15:23931967T>C	ENST00000331837.4	-	1	483	c.398A>G	c.(397-399)aAg>aGg	p.K133R		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	133	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		GCACCACTTCTTGTAGCTGCC	0.577									Prader-Willi syndrome																																								0													77.0	73.0	74.0					15																	23931967		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.398A>G	15.37:g.23931967T>C	ENSP00000332643:p.Lys133Arg		B2R6Z5	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.K133R	ENST00000331837.4	37	c.398	CCDS10014.1	15	.	.	.	.	.	.	.	.	.	.	T	18.45	3.626377	0.66901	.	.	ENSG00000182636	ENST00000331837	T	0.05319	3.46	3.87	3.87	0.44632	.	0.055638	0.64402	D	0.000002	T	0.09069	0.0224	N	0.24115	0.695	0.38477	D	0.947616	P	0.44946	0.846	P	0.54706	0.759	T	0.35301	-0.9794	10	0.35671	T	0.21	.	9.6703	0.40008	0.0:0.0:0.0:1.0	.	133	Q99608	NECD_HUMAN	R	133	ENSP00000332643:K133R	ENSP00000332643:K133R	K	-	2	0	NDN	21483060	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.474000	0.53129	1.717000	0.51406	0.459000	0.35465	AAG	NDN	-	pfam_MAGE,pfscan_MAGE	ENSG00000182636		0.577	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDN	HGNC	protein_coding	OTTHUMT00000251226.2	-	0.00	52	0	T	NM_002487		23931967	-1	tier1	-	no_errors	ENST00000331837	ensembl	human	known	74_37	missense	18.52	22	5	SNP	1.000	C
NF1	4763	genome.wustl.edu	37	17	29528504	29528504	+	Splice_Site	SNP	G	G	T	rs267606603		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:29528504G>T	ENST00000358273.4	+	11	1643		c.e11+1		NF1_ENST00000431387.4_Splice_Site|NF1_ENST00000356175.3_Splice_Site	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1						actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(8)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CATCACCAATGTAAGTCCAAA	0.308			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	16	Whole gene deletion(8)|Unknown(8)	soft_tissue(8)|autonomic_ganglia(3)|central_nervous_system(3)|lung(1)|haematopoietic_and_lymphoid_tissue(1)	GRCh37	CS064442	NF1	S							78.0	86.0	83.0					17																	29528504		2203	4295	6498	SO:0001630	splice_region_variant	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1260+1G>T	17.37:g.29528504G>T			O00662|Q14284|Q14930|Q14931|Q9UMK3	Splice_Site	SNP	-	e11+1	ENST00000358273.4	37	c.1260+1	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404549	0.62288	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6538	0.91441	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF1	26552630	1.000000	0.71417	1.000000	0.80357	0.781000	0.44180	9.096000	0.94182	2.412000	0.81896	0.491000	0.48974	.	NF1	-	-	ENSG00000196712		0.308	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2		0.00	26	0	G	NM_000267	Intron	29528504	+1			no_errors	ENST00000358273	ensembl	human	known	74_37	splice_site	5.26	36	2	SNP	1.000	T
NFAM1	150372	genome.wustl.edu	37	22	42783038	42783038	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr22:42783038T>C	ENST00000329021.5	-	5	747	c.710A>G	c.(709-711)gAg>gGg	p.E237G		NM_145912.5	NP_666017.1	Q8NET5	NFAM1_HUMAN	NFAT activating protein with ITAM motif 1	237	ITAM. {ECO:0000255|PROSITE- ProRule:PRU00379}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cytokine production (GO:0001819)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of B cell differentiation (GO:0045577)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			large_intestine(1)|lung(3)	4						GCTGCCATCCTCATTCTCGAT	0.632																																																	0													114.0	103.0	106.0					22																	42783038		2203	4300	6503	SO:0001583	missense	0			BC038241	CCDS14034.1	22q13.2	2005-02-01			ENSG00000235568	ENSG00000235568			29872	protein-coding gene	gene with protein product		608740				12615919	Standard	NM_145912		Approved	CNAIP	uc003bcn.4	Q8NET5	OTTHUMG00000150923	ENST00000329021.5:c.710A>G	22.37:g.42783038T>C	ENSP00000333680:p.Glu237Gly		B0QYD0|Q20WL2|Q5JZ96|Q8IUY8|Q8TEM8	Missense_Mutation	SNP	pfscan_Phos_immunorcpt_sig_ITAM	p.E237G	ENST00000329021.5	37	c.710	CCDS14034.1	22	.	.	.	.	.	.	.	.	.	.	T	13.46	2.243693	0.39697	.	.	ENSG00000235568	ENST00000329021	T	0.37411	1.2	3.56	3.56	0.40772	.	0.568763	0.14274	U	0.329982	T	0.51261	0.1664	L	0.56769	1.78	0.09310	N	1	D	0.71674	0.998	D	0.67725	0.953	T	0.31447	-0.9943	10	0.87932	D	0	.	8.7943	0.34870	0.0:0.0:0.0:1.0	.	237	Q8NET5	NFAM1_HUMAN	G	237	ENSP00000333680:E237G	ENSP00000333680:E237G	E	-	2	0	NFAM1	41112982	0.003000	0.15002	0.016000	0.15963	0.026000	0.11368	1.032000	0.30178	1.850000	0.53721	0.459000	0.35465	GAG	NFAM1	-	pfscan_Phos_immunorcpt_sig_ITAM	ENSG00000235568		0.632	NFAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFAM1	HGNC	protein_coding	OTTHUMT00000320541.1	-	0.00	62	0	T	NM_145912		42783038	-1	tier1	-	no_errors	ENST00000329021	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.018	C
NFX1	4799	genome.wustl.edu	37	9	33364102	33364102	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:33364102G>A	ENST00000379540.3	+	20	3030	c.2968G>A	c.(2968-2970)Gcc>Acc	p.A990T	NFX1_ENST00000379521.4_Missense_Mutation_p.A990T	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	990					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		GAAAGAAGATGCCAGGTATGT	0.378																																																	0													145.0	128.0	134.0					9																	33364102		2203	4300	6503	SO:0001583	missense	0			U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.2968G>A	9.37:g.33364102G>A	ENSP00000368856:p.Ala990Thr		A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	pfam_Znf_NFX1,pfam_R3H_ss-bd,smart_Znf_RING,smart_Znf_NFX1,smart_R3H_ss-bd,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_R3H_ss-bd	p.A990T	ENST00000379540.3	37	c.2968	CCDS6538.1	9	.	.	.	.	.	.	.	.	.	.	G	33	5.223310	0.95139	.	.	ENSG00000086102	ENST00000379540;ENST00000379521	T;T	0.45276	0.9;1.84	6.08	6.08	0.98989	Single-stranded nucleic acid binding R3H (1);	0.164693	0.53938	D	0.000056	T	0.70631	0.3246	M	0.89095	3.005	0.80722	D	1	D;D	0.76494	0.992;0.999	P;D	0.73708	0.818;0.981	T	0.71721	-0.4507	10	0.44086	T	0.13	-0.3376	18.1659	0.89727	0.0:0.0:1.0:0.0	.	990;990	Q12986;Q12986-2	NFX1_HUMAN;.	T	990	ENSP00000368856:A990T;ENSP00000368836:A990T	ENSP00000368836:A990T	A	+	1	0	NFX1	33354102	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.936000	0.87665	2.894000	0.99253	0.591000	0.81541	GCC	NFX1	-	smart_R3H_ss-bd	ENSG00000086102		0.378	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFX1	HGNC	protein_coding	OTTHUMT00000052069.1	-	0.00	47	0	G			33364102	+1	tier1	-	no_errors	ENST00000379540	ensembl	human	known	74_37	missense	33.33	18	9	SNP	1.000	A
NIPBL	25836	genome.wustl.edu	37	5	36984883	36984883	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:36984883G>A	ENST00000282516.8	+	10	2100	c.1601G>A	c.(1600-1602)gGg>gAg	p.G534E	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Missense_Mutation_p.G534E	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	534					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			ACGGGAAATGGGTCAAGGCCA	0.463																																																	0													183.0	191.0	188.0					5																	36984883		2203	4300	6503	SO:0001583	missense	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1601G>A	5.37:g.36984883G>A	ENSP00000282516:p.Gly534Glu		Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G534E	ENST00000282516.8	37	c.1601	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	G	20.5	3.992708	0.74703	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.96265	-3.95;-3.96	5.88	5.88	0.94601	.	0.056306	0.64402	D	0.000001	D	0.96537	0.8870	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.94314	0.7548	10	0.16420	T	0.52	.	20.2422	0.98381	0.0:0.0:1.0:0.0	.	534;534	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	E	534	ENSP00000282516:G534E;ENSP00000406266:G534E	ENSP00000282516:G534E	G	+	2	0	NIPBL	37020640	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.928000	0.92853	2.788000	0.95919	0.650000	0.86243	GGG	NIPBL	-	NULL	ENSG00000164190		0.463	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	-	0.00	85	0	G	NM_015384		36984883	+1	tier1	-	no_errors	ENST00000282516	ensembl	human	known	74_37	missense	21.21	52	14	SNP	1.000	A
NLRP1	22861	genome.wustl.edu	37	17	5456834	5456834	+	Silent	SNP	G	G	A	rs200218955		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:5456834G>A	ENST00000572272.1	-	5	2399	c.2400C>T	c.(2398-2400)ctC>ctT	p.L800L	NLRP1_ENST00000577119.1_Silent_p.L800L|NLRP1_ENST00000345221.3_Silent_p.L800L|NLRP1_ENST00000262467.5_Silent_p.L800L|NLRP1_ENST00000269280.4_Silent_p.L800L|NLRP1_ENST00000354411.3_Silent_p.L800L|NLRP1_ENST00000571307.1_5'UTR			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	800					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				GGACGGAGAAGAGAATCTGCC	0.537																																																	0													85.0	77.0	80.0					17																	5456834		2203	4300	6503	SO:0001819	synonymous_variant	0			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.2400C>T	17.37:g.5456834G>A			E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Silent	SNP	pfam_CARD,pfam_DAPIN,pfam_Leu-rich_rpt,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD,pfscan_DAPIN,prints_Disease_R	p.L800	ENST00000572272.1	37	c.2400	CCDS42246.1	17																																																																																			NLRP1	-	NULL	ENSG00000091592		0.537	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439517.1	-	0.00	56	0	G	NM_033004		5456834	-1	tier1	-	no_errors	ENST00000572272	ensembl	human	known	74_37	silent	30.65	43	19	SNP	0.909	A
NME8	51314	genome.wustl.edu	37	7	37927917	37927917	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:37927917A>C	ENST00000199447.4	+	15	1658	c.1286A>C	c.(1285-1287)aAc>aCc	p.N429T	EPDR1_ENST00000476620.1_Intron|NME8_ENST00000440017.1_Missense_Mutation_p.N429T	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	429	NDK 2.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										TTGCCGGTCAACCAGTTGTAT	0.373																																																	0													99.0	96.0	97.0					7																	37927917		2203	4300	6503	SO:0001583	missense	0			AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.1286A>C	7.37:g.37927917A>C	ENSP00000199447:p.Asn429Thr		Q9NZH1	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,pfam_Thioredoxin_domain,superfamily_Nucleoside_diP_kinase,superfamily_Thioredoxin-like_fold,smart_Nucleoside_diP_kinase	p.N429T	ENST00000199447.4	37	c.1286	CCDS5452.1	7	.	.	.	.	.	.	.	.	.	.	A	12.15	1.852606	0.32699	.	.	ENSG00000086288	ENST00000199447;ENST00000440017	T;T	0.71461	-0.57;-0.57	4.42	0.795	0.18643	.	0.352023	0.24280	N	0.039909	D	0.86322	0.5905	H	0.96111	3.77	0.33671	D	0.61095	D	0.89917	1.0	D	0.97110	1.0	D	0.87270	0.2285	10	0.87932	D	0	-20.691	8.2077	0.31465	0.7496:0.0:0.2504:0.0	.	429	Q8N427	TXND3_HUMAN	T	429	ENSP00000199447:N429T;ENSP00000397063:N429T	ENSP00000199447:N429T	N	+	2	0	TXNDC3	37894442	1.000000	0.71417	0.988000	0.46212	0.062000	0.15995	3.293000	0.51779	0.137000	0.18759	-0.371000	0.07208	AAC	NME8	-	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase	ENSG00000086288		0.373	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME8	HGNC	protein_coding	OTTHUMT00000219946.1	-	0.00	44	0	A	NM_016616		37927917	+1	tier1	-	no_errors	ENST00000199447	ensembl	human	known	74_37	missense	52.94	16	18	SNP	1.000	C
NOVA1	4857	genome.wustl.edu	37	14	27064693	27064693	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr14:27064693C>A	ENST00000344429.5	-	2	206	c.203G>T	c.(202-204)gGa>gTa	p.G68V	NOVA1_ENST00000551754.1_5'Flank|NOVA1-AS1_ENST00000547786.1_RNA|NOVA1_ENST00000547619.1_Missense_Mutation_p.G68V|NOVA1_ENST00000267422.7_5'UTR|NOVA1_ENST00000574031.1_Missense_Mutation_p.G68V|NOVA1_ENST00000465357.2_Missense_Mutation_p.G68V|RP11-483C6.1_ENST00000572358.1_RNA|NOVA1_ENST00000539517.2_Missense_Mutation_p.G68V	NM_006491.2	NP_006482.1	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1	68	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				locomotory behavior (GO:0007626)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA metabolic process (GO:0051252)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40				GBM - Glioblastoma multiforme(265;0.0135)		TGTCTGTCCTCCCTTCCCAAT	0.403																																																	0													140.0	131.0	134.0					14																	27064693		2203	4300	6503	SO:0001583	missense	0			U04840	CCDS9635.1, CCDS32060.1, CCDS32061.1	14q12	2006-06-09			ENSG00000139910	ENSG00000139910			7886	protein-coding gene	gene with protein product		602157				8558240	Standard	NM_006489		Approved		uc001wpy.3	P51513	OTTHUMG00000029385	ENST00000344429.5:c.203G>T	14.37:g.27064693C>A	ENSP00000342387:p.Gly68Val		A8K0S4|A8K4Q7|D3DS81|D3DS82|Q6B004	Missense_Mutation	SNP	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	p.G68V	ENST00000344429.5	37	c.203	CCDS9635.1	14	.	.	.	.	.	.	.	.	.	.	C	17.45	3.393920	0.62066	.	.	ENSG00000139910	ENST00000465357;ENST00000539517;ENST00000449198;ENST00000549571;ENST00000344429;ENST00000547619	T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99	5.1	5.1	0.69264	.	0.107102	0.38326	N	0.001738	T	0.75170	0.3813	H	0.94658	3.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.80764	0.994;0.986;0.976	T	0.83190	-0.0084	10	0.87932	D	0	-2.1805	18.8679	0.92300	0.0:1.0:0.0:0.0	.	68;68;68	P51513-2;D3DS81;P51513-4	.;.;.	V	68;68;27;31;68;68	ENSP00000447391:G68V;ENSP00000438875:G68V;ENSP00000408914:G27V;ENSP00000449185:G31V;ENSP00000342387:G68V;ENSP00000448157:G68V	ENSP00000342387:G68V	G	-	2	0	NOVA1	26134533	1.000000	0.71417	1.000000	0.80357	0.741000	0.42261	7.729000	0.84864	2.523000	0.85059	0.561000	0.74099	GGA	NOVA1	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000139910		0.403	NOVA1-001	KNOWN	basic|exp_conf|CCDS	protein_coding	NOVA1	HGNC	protein_coding	OTTHUMT00000276557.1	-	0.00	60	0	C	NM_006491		27064693	-1	tier1	-	no_errors	ENST00000539517	ensembl	human	known	74_37	missense	26.19	31	11	SNP	1.000	A
NOX3	50508	genome.wustl.edu	37	6	155775963	155775963	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:155775963G>T	ENST00000159060.2	-	3	339	c.237C>A	c.(235-237)ttC>ttA	p.F79L		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	79	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)	p.F79L(1)		cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		TTCCTCTTATGAATGAAATAA	0.363																																																	1	Substitution - Missense(1)	prostate(1)											56.0	56.0	56.0					6																	155775963		2203	4299	6502	SO:0001583	missense	0			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.237C>A	6.37:g.155775963G>T	ENSP00000159060:p.Phe79Leu		Q9HBJ9	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.F79L	ENST00000159060.2	37	c.237	CCDS5250.1	6	.	.	.	.	.	.	.	.	.	.	G	10.94	1.493388	0.26774	.	.	ENSG00000074771	ENST00000159060	D	0.95069	-3.6	5.7	1.27	0.21489	Flavoprotein transmembrane component (1);	0.087937	0.49916	N	0.000126	T	0.75781	0.3896	N	0.17248	0.465	0.31189	N	0.701198	B	0.19817	0.039	B	0.26693	0.072	T	0.61912	-0.6965	10	0.20519	T	0.43	-13.2335	5.1634	0.15073	0.4066:0.1546:0.4388:0.0	.	79	Q9HBY0	NOX3_HUMAN	L	79	ENSP00000159060:F79L	ENSP00000159060:F79L	F	-	3	2	NOX3	155817655	0.785000	0.28726	0.967000	0.41034	0.991000	0.79684	1.035000	0.30216	0.320000	0.23234	0.650000	0.86243	TTC	NOX3	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000074771		0.363	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX3	HGNC	protein_coding	OTTHUMT00000042819.1		0.00	31	0	G			155775963	-1			no_errors	ENST00000159060	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.954	T
NPS	594857	genome.wustl.edu	37	10	129350824	129350824	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:129350824A>C	ENST00000398023.1	+	3	211	c.191A>C	c.(190-192)aAg>aCg	p.K64T		NM_001030013.1	NP_001025184.1	P0C0P6	NPS_HUMAN	neuropeptide S	64					neuropeptide signaling pathway (GO:0007218)|positive regulation of action potential (GO:0045760)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|visual learning (GO:0008542)	extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|lung(4)	5						ATTTTGGAGAAGATGTTTGTG	0.418																																																	0													210.0	205.0	207.0					10																	129350824		1843	4098	5941	SO:0001583	missense	0			BC148465	CCDS41577.1	10q26.2	2013-02-26			ENSG00000214285	ENSG00000214285		"""Endogenous ligands"""	33940	protein-coding gene	gene with protein product	"""prepro-neuropeptide S"""	609513				18181564, 15312648	Standard	NM_001030013		Approved		uc001ljx.1	P0C0P6		ENST00000398023.1:c.191A>C	10.37:g.129350824A>C	ENSP00000381105:p.Lys64Thr			Missense_Mutation	SNP	NULL	p.K64T	ENST00000398023.1	37	c.191	CCDS41577.1	10	.	.	.	.	.	.	.	.	.	.	A	10.88	1.476272	0.26511	.	.	ENSG00000214285	ENST00000398023	T	0.51817	0.69	5.73	3.36	0.38483	.	0.246245	0.19779	U	0.106262	T	0.34279	0.0892	.	.	.	0.23232	N	0.99807	B	0.24426	0.103	B	0.26094	0.066	T	0.32929	-0.9888	9	0.66056	D	0.02	-5.0566	4.068	0.09869	0.577:0.241:0.0661:0.1159	.	64	P0C0P6	NPS_HUMAN	T	64	ENSP00000381105:K64T	ENSP00000381105:K64T	K	+	2	0	NPS	129240814	0.985000	0.35326	0.875000	0.34327	0.028000	0.11728	0.804000	0.27098	0.426000	0.26116	-0.334000	0.08254	AAG	NPS	-	NULL	ENSG00000214285		0.418	NPS-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NPS	HGNC	protein_coding		-	0.00	41	0	A	NM_001030013		129350824	+1	tier1	-	no_errors	ENST00000398023	ensembl	human	known	74_37	missense	38.30	29	18	SNP	0.616	C
NR3C1	2908	genome.wustl.edu	37	5	142689724	142689724	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:142689724C>T	ENST00000343796.2	-	4	2399	c.1406G>A	c.(1405-1407)cGa>cAa	p.R469Q	NR3C1_ENST00000394466.2_Missense_Mutation_p.R470Q|NR3C1_ENST00000415690.2_Missense_Mutation_p.R469Q|NR3C1_ENST00000504572.1_Missense_Mutation_p.R470Q|NR3C1_ENST00000424646.2_Missense_Mutation_p.R443Q|NR3C1_ENST00000416954.2_Missense_Mutation_p.R72Q|NR3C1_ENST00000231509.3_Missense_Mutation_p.R470Q|NR3C1_ENST00000503201.1_Missense_Mutation_p.R469Q|NR3C1_ENST00000394464.2_Missense_Mutation_p.R469Q|NR3C1_ENST00000504336.1_5'UTR	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)	469					adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)	p.R470Q(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	GTTTTTTCTTCGAATTTTATC	0.378																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											86.0	84.0	84.0					5																	142689724		2203	4300	6503	SO:0001583	missense	0			X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.1406G>A	5.37:g.142689724C>T	ENSP00000343205:p.Arg469Gln		A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Missense_Mutation	SNP	pfam_Glcrtcd_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Glcrtcd_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.R470Q	ENST00000343796.2	37	c.1409	CCDS4278.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.132066	0.97310	.	.	ENSG00000113580	ENST00000394464;ENST00000343796;ENST00000361001;ENST00000415690;ENST00000424646;ENST00000504572;ENST00000394466;ENST00000231509;ENST00000416954;ENST00000503201	D;D;D;D;D;D;D;D;D	0.97186	-4.28;-4.28;-4.28;-4.28;-4.28;-4.28;-4.28;-4.28;-4.28	6.06	6.06	0.98353	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.059973	0.64402	D	0.000003	D	0.98150	0.9389	L	0.59436	1.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	D	0.98645	1.0677	10	0.87932	D	0	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	469;469;470	E5KQF5;P04150;E5KQF6	.;GCR_HUMAN;.	Q	469;469;469;469;443;470;470;470;72;469	ENSP00000377977:R469Q;ENSP00000343205:R469Q;ENSP00000387672:R469Q;ENSP00000405282:R443Q;ENSP00000422518:R470Q;ENSP00000377979:R470Q;ENSP00000231509:R470Q;ENSP00000404218:R72Q;ENSP00000427672:R469Q	ENSP00000231509:R470Q	R	-	2	0	NR3C1	142669917	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.794000	0.85869	2.882000	0.98803	0.655000	0.94253	CGA	NR3C1	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	ENSG00000113580		0.378	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	NR3C1	HGNC	protein_coding	OTTHUMT00000370829.1	-	0.00	59	0	C			142689724	-1	tier1	-	no_errors	ENST00000231509	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	T
NRG1	3084	genome.wustl.edu	37	8	32463100	32463100	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr8:32463100A>C	ENST00000405005.3	+	3	299	c.299A>C	c.(298-300)aAc>aCc	p.N100T	NRG1_ENST00000287842.3_Missense_Mutation_p.N100T|NRG1_ENST00000523079.1_Missense_Mutation_p.N100T|NRG1_ENST00000520407.1_Missense_Mutation_p.N315T|NRG1_ENST00000356819.4_Missense_Mutation_p.N100T|NRG1_ENST00000338921.4_Missense_Mutation_p.N100T|NRG1_ENST00000341377.5_Missense_Mutation_p.N100T|NRG1_ENST00000287845.5_Missense_Mutation_p.N100T|NRG1_ENST00000519301.1_Missense_Mutation_p.N79T|NRG1_ENST00000521670.1_Missense_Mutation_p.N100T			Q02297	NRG1_HUMAN	neuregulin 1	100	Ig-like C2-type.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CTTCGCATTAACAAAGCATCA	0.378																																																	0													174.0	158.0	164.0					8																	32463100		2203	4300	6503	SO:0001583	missense	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.299A>C	8.37:g.32463100A>C	ENSP00000384620:p.Asn100Thr		A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Ig-like_dom,prints_Neuregulin	p.N100T	ENST00000405005.3	37	c.299	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	A	4.254	0.046072	0.08243	.	.	ENSG00000157168	ENST00000518104;ENST00000519301;ENST00000520407;ENST00000523534;ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000341377;ENST00000287842;ENST00000405005;ENST00000521670	T;T;T;T;T;T;T;T;T;T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21;-0.21	5.8	-4.65	0.03339	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.942027	0.09093	N	0.849541	T	0.47248	0.1435	N	0.16567	0.415	0.09310	N	1	B;B;B;B;B;B;B;B;B;B;B;B	0.23854	0.005;0.001;0.001;0.002;0.003;0.005;0.001;0.01;0.002;0.002;0.011;0.092	B;B;B;B;B;B;B;B;B;B;B;B	0.25884	0.007;0.004;0.008;0.011;0.015;0.011;0.004;0.016;0.006;0.015;0.019;0.064	T	0.34204	-0.9838	10	0.42905	T	0.14	-1.5477	11.4391	0.50086	0.4381:0.0938:0.4681:0.0	.	100;100;100;99;99;100;100;100;100;100;100;315	E9PHH4;F8W9E3;Q7RTW4;B0FYA9;B0FWZ3;B7Z4Z3;Q02297-7;Q02297;Q02297-6;Q02297-3;Q02297-8;Q02297-9	.;.;.;.;.;.;.;NRG1_HUMAN;.;.;.;.	T	79;79;315;168;100;100;100;100;100;100;100;100;100	ENSP00000430053:N79T;ENSP00000429582:N79T;ENSP00000434640:N315T;ENSP00000429067:N168T;ENSP00000430120:N100T;ENSP00000343395:N100T;ENSP00000349275:N100T;ENSP00000287840:N100T;ENSP00000287845:N100T;ENSP00000340497:N100T;ENSP00000287842:N100T;ENSP00000384620:N100T;ENSP00000428828:N100T	ENSP00000287840:N100T	N	+	2	0	NRG1	32582642	0.865000	0.29922	0.036000	0.18154	0.060000	0.15804	0.052000	0.14163	-1.004000	0.03421	-1.162000	0.01777	AAC	NRG1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000157168		0.378	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	-	0.00	51	0	A			32463100	+1	tier1	-	no_errors	ENST00000338921	ensembl	human	known	74_37	missense	54.84	14	17	SNP	0.004	C
NRXN1	9378	genome.wustl.edu	37	2	50779806	50779806	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:50779806T>C	ENST00000406316.2	-	9	3154	c.1678A>G	c.(1678-1680)Act>Gct	p.T560A	NRXN1_ENST00000401669.2_Missense_Mutation_p.T560A|NRXN1_ENST00000402717.3_Missense_Mutation_p.T552A|NRXN1_ENST00000405472.3_Missense_Mutation_p.T552A|NRXN1_ENST00000406859.3_Missense_Mutation_p.T560A|NRXN1_ENST00000404971.1_Missense_Mutation_p.T600A|NRXN1_ENST00000331040.5_5'UTR	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	560	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATTTTTATAGTACCTGACCCC	0.438																																																	0													127.0	120.0	122.0					2																	50779806		1881	4101	5982	SO:0001583	missense	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.1678A>G	2.37:g.50779806T>C	ENSP00000384311:p.Thr560Ala		A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.T552A	ENST00000406316.2	37	c.1654	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	T	14.52	2.559775	0.45590	.	.	ENSG00000179915	ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859	T;T;T;T;T;T	0.77620	-1.11;-1.11;-1.11;-1.11;-1.11;-1.11	5.93	3.52	0.40303	.	0.151795	0.64402	N	0.000017	T	0.65417	0.2689	L	0.35542	1.07	0.33167	D	0.547741	P;B;B	0.41420	0.749;0.195;0.425	B;B;B	0.43445	0.406;0.145;0.42	T	0.65001	-0.6274	10	0.09843	T	0.71	.	7.9113	0.29793	0.123:0.0663:0.0:0.8107	.	600;560;552	Q9ULB1-3;F8WB18;A7E294	.;.;.	A	600;560;552;560;601;552;560	ENSP00000385142:T600A;ENSP00000384311:T560A;ENSP00000434015:T552A;ENSP00000385017:T560A;ENSP00000385434:T552A;ENSP00000385681:T560A	ENSP00000385017:T560A	T	-	1	0	NRXN1	50633310	1.000000	0.71417	0.339000	0.25562	0.946000	0.59487	7.985000	0.88162	0.475000	0.27415	-0.326000	0.08463	ACT	NRXN1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000179915		0.438	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	-	0.00	25	0	T			50779806	-1	tier1	-	no_errors	ENST00000402717	ensembl	human	known	74_37	missense	48.39	16	15	SNP	1.000	C
NSD1	64324	genome.wustl.edu	37	5	176562826	176562826	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:176562826G>T	ENST00000439151.2	+	2	767	c.722G>T	c.(721-723)aGa>aTa	p.R241I	NSD1_ENST00000347982.4_Intron|NSD1_ENST00000511258.1_Intron|NSD1_ENST00000354179.4_Intron|NSD1_ENST00000361032.4_Missense_Mutation_p.R241I	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	241					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)	p.R241I(2)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AATAAGCAAAGAAATGAAGTG	0.438			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																														Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	2	Substitution - Missense(2)	large_intestine(2)											84.0	82.0	82.0					5																	176562826		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.722G>T	5.37:g.176562826G>T	ENSP00000395929:p.Arg241Ile		Q96PD8|Q96RN7	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.R241I	ENST00000439151.2	37	c.722	CCDS4412.1	5	.	.	.	.	.	.	.	.	.	.	G	16.67	3.187807	0.57909	.	.	ENSG00000165671	ENST00000439151;ENST00000361032	D;D	0.94687	-3.25;-3.49	4.74	4.74	0.60224	.	0.000000	0.48767	D	0.000171	D	0.94098	0.8108	N	0.19112	0.55	0.80722	D	1	D;D;D	0.69078	0.997;0.995;0.997	D;D;D	0.80764	0.994;0.986;0.991	D	0.94581	0.7779	10	0.72032	D	0.01	.	13.1063	0.59249	0.0:0.0:1.0:0.0	.	241;241;241	Q96L73-3;Q96L73;Q6PJ64	.;NSD1_HUMAN;.	I	241	ENSP00000395929:R241I;ENSP00000354310:R241I	ENSP00000354310:R241I	R	+	2	0	NSD1	176495432	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.069000	0.50026	2.459000	0.83118	0.655000	0.94253	AGA	NSD1	-	NULL	ENSG00000165671		0.438	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2		0.00	37	0	G	NM_172349		176562826	+1			no_errors	ENST00000439151	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
NTM	50863	genome.wustl.edu	37	11	132205624	132205624	+	3'UTR	DEL	T	T	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:132205624delT	ENST00000374786.1	+	0	2098				NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374791.3_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						ACCGTTAAACTTTTTTTTTTT	0.294																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*584T>-	11.37:g.132205624delT			A0MTT2|Q6UXJ3|Q86VJ9	RNA	DEL	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			NTM	-	-	ENSG00000182667		0.294	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	HGNC	protein_coding	OTTHUMT00000141937.1		0.00	12	0	T	NM_016522		132205624	+1	tier1		no_errors	ENST00000474900	ensembl	human	known	74_37	rna	14.29	18	3	DEL	0.000	-
OLFM4	10562	genome.wustl.edu	37	13	53624487	53624487	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr13:53624487C>A	ENST00000219022.2	+	5	1192	c.1114C>A	c.(1114-1116)Cgc>Agc	p.R372S		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	372	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		CTATAATAACCGCTTTTCATA	0.423																																																	0													220.0	217.0	218.0					13																	53624487		2203	4300	6503	SO:0001583	missense	0			AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.1114C>A	13.37:g.53624487C>A	ENSP00000219022:p.Arg372Ser		O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like	p.R372S	ENST00000219022.2	37	c.1114	CCDS9440.1	13	.	.	.	.	.	.	.	.	.	.	C	19.52	3.843890	0.71488	.	.	ENSG00000102837	ENST00000219022	D	0.88818	-2.43	5.92	5.92	0.95590	Olfactomedin-like (3);	0.199304	0.53938	D	0.000049	D	0.94847	0.8335	M	0.80982	2.52	0.45205	D	0.998212	D	0.69078	0.997	D	0.72338	0.977	D	0.94030	0.7300	10	0.51188	T	0.08	.	20.3172	0.98658	0.0:1.0:0.0:0.0	.	372	Q6UX06	OLFM4_HUMAN	S	372	ENSP00000219022:R372S	ENSP00000219022:R372S	R	+	1	0	OLFM4	52522488	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	2.762000	0.47597	2.801000	0.96364	0.650000	0.86243	CGC	OLFM4	-	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like	ENSG00000102837		0.423	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM4	HGNC	protein_coding	OTTHUMT00000045112.2	-	0.00	64	0	C	NM_006418		53624487	+1	tier1	-	no_errors	ENST00000219022	ensembl	human	known	74_37	missense	29.27	29	12	SNP	1.000	A
OR10R2	343406	genome.wustl.edu	37	1	158450322	158450322	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:158450322A>G	ENST00000368152.1	+	1	655	c.655A>G	c.(655-657)Ata>Gta	p.I219V	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	219						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					CGAATTTGTGATATTCATTTG	0.408																																																	0													156.0	145.0	148.0					1																	158450322		2203	4300	6503	SO:0001583	missense	0			AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.655A>G	1.37:g.158450322A>G	ENSP00000357134:p.Ile219Val		Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I219V	ENST00000368152.1	37	c.655	CCDS30898.1	1	.	.	.	.	.	.	.	.	.	.	a	4.964	0.179030	0.09443	.	.	ENSG00000198965	ENST00000368152	T	0.00054	8.8	4.48	0.723	0.18231	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00039	0.0001	N	0.13235	0.315	0.09310	N	1	B	0.20052	0.041	B	0.24269	0.052	T	0.22871	-1.0204	9	0.08381	T	0.77	.	4.7208	0.12917	0.5869:0.1553:0.2579:0.0	.	219	Q8NGX6	O10R2_HUMAN	V	219	ENSP00000357134:I219V	ENSP00000357134:I219V	I	+	1	0	OR10R2	156716946	0.000000	0.05858	0.054000	0.19295	0.903000	0.53119	0.181000	0.16880	-0.053000	0.13289	0.533000	0.62120	ATA	OR10R2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000198965		0.408	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10R2	HGNC	protein_coding	OTTHUMT00000051847.2	-	0.00	66	0	A	NM_001004472		158450322	+1	tier1	-	no_errors	ENST00000368152	ensembl	human	known	74_37	missense	16.67	70	14	SNP	0.169	G
OR13C3	138803	genome.wustl.edu	37	9	107298746	107298746	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:107298746A>G	ENST00000374781.2	-	1	391	c.349T>C	c.(349-351)Tca>Cca	p.S117P		NM_001001961.1	NP_001001961.1	Q8NGS6	O13C3_HUMAN	olfactory receptor, family 13, subfamily C, member 3	117						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(7)|lung(7)|pancreas(1)|prostate(1)|skin(1)	19						CTTTTCTTTGAGATTAAGCTC	0.433																																					GBM(86;1248 1274 14222 15028 46219)												0													168.0	145.0	153.0					9																	107298746		2203	4300	6503	SO:0001583	missense	0				CCDS35089.1	9q31.1	2013-09-24			ENSG00000204246	ENSG00000204246		"""GPCR / Class A : Olfactory receptors"""	14704	protein-coding gene	gene with protein product							Standard	NM_001001961		Approved		uc004bcb.1	Q8NGS6	OTTHUMG00000020406	ENST00000374781.2:c.349T>C	9.37:g.107298746A>G	ENSP00000363913:p.Ser117Pro		Q5VVG1|Q6IF52	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S117P	ENST00000374781.2	37	c.349	CCDS35089.1	9	.	.	.	.	.	.	.	.	.	.	A	13.34	2.207923	0.39003	.	.	ENSG00000204246	ENST00000374781	T	0.01347	4.99	4.81	4.81	0.61882	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39083	N	0.001463	T	0.05456	0.0144	M	0.84683	2.71	0.09310	N	1	D	0.60160	0.987	P	0.52710	0.707	T	0.15723	-1.0427	10	0.72032	D	0.01	.	8.8416	0.35146	0.8104:0.1896:0.0:0.0	.	117	Q8NGS6	O13C3_HUMAN	P	117	ENSP00000363913:S117P	ENSP00000363913:S117P	S	-	1	0	OR13C3	106338567	0.000000	0.05858	0.994000	0.49952	0.456000	0.32438	0.087000	0.14958	2.148000	0.66965	0.533000	0.62120	TCA	OR13C3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000204246		0.433	OR13C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C3	HGNC	protein_coding	OTTHUMT00000053477.2	-	0.00	70	0	A			107298746	-1	tier1	-	no_errors	ENST00000374781	ensembl	human	known	74_37	missense	41.38	34	24	SNP	0.224	G
OR13D1	286365	genome.wustl.edu	37	9	107456708	107456708	+	Silent	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:107456708C>T	ENST00000318763.5	+	1	49	c.6C>T	c.(4-6)taC>taT	p.Y2Y		NM_001004484.1	NP_001004484.1	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D, member 1	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(4)|lung(10)|ovary(1)|prostate(2)|skin(2)	19						TGTAGATGTACAGATTTACAG	0.328																																																	0													47.0	44.0	45.0					9																	107456708		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS35094.1	9q31.1	2013-09-24			ENSG00000179055	ENSG00000179055		"""GPCR / Class A : Olfactory receptors"""	14695	protein-coding gene	gene with protein product							Standard	NM_001004484		Approved		uc011lvs.2	Q8NGV5	OTTHUMG00000020412	ENST00000318763.5:c.6C>T	9.37:g.107456708C>T			B9EIS1|Q6IFL1	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y2	ENST00000318763.5	37	c.6	CCDS35094.1	9																																																																																			OR13D1	-	NULL	ENSG00000179055		0.328	OR13D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13D1	HGNC	protein_coding	OTTHUMT00000053483.1		0.00	60	0	C			107456708	+1			no_errors	ENST00000318763	ensembl	human	known	74_37	silent	7.69	36	3	SNP	0.000	T
OR1C1	26188	genome.wustl.edu	37	1	247921558	247921558	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:247921558A>C	ENST00000408896.2	-	1	424	c.151T>G	c.(151-153)Ttt>Gtt	p.F51V		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	51					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			TGAGAGTCAAAGCCAATCGTC	0.483																																																	0													84.0	82.0	82.0					1																	247921558		2123	4250	6373	SO:0001583	missense	0			X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.151T>G	1.37:g.247921558A>C	ENSP00000386138:p.Phe51Val		B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F51V	ENST00000408896.2	37	c.151	CCDS41481.1	1	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.608504	0.00842	.	.	ENSG00000221888	ENST00000408896	T	0.02863	4.13	2.83	0.25	0.15535	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01092	0.0036	N	0.01417	-0.88	0.09310	N	1	B	0.16603	0.018	B	0.15870	0.014	T	0.47195	-0.9136	9	0.37606	T	0.19	.	3.9583	0.09399	0.6551:0.2146:0.1303:0.0	.	51	Q15619	OR1C1_HUMAN	V	51	ENSP00000386138:F51V	ENSP00000386138:F51V	F	-	1	0	OR1C1	245988181	0.000000	0.05858	0.001000	0.08648	0.022000	0.10575	-4.172000	0.00280	-0.073000	0.12842	0.477000	0.44152	TTT	OR1C1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000221888		0.483	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1C1	HGNC	protein_coding	OTTHUMT00000096855.1	-	0.00	31	0	A			247921558	-1	tier1	-	no_errors	ENST00000408896	ensembl	human	known	74_37	missense	71.43	10	25	SNP	0.000	C
OR2A1	346528	genome.wustl.edu	37	7	144015564	144015564	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:144015564T>G	ENST00000408951.1	+	1	347	c.347T>G	c.(346-348)cTg>cGg	p.L116R	OR2A1-AS1_ENST00000476560.1_RNA|OR2A1-AS1_ENST00000478925.1_RNA|OR2A1-AS1_ENST00000489488.1_RNA|OR2A1-AS1_ENST00000488041.1_RNA|OR2A1-AS1_ENST00000478806.1_RNA|OR2A1-AS1_ENST00000461843.1_RNA|OR2A1-AS1_ENST00000463561.1_RNA|OR2A1-AS1_ENST00000493539.1_RNA|OR2A1-AS1_ENST00000467944.1_RNA|OR2A1-AS1_ENST00000486094.1_RNA|OR2A1-AS1_ENST00000487102.1_RNA|OR2A1-AS1_ENST00000496968.1_RNA|OR2A1-AS1_ENST00000475089.1_RNA	NM_001005287.1	NP_001005287.1	Q8NGT9	OR2A1_HUMAN	olfactory receptor, family 2, subfamily A, member 1	116						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|lung(3)|skin(2)	6	Melanoma(164;0.14)					CTGCTGGTGCTGATGTCCTAC	0.557																																																	0													69.0	78.0	75.0					7																	144015564		2195	4294	6489	SO:0001583	missense	0				CCDS43673.1	7q35	2013-09-20			ENSG00000221970	ENSG00000221970		"""GPCR / Class A : Olfactory receptors"""	8229	protein-coding gene	gene with protein product							Standard	NM_001005287		Approved		uc011kub.2	Q8NGT9	OTTHUMG00000158005	ENST00000408951.1:c.347T>G	7.37:g.144015564T>G	ENSP00000386175:p.Leu116Arg		Q6IF44|Q96R46	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L116R	ENST00000408951.1	37	c.347	CCDS43673.1	7	.	.	.	.	.	.	.	.	.	.	t	5.992	0.366967	0.11352	.	.	ENSG00000221970	ENST00000408951	T	0.03330	3.97	2.96	1.71	0.24356	.	.	.	.	.	T	0.06142	0.0159	L	0.60455	1.87	0.22142	N	0.99933	.	.	.	.	.	.	T	0.35748	-0.9776	7	0.87932	D	0	.	2.3405	0.04259	0.2448:0.1402:0.0:0.6151	.	.	.	.	R	116	ENSP00000386175:L116R	ENSP00000386175:L116R	L	+	2	0	OR2A1	143646497	0.000000	0.05858	0.932000	0.37286	0.028000	0.11728	0.302000	0.19192	0.299000	0.22661	0.402000	0.26972	CTG	OR2A1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000221970		0.557	OR2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A1	HGNC	protein_coding	OTTHUMT00000349985.1	-	0.00	81	0	T			144015564	+1	tier1	-	no_errors	ENST00000408951	ensembl	human	known	74_37	missense	33.93	37	19	SNP	0.803	G
OR52K2	119774	genome.wustl.edu	37	11	4471059	4471059	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:4471059C>A	ENST00000325719.4	+	1	535	c.490C>A	c.(490-492)Ctg>Atg	p.L164M		NM_001005172.2	NP_001005172.2	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K, member 2	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|skin(6)	25		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACTCCCCTTCCTGCTGAGATG	0.577																																																	0													153.0	129.0	137.0					11																	4471059		2201	4298	6499	SO:0001583	missense	0			AB065791	CCDS31351.1	11p15.4	2012-08-09			ENSG00000181963	ENSG00000181963		"""GPCR / Class A : Olfactory receptors"""	15223	protein-coding gene	gene with protein product							Standard	NM_001005172		Approved		uc001lyz.2	Q8NGK3	OTTHUMG00000165703	ENST00000325719.4:c.490C>A	11.37:g.4471059C>A	ENSP00000318956:p.Leu164Met		A8MUY8|B2RP35|Q6IFK4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L164M	ENST00000325719.4	37	c.490	CCDS31351.1	11	.	.	.	.	.	.	.	.	.	.	C	7.212	0.595586	0.13875	.	.	ENSG00000181963	ENST00000325719	T	0.00145	8.67	4.0	2.11	0.27256	GPCR, rhodopsin-like superfamily (1);	0.219727	0.22588	N	0.058124	T	0.00300	0.0009	L	0.49455	1.56	0.09310	N	0.999993	D	0.89917	1.0	D	0.91635	0.999	T	0.51140	-0.8743	10	0.51188	T	0.08	.	8.3255	0.32153	0.0:0.8014:0.0:0.1986	.	164	Q8NGK3	O52K2_HUMAN	M	164	ENSP00000318956:L164M	ENSP00000318956:L164M	L	+	1	2	OR52K2	4427635	0.000000	0.05858	0.996000	0.52242	0.237000	0.25408	-0.199000	0.09491	0.352000	0.24053	-0.350000	0.07774	CTG	OR52K2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181963		0.577	OR52K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K2	HGNC	protein_coding	OTTHUMT00000385844.1	-	0.00	86	0	C	NM_001005172		4471059	+1	tier1	-	no_errors	ENST00000325719	ensembl	human	known	74_37	missense	25.97	57	20	SNP	0.412	A
OR52A5	390054	genome.wustl.edu	37	11	5153418	5153418	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:5153418A>T	ENST00000307388.1	-	1	454	c.455T>A	c.(454-456)cTc>cAc	p.L152H		NM_001005160.2	NP_001005160.1	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A, member 5	152					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(18)|skin(3)	35		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		GGCAGCCCTGAGTGTCACCCC	0.473																																																	0													80.0	76.0	77.0					11																	5153418		2201	4298	6499	SO:0001583	missense	0			BK004433	CCDS31373.1	11p15.4	2012-08-09			ENSG00000171944	ENSG00000171944		"""GPCR / Class A : Olfactory receptors"""	19580	protein-coding gene	gene with protein product							Standard	NM_001005160		Approved		uc010qyx.2	Q9H2C5	OTTHUMG00000066616	ENST00000307388.1:c.455T>A	11.37:g.5153418A>T	ENSP00000303469:p.Leu152His			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L152H	ENST00000307388.1	37	c.455	CCDS31373.1	11	.	.	.	.	.	.	.	.	.	.	A	11.53	1.665553	0.29604	.	.	ENSG00000171944	ENST00000307388	T	0.45276	0.9	5.22	5.22	0.72569	GPCR, rhodopsin-like superfamily (1);	0.180534	0.25151	N	0.032757	T	0.68072	0.2961	M	0.87097	2.86	0.09310	N	1	D	0.71674	0.998	D	0.73708	0.981	T	0.64984	-0.6278	10	0.72032	D	0.01	.	14.0725	0.64868	1.0:0.0:0.0:0.0	.	152	Q9H2C5	O52A5_HUMAN	H	152	ENSP00000303469:L152H	ENSP00000303469:L152H	L	-	2	0	OR52A5	5109994	0.007000	0.16637	0.906000	0.35671	0.028000	0.11728	1.904000	0.39868	2.186000	0.69663	0.533000	0.62120	CTC	OR52A5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000171944		0.473	OR52A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52A5	HGNC	protein_coding	OTTHUMT00000142823.1	-	0.00	58	0	A	NM_001005160		5153418	-1	tier1	-	no_errors	ENST00000307388	ensembl	human	known	74_37	missense	48.15	28	26	SNP	0.008	T
OR5K3	403277	genome.wustl.edu	37	3	98109656	98109656	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:98109656T>G	ENST00000383695.1	+	1	147	c.147T>G	c.(145-147)atT>atG	p.I49M	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005516.1	NP_001005516.1	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K, member 3	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|prostate(1)|skin(1)|urinary_tract(1)	27						TGGCATTGATTTATATAGAGC	0.408																																																	0													277.0	260.0	266.0					3																	98109656		2203	4300	6503	SO:0001583	missense	0				CCDS33803.1	3q11.2	2013-09-23			ENSG00000206536	ENSG00000206536		"""GPCR / Class A : Olfactory receptors"""	31290	protein-coding gene	gene with protein product							Standard	NM_001005516		Approved		uc011bgw.2	A6NET4	OTTHUMG00000160077	ENST00000383695.1:c.147T>G	3.37:g.98109656T>G	ENSP00000373194:p.Ile49Met			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I49M	ENST00000383695.1	37	c.147	CCDS33803.1	3	.	.	.	.	.	.	.	.	.	.	T	9.986	1.229539	0.22542	.	.	ENSG00000206536	ENST00000383695	T	0.08458	3.09	5.35	-6.78	0.01721	GPCR, rhodopsin-like superfamily (1);	0.000000	0.41500	D	0.000868	T	0.30792	0.0776	H	0.97783	4.075	0.09310	N	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.05954	-1.0854	10	0.87932	D	0	-45.7675	4.2972	0.10908	0.3655:0.3096:0.0:0.3249	.	49	A6NET4	OR5K3_HUMAN	M	49	ENSP00000373194:I49M	ENSP00000373194:I49M	I	+	3	3	OR5K3	99592346	0.000000	0.05858	0.001000	0.08648	0.021000	0.10359	-2.637000	0.00866	-1.435000	0.01972	0.491000	0.48974	ATT	OR5K3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000206536		0.408	OR5K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K3	HGNC	protein_coding	OTTHUMT00000359110.1	-	0.00	117	0	T			98109656	+1	tier1	-	no_errors	ENST00000383695	ensembl	human	known	74_37	missense	58.33	25	35	SNP	0.000	G
OR5P3	120066	genome.wustl.edu	37	11	7847434	7847434	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:7847434A>C	ENST00000328375.1	-	1	85	c.86T>G	c.(85-87)cTt>cGt	p.L29R	RP11-35J10.5_ENST00000527565.1_lincRNA	NM_153445.1	NP_703146.1	Q8WZ94	OR5P3_HUMAN	olfactory receptor, family 5, subfamily P, member 3	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)	15				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TAGAAACACAAGAAATAAAAT	0.363																																																	0													55.0	60.0	58.0					11																	7847434		2185	4296	6481	SO:0001583	missense	0			AF158377	CCDS7783.1	11p15.4	2012-08-09			ENSG00000182334	ENSG00000182334		"""GPCR / Class A : Olfactory receptors"""	14784	protein-coding gene	gene with protein product							Standard	NM_153445		Approved	JCG1	uc010rbg.2	Q8WZ94	OTTHUMG00000165669	ENST00000328375.1:c.86T>G	11.37:g.7847434A>C	ENSP00000332068:p.Leu29Arg		Q6IFE1|Q8NGM2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L29R	ENST00000328375.1	37	c.86	CCDS7783.1	11	.	.	.	.	.	.	.	.	.	.	A	11.95	1.792530	0.31685	.	.	ENSG00000182334	ENST00000328375	T	0.00457	7.29	5.18	1.45	0.22620	.	0.768697	0.10546	U	0.662001	T	0.00580	0.0019	M	0.77103	2.36	0.09310	N	1	P	0.40376	0.715	B	0.40864	0.342	T	0.43556	-0.9384	10	0.72032	D	0.01	-7.2782	5.4987	0.16817	0.6947:0.1468:0.1585:0.0	.	29	Q8WZ94	OR5P3_HUMAN	R	29	ENSP00000332068:L29R	ENSP00000332068:L29R	L	-	2	0	OR5P3	7804010	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.918000	0.28678	0.083000	0.17047	-0.331000	0.08364	CTT	OR5P3	-	prints_GPCR_Rhodpsn	ENSG00000182334		0.363	OR5P3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5P3	HGNC	protein_coding	OTTHUMT00000385697.1	-	0.00	26	0	A	NM_153445		7847434	-1	tier1	-	no_errors	ENST00000328375	ensembl	human	known	74_37	missense	47.06	9	8	SNP	0.000	C
OR5T1	390155	genome.wustl.edu	37	11	56043855	56043855	+	Silent	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:56043855A>G	ENST00000313033.2	+	1	827	c.741A>G	c.(739-741)agA>agG	p.R247R		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	247						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					AAGGGAGGAGAAAAGTCTTCT	0.443																																																	0													233.0	206.0	215.0					11																	56043855		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.741A>G	11.37:g.56043855A>G			B2RNM9	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R247	ENST00000313033.2	37	c.741	CCDS31525.1	11																																																																																			OR5T1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181698		0.443	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T1	HGNC	protein_coding	OTTHUMT00000391600.1	-	0.00	77	0	A	NM_001004745		56043855	+1	tier1	-	no_errors	ENST00000313033	ensembl	human	known	74_37	silent	54.65	39	47	SNP	0.001	G
OR5V1	81696	genome.wustl.edu	37	6	29323840	29323840	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:29323840T>G	ENST00000377154.1	-	4	432	c.133A>C	c.(133-135)Att>Ctt	p.I45L	OR5V1_ENST00000543825.1_Missense_Mutation_p.I45L			Q9UGF6	OR5V1_HUMAN	olfactory receptor, family 5, subfamily V, member 1	45			I -> M (in dbSNP:rs9257770). {ECO:0000269|PubMed:14574404}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(3)|large_intestine(3)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GTCAAGATAATTAATATATTT	0.368																																					Ovarian(32;43 883 21137 32120 42650)												0													123.0	127.0	126.0					6																	29323840		2203	4300	6503	SO:0001583	missense	0				CCDS4657.1	6p22.1	2013-09-23				ENSG00000243729		"""GPCR / Class A : Olfactory receptors"""	13972	protein-coding gene	gene with protein product							Standard	NM_030876		Approved	hs6M1-21	uc011dlo.2	Q9UGF6		ENST00000377154.1:c.133A>C	6.37:g.29323840T>G	ENSP00000366359:p.Ile45Leu		A2BDZ0|B0S860|Q5SQI9|Q6NTB5|Q8IVL3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I45L	ENST00000377154.1	37	c.133	CCDS4657.1	6	.	.	.	.	.	.	.	.	.	.	T	9.441	1.088078	0.20390	.	.	ENSG00000243729	ENST00000377154;ENST00000377151;ENST00000543825	T;T	0.00453	7.33;7.33	4.36	1.91	0.25777	GPCR, rhodopsin-like superfamily (1);	0.249539	0.20866	N	0.084252	T	0.00109	0.0003	L	0.56124	1.755	0.09310	N	1	B	0.15141	0.012	B	0.12156	0.007	T	0.38329	-0.9666	10	0.17369	T	0.5	-27.1422	8.6383	0.33962	0.0:0.1634:0.0:0.8366	.	45	Q9UGF6	OR5V1_HUMAN	L	45	ENSP00000366359:I45L;ENSP00000443309:I45L	ENSP00000366356:I45L	I	-	1	0	OR5V1	29431819	0.331000	0.24713	0.006000	0.13384	0.629000	0.37895	1.338000	0.33873	0.299000	0.22661	0.438000	0.28831	ATT	OR5V1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000243729		0.368	OR5V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5V1	HGNC	protein_coding	OTTHUMT00000076398.3	-	0.00	47	0	T			29323840	-1	tier1	-	no_errors	ENST00000377154	ensembl	human	known	74_37	missense	80.77	5	21	SNP	0.132	G
OR6T1	219874	genome.wustl.edu	37	11	123813642	123813642	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:123813642T>A	ENST00000321252.2	-	1	938	c.904A>T	c.(904-906)Aga>Tga	p.R302*		NM_001005187.1	NP_001005187.1	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T, member 1	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		AAGGCTTCTCTCAGTGCTTGC	0.478																																																	0													169.0	159.0	162.0					11																	123813642		2202	4299	6501	SO:0001587	stop_gained	0			AB065759	CCDS31700.1	11q24.1	2012-08-09			ENSG00000181499	ENSG00000181499		"""GPCR / Class A : Olfactory receptors"""	14848	protein-coding gene	gene with protein product							Standard	NM_001005187		Approved		uc010sab.2	Q8NGN1	OTTHUMG00000165962	ENST00000321252.2:c.904A>T	11.37:g.123813642T>A	ENSP00000325203:p.Arg302*		Q6IFE7	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R302*	ENST00000321252.2	37	c.904	CCDS31700.1	11	.	.	.	.	.	.	.	.	.	.	T	11.49	1.654998	0.29425	.	.	ENSG00000181499	ENST00000321252	.	.	.	3.7	1.25	0.21368	.	.	.	.	.	.	.	.	.	.	.	0.30789	N	0.741126	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-17.3092	0.7278	0.00951	0.2004:0.1215:0.2072:0.4709	.	.	.	.	X	302	.	ENSP00000325203:R302X	R	-	1	2	OR6T1	123318852	0.005000	0.15991	0.020000	0.16555	0.212000	0.24457	1.516000	0.35856	1.525000	0.49052	0.460000	0.39030	AGA	OR6T1	-	NULL	ENSG00000181499		0.478	OR6T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6T1	HGNC	protein_coding	OTTHUMT00000387264.1	-	0.00	67	0	T	NM_001005187		123813642	-1	tier1	-	no_errors	ENST00000321252	ensembl	human	known	74_37	nonsense	34.15	27	14	SNP	0.001	A
OR6Y1	391112	genome.wustl.edu	37	1	158517216	158517216	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:158517216A>C	ENST00000302617.3	-	1	679	c.680T>G	c.(679-681)cTt>cGt	p.L227R		NM_001005189.1	NP_001005189.1	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y, member 1	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_hematologic(112;0.0378)					GATGGTGGCAAGGATAGCAGC	0.532																																																	0													117.0	114.0	115.0					1																	158517216		2202	4300	6502	SO:0001583	missense	0			BK004192	CCDS30899.1	1q23.1	2012-08-09			ENSG00000197532	ENSG00000197532		"""GPCR / Class A : Olfactory receptors"""	14823	protein-coding gene	gene with protein product				OR6Y2			Standard	NM_001005189		Approved		uc010pil.2	Q8NGX8	OTTHUMG00000019629	ENST00000302617.3:c.680T>G	1.37:g.158517216A>C	ENSP00000304807:p.Leu227Arg		Q6IFS0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L227R	ENST00000302617.3	37	c.680	CCDS30899.1	1	.	.	.	.	.	.	.	.	.	.	A	13.86	2.364168	0.41902	.	.	ENSG00000197532	ENST00000302617	T	0.00249	8.44	5.34	5.34	0.76211	GPCR, rhodopsin-like superfamily (1);	0.204232	0.24294	N	0.039790	T	0.00356	0.0011	M	0.89414	3.03	0.28967	N	0.889461	D	0.64830	0.994	D	0.67231	0.95	T	0.15065	-1.0450	10	0.87932	D	0	.	13.3154	0.60405	1.0:0.0:0.0:0.0	.	227	Q8NGX8	OR6Y1_HUMAN	R	227	ENSP00000304807:L227R	ENSP00000304807:L227R	L	-	2	0	OR6Y1	156783840	0.198000	0.23374	0.781000	0.31783	0.157000	0.22087	4.404000	0.59735	2.230000	0.72887	0.533000	0.62120	CTT	OR6Y1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000197532		0.532	OR6Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6Y1	HGNC	protein_coding	OTTHUMT00000051844.1	-	0.00	54	0	A	NM_001005189		158517216	-1	tier1	-	no_errors	ENST00000302617	ensembl	human	known	74_37	missense	16.33	41	8	SNP	0.669	C
OR8D2	283160	genome.wustl.edu	37	11	124189725	124189725	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:124189725A>T	ENST00000357438.2	-	1	459	c.369T>A	c.(367-369)taT>taA	p.Y123*		NM_001002918.1	NP_001002918.1	Q9GZM6	OR8D2_HUMAN	olfactory receptor, family 8, subfamily D, member 2	123						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0525)		AGATAGCAACATAACGGTCAT	0.418																																																	0													94.0	89.0	91.0					11																	124189725		2201	4299	6500	SO:0001587	stop_gained	0			AF162668	CCDS31707.1	11q24.1	2012-08-09			ENSG00000197263	ENSG00000197263		"""GPCR / Class A : Olfactory receptors"""	8482	protein-coding gene	gene with protein product							Standard	NM_001002918		Approved		uc010sah.2	Q9GZM6	OTTHUMG00000165978	ENST00000357438.2:c.369T>A	11.37:g.124189725A>T	ENSP00000350022:p.Tyr123*		B9EH49|Q6IFR0	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Y123*	ENST00000357438.2	37	c.369	CCDS31707.1	11	.	.	.	.	.	.	.	.	.	.	a	12.12	1.842337	0.32513	.	.	ENSG00000197263	ENST00000357438	.	.	.	3.59	-1.4	0.08968	.	0.162092	0.29152	N	0.012998	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.7973	0.40742	0.5685:0.0:0.4315:0.0	.	.	.	.	X	123	.	ENSP00000350022:Y123X	Y	-	3	2	OR8D2	123694935	0.179000	0.23135	0.105000	0.21289	0.032000	0.12392	-0.067000	0.11579	-0.263000	0.09378	0.432000	0.28606	TAT	OR8D2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000197263		0.418	OR8D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D2	HGNC	protein_coding	OTTHUMT00000387286.1		0.00	40	0	A	NM_001002918		124189725	-1			no_errors	ENST00000357438	ensembl	human	known	74_37	nonsense	7.69	24	2	SNP	0.965	T
OTOF	9381	genome.wustl.edu	37	2	26724638	26724638	+	Missense_Mutation	SNP	C	C	T	rs370225374		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:26724638C>T	ENST00000272371.2	-	8	875	c.749G>A	c.(748-750)cGg>cAg	p.R250Q	OTOF_ENST00000403946.3_Missense_Mutation_p.R250Q	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	250	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCCATGGGCCGCCCAGCACT	0.537																																					GBM(102;732 1451 20652 24062 31372)												0								C	GLN/ARG	0,4406		0,0,2203	89.0	79.0	83.0		749	4.9	1.0	2		83	1,8599	1.2+/-3.3	0,1,4299	no	missense	OTOF	NM_194248.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	250/1998	26724638	1,13005	2203	4300	6503	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.749G>A	2.37:g.26724638C>T	ENSP00000272371:p.Arg250Gln		B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_dom,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.R250Q	ENST00000272371.2	37	c.749	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910888	0.92178	0.0	1.16E-4	ENSG00000115155	ENST00000272371;ENST00000403946	T;T	0.80909	-1.43;-1.43	5.81	4.94	0.65067	C2 membrane targeting protein (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.84302	0.5442	M	0.74258	2.255	0.50313	D	0.999863	D	0.63046	0.992	P	0.50570	0.644	D	0.86319	0.1691	10	0.72032	D	0.01	-25.3683	13.6958	0.62578	0.0:0.9256:0.0:0.0744	.	250	Q9HC10	OTOF_HUMAN	Q	250	ENSP00000272371:R250Q;ENSP00000385255:R250Q	ENSP00000272371:R250Q	R	-	2	0	OTOF	26578142	0.998000	0.40836	1.000000	0.80357	0.983000	0.72400	5.796000	0.69080	1.469000	0.48083	0.655000	0.94253	CGG	OTOF	-	superfamily_C2_dom,pfscan_C2_dom	ENSG00000115155		0.537	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	-	0.00	76	0	C			26724638	-1	tier1	-	no_errors	ENST00000272371	ensembl	human	known	74_37	missense	20.59	54	14	SNP	1.000	T
PCDH11X	27328	genome.wustl.edu	37	X	91132816	91132816	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:91132816A>C	ENST00000373094.1	+	2	2422	c.1577A>C	c.(1576-1578)aAg>aCg	p.K526T	PCDH11X_ENST00000504220.2_Missense_Mutation_p.K526T|PCDH11X_ENST00000298274.8_Missense_Mutation_p.K526T|PCDH11X_ENST00000395337.2_Missense_Mutation_p.K526T|PCDH11X_ENST00000373088.1_Missense_Mutation_p.K526T|PCDH11X_ENST00000361724.1_Missense_Mutation_p.K526T|PCDH11X_ENST00000361655.2_Missense_Mutation_p.K526T|PCDH11X_ENST00000406881.1_Missense_Mutation_p.K526T|PCDH11X_ENST00000373097.1_Missense_Mutation_p.K526T	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	526	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						ACTGTAGTGAAGAAACTAGAT	0.438																																					NSCLC(38;925 1092 2571 38200 45895)												0													61.0	57.0	58.0					X																	91132816		2203	4300	6503	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.1577A>C	X.37:g.91132816A>C	ENSP00000362186:p.Lys526Thr		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K526T	ENST00000373094.1	37	c.1577	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	A	1.218	-0.627737	0.03610	.	.	ENSG00000102290	ENST00000395337;ENST00000373094;ENST00000373097;ENST00000361724;ENST00000373088;ENST00000504220;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43;0.43	5.38	4.23	0.50019	Cadherin (4);Cadherin-like (1);	0.216100	0.46145	D	0.000312	T	0.36908	0.0984	N	0.25789	0.76	0.37346	D	0.910592	P;B;P;P;P;P;P;P	0.45768	0.837;0.006;0.837;0.837;0.837;0.866;0.735;0.735	B;B;P;P;P;P;B;B	0.48873	0.287;0.017;0.457;0.457;0.457;0.593;0.287;0.287	T	0.51284	-0.8725	10	0.02654	T	1	.	4.4999	0.11858	0.7079:0.0:0.2921:0.0	.	526;526;526;526;526;526;526;526	Q9BZA7-6;Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7;Q9BZA7-7;Q9BZA7-2	.;.;.;.;.;PC11X_HUMAN;.;.	T	526	ENSP00000378746:K526T;ENSP00000362186:K526T;ENSP00000362189:K526T;ENSP00000355040:K526T;ENSP00000362180:K526T;ENSP00000423762:K526T;ENSP00000355105:K526T;ENSP00000384758:K526T;ENSP00000298274:K526T	ENSP00000298274:K526T	K	+	2	0	PCDH11X	91019472	1.000000	0.71417	1.000000	0.80357	0.531000	0.34715	4.012000	0.57131	1.786000	0.52430	0.441000	0.28932	AAG	PCDH11X	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000102290		0.438	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	30	0	A	NM_032969		91132816	+1	tier1	-	no_errors	ENST00000373094	ensembl	human	known	74_37	missense	94.12	2	32	SNP	1.000	C
PCDH18	54510	genome.wustl.edu	37	4	138451944	138451944	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:138451944C>A	ENST00000344876.4	-	1	1685	c.1299G>T	c.(1297-1299)ttG>ttT	p.L433F	PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.L433F|PCDH18_ENST00000507846.1_Missense_Mutation_p.L213F	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	433	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					CGATTACAGTCAAACTATACT	0.378																																																	0													136.0	137.0	137.0					4																	138451944		2203	4300	6503	SO:0001583	missense	0			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1299G>T	4.37:g.138451944C>A	ENSP00000355082:p.Leu433Phe		A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L433F	ENST00000344876.4	37	c.1299	CCDS34064.1	4	.	.	.	.	.	.	.	.	.	.	C	18.48	3.632137	0.67015	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.56776	0.44;0.44;0.44	6.04	6.04	0.98038	Cadherin (4);Cadherin-like (1);	0.000000	0.35525	N	0.003142	T	0.77267	0.4105	M	0.83692	2.655	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.78548	-0.2162	10	0.87932	D	0	.	20.5948	0.99439	0.0:1.0:0.0:0.0	.	213;433;433	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	F	433;433;213	ENSP00000355082:L433F;ENSP00000390688:L433F;ENSP00000425903:L213F	ENSP00000355082:L433F	L	-	3	2	PCDH18	138671394	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.883000	0.56168	2.873000	0.98535	0.563000	0.77884	TTG	PCDH18	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000189184		0.378	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH18	HGNC	protein_coding	OTTHUMT00000364614.1	-	0.00	46	0	C	NM_019035		138451944	-1	tier1	-	no_errors	ENST00000344876	ensembl	human	known	74_37	missense	42.86	24	18	SNP	1.000	A
PCDH18	54510	genome.wustl.edu	37	4	138452917	138452917	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:138452917T>G	ENST00000344876.4	-	1	712	c.326A>C	c.(325-327)gAt>gCt	p.D109A	PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.D109A|PCDH18_ENST00000507846.1_Intron	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	109	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					AGTGATCACATCAAACTCTAT	0.408																																																	0													144.0	141.0	142.0					4																	138452917		2203	4300	6503	SO:0001583	missense	0			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.326A>C	4.37:g.138452917T>G	ENSP00000355082:p.Asp109Ala		A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D109A	ENST00000344876.4	37	c.326	CCDS34064.1	4	.	.	.	.	.	.	.	.	.	.	T	29.1	4.981165	0.93044	.	.	ENSG00000189184	ENST00000344876;ENST00000412923	T;T	0.27402	1.67;1.67	5.96	5.96	0.96718	Cadherin, N-terminal (1);Cadherin (3);Cadherin-like (1);	0.000000	0.44285	U	0.000478	T	0.61615	0.2361	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.991;0.999	T	0.67780	-0.5582	10	0.87932	D	0	.	16.4447	0.83919	0.0:0.0:0.0:1.0	.	109;109	Q9HCL0-2;Q9HCL0	.;PCD18_HUMAN	A	109	ENSP00000355082:D109A;ENSP00000390688:D109A	ENSP00000355082:D109A	D	-	2	0	PCDH18	138672367	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.991000	0.88244	2.284000	0.76573	0.528000	0.53228	GAT	PCDH18	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000189184		0.408	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH18	HGNC	protein_coding	OTTHUMT00000364614.1	-	0.00	89	0	T	NM_019035		138452917	-1	tier1	-	no_errors	ENST00000344876	ensembl	human	known	74_37	missense	46.88	34	30	SNP	1.000	G
PCLO	27445	genome.wustl.edu	37	7	82390054	82390055	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:82390054_82390055insT	ENST00000333891.9	-	24	15525_15526	c.15188_15189insA	c.(15187-15189)aagfs	p.K5063fs		NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TCTTGATCACCTTTTTTTGGGT	0.317																																																	0																																										SO:0001589	frameshift_variant	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.15189dupA	7.37:g.82390061_82390061dupT	ENSP00000334319:p.Lys5063fs			Frame_Shift_Ins	INS	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.V5064fs	ENST00000333891.9	37	c.15189_15188	CCDS47630.1	7																																																																																			PCLO	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	ENSG00000186472		0.317	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5		0.00	64	0	-	NM_014510		82390055	-1	tier1		no_errors	ENST00000333891	ensembl	human	known	74_37	frame_shift_ins	30.30	23	10	INS	1.000:1.000	T
PEG3	5178	genome.wustl.edu	37	19	57325534	57325534	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:57325534C>A	ENST00000326441.9	-	10	4639	c.4276G>T	c.(4276-4278)Gat>Tat	p.D1426Y	PEG3_ENST00000598410.1_Missense_Mutation_p.D1302Y|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.D1300Y|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.D1426Y	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1426	4 X 5 AA repeat of P-X-G-E-A.|Glu-rich.				apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		GCCTCTCCATCTGGCCCTTCA	0.602																																																	0													44.0	46.0	45.0					19																	57325534		2203	4300	6503	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.4276G>T	19.37:g.57325534C>A	ENSP00000326581:p.Asp1426Tyr		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.D1426Y	ENST00000326441.9	37	c.4276	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	C	16.55	3.155125	0.57259	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02737	4.18;4.18	4.26	3.23	0.37069	.	0.483041	0.17835	N	0.160386	T	0.04497	0.0123	N	0.19112	0.55	.	.	.	D;P;D	0.56968	0.978;0.94;0.976	P;P;P	0.56865	0.808;0.707;0.781	T	0.38415	-0.9662	9	0.48119	T	0.1	-13.0189	7.9546	0.30035	0.0:0.8909:0.0:0.1091	.	1302;1426;1361	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	Y	1426	ENSP00000326581:D1426Y;ENSP00000403051:D1426Y	ENSP00000326581:D1426Y	D	-	1	0	ZIM2	62017346	0.000000	0.05858	0.853000	0.33588	0.990000	0.78478	0.298000	0.19120	1.391000	0.46566	0.655000	0.94253	GAT	PEG3	-	NULL	ENSG00000198300		0.602	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	93	0	C			57325534	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	49.09	28	27	SNP	0.784	A
PEG3	5178	genome.wustl.edu	37	19	57326873	57326873	+	Silent	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:57326873A>G	ENST00000326441.9	-	10	3300	c.2937T>C	c.(2935-2937)gcT>gcC	p.A979A	PEG3_ENST00000598410.1_Silent_p.A855A|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000593695.1_Silent_p.A853A|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000423103.2_Silent_p.A979A	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	979					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CAGAGCTATGAGCAAAGCACT	0.493																																																	0													109.0	102.0	104.0					19																	57326873		2203	4300	6503	SO:0001819	synonymous_variant	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2937T>C	19.37:g.57326873A>G			A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.A979	ENST00000326441.9	37	c.2937	CCDS12948.1	19																																																																																			PEG3	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198300		0.493	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	88	0	A			57326873	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	silent	34.78	30	16	SNP	0.000	G
PHKA2	5256	genome.wustl.edu	37	X	18917322	18917322	+	Missense_Mutation	SNP	G	G	A	rs375184186		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:18917322G>A	ENST00000379942.4	-	29	3745	c.3080C>T	c.(3079-3081)gCg>gTg	p.A1027V	PHKA2_ENST00000481718.1_5'Flank	NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	1027					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					ACTGCTGGACGCGGCCTGGCC	0.557																																																	0								G	VAL/ALA	1,3834		0,1,1631,571	167.0	127.0	141.0		3080	-5.0	0.0	X		141	0,6728		0,0,2428,1872	no	missense	PHKA2	NM_000292.2	64	0,1,4059,2443	AA,AG,GG,G		0.0,0.0261,0.0095	benign	1027/1236	18917322	1,10562	2203	4300	6503	SO:0001583	missense	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.3080C>T	X.37:g.18917322G>A	ENSP00000369274:p.Ala1027Val		A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.A1027V	ENST00000379942.4	37	c.3080	CCDS14190.1	X	.	.	.	.	.	.	.	.	.	.	G	10.66	1.413078	0.25465	2.61E-4	0.0	ENSG00000044446	ENST00000379942	D	0.90504	-2.68	5.33	-5.02	0.02982	.	2.597880	0.00714	N	0.000858	T	0.79458	0.4449	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.68700	-0.5339	10	0.25751	T	0.34	4.9801	13.9667	0.64213	0.4543:0.0:0.5457:0.0	.	1027	P46019	KPB2_HUMAN	V	1027	ENSP00000369274:A1027V	ENSP00000369274:A1027V	A	-	2	0	PHKA2	18827243	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.088000	0.14979	-1.400000	0.02061	-0.322000	0.08575	GCG	PHKA2	-	NULL	ENSG00000044446		0.557	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	-	0.00	32	0	G	NM_000292		18917322	-1	tier1	-	no_errors	ENST00000379942	ensembl	human	known	74_37	missense	40.00	15	10	SNP	0.000	A
PIK3AP1	118788	genome.wustl.edu	37	10	98408575	98408575	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:98408575delA	ENST00000339364.5	-	7	1145	c.1026delT	c.(1024-1026)tttfs	p.F342fs	PIK3AP1_ENST00000468783.1_5'UTR|PIK3AP1_ENST00000371110.2_Frame_Shift_Del_p.F164fs	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	342					negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		ACTTCGCAGCAAAATGCAACA	0.507																																																	0													100.0	87.0	91.0					10																	98408575		2203	4300	6503	SO:0001589	frameshift_variant	0			AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.1026delT	10.37:g.98408575delA	ENSP00000339826:p.Phe342fs		Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Frame_Shift_Del	DEL	superfamily_Ankyrin_rpt-contain_dom	p.F342fs	ENST00000339364.5	37	c.1026	CCDS31259.1	10																																																																																			PIK3AP1	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000155629		0.507	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3AP1	HGNC	protein_coding	OTTHUMT00000049619.2		0.00	65	0	A	NM_152309		98408575	-1	tier1		no_errors	ENST00000339364	ensembl	human	known	74_37	frame_shift_del	6.45	29	2	DEL	1.000	-
PKD1L1	168507	genome.wustl.edu	37	7	47944879	47944880	+	Frame_Shift_Del	DEL	TG	TG	-	rs377086330		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:47944879_47944880delTG	ENST00000289672.2	-	11	1615_1616	c.1565_1566delCA	c.(1564-1566)acafs	p.T522fs		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	522	PKD 1. {ECO:0000255|PROSITE- ProRule:PRU00151}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						ATGTAATGTCTGTGTCTGTGGC	0.441																																																	0																																										SO:0001589	frameshift_variant	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1565_1566delCA	7.37:g.47944881_47944882delTG	ENSP00000289672:p.Thr522fs		Q6UWK1	Frame_Shift_Del	DEL	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_PLAT/LH2_dom,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_PLAT/LH2_dom,pfscan_PKD_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like	p.T522fs	ENST00000289672.2	37	c.1566_1565	CCDS34633.1	7																																																																																			PKD1L1	-	smart_PKD/Chitinase_dom	ENSG00000158683		0.441	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1		0.00	54	0	TG	NM_138295		47944880	-1	tier1		no_errors	ENST00000289672	ensembl	human	known	74_37	frame_shift_del	12.00	44	6	DEL	0.001:0.001	-
PKHD1	5314	genome.wustl.edu	37	6	51924834	51924834	+	Silent	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:51924834C>T	ENST00000371117.3	-	15	1400	c.1125G>A	c.(1123-1125)cgG>cgA	p.R375R	PKHD1_ENST00000340994.4_Silent_p.R375R|AL590391.1_ENST00000408630.2_RNA	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	375					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)	p.R375R(2)		NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					ACCCACTGAGCCGTGCTCTGT	0.438																																																	2	Substitution - coding silent(2)	endometrium(2)											75.0	69.0	71.0					6																	51924834		2203	4300	6503	SO:0001819	synonymous_variant	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.1125G>A	6.37:g.51924834C>T			Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT,smart_PbH1	p.R375	ENST00000371117.3	37	c.1125	CCDS4935.1	6																																																																																			PKHD1	-	NULL	ENSG00000170927		0.438	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1		0.00	51	0	C	NM_138694		51924834	-1			no_errors	ENST00000371117	ensembl	human	known	74_37	silent	7.69	24	2	SNP	1.000	T
PKMYT1	9088	genome.wustl.edu	37	16	3024061	3024061	+	Missense_Mutation	SNP	G	G	A	rs4149800		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:3024061G>A	ENST00000262300.8	-	7	1758	c.1250C>T	c.(1249-1251)cCa>cTa	p.P417L	PKMYT1_ENST00000574385.1_Missense_Mutation_p.P408L|PKMYT1_ENST00000431515.2_Missense_Mutation_p.P417L|PKMYT1_ENST00000573944.1_Missense_Mutation_p.P408L|PKMYT1_ENST00000440027.2_Missense_Mutation_p.P417L|PKMYT1_ENST00000574730.1_Missense_Mutation_p.P348L	NM_001258450.1|NM_004203.4|NM_182687.2	NP_001245379.1|NP_004194.3|NP_872629.1	Q99640	PMYT1_HUMAN	protein kinase, membrane associated tyrosine/threonine 1	417	Interaction with PIN1.		P -> R (in dbSNP:rs4149800). {ECO:0000269|Ref.4}.		G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	10						ACTGCAGGGTGGTGAGCCAGG	0.672																																																	0													24.0	26.0	25.0					16																	3024061		2194	4298	6492	SO:0001583	missense	0			AK097642	CCDS10486.1, CCDS45391.1, CCDS58414.1, CCDS58415.1	16p13.3	2014-06-13			ENSG00000127564	ENSG00000127564			29650	protein-coding gene	gene with protein product	"""membrane-associated tyrosine- and threonine-specific cdc2-inhibitory kinase"", ""protein phosphatase 1, regulatory subunit 126"""	602474				9001210, 12606722	Standard	NM_004203		Approved	MYT1, PPP1R126	uc002csn.3	Q99640	OTTHUMG00000128975	ENST00000262300.8:c.1250C>T	16.37:g.3024061G>A	ENSP00000262300:p.Pro417Leu		B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr/Thr_kinase_Cdc2_inhib,pfscan_Prot_kinase_dom	p.P417L	ENST00000262300.8	37	c.1250	CCDS10486.1	16	.	.	.	.	.	.	.	.	.	.	G	16.14	3.040148	0.55003	.	.	ENSG00000127564	ENST00000431515;ENST00000262300;ENST00000440027;ENST00000402679;ENST00000382240	T;T;T;T	0.59502	1.76;1.76;1.76;0.26	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.67906	0.2943	L	0.32530	0.975	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.996;0.996;0.999	T	0.70400	-0.4882	10	0.72032	D	0.01	-29.8893	16.9392	0.86211	0.0:0.0:1.0:0.0	.	408;348;417;417	A6NHV6;B4DXD4;Q99640;F8W164	.;.;PMYT1_HUMAN;.	L	417;417;417;417;408	ENSP00000392855:P417L;ENSP00000262300:P417L;ENSP00000397739:P417L;ENSP00000371675:P408L	ENSP00000262300:P417L	P	-	2	0	PKMYT1	2964062	1.000000	0.71417	0.170000	0.22879	0.667000	0.39255	6.164000	0.71885	2.586000	0.87340	0.655000	0.94253	CCA	PKMYT1	-	pirsf_Tyr/Thr_kinase_Cdc2_inhib	ENSG00000127564		0.672	PKMYT1-001	KNOWN	basic|CCDS	protein_coding	PKMYT1	HGNC	protein_coding	OTTHUMT00000250963.2	-	0.00	45	0	G	NM_004203		3024061	-1	tier1	-	no_errors	ENST00000262300	ensembl	human	known	74_37	missense	32.14	38	18	SNP	0.920	A
PKNOX2	63876	genome.wustl.edu	37	11	125301355	125301355	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:125301355G>A	ENST00000298282.9	+	0	1757				PKNOX2_ENST00000542175.1_3'UTR|PKNOX2_ENST00000530517.1_3'UTR	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2						regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CTTCAGGGTGGGGGGGAAGGG	0.607																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.*67G>A	11.37:g.125301355G>A			B7Z5I5|F5GZ15|Q63HL6|Q86XD1	RNA	SNP	-	NULL	ENST00000298282.9	37	NULL	CCDS41730.1	11																																																																																			PKNOX2	-	-	ENSG00000165495		0.607	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKNOX2	HGNC	protein_coding	OTTHUMT00000386866.3	-	0.00	12	0	G			125301355	+1	tier1	-	no_errors	ENST00000530517	ensembl	human	known	74_37	rna	35.71	9	5	SNP	0.616	A
PKP4	8502	genome.wustl.edu	37	2	159514662	159514662	+	Silent	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:159514662C>A	ENST00000389759.3	+	12	2041	c.1929C>A	c.(1927-1929)tcC>tcA	p.S643S	PKP4_ENST00000389757.3_Silent_p.S643S|AC005042.4_ENST00000342892.4_RNA	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	643					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						GGAATTTATCCTCATGTGATG	0.318										HNSCC(62;0.18)																																							0													116.0	114.0	115.0					2																	159514662		2203	4300	6503	SO:0001819	synonymous_variant	0			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.1929C>A	2.37:g.159514662C>A			Q86W91	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.S643	ENST00000389759.3	37	c.1929	CCDS33305.1	2																																																																																			PKP4	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	ENSG00000144283		0.318	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	HGNC	protein_coding	OTTHUMT00000333250.1	-	0.00	43	0	C			159514662	+1	tier1	-	no_errors	ENST00000389759	ensembl	human	known	74_37	silent	24.29	53	17	SNP	0.993	A
PLXDC2	84898	genome.wustl.edu	37	10	20568836	20568836	+	3'UTR	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:20568836C>A	ENST00000377252.4	+	0	2519				PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_3'UTR	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2						multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						caaacaaacacacacacaaac	0.378																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.*88C>A	10.37:g.20568836C>A			Q96E59|Q96PD9|Q96SU9	RNA	SNP	-	NULL	ENST00000377252.4	37	NULL	CCDS7132.1	10																																																																																			PLXDC2	-	-	ENSG00000120594		0.378	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC2	HGNC	protein_coding	OTTHUMT00000047101.2	-	0.00	25	0	C	NM_032812		20568836	+1	tier1	-	no_errors	ENST00000377238	ensembl	human	known	74_37	rna	56.52	10	13	SNP	0.220	A
PLXNC1	10154	genome.wustl.edu	37	12	94562964	94562964	+	Silent	SNP	C	C	T	rs141950146		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:94562964C>T	ENST00000258526.4	+	2	1347	c.1098C>T	c.(1096-1098)atC>atT	p.I366I	RP11-74K11.2_ENST00000551029.1_RNA|RP11-74K11.2_ENST00000550759.1_RNA	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	366	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TCCAACCAATCGCATCATCTA	0.398																																																	0													183.0	143.0	157.0					12																	94562964		2203	4300	6503	SO:0001819	synonymous_variant	0			AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.1098C>T	12.37:g.94562964C>T			Q59H25	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Plexin_repeat,pfam_IPT,superfamily_Semap_dom,superfamily_Rho_GTPase_activation_prot,superfamily_Plexin-like_fold,superfamily_Ig_E-set,smart_Semap_dom,smart_Plexin-like_fold,smart_IPT,pfscan_Semap_dom	p.I366	ENST00000258526.4	37	c.1098	CCDS9049.1	12																																																																																			PLXNC1	-	superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000136040		0.398	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNC1	HGNC	protein_coding	OTTHUMT00000408126.2	-	0.00	120	0	C			94562964	+1	tier1	-	no_errors	ENST00000258526	ensembl	human	known	74_37	silent	65.79	26	50	SNP	0.700	T
POTEG	404785	genome.wustl.edu	37	14	19563512	19563512	+	Silent	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr14:19563512A>G	ENST00000409832.3	+	5	1078	c.1026A>G	c.(1024-1026)agA>agG	p.R342R	CTD-2311B13.5_ENST00000548748.1_lincRNA|RNU6-1239P_ENST00000391310.1_RNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	342										cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						AGACGGCCAGAGAGTATGCTG	0.348																																																	0													57.0	94.0	82.0					14																	19563512		1145	2446	3591	SO:0001819	synonymous_variant	0				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.1026A>G	14.37:g.19563512A>G			A1L153|A6NMI9|Q6S5H6|Q6S8J2	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R342	ENST00000409832.3	37	c.1026	CCDS32018.1	14																																																																																			POTEG	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000222036		0.348	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEG	HGNC	protein_coding	OTTHUMT00000408579.1	-	0.00	1002	0	A	NM_001005356		19563512	+1	tier1	-	no_errors	ENST00000409832	ensembl	human	known	74_37	silent	11.81	462	62	SNP	0.002	G
PPP1R17	10842	genome.wustl.edu	37	7	31735172	31735172	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:31735172T>G	ENST00000342032.3	+	3	800	c.172T>G	c.(172-174)Tca>Gca	p.S58A	PPP1R17_ENST00000409146.3_Intron	NM_006658.4	NP_006649.2	O96001	PPR17_HUMAN	protein phosphatase 1, regulatory subunit 17	58					central nervous system development (GO:0007417)|intracellular signal transduction (GO:0035556)|regulation of phosphatase activity (GO:0010921)		protein serine/threonine phosphatase inhibitor activity (GO:0004865)										GAATGTTGAGTCAGACCAAAA	0.428																																																	0													142.0	138.0	139.0					7																	31735172		2203	4300	6503	SO:0001583	missense	0			AF071789	CCDS5436.1, CCDS47570.1	7p15	2012-04-17	2011-10-11	2011-10-11	ENSG00000106341	ENSG00000106341		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16973	protein-coding gene	gene with protein product	"""G-substrate"""	604088	"""chromosome 7 open reading frame 16"""	C7orf16		10051666, 9920894	Standard	NM_006658		Approved	GSBS	uc003tcl.3	O96001	OTTHUMG00000128629	ENST00000342032.3:c.172T>G	7.37:g.31735172T>G	ENSP00000340125:p.Ser58Ala		B4DE58|Q9UDQ0	Missense_Mutation	SNP	NULL	p.S58A	ENST00000342032.3	37	c.172	CCDS5436.1	7	.	.	.	.	.	.	.	.	.	.	T	5.280	0.236993	0.10023	.	.	ENSG00000106341	ENST00000342032	T	0.32272	1.46	5.45	4.28	0.50868	.	0.405543	0.23402	N	0.048576	T	0.24547	0.0595	L	0.56769	1.78	0.46458	D	0.99905	B	0.06786	0.001	B	0.06405	0.002	T	0.09862	-1.0655	10	0.21014	T	0.42	-5.4658	4.1516	0.10240	0.0:0.1786:0.1832:0.6382	.	58	O96001	PPR17_HUMAN	A	58	ENSP00000340125:S58A	ENSP00000340125:S58A	S	+	1	0	C7orf16	31701697	0.966000	0.33281	0.862000	0.33874	0.998000	0.95712	2.033000	0.41136	0.979000	0.38497	0.533000	0.62120	TCA	PPP1R17	-	NULL	ENSG00000106341		0.428	PPP1R17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R17	HGNC	protein_coding	OTTHUMT00000250498.1	-	0.00	45	0	T	NM_006658		31735172	+1	tier1	-	no_errors	ENST00000342032	ensembl	human	known	74_37	missense	42.86	24	18	SNP	0.692	G
PREX2	80243	genome.wustl.edu	37	8	69005845	69005845	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr8:69005845T>G	ENST00000288368.4	+	21	2533	c.2256T>G	c.(2254-2256)gaT>gaG	p.D752E	RP11-403D15.2_ENST00000526901.1_RNA|PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	752	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TCCAGCAAGATTCCATACAAT	0.428																																																	0													105.0	106.0	105.0					8																	69005845		2203	4300	6503	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2256T>G	8.37:g.69005845T>G	ENSP00000288368:p.Asp752Glu		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.D752E	ENST00000288368.4	37	c.2256	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	T	14.19	2.461759	0.43736	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.35048	1.33	5.66	-0.843	0.10744	.	0.000000	0.85682	D	0.000000	T	0.13798	0.0334	N	0.00347	-1.61	0.49582	D	0.999801	D;B;B	0.56287	0.975;0.081;0.036	P;B;B	0.53062	0.717;0.082;0.02	T	0.34378	-0.9831	10	0.51188	T	0.08	.	7.6414	0.28296	0.0:0.4266:0.1248:0.4486	.	752;752;752	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	E	752	ENSP00000288368:D752E	ENSP00000288368:D752E	D	+	3	2	PREX2	69168399	0.993000	0.37304	0.997000	0.53966	0.993000	0.82548	0.221000	0.17680	-0.136000	0.11475	-0.263000	0.10527	GAT	PREX2	-	NULL	ENSG00000046889		0.428	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	72	0	T	NM_025170		69005845	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	63.16	14	24	SNP	0.994	G
PREX2	80243	genome.wustl.edu	37	8	69031715	69031715	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr8:69031715A>C	ENST00000288368.4	+	28	3747	c.3470A>C	c.(3469-3471)aAg>aCg	p.K1157T		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1157					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						AAACAGGACAAGATACATAGT	0.388																																																	0													204.0	184.0	191.0					8																	69031715		2203	4300	6503	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3470A>C	8.37:g.69031715A>C	ENSP00000288368:p.Lys1157Thr		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.K1157T	ENST00000288368.4	37	c.3470	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	A	25.6	4.654955	0.88056	.	.	ENSG00000046889	ENST00000288368;ENST00000396539	T	0.40225	1.04	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.55337	0.1914	M	0.64404	1.975	0.80722	D	1	P	0.40398	0.716	P	0.50896	0.653	T	0.59096	-0.7518	10	0.87932	D	0	.	15.7056	0.77577	1.0:0.0:0.0:0.0	.	1157	Q70Z35	PREX2_HUMAN	T	1157;1163	ENSP00000288368:K1157T	ENSP00000288368:K1157T	K	+	2	0	PREX2	69194269	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.726000	0.74758	2.178000	0.69098	0.528000	0.53228	AAG	PREX2	-	NULL	ENSG00000046889		0.388	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	37	0	A	NM_025170		69031715	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	C
PRLR	5618	genome.wustl.edu	37	5	35086442	35086442	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:35086442C>T	ENST00000382002.5	-	4	497	c.71G>A	c.(70-72)gGa>gAa	p.G24E	PRLR_ENST00000509934.1_5'Flank|PRLR_ENST00000342362.5_Intron|PRLR_ENST00000348262.3_Splice_Site_p.G24E|PRLR_ENST00000231423.3_Splice_Site_p.G24E|PRLR_ENST00000542609.1_Splice_Site_p.G24E|PRLR_ENST00000397391.3_Intron|PRLR_ENST00000310101.5_Splice_Site_p.G24E|PRLR_ENST00000511486.1_Intron|PRLR_ENST00000513753.1_Splice_Site_p.G24E	NM_000949.5	NP_000940.1	P16471	PRLR_HUMAN	prolactin receptor	24					activation of JAK2 kinase activity (GO:0042977)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cell surface receptor signaling pathway (GO:0007166)|embryo implantation (GO:0007566)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|prolactin signaling pathway (GO:0038161)|steroid biosynthetic process (GO:0006694)|T cell activation (GO:0042110)	cell surface (GO:0009986)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|ornithine decarboxylase activator activity (GO:0042978)|peptide hormone binding (GO:0017046)|prolactin receptor activity (GO:0004925)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	48	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Fluoxymesterone(DB01185)|Somatropin recombinant(DB00052)	AGGTAACTGTCCTAGAAAAAG	0.468																																																	0													71.0	67.0	68.0					5																	35086442		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS3909.1, CCDS56358.1, CCDS56359.1, CCDS56360.1, CCDS56361.1, CCDS56362.1	5p14-p13	2013-02-27			ENSG00000113494	ENSG00000113494			9446	protein-coding gene	gene with protein product		176761					Standard	NM_001204315		Approved		uc003jjm.3	P16471	OTTHUMG00000090789	ENST00000382002.5:c.71-1G>A	5.37:g.35086442C>T			B2R882|D1MDP1|Q16354|Q8TD75|Q8TD78|Q96P35|Q96P36|Q9BX87|Q9UHJ5	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.G24E	ENST00000382002.5	37	c.71	CCDS3909.1	5	.	.	.	.	.	.	.	.	.	.	C	19.24	3.789545	0.70337	.	.	ENSG00000113494	ENST00000231423;ENST00000513753;ENST00000348262;ENST00000542609;ENST00000382002;ENST00000310101;ENST00000514206;ENST00000509839;ENST00000503330;ENST00000504500;ENST00000515839	T;T;T;T;T;T;T;T;T;T;T	0.68903	-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36;-0.36	5.75	4.88	0.63580	Fibronectin, type III (1);	0.155531	0.56097	D	0.000030	T	0.81489	0.4833	M	0.75615	2.305	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.996;0.996;0.996	D	0.84157	0.0426	10	0.87932	D	0	.	15.6567	0.77140	0.0:0.8619:0.1381:0.0	.	24;24;24;24	P16471;P16471-7;P16471-6;P16471-4	PRLR_HUMAN;.;.;.	E	24	ENSP00000231423:G24E;ENSP00000424841:G24E;ENSP00000311613:G24E;ENSP00000441813:G24E;ENSP00000371432:G24E;ENSP00000309008:G24E;ENSP00000423493:G24E;ENSP00000427060:G24E;ENSP00000422385:G24E;ENSP00000422867:G24E;ENSP00000421864:G24E	ENSP00000231423:G24E	G	-	2	0	PRLR	35122199	1.000000	0.71417	1.000000	0.80357	0.624000	0.37722	2.299000	0.43611	1.412000	0.46977	0.561000	0.74099	GGA	PRLR	-	superfamily_Fibronectin_type3	ENSG00000113494		0.468	PRLR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRLR	HGNC	protein_coding	OTTHUMT00000207575.2	-	0.00	88	0	C		Missense_Mutation	35086442	-1	tier1	-	no_errors	ENST00000382002	ensembl	human	known	74_37	missense	17.74	51	11	SNP	1.000	T
PTBP1	5725	genome.wustl.edu	37	19	804119	804119	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:804119C>T	ENST00000349038.4	+	4	272	c.199C>T	c.(199-201)Ccc>Tcc	p.P67S	PTBP1_ENST00000394601.4_Missense_Mutation_p.P67S|MIR4745_ENST00000577608.1_RNA|PTBP1_ENST00000350092.4_Intron|PTBP1_ENST00000356948.6_Missense_Mutation_p.P67S	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1	67	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGGAAGCTCCCCATCGACGT	0.572																																																	0													74.0	68.0	70.0					19																	804119		2203	4300	6503	SO:0001583	missense	0			X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.199C>T	19.37:g.804119C>T	ENSP00000014112:p.Pro67Ser		Q9BUQ0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.P67S	ENST00000349038.4	37	c.199	CCDS32859.1	19	.	.	.	.	.	.	.	.	.	.	C	14.47	2.546049	0.45383	.	.	ENSG00000011304	ENST00000356948;ENST00000394601;ENST00000349038	T;T;T	0.55413	0.52;0.52;0.82	4.41	3.37	0.38596	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.057858	0.64402	D	0.000001	T	0.73434	0.3586	M	0.87038	2.855	0.80722	D	1	D;D;D	0.76494	0.991;0.999;0.996	D;D;D	0.76575	0.963;0.969;0.988	T	0.77587	-0.2532	10	0.87932	D	0	-36.3814	11.6448	0.51255	0.0:0.9128:0.0:0.0872	.	67;67;67	P26599;P26599-2;Q9BUQ0	PTBP1_HUMAN;.;.	S	67	ENSP00000349428:P67S;ENSP00000408096:P67S;ENSP00000014112:P67S	ENSP00000014112:P67S	P	+	1	0	PTBP1	755119	1.000000	0.71417	0.082000	0.20525	0.030000	0.12068	7.773000	0.85462	0.983000	0.38602	-0.136000	0.14681	CCC	PTBP1	-	smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	ENSG00000011304		0.572	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTBP1	HGNC	protein_coding	OTTHUMT00000457605.1	-	0.00	64	0	C			804119	+1	tier1	-	no_errors	ENST00000356948	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.996	T
PTCRA	171558	genome.wustl.edu	37	6	42889966	42889966	+	Intron	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:42889966C>T	ENST00000304672.1	+	2	139				PTCRA_ENST00000446507.1_Intron|PTCRA_ENST00000441198.1_Silent_p.S23S	NM_001243168.1|NM_138296.2	NP_001230097.1|NP_612153.2	Q6ISU1	PTCRA_HUMAN	pre T-cell antigen receptor alpha						negative regulation of thymocyte apoptotic process (GO:0070244)	integral component of membrane (GO:0016021)				large_intestine(2)|lung(4)|ovary(2)	8	Colorectal(47;0.196)		all cancers(41;0.000731)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			gtcctgtttccttcccttcct	0.373																																																	0																																										SO:0001627	intron_variant	0			AF084941	CCDS4874.1, CCDS59019.1, CCDS59020.1, CCDS75457.1	6p21.3	2008-02-05			ENSG00000171611	ENSG00000171611			21290	protein-coding gene	gene with protein product		606817				8618853, 9842925	Standard	NM_138296		Approved	PTA, PT-ALPHA	uc021yzp.1	Q6ISU1	OTTHUMG00000014709	ENST00000304672.1:c.59-799C>T	6.37:g.42889966C>T			Q5TFZ7	Silent	SNP	NULL	p.S23	ENST00000304672.1	37	c.69	CCDS4874.1	6	.	.	.	.	.	.	.	.	.	.	C	4.379	0.069964	0.08436	.	.	ENSG00000171611	ENST00000418903	.	.	.	2.24	1.35	0.21983	.	.	.	.	.	T	0.21347	0.0514	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24368	-1.0162	5	0.87932	D	0	.	4.8682	0.13618	0.0:0.8161:0.0:0.1839	.	.	.	.	F	20	.	ENSP00000407061:L20F	L	+	1	0	PTCRA	42997944	0.000000	0.05858	0.002000	0.10522	0.346000	0.29079	-0.259000	0.08721	0.517000	0.28361	0.505000	0.49811	CTT	PTCRA	-	NULL	ENSG00000171611		0.373	PTCRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCRA	HGNC	protein_coding	OTTHUMT00000040565.2		0.00	35	0	C	NM_138296		42889966	+1			no_errors	ENST00000441198	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.002	T
PTPRD	5789	genome.wustl.edu	37	9	8331729	8331729	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:8331729T>C	ENST00000381196.4	-	41	5930	c.5387A>G	c.(5386-5388)cAg>cGg	p.Q1796R	PTPRD_ENST00000397606.3_Missense_Mutation_p.Q1389R|PTPRD_ENST00000356435.5_Missense_Mutation_p.Q1796R|PTPRD_ENST00000397611.3_Missense_Mutation_p.Q1386R|PTPRD_ENST00000355233.5_Missense_Mutation_p.Q1390R|PTPRD_ENST00000486161.1_Missense_Mutation_p.Q1389R|PTPRD_ENST00000540109.1_Missense_Mutation_p.Q1796R|PTPRD_ENST00000397617.3_Missense_Mutation_p.Q1389R|PTPRD_ENST00000358503.5_Missense_Mutation_p.Q1774R|PTPRD_ENST00000537002.1_Missense_Mutation_p.Q1386R|PTPRD_ENST00000360074.4_Missense_Mutation_p.Q1783R	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1796	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TGTTCGGGACTGGCCGTCCTT	0.502										TSP Lung(15;0.13)																																							0													81.0	77.0	78.0					9																	8331729		2203	4300	6503	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.5387A>G	9.37:g.8331729T>C	ENSP00000370593:p.Gln1796Arg		B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt	p.Q1796R	ENST00000381196.4	37	c.5387	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	T	32	5.146895	0.94603	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	D;D;D;D;D;D;D;D;D;D;D	0.83419	-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72;-1.72	5.58	5.58	0.84498	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.85682	D	0.000000	D	0.88078	0.6340	L	0.48174	1.505	0.58432	D	0.999996	P;P;P;P;B;P;P;D;B	0.58970	0.619;0.619;0.619;0.619;0.283;0.565;0.523;0.984;0.147	P;P;P;P;B;P;B;D;B	0.75484	0.844;0.844;0.844;0.844;0.213;0.758;0.35;0.986;0.211	D	0.87121	0.2191	9	.	.	.	.	16.0502	0.80755	0.0:0.0:0.0:1.0	.	1389;1380;1389;1390;1386;1386;1783;1796;1796	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	R	1796;1796;1783;1774;1390;1389;1386;1386;1267;1796;1389;1389	ENSP00000370593:Q1796R;ENSP00000348812:Q1796R;ENSP00000353187:Q1783R;ENSP00000351293:Q1774R;ENSP00000347373:Q1390R;ENSP00000380741:Q1389R;ENSP00000380735:Q1386R;ENSP00000440515:Q1386R;ENSP00000438164:Q1796R;ENSP00000417093:Q1389R;ENSP00000380731:Q1389R	.	Q	-	2	0	PTPRD	8321729	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.983000	0.88140	2.250000	0.74265	0.454000	0.30748	CAG	PTPRD	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000153707		0.502	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	-	0.00	46	0	T			8331729	-1	tier1	-	no_errors	ENST00000356435	ensembl	human	known	74_37	missense	59.38	13	19	SNP	1.000	C
PTPRQ	374462	genome.wustl.edu	37	12	81009998	81009998	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:81009998C>T	ENST00000266688.5	+	35	5171	c.5171C>T	c.(5170-5172)gCt>gTt	p.A1724V				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1770	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						GTCAATAGTGCTGGTGCAGGT	0.323																																																	0													146.0	141.0	142.0					12																	81009998		692	1591	2283	SO:0001583	missense	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.5171C>T	12.37:g.81009998C>T	ENSP00000266688:p.Ala1724Val			Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A1724V	ENST00000266688.5	37	c.5171		12	.	.	.	.	.	.	.	.	.	.	C	21.5	4.155855	0.78114	.	.	ENSG00000139304	ENST00000266688	T	0.57273	0.41	5.92	5.92	0.95590	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67002	0.2847	.	.	.	0.58432	D	0.999996	D	0.89917	1.0	D	0.91635	0.999	T	0.57590	-0.7785	8	0.11485	T	0.65	.	18.4977	0.90870	0.0:1.0:0.0:0.0	.	1770	Q9UMZ3	PTPRQ_HUMAN	V	1724	ENSP00000266688:A1724V	ENSP00000266688:A1724V	A	+	2	0	PTPRQ	79534129	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	5.530000	0.67141	2.801000	0.96364	0.650000	0.86243	GCT	PTPRQ	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000139304		0.323	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		-	0.00	50	0	C	NM_001145026		81009998	+1	tier1	-	no_errors	ENST00000266688	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
PZP	5858	genome.wustl.edu	37	12	9312993	9312993	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:9312993T>C	ENST00000261336.2	-	24	2994	c.2966A>G	c.(2965-2967)aAc>aGc	p.N989S	PZP_ENST00000381997.2_Missense_Mutation_p.N775S|PZP_ENST00000539983.1_5'Flank	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	989					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GACATAGATGTTAGGAGCAAA	0.453																																					Melanoma(125;1402 1695 4685 34487 38571)												0													153.0	137.0	142.0					12																	9312993		2203	4300	6503	SO:0001583	missense	0			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.2966A>G	12.37:g.9312993T>C	ENSP00000261336:p.Asn989Ser		A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.N989S	ENST00000261336.2	37	c.2966	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	T	13.72	2.320544	0.41096	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.52526	0.66;0.66	4.46	4.46	0.54185	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);Alpha-2-macroglobulin, thiol-ester bond-forming (1);	0.148106	0.41938	U	0.000796	T	0.61974	0.2390	M	0.67953	2.075	0.35338	D	0.786247	D;P	0.61697	0.99;0.933	P;P	0.59825	0.864;0.718	T	0.74423	-0.3670	10	0.62326	D	0.03	.	13.7028	0.62620	0.0:0.0:0.0:1.0	.	775;989	P20742-2;P20742	.;PZP_HUMAN	S	989;775	ENSP00000261336:N989S;ENSP00000371427:N775S	ENSP00000261336:N989S	N	-	2	0	PZP	9204260	1.000000	0.71417	0.990000	0.47175	0.018000	0.09664	5.950000	0.70265	1.778000	0.52293	0.460000	0.39030	AAC	PZP	-	pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000126838		0.453	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	HGNC	protein_coding	OTTHUMT00000337624.1	-	0.00	65	0	T	NM_002864		9312993	-1	tier1	-	no_errors	ENST00000261336	ensembl	human	known	74_37	missense	36.07	39	22	SNP	1.000	C
PTPRQ	374462	genome.wustl.edu	37	12	81043443	81043443	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:81043443T>A	ENST00000266688.5	+	42	6007	c.6007T>A	c.(6007-6009)Ttt>Att	p.F2003I				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	2040					regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TCAAGAAGAATTTTCGGTATG	0.388																																																	0													136.0	113.0	120.0					12																	81043443		692	1590	2282	SO:0001583	missense	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.6007T>A	12.37:g.81043443T>A	ENSP00000266688:p.Phe2003Ile			Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.F2003I	ENST00000266688.5	37	c.6007		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.8|23.8	4.464105|4.464105	0.84425|0.84425	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722;ENST00000547881	T|.	0.21734|.	1.99|.	5.97|5.97	5.97|5.97	0.96955|0.96955	Protein-tyrosine phosphatase, receptor/non-receptor type (2);|.	.|.	.|.	.|.	.|.	T|T	0.73418|0.73418	0.3584|0.3584	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.70487|.	0.969|.	T|T	0.72316|0.72316	-0.4330|-0.4330	8|4	0.87932|.	D|.	0|.	.|.	16.4452|16.4452	0.83925|0.83925	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	2040|.	Q9UMZ3|.	PTPRQ_HUMAN|.	I|K	2003|1703;92	ENSP00000266688:F2003I|.	ENSP00000266688:F2003I|.	F|N	+|+	1|3	0|2	PTPRQ|PTPRQ	79567574|79567574	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.992000|6.992000	0.76238|0.76238	2.281000|2.281000	0.76405|0.76405	0.528000|0.528000	0.53228|0.53228	TTT|AAT	PTPRQ	-	smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000139304		0.388	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		-	0.00	38	0	T	NM_001145026		81043443	+1	tier1	-	no_errors	ENST00000266688	ensembl	human	known	74_37	missense	27.50	29	11	SNP	1.000	A
QRICH2	84074	genome.wustl.edu	37	17	74277968	74277969	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:74277968_74277969insA	ENST00000262765.5	-	8	3920_3921	c.3741_3742insT	c.(3739-3744)tccaagfs	p.K1248fs		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1248										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						TTGGCCTTCTTGGAGGGTCGGG	0.644																																																	0																																										SO:0001589	frameshift_variant	0			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.3741_3742insT	17.37:g.74277968_74277969insA	ENSP00000262765:p.Lys1248fs		A2RRE1|Q96LM3	Frame_Shift_Ins	INS	NULL	p.K1247fs	ENST00000262765.5	37	c.3742_3741	CCDS32741.1	17																																																																																			QRICH2	-	NULL	ENSG00000129646		0.644	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	HGNC	protein_coding	OTTHUMT00000395140.1		0.00	49	0	-	NM_032134		74277969	-1	tier1		no_errors	ENST00000262765	ensembl	human	known	74_37	frame_shift_ins	11.76	15	2	INS	1.000:0.999	A
RAB13	5872	genome.wustl.edu	37	1	153955602	153955602	+	Intron	DEL	A	A	-	rs370008084		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:153955602delA	ENST00000368575.3	-	4	440				RAB13_ENST00000462680.1_5'UTR	NM_002870.2	NP_002861.1	P51153	RAB13_HUMAN	RAB13, member RAS oncogene family						cellular response to insulin stimulus (GO:0032869)|cortical actin cytoskeleton organization (GO:0030866)|endocytic recycling (GO:0032456)|endosomal transport (GO:0016197)|endothelial cell chemotaxis (GO:0035767)|establishment of protein localization to plasma membrane (GO:0090002)|establishment of Sertoli cell barrier (GO:0097368)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|neuron projection development (GO:0031175)|protein kinase A signaling (GO:0010737)|protein localization to cell leading edge (GO:1902463)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)|tight junction assembly (GO:0070830)|trans-Golgi network to recycling endosome transport (GO:0044795)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|insulin-responsive compartment (GO:0032593)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|tight junction (GO:0005923)|trans-Golgi network (GO:0005802)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(3)|kidney(1)|lung(5)|urinary_tract(1)	11	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			acttcatctcaaaaaaaaaaa	0.498																																					Ovarian(138;395 2427 24306 43415)												0																																										SO:0001627	intron_variant	0			X75593	CCDS1058.1, CCDS72921.1	1q21.2	2008-02-05			ENSG00000143545	ENSG00000143545		"""RAB, member RAS oncogene"""	9762	protein-coding gene	gene with protein product		602672				8294494	Standard	NM_002870		Approved		uc001fdt.2	P51153	OTTHUMG00000036589	ENST00000368575.3:c.324+92T>-	1.37:g.153955602delA			A8K6B5|D3DV67|Q5U0A6|Q6GPG6|Q96GU4	RNA	DEL	-	NULL	ENST00000368575.3	37	NULL	CCDS1058.1	1																																																																																			RAB13	-	-	ENSG00000143545		0.498	RAB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB13	HGNC	protein_coding	OTTHUMT00000088992.1		0.00	14	0	A	NM_002870		153955602	-1	tier1		no_errors	ENST00000462680	ensembl	human	known	74_37	rna	21.74	18	5	DEL	0.029	-
RAB5C	5878	genome.wustl.edu	37	17	40282413	40282413	+	Silent	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:40282413G>A	ENST00000346213.4	-	2	320	c.108C>T	c.(106-108)agC>agT	p.S36S	RAB5C_ENST00000393860.3_Silent_p.S36S|RAB5C_ENST00000547517.1_Silent_p.S69S|CTD-2132N18.3_ENST00000592574.1_Silent_p.S36S	NM_004583.3	NP_004574.2	P51148	RAB5C_HUMAN	RAB5C, member RAS oncogene family	36					endosome organization (GO:0007032)|GTP catabolic process (GO:0006184)|plasma membrane to endosome transport (GO:0048227)|protein transport (GO:0015031)|regulation of endocytosis (GO:0030100)|small GTPase mediated signal transduction (GO:0007264)	endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			large_intestine(1)|lung(4)|prostate(1)|skin(1)	7		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		GGAGGACGAGGCTGGATTTGC	0.587																																																	0													91.0	76.0	81.0					17																	40282413		2203	4300	6503	SO:0001819	synonymous_variant	0			U18420	CCDS11419.1, CCDS58551.1	17q21.2	2013-02-15			ENSG00000108774	ENSG00000108774		"""RAB, member RAS oncogene"""	9785	protein-coding gene	gene with protein product	"""RAB, member of RAS oncogene family-like"", ""RAB5C, member of RAS oncogene family"""	604037		RABL		8646882	Standard	NM_004583		Approved	RAB5CL	uc010cxx.3	P51148	OTTHUMG00000169703	ENST00000346213.4:c.108C>T	17.37:g.40282413G>A			F8W1H5|Q6FH55|Q9P0Y5	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.S36	ENST00000346213.4	37	c.108	CCDS11419.1	17																																																																																			RAB5C	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000108774		0.587	RAB5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB5C	HGNC	protein_coding	OTTHUMT00000405509.1	-	0.00	57	0	G	NM_004583		40282413	-1	tier1	-	no_errors	ENST00000346213	ensembl	human	known	74_37	silent	7.55	47	4	SNP	1.000	A
RDX	5962	genome.wustl.edu	37	11	110134916	110134916	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:110134916T>G	ENST00000343115.4	-	5	555	c.236A>C	c.(235-237)aAg>aCg	p.K79T	RDX_ENST00000405097.1_Missense_Mutation_p.K79T|RDX_ENST00000528498.1_Missense_Mutation_p.K79T|RDX_ENST00000528900.1_Intron|RDX_ENST00000530301.1_Missense_Mutation_p.K47T|RDX_ENST00000544551.1_Intron	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	P35241	RADI_HUMAN	radixin	79	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		AGCTCTAAACTTGAACTGTAA	0.299																																					Esophageal Squamous(55;25 1062 11040 28755 44273)												0													36.0	37.0	37.0					11																	110134916		2201	4297	6498	SO:0001583	missense	0			BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000343115.4:c.236A>C	11.37:g.110134916T>G	ENSP00000342830:p.Lys79Thr		A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	p.K79T	ENST00000343115.4	37	c.236	CCDS8343.1	11	.	.	.	.	.	.	.	.	.	.	T	20.3	3.963745	0.74016	.	.	ENSG00000137710	ENST00000528498;ENST00000429481;ENST00000405097;ENST00000530301;ENST00000343115;ENST00000532118;ENST00000533991	T;T;T;T;T;T	0.76316	-1.01;-1.01;-1.0;-1.01;-1.01;-1.01	4.99	4.99	0.66335	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	D	0.87589	0.6215	M	0.77616	2.38	0.80722	D	1	B;D;P	0.89917	0.227;1.0;0.63	B;D;B	0.97110	0.248;1.0;0.442	D	0.88416	0.3025	10	0.51188	T	0.08	.	14.9797	0.71303	0.0:0.0:0.0:1.0	.	47;79;79	A7YIK0;A7YIJ8;P35241	.;.;RADI_HUMAN	T	79;79;79;47;79;68;68	ENSP00000432112:K79T;ENSP00000384136:K79T;ENSP00000436277:K47T;ENSP00000342830:K79T;ENSP00000437140:K68T;ENSP00000432572:K68T	ENSP00000342830:K79T	K	-	2	0	RDX	109640126	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.120000	0.64685	1.987000	0.57996	0.528000	0.53228	AAG	RDX	-	pirsf_ERM,pfam_FERM_N,smart_Band_41_domain,prints_Ez/rad/moesin_like,pfscan_FERM_domain	ENSG00000137710		0.299	RDX-001	KNOWN	basic|CCDS	protein_coding	RDX	HGNC	protein_coding	OTTHUMT00000390535.2	-	0.00	55	0	T	NM_002906		110134916	-1	tier1	-	no_errors	ENST00000530749	ensembl	human	known	74_37	missense	32.20	40	19	SNP	1.000	G
REPS2	9185	genome.wustl.edu	37	X	17080642	17080642	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:17080642T>C	ENST00000357277.3	+	9	1367	c.1196T>C	c.(1195-1197)tTg>tCg	p.L399S	REPS2_ENST00000380064.4_Missense_Mutation_p.L259S|REPS2_ENST00000303843.7_Missense_Mutation_p.L398S	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	399					epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					CCTCGTGACTTGAATCGGATG	0.363																																																	0													102.0	87.0	92.0					X																	17080642		2203	4300	6503	SO:0001583	missense	0			AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.1196T>C	X.37:g.17080642T>C	ENSP00000349824:p.Leu399Ser		A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Missense_Mutation	SNP	smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	p.L399S	ENST00000357277.3	37	c.1196	CCDS14180.2	X	.	.	.	.	.	.	.	.	.	.	T	17.37	3.373556	0.61624	.	.	ENSG00000169891	ENST00000357277;ENST00000380063;ENST00000303843;ENST00000380064	T;T;T	0.35048	1.4;1.4;1.33	5.62	3.2	0.36748	.	0.705620	0.12784	N	0.439419	T	0.42698	0.1214	M	0.62723	1.935	0.36296	D	0.856722	D;D;D	0.60575	0.988;0.96;0.988	P;P;P	0.57204	0.676;0.815;0.676	T	0.49476	-0.8936	10	0.08599	T	0.76	0.1173	5.7275	0.18020	0.0:0.0886:0.168:0.7433	.	259;398;399	B4DQQ8;Q8NFH8-4;Q8NFH8	.;.;REPS2_HUMAN	S	399;399;398;259	ENSP00000349824:L399S;ENSP00000306033:L398S;ENSP00000369404:L259S	ENSP00000306033:L398S	L	+	2	0	REPS2	16990563	1.000000	0.71417	0.766000	0.31476	0.967000	0.64934	2.178000	0.42519	0.266000	0.21894	0.441000	0.28932	TTG	REPS2	-	NULL	ENSG00000169891		0.363	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REPS2	HGNC	protein_coding	OTTHUMT00000316778.1	-	0.00	39	0	T	NM_004726		17080642	+1	tier1	-	no_errors	ENST00000357277	ensembl	human	known	74_37	missense	8.57	32	3	SNP	0.984	C
RGMB	285704	genome.wustl.edu	37	5	98129163	98129163	+	Silent	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:98129163C>A	ENST00000513185.1	+	3	1456	c.1020C>A	c.(1018-1020)acC>acA	p.T340T	RGMB_ENST00000308234.7_Silent_p.T381T			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	340					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		TGCCTCGCACCTCCTTGGTGC	0.597																																																	0													44.0	44.0	44.0					5																	98129163		2097	4230	6327	SO:0001819	synonymous_variant	0			AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.1020C>A	5.37:g.98129163C>A			D6R9A0|Q8NC92	Silent	SNP	pfam_RGM_C,pfam_RGM_N	p.T381	ENST00000513185.1	37	c.1143		5																																																																																			RGMB	-	pfam_RGM_C	ENSG00000174136		0.597	RGMB-003	KNOWN	basic	protein_coding	RGMB	HGNC	protein_coding	OTTHUMT00000370308.1	-	0.00	18	0	C	NM_173670		98129163	+1	tier1	-	no_errors	ENST00000308234	ensembl	human	known	74_37	silent	35.71	9	5	SNP	0.000	A
RIMKLB	57494	genome.wustl.edu	37	12	8902671	8902671	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:8902671C>T	ENST00000538135.1	+	3	1214	c.389C>T	c.(388-390)cCg>cTg	p.P130L	RIMKLB_ENST00000535829.1_Missense_Mutation_p.P130L|RIMKLB_ENST00000357529.3_Missense_Mutation_p.P130L|RIMKLB_ENST00000299673.5_3'UTR			Q9ULI2	RIMKB_HUMAN	ribosomal modification protein rimK-like family member B	130	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				cellular protein modification process (GO:0006464)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|citrate-L-glutamate ligase activity (GO:0072591)|metal ion binding (GO:0046872)|N-acetyl-L-aspartate-L-glutamate ligase activity (GO:0072590)			central_nervous_system(2)|kidney(3)|large_intestine(5)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						GTTCCTCTGCCGGATACTTTC	0.408																																																	0													80.0	74.0	76.0					12																	8902671		1883	4099	5982	SO:0001583	missense	0			AB033064	CCDS41748.1	12p13.31	2011-09-21	2008-10-13	2008-10-13	ENSG00000166532	ENSG00000166532	6.3.2.N6		29228	protein-coding gene	gene with protein product	"""N-acetylaspartyl-glutamate synthetase"""	614054	"""family with sequence similarity 80, member B"""	FAM80B		10574462, 20643647	Standard	XM_006719116		Approved	KIAA1238, NAAGS, NAAGS-I	uc001qux.2	Q9ULI2		ENST00000538135.1:c.389C>T	12.37:g.8902671C>T	ENSP00000440943:p.Pro130Leu		B7Z834|D3DUV2|Q8N4P4|Q8WTW6	Missense_Mutation	SNP	pfam_ATP-grasp_RimK-type,pfam_GSHS_ATP-bd,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	p.P130L	ENST00000538135.1	37	c.389	CCDS41748.1	12	.	.	.	.	.	.	.	.	.	.	C	27.5	4.837768	0.91117	.	.	ENSG00000166532	ENST00000535829;ENST00000357529;ENST00000538135	.	.	.	5.47	5.47	0.80525	ATP-grasp fold (1);ATP-grasp fold, RimK-type (1);ATP-grasp fold, subdomain 1 (1);	0.073509	0.56097	N	0.000033	D	0.84633	0.5515	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.71870	0.958;0.975	D	0.87456	0.2404	9	0.87932	D	0	.	17.8968	0.88891	0.0:1.0:0.0:0.0	.	130;130	Q9ULI2-2;Q9ULI2	.;RIMKB_HUMAN	L	130	.	ENSP00000350136:P130L	P	+	2	0	RIMKLB	8793938	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.392000	0.79840	2.571000	0.86741	0.591000	0.81541	CCG	RIMKLB	-	pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_DUF201-type,pfscan_ATP-grasp,tigrfam_RpS6_RimK/Lys_biosynth_LsyX	ENSG00000166532		0.408	RIMKLB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMKLB	HGNC	protein_coding	OTTHUMT00000398874.1		0.00	75	0	C	NM_020734		8902671	+1			no_errors	ENST00000357529	ensembl	human	known	74_37	missense	7.14	39	3	SNP	1.000	T
RIMBP2	23504	genome.wustl.edu	37	12	130907016	130907016	+	Missense_Mutation	SNP	C	C	T	rs372504138		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:130907016C>T	ENST00000261655.4	-	13	2615	c.2452G>A	c.(2452-2454)Gtg>Atg	p.V818M	RP11-117L5.4_ENST00000539532.1_lincRNA	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	818					negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GGGACTGTCACGGGCCGGGAC	0.567																																																	0								C	MET/VAL	1,4405	2.1+/-5.4	0,1,2202	53.0	44.0	47.0		2452	-2.8	0.0	12		47	0,8600		0,0,4300	no	missense	RIMBP2	NM_015347.4	21	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	818/1053	130907016	1,13005	2203	4300	6503	SO:0001583	missense	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.2452G>A	12.37:g.130907016C>T	ENSP00000261655:p.Val818Met		Q96ID2	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.V818M	ENST00000261655.4	37	c.2452	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	C	5.958	0.360753	0.11296	2.27E-4	0.0	ENSG00000060709	ENST00000261655	T	0.19250	2.16	4.2	-2.85	0.05734	.	3.622840	0.00616	N	0.000436	T	0.06600	0.0169	N	0.00538	-1.39	0.09310	N	0.999999	B	0.06786	0.001	B	0.04013	0.001	T	0.29671	-1.0004	10	0.27785	T	0.31	-0.2162	8.6791	0.34198	0.0:0.1354:0.1316:0.7331	.	818	O15034	RIMB2_HUMAN	M	818	ENSP00000261655:V818M	ENSP00000261655:V818M	V	-	1	0	RIMBP2	129472969	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.018000	0.13422	-0.431000	0.07307	-0.367000	0.07326	GTG	RIMBP2	-	NULL	ENSG00000060709		0.567	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	-	0.00	48	0	C	NM_015347		130907016	-1	tier1	-	no_errors	ENST00000261655	ensembl	human	known	74_37	missense	71.43	4	10	SNP	0.019	T
RIMS2	9699	genome.wustl.edu	37	8	104898284	104898284	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr8:104898284A>C	ENST00000436393.2	+	2	1032	c.791A>C	c.(790-792)gAc>gCc	p.D264A	RIMS2_ENST00000507740.1_Missense_Mutation_p.D294A|RIMS2_ENST00000406091.3_Missense_Mutation_p.D486A|RIMS2_ENST00000262231.10_Missense_Mutation_p.D294A			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	517					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CTCAGTTCAGACCAGTCAGAG	0.433										HNSCC(12;0.0054)																																							0													63.0	60.0	61.0					8																	104898284		2036	4186	6222	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.791A>C	8.37:g.104898284A>C	ENSP00000390665:p.Asp264Ala		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.D486A	ENST00000436393.2	37	c.1457		8	.	.	.	.	.	.	.	.	.	.	A	21.4	4.150898	0.78001	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.29142	1.87;2.35;1.75;1.71;1.58;1.74;2.1	5.54	5.54	0.83059	.	.	.	.	.	T	0.51907	0.1702	L	0.54323	1.7	0.80722	D	1	D;D;B;D;D	0.89917	1.0;0.986;0.363;0.977;1.0	D;D;B;P;D	0.91635	0.999;0.93;0.373;0.868;0.999	T	0.54043	-0.8352	9	0.87932	D	0	.	15.6758	0.77321	1.0:0.0:0.0:0.0	.	517;264;294;294;486	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	A	486;517;486;517;294;294;294;294;264	ENSP00000427018:D486A;ENSP00000384892:D486A;ENSP00000425205:D294A;ENSP00000262231:D294A;ENSP00000423559:D294A;ENSP00000386228:D294A;ENSP00000390665:D264A	ENSP00000262231:D294A	D	+	2	0	RIMS2	104967460	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.293000	0.96082	2.099000	0.63709	0.460000	0.39030	GAC	RIMS2	-	NULL	ENSG00000176406		0.433	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	-	0.00	30	0	A	NM_001100117		104898284	+1	tier1	-	no_errors	ENST00000406091	ensembl	human	known	74_37	missense	31.82	15	7	SNP	1.000	C
RLTPR	146206	genome.wustl.edu	37	16	67681024	67681024	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:67681024delT	ENST00000334583.6	+	9	945	c.617delT	c.(616-618)ctgfs	p.L206fs	RLTPR_ENST00000545661.1_Frame_Shift_Del_p.L206fs	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	206					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		ACCAGGGACCTGGCCTTGAGT	0.652																																																	0													38.0	41.0	40.0					16																	67681024		2009	4185	6194	SO:0001589	frameshift_variant	0			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.617delT	16.37:g.67681024delT	ENSP00000334958:p.Leu206fs		B8X2Z3	Frame_Shift_Del	DEL	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L206fs	ENST00000334583.6	37	c.617	CCDS45513.1	16																																																																																			RLTPR	-	NULL	ENSG00000159753		0.652	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RLTPR	HGNC	protein_coding	OTTHUMT00000467858.1		0.00	48	0	T	NM_001013838		67681024	+1	tier1		no_errors	ENST00000334583	ensembl	human	known	74_37	frame_shift_del	10.53	17	2	DEL	1.000	-
RNF103	7844	genome.wustl.edu	37	2	86832517	86832517	+	Silent	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:86832517G>A	ENST00000237455.4	-	4	1475	c.507C>T	c.(505-507)gtC>gtT	p.V169V	CHMP3_ENST00000439940.2_Intron|AC015971.2_ENST00000439077.1_RNA|AC015971.2_ENST00000424788.1_RNA|RNF103-CHMP3_ENST00000604011.1_Intron|RNF103_ENST00000477307.1_5'UTR|AC015971.2_ENST00000426549.1_RNA|AC015971.2_ENST00000597638.1_RNA	NM_001198951.1|NM_005667.3	NP_001185880.1|NP_005658.1	O00237	RN103_HUMAN	ring finger protein 103	169					central nervous system development (GO:0007417)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(7)|skin(2)	25						GTGTGGATCGGACCCAGCCTC	0.388																																																	0													88.0	86.0	87.0					2																	86832517		2203	4300	6503	SO:0001819	synonymous_variant	0			D76444	CCDS33237.1	2p11.2	2013-01-09	2003-05-14	2003-05-16	ENSG00000239305	ENSG00000239305		"""RING-type (C3HC4) zinc fingers"""	12859	protein-coding gene	gene with protein product		602507	"""zinc finger protein 103 homolog (mouse)"""	ZFP103		9070305	Standard	NM_005667		Approved	hkf-1, KF1	uc021vkg.1	O00237	OTTHUMG00000153197	ENST00000237455.4:c.507C>T	2.37:g.86832517G>A			A6NFV6|B2RAG4|Q53SU6|Q8IVB9	Silent	SNP	pfam_Znf_C3HC4_RING-type,superfamily_Thioredoxin-like_fold,smart_Znf_RING,pfscan_Znf_RING	p.V169	ENST00000237455.4	37	c.507	CCDS33237.1	2																																																																																			RNF103	-	NULL	ENSG00000239305		0.388	RNF103-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF103	HGNC	protein_coding	OTTHUMT00000330041.2	-	0.00	29	0	G	NM_005667		86832517	-1	tier1	-	no_errors	ENST00000237455	ensembl	human	known	74_37	silent	17.86	22	5	SNP	0.937	A
RNF217	154214	genome.wustl.edu	37	6	125397905	125397905	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:125397905T>G	ENST00000521654.2	+	4	1384	c.1384T>G	c.(1384-1386)Ttt>Gtt	p.F462V	RNF217_ENST00000359704.2_Missense_Mutation_p.F170V|RNF217_ENST00000560949.1_Missense_Mutation_p.F227V|RNF217_ENST00000275184.6_Missense_Mutation_p.F106V|RNF217_ENST00000368414.2_Missense_Mutation_p.F24V			Q8TC41	RN217_HUMAN	ring finger protein 217	462					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		GCTCCGATTTTTTGGAGACCA	0.458																																																	0													173.0	159.0	164.0					6																	125397905		2203	4300	6503	SO:0001583	missense	0			BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.1384T>G	6.37:g.125397905T>G	ENSP00000428698:p.Phe462Val		H7C5V4|Q5TCA4|Q9BX48	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_C6HC	p.F227V	ENST00000521654.2	37	c.679		6	.	.	.	.	.	.	.	.	.	.	T	32	5.172606	0.94807	.	.	ENSG00000146373	ENST00000521654;ENST00000368414;ENST00000359704;ENST00000275184	T;T;T;T	0.62498	1.55;0.02;0.02;0.02	5.56	5.56	0.83823	Zinc finger, C6HC-type (1);	0.000000	0.85682	D	0.000000	T	0.72755	0.3500	M	0.71206	2.165	0.80722	D	1	D;D	0.89917	1.0;0.979	D;P	0.87578	0.998;0.883	T	0.73248	-0.4043	10	0.41790	T	0.15	.	16.0193	0.80468	0.0:0.0:0.0:1.0	.	170;227	Q8TC41;F2Z2M4	RN217_HUMAN;.	V	227;24;170;106	ENSP00000428698:F227V;ENSP00000357399:F24V;ENSP00000352734:F170V;ENSP00000275184:F106V	ENSP00000275184:F106V	F	+	1	0	RNF217	125439604	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.655000	0.83696	2.241000	0.73720	0.528000	0.53228	TTT	RNF217	-	smart_Znf_C6HC	ENSG00000146373		0.458	RNF217-002	NOVEL	basic|appris_principal	protein_coding	RNF217	HGNC	protein_coding	OTTHUMT00000042063.3	-	0.00	73	0	T	NM_152553		125397905	+1	tier1	-	no_errors	ENST00000560949	ensembl	human	known	74_37	missense	33.33	28	14	SNP	1.000	G
RNF40	9810	genome.wustl.edu	37	16	30779758	30779758	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:30779758C>A	ENST00000324685.6	+	13	2321	c.1886C>A	c.(1885-1887)tCc>tAc	p.S629Y	RNF40_ENST00000357890.5_Missense_Mutation_p.S529Y|RNF40_ENST00000402121.3_Missense_Mutation_p.S321Y|RNF40_ENST00000563683.1_Missense_Mutation_p.S589Y	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	629					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			CCTGTAGCCTCCGCTCTCTCA	0.632																																																	0													47.0	59.0	55.0					16																	30779758		2164	4262	6426	SO:0001583	missense	0			AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.1886C>A	16.37:g.30779758C>A	ENSP00000325677:p.Ser629Tyr		Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.S629Y	ENST00000324685.6	37	c.1886	CCDS10691.1	16	.	.	.	.	.	.	.	.	.	.	C	13.61	2.288929	0.40494	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000402121	T;T;T	0.34275	1.37;1.37;1.37	5.97	5.02	0.67125	.	0.372474	0.23622	N	0.046224	T	0.48187	0.1486	L	0.43152	1.355	0.21627	N	0.999619	D;D;D;D	0.64830	0.989;0.994;0.978;0.978	P;P;P;P	0.62560	0.769;0.904;0.598;0.598	T	0.40627	-0.9553	10	0.72032	D	0.01	-0.523	12.1763	0.54188	0.0:0.9205:0.0:0.0795	.	321;529;629;629	F8W8Z4;O75150-4;A8K6K1;O75150	.;.;.;BRE1B_HUMAN	Y	629;529;321	ENSP00000325677:S629Y;ENSP00000350563:S529Y;ENSP00000384942:S321Y	ENSP00000325677:S629Y	S	+	2	0	RNF40	30687259	0.025000	0.19082	0.743000	0.31040	0.115000	0.19883	0.819000	0.27308	1.540000	0.49301	0.655000	0.94253	TCC	RNF40	-	NULL	ENSG00000103549		0.632	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF40	HGNC	protein_coding	OTTHUMT00000255524.2	-	0.00	34	0	C	NM_014771		30779758	+1	tier1	-	no_errors	ENST00000324685	ensembl	human	known	74_37	missense	15.38	33	6	SNP	0.408	A
RPA4	29935	genome.wustl.edu	37	X	96139622	96139622	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:96139622C>T	ENST00000373040.3	+	1	716	c.313C>T	c.(313-315)Cga>Tga	p.R105*	DIAPH2_ENST00000373049.4_Intron|DIAPH2_ENST00000324765.8_Intron|DIAPH2_ENST00000355827.4_Intron|DIAPH2_ENST00000373054.4_Intron|DIAPH2_ENST00000373061.3_Intron	NM_013347.4	NP_037479.1	Q13156	RFA4_HUMAN	replication protein A4, 30kDa	105					DNA damage checkpoint (GO:0000077)|DNA recombination (GO:0006310)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)	DNA replication factor A complex (GO:0005662)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	13						AATCGAGGCCCGACAGTGGTT	0.468								Other identified genes with known or suspected DNA repair function																																									0													90.0	78.0	82.0					X																	96139622		2203	4300	6503	SO:0001587	stop_gained	0			U24186	CCDS35345.1	Xq21	2010-04-09	2010-04-09		ENSG00000204086	ENSG00000204086			30305	protein-coding gene	gene with protein product		300767	"""replication protein A4, 34kDa"""			7760808	Standard	NM_013347		Approved	HSU24186	uc004efv.4	Q13156	OTTHUMG00000021987	ENST00000373040.3:c.313C>T	X.37:g.96139622C>T	ENSP00000362131:p.Arg105*		Q3SY03	Nonsense_Mutation	SNP	pfam_RPA_C,pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,pirsf_RPA32	p.R105*	ENST00000373040.3	37	c.313	CCDS35345.1	X	.	.	.	.	.	.	.	.	.	.	C	24.2	4.499659	0.85176	.	.	ENSG00000204086	ENST00000373040	.	.	.	3.66	-7.33	0.01431	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.3402	0.897	0.01266	0.2126:0.1555:0.209:0.4229	.	.	.	.	X	105	.	ENSP00000362131:R105X	R	+	1	2	RPA4	96026278	0.000000	0.05858	0.000000	0.03702	0.047000	0.14425	-3.238000	0.00545	-2.655000	0.00422	0.600000	0.82982	CGA	RPA4	-	pfam_NA-bd_OB_tRNA,superfamily_NA-bd_OB-fold,pirsf_RPA32	ENSG00000204086		0.468	RPA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPA4	HGNC	protein_coding	OTTHUMT00000057464.1	-	0.00	18	0	C	NM_013347		96139622	+1	tier1	-	no_errors	ENST00000373040	ensembl	human	known	74_37	nonsense	84.62	2	11	SNP	0.000	T
RPTOR	57521	genome.wustl.edu	37	17	78617542	78617542	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:78617542G>T	ENST00000306801.3	+	3	642	c.280G>T	c.(280-282)Ggt>Tgt	p.G94C	RPTOR_ENST00000537330.1_Intron|RPTOR_ENST00000570891.1_Missense_Mutation_p.G94C|RPTOR_ENST00000544334.2_Missense_Mutation_p.G94C	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	94					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						TCTGTCGATGGGTCCTCAGAA	0.468																																																	0													120.0	104.0	110.0					17																	78617542		2203	4300	6503	SO:0001583	missense	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.280G>T	17.37:g.78617542G>T	ENSP00000307272:p.Gly94Cys		B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Missense_Mutation	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.G94C	ENST00000306801.3	37	c.280	CCDS11773.1	17	.	.	.	.	.	.	.	.	.	.	G	16.84	3.233443	0.58886	.	.	ENSG00000141564	ENST00000306801;ENST00000544334	T;T	0.45668	0.9;0.89	5.61	5.61	0.85477	.	0.066781	0.64402	D	0.000014	T	0.49729	0.1574	N	0.24115	0.695	0.80722	D	1	D;B	0.69078	0.997;0.291	P;B	0.61132	0.884;0.161	T	0.52094	-0.8621	10	0.62326	D	0.03	.	18.626	0.91338	0.0:0.0:1.0:0.0	.	94;94	F5H7J5;Q8N122	.;RPTOR_HUMAN	C	94	ENSP00000307272:G94C;ENSP00000442479:G94C	ENSP00000307272:G94C	G	+	1	0	RPTOR	76232137	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	6.551000	0.73909	2.631000	0.89168	0.655000	0.94253	GGT	RPTOR	-	NULL	ENSG00000141564		0.468	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	-	0.00	69	0	G	NM_020761		78617542	+1	tier1	-	no_errors	ENST00000306801	ensembl	human	known	74_37	missense	8.51	42	4	SNP	1.000	T
RTFDC1	51507	genome.wustl.edu	37	20	55047458	55047458	+	Intron	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr20:55047458A>G	ENST00000023939.4	+	2	176				RTFDC1_ENST00000395881.3_Intron|RTFDC1_ENST00000357348.5_Missense_Mutation_p.D49G|RTFDC1_ENST00000484084.1_3'UTR	NM_001283035.1|NM_001283036.1|NM_016407.3	NP_001269964.1|NP_001269965.1|NP_057491.2	Q9BY42	RTF2_HUMAN	replication termination factor 2 domain containing 1																		AAGGAGTGGGACATGGAATAT	0.418																																																	0																																										SO:0001627	intron_variant	0			AF161513	CCDS13453.1, CCDS63316.1, CCDS63317.1	20q13	2012-10-29	2012-10-29	2012-10-29	ENSG00000022277	ENSG00000022277			15890	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 43"""	C20orf43			Standard	NM_001283035		Approved	HSPC164, CDAO5	uc002xxt.2	Q9BY42	OTTHUMG00000032801	ENST00000023939.4:c.70-899A>G	20.37:g.55047458A>G			E1P5Z9|Q9BYL7|Q9HCV9|Q9NX29|Q9NZZ8|Q9P002|Q9UHW3	Missense_Mutation	SNP	pfam_Rtf2_RING-finger	p.D49G	ENST00000023939.4	37	c.146	CCDS13453.1	20	.	.	.	.	.	.	.	.	.	.	A	2.969	-0.212839	0.06140	.	.	ENSG00000022277	ENST00000357348;ENST00000449062	T;T	0.32272	1.46;1.47	2.84	-2.54	0.06307	.	.	.	.	.	T	0.16428	0.0395	.	.	.	0.09310	N	0.999994	B	0.06786	0.001	B	0.06405	0.002	T	0.23119	-1.0197	8	0.31617	T	0.26	.	5.7871	0.18338	0.3061:0.5711:0.1228:0.0	.	49	A8MSH5	.	G	49	ENSP00000349906:D49G;ENSP00000400322:D49G	ENSP00000349906:D49G	D	+	2	0	C20orf43	54480865	0.001000	0.12720	0.014000	0.15608	0.049000	0.14656	-0.387000	0.07361	-0.633000	0.05545	0.402000	0.26972	GAC	RTFDC1	-	pfam_Rtf2_RING-finger	ENSG00000022277		0.418	RTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTFDC1	HGNC	protein_coding	OTTHUMT00000079817.2	-	0.00	48	0	A	NM_016407		55047458	+1	tier1	-	no_errors	ENST00000357348	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.022	G
RYR2	6262	genome.wustl.edu	37	1	237666672	237666672	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:237666672T>C	ENST00000366574.2	+	22	2797	c.2480T>C	c.(2479-2481)cTg>cCg	p.L827P	RYR2_ENST00000360064.6_Missense_Mutation_p.L825P|RYR2_ENST00000542537.1_Missense_Mutation_p.L811P	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	827					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAAGCTGTTCTGCCAAAAGAA	0.488																																																	0													89.0	90.0	90.0					1																	237666672		1942	4137	6079	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2480T>C	1.37:g.237666672T>C	ENSP00000355533:p.Leu827Pro		Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.L825P	ENST00000366574.2	37	c.2474	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.614381	0.87359	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97186	-4.28;-4.25;-4.27	5.86	5.86	0.93980	.	0.000000	0.48767	D	0.000171	D	0.98388	0.9464	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99187	1.0869	10	0.59425	D	0.04	.	16.5602	0.84551	0.0:0.0:0.0:1.0	.	827	Q92736	RYR2_HUMAN	P	827;825;811	ENSP00000355533:L827P;ENSP00000353174:L825P;ENSP00000443798:L811P	ENSP00000353174:L825P	L	+	2	0	RYR2	235733295	0.998000	0.40836	0.997000	0.53966	0.968000	0.65278	7.990000	0.88215	2.367000	0.80283	0.528000	0.53228	CTG	RYR2	-	NULL	ENSG00000198626		0.488	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	-	0.00	67	0	T	NM_001035		237666672	+1	tier1	-	no_errors	ENST00000360064	ensembl	human	known	74_37	missense	71.43	16	40	SNP	1.000	C
RYR3	6263	genome.wustl.edu	37	15	33905446	33905446	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr15:33905446A>C	ENST00000389232.4	+	19	2297	c.2227A>C	c.(2227-2229)Agc>Cgc	p.S743R	RYR3_ENST00000415757.3_Missense_Mutation_p.S743R	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	743	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGACGTGGTAAGCTGCTGCCT	0.567																																																	0													45.0	49.0	48.0					15																	33905446		2130	4274	6404	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.2227A>C	15.37:g.33905446A>C	ENSP00000373884:p.Ser743Arg		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.S743R	ENST00000389232.4	37	c.2227	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	A	24.9	4.585067	0.86748	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	T;T	0.68765	-0.35;-0.35	5.4	5.4	0.78164	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.81795	0.4898	M	0.78916	2.43	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.958	D	0.84044	0.0366	10	0.66056	D	0.02	.	15.6291	0.76888	1.0:0.0:0.0:0.0	.	743;743	Q15413-2;Q15413	.;RYR3_HUMAN	R	743	ENSP00000373884:S743R;ENSP00000399610:S743R	ENSP00000354735:S743R	S	+	1	0	RYR3	31692738	1.000000	0.71417	0.999000	0.59377	0.765000	0.43378	9.029000	0.93718	2.276000	0.75962	0.529000	0.55759	AGC	RYR3	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000198838		0.567	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	-	0.00	45	0	A			33905446	+1	tier1	-	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	16.67	25	5	SNP	1.000	C
RYR3	6263	genome.wustl.edu	37	15	34110876	34110876	+	Missense_Mutation	SNP	C	C	T	rs373357553		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr15:34110876C>T	ENST00000389232.4	+	76	10767	c.10697C>T	c.(10696-10698)aCg>aTg	p.T3566M	RYR3_ENST00000415757.3_Missense_Mutation_p.T3561M	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3566					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AACGCTCTCACGGAGAGGAGG	0.517																																																	0								C	MET/THR	0,4124		0,0,2062	86.0	90.0	89.0		10697	5.0	1.0	15		89	1,8403		0,1,4201	no	missense	RYR3	NM_001036.3	81	0,1,6263	TT,TC,CC		0.0119,0.0,0.0080	possibly-damaging	3566/4871	34110876	1,12527	2062	4202	6264	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.10697C>T	15.37:g.34110876C>T	ENSP00000373884:p.Thr3566Met		O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_hand_dom,pfscan_MIR_motif	p.T3566M	ENST00000389232.4	37	c.10697	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	C	24.4	4.531530	0.85706	0.0	1.19E-4	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D	0.97016	-4.21	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	D	0.97898	0.9309	M	0.75615	2.305	0.58432	D	0.999999	D;D	0.89917	1.0;0.977	D;P	0.76071	0.987;0.556	D	0.98260	1.0498	10	0.56958	D	0.05	.	18.4574	0.90725	0.0:1.0:0.0:0.0	.	3561;3566	Q15413-2;Q15413	.;RYR3_HUMAN	M	3566;3565;3561	ENSP00000373884:T3566M	ENSP00000354735:T3561M	T	+	2	0	RYR3	31898168	1.000000	0.71417	0.979000	0.43373	0.994000	0.84299	5.562000	0.67346	2.593000	0.87608	0.655000	0.94253	ACG	RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.517	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	-	0.00	43	0	C			34110876	+1	tier1	-	no_errors	ENST00000389232	ensembl	human	known	74_37	missense	18.75	26	6	SNP	1.000	T
SCAF11	9169	genome.wustl.edu	37	12	46322278	46322278	+	Silent	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:46322278G>A	ENST00000369367.3	-	11	1439	c.1206C>T	c.(1204-1206)tcC>tcT	p.S402S	SCAF11_ENST00000549162.1_Silent_p.S210S|SCAF11_ENST00000419565.2_Silent_p.S402S|SCAF11_ENST00000465950.1_Silent_p.S87S	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	402					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						CTGAATCATTGGAAGATGATT	0.418																																																	0													124.0	117.0	120.0					12																	46322278		2203	4300	6503	SO:0001819	synonymous_variant	0			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.1206C>T	12.37:g.46322278G>A			A6NEU9|A6NLW5|Q8IW59	Silent	SNP	smart_Znf_RING,pfscan_Znf_RING	p.S402	ENST00000369367.3	37	c.1206	CCDS8748.2	12																																																																																			SCAF11	-	NULL	ENSG00000139218		0.418	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF11	HGNC	protein_coding	OTTHUMT00000313992.2		0.00	63	0	G	NM_004719		46322278	-1			no_errors	ENST00000369367	ensembl	human	known	74_37	silent	5.08	56	3	SNP	0.984	A
ZBED9	114821	genome.wustl.edu	37	6	28543320	28543320	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:28543320C>T	ENST00000452236.2	-	3	1779	c.1162G>A	c.(1162-1164)Ggg>Agg	p.G388R	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1												p.G388W(1)		NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						CTGTACTCCCCATCAGGATTC	0.348																																																	1	Substitution - Missense(1)	lung(1)											75.0	79.0	78.0					6																	28543320		2203	4300	6503	SO:0001583	missense	0																														ENST00000452236.2:c.1162G>A	6.37:g.28543320C>T	ENSP00000395259:p.Gly388Arg			Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC_dom_C,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.G388R	ENST00000452236.2	37	c.1162	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	C	17.48	3.401398	0.62288	.	.	ENSG00000232040	ENST00000452236	T	0.01647	4.71	3.45	3.45	0.39498	Integrase, catalytic core (2);Ribonuclease H-like (1);	0.263231	0.24209	N	0.040547	T	0.03871	0.0109	L	0.60455	1.87	0.32117	N	0.588585	D	0.89917	1.0	D	0.87578	0.998	T	0.06023	-1.0850	10	0.87932	D	0	.	12.821	0.57694	0.0:1.0:0.0:0.0	.	388	Q6R2W3	SCND3_HUMAN	R	388	ENSP00000395259:G388R	ENSP00000395259:G388R	G	-	1	0	SCAND3	28651299	0.996000	0.38824	1.000000	0.80357	0.974000	0.67602	1.814000	0.38972	1.935000	0.56089	0.655000	0.94253	GGG	SCAND3	-	pfam_Integrase_cat-core,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	ENSG00000232040		0.348	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	HGNC	protein_coding	OTTHUMT00000043551.3	-	0.00	48	0	C			28543320	-1	tier1	-	no_errors	ENST00000452236	ensembl	human	known	74_37	missense	85.71	7	42	SNP	1.000	T
SCN4B	6330	genome.wustl.edu	37	11	118015906	118015906	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:118015906A>G	ENST00000324727.4	-	2	246	c.100T>C	c.(100-102)Tct>Cct	p.S34P	SCN4B_ENST00000529878.1_Intron|SCN4B_ENST00000423160.2_5'Flank	NM_001142349.1|NM_174934.3	NP_001135821.1|NP_777594.1	Q8IWT1	SCN4B_HUMAN	sodium channel, voltage-gated, type IV, beta subunit	34	Ig-like C2-type.				AV node cell to bundle of His cell communication (GO:0086067)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|voltage-gated sodium channel complex (GO:0001518)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.33e-05)|Epithelial(105;0.00126)	Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTCCCACAGACACCTCCAGC	0.597											OREG0021380	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													133.0	112.0	119.0					11																	118015906		2200	4296	6496	SO:0001583	missense	0			AY149967	CCDS8389.1, CCDS44744.1	11q23.3	2014-09-17	2012-02-28		ENSG00000177098	ENSG00000177098		"""Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	10592	protein-coding gene	gene with protein product		608256	"""sodium channel, voltage-gated, type IV, beta"""				Standard	NM_174934		Approved	LQT10	uc001pse.3	Q8IWT1	OTTHUMG00000166994	ENST00000324727.4:c.100T>C	11.37:g.118015906A>G	ENSP00000322460:p.Ser34Pro	1485	E9PPT5|Q6PIG5	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.S34P	ENST00000324727.4	37	c.100	CCDS8389.1	11	.	.	.	.	.	.	.	.	.	.	A	22.8	4.333750	0.81801	.	.	ENSG00000177098	ENST00000324727	D	0.97976	-4.64	5.26	5.26	0.73747	Immunoglobulin-like (1);	0.467692	0.22803	N	0.055457	D	0.97876	0.9302	M	0.61703	1.905	0.80722	D	1	D	0.55172	0.97	P	0.59424	0.857	D	0.97684	1.0174	10	0.41790	T	0.15	-15.5058	14.1995	0.65693	1.0:0.0:0.0:0.0	.	34	Q8IWT1	SCN4B_HUMAN	P	34	ENSP00000322460:S34P	ENSP00000322460:S34P	S	-	1	0	SCN4B	117521116	0.994000	0.37717	0.997000	0.53966	0.979000	0.70002	3.082000	0.50128	1.986000	0.57962	0.529000	0.55759	TCT	SCN4B	-	pfscan_Ig-like_dom	ENSG00000177098		0.597	SCN4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN4B	HGNC	protein_coding	OTTHUMT00000392326.1	-	0.00	39	0	A			118015906	-1	tier1	-	no_errors	ENST00000324727	ensembl	human	known	74_37	missense	64.29	15	27	SNP	0.999	G
SCN5A	6331	genome.wustl.edu	37	3	38674551	38674551	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:38674551A>G	ENST00000333535.4	-	2	397	c.248T>C	c.(247-249)cTg>cCg	p.L83P	SCN5A_ENST00000413689.1_Missense_Mutation_p.L83P|SCN5A_ENST00000449557.2_Missense_Mutation_p.L83P|SCN5A_ENST00000450102.2_Missense_Mutation_p.L83P|SCN5A_ENST00000443581.1_Missense_Mutation_p.L83P|SCN5A_ENST00000455624.2_Missense_Mutation_p.L83P|SCN5A_ENST00000423572.2_Missense_Mutation_p.L83P|SCN5A_ENST00000414099.2_Missense_Mutation_p.L83P|SCN5A_ENST00000425664.1_Missense_Mutation_p.L83P|SCN5A_ENST00000451551.2_Missense_Mutation_p.L83P			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	83					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	GAAGGGGTCCAGGTCCTCCAG	0.607																																																	0													45.0	48.0	47.0					3																	38674551		1925	4154	6079	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.248T>C	3.37:g.38674551A>G	ENSP00000328968:p.Leu83Pro		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.L83P	ENST00000333535.4	37	c.248	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	A	18.76	3.691959	0.68271	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.97066	-4.1;-4.15;-4.16;-4.17;-4.15;-4.1;-4.15;-4.23;-4.17;-4.16	4.73	3.54	0.40534	.	0.251926	0.34531	N	0.003885	D	0.97371	0.9140	L	0.53671	1.685	0.58432	D	0.999994	P;D;P;P;D;P	0.76494	0.799;0.994;0.911;0.911;0.999;0.946	B;P;P;P;D;P	0.70935	0.424;0.832;0.521;0.521;0.971;0.714	D	0.97128	0.9816	10	0.87932	D	0	.	11.495	0.50402	0.8492:0.1508:0.0:0.0	.	83;83;83;83;83;83	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	P	83	ENSP00000398962:L83P;ENSP00000398266:L83P;ENSP00000410257:L83P;ENSP00000388797:L83P;ENSP00000397915:L83P;ENSP00000416634:L83P;ENSP00000328968:L83P;ENSP00000399524:L83P;ENSP00000403355:L83P;ENSP00000413996:L83P	ENSP00000328968:L83P	L	-	2	0	SCN5A	38649555	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.065000	0.93941	0.808000	0.34231	0.402000	0.26972	CTG	SCN5A	-	NULL	ENSG00000183873		0.607	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	-	0.00	75	0	A	NM_198056		38674551	-1	tier1	-	no_errors	ENST00000333535	ensembl	human	known	74_37	missense	6.15	61	4	SNP	1.000	G
SEC14L5	9717	genome.wustl.edu	37	16	5058463	5058463	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:5058463G>A	ENST00000251170.7	+	14	1794	c.1614G>A	c.(1612-1614)tgG>tgA	p.W538*	RP11-165E7.1_ENST00000588778.1_RNA	NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	538	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						TCATCACCTGGGACTTTGACA	0.667																																																	0													37.0	43.0	41.0					16																	5058463		2063	4191	6254	SO:0001587	stop_gained	0			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.1614G>A	16.37:g.5058463G>A	ENSP00000251170:p.Trp538*			Nonsense_Mutation	SNP	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1,prints_CRAL-bd_toc_tran	p.W538*	ENST00000251170.7	37	c.1614	CCDS45403.1	16	.	.	.	.	.	.	.	.	.	.	g	40	8.050408	0.98629	.	.	ENSG00000103184	ENST00000251170	.	.	.	4.65	4.65	0.58169	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.9978	17.7099	0.88319	0.0:0.0:1.0:0.0	.	.	.	.	X	538	.	ENSP00000251170:W538X	W	+	3	0	SEC14L5	4998464	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	9.148000	0.94652	2.426000	0.82243	0.556000	0.70494	TGG	SEC14L5	-	superfamily_GOLD,pfscan_GOLD	ENSG00000103184		0.667	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	HGNC	protein_coding	OTTHUMT00000434379.1		0.00	32	0	G			5058463	+1			no_errors	ENST00000251170	ensembl	human	known	74_37	nonsense	10.34	26	3	SNP	1.000	A
SCNN1G	6340	genome.wustl.edu	37	16	23200778	23200778	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:23200778G>A	ENST00000300061.2	+	3	547	c.404G>A	c.(403-405)cGg>cAg	p.R135Q		NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	135					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	CCAGAGTCCCGGAAGCGCCGA	0.582																																																	0													83.0	93.0	89.0					16																	23200778		2197	4300	6497	SO:0001583	missense	0			U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.404G>A	16.37:g.23200778G>A	ENSP00000300061:p.Arg135Gln		P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.R135Q	ENST00000300061.2	37	c.404	CCDS10608.1	16	.	.	.	.	.	.	.	.	.	.	G	10.19	1.282894	0.23392	.	.	ENSG00000166828	ENST00000300061	T	0.62941	-0.01	5.75	5.75	0.90469	.	0.000000	0.47093	D	0.000248	T	0.38241	0.1033	N	0.14661	0.345	0.28172	N	0.928541	B	0.31193	0.312	B	0.23275	0.045	T	0.24297	-1.0164	10	0.12430	T	0.62	-12.7517	10.2237	0.43212	0.0936:0.0:0.9064:0.0	.	135	P51170	SCNNG_HUMAN	Q	135	ENSP00000300061:R135Q	ENSP00000300061:R135Q	R	+	2	0	SCNN1G	23108279	0.899000	0.30636	0.892000	0.35008	0.094000	0.18550	2.525000	0.45598	2.721000	0.93114	0.511000	0.50034	CGG	SCNN1G	-	pfam_Na+channel_ASC,tigrfam_EnaC	ENSG00000166828		0.582	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCNN1G	HGNC	protein_coding	OTTHUMT00000254496.1	-	0.00	41	0	G	NM_001039		23200778	+1	tier1	-	no_errors	ENST00000300061	ensembl	human	known	74_37	missense	33.33	26	13	SNP	0.711	A
SEMA6A	57556	genome.wustl.edu	37	5	115823894	115823894	+	Splice_Site	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:115823894T>G	ENST00000343348.6	-	9	1443		c.e9-2		CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000510263.1_Splice_Site|SEMA6A_ENST00000257414.8_Splice_Site|CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000508640.1_RNA|SEMA6A_ENST00000503962.1_5'Flank	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A						apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		AGTATGGTTCTGTAGACAAAC	0.383																																																	0													77.0	70.0	72.0					5																	115823894		1863	4111	5974	SO:0001630	splice_region_variant	0			AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.656-2A>C	5.37:g.115823894T>G			Q9P2H9	Splice_Site	SNP	-	e8-2	ENST00000343348.6	37	c.656-2	CCDS47256.1	5	.	.	.	.	.	.	.	.	.	.	T	14.71	2.615522	0.46631	.	.	ENSG00000092421	ENST00000343348;ENST00000257414;ENST00000510263	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2215	0.82262	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEMA6A	115851793	1.000000	0.71417	0.999000	0.59377	0.446000	0.32137	7.997000	0.88414	2.367000	0.80283	0.528000	0.53228	.	SEMA6A	-	-	ENSG00000092421		0.383	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6A	HGNC	protein_coding	OTTHUMT00000371270.1	-	0.00	79	0	T	NM_020796	Intron	115823894	-1	tier1	-	no_errors	ENST00000257414	ensembl	human	known	74_37	splice_site	55.32	21	26	SNP	1.000	G
SERPINB13	5275	genome.wustl.edu	37	18	61259619	61259619	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr18:61259619A>C	ENST00000344731.5	+	4	365	c.263A>C	c.(262-264)aAg>aCg	p.K88T	SERPINB13_ENST00000269489.5_Missense_Mutation_p.K88T	NM_012397.3	NP_036529.1	Q9UIV8	SPB13_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 13	88					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						CAATTCCAAAAGTTTTTGACT	0.353																																																	0													106.0	98.0	101.0					18																	61259619		2203	4300	6503	SO:0001583	missense	0			AF169949, BC101821	CCDS11985.1	18q21.33	2014-02-18	2005-08-18		ENSG00000197641	ENSG00000197641		"""Serine (or cysteine) peptidase inhibitors"""	8944	protein-coding gene	gene with protein product		604445	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 13"""	PI13		9297979, 10512713, 24172014	Standard	NM_012397		Approved	HUR7, hurpin, headpin	uc002ljc.3	Q9UIV8	OTTHUMG00000060406	ENST00000344731.5:c.263A>C	18.37:g.61259619A>C	ENSP00000341584:p.Lys88Thr		A8K2Q8|Q3MII2|Q9HCX1|Q9UBW1|Q9UKG0	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.K88T	ENST00000344731.5	37	c.263	CCDS11985.1	18	.	.	.	.	.	.	.	.	.	.	A	9.214	1.031601	0.19590	.	.	ENSG00000197641	ENST00000431153;ENST00000269489;ENST00000344731	T;D;D	0.84944	-0.9;-1.92;-1.92	4.78	-2.11	0.07187	Serpin domain (3);	1.054840	0.07377	N	0.886837	T	0.76905	0.4053	L	0.43554	1.36	0.09310	N	1	B;B	0.27068	0.167;0.01	B;B	0.33690	0.168;0.018	T	0.60414	-0.7268	10	0.22706	T	0.39	.	3.07	0.06227	0.3997:0.3765:0.1134:0.1104	.	97;88	B7ZKV6;Q9UIV8	.;SPB13_HUMAN	T	118;88;88	ENSP00000388300:K118T;ENSP00000269489:K88T;ENSP00000341584:K88T	ENSP00000269489:K88T	K	+	2	0	SERPINB13	59410599	0.000000	0.05858	0.015000	0.15790	0.963000	0.63663	-2.128000	0.01314	-0.319000	0.08652	0.528000	0.53228	AAG	SERPINB13	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	ENSG00000197641		0.353	SERPINB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB13	HGNC	protein_coding	OTTHUMT00000133798.1	-	0.00	36	0	A	NM_012397		61259619	+1	tier1	-	no_errors	ENST00000344731	ensembl	human	known	74_37	missense	63.16	7	12	SNP	0.005	C
SFI1	9814	genome.wustl.edu	37	22	32000874	32000874	+	Missense_Mutation	SNP	G	G	A	rs567259192		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr22:32000874G>A	ENST00000400288.2	+	20	2102	c.1997G>A	c.(1996-1998)cGa>cAa	p.R666Q	SFI1_ENST00000540643.1_Missense_Mutation_p.R611Q|SFI1_ENST00000400289.1_Missense_Mutation_p.R584Q|SFI1_ENST00000432498.1_Missense_Mutation_p.R635Q|SFI1_ENST00000414585.1_Missense_Mutation_p.R513Q|SFI1_ENST00000443011.1_Missense_Mutation_p.R513Q|SFI1_ENST00000443326.1_Missense_Mutation_p.R584Q	NM_001007467.2	NP_001007468.1	A8K8P3	SFI1_HUMAN	Sfi1 homolog, spindle assembly associated (yeast)	666					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(2)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)	38						GGCAGGGTGCGAAGCATCCTC	0.637													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18358	0.0		0.0	False		,,,				2504	0.0																0													25.0	29.0	28.0					22																	32000874		1999	4182	6181	SO:0001583	missense	0			AB011114	CCDS43004.1, CCDS43005.1, CCDS58803.1, CCDS58804.1	22q12.2	2014-06-13			ENSG00000198089	ENSG00000198089			29064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 139"""	612765				14504268	Standard	NM_001007467		Approved	KIAA0542, PISD, PPP1R139	uc003ale.4	A8K8P3	OTTHUMG00000030249	ENST00000400288.2:c.1997G>A	22.37:g.32000874G>A	ENSP00000383145:p.Arg666Gln		A1L373|A1L387|A2A2L2|B1AKL9|B5MDB7|B7Z1V6|B7Z8G3|B7ZBE2|B7ZBE3|O60289|Q2TAN8|Q5W1B5|Q86TK0|Q8N4U8|Q8N8C1|Q8WU14	Missense_Mutation	SNP	superfamily_Cyclin-like	p.R666Q	ENST00000400288.2	37	c.1997	CCDS43004.1	22	.	.	.	.	.	.	.	.	.	.	G	1.434	-0.569371	0.03910	.	.	ENSG00000198089	ENST00000432498;ENST00000540643;ENST00000443326;ENST00000421060;ENST00000414585;ENST00000443011;ENST00000400289;ENST00000400288;ENST00000417682	T;T;T;T;T;T;T;T	0.29142	1.58;1.58;1.58;1.58;1.58;1.58;1.58;1.59	4.51	-4.29	0.03721	.	0.475716	0.21244	N	0.077764	T	0.09247	0.0228	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.34372	0.043;0.451;0.068;0.284;0.014;0.2	B;B;B;B;B;B	0.22880	0.021;0.042;0.007;0.035;0.01;0.034	T	0.42015	-0.9476	10	0.10377	T	0.69	.	10.3947	0.44194	0.7056:0.0:0.2944:0.0	.	611;584;584;635;666;642	A8K8P3-9;A8K8P3-10;A8K8P3-3;A8K8P3-2;A8K8P3;A8K8P3-5	.;.;.;.;SFI1_HUMAN;.	Q	635;611;584;642;513;513;584;666;249	ENSP00000402679:R635Q;ENSP00000443025:R611Q;ENSP00000416469:R584Q;ENSP00000397148:R513Q;ENSP00000401199:R513Q;ENSP00000383146:R584Q;ENSP00000383145:R666Q;ENSP00000398871:R249Q	ENSP00000383145:R666Q	R	+	2	0	SFI1	30330874	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-0.108000	0.10857	-0.593000	0.05844	-0.244000	0.11960	CGA	SFI1	-	superfamily_Cyclin-like	ENSG00000198089		0.637	SFI1-023	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFI1	HGNC	protein_coding	OTTHUMT00000337180.3	-	0.00	79	0	G	NM_014775		32000874	+1	tier1	-	no_errors	ENST00000400288	ensembl	human	known	74_37	missense	68.57	11	24	SNP	0.000	A
SFXN4	119559	genome.wustl.edu	37	10	120914684	120914684	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:120914684C>T	ENST00000355697.2	-	11	641	c.622G>A	c.(622-624)Gcc>Acc	p.A208T	SFXN4_ENST00000330036.6_Missense_Mutation_p.A199T|SFXN4_ENST00000461438.1_5'UTR	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	208					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		ATTCCACTGGCTTGCACTGTA	0.493																																																	0													96.0	86.0	90.0					10																	120914684		2203	4300	6503	SO:0001583	missense	0				CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.622G>A	10.37:g.120914684C>T	ENSP00000347924:p.Ala208Thr		Q6WSU4|Q86TD9	Missense_Mutation	SNP	pfam_Mtc	p.A208T	ENST00000355697.2	37	c.622	CCDS7610.1	10	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733833	0.48939	.	.	ENSG00000183605	ENST00000355697;ENST00000330036;ENST00000392875;ENST00000369131	T;T;T	0.55052	0.54;0.54;0.54	4.47	-5.52	0.02560	.	0.871005	0.09916	N	0.739113	T	0.41534	0.1163	L	0.29908	0.895	0.09310	N	1	P	0.37781	0.608	P	0.46885	0.53	T	0.49504	-0.8933	10	0.87932	D	0	-3.7305	4.4501	0.11616	0.1114:0.176:0.1205:0.5921	.	208	Q6P4A7	SFXN4_HUMAN	T	208;199;91;92	ENSP00000347924:A208T;ENSP00000333200:A199T;ENSP00000358127:A92T	ENSP00000333200:A199T	A	-	1	0	SFXN4	120904674	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.455000	0.02379	-0.940000	0.03705	-0.824000	0.03097	GCC	SFXN4	-	pfam_Mtc	ENSG00000183605		0.493	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN4	HGNC	protein_coding	OTTHUMT00000050642.3	-	0.00	47	0	C	XM_058406		120914684	-1	tier1	-	no_errors	ENST00000355697	ensembl	human	known	74_37	missense	27.59	21	8	SNP	0.000	T
SHPRH	257218	genome.wustl.edu	37	6	146264331	146264331	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:146264331T>A	ENST00000367505.2	-	9	2450	c.2186A>T	c.(2185-2187)cAg>cTg	p.Q729L	SHPRH_ENST00000275233.7_Missense_Mutation_p.Q729L|SHPRH_ENST00000438092.2_Missense_Mutation_p.Q729L|SHPRH_ENST00000367503.3_Missense_Mutation_p.Q729L			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	729	Helicase ATP-binding; second part. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		ATCCACCCACTGGTGACAGAT	0.473																																																	0													81.0	81.0	81.0					6																	146264331		1965	4149	6114	SO:0001583	missense	0			AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2186A>T	6.37:g.146264331T>A	ENSP00000356475:p.Gln729Leu		Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Histone_H1/H5_H15,superfamily_P-loop_NTPase,superfamily_Znf_FYVE_PHD,superfamily_WW_dom,smart_Helicase_ATP-bd,smart_Histone_H1/H5_H15,smart_Znf_PHD,smart_Znf_RING,smart_Helicase_C,pfscan_Znf_RING,pfscan_Helicase_C	p.Q729L	ENST00000367505.2	37	c.2186	CCDS43513.2	6	.	.	.	.	.	.	.	.	.	.	T	28.0	4.884542	0.91814	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233;ENST00000444767	D;D;D;D	0.96587	-4.06;-4.06;-4.06;-4.06	5.36	5.36	0.76844	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.64402	D	0.000001	D	0.98498	0.9499	M	0.93763	3.455	0.80722	D	1	D;D;D;D	0.89917	1.0;0.996;0.996;1.0	D;D;D;D	0.91635	0.996;0.962;0.936;0.999	D	0.99809	1.1040	10	0.87932	D	0	-18.0232	15.6522	0.77108	0.0:0.0:0.0:1.0	.	618;729;729;618	Q149N8-2;Q149N8;Q149N8-4;F8WEL0	.;SHPRH_HUMAN;.;.	L	729;729;729;729;618	ENSP00000356475:Q729L;ENSP00000356473:Q729L;ENSP00000412797:Q729L;ENSP00000275233:Q729L	ENSP00000275233:Q729L	Q	-	2	0	SHPRH	146306024	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.970000	0.88000	2.167000	0.68274	0.528000	0.53228	CAG	SHPRH	-	pfam_SNF2_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd	ENSG00000146414		0.473	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHPRH	HGNC	protein_coding	OTTHUMT00000042571.2	-	0.00	29	0	T	NM_173082		146264331	-1	tier1	-	no_errors	ENST00000367503	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	A
SLC25A33	84275	genome.wustl.edu	37	1	9640067	9640067	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:9640067A>G	ENST00000302692.6	+	6	748	c.538A>G	c.(538-540)Acc>Gcc	p.T180A		NM_032315.2	NP_115691.1	Q9BSK2	S2533_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier), member 33	180					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(1)|lung(4)|prostate(1)|skin(1)	9	all_lung(157;0.246)	all_epithelial(116;1.16e-18)|all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Breast(348;0.00191)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.44e-05)|Kidney(185;0.000262)|KIRC - Kidney renal clear cell carcinoma(229;0.000957)|BRCA - Breast invasive adenocarcinoma(304;0.0019)|STAD - Stomach adenocarcinoma(132;0.00355)|READ - Rectum adenocarcinoma(331;0.0419)		CGTTTACCAGACCGAAGGCAT	0.418																																																	0													91.0	78.0	83.0					1																	9640067		2203	4300	6503	SO:0001583	missense	0			AF495714	CCDS103.1	1p36.22	2013-05-22	2012-03-29		ENSG00000171612	ENSG00000171612		"""Solute carriers"""	29681	protein-coding gene	gene with protein product		610816	"""solute carrier family 25, member 33"""			14715278, 16949250	Standard	XM_005263503		Approved	MGC4399, BMSC-MCP, PNC1	uc001apw.3	Q9BSK2	OTTHUMG00000001322	ENST00000302692.6:c.538A>G	1.37:g.9640067A>G	ENSP00000306328:p.Thr180Ala			Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.T180A	ENST00000302692.6	37	c.538	CCDS103.1	1	.	.	.	.	.	.	.	.	.	.	A	12.24	1.878569	0.33162	.	.	ENSG00000171612	ENST00000302692	T	0.78924	-1.22	5.66	4.51	0.55191	Mitochondrial carrier domain (2);	0.095043	0.64402	D	0.000001	T	0.66877	0.2834	L	0.41492	1.28	0.40555	D	0.981154	B	0.09022	0.002	B	0.15870	0.014	T	0.59075	-0.7522	10	0.13470	T	0.59	-17.5294	11.4561	0.50183	0.8651:0.0:0.0:0.1349	.	180	Q9BSK2	S2533_HUMAN	A	180	ENSP00000306328:T180A	ENSP00000306328:T180A	T	+	1	0	SLC25A33	9562654	1.000000	0.71417	0.943000	0.38184	0.643000	0.38383	6.018000	0.70811	1.043000	0.40175	0.533000	0.62120	ACC	SLC25A33	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000171612		0.418	SLC25A33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A33	HGNC	protein_coding	OTTHUMT00000003851.2	-	0.00	39	0	A	NM_032315		9640067	+1	tier1	-	no_errors	ENST00000302692	ensembl	human	known	74_37	missense	28.77	52	21	SNP	1.000	G
SLC35F1	222553	genome.wustl.edu	37	6	118556681	118556681	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:118556681A>C	ENST00000360388.4	+	3	560	c.359A>C	c.(358-360)aAc>aCc	p.N120T		NM_001029858.3	NP_001025029.2	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	120					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(3)|kidney(1)|large_intestine(7)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(226;0.217)		GGAGAAGAAAACCTCCTGGCA	0.358																																																	0													93.0	90.0	91.0					6																	118556681		2203	4300	6503	SO:0001583	missense	0			BC028615	CCDS34524.1	6q22.31	2013-05-22			ENSG00000196376	ENSG00000196376		"""Solute carriers"""	21483	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 169"""	C6orf169			Standard	NM_001029858		Approved	dJ230I3.1	uc003pxx.4	Q5T1Q4	OTTHUMG00000015460	ENST00000360388.4:c.359A>C	6.37:g.118556681A>C	ENSP00000353557:p.Asn120Thr		E1P564|Q1RMG1|Q4G0U9|Q4G167|Q6N007	Missense_Mutation	SNP	pfam_SLC35_F1/F2/F6,pfam_DMT	p.N120T	ENST00000360388.4	37	c.359	CCDS34524.1	6	.	.	.	.	.	.	.	.	.	.	A	10.83	1.462484	0.26248	.	.	ENSG00000196376	ENST00000360388	.	.	.	5.78	5.78	0.91487	.	0.217922	0.45126	D	0.000398	T	0.46889	0.1416	L	0.36672	1.1	0.54753	D	0.999988	B	0.30686	0.29	B	0.42593	0.392	T	0.47824	-0.9087	9	0.14252	T	0.57	.	16.3979	0.83621	1.0:0.0:0.0:0.0	.	120	Q5T1Q4	S35F1_HUMAN	T	120	.	ENSP00000353557:N120T	N	+	2	0	SLC35F1	118663374	1.000000	0.71417	1.000000	0.80357	0.153000	0.21895	6.920000	0.75799	2.333000	0.79357	0.533000	0.62120	AAC	SLC35F1	-	pfam_SLC35_F1/F2/F6,pfam_DMT	ENSG00000196376		0.358	SLC35F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F1	HGNC	protein_coding	OTTHUMT00000041991.2	-	0.00	81	0	A	XM_167044		118556681	+1	tier1	-	no_errors	ENST00000360388	ensembl	human	known	74_37	missense	33.33	50	25	SNP	1.000	C
SLC35F4	341880	genome.wustl.edu	37	14	58036551	58036551	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr14:58036551C>T	ENST00000339762.6	-	6	1188	c.1189G>A	c.(1189-1191)Gct>Act	p.A397T	SLC35F4_ENST00000554729.1_Missense_Mutation_p.A238T|SLC35F4_ENST00000556826.1_Missense_Mutation_p.A361T			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	397					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CATGGCAGAGCAGCAAAAGAG	0.502																																																	0													41.0	48.0	46.0					14																	58036551		2009	4184	6193	SO:0001583	missense	0					14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.1189G>A	14.37:g.58036551C>T	ENSP00000342518:p.Ala397Thr		A6NDQ3	Missense_Mutation	SNP	pfam_DMT,pfam_SLC35_F1/F2/F6	p.A397T	ENST00000339762.6	37	c.1189		14	.	.	.	.	.	.	.	.	.	.	C	12.96	2.093356	0.36952	.	.	ENSG00000151812	ENST00000556826;ENST00000339762;ENST00000554729	T;T;T	0.27557	1.66;1.66;1.66	6.01	6.01	0.97437	.	0.194877	0.56097	D	0.000034	T	0.27765	0.0683	L	0.38531	1.155	0.58432	D	0.999992	B	0.14012	0.009	B	0.13407	0.009	T	0.11203	-1.0597	10	0.11794	T	0.64	-2.2896	20.5211	0.99222	0.0:1.0:0.0:0.0	.	397	A4IF30	S35F4_HUMAN	T	361;397;238	ENSP00000452086:A361T;ENSP00000342518:A397T;ENSP00000451990:A238T	ENSP00000342518:A397T	A	-	1	0	SLC35F4	57106304	1.000000	0.71417	0.997000	0.53966	0.747000	0.42532	6.193000	0.72075	2.861000	0.98227	0.650000	0.86243	GCT	SLC35F4	-	pfam_SLC35_F1/F2/F6	ENSG00000151812		0.502	SLC35F4-201	KNOWN	basic	protein_coding	SLC35F4	HGNC	protein_coding		-	0.00	44	0	C	XM_292260		58036551	-1	tier1	-	no_errors	ENST00000339762	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
SLC46A3	283537	genome.wustl.edu	37	13	29275093	29275093	+	3'UTR	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr13:29275093T>A	ENST00000266943.6	-	0	2296				SLC46A3_ENST00000380814.4_Splice_Site_p.R461S|RNU6-53P_ENST00000365367.1_RNA|SLC46A3_ENST00000475385.1_5'UTR	NM_001135919.1|NM_181785.3	NP_001129391.1|NP_861450.1	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3						transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)	15		Lung SC(185;0.0367)		all cancers(112;0.159)		CTTAACAGGCTCTATAAAATA	0.299																																																	0													76.0	66.0	69.0					13																	29275093		692	1588	2280	SO:0001624	3_prime_UTR_variant	0				CCDS9332.1, CCDS45021.1	13q12.3	2013-05-22	2007-03-29		ENSG00000139508	ENSG00000139508		"""Solute carriers"""	27501	protein-coding gene	gene with protein product							Standard	NM_001135919		Approved	DKFZp686A1775, FLJ42613	uc001usj.3	Q7Z3Q1	OTTHUMG00000016650	ENST00000266943.6:c.*541A>T	13.37:g.29275093T>A			Q3ZCV8|Q6NUK5|Q6P9B3|Q6ZVG5|Q96QA1	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.R461S	ENST00000266943.6	37	c.1383	CCDS9332.1	13	.	.	.	.	.	.	.	.	.	.	T	17.47	3.397349	0.62177	.	.	ENSG00000139508	ENST00000380814	T	0.49432	0.78	4.76	4.76	0.60689	.	0.848976	0.10350	N	0.685202	T	0.37812	0.1017	.	.	.	0.09310	N	0.999999	B	0.11235	0.004	B	0.06405	0.002	T	0.17899	-1.0354	9	0.48119	T	0.1	.	10.8467	0.46746	0.0:0.0:0.0:1.0	.	461	Q7Z3Q1-2	.	S	461	ENSP00000370192:R461S	ENSP00000370192:R461S	R	-	3	2	SLC46A3	28173093	0.004000	0.15560	0.247000	0.24249	0.089000	0.18198	0.937000	0.28951	2.134000	0.65973	0.533000	0.62120	AGA	SLC46A3	-	NULL	ENSG00000139508		0.299	SLC46A3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC46A3	HGNC	protein_coding	OTTHUMT00000276111.1	-	0.00	73	0	T	NM_181785		29275093	-1	tier1	-	no_errors	ENST00000380814	ensembl	human	novel	74_37	missense	45.95	40	34	SNP	0.207	A
SLC5A12	159963	genome.wustl.edu	37	11	26705342	26705342	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:26705342A>C	ENST00000396005.3	-	11	1579	c.1270T>G	c.(1270-1272)Ttc>Gtc	p.F424V		NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	424					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						CCCAGGGAGAATAAGCCCAGC	0.522																																																	0													59.0	58.0	59.0					11																	26705342		1938	4154	6092	SO:0001583	missense	0			BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1270T>G	11.37:g.26705342A>C	ENSP00000379326:p.Phe424Val		Q86UC7	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.F424V	ENST00000396005.3	37	c.1270	CCDS7860.2	11	.	.	.	.	.	.	.	.	.	.	A	15.04	2.713888	0.48622	.	.	ENSG00000148942	ENST00000396005	D	0.87179	-2.22	5.59	5.59	0.84812	.	0.524198	0.16688	N	0.203648	D	0.95626	0.8578	H	0.97758	4.07	0.80722	D	1	D	0.59357	0.985	D	0.63113	0.911	D	0.96764	0.9563	10	0.87932	D	0	.	14.7404	0.69448	1.0:0.0:0.0:0.0	.	424	Q1EHB4	SC5AC_HUMAN	V	424	ENSP00000379326:F424V	ENSP00000379326:F424V	F	-	1	0	SLC5A12	26661918	1.000000	0.71417	0.956000	0.39512	0.107000	0.19398	7.278000	0.78587	2.117000	0.64856	0.533000	0.62120	TTC	SLC5A12	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000148942		0.522	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A12	HGNC	protein_coding	OTTHUMT00000319681.1	-	0.00	44	0	A	NM_178498		26705342	-1	tier1	-	no_errors	ENST00000396005	ensembl	human	known	74_37	missense	18.92	30	7	SNP	0.997	C
SLC6A11	6538	genome.wustl.edu	37	3	10864996	10864996	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:10864996T>G	ENST00000254488.2	+	4	608	c.542T>G	c.(541-543)gTg>gGg	p.V181G	SLC6A11_ENST00000454147.1_Missense_Mutation_p.V181G	NM_014229.1	NP_055044.1	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 11	181					brain development (GO:0007420)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter binding (GO:0042165)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(13)|ovary(1)|skin(4)	35				OV - Ovarian serous cystadenocarcinoma(96;0.229)	Clobazam(DB00349)	GAGAATTGTGTGGAGTTCCAG	0.433																																																	0													133.0	117.0	122.0					3																	10864996		2203	4300	6503	SO:0001583	missense	0			S75989	CCDS2602.1	3p25.3	2013-07-19	2013-07-19		ENSG00000132164	ENSG00000132164		"""Solute carriers"""	11044	protein-coding gene	gene with protein product	"""GABA transporter 3"""	607952	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 11"""			7874447	Standard	NM_014229		Approved	GAT3	uc003bvz.3	P48066	OTTHUMG00000129718	ENST00000254488.2:c.542T>G	3.37:g.10864996T>G	ENSP00000254488:p.Val181Gly		B2R6U6|Q8IYC9	Missense_Mutation	SNP	pfam_Na/ntran_symport,superfamily_S-AdoMet_deCO2ase_core,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT3	p.V181G	ENST00000254488.2	37	c.542	CCDS2602.1	3	.	.	.	.	.	.	.	.	.	.	T	17.95	3.514738	0.64634	.	.	ENSG00000132164	ENST00000254488;ENST00000454147	T;T	0.75589	-0.95;-0.95	5.81	5.81	0.92471	.	0.892285	0.09680	N	0.769871	T	0.80623	0.4658	M	0.85099	2.735	0.80722	D	1	B	0.10296	0.003	B	0.20577	0.03	T	0.73760	-0.3881	10	0.54805	T	0.06	.	16.1699	0.81801	0.0:0.0:0.0:1.0	.	181	P48066	S6A11_HUMAN	G	181	ENSP00000254488:V181G;ENSP00000404120:V181G	ENSP00000254488:V181G	V	+	2	0	SLC6A11	10839996	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.094000	0.71431	2.217000	0.71921	0.533000	0.62120	GTG	SLC6A11	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport	ENSG00000132164		0.433	SLC6A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A11	HGNC	protein_coding	OTTHUMT00000251927.1	-	0.00	94	0	T	NM_014229		10864996	+1	tier1	-	no_errors	ENST00000254488	ensembl	human	known	74_37	missense	30.30	46	20	SNP	1.000	G
SLC8A1	6546	genome.wustl.edu	37	2	40656313	40656313	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:40656313G>A	ENST00000403092.1	-	2	1141	c.1108C>T	c.(1108-1110)Cgc>Tgc	p.R370C	SLC8A1_ENST00000405901.3_Missense_Mutation_p.R370C|SLC8A1_ENST00000408028.2_Missense_Mutation_p.R370C|SLC8A1_ENST00000406391.2_Missense_Mutation_p.R370C|SLC8A1_ENST00000542756.1_Missense_Mutation_p.R370C|SLC8A1_ENST00000332839.4_Missense_Mutation_p.R370C|SLC8A1_ENST00000402441.1_Missense_Mutation_p.R370C|SLC8A1_ENST00000542024.1_Missense_Mutation_p.R370C|SLC8A1_ENST00000405269.1_Missense_Mutation_p.R370C|SLC8A1_ENST00000406785.2_Missense_Mutation_p.R370C			P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 1	370					blood coagulation (GO:0007596)|calcium ion export (GO:1901660)|calcium ion homeostasis (GO:0055074)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|cardiac muscle cell development (GO:0055013)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular response to caffeine (GO:0071313)|cellular response to reactive oxygen species (GO:0034614)|cellular sodium ion homeostasis (GO:0006883)|cytosolic calcium ion transport (GO:0060401)|embryonic heart tube development (GO:0035050)|embryonic placenta development (GO:0001892)|heart morphogenesis (GO:0003007)|ion transport (GO:0006811)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|muscle contraction (GO:0006936)|muscle fiber development (GO:0048747)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|post-embryonic development (GO:0009791)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|relaxation of smooth muscle (GO:0044557)|sodium ion export (GO:0071436)|sodium ion import (GO:0097369)|transmembrane transport (GO:0055085)|vascular smooth muscle contraction (GO:0014829)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|calcium:sodium antiporter activity (GO:0005432)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)	p.R370S(1)		NS(1)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|liver(1)|lung(57)|ovary(2)|pancreas(1)|skin(7)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(2)	100					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GTCATGAGGCGAGTAGCTTGA	0.428																																																	1	Substitution - Missense(1)	lung(1)											154.0	143.0	147.0					2																	40656313		2203	4300	6503	SO:0001583	missense	0				CCDS1806.1, CCDS46264.1, CCDS46265.1, CCDS59430.1	2p22.1	2013-07-15			ENSG00000183023	ENSG00000183023		"""Solute carriers"""	11068	protein-coding gene	gene with protein product	"""Na+/Ca++ exchanger"""	182305		NCX1		1559714	Standard	NM_021097		Approved		uc002rrx.3	P32418	OTTHUMG00000102183	ENST00000403092.1:c.1108C>T	2.37:g.40656313G>A	ENSP00000384763:p.Arg370Cys		A8K6N1|D6W595|O95849|Q4QQG6|Q587I6|Q59GN4|Q9UBL8|Q9UD55|Q9UDN1|Q9UDN2|Q9UKX6	Missense_Mutation	SNP	pfam_NaCa_Exmemb,pfam_Calx_beta,smart_Calx_beta,pfscan_DnaJ_domain,prints_Na_Ca_Ex,prints_NaCa_exhngr1,tigrfam_Na_Ca_Ex	p.R370C	ENST00000403092.1	37	c.1108	CCDS1806.1	2	.	.	.	.	.	.	.	.	.	.	G	17.89	3.499030	0.64298	.	.	ENSG00000183023	ENST00000406785;ENST00000378715;ENST00000542756;ENST00000403092;ENST00000405901;ENST00000402441;ENST00000405269;ENST00000332839;ENST00000408028;ENST00000535962;ENST00000406391;ENST00000542024	T;T;T;T;T;T;T;T;T;T	0.57273	0.44;0.49;0.47;0.49;0.44;0.44;0.47;0.41;0.44;0.44	6.17	5.3	0.74995	.	0.048922	0.85682	N	0.000000	T	0.77538	0.4145	M	0.91663	3.23	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.998;1.0;1.0;1.0	T	0.82878	-0.0239	10	0.87932	D	0	.	13.3312	0.60488	0.0754:0.0:0.9246:0.0	.	370;370;370;370;370	P32418-4;P32418-2;P32418-3;F6VPY9;P32418	.;.;.;.;NAC1_HUMAN	C	370	ENSP00000383886:R370C;ENSP00000440727:R370C;ENSP00000384763:R370C;ENSP00000385678:R370C;ENSP00000385188:R370C;ENSP00000385535:R370C;ENSP00000332931:R370C;ENSP00000384908:R370C;ENSP00000385811:R370C;ENSP00000443515:R370C	ENSP00000332931:R370C	R	-	1	0	SLC8A1	40509817	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.326000	0.72905	1.635000	0.50512	0.655000	0.94253	CGC	SLC8A1	-	tigrfam_Na_Ca_Ex	ENSG00000183023		0.428	SLC8A1-010	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC8A1	HGNC	protein_coding	OTTHUMT00000326065.1		0.00	57	0	G	NM_021097		40656313	-1			no_errors	ENST00000332839	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	A
SLITRK3	22865	genome.wustl.edu	37	3	164906581	164906581	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:164906581G>A	ENST00000475390.1	-	2	2481	c.2038C>T	c.(2038-2040)Cga>Tga	p.R680*	SLITRK3_ENST00000241274.3_Nonsense_Mutation_p.R680*			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	680					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						CGACGCCTTCGGAGCACGTAG	0.542										HNSCC(40;0.11)																																							0													64.0	57.0	59.0					3																	164906581		2203	4300	6503	SO:0001587	stop_gained	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2038C>T	3.37:g.164906581G>A	ENSP00000420091:p.Arg680*		Q1RMY6	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.R680*	ENST00000475390.1	37	c.2038	CCDS3197.1	3	.	.	.	.	.	.	.	.	.	.	G	40	8.326203	0.98762	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	.	.	.	5.0	1.87	0.25490	.	0.000000	0.32671	N	0.005790	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	-9.0705	12.7688	0.57408	0.0:0.0:0.4858:0.5141	.	.	.	.	X	680	.	ENSP00000241274:R680X	R	-	1	2	SLITRK3	166389275	0.802000	0.28943	0.206000	0.23566	0.492000	0.33523	1.914000	0.39966	0.726000	0.32339	0.655000	0.94253	CGA	SLITRK3	-	NULL	ENSG00000121871		0.542	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	-	0.00	22	0	G	NM_014926		164906581	-1	tier1	-	no_errors	ENST00000241274	ensembl	human	known	74_37	nonsense	18.18	36	8	SNP	0.548	A
SLITRK5	26050	genome.wustl.edu	37	13	88328307	88328307	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr13:88328307C>T	ENST00000325089.6	+	2	883	c.664C>T	c.(664-666)Cag>Tag	p.Q222*	SLITRK5_ENST00000400028.3_Intron	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	222					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)		p.Q222E(1)		breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GGGGCTCTTGCAGCACATGGA	0.493																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											71.0	74.0	73.0					13																	88328307		2203	4300	6503	SO:0001587	stop_gained	0			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.664C>T	13.37:g.88328307C>T	ENSP00000366283:p.Gln222*		B3KNB8|B4DSH5|Q5VT81	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.Q222*	ENST00000325089.6	37	c.664	CCDS9465.1	13	.	.	.	.	.	.	.	.	.	.	C	24.5	4.535019	0.85812	.	.	ENSG00000165300	ENST00000325089	.	.	.	5.79	5.79	0.91817	.	0.062750	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-15.7974	13.1564	0.59520	0.0:0.8397:0.1603:0.0	.	.	.	.	X	222	.	.	Q	+	1	0	SLITRK5	87126308	1.000000	0.71417	1.000000	0.80357	0.561000	0.35649	5.386000	0.66238	2.749000	0.94314	0.491000	0.48974	CAG	SLITRK5	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000165300		0.493	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK5	HGNC	protein_coding	OTTHUMT00000045416.3		0.00	60	0	C			88328307	+1			no_errors	ENST00000325089	ensembl	human	known	74_37	nonsense	5.41	35	2	SNP	1.000	T
SMARCA1	6594	genome.wustl.edu	37	X	128605259	128605259	+	Silent	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:128605259T>C	ENST00000371122.4	-	20	2616	c.2487A>G	c.(2485-2487)agA>agG	p.R829R	SMARCA1_ENST00000371121.3_Silent_p.R817R|SMARCA1_ENST00000371123.1_Silent_p.R817R	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	829					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						TTTGCTCTTCTCTTTGAGCCA	0.353																																																	0													141.0	130.0	134.0					X																	128605259		2203	4300	6503	SO:0001819	synonymous_variant	0			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.2487A>G	X.37:g.128605259T>C			Q5JV41|Q5JV42	Silent	SNP	pfam_SNF2_N,pfam_SLIDE,pfam_ISWI_HAND-dom,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,superfamily_ISWI_HAND-dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_SANT/Myb,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R829	ENST00000371122.4	37	c.2487	CCDS14612.1	X																																																																																			SMARCA1	-	pfam_ISWI_HAND-dom,superfamily_ISWI_HAND-dom	ENSG00000102038		0.353	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCA1	HGNC	protein_coding	OTTHUMT00000058206.1		0.00	44	0	T	NM_003069		128605259	-1			no_errors	ENST00000371122	ensembl	human	known	74_37	silent	5.36	53	3	SNP	1.000	C
SMTNL1	219537	genome.wustl.edu	37	11	57310453	57310453	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:57310453G>A	ENST00000399154.2	+	1	338	c.338G>A	c.(337-339)gGc>gAc	p.G113D	SMTNL1_ENST00000527972.1_Missense_Mutation_p.G113D|SMTNL1_ENST00000457912.1_Missense_Mutation_p.G131D			A8MU46	SMTL1_HUMAN	smoothelin-like 1	113	Glu-rich.				negative regulation of vasodilation (GO:0045908)|positive regulation of vasoconstriction (GO:0045907)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(4)|ovary(1)	8						GAGATGACTGGCAGGAAAGAA	0.522																																																	0													39.0	40.0	40.0					11																	57310453		1976	4172	6148	SO:0001583	missense	0			BX116227		11q12.1	2006-02-02				ENSG00000214872			32394	protein-coding gene	gene with protein product	"""calponin homology-associated smooth muscle protein"""	613664				15327999	Standard	NM_001105565		Approved	CHASM	uc021qjh.1	A8MU46		ENST00000399154.2:c.338G>A	11.37:g.57310453G>A	ENSP00000382108:p.Gly113Asp			Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.G131D	ENST00000399154.2	37	c.392		11	.	.	.	.	.	.	.	.	.	.	G	1.635	-0.517885	0.04171	.	.	ENSG00000214872	ENST00000457912;ENST00000527972;ENST00000399154	T;T;T	0.02498	4.35;4.35;4.27	4.64	-4.33	0.03677	.	0.700299	0.10944	N	0.616851	T	0.01189	0.0039	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47156	-0.9139	10	0.10111	T	0.7	-0.431	3.9606	0.09409	0.233:0.1384:0.493:0.1356	.	131	C9J621	.	D	131;113;113	ENSP00000406485:G131D;ENSP00000432651:G113D;ENSP00000382108:G113D	ENSP00000382108:G113D	G	+	2	0	SMTNL1	57067029	0.000000	0.05858	0.000000	0.03702	0.069000	0.16628	-0.310000	0.08135	-1.102000	0.03023	-0.345000	0.07892	GGC	SMTNL1	-	NULL	ENSG00000214872		0.522	SMTNL1-201	KNOWN	basic|appris_candidate	protein_coding	SMTNL1	HGNC	protein_coding		-	0.00	21	0	G	XM_166203		57310453	+1	tier1	-	no_errors	ENST00000457912	ensembl	human	known	74_37	missense	16.22	31	6	SNP	0.000	A
SNX13	23161	genome.wustl.edu	37	7	17855816	17855816	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:17855816C>T	ENST00000409389.1	-	19	2147	c.1975G>A	c.(1975-1977)Gca>Aca	p.A659T	SNX13_ENST00000428135.3_Missense_Mutation_p.A648T|SNX13_ENST00000496855.1_5'UTR			Q9Y5W8	SNX13_HUMAN	sorting nexin 13	659	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				intracellular protein transport (GO:0006886)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	early endosome (GO:0005769)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(13)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38	Lung NSC(10;0.0261)|all_lung(11;0.0521)					TGCAAATATGCATTTAGATCC	0.289																																																	0													56.0	54.0	55.0					7																	17855816		1670	3808	5478	SO:0001583	missense	0			AF420470	CCDS47551.1	7p21.1	2008-03-11			ENSG00000071189	ENSG00000071189		"""Sorting nexins"""	21335	protein-coding gene	gene with protein product		606589				11485546, 11729322	Standard	NM_015132		Approved	RGS-PX1, KIAA0713	uc003stv.3	Q9Y5W8	OTTHUMG00000152730	ENST00000409389.1:c.1975G>A	7.37:g.17855816C>T	ENSP00000386705:p.Ala659Thr		B2RCI9|O94821|Q8WVZ2|Q8WXH8	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Phox,pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_Phox,superfamily_Cyt_c_oxidase_su5A/6,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal_superfam,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal_superfam	p.A648T	ENST00000409389.1	37	c.1942		7	.	.	.	.	.	.	.	.	.	.	C	19.91	3.915040	0.72983	.	.	ENSG00000071189	ENST00000409389;ENST00000428135;ENST00000242044	T;T	0.39997	1.05;1.05	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.36744	0.0978	N	0.25060	0.705	0.80722	D	1	P;B;P	0.48089	0.87;0.153;0.905	P;B;B	0.45753	0.492;0.18;0.359	T	0.03773	-1.1005	10	0.19590	T	0.45	-13.4562	19.0833	0.93192	0.0:1.0:0.0:0.0	.	445;659;648	B3KN60;B8ZZT9;Q9Y5W8-2	.;.;.	T	659;648;696	ENSP00000386705:A659T;ENSP00000398789:A648T	ENSP00000242044:A696T	A	-	1	0	SNX13	17822341	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.289000	0.59013	2.753000	0.94483	0.467000	0.42956	GCA	SNX13	-	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000071189		0.289	SNX13-002	NOVEL	basic|exp_conf	protein_coding	SNX13	HGNC	protein_coding	OTTHUMT00000327608.1	-	0.00	82	0	C	NM_015132		17855816	-1	tier1	-	no_errors	ENST00000428135	ensembl	human	known	74_37	missense	40.91	39	27	SNP	1.000	T
SNX29	92017	genome.wustl.edu	37	16	12662432	12662432	+	Silent	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:12662432C>T	ENST00000566228.1	+	21	2457	c.2388C>T	c.(2386-2388)tcC>tcT	p.S796S	CTD-3037G24.3_ENST00000564505.1_RNA|SNX29_ENST00000306030.3_Silent_p.S411S	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29	796						extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						CCAAACTGTCCCGGGGTCAGC	0.657																																																	0													27.0	35.0	32.0					16																	12662432		1966	4185	6151	SO:0001819	synonymous_variant	0			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.2388C>T	16.37:g.12662432C>T			B5MDW2|Q8N2X2|Q9HA26	Silent	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.S411	ENST00000566228.1	37	c.1233	CCDS10553.2	16																																																																																			SNX29	-	NULL	ENSG00000048471		0.657	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SNX29	HGNC	protein_coding	OTTHUMT00000422622.1	-	0.00	91	0	C			12662432	+1	tier1	-	no_errors	ENST00000306030	ensembl	human	known	74_37	silent	8.97	71	7	SNP	1.000	T
SP4	6671	genome.wustl.edu	37	7	21470141	21470141	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:21470141A>G	ENST00000222584.3	+	3	1576	c.1358A>G	c.(1357-1359)cAg>cGg	p.Q453R		NM_003112.3	NP_003103.2	Q02446	SP4_HUMAN	Sp4 transcription factor	453					regulation of heart contraction (GO:0008016)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	35						AATCCGACTCAGGTGCTTATC	0.448																																																	0													147.0	147.0	147.0					7																	21470141		2203	4300	6503	SO:0001583	missense	0				CCDS5373.1	7p15	2013-01-08			ENSG00000105866	ENSG00000105866		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11209	protein-coding gene	gene with protein product		600540				1454515	Standard	XM_005249828		Approved	SPR-1, HF1B, MGC130008, MGC130009	uc003sva.3	Q02446	OTTHUMG00000094801	ENST00000222584.3:c.1358A>G	7.37:g.21470141A>G	ENSP00000222584:p.Gln453Arg		O60402|Q32M52	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q453R	ENST00000222584.3	37	c.1358	CCDS5373.1	7	.	.	.	.	.	.	.	.	.	.	A	16.77	3.216022	0.58452	.	.	ENSG00000105866	ENST00000222584	T	0.10668	2.85	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.22859	0.0552	L	0.51422	1.61	0.80722	D	1	P	0.45126	0.851	P	0.55391	0.775	T	0.00385	-1.1773	10	0.52906	T	0.07	.	14.7047	0.69179	1.0:0.0:0.0:0.0	.	453	Q02446	SP4_HUMAN	R	453	ENSP00000222584:Q453R	ENSP00000222584:Q453R	Q	+	2	0	SP4	21436666	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.809000	0.75211	2.054000	0.61138	0.460000	0.39030	CAG	SP4	-	NULL	ENSG00000105866		0.448	SP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP4	HGNC	protein_coding	OTTHUMT00000211617.2	-	0.00	61	0	A	NM_003112		21470141	+1	tier1	-	no_errors	ENST00000222584	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	G
SPEF2	79925	genome.wustl.edu	37	5	35654807	35654807	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:35654807delA	ENST00000356031.3	+	7	1111	c.957delA	c.(955-957)ttafs	p.L319fs	SPEF2_ENST00000440995.2_Frame_Shift_Del_p.L319fs|SPEF2_ENST00000509059.1_Frame_Shift_Del_p.L319fs|SPEF2_ENST00000282469.6_Frame_Shift_Del_p.L319fs	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	319					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TGGACCAGTTAATAGCCCACG	0.378																																																	0													72.0	70.0	70.0					5																	35654807		2203	4300	6503	SO:0001589	frameshift_variant	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.957delA	5.37:g.35654807delA	ENSP00000348314:p.Leu319fs		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Frame_Shift_Del	DEL	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.I320fs	ENST00000356031.3	37	c.957	CCDS43309.1	5																																																																																			SPEF2	-	NULL	ENSG00000152582		0.378	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1		0.00	69	0	A	NM_144722		35654807	+1	tier1		no_errors	ENST00000356031	ensembl	human	known	74_37	frame_shift_del	23.21	43	13	DEL	0.988	-
SPEF2	79925	genome.wustl.edu	37	5	35654810	35654811	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:35654810_35654811delAG	ENST00000356031.3	+	7	1114_1115	c.960_961delAG	c.(958-963)atagccfs	p.A321fs	SPEF2_ENST00000440995.2_Frame_Shift_Del_p.A321fs|SPEF2_ENST00000509059.1_Frame_Shift_Del_p.A321fs|SPEF2_ENST00000282469.6_Frame_Shift_Del_p.A321fs	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	321					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ACCAGTTAATAGCCCACGAAGC	0.371																																																	0																																										SO:0001589	frameshift_variant	0			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.960_961delAG	5.37:g.35654810_35654811delAG	ENSP00000348314:p.Ala321fs		Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Frame_Shift_Del	DEL	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC_dom_C,superfamily_P-loop_NTPase,superfamily_CH-domain,pfscan_CH-domain	p.A321fs	ENST00000356031.3	37	c.960_961	CCDS43309.1	5																																																																																			SPEF2	-	NULL	ENSG00000152582		0.371	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1		0.00	71	0	AG	NM_144722		35654811	+1	tier1		no_errors	ENST00000356031	ensembl	human	known	74_37	frame_shift_del	24.53	40	13	DEL	0.999:1.000	-
SPNS2	124976	genome.wustl.edu	37	17	4439393	4439393	+	Missense_Mutation	SNP	G	G	C	rs373813846		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:4439393G>C	ENST00000329078.3	+	10	1577	c.1367G>C	c.(1366-1368)cGc>cCc	p.R456P		NM_001124758.1	NP_001118230.1	Q8IVW8	SPNS2_HUMAN	spinster homolog 2 (Drosophila)	456					B cell homeostasis (GO:0001782)|bone development (GO:0060348)|lymph node development (GO:0048535)|lymphocyte migration (GO:0072676)|regulation of eye pigmentation (GO:0048073)|regulation of humoral immune response (GO:0002920)|sphingolipid metabolic process (GO:0006665)|sphingosine-1-phosphate signaling pathway (GO:0003376)|T cell homeostasis (GO:0043029)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	sphingolipid transporter activity (GO:0046624)			large_intestine(3)|lung(1)|prostate(1)|skin(1)	6						CCCACGCGGCGCGCCACTGCC	0.701																																																	0													28.0	27.0	27.0					17																	4439393		1567	3579	5146	SO:0001583	missense	0			BC041772	CCDS42237.1	17p13.2	2008-12-15				ENSG00000183018			26992	protein-coding gene	gene with protein product		612584				12815463	Standard	NM_001124758		Approved		uc002fxx.2	Q8IVW8		ENST00000329078.3:c.1367G>C	17.37:g.4439393G>C	ENSP00000333292:p.Arg456Pro		B9A1T3	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.R456P	ENST00000329078.3	37	c.1367	CCDS42237.1	17	.	.	.	.	.	.	.	.	.	.	G	22.3	4.265835	0.80358	.	.	ENSG00000183018	ENST00000329078	T	0.64260	-0.09	5.13	5.13	0.70059	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.82724	0.5099	M	0.90369	3.11	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.86175	0.1602	10	0.87932	D	0	.	16.1249	0.81386	0.0:0.0:1.0:0.0	.	456	Q8IVW8	SPNS2_HUMAN	P	456	ENSP00000333292:R456P	ENSP00000333292:R456P	R	+	2	0	SPNS2	4386142	1.000000	0.71417	0.958000	0.39756	0.284000	0.27059	7.463000	0.80869	2.667000	0.90743	0.563000	0.77884	CGC	SPNS2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000183018		0.701	SPNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPNS2	HGNC	protein_coding	OTTHUMT00000438802.1	-	0.00	22	0	G			4439393	+1	tier1	-	no_errors	ENST00000329078	ensembl	human	known	74_37	missense	22.73	15	5	SNP	1.000	C
SRPX	8406	genome.wustl.edu	37	X	38031202	38031202	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:38031202A>C	ENST00000378533.3	-	4	564	c.458T>G	c.(457-459)tTg>tGg	p.L153W	SRPX_ENST00000343800.6_Missense_Mutation_p.L140W|SRPX_ENST00000538295.1_Missense_Mutation_p.L153W|SRPX_ENST00000432886.2_Intron|SRPX_ENST00000544439.1_Missense_Mutation_p.L133W|TM4SF2_ENST00000465127.1_Intron	NM_006307.4	NP_006298.1	P78539	SRPX_HUMAN	sushi-repeat containing protein, X-linked	153	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				autophagy (GO:0006914)|cell adhesion (GO:0007155)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|phagolysosome assembly (GO:0001845)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|response to endoplasmic reticulum stress (GO:0034976)	autophagic vacuole (GO:0005776)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				autonomic_ganglia(1)|breast(2)|endometrium(5)|large_intestine(5)|lung(10)|prostate(2)	25						CTCCCCTTTCAACGTGTATCC	0.532																																																	0													111.0	92.0	99.0					X																	38031202		2202	4300	6502	SO:0001583	missense	0			U78093	CCDS14245.1, CCDS55400.1, CCDS55401.1, CCDS55402.1	Xp21.1	2011-01-25	2011-01-25		ENSG00000101955	ENSG00000101955			11309	protein-coding gene	gene with protein product		300187	"""sushi-repeat-containing protein, X chromosome"", ""sushi-repeat-containing protein, X-linked"""			8634708, 8634709	Standard	NM_006307		Approved	ETX1	uc004ddy.2	P78539	OTTHUMG00000021362	ENST00000378533.3:c.458T>G	X.37:g.38031202A>C	ENSP00000367794:p.Leu153Trp		A8K065|B3KWP8|B4DDB8|B4DQH5|F5H4D7|G3V1L0|Q4VX66|Q99652|Q99913	Missense_Mutation	SNP	pfam_Hyalin,pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Hyalin,pfscan_Sushi_SCR_CCP	p.L153W	ENST00000378533.3	37	c.458	CCDS14245.1	X	.	.	.	.	.	.	.	.	.	.	A	26.1	4.708739	0.89018	.	.	ENSG00000101955	ENST00000544439;ENST00000538295;ENST00000378533;ENST00000343800	T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54	5.86	5.86	0.93980	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.90072	0.6899	H	0.98005	4.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.991;0.999;1.0	D	0.93421	0.6777	10	0.66056	D	0.02	-11.9434	15.1285	0.72500	1.0:0.0:0.0:0.0	.	153;133;153	F5H4D7;G3V1L0;P78539	.;.;SRPX_HUMAN	W	133;153;153;140	ENSP00000440758:L133W;ENSP00000445034:L153W;ENSP00000367794:L153W;ENSP00000339211:L140W	ENSP00000339211:L140W	L	-	2	0	SRPX	37916146	1.000000	0.71417	0.909000	0.35828	0.981000	0.71138	8.917000	0.92751	1.955000	0.56771	0.486000	0.48141	TTG	SRPX	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000101955		0.532	SRPX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPX	HGNC	protein_coding	OTTHUMT00000056243.1	-	0.00	45	0	A	NM_006307		38031202	-1	tier1	-	no_errors	ENST00000378533	ensembl	human	known	74_37	missense	89.66	3	26	SNP	0.997	C
ST3GAL5	8869	genome.wustl.edu	37	2	86073588	86073588	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:86073588T>C	ENST00000377332.3	-	5	869	c.761A>G	c.(760-762)gAa>gGa	p.E254G	ST3GAL5_ENST00000393808.3_Missense_Mutation_p.E231G|ST3GAL5_ENST00000393805.1_Missense_Mutation_p.E226G	NM_003896.3	NP_003887.3	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 5	254					carbohydrate metabolic process (GO:0005975)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	lactosylceramide alpha-2,3-sialyltransferase activity (GO:0047291)|neolactotetraosylceramide alpha-2,3-sialyltransferase activity (GO:0004513)|sialyltransferase activity (GO:0008373)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15						GGAATAATATTCAAGGTCAGA	0.373																																																	0													110.0	108.0	109.0					2																	86073588		2203	4300	6503	SO:0001583	missense	0			AB018356	CCDS1986.2, CCDS42705.1	2p11.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000115525	ENSG00000115525	2.4.99.9	"""Sialyltransferases"""	10872	protein-coding gene	gene with protein product		604402	"""sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase; GM3 synthase)"""	SIAT9		9822625	Standard	NM_003896		Approved	ST3GalV, SIATGM3S	uc002sqq.1	Q9UNP4	OTTHUMG00000130171	ENST00000377332.3:c.761A>G	2.37:g.86073588T>C	ENSP00000366549:p.Glu254Gly		B3KM82|D6W5L9|O94902|Q53QU1|Q6NZX4|Q6YFL1	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.E254G	ENST00000377332.3	37	c.761	CCDS1986.2	2	.	.	.	.	.	.	.	.	.	.	T	22.8	4.337231	0.81911	.	.	ENSG00000115525	ENST00000393808;ENST00000393805;ENST00000377332	T;T;T	0.32272	1.46;1.46;1.46	5.65	5.65	0.86999	.	0.147928	0.64402	D	0.000014	T	0.54886	0.1886	M	0.75777	2.31	0.80722	D	1	D;D;D	0.64830	0.993;0.994;0.993	D;D;D	0.66716	0.91;0.946;0.91	T	0.57866	-0.7737	10	0.56958	D	0.05	-13.3588	15.0567	0.71917	0.0:0.0:0.0:1.0	.	226;254;231	Q9UNP4-2;Q9UNP4;Q9UNP4-3	.;SIAT9_HUMAN;.	G	231;226;254	ENSP00000377397:E231G;ENSP00000377394:E226G;ENSP00000366549:E254G	ENSP00000366549:E254G	E	-	2	0	ST3GAL5	85927099	1.000000	0.71417	0.436000	0.26797	0.979000	0.70002	7.540000	0.82074	2.154000	0.67381	0.454000	0.30748	GAA	ST3GAL5	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000115525		0.373	ST3GAL5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ST3GAL5	HGNC	protein_coding	OTTHUMT00000252486.1	-	0.00	41	0	T	NM_003896		86073588	-1	tier1	-	no_errors	ENST00000377332	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.994	C
STEAP3	55240	genome.wustl.edu	37	2	120020751	120020751	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:120020751C>T	ENST00000354888.5	+	6	1808	c.1304C>T	c.(1303-1305)aCg>aTg	p.T435M	STEAP3_ENST00000393107.2_Missense_Mutation_p.T435M|STEAP3_ENST00000393110.2_Missense_Mutation_p.T445M|STEAP3_ENST00000425223.2_Missense_Mutation_p.T435M|STEAP3_ENST00000393106.2_Missense_Mutation_p.T435M|STEAP3_ENST00000393108.2_Missense_Mutation_p.T435M|STEAP3_ENST00000409811.1_3'UTR	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	435					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						TTCACGCTCACGCTGCTGGTG	0.652																																																	0													95.0	92.0	93.0					2																	120020751		2203	4300	6503	SO:0001583	missense	0			AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.1304C>T	2.37:g.120020751C>T	ENSP00000346961:p.Thr435Met		A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.T445M	ENST00000354888.5	37	c.1334	CCDS2125.1	2	.	.	.	.	.	.	.	.	.	.	C	19.68	3.872307	0.72180	.	.	ENSG00000115107	ENST00000393108;ENST00000354888;ENST00000393110;ENST00000393106;ENST00000393107;ENST00000425223;ENST00000546236	T;T;T;T;T;T	0.07800	3.17;3.17;3.16;3.17;3.17;3.17	4.82	4.82	0.62117	.	0.139803	0.49916	D	0.000137	T	0.23370	0.0565	L	0.54323	1.7	0.80722	D	1	D;P	0.71674	0.998;0.925	D;B	0.67382	0.951;0.146	T	0.00292	-1.1842	9	.	.	.	-22.7663	17.0672	0.86562	0.0:1.0:0.0:0.0	.	445;435	Q658P3-2;Q658P3	.;STEA3_HUMAN	M	435;435;445;435;435;435;79	ENSP00000376820:T435M;ENSP00000346961:T435M;ENSP00000376822:T445M;ENSP00000376818:T435M;ENSP00000376819:T435M;ENSP00000396214:T435M	.	T	+	2	0	STEAP3	119737221	1.000000	0.71417	0.993000	0.49108	0.639000	0.38242	5.542000	0.67218	2.527000	0.85204	0.561000	0.74099	ACG	STEAP3	-	NULL	ENSG00000115107		0.652	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP3	HGNC	protein_coding	OTTHUMT00000254193.1	-	0.00	31	0	C	NM_018234		120020751	+1	tier1	-	no_errors	ENST00000393110	ensembl	human	known	74_37	missense	35.29	22	12	SNP	0.997	T
STEAP4	79689	genome.wustl.edu	37	7	87908875	87908875	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:87908875G>C	ENST00000380079.4	-	5	1319	c.1218C>G	c.(1216-1218)ttC>ttG	p.F406L	STEAP4_ENST00000301959.5_Missense_Mutation_p.F230L|AC003991.3_ENST00000447758.1_RNA|AC003991.3_ENST00000594469.1_RNA|AC003991.3_ENST00000595121.1_RNA|AC003991.3_ENST00000600908.1_RNA|AC003991.3_ENST00000434733.1_RNA	NM_001205315.1|NM_024636.3	NP_001192244.1|NP_078912.2	Q687X5	STEA4_HUMAN	STEAP family member 4	406					copper ion import (GO:0015677)|fat cell differentiation (GO:0045444)|ferric iron import into cell (GO:0097461)|iron ion homeostasis (GO:0055072)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(3)	15	Esophageal squamous(14;0.00802)					AAGGGCTGAGGAATCTCTTCC	0.438																																																	0													104.0	111.0	109.0					7																	87908875		1979	4143	6122	SO:0001583	missense	0			AK026806	CCDS43611.1, CCDS56494.1	7q21.13	2014-01-28	2005-06-15	2005-06-15	ENSG00000127954	ENSG00000127954			21923	protein-coding gene	gene with protein product		611098	"""tumor necrosis factor, alpha-induced protein 9"""	TNFAIP9		11443137, 15897894	Standard	NM_024636		Approved	FLJ23153, TIARP, STAMP2	uc003ujs.3	Q687X5	OTTHUMG00000153853	ENST00000380079.4:c.1218C>G	7.37:g.87908875G>C	ENSP00000369419:p.Phe406Leu		Q658Q9|Q687X4|Q8WWB0|Q9H5R1	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.F406L	ENST00000380079.4	37	c.1218	CCDS43611.1	7	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208744	0.58343	.	.	ENSG00000127954	ENST00000380079;ENST00000301959	T;T	0.11277	3.18;2.79	5.8	4.92	0.64577	.	0.136414	0.49916	U	0.000125	T	0.30008	0.0751	M	0.76002	2.32	0.80722	D	1	D;D	0.69078	0.997;0.962	D;P	0.76575	0.988;0.702	T	0.00733	-1.1589	10	0.25751	T	0.34	-14.1903	13.172	0.59604	0.0755:0.0:0.9245:0.0	.	230;406	Q687X5-2;Q687X5	.;STEA4_HUMAN	L	406;230	ENSP00000369419:F406L;ENSP00000305545:F230L	ENSP00000305545:F230L	F	-	3	2	STEAP4	87746811	1.000000	0.71417	1.000000	0.80357	0.377000	0.30045	2.462000	0.45049	2.744000	0.94065	0.655000	0.94253	TTC	STEAP4	-	NULL	ENSG00000127954		0.438	STEAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP4	HGNC	protein_coding	OTTHUMT00000332712.4	-	0.00	59	0	G	NM_024636		87908875	-1	tier1	-	no_errors	ENST00000380079	ensembl	human	known	74_37	missense	31.82	15	7	SNP	1.000	C
STIM1	6786	genome.wustl.edu	37	11	4095753	4095753	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:4095753G>C	ENST00000300737.4	+	7	1382	c.813G>C	c.(811-813)gaG>gaC	p.E271D	STIM1_ENST00000527651.1_Missense_Mutation_p.E271D|STIM1_ENST00000533977.1_Missense_Mutation_p.E98D	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	271	Glu-rich.				activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		CCCAGGAGGAGCACCGCACAG	0.617																																																	0													50.0	46.0	47.0					11																	4095753		2201	4298	6499	SO:0001583	missense	0			BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.813G>C	11.37:g.4095753G>C	ENSP00000300737:p.Glu271Asp		E9PQJ4|Q8N382	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.E271D	ENST00000300737.4	37	c.813	CCDS7749.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.1|21.1	4.094903|4.094903	0.76870|0.76870	.|.	.|.	ENSG00000167323|ENSG00000167323	ENST00000300737;ENST00000527651;ENST00000533977|ENST00000526596	T;T;T|.	0.80566|.	-0.38;-1.39;-0.42|.	5.44|5.44	1.99|1.99	0.26369|0.26369	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.69735|0.69735	0.3144|0.3144	M|M	0.74647|0.74647	2.275|2.275	0.80722|0.80722	D|D	1|1	D;D|.	0.69078|.	0.997;0.997|.	D;D|.	0.72625|.	0.978;0.978|.	T|T	0.68507|0.68507	-0.5390|-0.5390	10|5	0.52906|.	T|.	0.07|.	-23.9959|-23.9959	10.8908|10.8908	0.46994|0.46994	0.2466:0.0:0.7534:0.0|0.2466:0.0:0.7534:0.0	.|.	271;271|.	E9PQJ4;Q13586|.	.;STIM1_HUMAN|.	D|T	271;271;98|2	ENSP00000300737:E271D;ENSP00000436208:E271D;ENSP00000434767:E98D|.	ENSP00000300737:E271D|.	E|S	+|+	3|2	2|0	STIM1|STIM1	4052329|4052329	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	1.624000|1.624000	0.37018|0.37018	0.636000|0.636000	0.30508|0.30508	0.655000|0.655000	0.94253|0.94253	GAG|AGC	STIM1	-	NULL	ENSG00000167323		0.617	STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STIM1	HGNC	protein_coding	OTTHUMT00000257196.1	-	0.00	32	0	G	NM_003156		4095753	+1	tier1	-	no_errors	ENST00000300737	ensembl	human	known	74_37	missense	30.77	18	8	SNP	1.000	C
RNF217-AS1	7955	genome.wustl.edu	37	6	125233554	125233554	+	RNA	DEL	T	T	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:125233554delT	ENST00000439075.1	-	0	1191					NR_026876.1																						CTTAATCCTGTTTTTCTAATG	0.378																																																	0													126.0	127.0	127.0					6																	125233554		876	1991	2867			0																															6.37:g.125233554delT				RNA	DEL	-	NULL	ENST00000439075.1	37	NULL		6																																																																																			RP11-510H23.1	-	-	ENSG00000236548		0.378	RP11-510H23.1-001	KNOWN	basic	antisense	STL	Clone_based_vega_gene	antisense	OTTHUMT00000042059.1		0.00	42	0	T			125233554	-1	tier1		no_errors	ENST00000439075	ensembl	human	known	74_37	rna	42.59	31	23	DEL	0.401	-
STXBP1	6812	genome.wustl.edu	37	9	130446835	130446835	+	Intron	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:130446835C>T	ENST00000373299.1	+	18	1817				STXBP1_ENST00000481942.1_Intron|STXBP1_ENST00000373302.3_Intron	NM_001032221.3	NP_001027392.1	P61764	STXB1_HUMAN	syntaxin binding protein 1						axon target recognition (GO:0007412)|energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long term synaptic depression (GO:0060292)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|protein stabilization (GO:0050821)|protein transport (GO:0015031)|regulation of insulin secretion (GO:0050796)|regulation of SNARE complex assembly (GO:0035542)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|regulation of synaptic vesicle priming (GO:0010807)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle maturation (GO:0016188)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|protein complex (GO:0043234)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|SNARE binding (GO:0000149)|syntaxin binding (GO:0019905)|syntaxin-1 binding (GO:0017075)			breast(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|skin(2)	23						TTGATTATTCCGTCACTCTTT	0.338																																																	0																																										SO:0001627	intron_variant	0			AF004563	CCDS6874.1, CCDS35146.1	9q34.1	2008-07-21			ENSG00000136854	ENSG00000136854			11444	protein-coding gene	gene with protein product	"""syntaxin-binding protein 1"""	602926				9545644	Standard	NM_001032221		Approved	hUNC18, MUNC18-1, UNC18, rbSec1	uc004brk.2	P61764	OTTHUMG00000020713	ENST00000373299.1:c.1702+1996C>T	9.37:g.130446835C>T			B1AM97|Q28208|Q62759|Q64320|Q96TG8	RNA	SNP	-	NULL	ENST00000373299.1	37	NULL	CCDS35146.1	9																																																																																			STXBP1	-	-	ENSG00000136854		0.338	STXBP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP1	HGNC	protein_coding	OTTHUMT00000054229.1	-	0.00	14	0	C	NM_003165		130446835	+1	tier1	-	no_errors	ENST00000494254	ensembl	human	known	74_37	rna	23.53	13	4	SNP	1.000	T
SULT1E1	6783	genome.wustl.edu	37	4	70707713	70707713	+	Silent	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:70707713T>C	ENST00000226444.3	-	8	996	c.884A>G	c.(883-885)tAa>tGa	p.*295*		NM_005420.2	NP_005411.1	P49888	ST1E1_HUMAN	sulfotransferase family 1E, estrogen-preferring, member 1	0					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	estrone sulfotransferase activity (GO:0004304)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid binding (GO:0005496)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10					Acetaminophen(DB00316)|Cyclizine(DB01176)	AAGACCTTCTTAGATCTCAGT	0.303																																																	0													97.0	97.0	97.0					4																	70707713		2202	4296	6498	SO:0001819	synonymous_variant	0			BC027956	CCDS3531.1	4q13.1	2008-02-05	2004-02-06	2004-02-04	ENSG00000109193	ENSG00000109193	2.8.2.4	"""Sulfotransferases, cytosolic"""	11377	protein-coding gene	gene with protein product		600043	"""sulfotransferase, estrogen-preferring"""	STE		7961757	Standard	NM_005420		Approved	EST	uc003heo.3	P49888	OTTHUMG00000129403	ENST00000226444.3:c.884A>G	4.37:g.70707713T>C			Q8N6X5	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.*295	ENST00000226444.3	37	c.884	CCDS3531.1	4																																																																																			SULT1E1	-	NULL	ENSG00000109193		0.303	SULT1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1E1	HGNC	protein_coding	OTTHUMT00000251559.1	-	0.00	58	0	T	NM_005420		70707713	-1	tier1	-	no_errors	ENST00000226444	ensembl	human	known	74_37	silent	31.91	32	15	SNP	0.479	C
SYNDIG1	79953	genome.wustl.edu	37	20	24524039	24524039	+	Missense_Mutation	SNP	G	G	C	rs371527396		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr20:24524039G>C	ENST00000376862.3	+	2	939	c.306G>C	c.(304-306)tgG>tgC	p.W102C		NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	102					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)	p.W102*(1)		breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						TGCGCTCCTGGGGGGACGGTG	0.637																																																	1	Substitution - Nonsense(1)	skin(1)											60.0	61.0	60.0					20																	24524039		2203	4300	6503	SO:0001583	missense	0			AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.306G>C	20.37:g.24524039G>C	ENSP00000366058:p.Trp102Cys		Q6IA30|Q9H514	Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.W102C	ENST00000376862.3	37	c.306	CCDS13164.1	20	.	.	.	.	.	.	.	.	.	.	G	17.05	3.288912	0.59976	.	.	ENSG00000101463	ENST00000376862	D	0.90900	-2.75	5.85	5.85	0.93711	.	0.130857	0.56097	D	0.000034	D	0.94321	0.8175	L	0.60455	1.87	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93799	0.7099	10	0.51188	T	0.08	-14.3677	17.645	0.88146	0.0:0.0:1.0:0.0	.	102	Q9H7V2	SYNG1_HUMAN	C	102	ENSP00000366058:W102C	ENSP00000366058:W102C	W	+	3	0	SYNDIG1	24472039	1.000000	0.71417	1.000000	0.80357	0.421000	0.31385	9.200000	0.95010	2.766000	0.95052	0.655000	0.94253	TGG	SYNDIG1	-	NULL	ENSG00000101463		0.637	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNDIG1	HGNC	protein_coding	OTTHUMT00000078376.1		0.00	49	0	G	NM_024893		24524039	+1			no_errors	ENST00000376862	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	C
SYT3	84258	genome.wustl.edu	37	19	51132599	51132599	+	Silent	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:51132599C>T	ENST00000338916.4	-	4	1866	c.1233G>A	c.(1231-1233)gaG>gaA	p.E411E	SYT3_ENST00000600079.1_Silent_p.E411E|SYT3_ENST00000593901.1_Silent_p.E411E|SYT3_ENST00000544769.1_Silent_p.E411E	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	411					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		CAGGGGGCTGCTCGGCCAGCT	0.672																																																	0													29.0	30.0	30.0					19																	51132599		2203	4300	6503	SO:0001819	synonymous_variant	0			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.1233G>A	19.37:g.51132599C>T			Q8N5Z1|Q8N640	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_dom	p.E411	ENST00000338916.4	37	c.1233	CCDS12798.1	19																																																																																			SYT3	-	superfamily_C2_dom,smart_C2_dom	ENSG00000213023		0.672	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SYT3	HGNC	protein_coding	OTTHUMT00000464910.1	-	0.00	62	0	C	NM_032298		51132599	-1	tier1	-	no_errors	ENST00000338916	ensembl	human	known	74_37	silent	7.02	53	4	SNP	1.000	T
TAF10	6881	genome.wustl.edu	37	11	6632477	6632477	+	Silent	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:6632477G>A	ENST00000299424.4	-	4	987	c.510C>T	c.(508-510)gcC>gcT	p.A170A	RP11-732A19.2_ENST00000527398.1_RNA|TAF10_ENST00000531760.1_5'UTR	NM_006284.3	NP_006275.1	Q12962	TAF10_HUMAN	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa	170					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|perinuclear region of cytoplasm (GO:0048471)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|RNA polymerase binding (GO:0070063)|transcription coactivator activity (GO:0003713)						Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.0481)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.129)		AGTGCTGTAGGGCATCATTGG	0.478																																																	0													84.0	87.0	86.0					11																	6632477		2201	4296	6497	SO:0001819	synonymous_variant	0			U13991, U25816	CCDS7769.1	11p15.5-p15.2	2006-11-14	2002-08-29	2001-12-07	ENSG00000166337	ENSG00000166337			11543	protein-coding gene	gene with protein product		600475	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, H, 30kD"""	TAF2H, TAF2A		7923369	Standard	NM_006284		Approved	TAFII30	uc001mej.2	Q12962	OTTHUMG00000133402	ENST00000299424.4:c.510C>T	11.37:g.6632477G>A			O00703|Q13175|Q6FH13	Silent	SNP	pfam_TFIID_30kDa,pirsf_TFIID_30kDa,prints_TFIID_30kDa	p.A170	ENST00000299424.4	37	c.510	CCDS7769.1	11																																																																																			TAF10	-	pfam_TFIID_30kDa,pirsf_TFIID_30kDa,prints_TFIID_30kDa	ENSG00000166337		0.478	TAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF10	HGNC	protein_coding	OTTHUMT00000257259.2	-	0.00	32	0	G	NM_006284		6632477	-1	tier1	-	no_errors	ENST00000299424	ensembl	human	known	74_37	silent	47.06	9	8	SNP	1.000	A
TBC1D10B	26000	genome.wustl.edu	37	16	30376900	30376900	+	Silent	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:30376900G>A	ENST00000409939.3	-	2	1052	c.972C>T	c.(970-972)ccC>ccT	p.P324P		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	324					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			CCACGTCCACGGGAATGGAGC	0.577																																																	0													80.0	77.0	78.0					16																	30376900		2197	4300	6497	SO:0001819	synonymous_variant	0			BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.972C>T	16.37:g.30376900G>A			B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.P324	ENST00000409939.3	37	c.972	CCDS10676.2	16																																																																																			TBC1D10B	-	NULL	ENSG00000169221		0.577	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D10B	HGNC	protein_coding	OTTHUMT00000255527.3	-	0.00	56	0	G	NM_015527		30376900	-1	tier1	-	no_errors	ENST00000409939	ensembl	human	known	74_37	silent	34.85	43	23	SNP	0.725	A
TAF1C	9013	genome.wustl.edu	37	16	84217326	84217326	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:84217326A>T	ENST00000567759.1	-	3	379	c.197T>A	c.(196-198)cTc>cAc	p.L66H	TAF1C_ENST00000570117.1_Intron|TAF1C_ENST00000566732.1_Missense_Mutation_p.L66H|TAF1C_ENST00000565544.1_5'Flank|TAF1C_ENST00000341690.6_5'UTR|TAF1C_ENST00000378541.4_Missense_Mutation_p.L66H|TAF1C_ENST00000541676.1_5'UTR	NM_005679.3	NP_005670	Q15572	TAF1C_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kDa	66					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	26						CAGCATGGGGAGAGGCCCAGG	0.597																																																	0													69.0	67.0	68.0					16																	84217326		2200	4300	6500	SO:0001583	missense	0			L39059	CCDS32496.1, CCDS45535.1, CCDS58488.1, CCDS58489.1	16q24	2008-02-05	2002-08-29			ENSG00000103168			11534	protein-coding gene	gene with protein product		604905	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, C, 110kD"""			7801123	Standard	NM_005679		Approved	TAFI110, TAFI95, SL1, MGC:39976	uc010vnx.2	Q15572		ENST00000567759.1:c.197T>A	16.37:g.84217326A>T	ENSP00000455265:p.Leu66His		B7Z5K5|B7Z5S4|B7Z908|B7Z9L7|Q59F67|Q8N6V3	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.L66H	ENST00000567759.1	37	c.197	CCDS32496.1	16	.	.	.	.	.	.	.	.	.	.	A	14.60	2.584260	0.46110	.	.	ENSG00000103168	ENST00000378541;ENST00000537450	T	0.46819	0.86	4.35	4.35	0.52113	.	0.256859	0.26096	N	0.026366	T	0.62950	0.2470	M	0.70595	2.14	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.999	D;D;D	0.66351	0.912;0.943;0.939	T	0.66337	-0.5949	10	0.72032	D	0.01	-14.9608	9.8419	0.41004	1.0:0.0:0.0:0.0	.	66;66;66	F5H7W6;Q15572-6;Q15572	.;.;TAF1C_HUMAN	H	66	ENSP00000367802:L66H	ENSP00000367802:L66H	L	-	2	0	TAF1C	82774827	0.968000	0.33430	0.988000	0.46212	0.283000	0.27025	1.998000	0.40796	1.824000	0.53156	0.533000	0.62120	CTC	TAF1C	-	NULL	ENSG00000103168		0.597	TAF1C-001	KNOWN	basic|CCDS	protein_coding	TAF1C	HGNC	protein_coding	OTTHUMT00000433045.2	-	0.00	24	0	A	NM_139353		84217326	-1	tier1	-	no_errors	ENST00000378541	ensembl	human	known	74_37	missense	63.64	8	14	SNP	0.958	T
TBC1D32	221322	genome.wustl.edu	37	6	121600279	121600279	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:121600279G>A	ENST00000398212.2	-	15	1770	c.1721C>T	c.(1720-1722)tCt>tTt	p.S574F	TBC1D32_ENST00000275159.6_Missense_Mutation_p.S574F	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	574					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										TTCTTCAGAAGAGTTCATATT	0.323																																																	0													49.0	47.0	47.0					6																	121600279		1801	4068	5869	SO:0001583	missense	0			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.1721C>T	6.37:g.121600279G>A	ENSP00000381270:p.Ser574Phe		Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom	p.S574F	ENST00000398212.2	37	c.1721	CCDS43501.1	6	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062603	0.55432	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	T;T	0.25579	1.79;1.79	5.52	5.52	0.82312	.	0.287889	0.33419	N	0.004921	T	0.35278	0.0926	M	0.71581	2.175	0.44247	D	0.997099	D;D	0.63880	0.993;0.985	P;P	0.59487	0.858;0.751	T	0.16928	-1.0386	10	0.72032	D	0.01	-12.9195	11.6594	0.51337	0.0827:0.0:0.9173:0.0	.	574;574	Q96NH3-4;Q96NH3	.;BROMI_HUMAN	F	574	ENSP00000275159:S574F;ENSP00000381270:S574F	ENSP00000275159:S574F	S	-	2	0	C6orf170	121641978	1.000000	0.71417	0.994000	0.49952	0.794000	0.44872	2.367000	0.44213	2.603000	0.88011	0.650000	0.86243	TCT	TBC1D32	-	NULL	ENSG00000146350		0.323	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	TBC1D32	HGNC	protein_coding	OTTHUMT00000380937.2	-	0.00	57	0	G	NM_152730		121600279	-1	tier1	-	no_errors	ENST00000275159	ensembl	human	putative	74_37	missense	31.91	32	15	SNP	0.998	A
TBC1D3F	84218	genome.wustl.edu	37	17	36288293	36288293	+	Silent	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:36288293A>C	ENST00000327454.6	+	6	525	c.379A>C	c.(379-381)Aga>Cga	p.R127R	TBC1D3F_ENST00000505415.1_Silent_p.R127R|TBC1D3F_ENST00000378174.5_Silent_p.R127R|TBC1D3F_ENST00000539424.1_Silent_p.R47R	NM_032258.2	NP_115634.2	A6NER0	TBC3F_HUMAN	TBC1 domain family, member 3F	127	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			liver(1)|pancreas(1)	2						AAACCCCGGAAGATACCAGGT	0.577																																																	0													201.0	134.0	154.0					17																	36288293		876	1984	2860	SO:0001819	synonymous_variant	0					17q12	2014-09-16				ENSG00000275954			18257	protein-coding gene	gene with protein product		610809				16863688	Standard	NM_032258		Approved			A6NER0	OTTHUMG00000188428	ENST00000327454.6:c.379A>C	17.37:g.36288293A>C				Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R127	ENST00000327454.6	37	c.379	CCDS45657.1	17																																																																																			TBC1D3F	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000185128		0.577	TBC1D3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D3F	HGNC	protein_coding	OTTHUMT00000256100.3	-	0.00	622	0	A	NM_032258.2		36288293	+1	tier1	-	no_errors	ENST00000327454	ensembl	human	known	74_37	silent	16.55	353	70	SNP	0.998	C
TBXA2R	6915	genome.wustl.edu	37	19	3600441	3600441	+	Silent	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:3600441G>T	ENST00000375190.4	-	2	585	c.192C>A	c.(190-192)ctC>ctA	p.L64L	TBXA2R_ENST00000589966.1_Silent_p.L64L|TBXA2R_ENST00000411851.3_Silent_p.L64L|TBXA2R_ENST00000587717.1_5'Flank	NM_001060.5|NM_201636.2	NP_001051.1|NP_963998.2	P21731	TA2R_HUMAN	thromboxane A2 receptor	64					blood coagulation (GO:0007596)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood pressure (GO:0045777)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of vasoconstriction (GO:0045907)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|second-messenger-mediated signaling (GO:0019932)|thromboxane A2 signaling pathway (GO:0038193)	acrosomal vesicle (GO:0001669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|thromboxane A2 receptor activity (GO:0004961)			kidney(1)|lung(2)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)	Ridogrel(DB01207)	AGAGGAAGGTGAGGAAGGAGG	0.711																																																	0													40.0	58.0	52.0					19																	3600441		2171	4242	6413	SO:0001819	synonymous_variant	0				CCDS42467.1, CCDS54198.1	19p13.3	2014-09-17						"""GPCR / Class A : Prostanoid receptors"""	11608	protein-coding gene	gene with protein product		188070				1825698	Standard	NM_001060		Approved		uc021umv.1	P21731		ENST00000375190.4:c.192C>A	19.37:g.3600441G>T			O75228|Q6DK52|Q9UCY1|Q9UCY2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Thbox_rcpt,prints_Prostanoid_rcpt,prints_GPCR_Rhodpsn	p.L64	ENST00000375190.4	37	c.192	CCDS42467.1	19																																																																																			TBXA2R	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Prostanoid_rcpt	ENSG00000006638		0.711	TBXA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBXA2R	HGNC	protein_coding	OTTHUMT00000453081.2	-	0.00	152	0	G			3600441	-1	tier1	-	no_errors	ENST00000411851	ensembl	human	known	74_37	silent	25.00	104	35	SNP	0.999	T
TBXAS1	6916	genome.wustl.edu	37	7	139655362	139655362	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:139655362G>T	ENST00000336425.5	+	11	1033	c.644G>T	c.(643-645)cGt>cTt	p.R215L	TBXAS1_ENST00000436047.2_Missense_Mutation_p.R216L|TBXAS1_ENST00000411653.1_Missense_Mutation_p.R215L|TBXAS1_ENST00000263552.6_Missense_Mutation_p.R216L|TBXAS1_ENST00000416849.2_Missense_Mutation_p.R262L|TBXAS1_ENST00000458722.1_Missense_Mutation_p.R261L|TBXAS1_ENST00000414508.2_Missense_Mutation_p.R216L|TBXAS1_ENST00000448866.1_Missense_Mutation_p.R215L|TBXAS1_ENST00000462275.1_3'UTR|TBXAS1_ENST00000425687.1_Missense_Mutation_p.R148L			P24557	THAS_HUMAN	thromboxane A synthase 1 (platelet)	215					arachidonic acid metabolic process (GO:0019369)|cellular chloride ion homeostasis (GO:0030644)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|positive regulation of vasoconstriction (GO:0045907)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|thromboxane-A synthase activity (GO:0004796)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	28	Melanoma(164;0.0142)				Ridogrel(DB01207)|Sulfasalazine(DB00795)	CACTGCAAGCGTTTCTTCGAA	0.577																																																	0													74.0	80.0	78.0					7																	139655362		2203	4300	6503	SO:0001583	missense	0			L36085	CCDS5855.1, CCDS5856.1, CCDS55174.1, CCDS55175.1	7q34-q35	2014-09-17	2008-07-31		ENSG00000059377	ENSG00000059377	5.3.99.5	"""Cytochrome P450s"""	11609	protein-coding gene	gene with protein product	"""cytochrome P450, family 5, subfamily A, polypeptide 1"""	274180	"""thromboxane A synthase 1 (platelet, cytochrome P450, subfamily V)"""			1714723, 8964509	Standard	NM_001061		Approved	CYP5, CYP5A1, THAS, TXS, TXAS, TS	uc011kqv.2	P24557	OTTHUMG00000157302	ENST00000336425.5:c.644G>T	7.37:g.139655362G>T	ENSP00000338087:p.Arg215Leu		B4DJG6|E7EMU9|E7EP08|E7ESB5|O14987|Q16843|Q16844|Q8IUN1|Q96CN2|Q9GZW4|Q9HD77|Q9HD78|Q9HD79|Q9HD80|Q9HD81|Q9HD82|Q9HD83|Q9HD84	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.R262L	ENST00000336425.5	37	c.785		7	.	.	.	.	.	.	.	.	.	.	G	14.59	2.580470	0.46006	.	.	ENSG00000059377	ENST00000425687;ENST00000263552;ENST00000336425;ENST00000416849;ENST00000436047;ENST00000414508;ENST00000448866;ENST00000458722;ENST00000411653	T;T;T;T;T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	5.91	5.91	0.95273	.	0.317652	0.35436	N	0.003201	T	0.68897	0.3051	M	0.80616	2.505	0.26667	N	0.971798	B;B;B;B;B;B;B	0.27166	0.05;0.105;0.054;0.17;0.135;0.054;0.054	B;B;B;B;B;B;B	0.30646	0.098;0.069;0.039;0.048;0.118;0.063;0.044	T	0.63945	-0.6522	10	0.44086	T	0.13	.	12.1224	0.53900	0.0:0.1363:0.7377:0.126	.	196;262;167;148;216;216;215	B4DVP1;E7EP08;B4E0M5;E7ESB5;E7EMU9;Q53F23;P24557	.;.;.;.;.;.;THAS_HUMAN	L	148;216;215;262;216;216;215;261;215	ENSP00000388736:R148L;ENSP00000263552:R216L;ENSP00000338087:R215L;ENSP00000389414:R262L;ENSP00000392361:R216L;ENSP00000392702:R216L;ENSP00000402536:R215L;ENSP00000411274:R261L;ENSP00000411326:R215L	ENSP00000263552:R216L	R	+	2	0	TBXAS1	139301831	0.025000	0.19082	0.864000	0.33941	0.706000	0.40770	1.886000	0.39688	2.793000	0.96121	0.655000	0.94253	CGT	TBXAS1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000059377		0.577	TBXAS1-001	KNOWN	basic|appris_candidate	protein_coding	TBXAS1	HGNC	protein_coding	OTTHUMT00000348373.1		0.00	43	0	G			139655362	+1			no_errors	ENST00000416849	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.427	T
TCEB3B	51224	genome.wustl.edu	37	18	44560946	44560946	+	Silent	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr18:44560946A>G	ENST00000332567.4	-	1	1042	c.690T>C	c.(688-690)tcT>tcC	p.S230S	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000245121.5_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	230					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TTTCCTGGCGAGACGATTTGT	0.607																																																	0													41.0	42.0	41.0					18																	44560946		2203	4300	6503	SO:0001819	synonymous_variant	0			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.690T>C	18.37:g.44560946A>G			Q9P2V9	Silent	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.S230	ENST00000332567.4	37	c.690	CCDS11932.1	18																																																																																			TCEB3B	-	NULL	ENSG00000206181		0.607	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	HGNC	protein_coding	OTTHUMT00000255900.1	-	0.00	71	0	A	NM_016427		44560946	-1	tier1	-	no_errors	ENST00000332567	ensembl	human	known	74_37	silent	74.00	13	37	SNP	0.001	G
TCERG1L	256536	genome.wustl.edu	37	10	133107433	133107433	+	Silent	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:133107433T>G	ENST00000368642.4	-	2	557	c.472A>C	c.(472-474)Agg>Cgg	p.R158R		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	158	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.									cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		TTAGGAATCCTTTTGTCTATC	0.443																																																	0													72.0	70.0	71.0					10																	133107433		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.472A>C	10.37:g.133107433T>G			Q5VWI2|Q86XM8	Silent	SNP	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.R158	ENST00000368642.4	37	c.472	CCDS7662.2	10																																																																																			TCERG1L	-	NULL	ENSG00000176769		0.443	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCERG1L	HGNC	protein_coding	OTTHUMT00000091619.2	-	0.00	61	0	T	NM_174937		133107433	-1	tier1	-	no_errors	ENST00000368642	ensembl	human	known	74_37	silent	22.64	41	12	SNP	1.000	G
TDRD5	163589	genome.wustl.edu	37	1	179631398	179631398	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:179631398T>G	ENST00000367614.1	+	14	2679	c.2320T>G	c.(2320-2322)Tca>Gca	p.S774A	TDRD5_ENST00000444136.1_Missense_Mutation_p.S828A|TDRD5_ENST00000294848.8_Missense_Mutation_p.S774A	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	774					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TCAGTATTCATCATGTAAAGA	0.463																																																	0													78.0	73.0	75.0					1																	179631398		2203	4300	6503	SO:0001583	missense	0			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2320T>G	1.37:g.179631398T>G	ENSP00000356586:p.Ser774Ala		A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.S828A	ENST00000367614.1	37	c.2482	CCDS1332.1	1	.	.	.	.	.	.	.	.	.	.	T	8.758	0.922901	0.18056	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136;ENST00000417329	T;T;T;T	0.32753	2.62;2.62;2.83;1.44	4.62	-0.633	0.11519	.	1.627270	0.03343	N	0.195044	T	0.22475	0.0542	L	0.50333	1.59	0.09310	N	1	B;B	0.33171	0.4;0.172	B;B	0.24541	0.054;0.024	T	0.10660	-1.0620	10	0.17832	T	0.49	-14.8081	3.9441	0.09341	0.4913:0.0991:0.0:0.4096	.	828;774	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	A	774;774;828;284	ENSP00000356586:S774A;ENSP00000294848:S774A;ENSP00000406052:S828A;ENSP00000410744:S284A	ENSP00000294848:S774A	S	+	1	0	TDRD5	177898021	0.000000	0.05858	0.015000	0.15790	0.490000	0.33462	-0.506000	0.06359	0.002000	0.14630	0.528000	0.53228	TCA	TDRD5	-	NULL	ENSG00000162782		0.463	TDRD5-002	KNOWN	basic|CCDS	protein_coding	TDRD5	HGNC	protein_coding	OTTHUMT00000085295.1	-	0.00	40	0	T	NM_173533		179631398	+1	tier1	-	no_errors	ENST00000444136	ensembl	human	known	74_37	missense	56.60	23	30	SNP	0.020	G
TENM2	57451	genome.wustl.edu	37	5	167645899	167645899	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:167645899A>T	ENST00000518659.1	+	23	5042	c.5003A>T	c.(5002-5004)aAa>aTa	p.K1668I	TENM2_ENST00000519204.1_Missense_Mutation_p.K1547I|TENM2_ENST00000545108.1_Missense_Mutation_p.K1667I|TENM2_ENST00000403607.2_Missense_Mutation_p.K1492I|TENM2_ENST00000520394.1_Missense_Mutation_p.K1429I	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1668					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GGAGGCCTCAAAGTCGTGTCC	0.572																																																	0													143.0	149.0	147.0					5																	167645899		2097	4211	6308	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.5003A>T	5.37:g.167645899A>T	ENSP00000429430:p.Lys1668Ile		Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.K1668I	ENST00000518659.1	37	c.5003		5	.	.	.	.	.	.	.	.	.	.	A	19.24	3.789607	0.70337	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.56444	1.7;0.46;1.7;1.7;1.7	5.85	5.85	0.93711	.	0.045428	0.85682	D	0.000000	T	0.71409	0.3336	M	0.71581	2.175	0.49483	D	0.999797	D;D;D	0.63880	0.993;0.988;0.958	D;P;P	0.68192	0.956;0.905;0.466	T	0.74244	-0.3728	10	0.66056	D	0.02	.	16.2303	0.82332	1.0:0.0:0.0:0.0	.	1667;1668;1429	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	I	1668;1667;1547;1429;1492	ENSP00000429430:K1668I;ENSP00000438635:K1667I;ENSP00000428964:K1547I;ENSP00000427874:K1429I;ENSP00000384905:K1492I	ENSP00000384905:K1492I	K	+	2	0	ODZ2	167578477	1.000000	0.71417	0.988000	0.46212	0.990000	0.78478	6.168000	0.71908	2.233000	0.73108	0.533000	0.62120	AAA	TENM2	-	superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf	ENSG00000145934		0.572	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	-	0.00	38	0	A	NM_001122679		167645899	+1	tier1	-	no_errors	ENST00000518659	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.995	T
THEM5	284486	genome.wustl.edu	37	1	151824837	151824837	+	Silent	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:151824837C>T	ENST00000368817.5	-	2	353	c.222G>A	c.(220-222)ctG>ctA	p.L74L	AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5	74					cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TAGTCTTCTCCAGAAATTCTT	0.507																																																	0													138.0	134.0	136.0					1																	151824837		2203	4300	6503	SO:0001819	synonymous_variant	0			AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070	ENST00000368817.5:c.222G>A	1.37:g.151824837C>T			Q5T1C3	Silent	SNP	pfam_Thioestr_supf	p.L74	ENST00000368817.5	37	c.222	CCDS1005.1	1	.	.	.	.	.	.	.	.	.	.	C	9.865	1.197238	0.22037	.	.	ENSG00000196407	ENST00000453881	.	.	.	5.28	1.98	0.26296	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.3079	3.9978	0.09566	0.0:0.5823:0.1984:0.2193	.	.	.	.	X	21	.	.	W	-	2	0	THEM5	150091461	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	0.530000	0.23036	1.227000	0.43598	0.655000	0.94253	TGG	THEM5	-	NULL	ENSG00000196407		0.507	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THEM5	HGNC	protein_coding	OTTHUMT00000036678.2	-	0.00	52	0	C	NM_182578		151824837	-1	tier1	-	no_errors	ENST00000368817	ensembl	human	known	74_37	silent	61.82	21	34	SNP	0.998	T
THSD7B	80731	genome.wustl.edu	37	2	137988781	137988781	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:137988781A>C	ENST00000409968.1	+	8	2069	c.1891A>C	c.(1891-1893)Act>Cct	p.T631P	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000413152.2_Missense_Mutation_p.T600P|THSD7B_ENST00000272643.3_Missense_Mutation_p.T631P			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	631	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CAGGTCAAGAACTATCCTGGC	0.453																																																	0													38.0	39.0	39.0					2																	137988781		1909	4136	6045	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1891A>C	2.37:g.137988781A>C	ENSP00000387145:p.Thr631Pro			Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.T631P	ENST00000409968.1	37	c.1891		2	.	.	.	.	.	.	.	.	.	.	A	15.35	2.807567	0.50421	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.55052	0.54;0.54;0.54	5.89	0.966	0.19667	.	0.360590	0.34959	N	0.003548	T	0.57621	0.2066	M	0.84219	2.685	0.09310	N	0.999999	P;P	0.45715	0.845;0.865	P;B	0.50896	0.653;0.323	T	0.47433	-0.9118	10	0.34782	T	0.22	.	4.66	0.12637	0.33:0.0:0.2194:0.4505	.	631;600	Q9C0I4;C9JKN6	THS7B_HUMAN;.	P	631;631;600	ENSP00000387145:T631P;ENSP00000272643:T631P;ENSP00000413841:T600P	ENSP00000272643:T631P	T	+	1	0	THSD7B	137705251	0.009000	0.17119	0.019000	0.16419	0.918000	0.54935	0.669000	0.25142	0.472000	0.27344	0.460000	0.39030	ACT	THSD7B	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000144229		0.453	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	-	0.00	84	0	A	XM_046570.9		137988781	+1	tier1	-	no_errors	ENST00000272643	ensembl	human	known	74_37	missense	31.58	52	24	SNP	0.027	C
TIMD4	91937	genome.wustl.edu	37	5	156381443	156381443	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:156381443C>T	ENST00000274532.2	-	2	439	c.383G>A	c.(382-384)cGc>cAc	p.R128H	TIMD4_ENST00000407087.3_Missense_Mutation_p.R128H	NM_138379.2	NP_612388.2	Q96H15	TIMD4_HUMAN	T-cell immunoglobulin and mucin domain containing 4	128						integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(23)|ovary(2)|skin(2)	37	Renal(175;0.00488)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TAGATTCAGGCGCACGTTTAT	0.507																																																	0													69.0	64.0	65.0					5																	156381443		2203	4300	6503	SO:0001583	missense	0			BC008988	CCDS4332.1, CCDS54943.1	5q33.3	2013-01-11			ENSG00000145850	ENSG00000145850		"""Immunoglobulin superfamily / V-set domain containing"""	25132	protein-coding gene	gene with protein product		610096				12477932	Standard	NM_001146726		Approved		uc003lwh.2	Q96H15	OTTHUMG00000130244	ENST00000274532.2:c.383G>A	5.37:g.156381443C>T	ENSP00000274532:p.Arg128His		B5MCL9	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.R128H	ENST00000274532.2	37	c.383	CCDS4332.1	5	.	.	.	.	.	.	.	.	.	.	c	18.40	3.615891	0.66672	.	.	ENSG00000145850	ENST00000274532;ENST00000407087	T;T	0.18502	2.21;2.22	5.61	-5.81	0.02340	Immunoglobulin subtype (1);	0.819425	0.10591	N	0.656728	T	0.11537	0.0281	L	0.41573	1.285	0.09310	N	1	B;B	0.28208	0.045;0.203	B;B	0.16722	0.016;0.016	T	0.18999	-1.0319	10	0.49607	T	0.09	-2.1544	11.1474	0.48438	0.1087:0.1433:0.0:0.748	.	128;128	B5MCL9;Q96H15	.;TIMD4_HUMAN	H	128	ENSP00000274532:R128H;ENSP00000385973:R128H	ENSP00000274532:R128H	R	-	2	0	TIMD4	156314021	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.154000	0.10130	-0.786000	0.04516	-0.136000	0.14681	CGC	TIMD4	-	smart_Ig_sub	ENSG00000145850		0.507	TIMD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMD4	HGNC	protein_coding	OTTHUMT00000252568.1	-	0.00	28	0	C	NM_138379		156381443	-1	tier1	-	no_errors	ENST00000274532	ensembl	human	known	74_37	missense	47.62	11	10	SNP	0.000	T
TLX1NB	100038246	genome.wustl.edu	37	10	102849446	102849446	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:102849446G>T	ENST00000445873.1	-	3	1493	c.217C>A	c.(217-219)Cac>Aac	p.H73N	TLX1NB_ENST00000425505.1_5'Flank	NM_001085398.1	NP_001078867.1	P0CAT3	TLXNB_HUMAN	TLX1 neighbor	73																	TTTAGAGGGTGGGGCGGGGAA	0.602																																																	0													25.0	25.0	25.0					10																	102849446		1852	4079	5931	SO:0001583	missense	0			BC019674	CCDS60615.1	10q24	2014-04-01			ENSG00000236311	ENSG00000236311			37183	protein-coding gene	gene with protein product		612734				17303350	Standard	NM_001085398		Approved	TD1, TDI, APT-B7	uc001ksv.3	P0CAT3	OTTHUMG00000018925	ENST00000445873.1:c.217C>A	10.37:g.102849446G>T	ENSP00000475001:p.His73Asn			Missense_Mutation	SNP	NULL	p.H73N	ENST00000445873.1	37	c.217		10																																																																																			TLX1NB	-	NULL	ENSG00000236311		0.602	TLX1NB-001	NOVEL	basic|appris_principal	protein_coding	TLX1NB	HGNC	protein_coding	OTTHUMT00000049925.2	-	0.00	47	0	G	NM_001085398		102849446	-1	tier1	-	no_errors	ENST00000445873	ensembl	human	novel	74_37	missense	11.11	32	4	SNP	0.001	T
TMEM60	85025	genome.wustl.edu	37	7	77423460	77423460	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:77423460delT	ENST00000257663.3	-	2	607	c.231delA	c.(229-231)aaafs	p.K77fs		NM_032936.3	NP_116325.1	Q9H2L4	TMM60_HUMAN	transmembrane protein 60	77						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)	4						GGTACCAGGCTTTTTTTTTAA	0.408																																																	0													142.0	141.0	141.0					7																	77423460		2203	4300	6503	SO:0001589	frameshift_variant	0			AF260336	CCDS5593.1	7q11.23	2005-07-25	2005-07-25	2005-07-25	ENSG00000135211	ENSG00000135211			21754	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 35"""	C7orf35			Standard	NM_032936		Approved	DC32	uc003ugn.3	Q9H2L4	OTTHUMG00000130689	ENST00000257663.3:c.231delA	7.37:g.77423460delT	ENSP00000257663:p.Lys77fs		A4D1C3|Q86UM0	Frame_Shift_Del	DEL	pfam_TM_Fragile-X-F-assoc	p.A78fs	ENST00000257663.3	37	c.231	CCDS5593.1	7																																																																																			TMEM60	-	NULL	ENSG00000135211		0.408	TMEM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM60	HGNC	protein_coding	OTTHUMT00000253185.2		0.00	70	0	T	NM_032936		77423460	-1	tier1		no_errors	ENST00000257663	ensembl	human	known	74_37	frame_shift_del	9.09	40	4	DEL	0.998	-
TNFSF14	8740	genome.wustl.edu	37	19	6665098	6665098	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:6665098C>T	ENST00000599359.1	-	5	943	c.562G>A	c.(562-564)Gga>Aga	p.G188R	TNFSF14_ENST00000326176.9_Missense_Mutation_p.G152R|TNFSF14_ENST00000245912.3_Missense_Mutation_p.G152R			O43557	TNF14_HUMAN	tumor necrosis factor (ligand) superfamily, member 14	188					apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|immune response (GO:0006955)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of T cell chemotaxis (GO:0010820)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|receptor binding (GO:0005102)	p.G188R(1)		breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18						GTGGCCCGTCCGCAGGGTGAC	0.682																																																	1	Substitution - Missense(1)	ovary(1)											72.0	62.0	66.0					19																	6665098		2203	4300	6503	SO:0001583	missense	0			AF036581	CCDS12171.1, CCDS45939.1	19p13.3	2008-02-05				ENSG00000125735		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11930	protein-coding gene	gene with protein product		604520				9462508	Standard	NM_172014		Approved	LIGHT, LTg, HVEM-L, CD258	uc002mfk.2	O43557		ENST00000599359.1:c.562G>A	19.37:g.6665098C>T	ENSP00000469049:p.Gly188Arg		A8K7M2|C9J5H4|O75476|Q6FHA1|Q8WVF8|Q96LD2	Missense_Mutation	SNP	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pfscan_TNF_dom,prints_TNF	p.G188R	ENST00000599359.1	37	c.562	CCDS12171.1	19	.	.	.	.	.	.	.	.	.	.	C	2.644	-0.283525	0.05642	.	.	ENSG00000125735	ENST00000245912;ENST00000326176	D	0.94330	-3.4	4.67	1.32	0.21799	Tumour necrosis factor (3);Tumour necrosis factor-like (2);	0.543316	0.18528	N	0.138579	D	0.83783	0.5329	L	0.35854	1.095	0.09310	N	1	P;B	0.38788	0.647;0.288	B;B	0.28139	0.086;0.016	T	0.72997	-0.4121	10	0.21014	T	0.42	-3.8979	5.4069	0.16326	0.139:0.6153:0.0:0.2458	.	188;152	O43557;O43557-2	TNF14_HUMAN;.	R	188;152	ENSP00000326940:G152R	ENSP00000245912:G188R	G	-	1	0	TNFSF14	6616098	0.000000	0.05858	0.003000	0.11579	0.012000	0.07955	-0.525000	0.06214	0.417000	0.25871	-1.036000	0.02392	GGA	TNFSF14	-	pfam_TNF_dom,superfamily_Tumour_necrosis_fac-like_dom,smart_TNF_dom,pfscan_TNF_dom	ENSG00000125735		0.682	TNFSF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF14	HGNC	protein_coding	OTTHUMT00000457863.1	-	0.00	29	0	C			6665098	-1	tier1	-	no_errors	ENST00000599359	ensembl	human	known	74_37	missense	39.13	14	9	SNP	0.001	T
TNRC18	84629	genome.wustl.edu	37	7	5353350	5353350	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr7:5353350G>A	ENST00000430969.1	-	27	7520	c.7172C>T	c.(7171-7173)cCg>cTg	p.P2391L	TNRC18_ENST00000399537.4_Missense_Mutation_p.P2391L	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	2391	Pro-rich.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CGGCGGTGCCGGGCGCGCCTT	0.706																																																	0													11.0	13.0	13.0					7																	5353350		1559	3568	5127	SO:0001583	missense	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.7172C>T	7.37:g.5353350G>A	ENSP00000395538:p.Pro2391Leu		A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.P2391L	ENST00000430969.1	37	c.7172	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	g	1.200	-0.632896	0.03584	.	.	ENSG00000182095	ENST00000399537;ENST00000430969	T;T	0.11495	2.77;2.77	4.73	0.103	0.14526	.	0.788562	0.10395	N	0.679923	T	0.07954	0.0199	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.34254	-0.9836	10	0.62326	D	0.03	.	6.6427	0.22919	0.6691:0.0:0.3309:0.0	.	2391	O15417	TNC18_HUMAN	L	2391	ENSP00000382452:P2391L;ENSP00000395538:P2391L	ENSP00000382452:P2391L	P	-	2	0	TNRC18	5319876	0.090000	0.21635	0.010000	0.14722	0.010000	0.07245	0.575000	0.23729	0.094000	0.17404	-0.258000	0.10820	CCG	TNRC18	-	NULL	ENSG00000182095		0.706	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		-	0.00	148	0	G			5353350	-1	tier1	-	no_errors	ENST00000399537	ensembl	human	known	74_37	missense	38.10	52	32	SNP	0.007	A
TNS4	84951	genome.wustl.edu	37	17	38643518	38643518	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr17:38643518A>G	ENST00000254051.6	-	4	1216	c.1058T>C	c.(1057-1059)cTg>cCg	p.L353P		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	353					apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			TTCTTTGGCCAGTGGTGGAGA	0.577																																																	0													154.0	142.0	146.0					17																	38643518		2203	4300	6503	SO:0001583	missense	0			AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.1058T>C	17.37:g.38643518A>G	ENSP00000254051:p.Leu353Pro		A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Missense_Mutation	SNP	pfam_PTB,pfam_SH2,smart_SH2,smart_PTB/PI_dom,pfscan_SH2	p.L353P	ENST00000254051.6	37	c.1058	CCDS11368.1	17	.	.	.	.	.	.	.	.	.	.	A	7.087	0.571314	0.13623	.	.	ENSG00000131746	ENST00000377816;ENST00000254051	T	0.18960	2.18	5.23	2.87	0.33458	.	8.536320	0.00166	N	0.000000	T	0.16642	0.0400	L	0.27053	0.805	0.09310	N	0.999999	B	0.10296	0.003	B	0.10450	0.005	T	0.18398	-1.0338	10	0.38643	T	0.18	-1.1318	3.8915	0.09120	0.6354:0.0:0.0946:0.2699	.	353	Q8IZW8	TENS4_HUMAN	P	353	ENSP00000254051:L353P	ENSP00000254051:L353P	L	-	2	0	TNS4	35897044	0.003000	0.15002	0.143000	0.22291	0.659000	0.38960	0.730000	0.26043	0.828000	0.34709	0.533000	0.62120	CTG	TNS4	-	NULL	ENSG00000131746		0.577	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS4	HGNC	protein_coding	OTTHUMT00000257154.3	-	0.00	97	0	A	NM_032865		38643518	-1	tier1	-	no_errors	ENST00000254051	ensembl	human	known	74_37	missense	27.27	48	18	SNP	0.002	G
TRDMT1	1787	genome.wustl.edu	37	10	17210898	17210898	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:17210898A>C	ENST00000377799.3	-	3	240	c.193T>G	c.(193-195)Ttt>Gtt	p.F65V	TRDMT1_ENST00000377766.5_Intron|TRDMT1_ENST00000488990.1_Intron|TRDMT1_ENST00000457442.2_Intron|TRDMT1_ENST00000358282.7_Intron|TRDMT1_ENST00000412821.3_Missense_Mutation_p.F65V|TRDMT1_ENST00000452380.2_5'UTR|TRDMT1_ENST00000351358.4_Missense_Mutation_p.F65V	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1	65	SAM-dependent MTase C5-type. {ECO:0000255|PROSITE-ProRule:PRU01016}.				C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)			breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	AATCTGTCAAACTCTTCGAGT	0.358																																																	0													68.0	67.0	67.0					10																	17210898		2203	4300	6503	SO:0001583	missense	0			AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.193T>G	10.37:g.17210898A>C	ENSP00000367030:p.Phe65Val		B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	Missense_Mutation	SNP	pfam_C5_MeTfrase,prints_C5_MeTfrase,tigrfam_C5_MeTfrase	p.F65V	ENST00000377799.3	37	c.193	CCDS7114.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.32|15.32	2.797980|2.797980	0.50208|0.50208	.|.	.|.	ENSG00000107614|ENSG00000107614	ENST00000377799;ENST00000412821;ENST00000351358;ENST00000525762|ENST00000313936	D;D;D;D|.	0.85171|.	-1.95;-1.95;-1.95;-1.95|.	5.95|5.95	5.95|5.95	0.96441|0.96441	.|.	0.043340|.	0.85682|.	D|.	0.000000|.	T|T	0.54679|0.54679	0.1873|0.1873	L|L	0.38531|0.38531	1.155|1.155	0.80722|0.80722	D|D	1|1	P;B;B|.	0.47604|.	0.898;0.137;0.038|.	B;B;B|.	0.43658|.	0.426;0.309;0.306|.	T|T	0.52873|0.52873	-0.8517|-0.8517	10|5	0.21014|.	T|.	0.42|.	-29.2127|-29.2127	10.4455|10.4455	0.44490|0.44490	0.9272:0.0:0.0728:0.0|0.9272:0.0:0.0728:0.0	.|.	65;65;65|.	O14717-3;O14717-2;O14717|.	.;.;TRDMT_HUMAN|.	V|G	65;65;65;47|44	ENSP00000367030:F65V;ENSP00000409354:F65V;ENSP00000324328:F65V;ENSP00000431476:F47V|.	ENSP00000324328:F65V|.	F|V	-|-	1|2	0|0	TRDMT1|TRDMT1	17250904|17250904	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.897000|0.897000	0.52465|0.52465	5.915000|5.915000	0.69973|0.69973	2.281000|2.281000	0.76405|0.76405	0.528000|0.528000	0.53228|0.53228	TTT|GTT	TRDMT1	-	pfam_C5_MeTfrase,tigrfam_C5_MeTfrase	ENSG00000107614		0.358	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRDMT1	HGNC	protein_coding	OTTHUMT00000047024.3	-	0.00	42	0	A	NM_004412		17210898	-1	tier1	-	no_errors	ENST00000377799	ensembl	human	known	74_37	missense	50.00	21	21	SNP	1.000	C
TRIM62	55223	genome.wustl.edu	37	1	33613224	33613224	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:33613224G>A	ENST00000291416.5	-	5	1215	c.982C>T	c.(982-984)Cag>Tag	p.Q328*	TRIM62_ENST00000543586.1_Nonsense_Mutation_p.Q207*	NM_018207.2	NP_060677.2	Q9BVG3	TRI62_HUMAN	tripartite motif containing 62	328	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				innate immune response (GO:0045087)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)				GGCGAGTCCTGCAGTGGCTGT	0.627																																																	0													61.0	64.0	63.0					1																	33613224		2203	4299	6502	SO:0001587	stop_gained	0			BC007999	CCDS376.1	1p35.1	2013-10-11	2011-01-25		ENSG00000116525	ENSG00000116525		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	25574	protein-coding gene	gene with protein product	"""ductal epithelium-associated RING Chromosome 1"""		"""tripartite motif-containing 62"""			19536326	Standard	NM_018207		Approved	FLJ10759, DEAR1	uc001bxb.3	Q9BVG3	OTTHUMG00000004132	ENST00000291416.5:c.982C>T	1.37:g.33613224G>A	ENSP00000291416:p.Gln328*		B3KVH5|B4DTE4|D3DPR1|Q9NVG0	Nonsense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Q328*	ENST00000291416.5	37	c.982	CCDS376.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.693995	0.97768	.	.	ENSG00000116525	ENST00000291416;ENST00000373432;ENST00000373430;ENST00000543586	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	17.4143	0.87495	0.0:0.0:1.0:0.0	.	.	.	.	X	328;328;328;207	.	ENSP00000291416:Q328X	Q	-	1	0	TRIM62	33385811	1.000000	0.71417	0.998000	0.56505	0.913000	0.54294	6.286000	0.72665	2.721000	0.93114	0.491000	0.48974	CAG	TRIM62	-	superfamily_ConA-like_lec_gl_sf,smart_PRY,pfscan_B30.2/SPRY	ENSG00000116525		0.627	TRIM62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM62	HGNC	protein_coding	OTTHUMT00000011890.1	-	0.00	185	0	G	NM_018207		33613224	-1	tier1	-	no_errors	ENST00000291416	ensembl	human	known	74_37	nonsense	24.58	89	29	SNP	1.000	A
TRIM58	25893	genome.wustl.edu	37	1	248039764	248039764	+	Silent	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:248039764T>C	ENST00000366481.3	+	6	1482	c.1434T>C	c.(1432-1434)gcT>gcC	p.A478A	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	478						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TAGATCCTGCTTCTGATGTAA	0.443																																																	0													69.0	65.0	66.0					1																	248039764		2203	4300	6503	SO:0001819	synonymous_variant	0			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1434T>C	1.37:g.248039764T>C			Q6B0H9	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.A478	ENST00000366481.3	37	c.1434	CCDS1636.1	1																																																																																			TRIM58	-	NULL	ENSG00000162722		0.443	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM58	HGNC	protein_coding	OTTHUMT00000096860.1	-	0.00	35	0	T	NM_015431		248039764	+1	tier1	-	no_errors	ENST00000366481	ensembl	human	known	74_37	silent	19.61	41	10	SNP	0.000	C
TRPM3	80036	genome.wustl.edu	37	9	73206023	73206023	+	Silent	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:73206023T>C	ENST00000377111.2	-	21	3354	c.3111A>G	c.(3109-3111)tcA>tcG	p.S1037S	TRPM3_ENST00000396285.1_Silent_p.S884S|TRPM3_ENST00000396292.4_Silent_p.S909S|TRPM3_ENST00000358082.3_Silent_p.S899S|TRPM3_ENST00000360823.2_Silent_p.S899S|TRPM3_ENST00000423814.3_Silent_p.S1064S|TRPM3_ENST00000408909.2_Silent_p.S896S|TRPM3_ENST00000377106.1_Silent_p.S909S|TRPM3_ENST00000377105.1_Silent_p.S896S|TRPM3_ENST00000357533.2_Silent_p.S1041S|TRPM3_ENST00000377110.3_Silent_p.S1037S|TRPM3_ENST00000396280.5_Silent_p.S886S	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1062					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CCAGTTTCCATGATGGCTCCT	0.443																																																	0													157.0	140.0	146.0					9																	73206023		2203	4300	6503	SO:0001819	synonymous_variant	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.3111A>G	9.37:g.73206023T>C			A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	pfam_Ion_trans_dom	p.S1064	ENST00000377111.2	37	c.3192		9	.	.	.	.	.	.	.	.	.	.	T	7.157	0.584906	0.13749	.	.	ENSG00000083067	ENST00000396280	.	.	.	5.77	-1.76	0.08006	.	.	.	.	.	T	0.41789	0.1174	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.30504	-0.9976	4	.	.	.	-9.2674	2.7561	0.05293	0.1107:0.2225:0.1083:0.5585	.	.	.	.	V	886	.	.	M	-	1	0	TRPM3	72395843	0.837000	0.29446	0.997000	0.53966	0.998000	0.95712	-0.187000	0.09656	-0.164000	0.10927	0.519000	0.50382	ATG	TRPM3	-	pfam_Ion_trans_dom	ENSG00000083067		0.443	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5	-	0.00	49	0	T	NM_206945		73206023	-1	tier1	-	no_errors	ENST00000423814	ensembl	human	known	74_37	silent	13.64	19	3	SNP	0.990	C
TTC27	55622	genome.wustl.edu	37	2	32859031	32859031	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:32859031C>T	ENST00000317907.4	+	3	586	c.355C>T	c.(355-357)Cag>Tag	p.Q119*	MIR4765_ENST00000585007.1_RNA	NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	119										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						CTTACACCCTCAGGACTTTTT	0.363																																																	0													130.0	127.0	128.0					2																	32859031		2203	4300	6503	SO:0001587	stop_gained	0			BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.355C>T	2.37:g.32859031C>T	ENSP00000313953:p.Gln119*		A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Nonsense_Mutation	SNP	pfam_TPR_2,pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q119*	ENST00000317907.4	37	c.355	CCDS33176.1	2	.	.	.	.	.	.	.	.	.	.	C	34	5.311594	0.95655	.	.	ENSG00000018699	ENST00000448773;ENST00000317907	.	.	.	5.53	5.53	0.82687	.	0.339062	0.29791	N	0.011199	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-7.6938	14.5168	0.67824	0.0:0.8524:0.1476:0.0	.	.	.	.	X	69;119	.	ENSP00000313953:Q119X	Q	+	1	0	TTC27	32712535	1.000000	0.71417	1.000000	0.80357	0.592000	0.36648	2.982000	0.49337	2.587000	0.87381	0.563000	0.77884	CAG	TTC27	-	NULL	ENSG00000018699		0.363	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC27	HGNC	protein_coding	OTTHUMT00000325395.1	-	0.00	99	0	C	NM_017735		32859031	+1	tier1	-	no_errors	ENST00000317907	ensembl	human	known	74_37	nonsense	48.53	35	33	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179449464	179449464	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:179449464C>T	ENST00000591111.1	-	260	60205	c.59981G>A	c.(59980-59982)cGt>cAt	p.R19994H	TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R21635H|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R19067H|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R12695H|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R12762H|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R12570H			Q8WZ42	TITIN_HUMAN	titin	19994	Fibronectin type-III 44. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.R12695H(1)|p.R19065H(1)|p.R12570H(1)|p.R12762H(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTTTCAGCACGGACCCGGAA	0.488																																																	4	Substitution - Missense(4)	large_intestine(4)											179.0	178.0	178.0					2																	179449464		1919	4115	6034	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.59981G>A	2.37:g.179449464C>T	ENSP00000465570:p.Arg19994His		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R19067H	ENST00000591111.1	37	c.57200		2	.	.	.	.	.	.	.	.	.	.	C	25.7	4.665617	0.88251	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	6.17	6.17	0.99709	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78123	0.4234	M	0.85630	2.765	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.79200	-0.1901	9	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	12570;12695;12762;19994	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	19067;12570;12762;12695;12568	ENSP00000343764:R19067H;ENSP00000434586:R12570H;ENSP00000340554:R12762H;ENSP00000352154:R12695H	ENSP00000340554:R12762H	R	-	2	0	TTN	179157710	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.038000	0.70964	2.941000	0.99782	0.655000	0.94253	CGT	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.488	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	54	0	C	NM_133378		179449464	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179596613	179596613	+	Silent	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:179596613A>G	ENST00000591111.1	-	56	16262	c.16038T>C	c.(16036-16038)acT>acC	p.T5346T	TTN_ENST00000589042.1_Silent_p.T5663T|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.T4419T|TTN_ENST00000359218.5_Intron|TTN_ENST00000342175.6_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000582847.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12164	Ig-like 34.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAAAGGGAGGAGTGCCTGCCA	0.423																																																	0													109.0	113.0	111.0					2																	179596613		2036	4207	6243	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.16038T>C	2.37:g.179596613A>G			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.T4419	ENST00000591111.1	37	c.13257		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	33	0	A	NM_133378		179596613	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	silent	42.42	19	14	SNP	0.000	G
TUB	7275	genome.wustl.edu	37	11	8117062	8117062	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:8117062G>C	ENST00000299506.2	+	5	564	c.415G>C	c.(415-417)Gca>Cca	p.A139P	TUB_ENST00000305253.4_Missense_Mutation_p.A194P|TUB_ENST00000534099.1_Missense_Mutation_p.A145P	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	139					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)			breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		CGGGCCAGCAGCACTGGCAGA	0.637																																																	0													32.0	36.0	34.0					11																	8117062		2196	4293	6489	SO:0001583	missense	0			U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.415G>C	11.37:g.8117062G>C	ENSP00000299506:p.Ala139Pro		D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_N,prints_Tubby_C	p.A194P	ENST00000299506.2	37	c.580	CCDS7787.1	11	.	.	.	.	.	.	.	.	.	.	G	13.23	2.175409	0.38413	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.86694	-2.12;-2.16;-2.12	4.79	1.08	0.20341	Tubby, N-terminal (1);	0.477981	0.21800	N	0.068936	D	0.87293	0.6141	L	0.59436	1.845	0.34146	D	0.666981	B;P;D	0.57571	0.003;0.855;0.98	B;B;P	0.58331	0.002;0.271;0.837	D	0.84497	0.0614	10	0.15952	T	0.53	-11.5511	8.154	0.31158	0.1932:0.0:0.6863:0.1204	.	145;139;194	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	P	145;194;139	ENSP00000434400:A145P;ENSP00000305426:A194P;ENSP00000299506:A139P	ENSP00000299506:A139P	A	+	1	0	TUB	8073638	1.000000	0.71417	0.979000	0.43373	0.950000	0.60333	2.779000	0.47734	-0.102000	0.12197	-0.797000	0.03246	GCA	TUB	-	prints_Tubby_N	ENSG00000166402		0.637	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TUB	HGNC	protein_coding	OTTHUMT00000385823.1	-	0.00	54	0	G	NM_003320		8117062	+1	tier1	-	no_errors	ENST00000305253	ensembl	human	known	74_37	missense	21.88	25	7	SNP	0.978	C
TUBA3C	7278	genome.wustl.edu	37	13	19751617	19751617	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr13:19751617A>C	ENST00000400113.3	-	4	610	c.506T>G	c.(505-507)tTt>tGt	p.F169C		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	169					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GTAAATGGCAAATTCTAGCTT	0.572																																																	0													133.0	137.0	136.0					13																	19751617		2203	4300	6503	SO:0001583	missense	0			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.506T>G	13.37:g.19751617A>C	ENSP00000382982:p.Phe169Cys		A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.F169C	ENST00000400113.3	37	c.506	CCDS9284.1	13	.	.	.	.	.	.	.	.	.	.	a	7.602	0.672940	0.14776	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.72167	-0.63	1.19	1.19	0.21007	.	0.000000	0.49916	U	0.000136	T	0.72471	0.3464	.	.	.	0.40262	D	0.978187	.	.	.	.	.	.	T	0.72808	-0.4181	7	0.87932	D	0	.	6.5194	0.22266	1.0:0.0:0.0:0.0	.	.	.	.	C	169	ENSP00000382982:F169C	ENSP00000354037:F169C	F	-	2	0	TUBA3C	18649617	1.000000	0.71417	0.988000	0.46212	0.275000	0.26752	7.511000	0.81718	0.801000	0.34066	0.136000	0.15936	TTT	TUBA3C	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Alpha_tubulin,prints_Tubulin	ENSG00000198033		0.572	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	HGNC	protein_coding	OTTHUMT00000044007.2	-	0.00	85	0	A	NM_006001		19751617	-1	tier1	-	no_errors	ENST00000400113	ensembl	human	known	74_37	missense	44.44	30	24	SNP	1.000	C
ULK3	25989	genome.wustl.edu	37	15	75134440	75134440	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr15:75134440C>T	ENST00000440863.2	-	3	431	c.340G>A	c.(340-342)Gcg>Acg	p.A114T	ULK3_ENST00000569437.1_Missense_Mutation_p.A114T|ULK3_ENST00000568667.1_Missense_Mutation_p.A125T	NM_001099436.1	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51 like kinase 3	114	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cellular senescence (GO:0090398)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)	2						AAGACACGCGCCACCTTCTCA	0.572																																																	0													117.0	125.0	122.0					15																	75134440		2115	4233	6348	SO:0001583	missense	0			BC048289		15q24.1	2013-07-02	2013-07-02			ENSG00000140474			19703	protein-coding gene	gene with protein product		613472	"""unc-51-like kinase 3 (C. elegans)"""				Standard	XM_005254289		Approved	DKFZP434C131, FLJ90566	uc010bkf.1	Q6PHR2		ENST00000440863.2:c.340G>A	15.37:g.75134440C>T	ENSP00000400312:p.Ala114Thr		B2RXK3|B4DRQ7|D3DW68|Q9NPN5|Q9UFS4	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIT,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_MIT,pfscan_Prot_kinase_dom	p.A114T	ENST00000440863.2	37	c.340	CCDS45305.1	15	.	.	.	.	.	.	.	.	.	.	C	23.0	4.364261	0.82463	.	.	ENSG00000140474	ENST00000440863;ENST00000418051	T	0.68025	-0.3	5.53	5.53	0.82687	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.112642	0.64402	D	0.000014	T	0.66713	0.2817	L	0.41027	1.25	0.51012	D	0.999902	B;B;B;B;B	0.32893	0.372;0.277;0.362;0.389;0.211	B;B;B;B;B	0.42163	0.256;0.179;0.323;0.378;0.066	T	0.63355	-0.6656	10	0.33940	T	0.23	-5.4892	18.0717	0.89410	0.0:1.0:0.0:0.0	.	24;125;24;114;114	B4DEJ1;B4DFT0;B4DFS6;Q6PHR2;Q6PHR2-3	.;.;.;ULK3_HUMAN;.	T	114;125	ENSP00000400312:A114T	ENSP00000393658:A125T	A	-	1	0	ULK3	72921493	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	4.578000	0.60929	2.605000	0.88082	0.655000	0.94253	GCG	ULK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000140474		0.572	ULK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ULK3	HGNC	protein_coding	OTTHUMT00000421734.4	-	0.00	40	0	C	NM_015518		75134440	-1	tier1	-	no_errors	ENST00000440863	ensembl	human	known	74_37	missense	50.00	16	16	SNP	1.000	T
USP20	10868	genome.wustl.edu	37	9	132637912	132637912	+	Silent	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr9:132637912G>T	ENST00000315480.4	+	21	2450	c.2292G>T	c.(2290-2292)ctG>ctT	p.L764L	USP20_ENST00000372429.3_Silent_p.L764L|USP20_ENST00000358355.1_Silent_p.L764L			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	764	DUSP 1. {ECO:0000255|PROSITE- ProRule:PRU00613}.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				GGGAGCACCTGTACAACAGGT	0.612																																																	0													74.0	77.0	76.0					9																	132637912		2031	4184	6215	SO:0001819	synonymous_variant	0			AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.2292G>T	9.37:g.132637912G>T			Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Silent	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,pfam_Znf_UBP,smart_Znf_UBP,smart_Pept_C19_DUSP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.L764	ENST00000315480.4	37	c.2292	CCDS43892.1	9																																																																																			USP20	-	smart_Pept_C19_DUSP	ENSG00000136878		0.612	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	USP20	HGNC	protein_coding	OTTHUMT00000054604.2		0.00	54	0	G			132637912	+1			no_errors	ENST00000315480	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.959	T
USPL1	10208	genome.wustl.edu	37	13	31233169	31233169	+	Silent	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr13:31233169G>T	ENST00000255304.4	+	9	3297	c.2955G>T	c.(2953-2955)ctG>ctT	p.L985L		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	985					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		CAACAGAGCTGTCAGAAAATG	0.433																																					Ovarian(60;318 1180 1554 28110 31601)												0													128.0	125.0	126.0					13																	31233169		2203	4300	6503	SO:0001819	synonymous_variant	0			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.2955G>T	13.37:g.31233169G>T			Q14109|Q6AI45|Q8IY30|Q8IYE8	Silent	SNP	pfscan_Peptidase_C19/C67	p.L985	ENST00000255304.4	37	c.2955	CCDS9336.1	13																																																																																			USPL1	-	NULL	ENSG00000132952		0.433	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	-	0.00	61	0	G	NM_005800		31233169	+1	tier1	-	no_errors	ENST00000255304	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.062	T
VASH1	22846	genome.wustl.edu	37	14	77229456	77229456	+	Missense_Mutation	SNP	G	G	C	rs543576491		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr14:77229456G>C	ENST00000167106.4	+	1	925	c.292G>C	c.(292-294)Gcc>Ccc	p.A98P	RP11-99E15.2_ENST00000556271.1_lincRNA|VASH1_ENST00000554237.1_Missense_Mutation_p.A98P	NM_014909.4	NP_055724.1	Q7L8A9	VASH1_HUMAN	vasohibin 1	98					angiogenesis (GO:0001525)|cell cycle arrest (GO:0007050)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of lymphangiogenesis (GO:1901491)|regulation of cellular senescence (GO:2000772)|response to wounding (GO:0009611)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)				breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|urinary_tract(3)	10			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0283)		GATCCGTGGGGCCACAGACCT	0.602																																																	0													36.0	26.0	29.0					14																	77229456		2152	4212	6364	SO:0001583	missense	0			AB028959	CCDS9851.1	14q24.3	2006-09-25	2005-08-16	2005-08-16		ENSG00000071246			19964	protein-coding gene	gene with protein product		609011	"""KIAA1036"""	KIAA1036			Standard	NM_014909		Approved		uc001xst.2	Q7L8A9		ENST00000167106.4:c.292G>C	14.37:g.77229456G>C	ENSP00000167106:p.Ala98Pro		Q96H02|Q9UBF4|Q9Y629	Missense_Mutation	SNP	NULL	p.A98P	ENST00000167106.4	37	c.292	CCDS9851.1	14	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681749	0.88542	.	.	ENSG00000071246	ENST00000167106;ENST00000554237	.	.	.	5.33	5.33	0.75918	.	0.208577	0.50627	D	0.000112	T	0.71676	0.3368	M	0.61703	1.905	0.80722	D	1	P;D	0.60575	0.514;0.988	B;P	0.53689	0.246;0.732	T	0.73607	-0.3929	9	0.54805	T	0.06	-9.1354	18.1485	0.89667	0.0:0.0:1.0:0.0	.	98;98	Q7L8A9;Q7L8A9-2	VASH1_HUMAN;.	P	98	.	ENSP00000167106:A98P	A	+	1	0	VASH1	76299209	1.000000	0.71417	0.981000	0.43875	0.997000	0.91878	5.920000	0.70017	2.660000	0.90430	0.655000	0.94253	GCC	VASH1	-	NULL	ENSG00000071246		0.602	VASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VASH1	HGNC	protein_coding	OTTHUMT00000413706.1		0.00	59	0	G	NM_014909		77229456	+1			no_errors	ENST00000167106	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.997	C
VCAN	1462	genome.wustl.edu	37	5	82815484	82815484	+	Silent	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:82815484A>G	ENST00000265077.3	+	7	1924	c.1359A>G	c.(1357-1359)tcA>tcG	p.S453S	VCAN_ENST00000502527.2_Intron|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000342785.4_Silent_p.S453S|VCAN_ENST00000512590.2_Silent_p.S405S	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	453	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TAGACATATCAGAAATTAAGG	0.463																																																	0													78.0	80.0	79.0					5																	82815484		2203	4300	6503	SO:0001819	synonymous_variant	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.1359A>G	5.37:g.82815484A>G			P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Silent	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EG-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.S453	ENST00000265077.3	37	c.1359	CCDS4060.1	5																																																																																			VCAN	-	NULL	ENSG00000038427		0.463	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	-	0.00	38	0	A	NM_004385		82815484	+1	tier1	-	no_errors	ENST00000265077	ensembl	human	known	74_37	silent	21.95	32	9	SNP	0.996	G
VEPH1	79674	genome.wustl.edu	37	3	157004431	157004431	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr3:157004431T>G	ENST00000362010.2	-	12	2350	c.2043A>C	c.(2041-2043)gaA>gaC	p.E681D	RP11-550I24.2_ENST00000475102.1_RNA|VEPH1_ENST00000392832.2_Missense_Mutation_p.E681D|RP11-550I24.2_ENST00000488040.1_RNA|RP11-550I24.2_ENST00000487238.1_RNA|VEPH1_ENST00000392833.2_Missense_Mutation_p.E636D|RP11-550I24.2_ENST00000494885.1_RNA|VEPH1_ENST00000543418.1_Missense_Mutation_p.E636D	NM_001167912.1	NP_001161384.1	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain-containing 1	681						plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|cervix(1)|kidney(3)|large_intestine(9)|lung(22)|ovary(1)|pancreas(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			AGAACCTCACTTCTTCCAGAT	0.483																																																	0													167.0	147.0	154.0					3																	157004431		2203	4300	6503	SO:0001583	missense	0			AL713656	CCDS3179.1, CCDS54661.1, CCDS54662.1, CCDS54663.1	3q24-q25	2013-01-10	2012-12-10		ENSG00000197415	ENSG00000197415		"""Pleckstrin homology (PH) domain containing"""	25735	protein-coding gene	gene with protein product		609594	"""ventricular zone expressed PH domain homolog 1 (zebrafish)"""			11214970, 15388229	Standard	NM_024621		Approved	FLJ12604, KIAA1692	uc003fbk.2	Q14D04	OTTHUMG00000158711	ENST00000362010.2:c.2043A>C	3.37:g.157004431T>G	ENSP00000354919:p.Glu681Asp		D3DNL0|F5GZ91|Q2TAA9|Q3MIX2|Q6PEL3|Q86TL5|Q8TCR3|Q96SP7|Q9C0H1|Q9H9Q7	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E681D	ENST00000362010.2	37	c.2043	CCDS3179.1	3	.	.	.	.	.	.	.	.	.	.	T	21.3	4.133655	0.77662	.	.	ENSG00000197415	ENST00000392833;ENST00000362010;ENST00000543418;ENST00000392832	T;T;T;T	0.09630	2.96;3.0;2.96;3.0	6.0	3.64	0.41730	.	0.049063	0.85682	D	0.000000	T	0.10937	0.0267	L	0.60455	1.87	0.80722	D	1	P;B	0.43231	0.801;0.179	B;B	0.37451	0.25;0.092	T	0.08351	-1.0726	10	0.36615	T	0.2	1.0783	9.3893	0.38363	0.0:0.1458:0.0:0.8542	.	636;681	Q14D04-2;Q14D04	.;MELT_HUMAN	D	636;681;636;681	ENSP00000376578:E636D;ENSP00000354919:E681D;ENSP00000446258:E636D;ENSP00000376577:E681D	ENSP00000354919:E681D	E	-	3	2	VEPH1	158487125	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.647000	0.46639	0.528000	0.28580	0.519000	0.50382	GAA	VEPH1	-	NULL	ENSG00000197415		0.483	VEPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEPH1	HGNC	protein_coding	OTTHUMT00000351845.3	-	0.00	37	0	T	NM_024621		157004431	-1	tier1	-	no_errors	ENST00000362010	ensembl	human	known	74_37	missense	56.10	17	23	SNP	1.000	G
VN1R2	317701	genome.wustl.edu	37	19	53762203	53762203	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:53762203A>T	ENST00000341702.3	+	1	659	c.575A>T	c.(574-576)aAc>aTc	p.N192I		NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	192					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		ATCACCATCAACCCTAGGAAC	0.493																																																	0													44.0	44.0	44.0					19																	53762203		2203	4300	6503	SO:0001583	missense	0			AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.575A>T	19.37:g.53762203A>T	ENSP00000351244:p.Asn192Ile		A1L411|Q8TDU4	Missense_Mutation	SNP	pfam_Vmron_rcpt_1,pfam_GPCR_Rhodpsn,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	p.N192I	ENST00000341702.3	37	c.575	CCDS12862.1	19	.	.	.	.	.	.	.	.	.	.	A	8.948	0.967514	0.18659	.	.	ENSG00000196131	ENST00000341702	T	0.36520	1.25	2.94	-1.02	0.10135	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.27524	0.0676	N	0.11064	0.09	0.09310	N	1	P	0.52316	0.952	P	0.55871	0.786	T	0.14924	-1.0455	9	0.87932	D	0	.	3.7553	0.08582	0.4778:0.1958:0.3264:0.0	.	192	Q8NFZ6	VN1R2_HUMAN	I	192	ENSP00000351244:N192I	ENSP00000351244:N192I	N	+	2	0	VN1R2	58454015	0.020000	0.18652	0.007000	0.13788	0.050000	0.14768	-0.093000	0.11111	-0.124000	0.11724	0.486000	0.48141	AAC	VN1R2	-	pfam_Vmron_rcpt_1,pfam_GPCR_Rhodpsn,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM,prints_Vmron_rcpt_1	ENSG00000196131		0.493	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VN1R2	HGNC	protein_coding	OTTHUMT00000464285.1	-	0.00	77	0	A	NM_173856		53762203	+1	tier1	-	no_errors	ENST00000341702	ensembl	human	known	74_37	missense	34.62	34	18	SNP	0.029	T
WASF1	8936	genome.wustl.edu	37	6	110428322	110428322	+	Silent	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr6:110428322C>T	ENST00000392589.1	-	7	1334	c.498G>A	c.(496-498)ttG>ttA	p.L166L	WASF1_ENST00000392588.1_Silent_p.L166L|WASF1_ENST00000359451.2_Silent_p.L166L|WASF1_ENST00000392586.1_Silent_p.L166L|WASF1_ENST00000392587.2_Silent_p.L166L	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	166					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		CTGTATCTTGCAACATTTTTT	0.289																																																	0													112.0	110.0	111.0					6																	110428322		2203	4300	6503	SO:0001819	synonymous_variant	0			D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.498G>A	6.37:g.110428322C>T			E1P5F2|Q5SZK7	Silent	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.L166	ENST00000392589.1	37	c.498	CCDS5080.1	6																																																																																			WASF1	-	NULL	ENSG00000112290		0.289	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF1	HGNC	protein_coding	OTTHUMT00000041784.3	-	0.00	47	0	C	NM_003931		110428322	-1	tier1	-	no_errors	ENST00000359451	ensembl	human	known	74_37	silent	50.00	23	23	SNP	1.000	T
WDR7	23335	genome.wustl.edu	37	18	54426150	54426150	+	Silent	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr18:54426150T>C	ENST00000254442.3	+	16	3025	c.2814T>C	c.(2812-2814)acT>acC	p.T938T	WDR7_ENST00000357574.3_Silent_p.T938T|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	938					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		CCCCTCCAACTTCCAGTAATA	0.368																																																	0													67.0	71.0	69.0					18																	54426150		2203	4300	6503	SO:0001819	synonymous_variant	0			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.2814T>C	18.37:g.54426150T>C			A7E2C8|Q86UX5|Q86VP2|Q96PS7	Silent	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T938	ENST00000254442.3	37	c.2814	CCDS11962.1	18																																																																																			WDR7	-	NULL	ENSG00000091157		0.368	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	-	0.00	110	0	T			54426150	+1	tier1	-	no_errors	ENST00000254442	ensembl	human	known	74_37	silent	53.73	31	36	SNP	0.997	C
WDR87	83889	genome.wustl.edu	37	19	38380298	38380298	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:38380298T>G	ENST00000303868.5	-	6	4120	c.3896A>C	c.(3895-3897)aAg>aCg	p.K1299T	WDR87_ENST00000447313.2_Missense_Mutation_p.K1338T	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1299										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						AAGCAGAACCTTACTTTCTTT	0.473																																																	0													138.0	105.0	115.0					19																	38380298		692	1591	2283	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.3896A>C	19.37:g.38380298T>G	ENSP00000368025:p.Lys1299Thr		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K1338T	ENST00000303868.5	37	c.4013	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	T	4.603	0.112142	0.08831	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.10382	2.88;2.88	3.6	2.54	0.30619	.	1.762360	0.03505	N	0.218691	T	0.07234	0.0183	N	0.14661	0.345	0.09310	N	1	B;B	0.29432	0.244;0.244	B;B	0.24006	0.05;0.05	T	0.35051	-0.9804	10	0.21014	T	0.42	0.4216	7.6281	0.28224	0.1901:0.0:0.0:0.8099	.	1299;1338	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	T	1338;1299	ENSP00000405012:K1338T;ENSP00000368025:K1299T	ENSP00000368025:K1299T	K	-	2	0	WDR87	43072138	0.002000	0.14202	0.001000	0.08648	0.008000	0.06430	0.309000	0.19332	0.693000	0.31634	0.363000	0.22086	AAG	WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.473	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	-	0.00	33	0	T	XM_940478		38380298	-1	tier1	-	no_errors	ENST00000447313	ensembl	human	known	74_37	missense	39.02	25	16	SNP	0.000	G
WDR90	197335	genome.wustl.edu	37	16	711660	711660	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:711660C>T	ENST00000293879.4	+	31	3737	c.3737C>T	c.(3736-3738)aCc>aTc	p.T1246I	WDR90_ENST00000549091.1_Missense_Mutation_p.T1246I			Q96KV7	WDR90_HUMAN	WD repeat domain 90	1246										endometrium(4)|kidney(3)|large_intestine(2)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	37		Hepatocellular(780;0.0218)				GTGTCCTCCACCCGCCTCCCG	0.682																																																	0													28.0	34.0	32.0					16																	711660		2057	4199	6256	SO:0001583	missense	0			AB067511	CCDS42092.1	16p13.3	2013-01-09			ENSG00000161996	ENSG00000161996		"""WD repeat domain containing"""	26960	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 17"", ""chromosome 16 open reading frame 15"", ""chromosome 16 open reading frame 16"", ""chromosome 16 open reading frame 19"", ""chromosome 16 open reading frame 18"""	C16orf17, C16orf15, C16orf16, C16orf19, C16orf18		11572484, 11157797	Standard	XM_005255160		Approved	FLJ36483, KIAA1924	uc002cii.1	Q96KV7	OTTHUMG00000048040	ENST00000293879.4:c.3737C>T	16.37:g.711660C>T	ENSP00000293879:p.Thr1246Ile		Q0VA87|Q0VA88|Q6P048|Q6ZMS1|Q6ZTH1|Q8N202|Q8N221|Q8NBB8|Q96PW4|Q96S18	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_DUF667,pfam_Nucleoporin_Nup160,superfamily_Quinonprotein_ADH-like_supfam,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T1246I	ENST00000293879.4	37	c.3737	CCDS42092.1	16	.	.	.	.	.	.	.	.	.	.	C	9.534	1.111606	0.20714	.	.	ENSG00000161996	ENST00000549091;ENST00000293879	T;T	0.39997	1.05;3.77	5.63	2.57	0.30868	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.351538	0.29861	U	0.011007	T	0.36580	0.0972	M	0.69523	2.12	0.09310	N	1	P;P	0.43938	0.822;0.741	B;B	0.42282	0.382;0.147	T	0.19582	-1.0301	10	0.24483	T	0.36	.	3.3005	0.06982	0.142:0.5725:0.1373:0.1482	.	1246;1246	F8VUX9;Q96KV7	.;WDR90_HUMAN	I	1246	ENSP00000448122:T1246I;ENSP00000293879:T1246I	ENSP00000293879:T1246I	T	+	2	0	WDR90	651661	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	0.520000	0.22878	0.301000	0.22738	0.561000	0.74099	ACC	WDR90	-	superfamily_Quinonprotein_ADH-like_supfam,pfscan_WD40_repeat_dom	ENSG00000161996		0.682	WDR90-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	WDR90	HGNC	protein_coding	OTTHUMT00000404335.1		0.00	32	0	C	NM_145294		711660	+1			no_errors	ENST00000549091	ensembl	human	novel	74_37	missense	9.30	38	4	SNP	0.000	T
WSCD2	9671	genome.wustl.edu	37	12	108620910	108620910	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr12:108620910T>G	ENST00000332082.4	+	7	1766	c.948T>G	c.(946-948)agT>agG	p.S316R	WSCD2_ENST00000549903.1_Missense_Mutation_p.S316R|WSCD2_ENST00000261400.3_Missense_Mutation_p.S316R|WSCD2_ENST00000547525.1_Missense_Mutation_p.S316R			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	316	WSC 2. {ECO:0000255|PROSITE- ProRule:PRU00558}.					integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						GGACTCCTAGTTACTTCATTG	0.587																																																	0													60.0	64.0	63.0					12																	108620910		2040	4190	6230	SO:0001583	missense	0				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.948T>G	12.37:g.108620910T>G	ENSP00000331933:p.Ser316Arg		B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	pfam_WSC_carb-bd,superfamily_P-loop_NTPase,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.S316R	ENST00000332082.4	37	c.948	CCDS41828.1	12	.	.	.	.	.	.	.	.	.	.	T	10.97	1.501326	0.26861	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.31247	1.51;1.5;1.51;1.5	5.22	-2.16	0.07080	Carbohydrate-binding WSC (1);Carbohydrate-binding WSC, subgroup (1);	0.466207	0.25439	N	0.030670	T	0.12860	0.0312	N	0.14661	0.345	0.22771	N	0.998758	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.21245	-1.0251	10	0.21014	T	0.42	-3.6873	6.6502	0.22957	0.0:0.4235:0.2586:0.3178	.	316;316	Q2TBF2-2;Q2TBF2	.;WSCD2_HUMAN	R	316	ENSP00000448047:S316R;ENSP00000261400:S316R;ENSP00000331933:S316R;ENSP00000447272:S316R	ENSP00000261400:S316R	S	+	3	2	WSCD2	107145040	0.525000	0.26290	0.925000	0.36789	0.996000	0.88848	-0.307000	0.08167	-0.321000	0.08627	0.533000	0.62120	AGT	WSCD2	-	superfamily_P-loop_NTPase,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	ENSG00000075035		0.587	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	HGNC	protein_coding	OTTHUMT00000405554.1	-	0.00	44	0	T	NM_014653		108620910	+1	tier1	-	no_errors	ENST00000261400	ensembl	human	known	74_37	missense	56.52	10	13	SNP	0.798	G
ZC3H12C	85463	genome.wustl.edu	37	11	110007466	110007466	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr11:110007466T>G	ENST00000278590.3	+	2	151	c.100T>G	c.(100-102)Ttg>Gtg	p.L34V	ZC3H12C_ENST00000528673.1_Missense_Mutation_p.L35V|ZC3H12C_ENST00000453089.2_Missense_Mutation_p.L3V	NM_033390.1	NP_203748.1	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	34							endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		CTTCATGGGCTTGAAGGATCA	0.443																																																	0													88.0	88.0	88.0					11																	110007466		2014	4181	6195	SO:0001583	missense	0				CCDS44727.1	11q22.3	2012-07-05			ENSG00000149289	ENSG00000149289		"""Zinc fingers, CCCH-type domain containing"""	29362	protein-coding gene	gene with protein product	"""MCP induced protein 3"""	615001				11214970, 18178554	Standard	NM_033390		Approved	KIAA1726, MCPIP3	uc009yxw.3	Q9C0D7	OTTHUMG00000166572	ENST00000278590.3:c.100T>G	11.37:g.110007466T>G	ENSP00000278590:p.Leu34Val		B4DI65|B4DR47	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.L34V	ENST00000278590.3	37	c.100	CCDS44727.1	11	.	.	.	.	.	.	.	.	.	.	t	16.04	3.009267	0.54361	.	.	ENSG00000149289	ENST00000278590;ENST00000528673;ENST00000453089	T;T;T	0.37058	1.22;1.22;1.26	5.42	2.98	0.34508	.	.	.	.	.	T	0.18923	0.0454	N	0.19112	0.55	0.32770	N	0.503842	B;P;P	0.38020	0.384;0.615;0.615	B;B;B	0.29267	0.07;0.1;0.1	T	0.18777	-1.0326	9	0.34782	T	0.22	-7.5937	8.1662	0.31228	0.0:0.2349:0.0:0.7651	.	35;34;34	B4DR47;B4DI65;Q9C0D7	.;.;ZC12C_HUMAN	V	34;35;3	ENSP00000278590:L34V;ENSP00000431821:L35V;ENSP00000413094:L3V	ENSP00000278590:L34V	L	+	1	2	ZC3H12C	109512676	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.794000	0.26958	0.310000	0.22990	0.528000	0.53228	TTG	ZC3H12C	-	NULL	ENSG00000149289		0.443	ZC3H12C-001	KNOWN	basic|CCDS	protein_coding	ZC3H12C	HGNC	protein_coding	OTTHUMT00000390491.1	-	0.00	61	0	T	NM_033390		110007466	+1	tier1	-	no_errors	ENST00000278590	ensembl	human	known	74_37	missense	14.29	36	6	SNP	0.998	G
ZC3H13	23091	genome.wustl.edu	37	13	46549566	46549566	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr13:46549566G>A	ENST00000242848.4	-	12	2668	c.2320C>T	c.(2320-2322)Cga>Tga	p.R774*	ZC3H13_ENST00000282007.3_Nonsense_Mutation_p.R774*			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	774	Arg/Glu-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		gctctttctcgttcccgttct	0.512																																					Esophageal Squamous(187;747 2077 11056 31291 44172)												0													349.0	271.0	297.0					13																	46549566		2203	4300	6503	SO:0001587	stop_gained	0			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.2320C>T	13.37:g.46549566G>A	ENSP00000242848:p.Arg774*		A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Nonsense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.R774*	ENST00000242848.4	37	c.2320		13	.	.	.	.	.	.	.	.	.	.	G	41	8.836150	0.98972	.	.	ENSG00000123200	ENST00000242848;ENST00000282007	.	.	.	4.72	1.86	0.25419	.	0.000000	0.44285	D	0.000480	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	13.6588	0.62354	0.0:0.0:0.2808:0.7192	.	.	.	.	X	774	.	ENSP00000242848:R774X	R	-	1	2	ZC3H13	45447567	0.999000	0.42202	0.990000	0.47175	0.974000	0.67602	0.668000	0.25127	0.152000	0.19188	0.467000	0.42956	CGA	ZC3H13	-	NULL	ENSG00000123200		0.512	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	HGNC	protein_coding	OTTHUMT00000044789.1		0.00	97	0	G	NM_015070		46549566	-1			no_errors	ENST00000242848	ensembl	human	known	74_37	nonsense	5.06	75	4	SNP	0.993	A
ZC3H7A	29066	genome.wustl.edu	37	16	11861348	11861348	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:11861348C>T	ENST00000396516.2	-	12	1644	c.1447G>A	c.(1447-1449)Gaa>Aaa	p.E483K	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.E483K			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	483						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.E483K(1)		breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						GATTTATCTTCAACATTCTTT	0.289																																																	1	Substitution - Missense(1)	lung(1)											144.0	140.0	141.0					16																	11861348		2195	4300	6495	SO:0001583	missense	0			AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1447G>A	16.37:g.11861348C>T	ENSP00000379773:p.Glu483Lys		D3DUG5|Q9NPE9	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.E483K	ENST00000396516.2	37	c.1447	CCDS10550.1	16	.	.	.	.	.	.	.	.	.	.	C	20.7	4.031068	0.75504	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.10382	2.88;2.88	5.77	5.77	0.91146	.	0.261673	0.43579	D	0.000551	T	0.30854	0.0778	M	0.63843	1.955	0.80722	D	1	D;D	0.67145	0.992;0.996	D;D	0.65874	0.939;0.933	T	0.00134	-1.2009	10	0.41790	T	0.15	.	18.9808	0.92755	0.0:1.0:0.0:0.0	.	204;483	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	K	483	ENSP00000347999:E483K;ENSP00000379773:E483K	ENSP00000347999:E483K	E	-	1	0	ZC3H7A	11768849	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.846000	0.62860	2.729000	0.93468	0.467000	0.42956	GAA	ZC3H7A	-	NULL	ENSG00000122299		0.289	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZC3H7A	HGNC	protein_coding	OTTHUMT00000437066.1	-	0.00	68	0	C	NM_014153		11861348	-1	tier1	-	no_errors	ENST00000355758	ensembl	human	known	74_37	missense	12.63	83	12	SNP	1.000	T
ZFP69B	65243	genome.wustl.edu	37	1	40916691	40916691	+	Missense_Mutation	SNP	C	C	T	rs368099327		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr1:40916691C>T	ENST00000411995.2	+	2	433	c.58C>T	c.(58-60)Cgt>Tgt	p.R20C	ZFP69B_ENST00000361584.3_5'UTR|ZFP69B_ENST00000484445.1_Missense_Mutation_p.R20C	NM_023070.2	NP_075558.2	Q9UJL9	ZF69B_HUMAN	ZFP69 zinc finger protein B	20					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GGTGAAGTTGCGTCATCCAAA	0.587																																																	0																																										SO:0001583	missense	0			BC017498	CCDS452.1, CCDS452.2	1p34.2	2013-01-09	2012-11-27	2012-11-27	ENSG00000187801	ENSG00000187801		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	28053	protein-coding gene	gene with protein product			"""zinc finger protein 643"""	ZNF643			Standard	NM_023070		Approved	ZKSCAN23B, FLJ34293, ZSCAN54B	uc001cfn.2	Q9UJL9	OTTHUMG00000007302	ENST00000411995.2:c.58C>T	1.37:g.40916691C>T	ENSP00000399664:p.Arg20Cys		Q5QPL4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_Tscrpt_reg_SCAN,superfamily_Krueppel-associated_box,superfamily_Retrov_capsid_C,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.R20C	ENST00000411995.2	37	c.58	CCDS452.2	1	.	.	.	.	.	.	.	.	.	.	C	11.19	1.565802	0.27915	.	.	ENSG00000187801	ENST00000484445;ENST00000411995	T;T	0.04862	3.54;3.54	3.45	2.49	0.30216	Transcription regulator SCAN (2);	.	.	.	.	T	0.03477	0.0100	N	0.08118	0	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.41179	-0.9523	9	0.54805	T	0.06	.	7.7446	0.28862	0.2627:0.7373:0.0:0.0	.	20	Q9UJL9	ZN643_HUMAN	C	20	ENSP00000435907:R20C;ENSP00000399664:R20C	ENSP00000399664:R20C	R	+	1	0	ZNF643	40689278	0.024000	0.19004	0.996000	0.52242	0.301000	0.27625	-0.046000	0.11983	0.960000	0.38005	0.650000	0.86243	CGT	ZFP69B	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,pfscan_Tscrpt_reg_SCAN	ENSG00000187801		0.587	ZFP69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP69B	HGNC	protein_coding	OTTHUMT00000019078.2	-	0.00	48	0	C	NM_023070		40916691	+1	tier1	-	no_errors	ENST00000411995	ensembl	human	known	74_37	missense	19.23	21	5	SNP	0.997	T
ZHX3	23051	genome.wustl.edu	37	20	39832332	39832332	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr20:39832332C>T	ENST00000309060.3	-	4	1640	c.1225G>A	c.(1225-1227)Gct>Act	p.A409T	ZHX3_ENST00000544979.2_Missense_Mutation_p.A409T|ZHX3_ENST00000559234.1_Missense_Mutation_p.A409T|ZHX3_ENST00000560361.1_Missense_Mutation_p.A409T|ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000540170.1_Missense_Mutation_p.A409T|ZHX3_ENST00000432768.2_Missense_Mutation_p.A409T|ZHX3_ENST00000558993.1_Intron			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	409	Required for homodimerization and interaction with NFYA.|Required for repressor activity.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				CCTGGAAGAGCGGCCTGGATG	0.557																																																	0													89.0	84.0	86.0					20																	39832332		2203	4300	6503	SO:0001583	missense	0			AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.1225G>A	20.37:g.39832332C>T	ENSP00000312222:p.Ala409Thr		E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.A409T	ENST00000309060.3	37	c.1225	CCDS13315.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.537|7.537	0.659937|0.659937	0.14645|0.14645	.|.	.|.	ENSG00000174306|ENSG00000174306	ENST00000309060;ENST00000373263;ENST00000540170;ENST00000544979;ENST00000373262;ENST00000432768|ENST00000421422	T;T;T;T;T|.	0.31769|.	1.48;2.86;2.86;2.64;1.48|.	5.88|5.88	2.85|2.85	0.33270|0.33270	.|.	0.366282|.	0.31566|.	N|.	0.007425|.	T|T	0.21427|0.21427	0.0516|0.0516	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B;B|.	0.24651|.	0.006;0.011;0.108|.	B;B;B|.	0.19148|.	0.006;0.004;0.024|.	T|T	0.22208|0.22208	-1.0223|-1.0223	10|5	0.27082|.	T|.	0.32|.	-3.6668|-3.6668	4.5458|4.5458	0.12079|0.12079	0.1422:0.5117:0.0:0.3461|0.1422:0.5117:0.0:0.3461	.|.	409;409;409|.	A8K8Q0;Q9H4I2;F5H820|.	.;ZHX3_HUMAN;.|.	T|H	409;409;409;409;187;409|117	ENSP00000312222:A409T;ENSP00000362360:A409T;ENSP00000442290:A409T;ENSP00000443783:A409T;ENSP00000415498:A409T|.	ENSP00000312222:A409T|.	A|R	-|-	1|2	0|0	ZHX3|ZHX3	39265746|39265746	0.332000|0.332000	0.24722|0.24722	0.567000|0.567000	0.28434|0.28434	0.622000|0.622000	0.37654|0.37654	0.945000|0.945000	0.29056|0.29056	0.373000|0.373000	0.24621|0.24621	0.655000|0.655000	0.94253|0.94253	GCT|CGC	ZHX3	-	NULL	ENSG00000174306		0.557	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZHX3	HGNC	protein_coding	OTTHUMT00000079262.3		0.00	39	0	C	NM_015035		39832332	-1			no_errors	ENST00000309060	ensembl	human	known	74_37	missense	8.33	33	3	SNP	0.012	T
ZMYM3	9203	genome.wustl.edu	37	X	70463796	70463796	+	Silent	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chrX:70463796G>T	ENST00000353904.2	-	21	3502	c.3315C>A	c.(3313-3315)gcC>gcA	p.A1105A	ZMYM3_ENST00000314425.5_Silent_p.A1105A|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373988.1_Silent_p.A1107A|ZMYM3_ENST00000373984.3_Silent_p.A1100A|ZMYM3_ENST00000373998.1_Silent_p.A1093A	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	1105					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					CAGCTGAGCAGGCGAGAATAT	0.458																																																	0													164.0	112.0	130.0					X																	70463796		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.3315C>A	X.37:g.70463796G>T			D3DVV3|O15089|Q96E26	Silent	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH_dom	p.A1107	ENST00000353904.2	37	c.3321	CCDS14409.1	X																																																																																			ZMYM3	-	NULL	ENSG00000147130		0.458	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	-	0.00	39	0	G	NM_201599		70463796	-1	tier1	-	no_errors	ENST00000373988	ensembl	human	known	74_37	silent	12.90	27	4	SNP	1.000	T
ZNF236	7776	genome.wustl.edu	37	18	74625774	74625774	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr18:74625774A>G	ENST00000253159.8	+	18	3173	c.2975A>G	c.(2974-2976)gAa>gGa	p.E992G	ZNF236_ENST00000320610.9_Missense_Mutation_p.E994G	NM_007345.3	NP_031371.3	Q9UL36	ZN236_HUMAN	zinc finger protein 236	992					cellular response to glucose stimulus (GO:0071333)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(43)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	94		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CACACCGGGGAAAAGCCCTAC	0.517																																																	0													96.0	102.0	100.0					18																	74625774		1974	4171	6145	SO:0001583	missense	0			AF085243	CCDS42447.1	18q22-q23	2013-01-08				ENSG00000130856		"""Zinc fingers, C2H2-type"""	13028	protein-coding gene	gene with protein product		604760				10458916	Standard	NM_007345		Approved		uc002lmi.3	Q9UL36		ENST00000253159.8:c.2975A>G	18.37:g.74625774A>G	ENSP00000253159:p.Glu992Gly		B2RTX9|Q9UL37	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E992G	ENST00000253159.8	37	c.2975	CCDS42447.1	18	.	.	.	.	.	.	.	.	.	.	A	22.2	4.260639	0.80246	.	.	ENSG00000130856	ENST00000253159;ENST00000543926;ENST00000320610	T;T	0.27557	1.66;1.66	4.98	4.98	0.66077	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.59018	0.2163	M	0.84156	2.68	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.66324	-0.5952	10	0.87932	D	0	.	14.6983	0.69136	1.0:0.0:0.0:0.0	.	992	Q9UL36	ZN236_HUMAN	G	992	ENSP00000253159:E992G;ENSP00000444524:E992G	ENSP00000253159:E992G	E	+	2	0	ZNF236	72754762	1.000000	0.71417	1.000000	0.80357	0.568000	0.35870	8.999000	0.93557	1.880000	0.54463	0.379000	0.24179	GAA	ZNF236	-	pfscan_Znf_C2H2	ENSG00000130856		0.517	ZNF236-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF236	HGNC	protein_coding	OTTHUMT00000445776.1	-	0.00	72	0	A			74625774	+1	tier1	-	no_errors	ENST00000253159	ensembl	human	known	74_37	missense	60.87	9	14	SNP	1.000	G
ZNF257	113835	genome.wustl.edu	37	19	22271232	22271232	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:22271232A>C	ENST00000594947.1	+	4	824	c.680A>C	c.(679-681)aAa>aCa	p.K227T		NM_033468.2	NP_258429.2	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	227					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(4)	6		all_lung(12;0.0961)|Lung NSC(12;0.103)				ACTGGAGAGAAACCCTACAAA	0.388																																																	0													38.0	42.0	40.0					19																	22271232		2182	4282	6464	SO:0001583	missense	0			AF070651	CCDS46030.1	19p12	2014-02-14			ENSG00000197134	ENSG00000197134		"""Zinc fingers, C2H2-type"", ""-"""	13498	protein-coding gene	gene with protein product		606957				10585455	Standard	NM_033468		Approved	BMZF-4	uc010ecx.3	Q9Y2Q1	OTTHUMG00000182927	ENST00000594947.1:c.680A>C	19.37:g.22271232A>C	ENSP00000470209:p.Lys227Thr		B3KPS4|E9PG34|Q8NE34	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K227T	ENST00000594947.1	37	c.680	CCDS46030.1	19	.	.	.	.	.	.	.	.	.	.	A	17.97	3.518000	0.64634	.	.	ENSG00000197134	ENST00000435820;ENST00000397123	.	.	.	1.11	1.11	0.20524	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.67674	0.2918	M	0.83012	2.62	0.33031	D	0.530126	D	0.69078	0.997	D	0.67382	0.951	T	0.71586	-0.4548	8	0.87932	D	0	.	5.9831	0.19419	1.0:0.0:0.0:0.0	.	227	Q9Y2Q1	ZN257_HUMAN	T	227;199	.	ENSP00000380312:K199T	K	+	2	0	ZNF257	22063072	0.002000	0.14202	0.317000	0.25265	0.871000	0.50021	0.530000	0.23036	0.436000	0.26393	0.260000	0.18958	AAA	ZNF257	-	pfscan_Znf_C2H2	ENSG00000197134		0.388	ZNF257-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF257	HGNC	protein_coding	OTTHUMT00000464382.1	-	0.00	71	0	A			22271232	+1	tier1	-	no_errors	ENST00000594947	ensembl	human	known	74_37	missense	34.25	48	25	SNP	1.000	C
ZNF283	284349	genome.wustl.edu	37	19	44351115	44351116	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:44351115_44351116CC>AA	ENST00000324461.7	+	7	659_660	c.362_363CC>AA	c.(361-363)aCC>aAA	p.T121K	ZNF283_ENST00000588797.1_5'UTR	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	121	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				ACGTATGAGACCAAAAAAATAT	0.307																																																	0																																										SO:0001583	missense	0			AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		Exception_encountered	19.37:g.44351115_44351116delinsAA	ENSP00000327314:p.Thr121Lys		B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Missense_Mutation|Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T121N|p.T121	ENST00000324461.7	37	c.362|c.363	CCDS46097.1	19																																																																																			ZNF283	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000167637		0.307	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF283	HGNC	protein_coding	OTTHUMT00000459909.1	-	0.00	121|124	0	C	NM_181845		44351115|44351116	+1	tier1	-	no_errors	ENST00000324461	ensembl	human	known	74_37	missense|silent	42.61|43.48	65|64	49|50	SNP	0.002	A
ZNF304	57343	genome.wustl.edu	37	19	57868053	57868053	+	Silent	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:57868053C>A	ENST00000282286.5	+	3	989	c.816C>A	c.(814-816)atC>atA	p.I272I	ZNF304_ENST00000391705.3_Silent_p.I272I|ZNF304_ENST00000443917.2_Silent_p.I319I|ZNF304_ENST00000598744.1_Silent_p.I230I			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	272					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		ACAGAAAAATCCACAGTGGAG	0.418																																																	0													89.0	89.0	89.0					19																	57868053		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.816C>A	19.37:g.57868053C>A				Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I272	ENST00000282286.5	37	c.816	CCDS12950.1	19																																																																																			ZNF304	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000131845		0.418	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF304	HGNC	protein_coding	OTTHUMT00000465785.1		0.00	25	0	C			57868053	+1			no_errors	ENST00000282286	ensembl	human	known	74_37	silent	12.50	28	4	SNP	0.002	A
ZNF454	285676	genome.wustl.edu	37	5	178392181	178392181	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr5:178392181T>A	ENST00000320129.3	+	5	1079	c.776T>A	c.(775-777)cTt>cAt	p.L259H	ZNF454_ENST00000519564.1_Missense_Mutation_p.L259H	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	259					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		AGCTCCTCACTTACGTACCAT	0.428																																																	0													84.0	89.0	87.0					5																	178392181		2203	4300	6503	SO:0001583	missense	0			AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.776T>A	5.37:g.178392181T>A	ENSP00000326249:p.Leu259His		Q2M1P2|Q2M323	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L259H	ENST00000320129.3	37	c.776	CCDS4441.1	5	.	.	.	.	.	.	.	.	.	.	T	14.23	2.472835	0.43942	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.54071	0.59;0.59	4.46	4.46	0.54185	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.32028	N	0.006685	T	0.76241	0.3960	M	0.92026	3.265	0.25691	N	0.985687	D	0.89917	1.0	D	0.83275	0.996	T	0.70733	-0.4791	10	0.66056	D	0.02	-12.9454	12.0154	0.53311	0.0:0.0:0.0:1.0	.	259	Q8N9F8	ZN454_HUMAN	H	259	ENSP00000326249:L259H;ENSP00000430354:L259H	ENSP00000326249:L259H	L	+	2	0	ZNF454	178324787	0.990000	0.36364	0.154000	0.22540	0.366000	0.29705	5.527000	0.67123	1.999000	0.58509	0.454000	0.30748	CTT	ZNF454	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000178187		0.428	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF454	HGNC	protein_coding	OTTHUMT00000253476.2	-	0.00	71	0	T	XM_209718		178392181	+1	tier1	-	no_errors	ENST00000320129	ensembl	human	known	74_37	missense	38.46	24	15	SNP	0.414	A
ZNF532	55205	genome.wustl.edu	37	18	56585942	56585942	+	Silent	SNP	C	C	T	rs372741032		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr18:56585942C>T	ENST00000336078.4	+	4	1199	c.423C>T	c.(421-423)gaC>gaT	p.D141D	ZNF532_ENST00000591230.1_Silent_p.D141D|ZNF532_ENST00000589288.1_Silent_p.D141D|ZNF532_ENST00000591083.1_Silent_p.D141D|ZNF532_ENST00000591808.1_Silent_p.D141D	NM_018181.4	NP_060651.2	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	141					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(14)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(4)|urinary_tract(1)	52						TTGATGACGACGAGAAGATTG	0.532																																																	0								C		0,4406		0,0,2203	121.0	109.0	113.0		423	-9.6	0.0	18		113	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF532	NM_018181.4		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		141/1302	56585942	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB046849	CCDS11969.1	18q21.32	2005-08-22			ENSG00000074657	ENSG00000074657		"""Zinc fingers, C2H2-type"""	30940	protein-coding gene	gene with protein product						10997877	Standard	XM_005266723		Approved	FLJ10697	uc002lho.3	Q9HCE3	OTTHUMG00000132759	ENST00000336078.4:c.423C>T	18.37:g.56585942C>T			Q4G0V6|Q7L7Z7|Q96QR7|Q9NVJ6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D141	ENST00000336078.4	37	c.423	CCDS11969.1	18																																																																																			ZNF532	-	NULL	ENSG00000074657		0.532	ZNF532-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF532	HGNC	protein_coding	OTTHUMT00000256130.1	-	0.00	41	0	C	NM_018181		56585942	+1	tier1	-	no_errors	ENST00000336078	ensembl	human	known	74_37	silent	38.89	11	7	SNP	0.871	T
ZNF536	9745	genome.wustl.edu	37	19	30936442	30936442	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:30936442A>C	ENST00000355537.3	+	2	2120	c.1973A>C	c.(1972-1974)aAg>aCg	p.K658T		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	658					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					CGGGACCGCAAGGGCGAGGAG	0.687																																																	0													53.0	59.0	57.0					19																	30936442		2203	4299	6502	SO:0001583	missense	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1973A>C	19.37:g.30936442A>C	ENSP00000347730:p.Lys658Thr		A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K658T	ENST00000355537.3	37	c.1973	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	A	10.12	1.262640	0.23051	.	.	ENSG00000198597	ENST00000355537	T	0.08720	3.06	5.42	4.41	0.53225	Zinc finger, C2H2 (1);	0.105219	0.64402	D	0.000006	T	0.05640	0.0148	N	0.14661	0.345	0.36167	D	0.848537	P;P	0.36282	0.546;0.546	B;B	0.34180	0.177;0.177	T	0.39542	-0.9609	10	0.59425	D	0.04	-26.4448	10.9791	0.47483	0.9269:0.0:0.0731:0.0	.	658;658	A7E228;O15090	.;ZN536_HUMAN	T	658	ENSP00000347730:K658T	ENSP00000347730:K658T	K	+	2	0	ZNF536	35628282	1.000000	0.71417	0.995000	0.50966	0.733000	0.41908	5.776000	0.68924	0.887000	0.36136	0.533000	0.62120	AAG	ZNF536	-	pfscan_Znf_C2H2	ENSG00000198597		0.687	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	-	0.00	97	0	A	NM_014717		30936442	+1	tier1	-	no_errors	ENST00000355537	ensembl	human	known	74_37	missense	18.25	112	25	SNP	1.000	C
ZNF542P	147947	genome.wustl.edu	37	19	56884899	56884899	+	RNA	SNP	G	G	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:56884899G>C	ENST00000490123.1	+	0	520					NR_033418.1		Q5EBM4	ZN542_HUMAN							regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										TCTATTCACAGGACTTTCCAT	0.383																																																	0																																												0																															19.37:g.56884899G>C			B3KUG2|B4DLV1|Q6N061	Splice_Site	SNP	-	NULL	ENST00000490123.1	37	c.NULL		19																																																																																			ZNF542	-	-	ENSG00000240225		0.383	ZNF542-001	KNOWN	basic	processed_transcript	ZNF542	HGNC	pseudogene	OTTHUMT00000277130.1		0.00	57	0	G			56884899	+1			no_errors	ENST00000462524	ensembl	human	known	74_37	splice_site	7.50	37	3	SNP	0.424	C
AC006116.24	0	genome.wustl.edu	37	19	56889139	56889139	+	RNA	SNP	A	A	G	rs547205680		TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:56889139A>G	ENST00000591836.1	-	0	0				ZNF542_ENST00000490123.1_RNA																							CTTGTTACTCATAAGAGAACA	0.413													A|||	1	0.000199681	0.0	0.0	5008	,	,		19712	0.0		0.001	False		,,,				2504	0.0																0																																												0																															19.37:g.56889139A>G				RNA	SNP	-	NULL	ENST00000591836.1	37	NULL		19																																																																																			ZNF542	-	-	ENSG00000240225		0.413	AC006116.24-001	KNOWN	basic	sense_intronic	ZNF542	HGNC	sense_intronic	OTTHUMT00000459747.1	-	0.00	75	0	A			56889139	+1	tier1	-	no_errors	ENST00000467807	ensembl	human	known	74_37	rna	50.88	28	29	SNP	0.992	G
ZNF560	147741	genome.wustl.edu	37	19	9579815	9579815	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:9579815T>G	ENST00000301480.4	-	9	791	c.578A>C	c.(577-579)aAt>aCt	p.N193T		NM_152476.2	NP_689689.2	Q96MR9	ZN560_HUMAN	zinc finger protein 560	193					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(16)|liver(2)|lung(24)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	65						TAAACAAAAATTATCTTGCCA	0.313																																																	0													30.0	31.0	30.0					19																	9579815		2202	4297	6499	SO:0001583	missense	0			AK056548	CCDS12214.1	19p13.2	2013-09-20			ENSG00000198028	ENSG00000198028		"""Zinc fingers, C2H2-type"", ""-"""	26484	protein-coding gene	gene with protein product							Standard	NM_152476		Approved	FLJ31986	uc002mlp.1	Q96MR9	OTTHUMG00000180130	ENST00000301480.4:c.578A>C	19.37:g.9579815T>G	ENSP00000301480:p.Asn193Thr		Q495S9|Q495T1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N193T	ENST00000301480.4	37	c.578	CCDS12214.1	19	.	.	.	.	.	.	.	.	.	.	T	1.423	-0.572337	0.03882	.	.	ENSG00000198028	ENST00000301480	T	0.05199	3.48	1.99	0.931	0.19460	.	.	.	.	.	T	0.03695	0.0105	N	0.19112	0.55	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.44483	-0.9325	9	0.32370	T	0.25	.	2.61	0.04888	0.463:0.2523:0.0:0.2846	.	193	Q96MR9	ZN560_HUMAN	T	193	ENSP00000301480:N193T	ENSP00000301480:N193T	N	-	2	0	ZNF560	9440815	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-0.181000	0.09740	0.195000	0.20347	-0.542000	0.04241	AAT	ZNF560	-	NULL	ENSG00000198028		0.313	ZNF560-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF560	HGNC	protein_coding	OTTHUMT00000449901.1	-	0.00	48	0	T	NM_152476		9579815	-1	tier1	-	no_errors	ENST00000301480	ensembl	human	known	74_37	missense	27.27	24	9	SNP	0.018	G
ZNF676	163223	genome.wustl.edu	37	19	22363724	22363724	+	Silent	SNP	G	G	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:22363724G>T	ENST00000397121.2	-	3	1112	c.795C>A	c.(793-795)gtC>gtA	p.V265V		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	265					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TAAGGGTTGAGACGCTACTAA	0.393																																																	0													92.0	98.0	96.0					19																	22363724		2158	4272	6430	SO:0001819	synonymous_variant	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.795C>A	19.37:g.22363724G>T			A8MVX5	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V265	ENST00000397121.2	37	c.795	CCDS42539.1	19																																																																																			ZNF676	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196109		0.393	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	-	0.00	88	0	G	NM_001001411		22363724	-1	tier1	-	no_errors	ENST00000397121	ensembl	human	known	74_37	silent	37.10	39	23	SNP	0.003	T
ZNF681	148213	genome.wustl.edu	37	19	23927796	23927796	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:23927796T>G	ENST00000402377.3	-	4	697	c.556A>C	c.(556-558)Act>Cct	p.T186P	ZNF681_ENST00000395385.3_Missense_Mutation_p.T117P	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	186					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTATGTTGAGTTAGGTTTGAA	0.259																																																	0													19.0	21.0	20.0					19																	23927796		2191	4281	6472	SO:0001583	missense	0			AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.556A>C	19.37:g.23927796T>G	ENSP00000384000:p.Thr186Pro		B3KVF7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T186P	ENST00000402377.3	37	c.556	CCDS12414.2	19	.	.	.	.	.	.	.	.	.	.	.	10.74	1.436387	0.25813	.	.	ENSG00000196172	ENST00000402377;ENST00000395385;ENST00000528059;ENST00000531570	T;T;T;T	0.29655	2.38;2.38;1.56;1.56	1.27	1.27	0.21489	.	.	.	.	.	T	0.51210	0.1661	M	0.80508	2.5	0.09310	N	1	D	0.76494	0.999	D	0.73708	0.981	T	0.28554	-1.0040	9	0.66056	D	0.02	.	6.2392	0.20780	0.0:0.0:0.0:1.0	.	186	Q96N22	ZN681_HUMAN	P	186;117;117;117	ENSP00000384000:T186P;ENSP00000378783:T117P;ENSP00000433806:T117P;ENSP00000435824:T117P	ENSP00000378783:T117P	T	-	1	0	ZNF681	23719636	0.001000	0.12720	0.035000	0.18076	0.068000	0.16541	0.903000	0.28475	0.530000	0.28619	0.260000	0.18958	ACT	ZNF681	-	NULL	ENSG00000196172		0.259	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF681	HGNC	protein_coding	OTTHUMT00000320248.2	-	0.00	52	0	T	NM_138286		23927796	-1	tier1	-	no_errors	ENST00000402377	ensembl	human	known	74_37	missense	31.82	30	14	SNP	0.003	G
ZNF568	374900	genome.wustl.edu	37	19	37488344	37488344	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:37488344T>G	ENST00000455427.2	+	9	1888	c.1559T>G	c.(1558-1560)gTt>gGt	p.V520G		NM_001204839.1	NP_001191768.1	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	551					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CATCAAAAAGTTCACACTGGG	0.443																																																	0																																										SO:0001583	missense	0			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000455427.2:c.1559T>G	19.37:g.37488344T>G	ENSP00000413396:p.Val520Gly		B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V520G	ENST00000455427.2	37	c.1559	CCDS56093.1	19	.	.	.	.	.	.	.	.	.	.	t	15.71	2.914592	0.52546	.	.	ENSG00000198453	ENST00000455427	T	0.10288	2.89	3.8	2.78	0.32641	.	.	.	.	.	T	0.12433	0.0302	L	0.46741	1.465	0.48341	D	0.999635	P;P	0.47841	0.761;0.901	B;P	0.47102	0.398;0.537	T	0.06917	-1.0800	8	.	.	.	.	7.4359	0.27156	0.0:0.1089:0.0:0.8911	.	520;520	E7ER33;B4DS92	.;.	G	520	ENSP00000413396:V520G	.	V	+	2	0	ZNF568	42180184	0.000000	0.05858	0.326000	0.25389	0.994000	0.84299	0.542000	0.23222	0.635000	0.30488	0.491000	0.48974	GTT	ZNF568	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198453		0.443	ZNF568-007	KNOWN	basic|CCDS	protein_coding	ZNF568	HGNC	protein_coding	OTTHUMT00000457465.1	-	0.00	58	0	T	NM_198539		37488344	+1	tier1	-	no_errors	ENST00000455427	ensembl	human	known	74_37	missense	45.00	22	18	SNP	0.639	G
ZNF569	148266	genome.wustl.edu	37	19	37903852	37903852	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:37903852T>C	ENST00000316950.6	-	6	2265	c.1708A>G	c.(1708-1710)Aga>Gga	p.R570G	ZNF569_ENST00000392150.2_Missense_Mutation_p.R411G|ZNF569_ENST00000392149.2_Missense_Mutation_p.R570G	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	570					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTGTGACTTCTCATATGTAAA	0.418																																																	0													100.0	98.0	99.0					19																	37903852		2203	4300	6503	SO:0001583	missense	0			AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.1708A>G	19.37:g.37903852T>C	ENSP00000325018:p.Arg570Gly		A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R570G	ENST00000316950.6	37	c.1708	CCDS12503.1	19	.	.	.	.	.	.	.	.	.	.	T	15.52	2.858061	0.51376	.	.	ENSG00000196437	ENST00000316950;ENST00000392149;ENST00000392150	T;T	0.24723	1.84;1.84	4.1	1.86	0.25419	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.46619	0.1402	M	0.70595	2.14	0.30560	N	0.764558	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.987	T	0.47509	-0.9112	9	0.56958	D	0.05	.	10.2904	0.43592	0.0:0.0:0.2915:0.7085	.	411;570	Q17RR6;Q5MCW4	.;ZN569_HUMAN	G	570;226;411	ENSP00000325018:R570G;ENSP00000375993:R411G	ENSP00000325018:R570G	R	-	1	2	ZNF569	42595692	0.000000	0.05858	1.000000	0.80357	0.999000	0.98932	-0.239000	0.08965	0.184000	0.20083	0.533000	0.62120	AGA	ZNF569	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196437		0.418	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF569	HGNC	protein_coding	OTTHUMT00000109594.2	-	0.00	58	0	T	NM_152484		37903852	-1	tier1	-	no_errors	ENST00000316950	ensembl	human	known	74_37	missense	48.28	30	28	SNP	0.994	C
ZNF702P	79986	genome.wustl.edu	37	19	53473786	53473786	+	RNA	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:53473786A>C	ENST00000600068.1	-	0	489				ZNF702P_ENST00000270443.4_RNA																							CAATATATGCAGTTCAGGCAG	0.383																																																	0																																												0																															19.37:g.53473786A>C				RNA	SNP	-	NULL	ENST00000600068.1	37	NULL		19																																																																																			ZNF702P	-	-	ENSG00000242779		0.383	CTD-2620I22.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	ZNF702P	HGNC	processed_transcript	OTTHUMT00000463881.1	-	0.00	90	0	A			53473786	-1	tier1	-	no_errors	ENST00000270443	ensembl	human	known	74_37	rna	52.11	34	37	SNP	0.005	C
ZNF667	63934	genome.wustl.edu	37	19	56952879	56952879	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:56952879T>G	ENST00000504904.3	-	7	2204	c.1485A>C	c.(1483-1485)gaA>gaC	p.E495D	ZNF667_ENST00000591790.1_3'UTR|ZNF667_ENST00000342634.3_Missense_Mutation_p.E623D|ZNF667_ENST00000292069.6_Missense_Mutation_p.E495D			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	495					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		AGGGTCTATCTTCAGTATGAA	0.443																																																	0													85.0	76.0	79.0					19																	56952879		2203	4300	6503	SO:0001583	missense	0				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.1485A>C	19.37:g.56952879T>G	ENSP00000439402:p.Glu495Asp		B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E623D	ENST00000504904.3	37	c.1869	CCDS12944.1	19	.	.	.	.	.	.	.	.	.	.	T	11.39	1.623368	0.28889	.	.	ENSG00000198046	ENST00000342634;ENST00000504904;ENST00000292069;ENST00000452518;ENST00000360227	T;T;T	0.18502	2.21;2.21;2.21	4.77	1.41	0.22369	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41712	D	0.000838	T	0.11067	0.0270	L	0.31926	0.97	0.23238	N	0.998062	B;P	0.34934	0.238;0.476	B;B	0.36378	0.158;0.223	T	0.17561	-1.0365	10	0.87932	D	0	-20.6114	3.2095	0.06677	0.1745:0.2901:0.0:0.5355	.	623;495	E7EPS0;Q5HYK9	.;ZN667_HUMAN	D	623;495;495;277;210	ENSP00000344699:E623D;ENSP00000439402:E495D;ENSP00000292069:E495D	ENSP00000292069:E495D	E	-	3	2	ZNF667	61644691	0.003000	0.15002	0.851000	0.33527	0.027000	0.11550	-0.612000	0.05616	0.319000	0.23209	0.533000	0.62120	GAA	ZNF667	-	pfscan_Znf_C2H2	ENSG00000198046		0.443	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF667	HGNC	protein_coding	OTTHUMT00000458394.1	-	0.00	59	0	T	NM_022103		56952879	-1	tier1	-	no_errors	ENST00000342634	ensembl	human	known	74_37	missense	38.60	35	22	SNP	0.350	G
ZNF543	125919	genome.wustl.edu	37	19	57840428	57840428	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr19:57840428A>T	ENST00000321545.4	+	4	1943	c.1598A>T	c.(1597-1599)aAg>aTg	p.K533M		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	533					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		ACTGGAGAGAAGCCGTATGAA	0.468																																																	0													82.0	76.0	78.0					19																	57840428		2203	4300	6503	SO:0001583	missense	0			AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.1598A>T	19.37:g.57840428A>T	ENSP00000322545:p.Lys533Met		Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K533M	ENST00000321545.4	37	c.1598	CCDS33130.1	19	.	.	.	.	.	.	.	.	.	.	A	14.52	2.560986	0.45590	.	.	ENSG00000178229	ENST00000321545	T	0.27557	1.66	2.87	1.76	0.24704	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.35682	0.0940	M	0.63208	1.945	0.25543	N	0.987161	P	0.35780	0.52	P	0.46076	0.503	T	0.40079	-0.9582	9	0.72032	D	0.01	.	2.9365	0.05816	0.6551:0.0:0.1263:0.2186	.	533	Q08ER8	ZN543_HUMAN	M	533	ENSP00000322545:K533M	ENSP00000322545:K533M	K	+	2	0	ZNF543	62532240	0.000000	0.05858	0.966000	0.40874	0.754000	0.42855	-0.036000	0.12185	0.263000	0.21812	0.379000	0.24179	AAG	ZNF543	-	pfscan_Znf_C2H2	ENSG00000178229		0.468	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF543	HGNC	protein_coding	OTTHUMT00000465780.1	-	0.00	67	0	A	XM_064865		57840428	+1	tier1	-	no_errors	ENST00000321545	ensembl	human	known	74_37	missense	37.74	33	20	SNP	1.000	T
ZNF720	124411	genome.wustl.edu	37	16	31765507	31765507	+	Intron	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr16:31765507C>T	ENST00000316491.9	+	4	560				ZNF720_ENST00000398696.3_Missense_Mutation_p.S146L|ZNF720_ENST00000531864.2_Intron|ZNF720_ENST00000534369.1_Intron|ZNF720_ENST00000399681.3_Intron|ZNF720_ENST00000539915.1_Intron	NM_001130913.1	NP_001124385.1	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)|lung(1)|stomach(1)	4						AATGTTCAGTCAAATATTTCT	0.274																																																	0																																										SO:0001627	intron_variant	0			AK128671	CCDS45473.1	16p11.2	2013-01-08				ENSG00000197302		"""Zinc fingers, C2H2-type"", ""-"""	26987	protein-coding gene	gene with protein product							Standard	NM_001130913		Approved		uc002ecq.3	Q7Z2F6		ENST00000316491.9:c.361+286C>T	16.37:g.31765507C>T			Q6ZQX1	Missense_Mutation	SNP	NULL	p.S146L	ENST00000316491.9	37	c.437	CCDS45473.1	16	.	.	.	.	.	.	.	.	.	.	c	6.839	0.524037	0.13066	.	.	ENSG00000197302	ENST00000398696	T	0.03181	4.02	0.955	0.955	0.19602	.	.	.	.	.	T	0.02767	0.0083	.	.	.	0.09310	N	1	B	0.14805	0.011	B	0.09377	0.004	T	0.42865	-0.9426	8	0.56958	D	0.05	.	3.2083	0.06674	0.0:0.7088:0.0:0.2912	.	146	Q7Z2F6-2	.	L	146	ENSP00000443758:S146L	ENSP00000443758:S146L	S	+	2	0	ZNF720	31673008	0.001000	0.12720	0.032000	0.17829	0.020000	0.10135	0.443000	0.21644	0.842000	0.35045	0.555000	0.69702	TCA	ZNF720	-	NULL	ENSG00000197302		0.274	ZNF720-001	KNOWN	basic|CCDS	protein_coding	ZNF720	HGNC	protein_coding	OTTHUMT00000394883.3	-	0.00	66	0	C	NM_001004300		31765507	+1	tier1	-	no_errors	ENST00000398696	ensembl	human	known	74_37	missense	12.99	67	10	SNP	0.002	T
ZNF721	170960	genome.wustl.edu	37	4	438107	438107	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr4:438107C>T	ENST00000338977.5	-	2	161	c.113G>A	c.(112-114)aGg>aAg	p.R38K	ZNF721_ENST00000507078.1_Intron|ABCA11P_ENST00000451020.2_RNA|ZNF721_ENST00000511833.2_Missense_Mutation_p.R50K|ZNF721_ENST00000506646.1_Intron			Q8TF20	ZN721_HUMAN	zinc finger protein 721	38					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						ACAGCCTTTCCTTAATTGTAA	0.343																																																	0													61.0	68.0	66.0					4																	438107		2115	4273	6388	SO:0001583	missense	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20		ENST00000338977.5:c.113G>A	4.37:g.438107C>T	ENSP00000340524:p.Arg38Lys		Q69YG7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R50K	ENST00000338977.5	37	c.149		4	.	.	.	.	.	.	.	.	.	.	C	3.682	-0.065422	0.07273	.	.	ENSG00000182903	ENST00000338977;ENST00000511833;ENST00000505900	T;T;T	0.05319	3.47;3.46;6.1	1.03	1.03	0.20045	.	.	.	.	.	T	0.04003	0.0112	L	0.40543	1.245	0.09310	N	1	B;B;B	0.19817	0.023;0.023;0.039	B;B;B	0.09377	0.002;0.002;0.004	T	0.46679	-0.9174	9	0.02654	T	1	.	4.203	0.10476	0.3959:0.6041:0.0:0.0	.	38;50;50	Q8TF20;D9N162;Q8TF20-2	ZN721_HUMAN;.;.	K	38;50;82	ENSP00000340524:R38K;ENSP00000428878:R50K;ENSP00000421325:R82K	ENSP00000340524:R38K	R	-	2	0	ZNF721	428107	0.000000	0.05858	0.003000	0.11579	0.114000	0.19823	-0.455000	0.06762	0.486000	0.27676	0.195000	0.17529	AGG	ZNF721	-	NULL	ENSG00000182903		0.343	ZNF721-001	KNOWN	basic|appris_candidate	protein_coding	ZNF721	HGNC	protein_coding	OTTHUMT00000357939.1	-	0.00	62	0	C	NM_133474		438107	-1	tier1	-	no_errors	ENST00000511833	ensembl	human	known	74_37	missense	39.13	28	18	SNP	0.002	T
ZNF804A	91752	genome.wustl.edu	37	2	185800871	185800871	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:185800871A>C	ENST00000302277.6	+	4	1342	c.748A>C	c.(748-750)Agt>Cgt	p.S250R		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	250							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TAGCAGAAAAAGTAGATTTGT	0.443																																																	0													95.0	90.0	92.0					2																	185800871		2203	4299	6502	SO:0001583	missense	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.748A>C	2.37:g.185800871A>C	ENSP00000303252:p.Ser250Arg		A7E253|Q6ZN26	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.S250R	ENST00000302277.6	37	c.748	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	A	18.60	3.657976	0.67586	.	.	ENSG00000170396	ENST00000302277	T	0.07021	3.23	5.42	5.42	0.78866	.	0.264355	0.32918	N	0.005491	T	0.15696	0.0378	L	0.43152	1.355	0.27577	N	0.949696	D	0.57899	0.981	P	0.52758	0.708	T	0.01914	-1.1248	10	0.72032	D	0.01	-7.6676	14.6352	0.68682	1.0:0.0:0.0:0.0	.	250	Q7Z570	Z804A_HUMAN	R	250	ENSP00000303252:S250R	ENSP00000303252:S250R	S	+	1	0	ZNF804A	185509116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.908000	0.56355	2.048000	0.60808	0.482000	0.46254	AGT	ZNF804A	-	NULL	ENSG00000170396		0.443	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	-	0.00	42	0	A	NM_194250		185800871	+1	tier1	-	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	33.90	39	20	SNP	1.000	C
ZNF804A	91752	genome.wustl.edu	37	2	185802671	185802671	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr2:185802671A>C	ENST00000302277.6	+	4	3142	c.2548A>C	c.(2548-2550)Agt>Cgt	p.S850R		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	850							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TAGGTTAATAAGTGAAGACAA	0.358																																																	0													58.0	59.0	59.0					2																	185802671		2203	4300	6503	SO:0001583	missense	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.2548A>C	2.37:g.185802671A>C	ENSP00000303252:p.Ser850Arg		A7E253|Q6ZN26	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.S850R	ENST00000302277.6	37	c.2548	CCDS2291.1	2	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.619073	0.00828	.	.	ENSG00000170396	ENST00000302277	T	0.05925	3.37	5.57	1.93	0.25924	.	0.957352	0.08720	N	0.903662	T	0.03520	0.0101	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.49153	-0.8969	10	0.17369	T	0.5	-0.0184	8.6399	0.33970	0.7798:0.0:0.2202:0.0	.	850	Q7Z570	Z804A_HUMAN	R	850	ENSP00000303252:S850R	ENSP00000303252:S850R	S	+	1	0	ZNF804A	185510916	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	1.300000	0.33436	0.096000	0.17463	-0.326000	0.08463	AGT	ZNF804A	-	NULL	ENSG00000170396		0.358	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	-	0.00	31	0	A	NM_194250		185802671	+1	tier1	-	no_errors	ENST00000302277	ensembl	human	known	74_37	missense	73.53	9	25	SNP	0.002	C
ZRANB1	54764	genome.wustl.edu	37	10	126660624	126660624	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NE-01A-11D-A37C-09	TCGA-L5-A8NE-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	f6782b67-ba4d-4ad2-bf1d-72d57c81ab9f	0d8cf159-3ae8-476d-8eed-6db88565e839	g.chr10:126660624C>A	ENST00000359653.4	+	3	1464	c.1093C>A	c.(1093-1095)Cag>Aag	p.Q365K		NM_017580.2	NP_060050.2	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	365					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|positive regulation of Wnt signaling pathway (GO:0030177)|protein deubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0071947)|protein K29-linked deubiquitination (GO:0035523)|protein K33-linked deubiquitination (GO:1990168)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell morphogenesis (GO:0022604)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	K63-linked polyubiquitin binding (GO:0070530)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(3)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	23		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		CTCTCTTCATCAGAGAAAGGG	0.398																																																	0													126.0	128.0	127.0					10																	126660624		2203	4300	6503	SO:0001583	missense	0			AJ252060	CCDS7642.1	10q26.12	2014-02-24			ENSG00000019995	ENSG00000019995		"""Zinc fingers, RAN-binding domain containing"", ""OTU domain containing"""	18224	protein-coding gene	gene with protein product		611749				11463333	Standard	NM_017580		Approved	TRABID	uc001lic.3	Q9UGI0	OTTHUMG00000019223	ENST00000359653.4:c.1093C>A	10.37:g.126660624C>A	ENSP00000352676:p.Gln365Lys		B4DZ98|D3DRF4|Q5SQP6|Q69YK3	Missense_Mutation	SNP	pfam_OTU,pfam_Znf_RanBP2,smart_Znf_RanBP2,pfscan_OTU,pfscan_Znf_RanBP2	p.Q365K	ENST00000359653.4	37	c.1093	CCDS7642.1	10	.	.	.	.	.	.	.	.	.	.	C	15.31	2.795461	0.50208	.	.	ENSG00000019995	ENST00000359653	T	0.17854	2.25	5.35	5.35	0.76521	.	0.054549	0.85682	D	0.000000	T	0.17238	0.0414	L	0.59436	1.845	0.80722	D	1	B	0.28291	0.206	B	0.17433	0.018	T	0.10109	-1.0644	10	0.05620	T	0.96	-14.7346	19.069	0.93125	0.0:1.0:0.0:0.0	.	365	Q9UGI0	ZRAN1_HUMAN	K	365	ENSP00000352676:Q365K	ENSP00000352676:Q365K	Q	+	1	0	ZRANB1	126650614	1.000000	0.71417	0.986000	0.45419	0.995000	0.86356	5.641000	0.67881	2.514000	0.84764	0.585000	0.79938	CAG	ZRANB1	-	NULL	ENSG00000019995		0.398	ZRANB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZRANB1	HGNC	protein_coding	OTTHUMT00000050898.1	-	0.00	73	0	C	NM_017580		126660624	+1	tier1	-	no_errors	ENST00000359653	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	A
