#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCA13	154664	genome.wustl.edu	37	7	48311788	48311788	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:48311788T>A	ENST00000435803.1	+	17	2549	c.2525T>A	c.(2524-2526)aTt>aAt	p.I842N		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	842					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						GCCTATGGCATTTCAAAAGGA	0.299																																																	0													29.0	30.0	30.0					7																	48311788		1779	4054	5833	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.2525T>A	7.37:g.48311788T>A	ENSP00000411096:p.Ile842Asn		K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.I842N	ENST00000435803.1	37	c.2525	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	T	10.15	1.270794	0.23221	.	.	ENSG00000179869	ENST00000435803	D	0.89681	-2.55	5.66	3.31	0.37934	.	0.551628	0.16423	N	0.215083	D	0.86703	0.5996	L	0.59436	1.845	0.23661	N	0.997176	P	0.48911	0.917	P	0.45037	0.467	T	0.78510	-0.2176	10	0.87932	D	0	.	7.1302	0.25496	0.0:0.1764:0.0:0.8236	.	842	Q86UQ4	ABCAD_HUMAN	N	842	ENSP00000411096:I842N	ENSP00000411096:I842N	I	+	2	0	ABCA13	48282334	0.026000	0.19158	0.108000	0.21378	0.068000	0.16541	0.285000	0.18883	0.445000	0.26639	0.528000	0.53228	ATT	ABCA13	-	NULL	ENSG00000179869		0.299	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	-	0.00	78	0	T	NM_152701		48311788	+1	tier1	-	no_errors	ENST00000435803	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.281	A
ABCB9	23457	genome.wustl.edu	37	12	123434423	123434423	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:123434423T>C	ENST00000542678.1	-	4	3597	c.759A>G	c.(757-759)atA>atG	p.I253M	ABCB9_ENST00000344275.7_Missense_Mutation_p.I253M|ABCB9_ENST00000280560.8_Missense_Mutation_p.I253M|ABCB9_ENST00000540285.1_Missense_Mutation_p.I253M|ABCB9_ENST00000346530.5_Missense_Mutation_p.I253M|ABCB9_ENST00000442028.2_Missense_Mutation_p.I253M|ABCB9_ENST00000392439.3_Missense_Mutation_p.I253M|ABCB9_ENST00000442833.2_Missense_Mutation_p.I253M			Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 9	253	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				peptide transport (GO:0015833)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|peptide-transporting ATPase activity (GO:0015440)|protein homodimerization activity (GO:0042803)|substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		GTCTGGCAAATATGAGGGTAA	0.498																																					Ovarian(49;786 1333 9175 38236)												0													155.0	155.0	155.0					12																	123434423		2203	4300	6503	SO:0001583	missense	0			U66676	CCDS9241.1, CCDS58286.1, CCDS58287.1, CCDS58288.1	12q24	2012-03-14			ENSG00000150967	ENSG00000150967		"""ATP binding cassette transporters / subfamily B"""	50	protein-coding gene	gene with protein product		605453				8894702	Standard	NM_019625		Approved	EST122234	uc001udm.4	Q9NP78		ENST00000542678.1:c.759A>G	12.37:g.123434423T>C	ENSP00000440288:p.Ile253Met		B4E2J0|Q5W9G7|Q769F3|Q769F4|Q96AB1|Q9P208	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.I253M	ENST00000542678.1	37	c.759	CCDS9241.1	12	.	.	.	.	.	.	.	.	.	.	T	13.44	2.236515	0.39498	.	.	ENSG00000150967	ENST00000280560;ENST00000540285;ENST00000346530;ENST00000392439;ENST00000542678;ENST00000442028;ENST00000541424	D;D;D;D;D;D;T	0.90385	-2.66;-2.66;-2.66;-2.66;-2.66;-2.66;-1.46	5.84	3.32	0.38043	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.389539	0.30809	N	0.008823	D	0.88503	0.6454	L	0.33339	1.005	0.25490	N	0.987657	B;B;P;B;B	0.34629	0.084;0.23;0.46;0.131;0.093	B;B;P;B;B	0.51055	0.409;0.21;0.657;0.286;0.315	T	0.80437	-0.1383	10	0.66056	D	0.02	-5.7663	2.7708	0.05334	0.1023:0.1586:0.1755:0.5635	.	253;253;35;253;253	B4E2J0;Q9NP78-3;B3KNJ8;Q9NP78-2;Q9NP78	.;.;.;.;ABCB9_HUMAN	M	253;253;253;253;253;253;32	ENSP00000280560:I253M;ENSP00000441734:I253M;ENSP00000280559:I253M;ENSP00000376234:I253M;ENSP00000440288:I253M;ENSP00000394898:I253M;ENSP00000440138:I32M	ENSP00000280560:I253M	I	-	3	3	ABCB9	122000376	0.920000	0.31207	1.000000	0.80357	0.998000	0.95712	-0.128000	0.10531	1.029000	0.39812	0.459000	0.35465	ATA	ABCB9	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000150967		0.498	ABCB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB9	HGNC	protein_coding	OTTHUMT00000400956.1	-	0.00	63	0	T	NM_019624		123434423	-1	tier1	-	no_errors	ENST00000442028	ensembl	human	known	74_37	missense	20.00	20	5	SNP	0.733	C
ABCD4	5826	genome.wustl.edu	37	14	74759556	74759556	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:74759556delA	ENST00000356924.4	-	9	974	c.831delT	c.(829-831)tttfs	p.F277fs	ABCD4_ENST00000557554.1_Intron|AC005519.4_ENST00000554532.2_RNA|ABCD4_ENST00000298816.7_Frame_Shift_Del_p.F173fs|ABCD4_ENST00000557588.1_Stop_Codon_Del	NM_005050.3	NP_005041.1	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D (ALD), member 4	277	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cobalamin metabolic process (GO:0009235)|transmembrane transport (GO:0055085)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00153)		CCAGATAGTCAAAGGTGTTGA	0.542																																																	0													96.0	96.0	96.0					14																	74759556		2203	4300	6503	SO:0001589	frameshift_variant	0			AF009746	CCDS9828.1	14q24	2012-03-14			ENSG00000119688	ENSG00000119688		"""ATP binding cassette transporters / subfamily D"""	68	protein-coding gene	gene with protein product		603214		PXMP1L		9266848, 9302272	Standard	NR_003256		Approved	PMP69, P70R, EST352188	uc001xpr.2	O14678	OTTHUMG00000171207	ENST00000356924.4:c.831delT	14.37:g.74759556delA	ENSP00000349396:p.Phe277fs		A8K5L7|Q6IAQ0|Q96E75	Frame_Shift_Del	DEL	pfam_ABC_Peroxi_TM,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.F277fs	ENST00000356924.4	37	c.831	CCDS9828.1	14																																																																																			ABCD4	-	pfam_ABC_Peroxi_TM,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000119688		0.542	ABCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD4	HGNC	protein_coding	OTTHUMT00000314382.1		0.00	25	0	A	NM_005050		74759556	-1	tier1		no_errors	ENST00000356924	ensembl	human	known	74_37	frame_shift_del	22.22	7	2	DEL	0.998	-
ABHD12B	145447	genome.wustl.edu	37	14	51347290	51347290	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:51347290G>T	ENST00000337334.2	+	4	470		c.e4+1		ABHD12B_ENST00000395752.1_Splice_Site|PYGL_ENST00000532462.1_Intron|ABHD12B_ENST00000554241.1_Splice_Site|ABHD12B_ENST00000353130.1_Splice_Site	NM_001206673.1	NP_001193602.1	Q7Z5M8	AB12B_HUMAN	abhydrolase domain containing 12B								hydrolase activity (GO:0016787)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)	10	all_epithelial(31;0.00481)|Breast(41;0.148)					CAGAACACAGGTCAGTGGCTC	0.478																																																	0													143.0	130.0	134.0					14																	51347290		2203	4300	6503	SO:0001630	splice_region_variant	0			BG698443	CCDS9702.1, CCDS55916.1	14q21.3	2009-10-09	2007-04-03	2007-04-03	ENSG00000131969	ENSG00000131969		"""Abhydrolase domain containing"""	19837	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 29"""	C14orf29			Standard	NM_181814		Approved	BEM46L3	uc001wys.3	Q7Z5M8	OTTHUMG00000140286	ENST00000337334.2:c.455+1G>T	14.37:g.51347290G>T			Q3KNR9|Q3KNS0|Q7Z5M6|Q7Z5M7|Q8N4D2	Splice_Site	SNP	-	e4+1	ENST00000337334.2	37	c.455+1	CCDS55916.1	14	.	.	.	.	.	.	.	.	.	.	G	24.2	4.507538	0.85282	.	.	ENSG00000131969	ENST00000353130;ENST00000337334;ENST00000395752	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5804	0.76432	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ABHD12B	50417040	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.805000	0.91925	2.832000	0.97577	0.655000	0.94253	.	ABHD12B	-	-	ENSG00000131969		0.478	ABHD12B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABHD12B	HGNC	protein_coding	OTTHUMT00000411030.1	-	0.00	51	0	G		Intron	51347290	+1	tier1	-	no_errors	ENST00000337334	ensembl	human	known	74_37	splice_site	13.64	19	3	SNP	1.000	T
ACHE	43	genome.wustl.edu	37	7	100490296	100490296	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:100490296C>T	ENST00000412389.1	-	2	1367	c.1212G>A	c.(1210-1212)ctG>ctA	p.L404L	UFSP1_ENST00000388761.2_5'Flank|ACHE_ENST00000302913.4_Silent_p.L404L|ACHE_ENST00000411582.1_Silent_p.L404L|ACHE_ENST00000419336.2_Intron|ACHE_ENST00000241069.5_Silent_p.L404L|ACHE_ENST00000428317.1_Silent_p.L404L			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	404					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	CCTCGGCTGCCAGGTCACTTA	0.652																																																	0													27.0	28.0	27.0					7																	100490296		2202	4300	6502	SO:0001819	synonymous_variant	0				CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.1212G>A	7.37:g.100490296C>T			A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Cholinesterase	p.L404	ENST00000412389.1	37	c.1212	CCDS5709.1	7																																																																																			ACHE	-	pfam_CarbesteraseB	ENSG00000087085		0.652	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACHE	HGNC	protein_coding	OTTHUMT00000347201.1	-	0.00	99	0	C	NM_015831		100490296	-1	tier1	-	no_errors	ENST00000302913	ensembl	human	known	74_37	silent	14.04	49	8	SNP	0.998	T
ACOT12	134526	genome.wustl.edu	37	5	80643707	80643707	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:80643707C>T	ENST00000307624.3	-	6	567	c.539G>A	c.(538-540)gGc>gAc	p.G180D		NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	180	Acyl coenzyme A hydrolase 2.				acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		AACGGAGGTGCCCCTTGTGGA	0.507																																																	0													244.0	228.0	233.0					5																	80643707		2203	4300	6503	SO:0001583	missense	0			AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.539G>A	5.37:g.80643707C>T	ENSP00000303246:p.Gly180Asp		B3KVK9|Q5FWE9	Missense_Mutation	SNP	pfam_Thioestr_supf,pfam_START_lipid-bd_dom,pfscan_START_lipid-bd_dom	p.G180D	ENST00000307624.3	37	c.539	CCDS4055.1	5	.	.	.	.	.	.	.	.	.	.	C	7.688	0.690375	0.15039	.	.	ENSG00000172497	ENST00000307624	T	0.25250	1.81	5.77	-1.54	0.08584	.	0.870079	0.10330	N	0.687688	T	0.05273	0.0140	N	0.00661	-1.28	0.19300	N	0.99997	B	0.09022	0.002	B	0.06405	0.002	T	0.39418	-0.9615	10	0.09843	T	0.71	-13.3143	3.2995	0.06978	0.1169:0.1736:0.4585:0.251	.	180	Q8WYK0	ACO12_HUMAN	D	180	ENSP00000303246:G180D	ENSP00000303246:G180D	G	-	2	0	ACOT12	80679463	0.000000	0.05858	0.372000	0.25991	0.208000	0.24298	-0.236000	0.09003	-0.159000	0.11021	0.655000	0.94253	GGC	ACOT12	-	NULL	ENSG00000172497		0.507	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOT12	HGNC	protein_coding	OTTHUMT00000254074.1		0.00	85	0	C	NM_130767		80643707	-1			no_errors	ENST00000307624	ensembl	human	known	74_37	missense	11.76	15	2	SNP	0.011	T
ACTL6B	51412	genome.wustl.edu	37	7	100253447	100253447	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:100253447G>A	ENST00000160382.5	-	2	187	c.81C>T	c.(79-81)taC>taT	p.Y27Y		NM_016188.4	NP_057272.1	O94805	ACL6B_HUMAN	actin-like 6B	27					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|nervous system development (GO:0007399)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	structural constituent of cytoskeleton (GO:0005200)|transcription coactivator activity (GO:0003713)			endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					CCTCCCCAGCGTACCCAGCGC	0.622																																																	0													39.0	35.0	37.0					7																	100253447		2192	4284	6476	SO:0001819	synonymous_variant	0			AB015906	CCDS5702.1	7q22	2008-02-01	2004-07-12	2004-07-14	ENSG00000077080	ENSG00000077080			160	protein-coding gene	gene with protein product		612458	"""actin-like 6"""	ACTL6		9799793	Standard	NM_016188		Approved	BAF53B	uc003uvy.3	O94805	OTTHUMG00000159661	ENST00000160382.5:c.81C>T	7.37:g.100253447G>A			A4D2D0|O75421	Silent	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.Y27	ENST00000160382.5	37	c.81	CCDS5702.1	7																																																																																			ACTL6B	-	pfam_Actin-related,smart_Actin-related	ENSG00000077080		0.622	ACTL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTL6B	HGNC	protein_coding	OTTHUMT00000356745.1	-	0.00	85	0	G	NM_016188		100253447	-1	tier1	-	no_errors	ENST00000160382	ensembl	human	known	74_37	silent	8.70	42	4	SNP	0.998	A
ACTRT3	84517	genome.wustl.edu	37	3	169485221	169485221	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr3:169485221C>T	ENST00000330368.2	-	2	1492	c.1118G>A	c.(1117-1119)tGa>tAa	p.*373*	TERC_ENST00000602385.1_lincRNA|RP11-816J6.3_ENST00000602879.1_RNA	NM_032487.4	NP_115876.3	Q9BYD9	ACTT3_HUMAN	actin-related protein T3	0						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)											ATCTGTATTTCAGAAGCATCT	0.368																																																	0													65.0	65.0	65.0					3																	169485221		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055346	CCDS3206.1	3q26.2	2012-04-10			ENSG00000184378	ENSG00000184378			24022	protein-coding gene	gene with protein product	"""actin related protein M1"""	608534				11750065, 18692047	Standard	NM_032487		Approved	ARPM1	uc003ffs.2	Q9BYD9		ENST00000330368.2:c.1118G>A	3.37:g.169485221C>T			Q96IS0|Q96NJ0	Silent	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.*373	ENST00000330368.2	37	c.1118	CCDS3206.1	3																																																																																			ACTRT3	-	NULL	ENSG00000184378		0.368	ACTRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT3	HGNC	protein_coding	OTTHUMT00000467797.1	-	0.00	29	0	C	NM_032487		169485221	-1	tier1	-	no_errors	ENST00000330368	ensembl	human	known	74_37	silent	33.33	8	4	SNP	1.000	T
ADAM29	11086	genome.wustl.edu	37	4	175897795	175897795	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:175897795T>G	ENST00000359240.3	+	5	1789	c.1119T>G	c.(1117-1119)gaT>gaG	p.D373E	ADAM29_ENST00000404450.4_Missense_Mutation_p.D373E|ADAM29_ENST00000514159.1_Missense_Mutation_p.D373E|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000445694.1_Missense_Mutation_p.D373E	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	373	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.D373D(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GTTATGGTGATTTTTGGGAAT	0.388																																					Ovarian(140;1727 1835 21805 25838 41440)												1	Substitution - coding silent(1)	central_nervous_system(1)											128.0	129.0	128.0					4																	175897795		2203	4300	6503	SO:0001583	missense	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1119T>G	4.37:g.175897795T>G	ENSP00000352177:p.Asp373Glu		Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D373E	ENST00000359240.3	37	c.1119	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	T	4.397	0.073313	0.08485	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.62788	0.0;0.0;0.0;0.0	3.6	-7.2	0.01495	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	1.753660	0.04441	U	0.370851	T	0.42562	0.1208	N	0.21373	0.66	0.09310	N	1	B	0.22146	0.065	B	0.30251	0.113	T	0.30851	-0.9964	9	.	.	.	.	4.9378	0.13950	0.2292:0.5089:0.116:0.146	.	373	Q9UKF5	ADA29_HUMAN	E	373	ENSP00000352177:D373E;ENSP00000414544:D373E;ENSP00000384229:D373E;ENSP00000423517:D373E	.	D	+	3	2	ADAM29	176134370	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.722000	0.04958	-2.314000	0.00647	-0.342000	0.07992	GAT	ADAM29	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000168594		0.388	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding			0.00	33	0	T			175897795	+1			no_errors	ENST00000359240	ensembl	human	known	74_37	missense	28.57	5	2	SNP	0.000	G
ADCY8	114	genome.wustl.edu	37	8	131833649	131833649	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:131833649T>A	ENST00000286355.5	-	13	4785	c.2693A>T	c.(2692-2694)aAg>aTg	p.K898M	ADCY8_ENST00000377928.3_Missense_Mutation_p.K767M	NM_001115.2	NP_001106.1	P40145	ADCY8_HUMAN	adenylate cyclase 8 (brain)	898					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(21)|lung(67)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(5)|urinary_tract(2)	134	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TGATACCTCCTTGGTCCCCAG	0.478										HNSCC(32;0.087)																																							0													93.0	74.0	81.0					8																	131833649		2203	4300	6503	SO:0001583	missense	0			Z35309	CCDS6363.1	8q24	2013-02-04			ENSG00000155897	ENSG00000155897	4.6.1.1	"""Adenylate cyclases"""	239	protein-coding gene	gene with protein product		103070		ADCY3		8076676	Standard	NM_001115		Approved	HBAC1, AC8	uc003ytd.4	P40145	OTTHUMG00000164756	ENST00000286355.5:c.2693A>T	8.37:g.131833649T>A	ENSP00000286355:p.Lys898Met			Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.K898M	ENST00000286355.5	37	c.2693	CCDS6363.1	8	.	.	.	.	.	.	.	.	.	.	T	22.6	4.313162	0.81358	.	.	ENSG00000155897	ENST00000286355;ENST00000377928	T;T	0.80653	-1.4;-1.37	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.85622	0.5739	L	0.53249	1.67	0.41831	D	0.990073	P;D	0.69078	0.467;0.997	B;P	0.59221	0.357;0.854	D	0.87152	0.2209	10	0.72032	D	0.01	.	15.5593	0.76229	0.0:0.0:0.0:1.0	.	767;898	E7EVL1;P40145	.;ADCY8_HUMAN	M	898;767	ENSP00000286355:K898M;ENSP00000367161:K767M	ENSP00000286355:K898M	K	-	2	0	ADCY8	131902831	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	7.571000	0.82399	2.277000	0.76020	0.528000	0.53228	AAG	ADCY8	-	NULL	ENSG00000155897		0.478	ADCY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY8	HGNC	protein_coding	OTTHUMT00000380080.1	-	0.00	60	0	T			131833649	-1	tier1	-	no_errors	ENST00000286355	ensembl	human	known	74_37	missense	11.11	24	3	SNP	1.000	A
ADRBK2	157	genome.wustl.edu	37	22	26074809	26074809	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr22:26074809A>C	ENST00000324198.6	+	9	866	c.674A>C	c.(673-675)aAg>aCg	p.K225T		NM_005160.3	NP_005151.2	P35626	ARBK2_HUMAN	adrenergic, beta, receptor kinase 2	225	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				receptor internalization (GO:0031623)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)		ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|skin(3)|stomach(2)	32					Adenosine triphosphate(DB00171)	TTAGATAAGAAGAGGATCAAA	0.299																																																	0													105.0	98.0	100.0					22																	26074809		2203	4300	6503	SO:0001583	missense	0			X69117	CCDS13832.1	22q11	2013-01-10			ENSG00000100077	ENSG00000100077		"""Pleckstrin homology (PH) domain containing"""	290	protein-coding gene	gene with protein product		109636				7695743	Standard	NM_005160		Approved	GRK3, BARK2	uc003abx.4	P35626	OTTHUMG00000150280	ENST00000324198.6:c.674A>C	22.37:g.26074809A>C	ENSP00000317578:p.Lys225Thr		Q9UGW9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RGS_dom,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal_superfam,pfscan_Prot_kinase_dom,prints_GPCR_kinase	p.K225T	ENST00000324198.6	37	c.674	CCDS13832.1	22	.	.	.	.	.	.	.	.	.	.	A	24.5	4.539949	0.85917	.	.	ENSG00000100077	ENST00000324198;ENST00000545323	T	0.66460	-0.21	5.17	5.17	0.71159	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.058655	0.64402	D	0.000003	T	0.72309	0.3444	L	0.36672	1.1	0.80722	D	1	P;P	0.47545	0.897;0.671	P;P	0.59948	0.866;0.824	T	0.75462	-0.3309	10	0.87932	D	0	-31.2677	14.347	0.66672	1.0:0.0:0.0:0.0	.	225;225	A8K869;P35626	.;ARBK2_HUMAN	T	225	ENSP00000317578:K225T	ENSP00000317578:K225T	K	+	2	0	ADRBK2	24404809	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	8.309000	0.89969	2.175000	0.68902	0.533000	0.62120	AAG	ADRBK2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000100077		0.299	ADRBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRBK2	HGNC	protein_coding	OTTHUMT00000317296.4	-	0.00	35	0	A	NM_005160		26074809	+1	tier1	-	no_errors	ENST00000324198	ensembl	human	known	74_37	missense	27.78	13	5	SNP	1.000	C
ADRM1	11047	genome.wustl.edu	37	20	60882437	60882437	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr20:60882437G>A	ENST00000253003.2	+	6	598	c.552G>A	c.(550-552)ggG>ggA	p.G184G	LAMA5_ENST00000492698.1_5'Flank|RP11-157P1.4_ENST00000414042.1_RNA	NM_007002.2|NM_175573.1	NP_008933.2|NP_783163.1	Q16186	ADRM1_HUMAN	adhesion regulating molecule 1	184	Gly-rich.				positive regulation of endopeptidase activity (GO:0010950)|proteasome assembly (GO:0043248)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|protease binding (GO:0002020)|proteasome binding (GO:0070628)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|urinary_tract(1)	5	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;2.51e-06)			GTGGGCTGGGGGCCCTGACTG	0.667																																																	0													30.0	31.0	31.0					20																	60882437		2197	4297	6494	SO:0001819	synonymous_variant	0			D64154	CCDS13496.1, CCDS74747.1	20q13.33	2008-05-22			ENSG00000130706	ENSG00000130706			15759	protein-coding gene	gene with protein product		610650				8033103	Standard	NM_007002		Approved	GP110, Rpn13, ARM1	uc002yco.3	Q16186	OTTHUMG00000032904	ENST00000253003.2:c.552G>A	20.37:g.60882437G>A			A0PKB1|Q96FJ7|Q9H1P2	Silent	SNP	pfam_26S_Psome_Ubiquitin-recp_Rpn13	p.G184	ENST00000253003.2	37	c.552	CCDS13496.1	20																																																																																			ADRM1	-	pfam_26S_Psome_Ubiquitin-recp_Rpn13	ENSG00000130706		0.667	ADRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRM1	HGNC	protein_coding	OTTHUMT00000080007.1	-	0.00	137	0	G			60882437	+1	tier1	-	no_errors	ENST00000253003	ensembl	human	known	74_37	silent	8.60	85	8	SNP	1.000	A
AFF2	2334	genome.wustl.edu	37	X	148039913	148039913	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:148039913A>T	ENST00000370460.2	+	12	3094	c.2615A>T	c.(2614-2616)gAg>gTg	p.E872V	AFF2_ENST00000286437.5_Missense_Mutation_p.E513V|AFF2_ENST00000370457.5_Missense_Mutation_p.E839V|AFF2_ENST00000342251.3_Missense_Mutation_p.E839V	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	872					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					CAGCGCCTGGAGGAGGCCACA	0.517																																																	0													207.0	188.0	194.0					X																	148039913		2203	4300	6503	SO:0001583	missense	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2615A>T	X.37:g.148039913A>T	ENSP00000359489:p.Glu872Val		A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.E872V	ENST00000370460.2	37	c.2615	CCDS14684.1	X	.	.	.	.	.	.	.	.	.	.	A	23.7	4.447633	0.84101	.	.	ENSG00000155966	ENST00000370460;ENST00000370457;ENST00000342251;ENST00000286437	T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55	5.81	5.81	0.92471	.	0.498368	0.21476	N	0.073916	D	0.83312	0.5227	M	0.78049	2.395	0.53005	D	0.999969	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.75484	0.986;0.975;0.975;0.975;0.975;0.986	T	0.82522	-0.0415	10	0.34782	T	0.22	.	14.1911	0.65639	1.0:0.0:0.0:0.0	.	513;837;839;833;862;872	B4DXD5;P51816-6;P51816-3;P51816-2;P51816-5;P51816	.;.;.;.;.;AFF2_HUMAN	V	872;839;839;513	ENSP00000359489:E872V;ENSP00000359486:E839V;ENSP00000345459:E839V;ENSP00000286437:E513V	ENSP00000286437:E513V	E	+	2	0	AFF2	147847613	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	6.943000	0.75934	1.949000	0.56562	0.486000	0.48141	GAG	AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.517	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	-	0.00	46	0	A	NM_002025		148039913	+1	tier1	-	no_errors	ENST00000370460	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	T
AGL	178	genome.wustl.edu	37	1	100335979	100335979	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:100335979G>A	ENST00000294724.4	+	6	1166	c.688G>A	c.(688-690)Gaa>Aaa	p.E230K	AGL_ENST00000370165.3_Missense_Mutation_p.E230K|AGL_ENST00000361522.4_Missense_Mutation_p.E213K|AGL_ENST00000370163.3_Missense_Mutation_p.E230K|AGL_ENST00000361302.3_Missense_Mutation_p.E214K|AGL_ENST00000361915.3_Missense_Mutation_p.E230K|AGL_ENST00000370161.2_Missense_Mutation_p.E214K	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	230					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		ATGGATCCAGGAACATCCAGA	0.388																																																	0													85.0	84.0	84.0					1																	100335979		2203	4300	6503	SO:0001583	missense	0			BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.688G>A	1.37:g.100335979G>A	ENSP00000294724:p.Glu230Lys		A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	pfam_AGL/Gdb1,superfamily_6-hairpin_glycosidase-like,superfamily_Glycoside_hydrolase_SF,tigrfam_Glycogen_debranch_met	p.E230K	ENST00000294724.4	37	c.688	CCDS759.1	1	.	.	.	.	.	.	.	.	.	.	g	13.39	2.224358	0.39300	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	D;D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	5.37	4.46	0.54185	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.239016	0.42682	D	0.000661	T	0.67211	0.2869	L	0.48642	1.525	0.40083	D	0.976152	B;B;B	0.10296	0.003;0.003;0.002	B;B;B	0.15052	0.012;0.012;0.005	T	0.67669	-0.5611	10	0.45353	T	0.12	.	6.132	0.20211	0.1657:0.28:0.5543:0.0	.	213;214;230	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	K	230;230;230;230;214;214;213	ENSP00000355106:E230K;ENSP00000359184:E230K;ENSP00000359182:E230K;ENSP00000294724:E230K;ENSP00000354971:E214K;ENSP00000359180:E214K;ENSP00000354635:E213K	ENSP00000294724:E230K	E	+	1	0	AGL	100108567	0.594000	0.26849	0.993000	0.49108	0.995000	0.86356	2.109000	0.41863	1.398000	0.46701	0.585000	0.79938	GAA	AGL	-	superfamily_Glycoside_hydrolase_SF,tigrfam_Glycogen_debranch_met	ENSG00000162688		0.388	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGL	HGNC	protein_coding	OTTHUMT00000029778.1	-	0.00	46	0	G	NM_000028		100335979	+1	tier1	-	no_errors	ENST00000294724	ensembl	human	known	74_37	missense	24.00	19	6	SNP	0.954	A
AGPS	8540	genome.wustl.edu	37	2	178299116	178299116	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:178299116G>C	ENST00000264167.4	+	3	558	c.412G>C	c.(412-414)Gta>Cta	p.V138L	AGPS_ENST00000409888.1_Intron	NM_003659.3	NP_003650.1	O00116	ADAS_HUMAN	alkylglycerone phosphate synthase	138					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|lipid biosynthetic process (GO:0008610)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	alkylglycerone-phosphate synthase activity (GO:0008609)|FAD binding (GO:0071949)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|skin(1)	32			OV - Ovarian serous cystadenocarcinoma(117;0.0018)|Epithelial(96;0.00919)|all cancers(119;0.0358)			TACCCTTGGAGTAAATGTGGA	0.299																																																	0													73.0	70.0	71.0					2																	178299116		2203	4299	6502	SO:0001583	missense	0			Y09443	CCDS2275.1	2q	2008-02-05			ENSG00000018510	ENSG00000018510	2.5.1.26		327	protein-coding gene	gene with protein product		603051				9187299, 9553082	Standard	NM_003659		Approved	ADHAPS, ADAS, ALDHPSY, ADPS, ADAP-S	uc002ull.2	O00116	OTTHUMG00000132530	ENST00000264167.4:c.412G>C	2.37:g.178299116G>C	ENSP00000264167:p.Val138Leu		A5D8U9|Q2TU35	Missense_Mutation	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2,superfamily_FAD-linked_Oxase-like_C	p.V138L	ENST00000264167.4	37	c.412	CCDS2275.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.59|12.59	1.982230|1.982230	0.34942|0.34942	.|.	.|.	ENSG00000018510|ENSG00000018510	ENST00000536686|ENST00000264167	.|D	.|0.97209	.|-4.29	5.45|5.45	3.63|3.63	0.41609|0.41609	.|.	.|0.225472	.|0.43919	.|D	.|0.000503	D|D	0.92557|0.92557	0.7636|0.7636	L|L	0.31207|0.31207	0.915|0.915	0.80722|0.80722	D|D	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.08055	.|0.003	D|D	0.88155|0.88155	0.2853|0.2853	6|10	0.21540|0.13108	T|T	0.41|0.6	.|.	12.0681|12.0681	0.53601|0.53601	0.1424:0.0:0.8576:0.0|0.1424:0.0:0.8576:0.0	.|.	.|138	.|O00116	.|ADAS_HUMAN	T|L	8|138	.|ENSP00000264167:V138L	ENSP00000437945:S8T|ENSP00000264167:V138L	S|V	+|+	2|1	0|0	AGPS|AGPS	178007362|178007362	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.983000|0.983000	0.72400|0.72400	4.102000|4.102000	0.57776|0.57776	1.287000|1.287000	0.44583|0.44583	0.650000|0.650000	0.86243|0.86243	AGT|GTA	AGPS	-	NULL	ENSG00000018510		0.299	AGPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPS	HGNC	protein_coding	OTTHUMT00000255730.2	-	0.00	103	0	G			178299116	+1	tier1	-	no_errors	ENST00000264167	ensembl	human	known	74_37	missense	10.87	41	5	SNP	1.000	C
AHI1	54806	genome.wustl.edu	37	6	135787092	135787092	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:135787092C>A	ENST00000367800.4	-	5	825	c.609G>T	c.(607-609)gaG>gaT	p.E203D	AHI1_ENST00000327035.6_Missense_Mutation_p.E203D|AHI1_ENST00000457866.2_Missense_Mutation_p.E203D	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	203	Interaction with HAP1.				cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		TCCTCTTAATCTCCTTTGCCA	0.363																																																	0													168.0	157.0	160.0					6																	135787092		1863	4111	5974	SO:0001583	missense	0			AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.609G>T	6.37:g.135787092C>A	ENSP00000356774:p.Glu203Asp		E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SH3_domain,pfam_SH3_2,superfamily_WD40_repeat_dom,superfamily_SH3_domain,smart_WD40_repeat,smart_SH3_domain,pfscan_SH3_domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_SH3_domain	p.E203D	ENST00000367800.4	37	c.609	CCDS47483.1	6	.	.	.	.	.	.	.	.	.	.	C	18.56	3.649986	0.67472	.	.	ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000265602;ENST00000327035;ENST00000367801;ENST00000524469	T;T;T;T;T	0.58210	0.35;0.35;0.35;1.46;0.69	5.86	2.55	0.30701	.	0.266954	0.36555	N	0.002523	T	0.45875	0.1364	M	0.62723	1.935	0.80722	D	1	D;D	0.67145	0.993;0.996	P;P	0.60789	0.879;0.76	T	0.43163	-0.9408	10	0.27785	T	0.31	-23.7066	5.615	0.17426	0.0:0.4118:0.0:0.5882	.	203;203	Q8N157-2;Q8N157	.;AHI1_HUMAN	D	203;203;203;203;203;185	ENSP00000356774:E203D;ENSP00000388650:E203D;ENSP00000265602:E203D;ENSP00000322478:E203D;ENSP00000433063:E185D	ENSP00000265602:E203D	E	-	3	2	AHI1	135828785	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.690000	0.37711	0.871000	0.35750	0.650000	0.86243	GAG	AHI1	-	NULL	ENSG00000135541		0.363	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	AHI1	HGNC	protein_coding	OTTHUMT00000391948.1	-	0.00	107	0	C	NM_017651		135787092	-1	tier1	-	no_errors	ENST00000265602	ensembl	human	known	74_37	missense	11.36	39	5	SNP	1.000	A
AHNAK	79026	genome.wustl.edu	37	11	62293282	62293282	+	Silent	SNP	A	A	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:62293282A>T	ENST00000378024.4	-	5	8881	c.8607T>A	c.(8605-8607)gtT>gtA	p.V2869V	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2869					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTTTGAGGTCAACTTCAGGAC	0.468																																																	0													157.0	160.0	159.0					11																	62293282		2202	4299	6501	SO:0001819	synonymous_variant	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.8607T>A	11.37:g.62293282A>T			A1A586	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.V2869	ENST00000378024.4	37	c.8607	CCDS31584.1	11																																																																																			AHNAK	-	NULL	ENSG00000124942		0.468	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	-	0.00	118	0	A	NM_024060		62293282	-1	tier1	-	no_errors	ENST00000378024	ensembl	human	known	74_37	silent	31.03	40	18	SNP	0.948	T
AHNAK2	113146	genome.wustl.edu	37	14	105408919	105408919	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:105408919T>G	ENST00000333244.5	-	7	12988	c.12869A>C	c.(12868-12870)gAc>gCc	p.D4290A	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4290						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCAGTCATGTCCTTGTCGGC	0.607																																																	0													223.0	237.0	232.0					14																	105408919		2021	4156	6177	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12869A>C	14.37:g.105408919T>G	ENSP00000353114:p.Asp4290Ala		Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D4290A	ENST00000333244.5	37	c.12869	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	t	12.30	1.895317	0.33442	.	.	ENSG00000185567	ENST00000333244	T	0.01947	4.54	3.22	3.22	0.36961	.	3.747810	0.02059	U	0.050607	T	0.15219	0.0367	M	0.91717	3.235	0.09310	N	1	D	0.76494	0.999	D	0.87578	0.998	T	0.22556	-1.0213	10	0.20046	T	0.44	.	4.1556	0.10260	0.1879:0.0:0.2285:0.5836	.	4290	Q8IVF2	AHNK2_HUMAN	A	4290	ENSP00000353114:D4290A	ENSP00000353114:D4290A	D	-	2	0	AHNAK2	104479964	0.146000	0.22672	0.012000	0.15200	0.014000	0.08584	-0.231000	0.09069	1.111000	0.41721	0.241000	0.17934	GAC	AHNAK2	-	NULL	ENSG00000185567		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	-	0.00	175	0	T	NM_138420		105408919	-1	tier1	-	no_errors	ENST00000333244	ensembl	human	known	74_37	missense	11.00	89	11	SNP	0.000	G
ALOX5	240	genome.wustl.edu	37	10	45941110	45941110	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:45941110G>A	ENST00000374391.2	+	14	2053	c.2000G>A	c.(1999-2001)cGg>cAg	p.R667Q	ALOX5_ENST00000542434.1_Missense_Mutation_p.R610Q|RP11-67C2.2_ENST00000435635.1_RNA	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	667	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	TCCCCAGACCGGATTCCGAAC	0.587																																																	0													100.0	93.0	95.0					10																	45941110		2203	4300	6503	SO:0001583	missense	0			J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.2000G>A	10.37:g.45941110G>A	ENSP00000363512:p.Arg667Gln		B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	pfam_LipOase_C,pfam_PLAT/LH2_dom,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_PLAT/LH2_dom,prints_LipOase_mml,prints_LipOase_C,pfscan_PLAT/LH2_dom	p.R667Q	ENST00000374391.2	37	c.2000	CCDS7212.1	10	.	.	.	.	.	.	.	.	.	.	G	13.22	2.171098	0.38315	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	D;D	0.89875	-2.58;-2.58	5.44	4.55	0.56014	Lipoxygenase, C-terminal (2);	0.097634	0.64402	N	0.000003	T	0.81635	0.4864	M	0.62209	1.925	0.26670	N	0.971741	B;P;P	0.39480	0.343;0.51;0.675	B;B;B	0.19391	0.019;0.025;0.014	T	0.71600	-0.4544	10	0.11182	T	0.66	-35.258	11.9177	0.52776	0.0833:0.0:0.9167:0.0	.	610;635;667	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	Q	610;667	ENSP00000437634:R610Q;ENSP00000363512:R667Q	ENSP00000363512:R667Q	R	+	2	0	ALOX5	45261116	1.000000	0.71417	0.999000	0.59377	0.690000	0.40134	5.287000	0.65645	1.544000	0.49359	0.655000	0.94253	CGG	ALOX5	-	superfamily_LipOase_C	ENSG00000012779		0.587	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX5	HGNC	protein_coding	OTTHUMT00000047780.1	-	0.00	26	0	G			45941110	+1	tier1	-	no_errors	ENST00000374391	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	A
ALPP	250	genome.wustl.edu	37	2	233243909	233243909	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:233243909G>A	ENST00000392027.2	+	3	462		c.e3-1		AC068134.8_ENST00000439072.1_RNA|AC068134.8_ENST00000441266.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental						dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		TGTTCCTTCAGGGATGGGGGT	0.622																																																	0													81.0	87.0	85.0					2																	233243909		2203	4300	6503	SO:0001630	splice_region_variant	0			M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.194-1G>A	2.37:g.233243909G>A			P05188|P06861|Q53S78|Q96DB7	Splice_Site	SNP	-	e3-1	ENST00000392027.2	37	c.194-1	CCDS2490.1	2	.	.	.	.	.	.	.	.	.	.	g	14.14	2.445421	0.43429	.	.	ENSG00000163283	ENST00000392027	.	.	.	2.47	2.47	0.30058	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3571	0.60633	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ALPP	232952153	1.000000	0.71417	0.975000	0.42487	0.658000	0.38924	7.227000	0.78070	1.379000	0.46325	0.298000	0.19748	.	ALPP	-	-	ENSG00000163283		0.622	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPP	HGNC	protein_coding	OTTHUMT00000257032.3	-	0.00	92	0	G	NM_001632	Intron	233243909	+1	tier1	rs150492331	no_errors	ENST00000392027	ensembl	human	known	74_37	splice_site	20.00	28	7	SNP	1.000	A
ANKRD30A	91074	genome.wustl.edu	37	10	37421265	37421265	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:37421265A>C	ENST00000602533.1	+	4	539	c.440A>C	c.(439-441)aAg>aCg	p.K147T	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.K147T|RNU6-811P_ENST00000384069.1_RNA|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.K147T			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	203					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GCAGTTAATAAGTATAAATGG	0.294																																																	0													46.0	44.0	45.0					10																	37421265		1790	4048	5838	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.440A>C	10.37:g.37421265A>C	ENSP00000473551:p.Lys147Thr		Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K147T	ENST00000602533.1	37	c.440		10	.	.	.	.	.	.	.	.	.	.	.	9.175	1.022011	0.19433	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.72167	-0.2;-0.63	2.37	-0.435	0.12279	Ankyrin repeat-containing domain (4);	.	.	.	.	T	0.52075	0.1712	L	0.46614	1.455	0.09310	N	1	P	0.41748	0.761	B	0.33846	0.171	T	0.40905	-0.9538	9	0.31617	T	0.26	.	2.8849	0.05658	0.5709:0.2614:0.1676:0.0	.	203	Q9BXX3	AN30A_HUMAN	T	147	ENSP00000354432:K147T;ENSP00000363792:K147T	ENSP00000354432:K147T	K	+	2	0	ANKRD30A	37461271	0.004000	0.15560	0.002000	0.10522	0.033000	0.12548	0.082000	0.14847	0.066000	0.16515	0.240000	0.17902	AAG	ANKRD30A	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000148513		0.294	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	-	0.00	71	0	A	NM_052997		37421265	+1	tier1	-	no_errors	ENST00000361713	ensembl	human	known	74_37	missense	34.62	17	9	SNP	0.001	C
ANKRD33B	651746	genome.wustl.edu	37	5	10649794	10649794	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:10649794C>T	ENST00000296657.5	+	4	1054	c.1054C>T	c.(1054-1056)Cgg>Tgg	p.R352W		NM_001164440.1	NP_001157912.1	A6NCL7	AN33B_HUMAN	ankyrin repeat domain 33B	352																	GCGGGCTGCACGGGGCCCCCA	0.766																																																	0													2.0	3.0	2.0					5																	10649794		519	1265	1784	SO:0001583	missense	0				CCDS47191.1	5p15.2	2013-01-10			ENSG00000164236	ENSG00000164236		"""Ankyrin repeat domain containing"""	35240	protein-coding gene	gene with protein product							Standard	NM_001164440		Approved		uc021xwp.1	A6NCL7	OTTHUMG00000162050	ENST00000296657.5:c.1054C>T	5.37:g.10649794C>T	ENSP00000296657:p.Arg352Trp			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R352W	ENST00000296657.5	37	c.1054	CCDS47191.1	5	.	.	.	.	.	.	.	.	.	.	C	11.49	1.653049	0.29336	.	.	ENSG00000164236	ENST00000296657	T	0.43294	0.95	5.05	0.787	0.18596	.	1.419990	0.04406	N	0.365098	T	0.41488	0.1161	L	0.40543	1.245	0.09310	N	1	.	.	.	.	.	.	T	0.43925	-0.9361	7	.	.	.	-21.9104	10.8297	0.46652	0.1816:0.3416:0.4767:0.0	.	.	.	.	W	352	ENSP00000296657:R352W	.	R	+	1	2	ANKRD33B	10702794	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.226000	0.17776	0.483000	0.27608	0.603000	0.83216	CGG	ANKRD33B	-	NULL	ENSG00000164236		0.766	ANKRD33B-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|exp_conf|CCDS	protein_coding	ANKRD33B	HGNC	protein_coding	OTTHUMT00000367037.3	-	0.00	65	0	C	XM_001130634		10649794	+1	tier1	-	no_errors	ENST00000296657	ensembl	human	novel	74_37	missense	6.78	55	4	SNP	0.000	T
ANKS4B	257629	genome.wustl.edu	37	16	21261759	21261759	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr16:21261759A>T	ENST00000311620.5	+	2	945	c.872A>T	c.(871-873)aAg>aTg	p.K291M		NM_145865.2	NP_665872.2	Q8N8V4	ANS4B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 4B	291					response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum membrane (GO:0005789)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|lung(11)|ovary(2)	20				GBM - Glioblastoma multiforme(48;0.0565)		TCAGATAGCAAGAGAGAGTTT	0.463																																																	0													93.0	97.0	96.0					16																	21261759		1993	4174	6167	SO:0001583	missense	0			AK096138	CCDS42130.1	16p12.2	2013-01-10				ENSG00000175311		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26795	protein-coding gene	gene with protein product		609901					Standard	NM_145865		Approved	FLJ38819, HARP	uc010bwp.1	Q8N8V4		ENST00000311620.5:c.872A>T	16.37:g.21261759A>T	ENSP00000308772:p.Lys291Met			Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K291M	ENST00000311620.5	37	c.872	CCDS42130.1	16	.	.	.	.	.	.	.	.	.	.	A	6.740	0.505262	0.12822	.	.	ENSG00000175311	ENST00000311620	T	0.42900	0.96	5.77	3.41	0.39046	.	0.371935	0.30260	N	0.010023	T	0.40743	0.1129	M	0.65975	2.015	0.38732	D	0.953688	B	0.32425	0.371	B	0.39185	0.293	T	0.43245	-0.9403	10	0.52906	T	0.07	-21.4017	3.8054	0.08774	0.5694:0.1813:0.2493:0.0	.	291	Q8N8V4	ANS4B_HUMAN	M	291	ENSP00000308772:K291M	ENSP00000308772:K291M	K	+	2	0	ANKS4B	21169260	1.000000	0.71417	0.954000	0.39281	0.097000	0.18754	3.090000	0.50191	1.015000	0.39444	0.482000	0.46254	AAG	ANKS4B	-	NULL	ENSG00000175311		0.463	ANKS4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKS4B	HGNC	protein_coding	OTTHUMT00000436535.1		0.00	49	0	A	NM_145865		21261759	+1			no_errors	ENST00000311620	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.525	T
ANO2	57101	genome.wustl.edu	37	12	5685120	5685120	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:5685120C>T	ENST00000356134.5	-	25	2575	c.2504G>A	c.(2503-2505)aGt>aAt	p.S835N	ANO2_ENST00000327087.8_Missense_Mutation_p.S834N|ANO2_ENST00000546188.1_Missense_Mutation_p.S835N	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	839					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						CCCATTGTGACTGTAGGAGTA	0.527																																																	0													75.0	79.0	78.0					12																	5685120		1956	4160	6116	SO:0001583	missense	0			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2504G>A	12.37:g.5685120C>T	ENSP00000348453:p.Ser835Asn		C4N787|Q9H847	Missense_Mutation	SNP	pfam_Anoctamin	p.S835N	ENST00000356134.5	37	c.2504		12	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283545	0.80803	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	T;T;T	0.69306	-0.39;-0.39;-0.39	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.80121	0.4565	M	0.64676	1.99	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	T	0.78334	-0.2244	10	0.39692	T	0.17	.	18.2772	0.90087	0.0:1.0:0.0:0.0	.	834	Q9NQ90-3	.	N	834;835;835;839	ENSP00000314048:S834N;ENSP00000348453:S835N;ENSP00000440981:S835N	ENSP00000314048:S834N	S	-	2	0	ANO2	5555381	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.621000	0.88768	0.650000	0.86243	AGT	ANO2	-	pfam_Anoctamin	ENSG00000047617		0.527	ANO2-001	KNOWN	basic	protein_coding	ANO2	HGNC	protein_coding	OTTHUMT00000399019.4	-	0.00	64	0	C	NM_020373		5685120	-1	tier1	-	no_errors	ENST00000356134	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	T
ANP32A	8125	genome.wustl.edu	37	15	69072347	69072347	+	3'UTR	DEL	G	G	-	rs3214818	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:69072347delG	ENST00000465139.2	-	0	966				ANP32A_ENST00000483551.2_5'Flank	NM_006305.3	NP_006296.1	P39687	AN32A_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member A						gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA metabolic process (GO:0016071)|nucleocytoplasmic transport (GO:0006913)|regulation of transcription, DNA-templated (GO:0006355)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)	4						CAGGATTGGAGGGGGGGGGGA	0.478													|||unknown(HR)	16	0.00319489	0.0083	0.0029	5008	,	,		8789	0.001		0.0	False		,,,				2504	0.002																0																																										SO:0001624	3_prime_UTR_variant	0			AF025684	CCDS45292.1	15q23	2008-05-14			ENSG00000140350	ENSG00000140350		"""ANP32 acidic nuclear phosphoproteins"""	13233	protein-coding gene	gene with protein product		600832		C15orf1		8970164, 9144194	Standard	NM_006305		Approved	LANP, PP32, I1PP2A, PHAPI, MAPM, mapmodulin	uc002arl.3	P39687	OTTHUMG00000154502	ENST00000465139.2:c.*73C>-	15.37:g.69072347delG			B2R6T4|Q53FK4|Q5J8L8|Q7M4N6	RNA	DEL	-	NULL	ENST00000465139.2	37	NULL	CCDS45292.1	15																																																																																			ANP32A	-	-	ENSG00000140350		0.478	ANP32A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32A	HGNC	protein_coding	OTTHUMT00000335525.2		0.00	53	0	G			69072347	-1	tier1		no_errors	ENST00000267918	ensembl	human	known	74_37	rna	17.39	19	4	DEL	0.000	-
APBB1IP	54518	genome.wustl.edu	37	10	26856357	26856357	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:26856357G>A	ENST00000376236.4	+	15	2396	c.1941G>A	c.(1939-1941)gaG>gaA	p.E647E		NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	647					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						GAGGCGGGGAGCAAGATTTCA	0.627																																																	0													42.0	39.0	40.0					10																	26856357		2203	4300	6503	SO:0001819	synonymous_variant	0			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.1941G>A	10.37:g.26856357G>A			Q8IWS8|Q8IYL7|Q8IZZ7	Silent	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc	p.E647	ENST00000376236.4	37	c.1941	CCDS31167.1	10	.	.	.	.	.	.	.	.	.	.	G	1.856	-0.463780	0.04476	.	.	ENSG00000077420	ENST00000445780	.	.	.	5.47	3.37	0.38596	.	.	.	.	.	T	0.58581	0.2132	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60541	-0.7243	5	0.66056	D	0.02	.	4.4302	0.11524	0.4216:0.0:0.5784:0.0	.	.	.	.	T	591	.	ENSP00000412699:A591T	A	+	1	0	APBB1IP	26896363	1.000000	0.71417	0.979000	0.43373	0.117000	0.20001	0.963000	0.29293	1.311000	0.45024	0.655000	0.94253	GCA	APBB1IP	-	NULL	ENSG00000077420		0.627	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	HGNC	protein_coding	OTTHUMT00000047270.1	-	0.00	36	0	G	NM_019043		26856357	+1	tier1	-	no_errors	ENST00000376236	ensembl	human	known	74_37	silent	13.79	25	4	SNP	0.999	A
APLF	200558	genome.wustl.edu	37	2	68765198	68765198	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:68765198C>T	ENST00000303795.4	+	7	1170	c.999C>T	c.(997-999)ggC>ggT	p.G333G	APLF_ENST00000471727.1_3'UTR	NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	333					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						GTGCCCAGGGCGACTCACTTC	0.423																																																	0													92.0	86.0	88.0					2																	68765198		2203	4300	6503	SO:0001819	synonymous_variant	0			BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.999C>T	2.37:g.68765198C>T			A8K476|Q53P47|Q53PB9|Q53QU0	Silent	SNP	pfam_Znf_C2H2_APLF-like,superfamily_SMAD_FHA_domain	p.G333	ENST00000303795.4	37	c.999	CCDS1888.1	2																																																																																			APLF	-	NULL	ENSG00000169621		0.423	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APLF	HGNC	protein_coding	OTTHUMT00000251759.1	-	0.00	43	0	C	NM_173545		68765198	+1	tier1	-	no_errors	ENST00000303795	ensembl	human	known	74_37	silent	47.83	12	11	SNP	0.190	T
AQP3	360	genome.wustl.edu	37	9	33441179	33441180	+	3'UTR	INS	-	-	T	rs541502176	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:33441179_33441180insT	ENST00000297991.4	-	0	1820_1821				AQP3_ENST00000493581.1_5'UTR	NM_004925.4	NP_004916.1	Q92482	AQP3_HUMAN	aquaporin 3 (Gill blood group)						excretion (GO:0007588)|odontogenesis (GO:0042476)|positive regulation of immune system process (GO:0002684)|regulation of keratinocyte differentiation (GO:0045616)|renal water absorption (GO:0070295)|response to calcium ion (GO:0051592)|response to retinoic acid (GO:0032526)|response to vitamin D (GO:0033280)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urea transport (GO:0015840)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		tatttattttattttttttaat	0.416																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS6542.1	9p13	2014-07-18	2006-02-23		ENSG00000165272	ENSG00000165272		"""Ion channels / Aquaporins"", ""Blood group antigens"""	636	protein-coding gene	gene with protein product	"""Gill blood group"""	600170	"""aquaporin 3"", ""aquaporin 3 (GIL blood group)"""			7558005	Standard	NM_004925		Approved	GIL	uc003zsx.3	Q92482	OTTHUMG00000019769	ENST00000297991.4:c.*862->A	9.37:g.33441187_33441187dupT			A8K843|B2RE16|D3DRL3|O00108|Q6FGT2|Q6FGW6	RNA	INS	-	NULL	ENST00000297991.4	37	NULL	CCDS6542.1	9																																																																																			AQP3	-	-	ENSG00000165272		0.416	AQP3-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	AQP3	HGNC	protein_coding	OTTHUMT00000052055.1		0.00	78	0	-	NM_004925		33441180	-1	tier1		no_errors	ENST00000493581	ensembl	human	known	74_37	rna	23.53	39	12	INS	0.001:0.018	T
ARHGEF7	8874	genome.wustl.edu	37	13	111862249	111862249	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr13:111862249C>T	ENST00000375741.2	+	5	681	c.431C>T	c.(430-432)gCc>gTc	p.A144V	ARHGEF7_ENST00000218789.5_5'UTR|ARHGEF7_ENST00000375737.5_Missense_Mutation_p.A41V|ARHGEF7_ENST00000375723.1_5'UTR|ARHGEF7_ENST00000426073.2_5'UTR|ARHGEF7_ENST00000370623.3_Intron|ARHGEF7_ENST00000375736.4_5'UTR|ARHGEF7_ENST00000375739.2_Missense_Mutation_p.A94V|ARHGEF7_ENST00000544132.1_Intron|ARHGEF7_ENST00000317133.5_Missense_Mutation_p.A123V	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	144					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			TCCGTGTGTGCCCGGCCCTCG	0.537																																																	0													206.0	204.0	205.0					13																	111862249		2203	4300	6503	SO:0001583	missense	0			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.431C>T	13.37:g.111862249C>T	ENSP00000364893:p.Ala144Val		B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_CH-domain,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain	p.A144V	ENST00000375741.2	37	c.431	CCDS45068.1	13	.	.	.	.	.	.	.	.	.	.	C	15.26	2.779739	0.49891	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000545635;ENST00000426768;ENST00000375737	T;T;T;T;T	0.52526	0.69;0.66;0.68;0.9;0.69	5.39	5.39	0.77823	Calponin homology domain (1);	0.108954	0.64402	D	0.000007	T	0.38134	0.1029	N	0.19112	0.55	0.80722	D	1	B;B;B;B	0.15141	0.001;0.012;0.004;0.008	B;B;B;B	0.15052	0.004;0.005;0.005;0.012	T	0.12889	-1.0530	10	0.48119	T	0.1	.	19.5049	0.95111	0.0:1.0:0.0:0.0	.	41;94;144;123	B7Z6G2;Q14155-2;Q14155;Q14155-3	.;.;ARHG7_HUMAN;.	V	123;144;94;121;41;41	ENSP00000325994:A123V;ENSP00000364893:A144V;ENSP00000364891:A94V;ENSP00000389890:A41V;ENSP00000364889:A41V	ENSP00000325994:A123V	A	+	2	0	ARHGEF7	110660250	1.000000	0.71417	0.986000	0.45419	0.509000	0.34042	4.312000	0.59154	2.677000	0.91161	0.655000	0.94253	GCC	ARHGEF7	-	superfamily_CH-domain	ENSG00000102606		0.537	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	ARHGEF7	HGNC	protein_coding			0.00	134	0	C	NM_001113511		111862249	+1			no_errors	ENST00000375741	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
ARMC4	55130	genome.wustl.edu	37	10	28151508	28151508	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:28151508A>G	ENST00000305242.5	-	18	2746	c.2654T>C	c.(2653-2655)cTt>cCt	p.L885P	ARMC4_ENST00000545014.1_Missense_Mutation_p.L410P|ARMC4_ENST00000537576.1_Missense_Mutation_p.L577P	NM_018076.2	NP_060546.2	Q5T2S8	ARMC4_HUMAN	armadillo repeat containing 4	885					cell projection organization (GO:0030030)|cilium movement (GO:0003341)|left/right axis specification (GO:0070986)|outer dynein arm assembly (GO:0036158)|ventricular system development (GO:0021591)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(17)|liver(1)|lung(17)|ovary(5)|prostate(3)|skin(8)|stomach(2)|urinary_tract(3)	75						ATTGACAATAAGTTCCAAACC	0.343																																																	0													104.0	97.0	99.0					10																	28151508		2203	4300	6503	SO:0001583	missense	0			AL136859	CCDS7157.1	10p12.1-p11.23	2014-02-03			ENSG00000169126	ENSG00000169126		"""Armadillo repeat containing"""	25583	protein-coding gene	gene with protein product		615408				11230166	Standard	XM_005252485		Approved	FLJ10817, FLJ10376, DKFZP434P1735, CILD23	uc001itz.3	Q5T2S8	OTTHUMG00000017867	ENST00000305242.5:c.2654T>C	10.37:g.28151508A>G	ENSP00000306410:p.Leu885Pro		A8K906|B7Z7I1|Q9H0C0	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_GSKIP_dom,smart_Armadillo,pfscan_Armadillo	p.L885P	ENST00000305242.5	37	c.2654	CCDS7157.1	10	.	.	.	.	.	.	.	.	.	.	A	18.95	3.731490	0.69189	.	.	ENSG00000169126	ENST00000537576;ENST00000305242;ENST00000545014	D;D;D	0.96011	-3.88;-3.88;-3.88	5.75	5.75	0.90469	Armadillo-like helical (1);Armadillo-type fold (1);	0.059733	0.64402	D	0.000002	D	0.96583	0.8885	M	0.80847	2.515	0.80722	D	1	P;P	0.50943	0.884;0.94	P;B	0.51974	0.686;0.41	D	0.96009	0.9000	10	0.37606	T	0.19	-23.773	16.0755	0.80965	1.0:0.0:0.0:0.0	.	410;885	B7Z7I1;Q5T2S8	.;ARMC4_HUMAN	P	577;885;410	ENSP00000443208:L577P;ENSP00000306410:L885P;ENSP00000441076:L410P	ENSP00000306410:L885P	L	-	2	0	ARMC4	28191514	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.489000	0.81451	2.182000	0.69389	0.528000	0.53228	CTT	ARMC4	-	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	ENSG00000169126		0.343	ARMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC4	HGNC	protein_coding	OTTHUMT00000047339.1	-	0.00	67	0	A	NM_018076		28151508	-1	tier1	-	no_errors	ENST00000305242	ensembl	human	known	74_37	missense	27.66	34	13	SNP	1.000	G
ASXL2	55252	genome.wustl.edu	37	2	26101061	26101061	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:26101061T>A	ENST00000435504.4	-	1	324	c.31A>T	c.(31-33)Agg>Tgg	p.R11W	ASXL2_ENST00000336112.4_5'UTR|ASXL2_ENST00000272341.4_5'UTR			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	11					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCCAGGTCCTGCCCTTCTTC	0.667																																																	0													102.0	109.0	107.0					2																	26101061		1917	4116	6033	SO:0001583	missense	0					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.31A>T	2.37:g.26101061T>A	ENSP00000391447:p.Arg11Trp		Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.R11W	ENST00000435504.4	37	c.31		2	.	.	.	.	.	.	.	.	.	.	T	17.58	3.425751	0.62733	.	.	ENSG00000143970	ENST00000435504	T	0.30182	1.54	4.53	4.53	0.55603	.	.	.	.	.	T	0.49133	0.1539	L	0.57536	1.79	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.50882	-0.8775	9	0.87932	D	0	.	10.5651	0.45167	0.0:0.0:0.0:1.0	.	11	Q76L83	ASXL2_HUMAN	W	11	ENSP00000391447:R11W	ENSP00000391447:R11W	R	-	1	2	ASXL2	25954565	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.611000	0.54132	1.802000	0.52723	0.459000	0.35465	AGG	ASXL2	-	NULL	ENSG00000143970		0.667	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	HGNC	protein_coding	OTTHUMT00000325593.3	-	0.00	132	0	T	NM_018263		26101061	-1	tier1	-	no_errors	ENST00000435504	ensembl	human	known	74_37	missense	12.28	50	7	SNP	1.000	A
ATP10A	57194	genome.wustl.edu	37	15	25947173	25947173	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:25947173G>T	ENST00000356865.6	-	13	2761	c.2650C>A	c.(2650-2652)Cag>Aag	p.Q884K		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	884					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		ACCCAAATCTGCAGGCCCGCT	0.522																																																	0													161.0	149.0	153.0					15																	25947173		2203	4300	6503	SO:0001583	missense	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.2650C>A	15.37:g.25947173G>T	ENSP00000349325:p.Gln884Lys		Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.Q884K	ENST00000356865.6	37	c.2650	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	G	16.05	3.013767	0.54468	.	.	ENSG00000206190	ENST00000356865	T	0.64803	-0.12	5.38	5.38	0.77491	HAD-like domain (2);	0.048723	0.85682	D	0.000000	T	0.39036	0.1063	N	0.02916	-0.46	0.54753	D	0.999986	B	0.20052	0.041	B	0.28139	0.086	T	0.42498	-0.9448	10	0.02654	T	1	-32.8848	19.125	0.93378	0.0:0.0:1.0:0.0	.	884	O60312	AT10A_HUMAN	K	884	ENSP00000349325:Q884K	ENSP00000349325:Q884K	Q	-	1	0	ATP10A	23498266	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	9.534000	0.98061	2.520000	0.84964	0.561000	0.74099	CAG	ATP10A	-	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transp	ENSG00000206190		0.522	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	-	0.00	106	0	G	NM_024490		25947173	-1	tier1	-	no_errors	ENST00000356865	ensembl	human	known	74_37	missense	9.30	38	4	SNP	1.000	T
ATP10A	57194	genome.wustl.edu	37	15	25959185	25959185	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:25959185C>A	ENST00000356865.6	-	10	2091	c.1980G>T	c.(1978-1980)caG>caT	p.Q660H		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	660					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CCGAGGTGGGCTGGCCCAGCC	0.677																																																	0													28.0	31.0	30.0					15																	25959185		2203	4299	6502	SO:0001583	missense	0			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.1980G>T	15.37:g.25959185C>A	ENSP00000349325:p.Gln660His		Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.Q660H	ENST00000356865.6	37	c.1980	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	C	2.106	-0.404888	0.04832	.	.	ENSG00000206190	ENST00000356865	T	0.10573	2.86	3.77	-0.864	0.10666	HAD-like domain (1);	1.182170	0.05706	N	0.595005	T	0.08537	0.0212	L	0.31752	0.955	0.09310	N	1	B	0.06786	0.001	B	0.18263	0.021	T	0.41805	-0.9488	10	0.44086	T	0.13	-7.3726	5.7968	0.18392	0.0:0.2953:0.4763:0.2284	.	660	O60312	AT10A_HUMAN	H	660	ENSP00000349325:Q660H	ENSP00000349325:Q660H	Q	-	3	2	ATP10A	23510278	0.002000	0.14202	0.000000	0.03702	0.018000	0.09664	0.890000	0.28295	0.048000	0.15891	0.561000	0.74099	CAG	ATP10A	-	superfamily_HAD-like_dom	ENSG00000206190		0.677	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	-	0.00	120	0	C	NM_024490		25959185	-1	tier1	-	no_errors	ENST00000356865	ensembl	human	known	74_37	missense	24.14	44	14	SNP	0.000	A
ATP4A	495	genome.wustl.edu	37	19	36050028	36050028	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:36050028C>T	ENST00000262623.3	-	8	1150	c.1122G>A	c.(1120-1122)gcG>gcA	p.A374A		NM_000704.2	NP_000695.2	P20648	ATP4A_HUMAN	ATPase, H+/K+ exchanging, alpha polypeptide	374					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|ion transmembrane transport (GO:0034220)|pH reduction (GO:0045851)|regulation of proton transport (GO:0010155)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|magnesium ion binding (GO:0000287)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(26)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	53	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)	ATGTCTCCACCGCCTCCAGGT	0.602																																																	0													233.0	206.0	215.0					19																	36050028		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12467.1	19q13.1	2010-04-20			ENSG00000105675	ENSG00000105675	3.6.3.10	"""ATPases / P-type"""	819	protein-coding gene	gene with protein product	"""gastric H,K-ATPase alpha subunit"", ""H(+)-K(+)-ATPase alpha subunit"", ""proton pump"""	137216				1330887	Standard	NM_000704		Approved	ATP6A	uc002oal.1	P20648	OTTHUMG00000048106	ENST00000262623.3:c.1122G>A	19.37:g.36050028C>T			O00738	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATPase_P-typ_H/K-transp_N,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	p.A374	ENST00000262623.3	37	c.1122	CCDS12467.1	19																																																																																			ATP4A	-	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Na/K_IIC,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000105675		0.602	ATP4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4A	HGNC	protein_coding	OTTHUMT00000109470.2	-	0.00	46	0	C	NM_000704		36050028	-1	tier1	-	no_errors	ENST00000262623	ensembl	human	known	74_37	silent	22.22	14	4	SNP	0.987	T
ATP8A1	10396	genome.wustl.edu	37	4	42467002	42467002	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:42467002C>T	ENST00000381668.5	-	26	2647	c.2416G>A	c.(2416-2418)Gtc>Atc	p.V806I	ATP8A1_ENST00000264449.10_Missense_Mutation_p.V791I	NM_006095.2	NP_006086.1	Q9Y2Q0	AT8A1_HUMAN	ATPase, aminophospholipid transporter (APLT), class I, type 8A, member 1	806					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|pancreas(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	51					Phosphatidylserine(DB00144)	ATCATGCTGACATCATTTGCT	0.453																																																	0													183.0	150.0	161.0					4																	42467002		2203	4300	6503	SO:0001583	missense	0			AF067820	CCDS3466.1, CCDS47049.1	4p13	2010-04-20	2007-09-19		ENSG00000124406	ENSG00000124406		"""ATPases / P-type"""	13531	protein-coding gene	gene with protein product		609542	"""ATPase, aminophospholipid transporter (APLT), Class I, type 8A, member 1"""			10198212, 9548971	Standard	NM_006095		Approved	ATPIA	uc003gwr.2	Q9Y2Q0	OTTHUMG00000099403	ENST00000381668.5:c.2416G>A	4.37:g.42467002C>T	ENSP00000371084:p.Val806Ile		Q32M35|Q32M36|Q4W5J7|Q4W5P2	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.V806I	ENST00000381668.5	37	c.2416	CCDS3466.1	4	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128832	0.77549	.	.	ENSG00000124406	ENST00000381668;ENST00000264449	T;T	0.76448	-1.02;-1.02	5.38	4.54	0.55810	HAD-like domain (2);	0.077115	0.51477	N	0.000081	D	0.87358	0.6157	M	0.81497	2.545	0.80722	D	1	P;D;D	0.64830	0.951;0.994;0.994	P;D;D	0.67900	0.863;0.954;0.954	D	0.88841	0.3312	10	0.62326	D	0.03	.	14.4066	0.67086	0.0:0.9284:0.0:0.0716	.	791;806;798	Q32M35;Q9Y2Q0;E7EUK4	.;AT8A1_HUMAN;.	I	806;791	ENSP00000371084:V806I;ENSP00000264449:V791I	ENSP00000264449:V791I	V	-	1	0	ATP8A1	42161759	1.000000	0.71417	0.970000	0.41538	0.617000	0.37484	5.959000	0.70339	1.409000	0.46915	0.585000	0.79938	GTC	ATP8A1	-	superfamily_HAD-like_dom,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000124406		0.453	ATP8A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP8A1	HGNC	protein_coding	OTTHUMT00000216861.2	-	0.00	52	0	C	NM_006095		42467002	-1	tier1	-	no_errors	ENST00000381668	ensembl	human	known	74_37	missense	21.43	11	3	SNP	1.000	T
BDNF	627	genome.wustl.edu	37	11	27679499	27679499	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:27679499T>G	ENST00000525528.1	-	1	1706	c.613A>C	c.(613-615)Aac>Cac	p.N205H	BDNF-AS_ENST00000530313.1_RNA|BDNF_ENST00000530861.1_Missense_Mutation_p.N205H|BDNF_ENST00000356660.4_Missense_Mutation_p.N205H|BDNF_ENST00000438929.1_Missense_Mutation_p.N287H|BDNF_ENST00000418212.1_Missense_Mutation_p.N205H|BDNF-AS_ENST00000532965.1_RNA|BDNF_ENST00000525950.1_Missense_Mutation_p.N205H|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000395983.3_Missense_Mutation_p.N205H|BDNF_ENST00000314915.6_Missense_Mutation_p.N213H|BDNF_ENST00000439476.2_Missense_Mutation_p.N205H|BDNF-AS_ENST00000500662.2_RNA|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000395978.3_Missense_Mutation_p.N205H|BDNF_ENST00000395986.2_Missense_Mutation_p.N220H|BDNF_ENST00000533131.1_Missense_Mutation_p.N205H|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000532997.1_Missense_Mutation_p.N205H|BDNF_ENST00000533246.1_Missense_Mutation_p.N205H|BDNF_ENST00000395981.3_Missense_Mutation_p.N205H|BDNF-AS_ENST00000502161.2_RNA|BDNF_ENST00000584049.1_5'UTR|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000420794.1_Missense_Mutation_p.N205H|BDNF_ENST00000395980.2_Missense_Mutation_p.N205H	NM_170735.5	NP_733931.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor	205					axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						CACTGGGAGTTCCAATGCCTT	0.478																																																	0													178.0	176.0	176.0					11																	27679499		2202	4299	6501	SO:0001583	missense	0			AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000525528.1:c.613A>C	11.37:g.27679499T>G	ENSP00000437138:p.Asn205His		A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Missense_Mutation	SNP	pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,pfscan_Nerve_growth_factor-rel,prints_Brain-der_neurotrophic_factor,prints_Nerve_growth_factor-rel	p.N287H	ENST00000525528.1	37	c.859	CCDS7866.1	11	.	.	.	.	.	.	.	.	.	.	T	14.76	2.630458	0.46944	.	.	ENSG00000176697	ENST00000439476;ENST00000525528;ENST00000395986;ENST00000533131;ENST00000356660;ENST00000418212;ENST00000533246;ENST00000530861;ENST00000395983;ENST00000438929;ENST00000395980;ENST00000532997;ENST00000395981;ENST00000395978;ENST00000525950;ENST00000314915;ENST00000420794;ENST00000528035	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.68765	-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35;-0.35	5.86	5.86	0.93980	Nerve growth factor-related (5);Nerve growth factor conserved site (1);	0.000000	0.85682	D	0.000000	T	0.81884	0.4917	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.996;0.999;0.999	D;D;D;D;D	0.87578	0.998;0.996;0.986;0.992;0.986	D	0.84038	0.0363	10	0.87932	D	0	-9.198	16.2526	0.82494	0.0:0.0:0.0:1.0	.	234;287;213;205;220	P23560-5;P23560-4;P23560-2;P23560;P23560-3	.;.;.;BDNF_HUMAN;.	H	205;205;220;205;205;205;205;205;205;287;205;205;205;205;205;213;205;157	ENSP00000389345:N205H;ENSP00000437138:N205H;ENSP00000379309:N220H;ENSP00000432727:N205H;ENSP00000349084:N205H;ENSP00000400502:N205H;ENSP00000432376:N205H;ENSP00000435564:N205H;ENSP00000379307:N205H;ENSP00000414303:N287H;ENSP00000379304:N205H;ENSP00000435805:N205H;ENSP00000379305:N205H;ENSP00000379302:N205H;ENSP00000432035:N205H;ENSP00000320002:N213H;ENSP00000389564:N205H	ENSP00000320002:N213H	N	-	1	0	BDNF	27636075	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.241000	0.73720	0.482000	0.46254	AAC	BDNF	-	pfam_Nerve_growth_factor-rel,smart_Nerve_growth_factor-rel,pfscan_Nerve_growth_factor-rel,prints_Nerve_growth_factor-rel	ENSG00000176697		0.478	BDNF-016	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BDNF	HGNC	protein_coding	OTTHUMT00000388135.1	-	0.00	18	0	T	NM_170735		27679499	-1	tier1	-	no_errors	ENST00000438929	ensembl	human	known	74_37	missense	45.45	6	5	SNP	1.000	G
BICC1	80114	genome.wustl.edu	37	10	60562850	60562850	+	Silent	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:60562850T>C	ENST00000373886.3	+	15	2033	c.2029T>C	c.(2029-2031)Ttg>Ctg	p.L677L	BICC1_ENST00000263103.1_Silent_p.L303L	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	677					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						CACTGACAGGTTGCTCTCAGA	0.488																																																	0													64.0	61.0	62.0					10																	60562850		2203	4300	6503	SO:0001819	synonymous_variant	0			AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.2029T>C	10.37:g.60562850T>C				Silent	SNP	pfam_KH_dom_type_1,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_KH_dom,smart_SAM,pfscan_SAM,pfscan_KH_dom_type_1	p.L677	ENST00000373886.3	37	c.2029	CCDS31206.1	10																																																																																			BICC1	-	NULL	ENSG00000122870		0.488	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICC1	HGNC	protein_coding	OTTHUMT00000048150.2	-	0.00	36	0	T	NM_025044		60562850	+1	tier1	-	no_errors	ENST00000373886	ensembl	human	known	74_37	silent	28.00	18	7	SNP	0.949	C
BRD4	23476	genome.wustl.edu	37	19	15355177	15355177	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:15355177C>T	ENST00000263377.2	-	13	2667	c.2446G>A	c.(2446-2448)Gtc>Atc	p.V816I		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	816					cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GGGTCAAAGACGCTGCCTGGG	0.697			T	C15orf55	lethal midline carcinoma of young people																																			Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	0													15.0	18.0	17.0					19																	15355177		2195	4297	6492	SO:0001583	missense	0			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.2446G>A	19.37:g.15355177C>T	ENSP00000263377:p.Val816Ile		O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.V816I	ENST00000263377.2	37	c.2446	CCDS12328.1	19	.	.	.	.	.	.	.	.	.	.	C	13.97	2.395273	0.42512	.	.	ENSG00000141867	ENST00000263377	T	0.29655	1.56	4.43	3.37	0.38596	.	0.141137	0.32640	N	0.005828	T	0.21145	0.0509	L	0.47716	1.5	0.80722	D	1	B	0.30146	0.27	B	0.17433	0.018	T	0.05354	-1.0890	10	0.33940	T	0.23	-14.04	6.1744	0.20434	0.0:0.7036:0.1928:0.1035	.	816	O60885	BRD4_HUMAN	I	816	ENSP00000263377:V816I	ENSP00000263377:V816I	V	-	1	0	BRD4	15216177	0.917000	0.31117	1.000000	0.80357	0.993000	0.82548	0.999000	0.29757	0.831000	0.34780	0.561000	0.74099	GTC	BRD4	-	NULL	ENSG00000141867		0.697	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BRD4	HGNC	protein_coding	OTTHUMT00000465800.3	-	0.00	96	0	C	NM_058243		15355177	-1	tier1	-	no_errors	ENST00000263377	ensembl	human	known	74_37	missense	8.77	52	5	SNP	0.997	T
BTN1A1	696	genome.wustl.edu	37	6	26509198	26509198	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:26509198C>T	ENST00000244513.6	+	7	1443	c.1377C>T	c.(1375-1377)ttC>ttT	p.F459F		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	459	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						TCCGGCCCTTCTTTTGCCTAT	0.478																																																	0													74.0	71.0	72.0					6																	26509198		2203	4300	6503	SO:0001819	synonymous_variant	0			U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.1377C>T	6.37:g.26509198C>T			Q4VAN3|Q4VAN4|Q9H458	Silent	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like_dom,prints_Butyrophylin	p.F459	ENST00000244513.6	37	c.1377	CCDS4614.1	6																																																																																			BTN1A1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000124557		0.478	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN1A1	HGNC	protein_coding	OTTHUMT00000043776.1		0.00	64	0	C	NM_001732		26509198	+1			no_errors	ENST00000244513	ensembl	human	known	74_37	silent	11.11	24	3	SNP	1.000	T
MALRD1	340895	genome.wustl.edu	37	10	19493862	19493862	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:19493862A>C	ENST00000454679.2	+	2	134	c.134A>C	c.(133-135)gAg>gCg	p.E45A				Q5VYJ5	MALR1_HUMAN		45	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cholesterol homeostasis (GO:0042632)|negative regulation of bile acid biosynthetic process (GO:0070858)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				breast(1)|lung(2)	3						GGAGCAGCTGAGCTGCAGCTA	0.388																																																	0																																										SO:0001583	missense	0																														ENST00000454679.2:c.134A>C	10.37:g.19493862A>C	ENSP00000412763:p.Glu45Ala		B7ZBP2	Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,prints_LDrepeatLR_classA_rpt,prints_MAM_dom	p.E45A	ENST00000454679.2	37	c.134		10	.	.	.	.	.	.	.	.	.	.	A	16.03	3.008545	0.54361	.	.	ENSG00000204740	ENST00000377266;ENST00000454679	T;T	0.02067	4.47;4.47	5.44	4.28	0.50868	.	0.316818	0.38164	N	0.001788	T	0.05227	0.0139	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50206	-0.8855	6	.	.	.	-20.0804	11.4997	0.50430	0.8536:0.0:0.0:0.1464	.	.	.	.	A	58;45	ENSP00000366477:E58A;ENSP00000412763:E45A	.	E	+	2	0	C10orf112	19533868	1.000000	0.71417	0.967000	0.41034	0.965000	0.64279	4.775000	0.62346	1.026000	0.39733	0.482000	0.46254	GAG	C10orf112	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,pfscan_MAM_dom	ENSG00000204740		0.388	C10orf112-201	KNOWN	basic|appris_principal	protein_coding	C10orf112	HGNC	protein_coding		-	0.00	66	0	A			19493862	+1	tier1	-	no_errors	ENST00000454679	ensembl	human	known	74_37	missense	12.50	35	5	SNP	1.000	C
C12orf76	400073	genome.wustl.edu	37	12	110511298	110511301	+	5'UTR	DEL	TTTG	TTTG	-	rs375333527		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	TTTG	TTTG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:110511298_110511301delTTTG	ENST00000548191.1	-	0	190_193				C12orf76_ENST00000548936.1_5'UTR			Q8N812	CL076_HUMAN	chromosome 12 open reading frame 76											endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6						TCCGGGCGACTTTGTTTGTCTCAT	0.534																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC041968	CCDS9141.1	12q24.11	2012-08-16			ENSG00000174456	ENSG00000174456			33790	protein-coding gene	gene with protein product							Standard	NM_207435		Approved	FLJ40142	uc001tqe.2	Q8N812	OTTHUMG00000169315	ENST00000548191.1:c.-68CAAA>-	12.37:g.110511302_110511305delTTTG				RNA	DEL	-	NULL	ENST00000548191.1	37	NULL		12																																																																																			C12orf76	-	-	ENSG00000174456		0.534	C12orf76-007	PUTATIVE	basic|exp_conf	protein_coding	C12orf76	HGNC	protein_coding	OTTHUMT00000403445.1		0.00	94	0	TTTG	NM_207435		110511301	-1	tier1		no_errors	ENST00000548936	ensembl	human	known	74_37	rna	26.19	31	11	DEL	0.969:0.995:0.998:0.997	-
C14orf177	283598	genome.wustl.edu	37	14	99183561	99183561	+	Silent	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:99183561A>C	ENST00000325812.2	+	4	747	c.328A>C	c.(328-330)Aga>Cga	p.R110R		NM_182560.2	NP_872366.2	Q52M58	CN177_HUMAN	chromosome 14 open reading frame 177	110										endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	13		Melanoma(154;0.128)				TGCTACACCAAGATTTAAGCA	0.398																																																	0													114.0	92.0	99.0					14																	99183561		2203	4300	6503	SO:0001819	synonymous_variant	0			AK098639	CCDS9948.1	14q32.2	2012-05-30			ENSG00000176605	ENSG00000176605			26375	protein-coding gene	gene with protein product						12477932	Standard	NM_182560		Approved	FLJ25773	uc001yfz.2	Q52M58	OTTHUMG00000167745	ENST00000325812.2:c.328A>C	14.37:g.99183561A>C			Q8N7D2	Silent	SNP	NULL	p.R110	ENST00000325812.2	37	c.328	CCDS9948.1	14																																																																																			C14orf177	-	NULL	ENSG00000176605		0.398	C14orf177-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf177	HGNC	protein_coding	OTTHUMT00000396078.1	-	0.00	52	0	A	NM_182560		99183561	+1	tier1	-	no_errors	ENST00000325812	ensembl	human	known	74_37	silent	30.56	25	11	SNP	0.000	C
ERICH3	127254	genome.wustl.edu	37	1	75102058	75102058	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:75102058G>A	ENST00000326665.5	-	6	727	c.509C>T	c.(508-510)cCc>cTc	p.P170L	C1orf173_ENST00000420661.2_5'Flank	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		170										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						AGGATTACTGGGAAGAGGCTG	0.418																																																	0													219.0	229.0	225.0					1																	75102058		2203	4300	6503	SO:0001583	missense	0																														ENST00000326665.5:c.509C>T	1.37:g.75102058G>A	ENSP00000322609:p.Pro170Leu		Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.P170L	ENST00000326665.5	37	c.509	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	7.753	0.703809	0.15172	.	.	ENSG00000178965	ENST00000326665	T	0.11712	2.75	5.65	0.899	0.19271	.	.	.	.	.	T	0.01421	0.0046	N	0.16478	0.41	0.32619	N	0.52358	B	0.20887	0.049	B	0.20184	0.028	T	0.46512	-0.9186	9	0.10902	T	0.67	0.0859	3.2997	0.06979	0.3243:0.0:0.298:0.3777	.	170	Q5RHP9	CA173_HUMAN	L	170	ENSP00000322609:P170L	ENSP00000322609:P170L	P	-	2	0	C1orf173	74874646	0.981000	0.34729	0.990000	0.47175	0.222000	0.24845	0.948000	0.29096	0.730000	0.32425	-0.259000	0.10710	CCC	C1orf173	-	NULL	ENSG00000178965		0.418	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	-	0.00	107	0	G			75102058	-1	tier1	-	no_errors	ENST00000326665	ensembl	human	known	74_37	missense	17.78	37	8	SNP	0.568	A
C2orf69	205327	genome.wustl.edu	37	2	200790063	200790063	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:200790063G>C	ENST00000319974.5	+	2	795	c.612G>C	c.(610-612)aaG>aaC	p.K204N	C2orf69_ENST00000491721.1_Intron	NM_153689.5	NP_710156.3	Q8N8R5	CB069_HUMAN	chromosome 2 open reading frame 69	204						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(2)|stomach(1)|urinary_tract(1)	11						GTTTATCAAAGAAAAGTTTGA	0.363																																																	0													52.0	51.0	51.0					2																	200790063		1812	4071	5883	SO:0001583	missense	0				CCDS46482.1	2q33.1	2008-08-08			ENSG00000178074	ENSG00000178074			26799	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38973"""					12477932	Standard	NM_153689		Approved	FLJ38973	uc010zhb.2	Q8N8R5	OTTHUMG00000154480	ENST00000319974.5:c.612G>C	2.37:g.200790063G>C	ENSP00000312770:p.Lys204Asn		Q8NE30	Missense_Mutation	SNP	pfam_UPF0565	p.K204N	ENST00000319974.5	37	c.612	CCDS46482.1	2	.	.	.	.	.	.	.	.	.	.	G	9.319	1.057536	0.19907	.	.	ENSG00000178074	ENST00000319974	.	.	.	5.3	0.363	0.16118	.	0.341074	0.27991	N	0.017035	T	0.26593	0.0650	L	0.34521	1.04	0.26649	N	0.972138	B	0.24043	0.096	B	0.31390	0.129	T	0.23868	-1.0176	9	0.15499	T	0.54	.	5.8137	0.18479	0.297:0.1346:0.5684:0.0	.	204	Q8N8R5	CB069_HUMAN	N	204	.	ENSP00000312770:K204N	K	+	3	2	C2orf69	200498308	1.000000	0.71417	0.081000	0.20488	0.544000	0.35116	0.866000	0.27954	-0.114000	0.11936	0.655000	0.94253	AAG	C2orf69	-	pfam_UPF0565	ENSG00000178074		0.363	C2orf69-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf69	HGNC	protein_coding	OTTHUMT00000335446.1	-	0.00	73	0	G	NM_153689		200790063	+1	tier1	-	no_errors	ENST00000319974	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.923	C
C4B	721	genome.wustl.edu	37	6	31997689	31997689	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:31997689C>A	ENST00000435363.2	+	30	4025	c.3941C>A	c.(3940-3942)gCc>gAc	p.A1314D	C4B_ENST00000425700.2_Missense_Mutation_p.A1314D|C4B-AS1_ENST00000415626.1_RNA	NM_001002029.3	NP_001002029.3	P0C0L5	CO4B_HUMAN	complement component 4B (Chido blood group)	1314					complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|detection of molecule of bacterial origin (GO:0032490)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of apoptotic cell clearance (GO:2000427)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|other organism cell (GO:0044216)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|complement binding (GO:0001848)|endopeptidase inhibitor activity (GO:0004866)									Intravenous Immunoglobulin(DB00028)	GCCCTGTCTGCCTACTGGATT	0.617																																																	0													4.0	4.0	4.0					6																	31997689		1322	2418	3740	SO:0001583	missense	0			AF019413	CCDS47405.1	6p21.3	2014-09-17	2009-01-06		ENSG00000224389	ENSG00000224389		"""Blood group antigens"", ""Complement system"""	1324	protein-coding gene	gene with protein product		120820	"""complement component 4B"""				Standard	NM_001002029		Approved	CPAMD3, C4F, CO4, C4B1, C4B3, CH	uc011jpm.2	P0C0L5	OTTHUMG00000031187	ENST00000435363.2:c.3941C>A	6.37:g.31997689C>A	ENSP00000415941:p.Ala1314Asp		A2BHY4|P01028|P78445|Q13160|Q13906|Q14033|Q14835|Q6U2E9|Q6U2G1|Q6U2I5|Q6U2L1|Q6U2L7|Q6U2L9|Q6U2M5|Q6VCV8|Q96SA7|Q9NPK5|Q9UIP5	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A-macroglobulin_rcpt-bd,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_Netrin_module_non-TIMP,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_Anaphylatoxin/fibulin,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,superfamily_TIMP-like_OB-fold,superfamily_Anaphylatoxin_comp_syst,superfamily_Invasin/intimin_cell_adhesion,smart_Anaphylatoxin/fibulin,smart_Netrin_module_non-TIMP,pfscan_Anaphylatoxin/fibulin,pfscan_Netrin_domain,prints_Anaphylatoxn_comp_syst_dom	p.A1314D	ENST00000435363.2	37	c.3941	CCDS47405.1	6	.	.	.	.	.	.	.	.	.	.	C	8.705	0.910732	0.17833	.	.	ENSG00000224389	ENST00000435363;ENST00000425700	T;T	0.33654	1.4;1.4	4.63	-0.263	0.12954	.	0.407215	0.24881	N	0.034855	T	0.24624	0.0597	M	0.79343	2.45	0.09310	N	0.999996	B;B	0.31859	0.156;0.343	B;B	0.43155	0.167;0.41	T	0.33111	-0.9881	10	0.44086	T	0.13	.	6.2781	0.20991	0.6104:0.2854:0.0:0.1041	.	1314;1314	F5GXS0;Q6U2E9	.;.	D	1314	ENSP00000415941:A1314D;ENSP00000391933:A1314D	ENSP00000391933:A1314D	A	+	2	0	C4B	32105668	0.000000	0.05858	0.389000	0.26208	0.643000	0.38383	-0.813000	0.04491	0.026000	0.15269	0.449000	0.29647	GCC	C4B	-	pfam_A2M_comp,superfamily_Terpenoid_cyclase/PrenylTrfase	ENSG00000224389		0.617	C4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4B	HGNC	protein_coding	OTTHUMT00000076368.5	-	0.00	26	0	C	NM_001002029		31997689	+1	tier1	-	no_errors	ENST00000435363	ensembl	human	known	74_37	missense	40.00	12	8	SNP	0.093	A
C6orf118	168090	genome.wustl.edu	37	6	165695343	165695343	+	Intron	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:165695343A>C	ENST00000230301.8	-	8	1323				C6orf118_ENST00000494696.2_Intron|C6orf118_ENST00000543069.1_Intron	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118											breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		AAAATGAAGGACAATTAATGA	0.308																																																	0																																										SO:0001627	intron_variant	0				CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.1303-161T>G	6.37:g.165695343A>C			Q8TC11	RNA	SNP	-	NULL	ENST00000230301.8	37	NULL	CCDS5288.1	6																																																																																			C6orf118	-	-	ENSG00000112539		0.308	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C6orf118	HGNC	protein_coding	OTTHUMT00000043026.1	-	0.00	29	0	A	NM_144980		165695343	-1	tier1	-	no_errors	ENST00000491176	ensembl	human	known	74_37	rna	41.67	7	5	SNP	0.000	C
CACNA1G	8913	genome.wustl.edu	37	17	48695481	48695481	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:48695481G>A	ENST00000359106.5	+	31	5299	c.5299G>A	c.(5299-5301)Gac>Aac	p.D1767N	CACNA1G_ENST00000514079.1_Missense_Mutation_p.D1774N|CACNA1G_ENST00000507336.1_Missense_Mutation_p.D1756N|CACNA1G_ENST00000507510.2_Missense_Mutation_p.D1767N|CACNA1G_ENST00000510115.1_Missense_Mutation_p.D1733N|CACNA1G_ENST00000442258.2_Missense_Mutation_p.D1726N|CACNA1G_ENST00000515411.1_Missense_Mutation_p.D1749N|CACNA1G_ENST00000510366.1_Missense_Mutation_p.D1715N|CACNA1G_ENST00000513689.2_Missense_Mutation_p.D1722N|CACNA1G_ENST00000514181.1_Missense_Mutation_p.D1742N|CACNA1G_ENST00000503485.1_Missense_Mutation_p.D1733N|CACNA1G_ENST00000429973.2_Missense_Mutation_p.D1749N|CACNA1G_ENST00000512389.1_Missense_Mutation_p.D1756N|CACNA1G_ENST00000354983.4_Missense_Mutation_p.D1733N|CACNA1G_ENST00000505165.1_Missense_Mutation_p.D1767N|CACNA1G_ENST00000507896.1_Missense_Mutation_p.D1756N|CACNA1G_ENST00000360761.4_Missense_Mutation_p.D1744N|CACNA1G_ENST00000515765.1_Missense_Mutation_p.D1756N|CACNA1G_ENST00000513964.1_Missense_Mutation_p.D1722N|CACNA1G_ENST00000515165.1_Missense_Mutation_p.D1767N|CACNA1G_ENST00000507609.1_Missense_Mutation_p.D1760N|CACNA1G_ENST00000514717.1_Missense_Mutation_p.D1710N|CACNA1G_ENST00000352832.5_Missense_Mutation_p.D1733N|CACNA1G_ENST00000358244.5_Missense_Mutation_p.D1733N|CACNA1G_ENST00000502264.1_Missense_Mutation_p.D1744N	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	1767					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	GCTCTTTGGAGACCTGGGTGA	0.567																																																	0													56.0	57.0	57.0					17																	48695481		1887	4118	6005	SO:0001583	missense	0			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.5299G>A	17.37:g.48695481G>A	ENSP00000352011:p.Asp1767Asn		D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.D1767N	ENST00000359106.5	37	c.5299	CCDS45730.1	17	.	.	.	.	.	.	.	.	.	.	g	23.8	4.458038	0.84317	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.98400	-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91;-4.91	5.22	5.22	0.72569	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96568	0.8880	N	0.04724	-0.175	0.80722	D	1	B;D;D;D;D;D;D;D;D;D;D;P;P;D;D;P;D;P;D;D;D;P;D;D;D	0.89917	0.256;0.973;0.999;0.999;1.0;0.994;0.999;1.0;0.999;0.974;1.0;0.503;0.941;1.0;0.996;0.745;0.977;0.917;1.0;0.988;0.999;0.745;1.0;0.971;0.99	B;P;D;D;D;D;D;D;D;P;D;B;P;D;D;B;P;P;D;D;D;B;D;P;P	0.97110	0.437;0.908;0.999;0.998;1.0;0.935;0.998;1.0;0.998;0.842;1.0;0.257;0.867;1.0;0.939;0.374;0.852;0.583;1.0;0.911;0.995;0.374;1.0;0.9;0.903	D	0.93108	0.6514	10	0.02654	T	1	.	18.7781	0.91920	0.0:0.0:1.0:0.0	.	1710;1722;1715;1749;1722;1742;1774;1733;1760;1756;1767;1744;1756;1756;1749;1756;1767;1744;1767;1733;1726;1733;1744;1767;1733	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.	N	1744;1733;1733;1726;1744;1756;1722;1710;1715;1733;1767;1756;1722;1760;1733;1767;1742;1756;1774;1733;1767;1749;1749;1767;1756	ENSP00000353990:D1744N;ENSP00000339302:D1733N;ENSP00000347078:D1733N;ENSP00000409759:D1726N;ENSP00000425522:D1744N;ENSP00000426261:D1756N;ENSP00000425451:D1722N;ENSP00000422407:D1710N;ENSP00000426814:D1715N;ENSP00000427238:D1733N;ENSP00000423112:D1767N;ENSP00000420918:D1756N;ENSP00000426172:D1722N;ENSP00000423045:D1760N;ENSP00000427173:D1733N;ENSP00000426098:D1767N;ENSP00000425698:D1742N;ENSP00000426232:D1756N;ENSP00000423317:D1774N;ENSP00000350979:D1733N;ENSP00000352011:D1767N;ENSP00000414388:D1749N;ENSP00000423155:D1749N;ENSP00000422268:D1767N;ENSP00000421518:D1756N	ENSP00000339302:D1733N	D	+	1	0	CACNA1G	46050480	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.106000	0.57804	2.434000	0.82447	0.561000	0.74099	GAC	CACNA1G	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000006283		0.567	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	HGNC	protein_coding	OTTHUMT00000367895.1	-	0.00	70	0	G	NM_018896		48695481	+1	tier1	-	no_errors	ENST00000359106	ensembl	human	known	74_37	missense	50.52	48	49	SNP	1.000	A
CACNA2D1	781	genome.wustl.edu	37	7	81593645	81593645	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:81593645T>A	ENST00000356253.5	-	33	2896	c.2641A>T	c.(2641-2643)Agc>Tgc	p.S881C	CACNA2D1_ENST00000356860.3_Missense_Mutation_p.S869C|CACNA2D1_ENST00000535308.1_Missense_Mutation_p.S81C			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	881					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CTCATCAAGCTGGGATCAATC	0.383																																																	0													59.0	59.0	59.0					7																	81593645		2203	4300	6503	SO:0001583	missense	0			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.2641A>T	7.37:g.81593645T>A	ENSP00000348589:p.Ser881Cys		Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	pfam_VDCC_a2/dsu,pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.S881C	ENST00000356253.5	37	c.2641		7	.	.	.	.	.	.	.	.	.	.	T	14.28	2.487230	0.44249	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000535308	T;T;T	0.72615	-0.67;-0.67;-0.67	5.4	5.4	0.78164	.	0.103999	0.64402	D	0.000002	T	0.65719	0.2718	M	0.62723	1.935	0.37217	D	0.905087	B;B	0.12013	0.002;0.005	B;B	0.15052	0.006;0.012	T	0.68116	-0.5494	10	0.59425	D	0.04	-19.2924	8.4317	0.32761	0.0:0.1175:0.0:0.8825	.	81;869	B7Z658;P54289-2	.;.	C	869;888;881;81	ENSP00000349320:S869C;ENSP00000348589:S881C;ENSP00000443124:S81C	ENSP00000284088:S888C	S	-	1	0	CACNA2D1	81431581	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	4.171000	0.58236	2.167000	0.68274	0.528000	0.53228	AGC	CACNA2D1	-	NULL	ENSG00000153956		0.383	CACNA2D1-201	KNOWN	basic	protein_coding	CACNA2D1	HGNC	protein_coding		-	0.00	43	0	T			81593645	-1	tier1	-	no_errors	ENST00000356253	ensembl	human	known	74_37	missense	31.58	13	6	SNP	0.980	A
CACNB1	782	genome.wustl.edu	37	17	37331544	37331544	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:37331544G>A	ENST00000394303.3	-	14	1906	c.1699C>T	c.(1699-1701)Cgg>Tgg	p.R567W	RP5-906A24.2_ENST00000579256.1_RNA	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	567					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GCCTTATTCCGGCCCCGGTTC	0.642											OREG0024371	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(5;100 366 38393 41452 45827)												0													131.0	146.0	142.0					17																	37331544		1895	4096	5991	SO:0001583	missense	0				CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.1699C>T	17.37:g.37331544G>A	ENSP00000377840:p.Arg567Trp	869	A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Missense_Mutation	SNP	pfam_GK/Ca_channel_bsu,pfam_VDCC_L_bsu,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b1su	p.R567W	ENST00000394303.3	37	c.1699	CCDS42311.1	17	.	.	.	.	.	.	.	.	.	.	G	20.7	4.027409	0.75390	.	.	ENSG00000067191	ENST00000539338;ENST00000394303	T	0.79554	-1.28	5.14	5.14	0.70334	.	0.067266	0.64402	D	0.000013	T	0.74076	0.3669	L	0.40543	1.245	0.80722	D	1	P	0.51537	0.946	B	0.43478	0.421	T	0.73600	-0.3931	10	0.34782	T	0.22	-17.9546	13.1174	0.59307	0.0:0.0:0.8391:0.1608	.	567	Q02641	CACB1_HUMAN	W	517;567	ENSP00000377840:R567W	ENSP00000377840:R567W	R	-	1	2	CACNB1	34585070	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.150000	0.58098	2.686000	0.91538	0.561000	0.74099	CGG	CACNB1	-	NULL	ENSG00000067191		0.642	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACNB1	HGNC	protein_coding	OTTHUMT00000256945.3		0.00	44	0	G			37331544	-1			no_errors	ENST00000394303	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	A
CAMSAP3	57662	genome.wustl.edu	37	19	7682863	7682863	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:7682863G>A	ENST00000160298.4	+	17	3771	c.3670G>A	c.(3670-3672)Gat>Aat	p.D1224N	CAMSAP3_ENST00000446248.2_Missense_Mutation_p.D1251N	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	1224	CKK. {ECO:0000255|PROSITE- ProRule:PRU00841}.				epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)	p.D1224N(1)		cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						CATGAGCGTCGATGCCTTCAC	0.642																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											52.0	59.0	57.0					19																	7682863		2029	4174	6203	SO:0001583	missense	0			AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.3670G>A	19.37:g.7682863G>A	ENSP00000160298:p.Asp1224Asn		Q8NDF1	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrel-like,superfamily_CH-domain	p.D1251N	ENST00000160298.4	37	c.3751	CCDS42489.1	19	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904195	0.92035	.	.	ENSG00000076826	ENST00000446248;ENST00000160298	T;T	0.32515	1.47;1.45	5.06	4.02	0.46733	PRC-barrel-like (1);Microtubule-binding calmodulin-regulated spectrin-associated, C-terminal (2);	0.115866	0.56097	D	0.000039	T	0.56217	0.1970	M	0.81682	2.555	0.80722	D	1	D;D;D	0.89917	0.992;1.0;1.0	D;D;D	0.97110	0.93;1.0;0.999	T	0.62746	-0.6789	10	0.87932	D	0	-25.9859	12.7124	0.57098	0.0812:0.0:0.9188:0.0	.	1235;1224;1251	D6W648;Q9P1Y5;Q9P1Y5-2	.;CAMP3_HUMAN;.	N	1251;1224	ENSP00000416797:D1251N;ENSP00000160298:D1224N	ENSP00000160298:D1224N	D	+	1	0	KIAA1543	7588863	1.000000	0.71417	0.986000	0.45419	0.997000	0.91878	9.492000	0.97957	1.360000	0.45960	0.462000	0.41574	GAT	CAMSAP3	-	pfam_CKK_domain,superfamily_PRC_barrel-like	ENSG00000076826		0.642	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CAMSAP3	HGNC	protein_coding	OTTHUMT00000459300.1		0.00	90	0	G	XM_048362		7682863	+1			no_errors	ENST00000446248	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
CAMTA1	23261	genome.wustl.edu	37	1	7724522	7724522	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:7724522G>A	ENST00000303635.7	+	9	2122	c.1915G>A	c.(1915-1917)Ggg>Agg	p.G639R	CAMTA1_ENST00000439411.2_Missense_Mutation_p.G639R	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	639					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GAGTGACTCTGGGGGCACCTT	0.647			T	WWTR1	epitheliod hemangioendothelioma																																			Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0													109.0	123.0	118.0					1																	7724522		2203	4300	6503	SO:0001583	missense	0			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.1915G>A	1.37:g.7724522G>A	ENSP00000306522:p.Gly639Arg		A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	pfam_CG-1_dom,pfam_IPT,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,superfamily_P-loop_NTPase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.G639R	ENST00000303635.7	37	c.1915	CCDS30576.1	1	.	.	.	.	.	.	.	.	.	.	g	11.70	1.718080	0.30503	.	.	ENSG00000171735	ENST00000303635;ENST00000439411	T;T	0.22134	1.97;1.97	5.12	5.12	0.69794	.	0.710435	0.13736	N	0.366306	T	0.16128	0.0388	L	0.29908	0.895	0.35783	D	0.821813	B	0.06786	0.001	B	0.06405	0.002	T	0.09058	-1.0692	10	0.51188	T	0.08	-21.0746	8.8703	0.35311	0.2111:0.0:0.7889:0.0	.	639	Q9Y6Y1	CMTA1_HUMAN	R	639	ENSP00000306522:G639R;ENSP00000402561:G639R	ENSP00000306522:G639R	G	+	1	0	CAMTA1	7647109	0.997000	0.39634	0.987000	0.45799	0.993000	0.82548	2.605000	0.46283	2.408000	0.81797	0.498000	0.49722	GGG	CAMTA1	-	NULL	ENSG00000171735		0.647	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	HGNC	protein_coding	OTTHUMT00000003588.3	-	0.00	93	0	G	NM_015215		7724522	+1	tier1	-	no_errors	ENST00000303635	ensembl	human	known	74_37	missense	10.42	43	5	SNP	0.965	A
CAPN9	10753	genome.wustl.edu	37	1	230883352	230883352	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:230883352T>G	ENST00000271971.2	+	1	223	c.110T>G	c.(109-111)cTg>cGg	p.L37R	CAPN9_ENST00000366666.2_Missense_Mutation_p.L37R|RP11-99J16__A.2_ENST00000412344.1_RNA|CAPN9_ENST00000354537.1_Missense_Mutation_p.L37R	NM_006615.2	NP_006606.1	O14815	CAN9_HUMAN	calpain 9	37					digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	25	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)				CAGGAGTGCCTGCAGAGAGGC	0.607																																																	0													63.0	65.0	64.0					1																	230883352		2203	4300	6503	SO:0001583	missense	0			AF022799	CCDS1586.1, CCDS31053.1	1q42.11-q42.3	2013-01-10	2004-11-11		ENSG00000135773	ENSG00000135773		"""EF-hand domain containing"""	1486	protein-coding gene	gene with protein product	"""novel calpain large subunit-4"""	606401	"""calpain 9 (nCL-4)"""			9524069, 10835488	Standard	XM_005273010		Approved	nCL-4, GC36	uc001htz.1	O14815	OTTHUMG00000037779	ENST00000271971.2:c.110T>G	1.37:g.230883352T>G	ENSP00000271971:p.Leu37Arg		B1APS1|B1AQI0|Q9NS74	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_dom,prints_Calpain_cysteine_protease,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat	p.L37R	ENST00000271971.2	37	c.110	CCDS1586.1	1	.	.	.	.	.	.	.	.	.	.	T	16.84	3.233672	0.58886	.	.	ENSG00000135773	ENST00000271971;ENST00000354537;ENST00000366666	T;T;T	0.50001	0.76;0.76;0.76	5.29	5.29	0.74685	Peptidase C2, calpain, catalytic domain (1);	0.067900	0.64402	D	0.000011	T	0.47911	0.1471	N	0.19112	0.55	0.32643	N	0.52041	P;P;P	0.51240	0.943;0.889;0.832	P;P;B	0.54238	0.641;0.746;0.402	T	0.61964	-0.6954	10	0.66056	D	0.02	.	15.2297	0.73378	0.0:0.0:0.0:1.0	.	37;37;37	E7ESS6;O14815-2;O14815	.;.;CAN9_HUMAN	R	37	ENSP00000271971:L37R;ENSP00000346538:L37R;ENSP00000355626:L37R	ENSP00000271971:L37R	L	+	2	0	CAPN9	228949975	1.000000	0.71417	0.016000	0.15963	0.738000	0.42128	3.764000	0.55264	1.995000	0.58328	0.533000	0.62120	CTG	CAPN9	-	smart_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	ENSG00000135773		0.607	CAPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN9	HGNC	protein_coding	OTTHUMT00000092179.1	-	0.00	152	0	T	NM_006615		230883352	+1	tier1	-	no_errors	ENST00000271971	ensembl	human	known	74_37	missense	33.33	41	21	SNP	1.000	G
CASS4	57091	genome.wustl.edu	37	20	55012496	55012496	+	Missense_Mutation	SNP	C	C	T	rs199573867	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr20:55012496C>T	ENST00000360314.3	+	3	538	c.313C>T	c.(313-315)Cgc>Tgc	p.R105C	CASS4_ENST00000371336.3_Missense_Mutation_p.R105C|CASS4_ENST00000434344.1_Missense_Mutation_p.R105C	NM_001164116.1	NP_001157588.1	Q9NQ75	CASS4_HUMAN	Cas scaffolding protein family member 4	105					cell adhesion (GO:0007155)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)	p.R105C(1)		breast(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(4)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	54						CACTCTACCCCGCCCTCCCAC	0.647													C|||	2	0.000399361	0.0	0.0	5008	,	,		16036	0.001		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	endometrium(1)											37.0	43.0	41.0					20																	55012496		2203	4300	6503	SO:0001583	missense	0			AJ276678	CCDS33492.1, CCDS54475.1	20q13.31	2011-04-13	2008-04-14	2008-04-15	ENSG00000087589	ENSG00000087589		"""Cas scaffolding proteins"""	15878	protein-coding gene	gene with protein product	"""HEF-like protein"", ""HEF1-Efs-p130Cas-like"""		"""chromosome 20 open reading frame 32"""	C20orf32			Standard	NM_020356		Approved	HEFL, HEPL	uc002xxr.2	Q9NQ75	OTTHUMG00000032788	ENST00000360314.3:c.313C>T	20.37:g.55012496C>T	ENSP00000353462:p.Arg105Cys		E1P5Z8|Q5QPD6|Q96K09|Q9BYL5	Missense_Mutation	SNP	pfam_Serine_rich,pfam_CAS_DUF3513,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.R105C	ENST00000360314.3	37	c.313	CCDS33492.1	20	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	10.89	1.477417	0.26511	.	.	ENSG00000087589	ENST00000360314;ENST00000371336;ENST00000434344	T;T;T	0.21191	2.53;2.53;2.02	5.57	-0.473	0.12112	.	2.871980	0.01246	N	0.008757	T	0.13756	0.0333	N	0.19112	0.55	0.09310	N	1	P;B;B	0.45078	0.85;0.001;0.001	B;B;B	0.40782	0.34;0.0;0.0	T	0.05022	-1.0911	10	0.51188	T	0.08	4.5031	1.7647	0.02999	0.3212:0.3004:0.0742:0.3041	.	105;105;105	Q9NQ75-3;Q9NQ75-2;Q9NQ75	.;.;CASS4_HUMAN	C	105	ENSP00000353462:R105C;ENSP00000360387:R105C;ENSP00000410027:R105C	ENSP00000353462:R105C	R	+	1	0	CASS4	54445903	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.686000	0.25392	-0.685000	0.05177	-0.797000	0.03246	CGC	CASS4	-	NULL	ENSG00000087589		0.647	CASS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASS4	HGNC	protein_coding	OTTHUMT00000079789.2		0.00	45	0	C	NM_020356		55012496	+1			no_errors	ENST00000360314	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.000	T
CCDC149	91050	genome.wustl.edu	37	4	24839867	24839867	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:24839867delT	ENST00000389609.4	-	6	543	c.400delA	c.(400-402)aggfs	p.R134fs	CCDC149_ENST00000502801.1_Intron|CCDC149_ENST00000504487.1_Frame_Shift_Del_p.R134fs|CCDC149_ENST00000428116.2_Intron	NM_173463.4	NP_775734.2	Q6ZUS6	CC149_HUMAN	coiled-coil domain containing 149	79										cervix(1)|endometrium(1)|large_intestine(2)|lung(3)	7		Breast(46;0.173)				TCTCCGAGCCTTTGTTTGGCA	0.463																																																	0													118.0	103.0	108.0					4																	24839867		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS33967.1, CCDS47036.1, CCDS33967.2	4p15.2	2008-03-03				ENSG00000181982			25405	protein-coding gene	gene with protein product						17457313	Standard	NM_173463		Approved	DKFZp761B107	uc003grc.3	Q6ZUS6		ENST00000389609.4:c.400delA	4.37:g.24839867delT	ENSP00000374260:p.Arg134fs		A6NJE7|B4DK90|B4DZG3|G5EA04|Q6NW41|Q8N3K8	Frame_Shift_Del	DEL	pfam_Coiled-coil_dom-contain_pr_149	p.R134fs	ENST00000389609.4	37	c.400	CCDS33967.2	4																																																																																			CCDC149	-	pfam_Coiled-coil_dom-contain_pr_149	ENSG00000181982		0.463	CCDC149-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	CCDC149	HGNC	protein_coding	OTTHUMT00000360157.1		0.00	55	0	T	NM_173463		24839867	-1	tier1		no_errors	ENST00000504487	ensembl	human	known	74_37	frame_shift_del	16.67	10	2	DEL	0.999	-
CCDC109B	55013	genome.wustl.edu	37	4	110606475	110606475	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:110606475G>A	ENST00000394650.4	+	7	1018	c.885G>A	c.(883-885)caG>caA	p.Q295Q		NM_017918.4	NP_060388.2	Q9NWR8	MCUB_HUMAN	coiled-coil domain containing 109B	295					mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)	calcium channel complex (GO:0034704)|integral component of mitochondrial inner membrane (GO:0031305)|intrinsic component of membrane (GO:0031224)|mitochondrion (GO:0005739)|uniplex complex (GO:1990246)	calcium channel inhibitor activity (GO:0019855)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(1)	9				OV - Ovarian serous cystadenocarcinoma(123;6.65e-06)		CAAAGCAACAGCACTTTGATG	0.353																																																	0													96.0	99.0	98.0					4																	110606475		2203	4300	6503	SO:0001819	synonymous_variant	0			BC002633	CCDS3683.2	4q25	2011-05-24			ENSG00000005059	ENSG00000005059			26076	protein-coding gene	gene with protein product						12477932	Standard	NM_017918		Approved	FLJ20647	uc011cfs.2	Q9NWR8	OTTHUMG00000161103	ENST00000394650.4:c.885G>A	4.37:g.110606475G>A			A8K4Y3|Q6IAC1	Silent	SNP	pfam_Coiled-coil-dom_prot_109_C	p.Q295	ENST00000394650.4	37	c.885	CCDS3683.2	4																																																																																			CCDC109B	-	pfam_Coiled-coil-dom_prot_109_C	ENSG00000005059		0.353	CCDC109B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC109B	HGNC	protein_coding	OTTHUMT00000254865.1	-	0.00	46	0	G	NM_017918		110606475	+1	tier1	-	no_errors	ENST00000394650	ensembl	human	known	74_37	silent	14.29	18	3	SNP	0.000	A
CCDC169	728591	genome.wustl.edu	37	13	36801276	36801276	+	3'UTR	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr13:36801276T>C	ENST00000503173.1	-	0	817				SOHLH2_ENST00000554962.1_Intron|CCDC169_ENST00000239860.6_3'UTR|CCDC169-SOHLH2_ENST00000511166.1_Intron|CCDC169_ENST00000491049.2_3'UTR|CCDC169_ENST00000379864.2_3'UTR	NM_001198908.1	NP_001185837.1	A6NNP5	CC169_HUMAN	coiled-coil domain containing 169											breast(1)|endometrium(1)	2						TGGGGGAGGCTTAAAGAAATA	0.448																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS45027.1, CCDS45028.1, CCDS45029.1, CCDS53863.1, CCDS55897.1	13q13.3	2011-08-09	2011-08-09	2011-08-09	ENSG00000242715	ENSG00000242715			34361	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 38"""	C13orf38			Standard	NM_001144981		Approved	RP11-251J8.1, LOC728591		A6NNP5	OTTHUMG00000016731	ENST00000503173.1:c.*62A>G	13.37:g.36801276T>C			A6NC13|A6NCT2|B7ZW45|B7ZW49|B9EJF2|Q9H1T4|Q9H1T5	RNA	SNP	-	NULL	ENST00000503173.1	37	NULL	CCDS55897.1	13																																																																																			CCDC169	-	-	ENSG00000242715		0.448	CCDC169-012	NOVEL	basic|CCDS	protein_coding	CCDC169	HGNC	protein_coding	OTTHUMT00000368253.1	-	0.00	40	0	T	NM_001144981		36801276	-1	tier1	-	no_errors	ENST00000479850	ensembl	human	known	74_37	rna	35.29	11	6	SNP	0.210	C
CCDC180	100499483	genome.wustl.edu	37	9	100077198	100077198	+	Silent	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:100077198A>G	ENST00000357054.1	+	22	2249	c.1314A>G	c.(1312-1314)gaA>gaG	p.E438E	CCDC180_ENST00000529487.1_Silent_p.E299E|CCDC180_ENST00000375202.2_Silent_p.E299E|CCDC180_ENST00000460482.2_3'UTR|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000395220.1_Silent_p.E438E|CCDC180_ENST00000411667.2_Silent_p.E296E			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	438						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											TGCGGCCCGAAGTGTACAGGC	0.507																																																	0													83.0	79.0	80.0					9																	100077198		2203	4300	6503	SO:0001819	synonymous_variant	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1314A>G	9.37:g.100077198A>G			Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	NULL	p.E299	ENST00000357054.1	37	c.897		9																																																																																			CCDC180	-	NULL	ENSG00000197816		0.507	CCDC180-201	KNOWN	basic	protein_coding	CCDC180	HGNC	protein_coding		-	0.00	23	0	A	NM_020893		100077198	+1	tier1	-	no_errors	ENST00000375202	ensembl	human	known	74_37	silent	37.50	10	6	SNP	0.485	G
CCDC73	493860	genome.wustl.edu	37	11	32635921	32635921	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:32635921C>A	ENST00000335185.5	-	16	1986	c.1943G>T	c.(1942-1944)cGg>cTg	p.R648L	CCDC73_ENST00000534415.1_5'Flank	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	648										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					ACTTGAATTCCGTAAACTATA	0.289																																																	0													55.0	49.0	51.0					11																	32635921		1803	4066	5869	SO:0001583	missense	0			AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.1943G>T	11.37:g.32635921C>A	ENSP00000335325:p.Arg648Leu		Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	NULL	p.R648L	ENST00000335185.5	37	c.1943	CCDS41630.1	11	.	.	.	.	.	.	.	.	.	.	T	0.018	-1.476897	0.01035	.	.	ENSG00000186714	ENST00000335185	.	.	.	4.37	1.81	0.25067	.	0.866255	0.10009	N	0.727448	T	0.14227	0.0344	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22626	-1.0211	9	0.34782	T	0.22	.	2.2496	0.04040	0.1958:0.0892:0.1273:0.5877	.	648	Q6ZRK6	CCD73_HUMAN	L	648	.	ENSP00000335325:R648L	R	-	2	0	CCDC73	32592497	0.547000	0.26465	0.576000	0.28549	0.022000	0.10575	0.773000	0.26661	0.289000	0.22422	-0.332000	0.08345	CGG	CCDC73	-	NULL	ENSG00000186714		0.289	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC73	HGNC	protein_coding	OTTHUMT00000388874.2		0.00	70	0	C	NM_001008391		32635921	-1			no_errors	ENST00000335185	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.025	A
CCDC74B	91409	genome.wustl.edu	37	2	130902262	130902262	+	Intron	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:130902262G>A	ENST00000310463.6	-	1	388				CCDC74B_ENST00000409234.3_Intron|CCDC74B_ENST00000409128.1_Missense_Mutation_p.P103L|CCDC74B_ENST00000409943.3_Intron|CCDC74B_ENST00000392984.3_5'UTR	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B											endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					CTGCGGGAGCGGCAGTGTTGA	0.657																																																	0																																										SO:0001627	intron_variant	0				CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.250+57C>T	2.37:g.130902262G>A			Q6NW18	Missense_Mutation	SNP	NULL	p.P103L	ENST00000310463.6	37	c.308	CCDS2155.1	2	.	.	.	.	.	.	.	.	.	.	.	2.643	-0.283668	0.05642	.	.	ENSG00000152076	ENST00000409128;ENST00000418636;ENST00000441670	T	0.51071	0.72	0.861	-1.72	0.08107	.	.	.	.	.	T	0.43986	0.1272	.	.	.	0.20764	N	0.99985	.	.	.	.	.	.	T	0.42599	-0.9442	6	0.66056	D	0.02	.	7.0669	0.25157	0.0:0.7029:0.2971:0.0	.	.	.	.	L	103	ENSP00000386644:P103L	ENSP00000386644:P103L	P	-	2	0	CCDC74B	130618732	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.357000	0.07651	-2.772000	0.00364	-2.838000	0.00105	CCG	CCDC74B	-	NULL	ENSG00000152076		0.657	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC74B	HGNC	protein_coding	OTTHUMT00000254522.3	-	0.00	72	0	G	NM_207310		130902262	-1	tier1	-	no_errors	ENST00000409128	ensembl	human	putative	74_37	missense	33.33	28	14	SNP	0.001	A
CCDC88C	440193	genome.wustl.edu	37	14	91739932	91739932	+	Silent	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:91739932G>T	ENST00000389857.6	-	30	5210	c.5124C>A	c.(5122-5124)gcC>gcA	p.A1708A	CCDC88C_ENST00000331194.7_Silent_p.A232A	NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1708					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GGCCTCCGATGGCTGGGGGAT	0.612																																																	0													42.0	47.0	45.0					14																	91739932		2043	4178	6221	SO:0001819	synonymous_variant	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.5124C>A	14.37:g.91739932G>T			Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	pfam_Hook-related_fam,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.A1708	ENST00000389857.6	37	c.5124	CCDS45151.1	14																																																																																			CCDC88C	-	NULL	ENSG00000015133		0.612	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	-	0.00	89	0	G	XM_029353		91739932	-1	tier1	-	no_errors	ENST00000389857	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.264	T
CDK6	1021	genome.wustl.edu	37	7	92244497	92244497	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:92244497T>A	ENST00000265734.4	-	8	1349	c.938A>T	c.(937-939)cAc>cTc	p.H313L	CDK6_ENST00000424848.2_Missense_Mutation_p.H313L	NM_001259.6	NP_001250.1	Q00534	CDK6_HUMAN	cyclin-dependent kinase 6	313					astrocyte development (GO:0014002)|cell cycle arrest (GO:0007050)|cell dedifferentiation (GO:0043697)|cell division (GO:0051301)|dentate gyrus development (GO:0021542)|G1/S transition of mitotic cell cycle (GO:0000082)|generation of neurons (GO:0048699)|gliogenesis (GO:0042063)|hematopoietic stem cell differentiation (GO:0060218)|lateral ventricle development (GO:0021670)|mitotic cell cycle (GO:0000278)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell differentiation (GO:0045596)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular senescence (GO:2000773)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of osteoblast differentiation (GO:0045668)|Notch signaling pathway (GO:0007219)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of erythrocyte differentiation (GO:0045646)|regulation of gene expression (GO:0010468)|response to virus (GO:0009615)|T cell differentiation in thymus (GO:0033077)|type B pancreatic cell development (GO:0003323)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|ruffle (GO:0001726)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|urinary_tract(1)	11	all_cancers(62;8.72e-12)|all_epithelial(64;3.65e-10)|Breast(17;0.000675)|all_lung(186;0.0392)|Lung NSC(181;0.053)|all_neural(327;0.219)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;1.2e-06)|all cancers(6;3.1e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			GGGCGGCAGGTGGGAATCCAG	0.542			T	MLLT10	ALL																																			Dom	yes		7	7q21-q22	1021	cyclin-dependent kinase 6		L	0													93.0	84.0	87.0					7																	92244497		2203	4300	6503	SO:0001583	missense	0				CCDS5628.1	7q21-q22	2011-11-08			ENSG00000105810	ENSG00000105810		"""Cyclin-dependent kinases"""	1777	protein-coding gene	gene with protein product		603368				1639063	Standard	NM_001259		Approved	PLSTIRE	uc010lez.3	Q00534	OTTHUMG00000131697	ENST00000265734.4:c.938A>T	7.37:g.92244497T>A	ENSP00000265734:p.His313Leu		A4D1G0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.H313L	ENST00000265734.4	37	c.938	CCDS5628.1	7	.	.	.	.	.	.	.	.	.	.	T	7.060	0.566099	0.13560	.	.	ENSG00000105810	ENST00000265734;ENST00000424848	T;T	0.70986	-0.53;-0.53	6.06	2.43	0.29744	Protein kinase-like domain (1);	0.221097	0.48286	D	0.000194	T	0.49047	0.1534	N	0.11427	0.14	0.32366	N	0.556517	B	0.11235	0.004	B	0.09377	0.004	T	0.52660	-0.8546	10	0.54805	T	0.06	-17.8832	9.848	0.41039	0.0:0.2507:0.0:0.7493	.	313	Q00534	CDK6_HUMAN	L	313	ENSP00000265734:H313L;ENSP00000397087:H313L	ENSP00000265734:H313L	H	-	2	0	CDK6	92082433	0.977000	0.34250	0.999000	0.59377	0.171000	0.22731	1.291000	0.33330	0.535000	0.28714	-0.250000	0.11733	CAC	CDK6	-	superfamily_Kinase-like_dom	ENSG00000105810		0.542	CDK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK6	HGNC	protein_coding	OTTHUMT00000254605.2	-	0.00	48	0	T			92244497	-1	tier1	-	no_errors	ENST00000265734	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.713	A
CDK7	1022	genome.wustl.edu	37	5	68565057	68565057	+	Silent	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:68565057A>G	ENST00000256443.3	+	9	754	c.651A>G	c.(649-651)tcA>tcG	p.S217S	CDK7_ENST00000513629.1_3'UTR|CDK7_ENST00000502604.1_Silent_p.S124S|CDK7_ENST00000514676.1_Silent_p.S180S	NM_001799.3	NP_001790.1	P50613	CDK7_HUMAN	cyclin-dependent kinase 7	217	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				7-methylguanosine mRNA capping (GO:0006370)|androgen receptor signaling pathway (GO:0030521)|ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|cell division (GO:0051301)|cell proliferation (GO:0008283)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasm (GO:0005737)|holo TFIIH complex (GO:0005675)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|DNA-dependent ATPase activity (GO:0008094)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)|transcription coactivator activity (GO:0003713)			endometrium(1)|lung(2)	3		Lung NSC(167;7.26e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.98e-56)|Epithelial(20;3.54e-52)|all cancers(19;9.11e-48)|Lung(70;0.0185)		CAGGAGATTCAGACCTTGATC	0.363								Nucleotide excision repair (NER)																																									0													105.0	102.0	103.0					5																	68565057		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3999.1	5q12.1	2012-11-05	2007-11-21		ENSG00000134058	ENSG00000134058		"""Cyclin-dependent kinases"", ""General transcription factor IIH complex subunits"""	1778	protein-coding gene	gene with protein product		601955	"""cyclin-dependent kinase 7 (homolog of Xenopus MO15 cdk-activating kinase)"", ""cyclin-dependent kinase 7 (MO15 homolog, Xenopus laevis, cdk-activating kinase)"""			8069918	Standard	NM_001799		Approved	CAK1, CDKN7, MO15, STK1, CAK	uc003jvs.4	P50613	OTTHUMG00000099358	ENST00000256443.3:c.651A>G	5.37:g.68565057A>G			Q9BS60|Q9UE19	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.S217	ENST00000256443.3	37	c.651	CCDS3999.1	5																																																																																			CDK7	-	pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000134058		0.363	CDK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK7	HGNC	protein_coding	OTTHUMT00000216802.3	-	0.00	83	0	A	NM_001799		68565057	+1	tier1	-	no_errors	ENST00000256443	ensembl	human	known	74_37	silent	14.81	23	4	SNP	1.000	G
CDKN2A	1029	genome.wustl.edu	37	9	21970901	21970901	+	Splice_Site	SNP	C	C	T	rs45476696		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:21970901C>T	ENST00000304494.5	-	2	727	c.457G>A	c.(457-459)Gac>Aac	p.D153N	CDKN2A_ENST00000497750.1_Missense_Mutation_p.G102S|CDKN2A_ENST00000446177.1_Splice_Site_p.E153K|CDKN2A_ENST00000494262.1_Splice_Site_p.D102N|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000361570.3_3'UTR|CDKN2A_ENST00000498628.2_Splice_Site_p.D102N|CDKN2A_ENST00000578845.2_Splice_Site_p.D102N|CDKN2A_ENST00000498124.1_Splice_Site_p.E153K|CDKN2A_ENST00000530628.2_Intron|CDKN2A_ENST00000579755.1_3'UTR|CDKN2A_ENST00000479692.2_Splice_Site_p.V102I|CDKN2A_ENST00000579122.1_Intron	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	153					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(16)|p.D153N(1)|p.0(1)|p.E153K(1)|p.D153Y(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CAGTCCTCACCTGAGGGACCT	0.597		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																																							1335	Whole gene deletion(1316)|Unknown(16)|Substitution - Missense(3)	haematopoietic_and_lymphoid_tissue(278)|skin(170)|central_nervous_system(163)|lung(145)|urinary_tract(90)|bone(73)|soft_tissue(57)|pleura(51)|oesophagus(48)|upper_aerodigestive_tract(47)|ovary(34)|breast(31)|kidney(30)|pancreas(29)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	GRCh37	CS972842	CDKN2A	S	rs45476696						34.0	35.0	34.0					9																	21970901		2203	4300	6503	SO:0001630	splice_region_variant	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.457+1G>A	9.37:g.21970901C>T			A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.E153K	ENST00000304494.5	37	c.457	CCDS6510.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.26|10.26	1.301003|1.301003	0.23650|0.23650	.|.	.|.	ENSG00000147889|ENSG00000147889	ENST00000304494|ENST00000446177	T|T	0.78126|0.76578	-1.15|-1.03	4.21|4.21	3.31|3.31	0.37934|0.37934	.|.	.|.	.|.	.|.	.|.	T|T	0.75140|0.75140	0.3809|0.3809	L|L	0.39898|0.39898	1.24|1.24	0.80722|0.80722	D|D	1|1	B|.	0.13594|.	0.008|.	B|.	0.12156|.	0.007|.	T|T	0.74266|0.74266	-0.3721|-0.3721	9|7	0.66056|0.48119	D|T	0.02|0.1	.|.	9.7139|9.7139	0.40263|0.40263	0.2066:0.7934:0.0:0.0|0.2066:0.7934:0.0:0.0	rs45476696|rs45476696	153|.	P42771|.	CD2A1_HUMAN|.	N|K	153|153	ENSP00000307101:D153N|ENSP00000394932:E153K	ENSP00000307101:D153N|ENSP00000394932:E153K	D|E	-|-	1|1	0|0	CDKN2A|CDKN2A	21960901|21960901	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.015000|0.015000	0.08874|0.08874	3.892000|3.892000	0.56235|0.56235	1.376000|1.376000	0.46267|0.46267	-0.122000|-0.122000	0.15005|0.15005	GAC|GAA	CDKN2A	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000147889		0.597	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051915.1	-	0.00	74	0	C	NM_000077	Missense_Mutation	21970901	-1	tier1	rs45476696	no_errors	ENST00000446177	ensembl	human	known	74_37	missense	37.50	20	12	SNP	0.995	T
CENPN	55839	genome.wustl.edu	37	16	81058368	81058368	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr16:81058368G>T	ENST00000305850.5	+	8	1472	c.682G>T	c.(682-684)Gga>Tga	p.G228*	RP11-303E16.3_ENST00000561808.1_RNA|CENPN_ENST00000439957.3_Nonsense_Mutation_p.G208*|RP11-303E16.3_ENST00000566390.1_RNA|RP11-303E16.3_ENST00000562315.1_RNA|CENPN_ENST00000428963.2_Nonsense_Mutation_p.G194*|CENPN_ENST00000393335.3_Nonsense_Mutation_p.G228*	NM_001100624.2|NM_001270474.1	NP_001094094.2|NP_001257403.1	Q96H22	CENPN_HUMAN	centromere protein N	228					CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|large_intestine(5)|lung(4)	10						AAGAAGCCTTGGACTAGATAT	0.333																																																	0													81.0	77.0	79.0					16																	81058368		1815	4076	5891	SO:0001587	stop_gained	0			AK026313	CCDS10931.1, CCDS42199.1, CCDS42200.1, CCDS58482.1, CCDS58483.1	16q23.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000166451	ENSG00000166451			30873	protein-coding gene	gene with protein product		611509	"""chromosome 16 open reading frame 60"""	C16orf60		16622419	Standard	NM_001100625		Approved	FLJ13607, FLJ22660, BM039	uc002ffy.4	Q96H22	OTTHUMG00000137628	ENST00000305850.5:c.682G>T	16.37:g.81058368G>T	ENSP00000305608:p.Gly228*		A8MZE6|B3KN53|B4DJD1|B4DPY7|C9JJM5|D3DUK8|E7ES30|E7ETS3|Q9NZ83	Nonsense_Mutation	SNP	pfam_Chl4/mis15/CENP-N	p.G228*	ENST00000305850.5	37	c.682	CCDS42200.1	16	.	.	.	.	.	.	.	.	.	.	G	15.65	2.896037	0.52121	.	.	ENSG00000166451	ENST00000305850;ENST00000439957;ENST00000393335;ENST00000428963	.	.	.	5.46	3.45	0.39498	.	0.855108	0.10532	N	0.663722	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-2.0256	11.2096	0.48790	0.0:0.0:0.629:0.371	.	.	.	.	X	228;208;228;194	.	ENSP00000305608:G228X	G	+	1	0	CENPN	79615869	0.897000	0.30589	0.210000	0.23637	0.078000	0.17371	1.719000	0.38011	0.703000	0.31848	0.655000	0.94253	GGA	CENPN	-	pfam_Chl4/mis15/CENP-N	ENSG00000166451		0.333	CENPN-001	NOVEL	basic|appris_principal|CCDS	protein_coding	CENPN	HGNC	protein_coding	OTTHUMT00000269051.1	-	0.00	88	0	G	NM_018455		81058368	+1	tier1	-	no_errors	ENST00000393335	ensembl	human	putative	74_37	nonsense	10.00	36	4	SNP	0.526	T
CEP85L	387119	genome.wustl.edu	37	6	118953622	118953622	+	Missense_Mutation	SNP	C	C	T	rs373910393		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:118953622C>T	ENST00000368491.3	-	2	847	c.226G>A	c.(226-228)Gtg>Atg	p.V76M	CEP85L_ENST00000368488.5_Missense_Mutation_p.V79M|CEP85L_ENST00000360290.3_De_novo_Start_InFrame|CEP85L_ENST00000392500.3_Missense_Mutation_p.V79M|CEP85L_ENST00000419517.2_Missense_Mutation_p.V76M	NM_001042475.2	NP_001035940.1	Q5SZL2	CE85L_HUMAN	centrosomal protein 85kDa-like	76						centrosome (GO:0005813)|cytoplasm (GO:0005737)											TCACCTTCCACGCTATCAGAA	0.378													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17164	0.0		0.0	False		,,,				2504	0.0																0								C	MET/VAL,MET/VAL,MET/VAL	1,3713		0,1,1856	92.0	84.0	86.0		226,235,226	4.9	1.0	6		86	0,8222		0,0,4111	no	missense,missense,missense	C6orf204	NM_001042475.2,NM_001178035.1,NM_206921.2	21,21,21	0,1,5967	TT,TC,CC		0.0,0.0269,0.0084	benign,benign,benign	76/806,79/809,76/497	118953622	1,11935	1857	4111	5968	SO:0001583	missense	0			AF308284	CCDS5119.2, CCDS43498.1, CCDS55052.1	6q22.31	2011-11-25	2011-11-25	2011-11-25	ENSG00000111860	ENSG00000111860			21638	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 204"""	C6orf204			Standard	NM_206921		Approved	NY-BR-15, bA57K17.2	uc003pya.2	Q5SZL2	OTTHUMG00000015465	ENST00000368491.3:c.226G>A	6.37:g.118953622C>T	ENSP00000357477:p.Val76Met		A1A4E1|A2A3P2|A2IDE5|F8W6J2|G3V0H3|Q2TAM2|Q5T323|Q7Z5K7|Q9H289	Missense_Mutation	SNP	NULL	p.V79M	ENST00000368491.3	37	c.235	CCDS43498.1	6	.	.	.	.	.	.	.	.	.	.	C	15.08	2.725740	0.48833	2.69E-4	0.0	ENSG00000111860	ENST00000368491;ENST00000368488;ENST00000434604;ENST00000392500;ENST00000419517	T;T;T;T;T	0.25085	1.82;1.82;1.82;1.82;1.82	5.82	4.9	0.64082	.	0.100168	0.43919	D	0.000513	T	0.21962	0.0529	N	0.16656	0.425	0.37545	D	0.91845	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.70487	0.969;0.969;0.912;0.912	T	0.03025	-1.1081	10	0.52906	T	0.07	-12.5877	11.4167	0.49956	0.1405:0.7241:0.1354:0.0	.	79;76;79;76	Q5SZL2-2;G3V0H3;F8W6J2;Q5SZL2	.;.;.;CF204_HUMAN	M	76;79;79;79;76	ENSP00000357477:V76M;ENSP00000357474:V79M;ENSP00000392131:V79M;ENSP00000376288:V79M;ENSP00000393317:V76M	ENSP00000357474:V79M	V	-	1	0	C6orf204	119060315	0.995000	0.38212	1.000000	0.80357	0.988000	0.76386	2.956000	0.49129	2.754000	0.94517	0.650000	0.86243	GTG	CEP85L	-	NULL	ENSG00000111860		0.378	CEP85L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP85L	HGNC	protein_coding	OTTHUMT00000041996.2		0.00	59	0	C	NM_001042475		118953622	-1			no_errors	ENST00000368488	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.996	T
CES1	1066	genome.wustl.edu	37	16	55854390	55854390	+	Splice_Site	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr16:55854390A>C	ENST00000361503.4	-	6	822	c.692T>G	c.(691-693)gTt>gGt	p.V231G	CES1_ENST00000360526.3_Splice_Site_p.V232G|CES1_ENST00000422046.2_Splice_Site_p.V231G|CES1_ENST00000566555.1_5'Flank			P23141	EST1_HUMAN	carboxylesterase 1	231					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	TGGAGACAAAACCTGACAGCA	0.522																																					NSCLC(162;1801 2756 42904 52896)												0													14.0	15.0	15.0					16																	55854390		2196	4294	6490	SO:0001630	splice_region_variant	0			BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.691-1T>G	16.37:g.55854390A>C			A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3	p.V232G	ENST00000361503.4	37	c.695	CCDS45488.1	16	.	.	.	.	.	.	.	.	.	.	.	13.58	2.278830	0.40294	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046;ENST00000426667	T;T;T	0.69435	-0.4;-0.4;-0.4	3.93	3.93	0.45458	Carboxylesterase, type B (1);	0.275502	0.25610	N	0.029498	D	0.82953	0.5149	M	0.91090	3.175	0.29682	N	0.841635	D;D;D	0.67145	0.996;0.996;0.995	D;D;D	0.68765	0.96;0.96;0.933	T	0.80937	-0.1159	10	0.87932	D	0	.	10.794	0.46449	1.0:0.0:0.0:0.0	.	231;231;232	E9PAU8;P23141;P23141-2	.;EST1_HUMAN;.	G	232;231;231;96	ENSP00000353720:V232G;ENSP00000355193:V231G;ENSP00000390492:V231G	ENSP00000353720:V232G	V	-	2	0	CES1	54411891	0.557000	0.26546	0.137000	0.22149	0.006000	0.05464	3.375000	0.52410	1.439000	0.47511	0.374000	0.22700	GTT	CES1	-	pfam_CarbesteraseB,pfam_AB_hydrolase_3	ENSG00000198848		0.522	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CES1	HGNC	protein_coding	OTTHUMT00000433285.1	-	0.00	113	0	A	NM_001266	Missense_Mutation	55854390	-1	tier1	-	no_errors	ENST00000360526	ensembl	human	known	74_37	missense	13.56	51	8	SNP	0.200	C
CHD3	1107	genome.wustl.edu	37	17	7796665	7796665	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:7796665G>C	ENST00000330494.7	+	5	721	c.571G>C	c.(571-573)Gcc>Ccc	p.A191P	CHD3_ENST00000358181.4_Missense_Mutation_p.A191P|CHD3_ENST00000380358.4_Missense_Mutation_p.A250P	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	191					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				CATCCTTGGGGCCAAATGGAG	0.527																																																	0													54.0	49.0	51.0					17																	7796665		2203	4300	6503	SO:0001583	missense	0			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.571G>C	17.37:g.7796665G>C	ENSP00000332628:p.Ala191Pro		D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.A191P	ENST00000330494.7	37	c.571	CCDS32554.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.02|17.02	3.282326|3.282326	0.59867|0.59867	.|.	.|.	ENSG00000170004|ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494|ENST00000452447	D;D;D|D	0.94000|0.95001	-3.33;-3.33;-3.33|-3.58	4.65|4.65	4.65|4.65	0.58169|0.58169	High mobility group, HMG1/HMG2 (1);CHD, N-terminal (1);|.	0.000000|.	0.46145|.	D|.	0.000318|.	D|D	0.95698|0.95698	0.8601|0.8601	M|M	0.80422|0.80422	2.495|2.495	0.58432|0.58432	D|D	0.999997|0.999997	D;D;D|.	0.69078|.	0.99;0.992;0.997|.	P;D;D|.	0.67548|.	0.885;0.93;0.952|.	D|D	0.94273|0.94273	0.7512|0.7512	10|7	0.87932|0.08179	D|T	0|0.78	-15.5989|-15.5989	17.7258|17.7258	0.88365|0.88365	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	191;191;250|.	Q12873-2;Q12873;E9PG89|.	.;CHD3_HUMAN;.|.	P|A	250;191;191|65	ENSP00000369716:A250P;ENSP00000350907:A191P;ENSP00000332628:A191P|ENSP00000405861:G65A	ENSP00000332628:A191P|ENSP00000405861:G65A	A|G	+|+	1|2	0|0	CHD3|CHD3	7737390|7737390	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.251000|9.251000	0.95483|0.95483	2.411000|2.411000	0.81874|0.81874	0.561000|0.561000	0.74099|0.74099	GCC|GGC	CHD3	-	pfam_CHD_N,superfamily_HMG_box_dom	ENSG00000170004		0.527	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	-	0.00	85	0	G	NM_001005273		7796665	+1	tier1	-	no_errors	ENST00000330494	ensembl	human	known	74_37	missense	17.65	28	6	SNP	1.000	C
CLASP2	23122	genome.wustl.edu	37	3	33543245	33543245	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr3:33543245C>G	ENST00000468888.2	-	38	4403	c.4357G>C	c.(4357-4359)Gag>Cag	p.E1453Q	CLASP2_ENST00000359576.5_Missense_Mutation_p.E1444Q|CLASP2_ENST00000461133.3_Missense_Mutation_p.E1212Q|CLASP2_ENST00000307312.7_Missense_Mutation_p.E934Q|CLASP2_ENST00000480013.1_Missense_Mutation_p.E1232Q|CLASP2_ENST00000539981.1_3'UTR|CLASP2_ENST00000399362.4_Missense_Mutation_p.E1452Q			O75122	CLAP2_HUMAN	cytoplasmic linker associated protein 2	1233					axon guidance (GO:0007411)|establishment or maintenance of cell polarity (GO:0007163)|fucosylation (GO:0036065)|microtubule anchoring (GO:0034453)|microtubule nucleation (GO:0007020)|microtubule organizing center organization (GO:0031023)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of microtubule polymerization or depolymerization (GO:0031110)|regulation of microtubule-based process (GO:0032886)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|trans-Golgi network (GO:0005802)	galactoside 2-alpha-L-fucosyltransferase activity (GO:0008107)|microtubule plus-end binding (GO:0051010)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	48						ACACTGCTCTCTGAATTATCA	0.448																																																	0													132.0	121.0	125.0					3																	33543245		1921	4135	6056	SO:0001583	missense	0			AB014527		3p24.3	2013-01-18			ENSG00000163539	ENSG00000163539			17078	protein-coding gene	gene with protein product		605853				9734811, 10899121	Standard	NM_015097		Approved	KIAA0627	uc021wvc.1	O75122	OTTHUMG00000156489	ENST00000468888.2:c.4357G>C	3.37:g.33543245C>G	ENSP00000419974:p.Glu1453Gln		Q7L8F6|Q8N6R6|Q9BQT3|Q9BQT4|Q9H7A3|Q9NSZ2	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.E1452Q	ENST00000468888.2	37	c.4354		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.086723|5.086723	0.94100|0.94100	.|.	.|.	ENSG00000163539|ENSG00000163539	ENST00000468888;ENST00000399362;ENST00000359576;ENST00000307312;ENST00000480013;ENST00000461133|ENST00000487553	T;T;T;T;T;T|.	0.67345|.	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26|.	5.7|5.7	5.7|5.7	0.88788|0.88788	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.59473|0.59473	0.2196|0.2196	L|L	0.33189|0.33189	0.99|0.99	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.998;0.999|.	D;D|.	0.91635|.	0.994;0.999|.	T|T	0.52931|0.52931	-0.8509|-0.8509	10|5	0.29301|.	T|.	0.29|.	-20.2089|-20.2089	18.0216|18.0216	0.89257|0.89257	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1444;1452|.	F5H604;E7ERI8|.	.;.|.	Q|T	1453;1452;1444;934;1232;1212|158	ENSP00000419974:E1453Q;ENSP00000382297:E1452Q;ENSP00000352581:E1444Q;ENSP00000304743:E934Q;ENSP00000417518:E1232Q;ENSP00000419305:E1212Q|.	ENSP00000304743:E934Q|.	E|R	-|-	1|2	0|0	CLASP2|CLASP2	33518249|33518249	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.965000|0.965000	0.64279|0.64279	7.506000|7.506000	0.81665|0.81665	2.683000|2.683000	0.91414|0.91414	0.655000|0.655000	0.94253|0.94253	GAG|AGA	CLASP2	-	superfamily_ARM-type_fold	ENSG00000163539		0.448	CLASP2-001	NOVEL	basic|appris_candidate_longest	protein_coding	CLASP2	HGNC	protein_coding	OTTHUMT00000344320.4		0.00	44	0	C	NM_001207044		33543245	-1			no_errors	ENST00000399362	ensembl	human	known	74_37	missense	9.68	28	3	SNP	1.000	G
CLEC12B	387837	genome.wustl.edu	37	12	10167210	10167210	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:10167210C>T	ENST00000338896.5	+	3	407	c.279C>T	c.(277-279)tcC>tcT	p.S93S	RP11-133L14.5_ENST00000544225.1_RNA|CLEC1B_ENST00000428126.2_5'Flank|CLEC12B_ENST00000396502.1_Silent_p.S93S	NM_001129998.1	NP_001123470.1	Q2HXU8	CL12B_HUMAN	C-type lectin domain family 12, member B	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(2)|large_intestine(2)|lung(5)	9						ATAACTTATCCCAGCAACTGG	0.428																																																	0													104.0	96.0	99.0					12																	10167210		2203	4300	6503	SO:0001819	synonymous_variant	0			AK128243	CCDS8610.1, CCDS44830.1	12p13.2	2010-08-17			ENSG00000256660	ENSG00000256660		"""C-type lectin domain containing"""	31966	protein-coding gene	gene with protein product						17562706	Standard	NM_205852		Approved		uc001qwz.2	Q2HXU8	OTTHUMG00000168397	ENST00000338896.5:c.279C>T	12.37:g.10167210C>T			Q6UWF2|Q6ZRG0	Silent	SNP	pfam_C-type_lectin,pfam_Ly49,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.S93	ENST00000338896.5	37	c.279	CCDS44830.1	12																																																																																			CLEC12B	-	pfam_Ly49	ENSG00000256660		0.428	CLEC12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC12B	HGNC	protein_coding	OTTHUMT00000399554.2	-	0.00	42	0	C	NM_205852		10167210	+1	tier1	-	no_errors	ENST00000338896	ensembl	human	known	74_37	silent	23.08	20	6	SNP	0.400	T
CNTN5	53942	genome.wustl.edu	37	11	100061873	100061873	+	Silent	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:100061873A>G	ENST00000524871.1	+	14	1886	c.1596A>G	c.(1594-1596)ccA>ccG	p.P532P	CNTN5_ENST00000527185.1_Silent_p.P532P|CNTN5_ENST00000418526.2_Silent_p.P458P|CNTN5_ENST00000279463.3_Silent_p.P532P|CNTN5_ENST00000528682.1_Silent_p.P532P	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	532	Ig-like C2-type 5.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		CTATTCTTCCAGACGGGAGTC	0.373																																																	0													56.0	56.0	56.0					11																	100061873		1812	4068	5880	SO:0001819	synonymous_variant	0			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1596A>G	11.37:g.100061873A>G			A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P532	ENST00000524871.1	37	c.1596	CCDS53696.1	11																																																																																			CNTN5	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000149972		0.373	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTN5	HGNC	protein_coding	OTTHUMT00000395148.2	-	0.00	113	0	A	NM_014361		100061873	+1	tier1	-	no_errors	ENST00000279463	ensembl	human	known	74_37	silent	6.25	60	4	SNP	1.000	G
CNTN6	27255	genome.wustl.edu	37	3	1425020	1425020	+	Silent	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr3:1425020T>C	ENST00000446702.2	+	19	3072	c.2445T>C	c.(2443-2445)tcT>tcC	p.S815S	CNTN6_ENST00000539053.1_Silent_p.S743S|CNTN6_ENST00000350110.2_Silent_p.S815S			Q9UQ52	CNTN6_HUMAN	contactin 6	815	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AGAGTTTTTCTGCTTCTGAAA	0.423																																																	0													189.0	198.0	195.0					3																	1425020		2203	4300	6503	SO:0001819	synonymous_variant	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2445T>C	3.37:g.1425020T>C			Q2KHM2	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.S815	ENST00000446702.2	37	c.2445	CCDS2557.1	3																																																																																			CNTN6	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134115		0.423	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	-	0.00	91	0	T	NM_014461		1425020	+1	tier1	-	no_errors	ENST00000350110	ensembl	human	known	74_37	silent	13.79	50	8	SNP	0.932	C
CNTNAP5	129684	genome.wustl.edu	37	2	125204470	125204470	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:125204470T>G	ENST00000431078.1	+	6	1238	c.874T>G	c.(874-876)Ttc>Gtc	p.F292V		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	292	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		CACACAGCACTTCCGCACCAA	0.587																																																	0													113.0	117.0	115.0					2																	125204470		2174	4282	6456	SO:0001583	missense	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.874T>G	2.37:g.125204470T>G	ENSP00000399013:p.Phe292Val		Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.F292V	ENST00000431078.1	37	c.874	CCDS46401.1	2	.	.	.	.	.	.	.	.	.	.	T	17.82	3.482325	0.63962	.	.	ENSG00000155052	ENST00000431078	T	0.78126	-1.15	5.78	4.63	0.57726	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.000000	0.53938	D	0.000059	T	0.80363	0.4609	L	0.38692	1.165	0.54753	D	0.999984	D	0.89917	1.0	D	0.87578	0.998	T	0.75654	-0.3243	10	0.20046	T	0.44	.	11.1765	0.48603	0.0:0.0717:0.0:0.9283	.	292	Q8WYK1	CNTP5_HUMAN	V	292	ENSP00000399013:F292V	ENSP00000399013:F292V	F	+	1	0	CNTNAP5	124920940	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.153000	0.71819	1.131000	0.42111	0.533000	0.62120	TTC	CNTNAP5	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	ENSG00000155052		0.587	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	-	0.00	43	0	T			125204470	+1	tier1	-	no_errors	ENST00000431078	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	G
COL2A1	1280	genome.wustl.edu	37	12	48367888	48367888	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:48367888delA	ENST00000380518.3	-	53	4465	c.4301delT	c.(4300-4302)ctgfs	p.L1434fs	COL2A1_ENST00000493991.1_5'UTR|COL2A1_ENST00000337299.6_Frame_Shift_Del_p.L1365fs	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	1434	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GCCATCCTTCAGGGCAGTGTA	0.632																																																	0													88.0	79.0	82.0					12																	48367888		2203	4300	6503	SO:0001589	frameshift_variant	0			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.4301delT	12.37:g.48367888delA	ENSP00000369889:p.Leu1434fs		A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Frame_Shift_Del	DEL	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C_dom,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.L1434fs	ENST00000380518.3	37	c.4301	CCDS41778.1	12																																																																																			COL2A1	-	pfam_Fib_collagen_C,smart_Fib_collagen_C	ENSG00000139219		0.632	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL2A1	HGNC	protein_coding	OTTHUMT00000313810.2		0.00	39	0	A	NM_001844		48367888	-1	tier1		no_errors	ENST00000380518	ensembl	human	known	74_37	frame_shift_del	22.22	7	2	DEL	1.000	-
COL6A6	131873	genome.wustl.edu	37	3	130287171	130287171	+	Silent	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr3:130287171G>T	ENST00000358511.6	+	5	2155	c.2124G>T	c.(2122-2124)gtG>gtT	p.V708V	COL6A6_ENST00000453409.2_Silent_p.V708V	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	708	Nonhelical region.|VWFA 4. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TGAGCTTTGTGTCTCAGTACT	0.498																																																	0													99.0	101.0	101.0					3																	130287171		1955	4133	6088	SO:0001819	synonymous_variant	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2124G>T	3.37:g.130287171G>T			A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.V708	ENST00000358511.6	37	c.2124	CCDS46911.1	3																																																																																			COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000206384		0.498	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	-	0.00	45	0	G	NM_001102608		130287171	+1	tier1	-	no_errors	ENST00000358511	ensembl	human	known	74_37	silent	15.00	17	3	SNP	0.909	T
COPS7A	50813	genome.wustl.edu	37	12	6838513	6838513	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:6838513G>A	ENST00000543155.1	+	5	910	c.428G>A	c.(427-429)gGc>gAc	p.G143D	COPS7A_ENST00000542150.1_3'UTR|COPS7A_ENST00000539735.1_Missense_Mutation_p.G143D|COPS7A_ENST00000229251.3_Missense_Mutation_p.G143D|COPS7A_ENST00000534877.1_Missense_Mutation_p.G143D|COPS7A_ENST00000538410.1_Missense_Mutation_p.G143D|COPS7A_ENST00000534947.1_Missense_Mutation_p.G143D	NM_001164094.1	NP_001157566.1	Q9UBW8	CSN7A_HUMAN	COP9 signalosome subunit 7A	143	PCI.				cullin deneddylation (GO:0010388)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				endometrium(2)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|ovary(1)|urinary_tract(1)	10						GTGCTTCGTGGCTCCCTGGAC	0.597																																																	0													187.0	141.0	156.0					12																	6838513		2203	4300	6503	SO:0001583	missense	0			AF193844	CCDS8558.1	12p13.31	2013-03-14	2013-03-14		ENSG00000111652	ENSG00000111652			16758	protein-coding gene	gene with protein product			"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 7A"", ""COP9 constitutive photomorphogenic homolog subunit 7A (Arabidopsis)"""				Standard	NM_001164093		Approved	CSN7A	uc001qqh.3	Q9UBW8	OTTHUMG00000169182	ENST00000543155.1:c.428G>A	12.37:g.6838513G>A	ENSP00000438115:p.Gly143Asp		A8K9A6|Q9NVX3|Q9UJW4	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.G143D	ENST00000543155.1	37	c.428	CCDS8558.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.325764	0.95708	.	.	ENSG00000111652	ENST00000543155;ENST00000442593;ENST00000229251;ENST00000539735;ENST00000538410;ENST00000534947;ENST00000541866;ENST00000534877;ENST00000538753	T;T;T;T;T;T;T;T	0.38077	1.16;1.16;1.16;1.16;1.16;1.16;1.16;1.16	5.39	5.39	0.77823	Proteasome component (PCI) domain (2);	0.000000	0.85682	D	0.000000	T	0.69949	0.3168	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.77593	-0.2530	10	0.87932	D	0	-12.3195	19.1574	0.93517	0.0:0.0:1.0:0.0	.	143;143	F5H248;Q9UBW8	.;CSN7A_HUMAN	D	143	ENSP00000438115:G143D;ENSP00000229251:G143D;ENSP00000441852:G143D;ENSP00000439547:G143D;ENSP00000446039:G143D;ENSP00000442613:G143D;ENSP00000438363:G143D;ENSP00000440683:G143D	ENSP00000229251:G143D	G	+	2	0	COPS7A	6708774	1.000000	0.71417	0.979000	0.43373	0.889000	0.51656	9.473000	0.97714	2.525000	0.85131	0.655000	0.94253	GGC	COPS7A	-	pfam_PCI_dom,smart_PCI_dom	ENSG00000111652		0.597	COPS7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS7A	HGNC	protein_coding	OTTHUMT00000402740.1	-	0.00	52	0	G			6838513	+1	tier1	-	no_errors	ENST00000229251	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	A
CPQ	10404	genome.wustl.edu	37	8	97797433	97797433	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:97797433T>G	ENST00000220763.5	+	2	518	c.308T>G	c.(307-309)gTt>gGt	p.V103G		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	103					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										CTGGAGAAAGTTCACCTGGAG	0.498																																																	0													76.0	72.0	74.0					8																	97797433		2203	4300	6503	SO:0001583	missense	0			AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.308T>G	8.37:g.97797433T>G	ENSP00000220763:p.Val103Gly		B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.V103G	ENST00000220763.5	37	c.308	CCDS6273.1	8	.	.	.	.	.	.	.	.	.	.	T	14.83	2.652736	0.47362	.	.	ENSG00000104324	ENST00000220763;ENST00000519900;ENST00000517742;ENST00000519484;ENST00000521142	T;T	0.59906	0.32;0.23	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.80088	0.4559	M	0.88181	2.935	0.58432	D	0.999998	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	D	0.83950	0.0316	10	0.66056	D	0.02	-8.8489	15.8741	0.79148	0.0:0.0:0.0:1.0	.	103;103	B5MDX4;Q9Y646	.;PGCP_HUMAN	G	103	ENSP00000220763:V103G;ENSP00000429146:V103G	ENSP00000220763:V103G	V	+	2	0	AC010859.1	97866609	1.000000	0.71417	0.992000	0.48379	0.282000	0.26991	5.527000	0.67123	2.154000	0.67381	0.533000	0.62120	GTT	CPQ	-	NULL	ENSG00000104324		0.498	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPQ	HGNC	protein_coding	OTTHUMT00000379757.2	-	0.00	47	0	T	NM_016134		97797433	+1	tier1	-	no_errors	ENST00000220763	ensembl	human	known	74_37	missense	25.00	18	6	SNP	0.979	G
CPXM2	119587	genome.wustl.edu	37	10	125472815	125472815	+	5'UTR	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:125472815T>G	ENST00000368854.3	-	0	2210							Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		agtggggatattttggtggta	0.383																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000368854.3:c.-438A>C	10.37:g.125472815T>G			B4E3Q2	RNA	SNP	-	NULL	ENST00000368854.3	37	NULL		10	.	.	.	.	.	.	.	.	.	.	C	1.961	-0.438921	0.04636	.	.	ENSG00000121898	ENST00000368854	.	.	.	1.48	-2.95	0.05564	.	.	.	.	.	T	0.12390	0.0301	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23797	-1.0178	5	0.10377	T	0.69	.	0.5797	0.00709	0.2028:0.3327:0.2043:0.2602	.	.	.	.	L	218	.	ENSP00000357847:I218L	I	-	1	0	CPXM2	125462805	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.528000	0.02225	-1.818000	0.01218	-0.283000	0.09986	ATA	CPXM2	-	-	ENSG00000121898		0.383	CPXM2-001	KNOWN	basic	processed_transcript	CPXM2	HGNC	protein_coding	OTTHUMT00000050852.2	-	0.00	51	0	T	NM_198148		125472815	-1	tier1	-	no_errors	ENST00000368854	ensembl	human	known	74_37	rna	29.17	17	7	SNP	0.000	G
CRAT	1384	genome.wustl.edu	37	9	131862207	131862207	+	Silent	SNP	G	G	A	rs376776814		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:131862207G>A	ENST00000318080.2	-	8	1317	c.1023C>T	c.(1021-1023)taC>taT	p.Y341Y	CRAT_ENST00000464290.1_5'Flank|RP11-247A12.1_ENST00000434250.1_RNA	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	341					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	CAGCATGCTCGTACACAAGCC	0.607													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17017	0.0		0.0	False		,,,				2504	0.0																0								G		1,4405	2.1+/-5.4	0,1,2202	81.0	72.0	75.0		1023	-10.1	0.0	9		75	0,8600		0,0,4300	no	coding-synonymous	CRAT	NM_000755.3		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		341/627	131862207	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.1023C>T	9.37:g.131862207G>A			Q5T952|Q9BW16	Silent	SNP	pfam_Carn_acyl_trans	p.Y341	ENST00000318080.2	37	c.1023	CCDS6919.1	9																																																																																			CRAT	-	pfam_Carn_acyl_trans	ENSG00000095321		0.607	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAT	HGNC	protein_coding	OTTHUMT00000253700.1		0.00	53	0	G			131862207	-1			no_errors	ENST00000318080	ensembl	human	known	74_37	silent	8.82	31	3	SNP	0.306	A
CRELD1	78987	genome.wustl.edu	37	3	9979713	9979713	+	Missense_Mutation	SNP	C	C	T	rs2302787	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr3:9979713C>T	ENST00000383811.3	+	4	982	c.383C>T	c.(382-384)cCg>cTg	p.P128L	CRELD1_ENST00000326434.5_Missense_Mutation_p.P128L|CRELD1_ENST00000397170.3_Missense_Mutation_p.P128L|RP11-1020A11.1_ENST00000602411.1_RNA|CRELD1_ENST00000452070.1_Missense_Mutation_p.P128L	NM_015513.4	NP_056328	Q96HD1	CREL1_HUMAN	cysteine-rich with EGF-like domains 1	128			P -> R (in dbSNP:rs2302787).		cardiac septum development (GO:0003279)|endocardial cushion development (GO:0003197)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)|urinary_tract(1)	14						CAGGAGGCCCCGGACCTCTTC	0.607																																																	0													30.0	33.0	32.0					3																	9979713		2203	4300	6503	SO:0001583	missense	0			AF452623	CCDS2593.1, CCDS33693.1	3p25.3	2005-12-08	2004-02-13		ENSG00000163703	ENSG00000163703			14630	protein-coding gene	gene with protein product		607170	"""atrioventricular septal defect 2"""	AVSD2		10922384, 12137942	Standard	NM_015513		Approved		uc003buf.3	Q96HD1	OTTHUMG00000128653	ENST00000383811.3:c.383C>T	3.37:g.9979713C>T	ENSP00000373322:p.Pro128Leu		A8MX90|B2RAA9|Q6I9X5|Q8NFT4|Q9Y409	Missense_Mutation	SNP	pfam_DUF3456,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,smart_Furin_repeat,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.P128L	ENST00000383811.3	37	c.383	CCDS2593.1	3	.	.	.	.	.	.	.	.	.	.	C	25.2	4.608983	0.87258	.	.	ENSG00000163703	ENST00000397170;ENST00000383811;ENST00000452070;ENST00000326434	T;T;T;T	0.35236	1.32;1.32;1.32;1.32	5.22	5.22	0.72569	Growth factor, receptor (1);	0.000000	0.85682	D	0.000000	T	0.62732	0.2452	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.65372	-0.6184	9	.	.	.	-6.6884	16.2719	0.82626	0.0:1.0:0.0:0.0	.	128;128	Q96HD1;Q96HD1-2	CREL1_HUMAN;.	L	128	ENSP00000380355:P128L;ENSP00000373322:P128L;ENSP00000393643:P128L;ENSP00000321856:P128L	.	P	+	2	0	CRELD1	9954713	1.000000	0.71417	0.953000	0.39169	0.788000	0.44548	7.458000	0.80787	2.434000	0.82447	0.561000	0.74099	CCG	CRELD1	-	superfamily_Growth_fac_rcpt_N_dom	ENSG00000163703		0.607	CRELD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRELD1	HGNC	protein_coding	OTTHUMT00000250533.1	-	0.00	54	0	C	NM_015513		9979713	+1	tier1	-	no_errors	ENST00000326434	ensembl	human	known	74_37	missense	46.88	17	15	SNP	0.999	T
CRYL1	51084	genome.wustl.edu	37	13	20987431	20987431	+	Silent	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr13:20987431G>C	ENST00000298248.7	-	6	791	c.729C>G	c.(727-729)ctC>ctG	p.L243L	CRYL1_ENST00000382812.1_Silent_p.L221L	NM_015974.2	NP_057058.2	Q9Y2S2	CRYL1_HUMAN	crystallin, lambda 1	243					fatty acid metabolic process (GO:0006631)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|L-gulonate 3-dehydrogenase activity (GO:0050104)|NAD+ binding (GO:0070403)|protein homodimerization activity (GO:0042803)			NS(1)|kidney(1)|large_intestine(5)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(29;2.27e-23)|all_epithelial(30;1.69e-19)|all_lung(29;8.29e-18)|Lung SC(185;0.0262)|Ovarian(182;0.0827)|Hepatocellular(188;0.244)		all cancers(112;6.6e-05)|Epithelial(112;0.00178)|OV - Ovarian serous cystadenocarcinoma(117;0.0169)|Lung(94;0.0215)|GBM - Glioblastoma multiforme(144;0.0402)|LUSC - Lung squamous cell carcinoma(192;0.061)		CTTCTGCATTGAGATGCATGG	0.463																																																	0													98.0	94.0	96.0					13																	20987431		1951	4151	6102	SO:0001819	synonymous_variant	0			AF077049	CCDS41871.1	13q11	2008-07-18			ENSG00000165475	ENSG00000165475			18246	protein-coding gene	gene with protein product	"""crystallin, lamda 1"", ""L-gulonate 3-dehydrogenase"", ""lambda-crystallin homolog"""	609877				12527201	Standard	NM_015974		Approved	GDH, lambda-CRY, MGC149525, MGC149526	uc001une.3	Q9Y2S2	OTTHUMG00000016516	ENST00000298248.7:c.729C>G	13.37:g.20987431G>C			A0PJ43|B3KN92|Q0VDI1|Q7Z4Z9|Q9P0G7	Silent	SNP	pfam_3-OHacyl-CoA_DH_NAD-bd,pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like	p.L243	ENST00000298248.7	37	c.729	CCDS41871.1	13																																																																																			CRYL1	-	pfam_3HC_DH_C,superfamily_6-PGluconate_DH_C-like	ENSG00000165475		0.463	CRYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYL1	HGNC	protein_coding	OTTHUMT00000044071.1	-	0.00	56	0	G	NM_015974		20987431	-1	tier1	-	no_errors	ENST00000298248	ensembl	human	known	74_37	silent	15.15	27	5	SNP	1.000	C
CSMD2	114784	genome.wustl.edu	37	1	34076780	34076780	+	Silent	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:34076780G>T	ENST00000373380.1	-	20	3043	c.2823C>A	c.(2821-2823)ccC>ccA	p.P941P	CSMD2_ENST00000373377.1_Silent_p.P167P|CSMD2_ENST00000373381.4_Silent_p.P2068P|CSMD2_ENST00000373388.2_Silent_p.P167P			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2028	CUB 6. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGGTCTCATAGGGGCCATTCC	0.572																																																	0													115.0	111.0	112.0					1																	34076780		2203	4300	6503	SO:0001819	synonymous_variant	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2823C>A	1.37:g.34076780G>T			B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.P2068	ENST00000373380.1	37	c.6204		1																																																																																			CSMD2	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000121904		0.572	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4		0.00	36	0	G	NM_052896		34076780	-1			no_errors	ENST00000373381	ensembl	human	known	74_37	silent	9.52	19	2	SNP	0.108	T
CTSO	1519	genome.wustl.edu	37	4	156849542	156849542	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:156849542T>C	ENST00000433477.3	-	7	946	c.877A>G	c.(877-879)Agt>Ggt	p.S293G		NM_001334.2	NP_001325.1	P43235	CATK_HUMAN	cathepsin O	300					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)	p.S293R(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|prostate(1)	16	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.05)|Kidney(143;0.0627)|COAD - Colon adenocarcinoma(41;0.148)		CCCCAAGAACTTCCCCAGGAA	0.348																																					Pancreas(148;2303 2598 8989 35298)												1	Substitution - Missense(1)	large_intestine(1)											106.0	98.0	101.0					4																	156849542		2203	4300	6503	SO:0001583	missense	0			X77383	CCDS3794.1	4q32.1	2012-10-03			ENSG00000256043	ENSG00000256043		"""Cathepsins"""	2542	protein-coding gene	gene with protein product		600550		CTSO1		9790772	Standard	NM_001334		Approved		uc003ipg.3	P43234	OTTHUMG00000161942	ENST00000433477.3:c.877A>G	4.37:g.156849542T>C	ENSP00000414904:p.Ser293Gly		Q6FHS6	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.S293G	ENST00000433477.3	37	c.877	CCDS3794.1	4	.	.	.	.	.	.	.	.	.	.	T	10.59	1.393693	0.25205	.	.	ENSG00000256043	ENST00000433477	T	0.31769	1.48	5.56	-0.299	0.12808	Peptidase C1A, papain C-terminal (2);	0.465751	0.23985	N	0.042635	T	0.28366	0.0701	L	0.61036	1.89	0.09310	N	1	P	0.37688	0.605	B	0.39771	0.309	T	0.14090	-1.0485	10	0.48119	T	0.1	.	7.418	0.27055	0.2062:0.0:0.4102:0.3836	.	293	P43234	CATO_HUMAN	G	293	ENSP00000414904:S293G	ENSP00000281527:S293G	S	-	1	0	CTSO	157068992	0.012000	0.17670	0.015000	0.15790	0.785000	0.44390	1.887000	0.39698	0.038000	0.15604	0.528000	0.53228	AGT	CTSO	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000256043		0.348	CTSO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSO	HGNC	protein_coding	OTTHUMT00000366469.1	-	0.00	105	0	T	NM_001334		156849542	-1	tier1	-	no_errors	ENST00000433477	ensembl	human	known	74_37	missense	30.56	25	11	SNP	0.007	C
CXADRP3	440224	genome.wustl.edu	37	18	14479007	14479007	+	lincRNA	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr18:14479007A>C	ENST00000581457.1	-	0	901					NR_024076.1				coxsackie virus and adenovirus receptor pseudogene 3																		TCGGCCTTTCAGTTCTGGATA	0.368																																																	0																																												0					18p11.21	2013-09-19			ENSG00000265766	ENSG00000265766			33974	pseudogene	pseudogene							Standard	NR_024076		Approved		uc010xai.2		OTTHUMG00000178700		18.37:g.14479007A>C				RNA	SNP	-	NULL	ENST00000581457.1	37	NULL		18																																																																																			CXADRP3	-	-	ENSG00000265766		0.368	CXADRP3-001	KNOWN	basic	lincRNA	CXADRP3	HGNC	lincRNA	OTTHUMT00000443008.1	-	0.00	52	0	A	NR_024076		14479007	-1	tier1	-	no_errors	ENST00000581457	ensembl	human	known	74_37	rna	47.37	9	9	SNP	0.994	C
CYP2C18	1562	genome.wustl.edu	37	10	96447929	96447929	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:96447929T>C	ENST00000285979.6	+	3	578	c.379T>C	c.(379-381)Tgc>Cgc	p.C127R	CYP2C19_ENST00000464755.1_3'UTR|CYP2C18_ENST00000339022.5_Missense_Mutation_p.C127R	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	127					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	CCGGCGTTTCTGCCTCATGAC	0.498																																																	0													123.0	112.0	116.0					10																	96447929		2203	4300	6503	SO:0001583	missense	0			M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.379T>C	10.37:g.96447929T>C	ENSP00000285979:p.Cys127Arg		B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.C127R	ENST00000285979.6	37	c.379	CCDS7435.1	10	.	.	.	.	.	.	.	.	.	.	t	13.22	2.172503	0.38315	.	.	ENSG00000108242	ENST00000339022;ENST00000285979	T;T	0.68331	-0.32;-0.32	4.63	3.4	0.38934	.	0.415433	0.23380	U	0.048803	T	0.49966	0.1588	N	0.24115	0.695	0.80722	D	1	P;B	0.37594	0.601;0.044	B;B	0.36845	0.234;0.016	T	0.56505	-0.7968	10	0.87932	D	0	.	9.0649	0.36458	0.0:0.0:0.1852:0.8148	.	127;127	Q4VAT5;P33260	.;CP2CI_HUMAN	R	127	ENSP00000341293:C127R;ENSP00000285979:C127R	ENSP00000285979:C127R	C	+	1	0	CYP2C18	96437919	0.000000	0.05858	0.617000	0.29091	0.773000	0.43773	-0.061000	0.11693	1.711000	0.51337	0.255000	0.18592	TGC	CYP2C18	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000108242		0.498	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C18	HGNC	protein_coding	OTTHUMT00000049486.1	-	0.00	121	0	T	NM_000772		96447929	+1	tier1	-	no_errors	ENST00000285979	ensembl	human	known	74_37	missense	12.50	40	6	SNP	0.826	C
DAAM2	23500	genome.wustl.edu	37	6	39832802	39832802	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:39832802A>G	ENST00000398904.2	+	5	562	c.380A>G	c.(379-381)aAc>aGc	p.N127S	DAAM2_ENST00000494405.1_3'UTR|DAAM2_ENST00000538976.1_Missense_Mutation_p.N127S|DAAM2_ENST00000274867.4_Missense_Mutation_p.N127S			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	127	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GAGATGAGGAACCAAGTCGTG	0.552											OREG0017416	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													101.0	119.0	113.0					6																	39832802		2099	4225	6324	SO:0001583	missense	0			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.380A>G	6.37:g.39832802A>G	ENSP00000381876:p.Asn127Ser	888	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	pfam_FH2_Formin,pfam_FH3_dom,pfam_GTPase-bd,superfamily_ARM-type_fold,smart_FH2_Formin	p.N127S	ENST00000398904.2	37	c.380	CCDS56426.1	6	.	.	.	.	.	.	.	.	.	.	a	16.25	3.070148	0.55539	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976	D;D;D	0.86366	-2.11;-2.11;-2.11	5.71	4.52	0.55395	GTPase-binding/formin homology 3 (1);Armadillo-type fold (1);Diaphanous GTPase-binding (1);	0.047776	0.85682	N	0.000000	T	0.54902	0.1887	N	0.12182	0.205	0.80722	D	1	B;B	0.24426	0.084;0.103	B;B	0.19666	0.015;0.026	T	0.54879	-0.8227	10	0.06099	T	0.92	.	11.6456	0.51259	0.9292:0.0:0.0708:0.0	.	127;127	G5EA45;Q86T65	.;DAAM2_HUMAN	S	127	ENSP00000274867:N127S;ENSP00000381876:N127S;ENSP00000437808:N127S	ENSP00000274867:N127S	N	+	2	0	DAAM2	39940780	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.511000	0.81718	0.959000	0.37980	0.529000	0.55759	AAC	DAAM2	-	pfam_GTPase-bd,superfamily_ARM-type_fold	ENSG00000146122		0.552	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	DAAM2	HGNC	protein_coding	OTTHUMT00000280648.1	-	0.00	44	0	A			39832802	+1	tier1	-	no_errors	ENST00000274867	ensembl	human	known	74_37	missense	9.80	46	5	SNP	1.000	G
DCC	1630	genome.wustl.edu	37	18	50936959	50936959	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr18:50936959C>T	ENST00000442544.2	+	20	3689	c.3073C>T	c.(3073-3075)Cga>Tga	p.R1025*	DCC_ENST00000412726.1_Nonsense_Mutation_p.R853*|DCC_ENST00000581580.1_Nonsense_Mutation_p.R660*	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	1025	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)	p.R1025G(1)|p.R1025*(1)		NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		AATTCAAGCACGAAATTCAAA	0.378																																																	2	Substitution - Nonsense(1)|Substitution - Missense(1)	cervix(1)|haematopoietic_and_lymphoid_tissue(1)											120.0	116.0	117.0					18																	50936959		2203	4300	6503	SO:0001587	stop_gained	0			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.3073C>T	18.37:g.50936959C>T	ENSP00000389140:p.Arg1025*			Nonsense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.R1025*	ENST00000442544.2	37	c.3073	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	C	38	6.925823	0.97940	.	.	ENSG00000187323	ENST00000442544;ENST00000412726	.	.	.	5.87	4.99	0.66335	.	0.080048	0.50627	D	0.000118	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-8.005	13.2613	0.60106	0.2888:0.7112:0.0:0.0	.	.	.	.	X	1025;853	.	ENSP00000397322:R853X	R	+	1	2	DCC	49190957	0.965000	0.33210	0.987000	0.45799	0.218000	0.24690	2.309000	0.43699	1.590000	0.49995	0.655000	0.94253	CGA	DCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187323		0.378	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3		0.00	75	0	C	NM_005215		50936959	+1			no_errors	ENST00000442544	ensembl	human	known	74_37	nonsense	7.14	26	2	SNP	0.998	T
DCDC1	341019	genome.wustl.edu	37	11	31312305	31312305	+	Silent	SNP	A	A	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:31312305A>T	ENST00000452803.1	-	7	1050	c.849T>A	c.(847-849)tcT>tcA	p.S283S	DCDC1_ENST00000597505.1_Silent_p.S283S	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	283					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TCATTCTAATAGAAAGAACAG	0.393																																																	0													87.0	88.0	88.0					11																	31312305		2202	4299	6501	SO:0001819	synonymous_variant	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.849T>A	11.37:g.31312305A>T			A6PVL6|B7WNX6|Q6ZU04	Silent	SNP	pfscan_Doublecortin_dom	p.S283	ENST00000452803.1	37	c.849	CCDS7872.1	11																																																																																			DCDC1	-	NULL	ENSG00000170959		0.393	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000316531.1	-	0.00	91	0	A	NM_181807		31312305	-1	tier1	-	no_errors	ENST00000452803	ensembl	human	known	74_37	silent	18.42	31	7	SNP	0.035	T
DEFB119	245932	genome.wustl.edu	37	20	29976958	29976958	+	Intron	SNP	C	C	T	rs375754726		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr20:29976958C>T	ENST00000376321.3	-	1	181				DEFB119_ENST00000376315.2_Missense_Mutation_p.R46H|DEFB119_ENST00000492344.1_Intron|DEFB119_ENST00000339144.3_Intron	NM_153289.3	NP_695021.2	Q8N690	DB119_HUMAN	defensin, beta 119						defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				large_intestine(2)|lung(1)|prostate(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GCACCGTTTACGATTTCGGCA	0.458																																																	0								C	,HIS/ARG,	1,4405	2.1+/-5.4	0,1,2202	210.0	179.0	189.0		,137,	1.8	0.1	20		189	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense,intron	DEFB119	NM_153289.2,NM_153323.3,NM_173460.1	,29,	0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154	,,	,46/89,	29976958	2,13004	2203	4300	6503	SO:0001627	intron_variant	0			AA939044	CCDS13178.1, CCDS33455.1	20q11.21	2007-02-19	2003-10-06		ENSG00000180483	ENSG00000180483		"""Defensins, beta"""	18099	protein-coding gene	gene with protein product			"""defensin, beta 120"""	DEFB120		11854508	Standard	NM_153289		Approved	DEFB-19, DEFB-20	uc002wvu.2	Q8N690	OTTHUMG00000032172	ENST00000376321.3:c.61+1267G>A	20.37:g.29976958C>T			Q5GRG1|Q5JWP1|Q5TH42|Q8N689	Missense_Mutation	SNP	superfamily_Scorpion_toxin-like	p.R46H	ENST00000376321.3	37	c.137	CCDS13178.1	20	.	.	.	.	.	.	.	.	.	.	C	21.6	4.167093	0.78339	2.27E-4	1.16E-4	ENSG00000180483	ENST00000376315	T	0.11604	2.76	3.71	1.75	0.24633	.	1.479110	0.04294	N	0.346186	T	0.08268	0.0206	.	.	.	0.09310	N	1	B	0.29232	0.238	B	0.21151	0.033	T	0.32613	-0.9900	9	0.49607	T	0.09	-15.7844	5.3328	0.15942	0.0:0.7323:0.0:0.2677	.	46	Q8N690-2	.	H	46	ENSP00000365492:R46H	ENSP00000365492:R46H	R	-	2	0	DEFB119	29440619	0.935000	0.31712	0.112000	0.21494	0.983000	0.72400	0.842000	0.27627	0.538000	0.28769	0.563000	0.77884	CGT	DEFB119	-	superfamily_Scorpion_toxin-like	ENSG00000180483		0.458	DEFB119-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB119	HGNC	protein_coding	OTTHUMT00000078514.1		0.00	76	0	C	NM_153289		29976958	-1			no_errors	ENST00000376315	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.156	T
DGKI	9162	genome.wustl.edu	37	7	137092657	137092657	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:137092657C>T	ENST00000288490.5	-	31	2908	c.2908G>A	c.(2908-2910)Ggc>Agc	p.G970S	DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000424189.2_Missense_Mutation_p.G983S|DGKI_ENST00000453654.2_Missense_Mutation_p.G639S|DGKI_ENST00000446122.1_Missense_Mutation_p.G952S	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	970					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TCCCCGTTGCCGGTTTTAGCT	0.428																																																	0													209.0	177.0	188.0					7																	137092657		2203	4300	6503	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2908G>A	7.37:g.137092657C>T	ENSP00000288490:p.Gly970Ser		A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G970S	ENST00000288490.5	37	c.2908	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772877	0.90108	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.46819	0.86;0.86;0.86	5.7	5.7	0.88788	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.73931	0.3650	M	0.86740	2.835	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.76575	0.98;0.988	T	0.78244	-0.2279	10	0.87932	D	0	.	18.0216	0.89257	0.0:1.0:0.0:0.0	.	639;970	E9PFX6;O75912	.;DGKI_HUMAN	S	639;887;973;970;952	ENSP00000392161:G639S;ENSP00000288490:G970S;ENSP00000399131:G952S	ENSP00000288490:G970S	G	-	1	0	DGKI	136743197	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.019000	0.64060	2.683000	0.91414	0.655000	0.94253	GGC	DGKI	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000157680		0.428	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3		0.00	83	0	C	NM_004717		137092657	-1			no_errors	ENST00000288490	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	T
DLGAP2	9228	genome.wustl.edu	37	8	1624706	1624706	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:1624706C>T	ENST00000421627.2	+	8	2104	c.1970C>T	c.(1969-1971)aCg>aTg	p.T657M		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	736					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TAGGTGGAAACGGCCACAGAT	0.493																																																	0													32.0	35.0	34.0					8																	1624706		1886	4107	5993	SO:0001583	missense	0			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1970C>T	8.37:g.1624706C>T	ENSP00000400258:p.Thr657Met		A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	pfam_GKAP	p.T657M	ENST00000421627.2	37	c.1970	CCDS47760.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.45|15.45	2.836897|2.836897	0.50951|0.50951	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000520901|ENST00000356067;ENST00000421627	.|T	.|0.18960	.|2.18	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.276401	.|0.45606	.|D	.|0.000351	T|T	0.43322|0.43322	0.1242|0.1242	L|L	0.55481|0.55481	1.735|1.735	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.76494	.|0.998;0.999	.|P;D	.|0.65874	.|0.899;0.939	T|T	0.22661|0.22661	-1.0210|-1.0210	5|10	.|0.66056	.|D	.|0.02	-9.1673|-9.1673	19.4089|19.4089	0.94660|0.94660	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|722;736	.|Q9P1A6-2;Q9P1A6	.|.;DLGP2_HUMAN	W|M	660|688;657	.|ENSP00000400258:T657M	.|ENSP00000348366:T688M	R|T	+|+	1|2	2|0	DLGAP2|DLGAP2	1612113|1612113	1.000000|1.000000	0.71417|0.71417	0.609000|0.609000	0.28983|0.28983	0.022000|0.022000	0.10575|0.10575	7.073000|7.073000	0.76784|0.76784	2.583000|2.583000	0.87209|0.87209	0.563000|0.563000	0.77884|0.77884	CGG|ACG	DLGAP2	-	pfam_GKAP	ENSG00000198010		0.493	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP2	HGNC	protein_coding	OTTHUMT00000374478.1	-	0.00	26	0	C	NM_004745		1624706	+1	tier1	-	no_errors	ENST00000421627	ensembl	human	known	74_37	missense	25.00	15	5	SNP	1.000	T
DNAH12	201625	genome.wustl.edu	37	3	57357587	57357587	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr3:57357587G>T	ENST00000351747.2	-	48	7615	c.7435C>A	c.(7435-7437)Cca>Aca	p.P2479T	DNAH12_ENST00000344804.4_Missense_Mutation_p.P112T	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	2479	AAA 4. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						TCAAATGGTGGAGGCTCTACA	0.368																																																	0													237.0	210.0	218.0					3																	57357587		692	1590	2282	SO:0001583	missense	0			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.7435C>A	3.37:g.57357587G>T	ENSP00000295937:p.Pro2479Thr		A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.P2479T	ENST00000351747.2	37	c.7435		3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	31|31	5.069598|5.069598	0.93950|0.93950	.|.	.|.	ENSG00000174844|ENSG00000174844	ENST00000351747;ENST00000466540;ENST00000344804|ENST00000462199	T;T;T|.	0.08193|.	3.12;3.12;3.12|.	6.07|6.07	6.07|6.07	0.98685|0.98685	Dynein heavy chain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.84028|0.84028	0.5382|0.5382	M|M	0.85777|0.85777	2.775|2.775	0.47276|0.47276	D|D	0.999375|0.999375	D;D|.	0.69078|.	0.969;0.997|.	P;D|.	0.77004|.	0.749;0.989|.	D|D	0.83925|0.83925	0.0303|0.0303	10|5	0.72032|.	D|.	0.01|.	.|.	20.6593|20.6593	0.99626|0.99626	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	112;2479|.	Q6ZR08-2;Q6ZR08|.	.;DYH12_HUMAN|.	T|Y	2479;170;112|169	ENSP00000295937:P2479T;ENSP00000420359:P170T;ENSP00000340464:P112T|.	ENSP00000340464:P112T|.	P|S	-|-	1|2	0|0	DNAH12|DNAH12	57332627|57332627	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.710000|9.710000	0.98732|0.98732	2.885000|2.885000	0.99019|0.99019	0.655000|0.655000	0.94253|0.94253	CCA|TCC	DNAH12	-	pfam_Dynein_heavy_dom	ENSG00000174844		0.368	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		-	0.00	110	0	G	NM_178504		57357587	-1	tier1	-	no_errors	ENST00000351747	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
DNAH8	1769	genome.wustl.edu	37	6	38794124	38794124	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:38794124G>A	ENST00000359357.3	+	27	3643	c.3389G>A	c.(3388-3390)cGt>cAt	p.R1130H	DNAH8_ENST00000449981.2_Missense_Mutation_p.R1347H|DNAH8_ENST00000441566.1_Missense_Mutation_p.R1130H			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	1130					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R1130H(2)		NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TCTTGCATACGTGATAATGAA	0.294																																																	2	Substitution - Missense(2)	endometrium(2)											101.0	100.0	101.0					6																	38794124		2203	4300	6503	SO:0001583	missense	0			Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.3389G>A	6.37:g.38794124G>A	ENSP00000352312:p.Arg1130His		O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R1130H	ENST00000359357.3	37	c.3389		6	.	.	.	.	.	.	.	.	.	.	G	23.4	4.409114	0.83340	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.29655	1.63;1.63;1.56	5.44	5.44	0.79542	.	0.116044	0.64402	D	0.000014	T	0.44222	0.1283	M	0.87456	2.885	0.53005	D	0.999961	D	0.67145	0.996	P	0.54590	0.756	T	0.53851	-0.8380	10	0.72032	D	0.01	.	12.8599	0.57908	0.0775:0.0:0.9225:0.0	.	1130	Q96JB1	DYH8_HUMAN	H	1335;1335;1130;1130	ENSP00000333363:R1335H;ENSP00000352312:R1130H;ENSP00000402294:R1130H	ENSP00000333363:R1335H	R	+	2	0	DNAH8	38902102	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.583000	0.60964	2.587000	0.87381	0.545000	0.68477	CGT	DNAH8	-	NULL	ENSG00000124721		0.294	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	DNAH8	HGNC	protein_coding	OTTHUMT00000043574.1		0.00	69	0	G	NM_001206927		38794124	+1			no_errors	ENST00000359357	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	A
DNAI1	27019	genome.wustl.edu	37	9	34491532	34491532	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:34491532T>G	ENST00000242317.4	+	8	832	c.661T>G	c.(661-663)Ttt>Gtt	p.F221V	DNAI1_ENST00000488369.1_3'UTR	NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	221					cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)			autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		CAGGACAAACTTTTCAGCCAC	0.493									Kartagener syndrome																																								0													100.0	88.0	93.0					9																	34491532		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.661T>G	9.37:g.34491532T>G	ENSP00000242317:p.Phe221Val		B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F221V	ENST00000242317.4	37	c.661	CCDS6557.1	9	.	.	.	.	.	.	.	.	.	.	T	23.3	4.399679	0.83120	.	.	ENSG00000122735	ENST00000396929;ENST00000242317;ENST00000437363	T;T	0.76186	-1.0;-1.0	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.73385	0.3580	M	0.78637	2.42	0.80722	D	1	P	0.42010	0.768	B	0.41088	0.347	T	0.72453	-0.4289	10	0.26408	T	0.33	.	11.0419	0.47835	0.0:0.0:0.0:1.0	.	221	Q9UI46	DNAI1_HUMAN	V	210;221;210	ENSP00000242317:F221V;ENSP00000395396:F210V	ENSP00000242317:F221V	F	+	1	0	DNAI1	34481532	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.362000	0.73077	1.925000	0.55765	0.459000	0.35465	TTT	DNAI1	-	NULL	ENSG00000122735		0.493	DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAI1	HGNC	protein_coding	OTTHUMT00000052192.1	-	0.00	114	0	T			34491532	+1	tier1	-	no_errors	ENST00000242317	ensembl	human	known	74_37	missense	10.84	74	9	SNP	1.000	G
DNM1P47	100216544	genome.wustl.edu	37	15	102304950	102304950	+	RNA	SNP	G	G	C	rs113247239	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:102304950G>C	ENST00000561463.1	+	0	12996									DNM1 pseudogene 47																		CAGAGCTGCTGTCCAACCTGC	0.602																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102304950G>C				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.602	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	62	0	G	NG_009149		102304950	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	15.38	22	4	SNP	1.000	C
DNM1P47	100216544	genome.wustl.edu	37	15	102304970	102304970	+	RNA	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:102304970G>A	ENST00000561463.1	+	0	13016									DNM1 pseudogene 47																		CACTCGCGTAGGGACAAGAAG	0.592																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102304970G>A				RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			DNM1P47	-	-	ENSG00000259660		0.592	DNM1P47-001	KNOWN	basic	processed_transcript	DNM1P47	HGNC	pseudogene	OTTHUMT00000417589.1	-	0.00	67	0	G	NG_009149		102304970	+1	tier1	-	no_errors	ENST00000561463	ensembl	human	known	74_37	rna	16.00	21	4	SNP	1.000	A
DOCK2	1794	genome.wustl.edu	37	5	169435601	169435601	+	Splice_Site	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:169435601A>C	ENST00000256935.8	+	31	3253	c.3173A>C	c.(3172-3174)aAg>aCg	p.K1058T	DOCK2_ENST00000540750.1_Splice_Site_p.K119T|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000520908.1_Splice_Site_p.K550T	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1058	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)	p.K1058T(2)		NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			ATCCTGAATAAGTAGGTTGCA	0.468																																																	2	Substitution - Missense(2)	large_intestine(2)											135.0	132.0	133.0					5																	169435601		2203	4300	6503	SO:0001630	splice_region_variant	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3173+1A>C	5.37:g.169435601A>C			Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.K1058T	ENST00000256935.8	37	c.3173	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	A	19.26	3.793522	0.70452	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.55052	0.54;0.54;0.54	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.70806	0.3266	M	0.76938	2.355	0.58432	D	0.999996	P;D	0.76494	0.915;0.999	P;D	0.78314	0.549;0.991	T	0.68176	-0.5478	10	0.14252	T	0.57	.	15.9958	0.80243	1.0:0.0:0.0:0.0	.	550;1058	E7ERW7;Q92608	.;DOCK2_HUMAN	T	1058;550;119	ENSP00000256935:K1058T;ENSP00000429283:K550T;ENSP00000438827:K119T	ENSP00000256935:K1058T	K	+	2	0	DOCK2	169368179	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.188000	0.69820	0.533000	0.62120	AAG	DOCK2	-	superfamily_ARM-type_fold,superfamily_Ferritin-like_SF	ENSG00000134516		0.468	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	-	0.00	62	0	A	NM_004946	Missense_Mutation	169435601	+1	tier1	-	no_errors	ENST00000256935	ensembl	human	known	74_37	missense	34.62	17	9	SNP	1.000	C
DOCK8	81704	genome.wustl.edu	37	9	422084	422084	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:422084G>T	ENST00000453981.1	+	33	4302	c.4190G>T	c.(4189-4191)aGa>aTa	p.R1397I	DOCK8_ENST00000469391.1_Missense_Mutation_p.R1297I|DOCK8_ENST00000432829.2_Missense_Mutation_p.R1329I|DOCK8_ENST00000382329.1_Missense_Mutation_p.R864I|DOCK8_ENST00000493666.2_3'UTR			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1397					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GAAAATTTGAGATGGAAGAAA	0.408																																																	0													89.0	87.0	88.0					9																	422084		2203	4300	6503	SO:0001583	missense	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.4190G>T	9.37:g.422084G>T	ENSP00000408464:p.Arg1397Ile		A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.R1397I	ENST00000453981.1	37	c.4190	CCDS6440.2	9	.	.	.	.	.	.	.	.	.	.	G	34	5.400041	0.96030	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.77391	0.4123	M	0.86953	2.85	0.80722	D	1	D;D;D	0.58268	0.982;0.982;0.982	D;D;D	0.65987	0.921;0.94;0.921	T	0.79607	-0.1733	10	0.72032	D	0.01	.	20.4024	0.99000	0.0:0.0:1.0:0.0	.	1297;864;1397	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	I	1397;1365;1329;1297;864	ENSP00000408464:R1397I;ENSP00000394888:R1329I;ENSP00000419438:R1297I;ENSP00000371766:R864I	ENSP00000287364:R1365I	R	+	2	0	DOCK8	412084	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.254000	0.95512	2.827000	0.97445	0.650000	0.86243	AGA	DOCK8	-	NULL	ENSG00000107099		0.408	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	-	0.00	36	0	G	XM_036307		422084	+1	tier1	-	no_errors	ENST00000453981	ensembl	human	known	74_37	missense	25.00	9	3	SNP	1.000	T
DPP10	57628	genome.wustl.edu	37	2	116594126	116594126	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:116594126A>C	ENST00000410059.1	+	23	2574	c.2094A>C	c.(2092-2094)gaA>gaC	p.E698D	DPP10_ENST00000393147.2_Missense_Mutation_p.E702D|DPP10_ENST00000409163.1_Missense_Mutation_p.E648D|DPP10_ENST00000310323.8_Missense_Mutation_p.E691D	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	698						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						CATCTAAGGAAGAAAGCACTT	0.333																																																	0													109.0	112.0	111.0					2																	116594126		2203	4300	6503	SO:0001583	missense	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.2094A>C	2.37:g.116594126A>C	ENSP00000386565:p.Glu698Asp		A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.E702D	ENST00000410059.1	37	c.2106	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	A	4.187	0.033347	0.08101	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.28	2.89	0.33648	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.159508	0.56097	N	0.000040	T	0.11793	0.0287	N	0.10837	0.055	0.39697	D	0.971122	B;B;B;B	0.11235	0.002;0.004;0.003;0.003	B;B;B;B	0.20184	0.008;0.01;0.028;0.013	T	0.12811	-1.0533	10	0.14252	T	0.57	-13.068	0.8169	0.01104	0.4642:0.1586:0.2254:0.1519	.	691;702;694;698	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	D	698;648;702;691	ENSP00000386565:E698D;ENSP00000387038:E648D;ENSP00000376855:E702D;ENSP00000309066:E691D	ENSP00000309066:E691D	E	+	3	2	DPP10	116310596	0.989000	0.36119	1.000000	0.80357	0.937000	0.57800	0.201000	0.17276	0.450000	0.26774	-0.256000	0.11100	GAA	DPP10	-	pfam_Peptidase_S9	ENSG00000175497		0.333	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	-	0.00	44	0	A	NM_020868		116594126	+1	tier1	-	no_errors	ENST00000393147	ensembl	human	known	74_37	missense	20.00	20	5	SNP	0.998	C
DTWD1	56986	genome.wustl.edu	37	15	49917567	49917567	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:49917567A>C	ENST00000251250.6	+	3	410	c.203A>C	c.(202-204)tAc>tCc	p.Y68S	DTWD1_ENST00000403028.3_Missense_Mutation_p.Y68S|DTWD1_ENST00000559223.1_3'UTR|DTWD1_ENST00000329873.5_Missense_Mutation_p.Y68S|DTWD1_ENST00000558653.1_Missense_Mutation_p.Y68S	NM_020234.5	NP_064619.2	Q8N5C7	DTWD1_HUMAN	DTW domain containing 1	68										endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9		all_lung(180;0.0384)		all cancers(107;3.27e-08)|GBM - Glioblastoma multiforme(94;7.6e-05)		AGAATGTTCTACTGCTATACA	0.343																																																	0													94.0	87.0	90.0					15																	49917567		2196	4295	6491	SO:0001583	missense	0			BC032535	CCDS10132.1	15q21.2	2005-08-09			ENSG00000104047	ENSG00000104047			30926	protein-coding gene	gene with protein product							Standard	NM_020234		Approved	MDS009, MGC111207	uc001zxs.3	Q8N5C7	OTTHUMG00000131567	ENST00000251250.6:c.203A>C	15.37:g.49917567A>C	ENSP00000251250:p.Tyr68Ser		Q567Q3|Q8WVG9|Q9NRU6	Missense_Mutation	SNP	pfam_DTW	p.Y68S	ENST00000251250.6	37	c.203	CCDS10132.1	15	.	.	.	.	.	.	.	.	.	.	A	19.73	3.881101	0.72294	.	.	ENSG00000104047	ENST00000403028;ENST00000329873;ENST00000251250	T;T;T	0.36520	1.41;1.25;1.41	5.09	5.09	0.68999	DTW (1);	0.052045	0.85682	D	0.000000	T	0.61912	0.2385	M	0.81497	2.545	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	T	0.65985	-0.6035	9	.	.	.	-9.4207	15.1692	0.72858	1.0:0.0:0.0:0.0	.	68	Q8N5C7	DTWD1_HUMAN	S	68	ENSP00000385399:Y68S;ENSP00000329313:Y68S;ENSP00000251250:Y68S	.	Y	+	2	0	DTWD1	47704859	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.292000	0.72725	2.029000	0.59856	0.482000	0.46254	TAC	DTWD1	-	pfam_DTW	ENSG00000104047		0.343	DTWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTWD1	HGNC	protein_coding	OTTHUMT00000254431.2	-	0.00	160	0	A	NM_020234		49917567	+1	tier1	-	no_errors	ENST00000251250	ensembl	human	known	74_37	missense	13.43	56	9	SNP	1.000	C
EDF1	8721	genome.wustl.edu	37	9	139757385	139757385	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:139757385C>T	ENST00000224073.1	-	4	385	c.358G>A	c.(358-360)Gtg>Atg	p.V120M	EDF1_ENST00000371648.4_Missense_Mutation_p.V120M|EDF1_ENST00000371649.1_Missense_Mutation_p.V120M	NM_003792.2	NP_003783.1	O60869	EDF1_HUMAN	endothelial differentiation-related factor 1	120	HTH cro/C1-type. {ECO:0000255|PROSITE- ProRule:PRU00257}.				endothelial cell differentiation (GO:0045446)|multicellular organismal development (GO:0007275)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			lung(1)	1	all_cancers(76;0.0841)|all_epithelial(76;0.217)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		TTGCCAAGCACCTGGTTATTG	0.557																																																	0													152.0	112.0	126.0					9																	139757385		2203	4300	6503	SO:0001583	missense	0			AJ005259	CCDS7011.1, CCDS7012.1, CCDS65193.1	9q34.3	2009-11-06			ENSG00000107223	ENSG00000107223			3164	protein-coding gene	gene with protein product	"""multiprotein bridging factor-1"""	605107				9813014, 15112053	Standard	NM_003792		Approved	EDF-1	uc004cjt.1	O60869	OTTHUMG00000020948	ENST00000224073.1:c.358G>A	9.37:g.139757385C>T	ENSP00000224073:p.Val120Met		Q5T5T2|Q9UIM1	Missense_Mutation	SNP	pfam_MBF1_N,pfam_Cro/C1-type_HTH,superfamily_Lambda_DNA-bd_dom,smart_Cro/C1-type_HTH,pfscan_Cro/C1-type_HTH	p.V120M	ENST00000224073.1	37	c.358	CCDS7011.1	9	.	.	.	.	.	.	.	.	.	.	C	22.0	4.224924	0.79576	.	.	ENSG00000107223	ENST00000371649;ENST00000224073;ENST00000371648	.	.	.	5.65	5.65	0.86999	Lambda repressor-like, DNA-binding (2);Helix-turn-helix type 3 (3);	0.062050	0.64402	D	0.000005	T	0.73822	0.3636	L	0.49350	1.555	0.80722	D	1	P;P	0.50528	0.862;0.936	P;P	0.59288	0.851;0.855	T	0.75139	-0.3423	9	0.87932	D	0	-6.8986	19.7074	0.96079	0.0:1.0:0.0:0.0	.	120;120	O60869-2;O60869	.;EDF1_HUMAN	M	120	.	ENSP00000224073:V120M	V	-	1	0	EDF1	138877206	1.000000	0.71417	1.000000	0.80357	0.552000	0.35366	3.529000	0.53532	2.667000	0.90743	0.655000	0.94253	GTG	EDF1	-	pfam_Cro/C1-type_HTH,superfamily_Lambda_DNA-bd_dom,smart_Cro/C1-type_HTH,pfscan_Cro/C1-type_HTH	ENSG00000107223		0.557	EDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDF1	HGNC	protein_coding	OTTHUMT00000055143.1	-	0.00	70	0	C			139757385	-1	tier1	-	no_errors	ENST00000224073	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	T
EFHB	151651	genome.wustl.edu	37	3	19975259	19975259	+	Missense_Mutation	SNP	C	C	A	rs374241010		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr3:19975259C>A	ENST00000295824.9	-	1	413	c.252G>T	c.(250-252)atG>atT	p.M84I	EFHB_ENST00000498089.1_5'UTR|EFHB_ENST00000344838.4_Intron	NM_144715.3	NP_653316.3	Q8N7U6	EFHB_HUMAN	EF-hand domain family, member B	84							calcium ion binding (GO:0005509)			breast(2)|endometrium(4)|kidney(1)|lung(17)|prostate(1)|urinary_tract(1)	26						TACCCCTCTGCATGACAGTCC	0.443																																																	0								C	ILE/MET	0,3916		0,0,1958	154.0	148.0	150.0		252	-0.7	0.0	3		150	1,8311		0,1,4155	no	missense	EFHB	NM_144715.3	10	0,1,6113	AA,AC,CC		0.012,0.0,0.0082	benign	84/834	19975259	1,12227	1958	4156	6114	SO:0001583	missense	0			AK122616	CCDS33715.2	3p24.3	2014-07-18			ENSG00000163576	ENSG00000163576		"""EF-hand domain containing"""	26330	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 21"""					12477932	Standard	NM_144715		Approved	FLJ25200, CFAP21	uc003cbl.4	Q8N7U6	OTTHUMG00000150505	ENST00000295824.9:c.252G>T	3.37:g.19975259C>A	ENSP00000295824:p.Met84Ile		A6ND25|A8MPR3|Q6ZWK9|Q8IV58|Q96LQ6	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,smart_EF_hand_dom,pfscan_EF_hand_dom	p.M84I	ENST00000295824.9	37	c.252	CCDS33715.2	3	.	.	.	.	.	.	.	.	.	.	C	4.839	0.155961	0.09236	0.0	1.2E-4	ENSG00000163576	ENST00000295824;ENST00000389256	T;T	0.23754	1.89;2.19	3.6	-0.723	0.11181	.	.	.	.	.	T	0.16085	0.0387	L	0.40543	1.245	0.09310	N	1	B	0.22604	0.072	B	0.12156	0.007	T	0.27872	-1.0061	8	.	.	.	0.0767	4.1208	0.10104	0.0:0.3828:0.389:0.2283	.	84	Q8N7U6	EFHB_HUMAN	I	84	ENSP00000295824:M84I;ENSP00000373908:M84I	.	M	-	3	0	EFHB	19950263	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.189000	0.09629	-0.151000	0.11176	0.555000	0.69702	ATG	EFHB	-	NULL	ENSG00000163576		0.443	EFHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHB	HGNC	protein_coding	OTTHUMT00000318673.2		0.00	82	0	C	NM_144715		19975259	-1			no_errors	ENST00000295824	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.000	A
EFR3A	23167	genome.wustl.edu	37	8	132958779	132958779	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:132958779C>T	ENST00000254624.5	+	4	490	c.265C>T	c.(265-267)Cat>Tat	p.H89Y	EFR3A_ENST00000519656.1_Missense_Mutation_p.H53Y|EFR3A_ENST00000334503.4_Missense_Mutation_p.H89Y	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	89						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			CATGGCTTGCCATTCTCAAAG	0.408																																																	0													88.0	76.0	80.0					8																	132958779		2202	4300	6502	SO:0001583	missense	0			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.265C>T	8.37:g.132958779C>T	ENSP00000254624:p.His89Tyr		A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.H89Y	ENST00000254624.5	37	c.265	CCDS34942.2	8	.	.	.	.	.	.	.	.	.	.	C	19.93	3.917739	0.73098	.	.	ENSG00000132294	ENST00000254624;ENST00000522709;ENST00000377917;ENST00000334503;ENST00000519656	T;T;T;T	0.19394	2.15;2.15;2.15;2.15	5.47	5.47	0.80525	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.46889	0.1416	M	0.79805	2.47	0.80722	D	1	P	0.45240	0.854	P	0.55923	0.787	T	0.47983	-0.9074	10	0.87932	D	0	-21.9556	18.3132	0.90208	0.0:1.0:0.0:0.0	.	89	Q14156	EFR3A_HUMAN	Y	89;53;89;89;53	ENSP00000254624:H89Y;ENSP00000430512:H53Y;ENSP00000334769:H89Y;ENSP00000428086:H53Y	ENSP00000254624:H89Y	H	+	1	0	EFR3A	133027961	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.743000	0.85020	2.572000	0.86782	0.655000	0.94253	CAT	EFR3A	-	superfamily_ARM-type_fold	ENSG00000132294		0.408	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	-	0.00	77	0	C	NM_015137		132958779	+1	tier1	-	no_errors	ENST00000254624	ensembl	human	known	74_37	missense	12.12	29	4	SNP	1.000	T
ELMO1	9844	genome.wustl.edu	37	7	37243802	37243802	+	Intron	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:37243802T>C	ENST00000310758.4	-	13	1734				ELMO1_ENST00000341056.3_Missense_Mutation_p.K35R|ELMO1_ENST00000442504.1_Intron|ELMO1_ENST00000448602.1_Intron	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1						actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						tggtgggttcttggtcttgct	0.498																																																	0																																										SO:0001627	intron_variant	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1086+7188A>G	7.37:g.37243802T>C			A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	pfam_Engulfment_cell_motility_ELMO	p.K35R	ENST00000310758.4	37	c.104	CCDS5449.1	7	.	.	.	.	.	.	.	.	.	.	T	0.060	-1.225822	0.01518	.	.	ENSG00000155849	ENST00000341056	T	0.34072	1.38	0.158	-0.317	0.12736	.	.	.	.	.	T	0.27241	0.0668	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.27226	-1.0080	5	0.49607	T	0.09	.	.	.	.	.	.	.	.	R	35	ENSP00000342142:K35R	ENSP00000342142:K35R	K	-	2	0	ELMO1	37210327	0.073000	0.21202	0.006000	0.13384	0.006000	0.05464	0.213000	0.17521	-1.226000	0.02574	-1.256000	0.01477	AAG	ELMO1	-	NULL	ENSG00000155849		0.498	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4	-	0.00	24	0	T	NM_130442		37243802	-1	tier1	-	no_errors	ENST00000341056	ensembl	human	known	74_37	missense	46.67	8	7	SNP	0.007	C
EMD	2010	genome.wustl.edu	37	X	153609157	153609157	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:153609157G>T	ENST00000369842.4	+	5	732	c.444G>T	c.(442-444)aaG>aaT	p.K148N	EMD_ENST00000369835.3_Missense_Mutation_p.K113N|EMD_ENST00000492448.1_3'UTR	NM_000117.2	NP_000108.1	P50402	EMD_HUMAN	emerin	148	Interaction with F-actin. {ECO:0000305}.				cellular response to growth factor stimulus (GO:0071363)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of fibroblast proliferation (GO:0048147)|positive regulation of protein export from nucleus (GO:0046827)|regulation of canonical Wnt signaling pathway (GO:0060828)|skeletal muscle cell differentiation (GO:0035914)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nuclear inner membrane (GO:0005637)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	actin binding (GO:0003779)|beta-tubulin binding (GO:0048487)			lung(5)	5	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGAGTGCAAGGATAGGTGCG	0.612																																																	0													87.0	83.0	84.0					X																	153609157		2203	4300	6503	SO:0001583	missense	0			X82434	CCDS14745.1	Xq27.3-q28	2014-09-17	2008-07-29		ENSG00000102119	ENSG00000102119			3331	protein-coding gene	gene with protein product	"""LEM domain containing 5"""	300384	"""Emery-Dreifuss muscular dystrophy"""				Standard	NM_000117		Approved	STA, LEMD5	uc004fkl.3	P50402	OTTHUMG00000033186	ENST00000369842.4:c.444G>T	X.37:g.153609157G>T	ENSP00000358857:p.Lys148Asn		Q6FI02	Missense_Mutation	SNP	pfam_LEM_dom,superfamily_LEM/LEM-like_dom,smart_LEM_dom,pfscan_LEM_dom	p.K148N	ENST00000369842.4	37	c.444	CCDS14745.1	X	.	.	.	.	.	.	.	.	.	.	G	5.697	0.313202	0.10789	.	.	ENSG00000102119	ENST00000369842;ENST00000369835	D;D	0.86694	-1.74;-2.16	4.53	-1.31	0.09230	.	0.438115	0.24937	N	0.034411	T	0.79488	0.4454	L	0.32530	0.975	0.09310	N	1	D	0.54964	0.969	P	0.46144	0.505	T	0.73139	-0.4077	10	0.41790	T	0.15	-32.2044	8.6233	0.33875	0.633:0.0:0.367:0.0	.	148	P50402	EMD_HUMAN	N	148;113	ENSP00000358857:K148N;ENSP00000358850:K113N	ENSP00000358850:K113N	K	+	3	2	EMD	153262351	0.990000	0.36364	0.014000	0.15608	0.028000	0.11728	0.067000	0.14510	-0.330000	0.08514	-0.397000	0.06425	AAG	EMD	-	NULL	ENSG00000102119		0.612	EMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMD	HGNC	protein_coding	OTTHUMT00000080921.1	-	0.00	35	0	G			153609157	+1	tier1	-	no_errors	ENST00000369842	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.001	T
LOC102723968	102723968	genome.wustl.edu	37	13	64414146	64414146	+	lincRNA	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr13:64414146G>A	ENST00000607822.1	-	0	1738				RP11-394A14.4_ENST00000606894.1_lincRNA																							gcggggaccgggaacctttgg	0.498																																																	0																																												0																															13.37:g.64414146G>A				RNA	SNP	-	NULL	ENST00000607822.1	37	NULL		13																																																																																			RP11-394A14.2	-	-	ENSG00000219926		0.498	RP11-394A14.2-002	KNOWN	basic	lincRNA	ENSG00000219926	Clone_based_vega_gene	lincRNA	OTTHUMT00000471084.1		0.00	14	0	G			64414146	-1			no_errors	ENST00000607822	ensembl	human	known	74_37	rna	33.33	6	3	SNP	0.000	A
AC079610.1	0	genome.wustl.edu	37	2	213628386	213628386	+	RNA	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:213628386T>C	ENST00000415387.1	-	0	381				AC093865.1_ENST00000408461.1_RNA																							tatatatatatatatatatat	0.164																																																	0																																												0																															2.37:g.213628386T>C				RNA	SNP	-	NULL	ENST00000415387.1	37	NULL		2																																																																																			AC093865.1	-	-	ENSG00000221388		0.164	AC079610.1-001	KNOWN	basic	sense_overlapping	ENSG00000221388	Clone_based_ensembl_gene	sense_overlapping	OTTHUMT00000337265.1	-	0.00	30	0	T			213628386	-1	tier1	-	no_errors	ENST00000408461	ensembl	human	novel	74_37	rna	40.00	6	4	SNP	0.004	C
LOC101927587	101927587	genome.wustl.edu	37	1	84259637	84259638	+	lincRNA	INS	-	-	AA	rs111685871|rs558985896		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:84259637_84259638insAA	ENST00000439186.1	+	0	163				RP11-475O6.1_ENST00000417975.1_lincRNA|AL035706.1_ENST00000411299.1_RNA																							gtaatggcaTTAAAAAAAAAAC	0.317																																																	0																																												0																															1.37:g.84259646_84259647dupAA				RNA	INS	-	NULL	ENST00000439186.1	37	NULL		1																																																																																			AL035706.1	-	-	ENSG00000223231		0.317	RP5-836J3.1-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000223231	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000027497.1		0.00	67	0	-			84259638	+1	tier1		no_errors	ENST00000411299	ensembl	human	novel	74_37	rna	14.29	30	5	INS	0.082:0.062	AA
PLSCR2	57047	genome.wustl.edu	37	3	146113558	146113558	+	RNA	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr3:146113558T>G	ENST00000490344.1	-	0	493																											ATGAGGAAAGTTGCTCCAAGC	0.323																																																	0																																												0																															3.37:g.146113558T>G				RNA	SNP	-	NULL	ENST00000490344.1	37	NULL		3																																																																																			RP11-758I14.3	-	-	ENSG00000241358		0.323	RP11-758I14.3-002	KNOWN	basic	processed_transcript	ENSG00000241358	Clone_based_vega_gene	pseudogene	OTTHUMT00000355269.1	-	0.00	123	0	T			146113558	-1	tier1	-	no_errors	ENST00000490344	ensembl	human	known	74_37	rna	21.57	40	11	SNP	0.801	G
TRPC6	7225	genome.wustl.edu	37	11	101465073	101465073	+	Intron	SNP	C	C	T	rs566900680		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:101465073C>T	ENST00000526713.1	-	2	265				RP11-748H22.1_ENST00000527374.1_RNA			Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6						aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		CATGAATTATCGGATCACAAA	0.547													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21887	0.0		0.0	False		,,,				2504	0.0				Colon(166;1315 1927 11094 12848 34731)												0																																										SO:0001627	intron_variant	0			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000526713.1:c.95-89544G>A	11.37:g.101465073C>T			Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	RNA	SNP	-	NULL	ENST00000526713.1	37	NULL		11																																																																																			RP11-748H22.1	-	-	ENSG00000254506		0.547	TRPC6-007	KNOWN	basic	processed_transcript	ENSG00000254506	Clone_based_vega_gene	protein_coding	OTTHUMT00000394832.1	-	0.00	54	0	C	NM_004621		101465073	+1	tier1	-	no_errors	ENST00000527374	ensembl	human	known	74_37	rna	30.77	18	8	SNP	0.874	T
PCED1B	91523	genome.wustl.edu	37	12	47529650	47529650	+	Intron	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:47529650G>A	ENST00000546455.1	+	2	206				RP11-23J18.1_ENST00000548463.1_RNA			Q96HM7	PED1B_HUMAN	PC-esterase domain containing 1B								hydrolase activity (GO:0016787)										GCCGGTGTTGGCAGGAGTGAA	0.547																																																	0																																										SO:0001627	intron_variant	0			BC016154	CCDS8752.1	12q13.11	2012-06-11	2012-06-11	2012-06-11	ENSG00000179715	ENSG00000179715			28255	protein-coding gene	gene with protein product			"""family with sequence similarity 113, member B"""	FAM113B		20056006	Standard	NM_138371		Approved	MGC16044	uc001rpq.3	Q96HM7	OTTHUMG00000169617	ENST00000546455.1:c.-526+31672G>A	12.37:g.47529650G>A			Q96B20	RNA	SNP	-	NULL	ENST00000546455.1	37	NULL	CCDS8752.1	12																																																																																			RP11-23J18.1	-	-	ENSG00000258352		0.547	PCED1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258352	Clone_based_vega_gene	protein_coding	OTTHUMT00000405079.1	-	0.00	18	0	G	NM_138371		47529650	-1	tier1	-	no_errors	ENST00000548463	ensembl	human	known	74_37	rna	30.00	7	3	SNP	0.015	A
BRD2	6046	genome.wustl.edu	37	6	32940349	32940349	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:32940349C>T	ENST00000374825.4	+	0	1375				BRD2-IT1_ENST00000415875.2_RNA|BRD2_ENST00000395289.2_5'UTR|BRD2_ENST00000374831.4_5'UTR|BRD2_ENST00000443797.2_5'UTR|BRD2_ENST00000449085.2_5'Flank|XXbac-BPG181M17.6_ENST00000580587.1_RNA|BRD2_ENST00000395287.1_5'Flank	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2						chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						CCCTGCAGACCAACAGCGGGC	0.592																																																	0																																										SO:0001623	5_prime_UTR_variant	0			X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.-327C>T	6.37:g.32940349C>T			A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	RNA	SNP	-	NULL	ENST00000374825.4	37	NULL	CCDS4762.1	6																																																																																			XXbac-BPG181M17.6	-	-	ENSG00000263756		0.592	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000263756	Clone_based_vega_gene	protein_coding	OTTHUMT00000076503.2	-	0.00	97	0	C			32940349	-1	tier1	-	no_errors	ENST00000580587	ensembl	human	known	74_37	rna	24.07	41	13	SNP	0.002	T
ENTHD1	150350	genome.wustl.edu	37	22	40231918	40231918	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr22:40231918A>T	ENST00000325157.6	-	4	888	c.638T>A	c.(637-639)gTt>gAt	p.V213D		NM_152512.3	NP_689725.2	Q8IYW4	ENTD1_HUMAN	ENTH domain containing 1	213								p.V213D(1)		breast(2)|endometrium(1)|kidney(6)|large_intestine(6)|lung(11)|ovary(3)|skin(3)	32	Melanoma(58;0.0749)					AGGCAAATGAACATCTTGGCA	0.373																																																	1	Substitution - Missense(1)	kidney(1)											292.0	268.0	276.0					22																	40231918		2203	4300	6503	SO:0001583	missense	0			AK093154	CCDS13998.1	22q13.1	2006-06-26			ENSG00000176177	ENSG00000176177			26352	protein-coding gene	gene with protein product						12477932	Standard	NM_152512		Approved	FLJ25421	uc003ayg.3	Q8IYW4	OTTHUMG00000151098	ENST00000325157.6:c.638T>A	22.37:g.40231918A>T	ENSP00000317431:p.Val213Asp		B0QYD5|Q5H9F7|Q96LK3	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_VHS,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.V213D	ENST00000325157.6	37	c.638	CCDS13998.1	22	.	.	.	.	.	.	.	.	.	.	A	5.543	0.285126	0.10513	.	.	ENSG00000176177	ENST00000325157	T	0.51325	0.71	5.65	-0.269	0.12930	.	2.100850	0.01697	N	0.026946	T	0.33440	0.0863	N	0.19112	0.55	0.09310	N	1	B	0.18166	0.026	B	0.20384	0.029	T	0.13899	-1.0492	10	0.37606	T	0.19	1.2567	5.3282	0.15918	0.5353:0.1449:0.3198:0.0	.	213	Q8IYW4	ENTD1_HUMAN	D	213	ENSP00000317431:V213D	ENSP00000317431:V213D	V	-	2	0	ENTHD1	38561864	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.238000	0.02919	-0.428000	0.07339	-0.491000	0.04670	GTT	ENTHD1	-	NULL	ENSG00000176177		0.373	ENTHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTHD1	HGNC	protein_coding	OTTHUMT00000321302.1		0.00	87	0	A	NM_152512		40231918	-1			no_errors	ENST00000325157	ensembl	human	known	74_37	missense	5.00	38	2	SNP	0.000	T
EPB41L4A	64097	genome.wustl.edu	37	5	111494139	111494139	+	5'UTR	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:111494139C>A	ENST00000507810.1	-	0	952				EPB41L4A-AS1_ENST00000413221.2_lincRNA			Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		tggtcacatacctaagggaac	0.378																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000507810.1:c.-1600G>T	5.37:g.111494139C>A			A4FUI6	RNA	SNP	-	NULL	ENST00000507810.1	37	NULL		5																																																																																			EPB41L4A	-	-	ENSG00000129595		0.378	EPB41L4A-007	KNOWN	basic	processed_transcript	EPB41L4A	HGNC	protein_coding	OTTHUMT00000370975.1	-	0.00	89	0	C			111494139	-1	tier1	-	no_errors	ENST00000507810	ensembl	human	known	74_37	rna	27.27	16	6	SNP	0.000	A
ZYX	7791	genome.wustl.edu	37	7	143087602	143087602	+	Intron	DEL	G	G	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:143087602delG	ENST00000322764.5	+	10	1959				EPHA1_ENST00000458129.1_5'UTR|ZYX_ENST00000449423.2_Intron|ZYX_ENST00000392910.2_Intron	NM_001010972.1|NM_003461.4	NP_001010972.1|NP_003452.1	Q15942	ZYX_HUMAN	zyxin						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|integrin-mediated signaling pathway (GO:0007229)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)	17	Melanoma(164;0.205)					GGAGCTGGATGGGGTGGGGTA	0.582																																																	0																																										SO:0001627	intron_variant	0			X95735	CCDS5883.1	7q32	2010-02-26			ENSG00000159840	ENSG00000159840			13200	protein-coding gene	gene with protein product		602002				8917469, 8940160	Standard	XM_005250052		Approved		uc003wcx.3	Q15942	OTTHUMG00000023822	ENST00000322764.5:c.1615-69G>-	7.37:g.143087602delG			A4D2G6|Q6I9S4	RNA	DEL	-	NULL	ENST00000322764.5	37	NULL	CCDS5883.1	7																																																																																			EPHA1	-	-	ENSG00000146904		0.582	ZYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA1	HGNC	protein_coding	OTTHUMT00000156296.2		0.00	49	0	G	NM_003461		143087602	-1	tier1		no_errors	ENST00000458129	ensembl	human	putative	74_37	rna	6.45	29	2	DEL	0.000	-
ERC2	26059	genome.wustl.edu	37	3	55543970	55543970	+	3'UTR	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr3:55543970A>C	ENST00000288221.6	-	0	4503				ERC2_ENST00000486496.1_5'UTR	NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2							cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TCCATTGACAAGAAAATGGAG	0.353																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.*1374T>G	3.37:g.55543970A>C			Q2T9F6|Q86TK4	RNA	SNP	-	NULL	ENST00000288221.6	37	NULL	CCDS46851.1	3																																																																																			ERC2	-	-	ENSG00000187672		0.353	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	-	0.00	60	0	A	NM_015576		55543970	-1	tier1	-	no_errors	ENST00000484530	ensembl	human	known	74_37	rna	43.75	9	7	SNP	1.000	C
ESX1	80712	genome.wustl.edu	37	X	103498837	103498837	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:103498837C>T	ENST00000372588.4	-	2	587	c.504G>A	c.(502-504)gcG>gcA	p.A168A		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	168					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						CCACTTACCGCGCCACAACGT	0.627																																					Pancreas(200;1705 2227 25194 28471 45274)												0													48.0	50.0	50.0					X																	103498837		2202	4298	6500	SO:0001819	synonymous_variant	0			AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.504G>A	X.37:g.103498837C>T			B0QYU3|Q7Z6K7	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_POU	p.A168	ENST00000372588.4	37	c.504	CCDS14516.1	X																																																																																			ESX1	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000123576		0.627	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESX1	HGNC	protein_coding	OTTHUMT00000057763.2	-	0.00	87	0	C	NM_153448		103498837	-1	tier1	-	no_errors	ENST00000372588	ensembl	human	known	74_37	silent	9.26	49	5	SNP	0.000	T
ETNK2	55224	genome.wustl.edu	37	1	204106375	204106375	+	Missense_Mutation	SNP	C	C	T	rs533254441	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:204106375C>T	ENST00000367202.4	-	6	1021	c.871G>A	c.(871-873)Gtg>Atg	p.V291M	ETNK2_ENST00000367197.1_De_novo_Start_InFrame|ETNK2_ENST00000367201.3_Missense_Mutation_p.V291M|ETNK2_ENST00000367198.2_Missense_Mutation_p.V113M|ETNK2_ENST00000477125.1_5'Flank|ETNK2_ENST00000367199.2_Missense_Mutation_p.V222M	NM_018208.2	NP_060678.2	Q9NVF9	EKI2_HUMAN	ethanolamine kinase 2	291					glycerophospholipid biosynthetic process (GO:0046474)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|placenta development (GO:0001890)|post-embryonic development (GO:0009791)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			breast(1)|central_nervous_system(1)|large_intestine(4)|ovary(1)	7	all_cancers(21;0.032)|Breast(84;0.116)|all_epithelial(62;0.196)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			ACCTCATTCACGCCTGAGGGG	0.607													C|||	2	0.000399361	0.0008	0.0	5008	,	,		18598	0.0		0.0	False		,,,				2504	0.001																0													41.0	39.0	40.0					1																	204106375		2203	4300	6503	SO:0001583	missense	0			AK001623	CCDS1442.2, CCDS73006.1	1q32.1	2008-02-05			ENSG00000143845	ENSG00000143845			25575	protein-coding gene	gene with protein product		609859				12477932	Standard	XM_005245302		Approved	FLJ10761, EKI2	uc001hao.4	Q9NVF9	OTTHUMG00000036061	ENST00000367202.4:c.871G>A	1.37:g.204106375C>T	ENSP00000356170:p.Val291Met		B7Z7K1|Q5SXX5|Q68CK3|Q96G05	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	p.V291M	ENST00000367202.4	37	c.871	CCDS1442.2	1	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352666	0.41700	.	.	ENSG00000143845	ENST00000367201;ENST00000367202;ENST00000367199;ENST00000455266;ENST00000367198;ENST00000422699;ENST00000452983;ENST00000444817	T;T;T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54;0.54;0.54	5.46	5.46	0.80206	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);	0.051867	0.85682	D	0.000000	T	0.51278	0.1665	L	0.45698	1.435	0.39177	D	0.962711	P;P;D	0.60575	0.794;0.828;0.988	B;B;P	0.48063	0.176;0.269;0.565	T	0.52403	-0.8580	10	0.34782	T	0.22	-4.5192	12.9904	0.58616	0.1612:0.8388:0.0:0.0	.	250;291;291	Q9NVF9-3;Q9NVF9;Q9NVF9-2	.;EKI2_HUMAN;.	M	291;291;222;157;113;157;148;137	ENSP00000356169:V291M;ENSP00000356170:V291M;ENSP00000356167:V222M;ENSP00000356166:V113M;ENSP00000405497:V157M;ENSP00000398091:V148M;ENSP00000406241:V137M	ENSP00000356166:V113M	V	-	1	0	ETNK2	202372998	1.000000	0.71417	1.000000	0.80357	0.744000	0.42396	3.870000	0.56070	2.557000	0.86248	0.467000	0.42956	GTG	ETNK2	-	superfamily_Kinase-like_dom	ENSG00000143845		0.607	ETNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETNK2	HGNC	protein_coding	OTTHUMT00000087893.1		0.00	36	0	C	NM_018208		204106375	-1			no_errors	ENST00000367201	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
FAM120C	54954	genome.wustl.edu	37	X	54117833	54117833	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:54117833C>T	ENST00000375180.2	-	11	2395	c.2339G>A	c.(2338-2340)cGa>cAa	p.R780Q	FAM120C_ENST00000328235.4_Missense_Mutation_p.R780Q	NM_017848.4	NP_060318.3	Q9NX05	F120C_HUMAN	family with sequence similarity 120C	780							poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						ATGCAGGATTCGGCCACCAGG	0.443																																																	0													106.0	81.0	89.0					X																	54117833		2203	4300	6503	SO:0001583	missense	0			AY150025	CCDS14356.1, CCDS55421.1, CCDS75987.1	Xp11.22	2011-04-13	2006-07-04	2006-07-04	ENSG00000184083	ENSG00000184083			16949	protein-coding gene	gene with protein product		300741	"""chromosome X open reading frame 17"""	CXorf17		14585507	Standard	XM_006724589		Approved	ORF34, FLJ20506	uc004dsz.4	Q9NX05	OTTHUMG00000021625	ENST00000375180.2:c.2339G>A	X.37:g.54117833C>T	ENSP00000364324:p.Arg780Gln		B2RMT7	Missense_Mutation	SNP	NULL	p.R780Q	ENST00000375180.2	37	c.2339	CCDS14356.1	X	.	.	.	.	.	.	.	.	.	.	C	32	5.113833	0.94339	.	.	ENSG00000184083	ENST00000375180;ENST00000328235	T;T	0.47869	0.83;0.83	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.48095	0.1481	L	0.44542	1.39	0.80722	D	1	D;D	0.60575	0.988;0.98	P;P	0.48304	0.573;0.573	T	0.44221	-0.9342	10	0.35671	T	0.21	-6.3599	16.259	0.82532	0.0:1.0:0.0:0.0	.	780;780	F8W881;Q9NX05	.;F120C_HUMAN	Q	780	ENSP00000364324:R780Q;ENSP00000329896:R780Q	ENSP00000329896:R780Q	R	-	2	0	FAM120C	54134558	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.578000	0.60929	2.171000	0.68590	0.600000	0.82982	CGA	FAM120C	-	NULL	ENSG00000184083		0.443	FAM120C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM120C	HGNC	protein_coding	OTTHUMT00000056795.2	-	0.00	42	0	C	NM_017848		54117833	-1	tier1	-	no_errors	ENST00000375180	ensembl	human	known	74_37	missense	17.65	14	3	SNP	1.000	T
FAM13A	10144	genome.wustl.edu	37	4	89708959	89708959	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:89708959T>A	ENST00000264344.5	-	10	1423	c.1216A>T	c.(1216-1218)Aga>Tga	p.R406*	FAM13A_ENST00000502459.1_5'UTR|FAM13A_ENST00000513837.1_Nonsense_Mutation_p.R52*|FAM13A_ENST00000395002.2_Nonsense_Mutation_p.R80*|FAM13A_ENST00000508369.1_Nonsense_Mutation_p.R80*|FAM13A_ENST00000503556.1_Nonsense_Mutation_p.R66*|FAM13A_ENST00000511976.1_Intron	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	406					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						CGGCGCTGTCTGGCAGATGTG	0.453																																																	0													87.0	90.0	89.0					4																	89708959		2203	4300	6503	SO:0001587	stop_gained	0			AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.1216A>T	4.37:g.89708959T>A	ENSP00000264344:p.Arg406*		B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R406*	ENST00000264344.5	37	c.1216	CCDS34029.1	4	.	.	.	.	.	.	.	.	.	.	T	35	5.414349	0.96092	.	.	ENSG00000138640	ENST00000395002;ENST00000264344;ENST00000503556;ENST00000508369;ENST00000513837	.	.	.	5.0	2.53	0.30540	.	0.450164	0.23541	N	0.047077	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3318	0.32191	0.1309:0.0:0.1373:0.7319	.	.	.	.	X	80;406;66;80;52	.	ENSP00000264344:R406X	R	-	1	2	FAM13A	89927982	1.000000	0.71417	0.040000	0.18447	0.034000	0.12701	1.722000	0.38042	0.458000	0.26988	0.533000	0.62120	AGA	FAM13A	-	NULL	ENSG00000138640		0.453	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13A	HGNC	protein_coding	OTTHUMT00000363371.1	-	0.00	44	0	T			89708959	-1	tier1	-	no_errors	ENST00000264344	ensembl	human	known	74_37	nonsense	14.29	24	4	SNP	0.994	A
FAM13C	220965	genome.wustl.edu	37	10	61122392	61122392	+	5'Flank	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:61122392G>C	ENST00000373868.2	-	0	0				FAM13C_ENST00000468840.2_5'UTR|FAM13C_ENST00000277705.6_5'Flank|FAM13C_ENST00000373867.3_5'Flank|FAM13C_ENST00000422313.2_5'Flank|FAM13C_ENST00000435852.2_5'Flank|FAM13C_ENST00000419214.2_5'Flank|FAM13C_ENST00000442566.3_5'Flank	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C											NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CCAGCGGCACGGGCGAACCAC	0.731																																																	0																																										SO:0001631	upstream_gene_variant	0			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277		10.37:g.61122392G>C	Exception_encountered		B7ZB77|Q5T631|Q6P2M3|Q99787	RNA	SNP	-	NULL	ENST00000373868.2	37	NULL	CCDS7255.1	10																																																																																			FAM13C	-	-	ENSG00000148541		0.731	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM13C	HGNC	protein_coding	OTTHUMT00000048162.2	-	0.00	27	0	G			61122392	-1	tier1	-	no_errors	ENST00000470220	ensembl	human	known	74_37	rna	38.89	11	7	SNP	0.148	C
FAM198B	51313	genome.wustl.edu	37	4	159091900	159091900	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:159091900C>T	ENST00000296530.8	-	2	1249	c.628G>A	c.(628-630)Gag>Aag	p.E210K	FAM198B_ENST00000585682.1_Missense_Mutation_p.E210K|FAM198B_ENST00000393807.5_Missense_Mutation_p.E210K|RP11-597D13.9_ENST00000509463.1_RNA|FAM198B_ENST00000592057.1_Missense_Mutation_p.E210K|RP11-597D13.9_ENST00000514381.1_RNA|FAM198B_ENST00000589306.1_Intron|RP11-597D13.9_ENST00000503611.1_RNA|RP11-597D13.9_ENST00000505532.1_RNA	NM_016613.6	NP_057697.2	Q6UWH4	F198B_HUMAN	family with sequence similarity 198, member B	210						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(14)|skin(2)|urinary_tract(1)	26						GGGGCGCTCTCGCTGTAGATC	0.652											OREG0016378	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													54.0	59.0	57.0					4																	159091900		2203	4300	6503	SO:0001583	missense	0				CCDS3798.1, CCDS34087.1	4q32.1	2012-11-29	2009-10-19	2009-10-19	ENSG00000164125	ENSG00000164125			25312	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 18"""	C4orf18		12975309	Standard	NM_001031700		Approved	FLJ38155, DKFZp434L142	uc003ipr.4	Q6UWH4	OTTHUMG00000161537	ENST00000296530.8:c.628G>A	4.37:g.159091900C>T	ENSP00000296530:p.Glu210Lys	1798	Q498Z3|Q6IAF9|Q6ZMF2|Q86XL0	Missense_Mutation	SNP	NULL	p.E210K	ENST00000296530.8	37	c.628	CCDS3798.1	4	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054540	0.75960	.	.	ENSG00000164125	ENST00000337222;ENST00000296530;ENST00000393807;ENST00000417442	T;T	0.31769	1.48;1.48	4.93	4.93	0.64822	.	0.314529	0.35349	N	0.003272	T	0.45418	0.1341	L	0.55834	1.745	0.36835	D	0.88708	D;D;D	0.89917	1.0;0.993;0.991	D;B;P	0.63488	0.915;0.399;0.526	T	0.46527	-0.9185	10	0.37606	T	0.19	-0.9667	11.77	0.51953	0.0:0.9197:0.0:0.0803	.	210;210;210	Q6UWH4-3;Q6UWH4-2;Q6UWH4	.;.;F198B_HUMAN	K	210	ENSP00000296530:E210K;ENSP00000377396:E210K	ENSP00000296530:E210K	E	-	1	0	FAM198B	159311350	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	1.942000	0.40243	2.550000	0.86006	0.563000	0.77884	GAG	FAM198B	-	NULL	ENSG00000164125		0.652	FAM198B-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM198B	HGNC	protein_coding	OTTHUMT00000365230.1	-	0.00	39	0	C	NM_001031700, NM_016613		159091900	-1	tier1	-	no_errors	ENST00000393807	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	T
FAM205A	259308	genome.wustl.edu	37	9	34725945	34725945	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:34725945T>C	ENST00000378788.3	-	4	1331	c.1292A>G	c.(1291-1293)cAg>cGg	p.Q431R		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	431						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						ACAGAATAGCTGGCTGTATTT	0.557																																																	0													11.0	13.0	12.0					9																	34725945		692	1590	2282	SO:0001583	missense	0				CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.1292A>G	9.37:g.34725945T>C	ENSP00000417711:p.Gln431Arg		A8MVW7	Missense_Mutation	SNP	NULL	p.Q431R	ENST00000378788.3	37	c.1292	CCDS55305.1	9	.	.	.	.	.	.	.	.	.	.	T	17.79	3.474963	0.63737	.	.	ENSG00000205108	ENST00000378788	T	0.14266	2.52	3.95	3.95	0.45737	.	.	.	.	.	T	0.37210	0.0995	M	0.84082	2.675	0.27039	N	0.964063	D	0.76494	0.999	D	0.70935	0.971	T	0.13818	-1.0495	9	0.87932	D	0	.	9.3607	0.38195	0.0:0.0:0.0:1.0	.	431	Q6ZU69	F205A_HUMAN	R	431	ENSP00000417711:Q431R	ENSP00000417711:Q431R	Q	-	2	0	RP11-195F19.10	34715945	0.355000	0.24921	0.983000	0.44433	0.917000	0.54804	2.091000	0.41691	1.768000	0.52137	0.459000	0.35465	CAG	FAM205A	-	NULL	ENSG00000205108		0.557	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM205A	HGNC	protein_coding	OTTHUMT00000001150.2	-	0.00	43	0	T	NM_001141917		34725945	-1	tier1	-	no_errors	ENST00000378788	ensembl	human	novel	74_37	missense	45.45	12	10	SNP	0.998	C
FAM20B	9917	genome.wustl.edu	37	1	179033624	179033624	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:179033624G>T	ENST00000263733.4	+	6	1267	c.931G>T	c.(931-933)Gcc>Tcc	p.A311S		NM_014864.3	NP_055679.1	O75063	XYLK_HUMAN	family with sequence similarity 20, member B	311						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)	14						TCTTGATAATGCCAAAAGGTG	0.463																																																	0													68.0	60.0	63.0					1																	179033624		2203	4300	6503	SO:0001583	missense	0			AB007944	CCDS1328.1	1q25.2	2013-04-29			ENSG00000116199	ENSG00000116199			23017	protein-coding gene	gene with protein product	"""glycosaminoglycan xylosylkinase"""	611063				9455484, 19473117	Standard	NM_014864		Approved	KIAA0475, GXK1	uc001gmc.3	O75063	OTTHUMG00000035073	ENST00000263733.4:c.931G>T	1.37:g.179033624G>T	ENSP00000263733:p.Ala311Ser		Q5W0C3|Q5W0C4	Missense_Mutation	SNP	pfam_DUF1193	p.A311S	ENST00000263733.4	37	c.931	CCDS1328.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.179033	0.94846	.	.	ENSG00000116199	ENST00000263733	T	0.80480	-1.38	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.89705	0.6792	M	0.76574	2.34	0.80722	D	1	D	0.65815	0.995	D	0.69307	0.963	D	0.90058	0.4154	10	0.72032	D	0.01	-22.2064	19.773	0.96379	0.0:0.0:1.0:0.0	.	311	O75063	XYLK_HUMAN	S	311	ENSP00000263733:A311S	ENSP00000263733:A311S	A	+	1	0	FAM20B	177300247	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.476000	0.97823	2.677000	0.91161	0.655000	0.94253	GCC	FAM20B	-	pfam_DUF1193	ENSG00000116199		0.463	FAM20B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM20B	HGNC	protein_coding	OTTHUMT00000084922.1	-	0.00	45	0	G	NM_014864		179033624	+1	tier1	-	no_errors	ENST00000263733	ensembl	human	known	74_37	missense	13.33	26	4	SNP	1.000	T
FAM230B	642633	genome.wustl.edu	37	22	21540899	21540899	+	RNA	DEL	T	T	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr22:21540899delT	ENST00000451257.1	+	0	2976									family with sequence similarity 230, member B (non-protein coding)																		CTTTTCCGGGTTTATTGGCAT	0.458																																																	0																																												0			BC039313, AK128837		22q11.21	2014-01-24	2014-01-06		ENSG00000215498	ENSG00000215498			32943	non-coding RNA	RNA, long non-coding			"""family with sequence similarity 230, member B"""				Standard	NR_108107		Approved	FLJ46366			OTTHUMG00000150782		22.37:g.21540899delT				RNA	DEL	-	NULL	ENST00000451257.1	37	NULL		22																																																																																			FAM230B	-	-	ENSG00000215498		0.458	FAM230B-002	KNOWN	basic	lincRNA	FAM230B	HGNC	processed_transcript	OTTHUMT00000320063.1		0.00	20	0	T	NR_108107		21540899	+1	tier1		no_errors	ENST00000415376	ensembl	human	known	74_37	rna	40.00	3	2	DEL	0.003	-
FBXW9	84261	genome.wustl.edu	37	19	12800370	12800370	+	Silent	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:12800370A>G	ENST00000380339.3	-	8	1347	c.1311T>C	c.(1309-1311)acT>acC	p.T437T	CTD-2659N19.2_ENST00000585742.1_RNA|FBXW9_ENST00000544494.1_Silent_p.T145T|CTD-2192J16.26_ENST00000593554.1_lincRNA|FBXW9_ENST00000393261.3_Silent_p.T407T|FBXW9_ENST00000587955.1_Silent_p.T427T			Q5XUX1	FBXW9_HUMAN	F-box and WD repeat domain containing 9	437					SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)					cervix(1)|lung(4)|ovary(1)|prostate(1)	7						TGGTCTTGTCAGTGGATGTGG	0.612																																																	0													101.0	93.0	96.0					19																	12800370		2203	4300	6503	SO:0001819	synonymous_variant	0			BC004290	CCDS12278.2	19p13.2	2013-01-09	2007-02-08		ENSG00000132004	ENSG00000132004		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	28136	protein-coding gene	gene with protein product		609074	"""F-box and WD-40 domain protein 9"""			12477932	Standard	NM_032301		Approved	MGC10870, Fbw9	uc002mum.1	Q5XUX1	OTTHUMG00000150152	ENST00000380339.3:c.1311T>C	19.37:g.12800370A>G			B3KVP7|Q9BT89	Silent	SNP	pfam_WD40_repeat,pfam_F-box_dom,superfamily_WD40_repeat_dom,superfamily_F-box_dom,smart_F-box_dom,smart_WD40_repeat,pfscan_F-box_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.T437	ENST00000380339.3	37	c.1311		19																																																																																			FBXW9	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000132004		0.612	FBXW9-201	KNOWN	basic	protein_coding	FBXW9	HGNC	protein_coding		-	0.00	76	0	A	NM_032301		12800370	-1	tier1	-	no_errors	ENST00000380339	ensembl	human	known	74_37	silent	10.00	36	4	SNP	0.762	G
FDXR	2232	genome.wustl.edu	37	17	72868242	72868242	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:72868242G>T	ENST00000293195.5	-	2	174	c.96C>A	c.(94-96)ttC>ttA	p.F32L	FDXR_ENST00000420580.2_Missense_Mutation_p.F32L|FDXR_ENST00000413947.2_Intron|FDXR_ENST00000581530.1_Missense_Mutation_p.F32L|FDXR_ENST00000582944.1_Missense_Mutation_p.F32L|FDXR_ENST00000583917.1_Missense_Mutation_p.F32L|FDXR_ENST00000442102.2_Missense_Mutation_p.F32L|FDXR_ENST00000455107.2_5'UTR	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase	32					cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	CCTGTGTGGAGAAATGGTGGC	0.537																																																	0													42.0	43.0	43.0					17																	72868242		2203	4300	6503	SO:0001583	missense	0			J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.96C>A	17.37:g.72868242G>T	ENSP00000293195:p.Phe32Leu		B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	p.F32L	ENST00000293195.5	37	c.96	CCDS58593.1	17	.	.	.	.	.	.	.	.	.	.	G	2.119	-0.401861	0.04865	.	.	ENSG00000161513	ENST00000420580;ENST00000293195;ENST00000442102	T;T;D	0.81579	3.26;-0.11;-1.51	4.4	3.43	0.39272	.	0.692334	0.14362	N	0.324369	T	0.57489	0.2057	N	0.08118	0	0.80722	D	1	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.06405	0.0;0.002;0.001;0.0;0.0;0.0;0.002	T	0.38222	-0.9671	10	0.08179	T	0.78	-7.8185	7.0406	0.25019	0.0786:0.1335:0.6638:0.1241	.	32;32;29;32;32;32;32	B4DQQ4;B4DHX5;B4DDI9;Q6GSK2;B4DX24;P22570;P22570-2	.;.;.;.;.;ADRO_HUMAN;.	L	32	ENSP00000414172:F32L;ENSP00000293195:F32L;ENSP00000416515:F32L	ENSP00000293195:F32L	F	-	3	2	FDXR	70379837	1.000000	0.71417	0.946000	0.38457	0.025000	0.11179	1.778000	0.38614	0.295000	0.22570	-2.281000	0.00270	TTC	FDXR	-	NULL	ENSG00000161513		0.537	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FDXR	HGNC	protein_coding	OTTHUMT00000444449.1	-	0.00	33	0	G	NM_004110		72868242	-1	tier1	-	no_errors	ENST00000581530	ensembl	human	known	74_37	missense	64.29	5	9	SNP	0.957	T
FGF13	2258	genome.wustl.edu	37	X	137939763	137939763	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:137939763T>G	ENST00000441825.2	-	1	78	c.41A>C	c.(40-42)aAa>aCa	p.K14T	FGF13_ENST00000370603.3_Missense_Mutation_p.K43T|FGF13_ENST00000541469.1_Intron	NM_001139501.1|NM_001139502.1	NP_001132973.1|NP_001132974.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	0	Mediates targeting to the nucleus. {ECO:0000250}.				cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					GGACTCTTTTTTCTTTAATTC	0.478																																																	0													210.0	176.0	186.0					X																	137939763		1568	3582	5150	SO:0001583	missense	0			BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000441825.2:c.41A>C	X.37:g.137939763T>G	ENSP00000409276:p.Lys14Thr		B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Missense_Mutation	SNP	pfam_Fibroblast_GF_fam,superfamily_Cytokine_IL1-like,smart_Fibroblast_GF_fam,prints_IL-1_fam/FGF_fam,prints_Fibroblast_GF_fam	p.K43T	ENST00000441825.2	37	c.128	CCDS55511.1	X	.	.	.	.	.	.	.	.	.	.	T	15.59	2.879559	0.51801	.	.	ENSG00000129682	ENST00000441825;ENST00000370603;ENST00000436198;ENST00000455663;ENST00000448673;ENST00000421460	T;T;T;D	0.82433	-1.44;-1.39;-1.38;-1.61	6.07	6.07	0.98685	.	1.294320	0.04697	N	0.415125	T	0.73713	0.3622	N	0.08118	0	0.26174	N	0.979828	B	0.17038	0.02	B	0.15052	0.012	T	0.58487	-0.7628	10	0.33141	T	0.24	.	14.5728	0.68224	0.0:0.0:0.0:1.0	.	43	B7Z4M7	.	T	14;43;43;49;43;14	ENSP00000409276:K14T;ENSP00000359635:K43T;ENSP00000396198:K43T;ENSP00000406916:K49T	ENSP00000359635:K43T	K	-	2	0	FGF13	137767429	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.455000	0.66658	2.041000	0.60428	0.481000	0.45027	AAA	FGF13	-	NULL	ENSG00000129682		0.478	FGF13-202	KNOWN	basic|CCDS	protein_coding	FGF13	HGNC	protein_coding		-	0.00	18	0	T	NM_004114		137939763	-1	tier1	-	no_errors	ENST00000370603	ensembl	human	known	74_37	missense	66.67	4	8	SNP	1.000	G
FLG	2312	genome.wustl.edu	37	1	152284192	152284192	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:152284192G>T	ENST00000368799.1	-	3	3205	c.3170C>A	c.(3169-3171)gCa>gAa	p.A1057E	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1057	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCTCTGACTGCAGATGAAGC	0.562									Ichthyosis																																								0													410.0	406.0	408.0					1																	152284192		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3170C>A	1.37:g.152284192G>T	ENSP00000357789:p.Ala1057Glu		Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom,prints_Filaggrin	p.A1057E	ENST00000368799.1	37	c.3170	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	8.695	0.908302	0.17833	.	.	ENSG00000143631	ENST00000368799;ENST00000392689	T	0.04809	3.55	3.74	-3.3	0.05003	.	.	.	.	.	T	0.01029	0.0034	L	0.56769	1.78	0.09310	N	1	B	0.29909	0.261	B	0.23716	0.048	T	0.48210	-0.9055	9	0.02654	T	1	.	7.0409	0.25019	0.0:0.1652:0.2744:0.5604	.	1057	P20930	FILA_HUMAN	E	1057;264	ENSP00000357789:A1057E	ENSP00000357789:A1057E	A	-	2	0	FLG	150550816	0.000000	0.05858	0.000000	0.03702	0.055000	0.15305	-2.142000	0.01298	-0.411000	0.07530	0.299000	0.19835	GCA	FLG	-	pfam_Filaggrin,prints_Filaggrin	ENSG00000143631		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	-	0.00	288	0	G	NM_002016		152284192	-1	tier1	-	no_errors	ENST00000368799	ensembl	human	known	74_37	missense	6.02	156	10	SNP	0.000	T
FMO1	2326	genome.wustl.edu	37	1	171254716	171254716	+	3'UTR	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:171254716G>A	ENST00000354841.4	+	0	1763				FMO1_ENST00000367750.3_3'UTR|FMO1_ENST00000402921.2_3'UTR|FMO1_ENST00000469112.1_3'UTR	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1						NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GATGCACAGAGTAGATTTACA	0.373																																																	0													24.0	26.0	25.0					1																	171254716		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.*33G>A	1.37:g.171254716G>A			A8K248|B7Z3P4|Q5QPT2|Q9UJC2	RNA	SNP	-	NULL	ENST00000354841.4	37	NULL	CCDS1294.1	1																																																																																			FMO1	-	-	ENSG00000010932		0.373	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1	-	0.00	45	0	G	NM_002021		171254716	+1	tier1	-	no_errors	ENST00000469112	ensembl	human	known	74_37	rna	26.67	21	8	SNP	0.006	A
FOXN1	8456	genome.wustl.edu	37	17	26851857	26851857	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:26851857C>T	ENST00000226247.2	+	2	489	c.460C>T	c.(460-462)Ccg>Tcg	p.P154S	FOXN1_ENST00000579795.1_Missense_Mutation_p.P154S	NM_003593.2	NP_003584.2	O15353	FOXN1_HUMAN	forkhead box N1	154					defense response (GO:0006952)|epidermis development (GO:0008544)|epithelial cell proliferation (GO:0050673)|hair follicle development (GO:0001942)|keratinocyte differentiation (GO:0030216)|lymphocyte homeostasis (GO:0002260)|nail development (GO:0035878)|organ morphogenesis (GO:0009887)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Lung NSC(42;0.00431)					GACCCCAGGGCCGCTGGAGGC	0.657																																																	0													34.0	38.0	37.0					17																	26851857		2203	4300	6503	SO:0001583	missense	0			Y11739	CCDS11232.1	17q11-q12	2014-09-17	2003-06-12	2003-06-13	ENSG00000109101	ENSG00000109101		"""Forkhead boxes"""	12765	protein-coding gene	gene with protein product		600838	"""winged-helix nude"", ""Rowett nude"""	WHN, RONU		9321431	Standard	NM_003593		Approved	FKHL20	uc002hbj.3	O15353	OTTHUMG00000132603	ENST00000226247.2:c.460C>T	17.37:g.26851857C>T	ENSP00000226247:p.Pro154Ser		B2R9Q7|O15352	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P154S	ENST00000226247.2	37	c.460	CCDS11232.1	17	.	.	.	.	.	.	.	.	.	.	C	2.987	-0.208945	0.06140	.	.	ENSG00000109101	ENST00000226247	D	0.91351	-2.83	5.58	-5.01	0.02991	.	1.431730	0.04052	N	0.304965	T	0.71762	0.3378	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.63739	-0.6569	10	0.15952	T	0.53	.	0.9095	0.01291	0.2043:0.3088:0.2078:0.2791	.	154	O15353	FOXN1_HUMAN	S	154	ENSP00000226247:P154S	ENSP00000226247:P154S	P	+	1	0	FOXN1	23875984	0.000000	0.05858	0.000000	0.03702	0.344000	0.29017	-0.814000	0.04486	-0.636000	0.05524	-0.321000	0.08615	CCG	FOXN1	-	NULL	ENSG00000109101		0.657	FOXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN1	HGNC	protein_coding	OTTHUMT00000255832.1		0.00	88	0	C			26851857	+1			no_errors	ENST00000226247	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.000	T
FOXP2	93986	genome.wustl.edu	37	7	114271582	114271582	+	Splice_Site	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:114271582G>C	ENST00000393494.2	+	6	876		c.e6-1		FOXP2_ENST00000390668.3_Splice_Site|FOXP2_ENST00000360232.4_Splice_Site|FOXP2_ENST00000393491.3_Splice_Site|FOXP2_ENST00000393489.3_Splice_Site|FOXP2_ENST00000393500.3_Splice_Site|FOXP2_ENST00000393498.2_Intron|FOXP2_ENST00000350908.4_Splice_Site|FOXP2_ENST00000378237.3_Splice_Site|AC020606.1_ENST00000580664.1_RNA|FOXP2_ENST00000403559.4_Splice_Site|FOXP2_ENST00000408937.3_Splice_Site			O15409	FOXP2_HUMAN	forkhead box P2						camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(3)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						TCTGATACcagcagcagcagc	0.517																																																	3	Unknown(3)	endometrium(3)																																								SO:0001630	splice_region_variant	0			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.598-1G>C	7.37:g.114271582G>C			A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Splice_Site	SNP	-	e6-1	ENST00000393494.2	37	c.673-1	CCDS5760.1	7																																																																																			FOXP2	-	-	ENSG00000128573		0.517	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	FOXP2	HGNC	protein_coding	OTTHUMT00000317366.1		0.00	46	0	G	NM_014491	Intron	114271582	+1			no_errors	ENST00000408937	ensembl	human	known	74_37	splice_site	7.41	25	2	SNP	0.135	C
FPGS	2356	genome.wustl.edu	37	9	130566932	130566932	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:130566932C>T	ENST00000373247.2	+	4	389	c.339C>T	c.(337-339)ttC>ttT	p.F113F	FPGS_ENST00000393706.2_Silent_p.F113F|FPGS_ENST00000373245.1_Silent_p.F113F|FPGS_ENST00000373225.3_Silent_p.F63F|FPGS_ENST00000460181.1_3'UTR	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	113					brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	CCTGTGCCTTCACGGAATGTA	0.577																																																	0													96.0	97.0	97.0					9																	130566932		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.339C>T	9.37:g.130566932C>T			B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Silent	SNP	superfamily_Mur_ligase_cen,superfamily_Mur_ligase_C,tigrfam_Folylpolyglutamate_synth	p.F113	ENST00000373247.2	37	c.339	CCDS35148.1	9																																																																																			FPGS	-	superfamily_Mur_ligase_cen,tigrfam_Folylpolyglutamate_synth	ENSG00000136877		0.577	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	FPGS	HGNC	protein_coding	OTTHUMT00000054251.1		0.00	93	0	C			130566932	+1			no_errors	ENST00000373247	ensembl	human	known	74_37	silent	10.64	42	5	SNP	1.000	T
FREM2	341640	genome.wustl.edu	37	13	39263254	39263254	+	Silent	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr13:39263254A>G	ENST00000280481.7	+	1	1989	c.1773A>G	c.(1771-1773)tcA>tcG	p.S591S		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	591					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		ACATGGATTCAGATGATTCTC	0.542																																																	0													142.0	142.0	142.0					13																	39263254		2203	4300	6503	SO:0001819	synonymous_variant	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.1773A>G	13.37:g.39263254A>G			Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.S591	ENST00000280481.7	37	c.1773	CCDS31960.1	13																																																																																			FREM2	-	NULL	ENSG00000150893		0.542	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	-	0.00	41	0	A	NM_207361		39263254	+1	tier1	-	no_errors	ENST00000280481	ensembl	human	known	74_37	silent	12.00	22	3	SNP	0.290	G
FXYD2	486	genome.wustl.edu	37	11	117688619	117688619	+	IGR	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:117688619T>C	ENST00000292079.2	-	0	571				FXYD2_ENST00000532119.1_Intron|RP11-728F11.3_ENST00000596805.1_RNA|FXYD2_ENST00000514385.1_5'UTR|RP11-728F11.3_ENST00000531850.2_RNA	NM_001680.4	NP_001671.2	P54710	ATNG_HUMAN	FXYD domain containing ion transport regulator 2						ion transmembrane transport (GO:0034220)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ion channel activity (GO:0005216)|sodium:potassium-exchanging ATPase activity (GO:0005391)|transporter activity (GO:0005215)			breast(1)|kidney(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|Breast(348;0.111)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;2.83e-05)|Epithelial(105;0.00114)	Cyclothiazide(DB00606)	AGCCACGTGCTCCCTCTGGTG	0.537											OREG0021375	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001628	intergenic_variant	0			AF241236	CCDS8385.1, CCDS8386.1	11q23	2008-02-05	2003-02-28						4026	protein-coding gene	gene with protein product		601814	"""hypomagnesemia 2, renal"""	ATP1G1, HOMG2		9048881, 9915957	Standard	NM_021603		Approved	MGC12372		P54710			11.37:g.117688619T>C		1482	Q15332|Q53YC1|Q9GZP3|Q9GZQ7	RNA	SNP	-	NULL	ENST00000292079.2	37	NULL	CCDS8386.1	11																																																																																			FXYD2	-	-	ENSG00000137731		0.537	FXYD2-002	KNOWN	basic|CCDS	protein_coding	FXYD2	HGNC	protein_coding	OTTHUMT00000390050.1	-	0.00	12	0	T	NM_021603		117688619	-1	tier1	-	no_errors	ENST00000514385	ensembl	human	known	74_37	rna	50.00	5	5	SNP	0.964	C
GALNT8	26290	genome.wustl.edu	37	12	4870249	4870249	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:4870249C>T	ENST00000252318.2	+	7	1636	c.1299C>T	c.(1297-1299)gcC>gcT	p.A433A		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	433					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						TGCGAGTGGCCGAAATCTGGA	0.527																																					Colon(108;631 1558 7270 20097 39846)												0													156.0	126.0	136.0					12																	4870249		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.1299C>T	12.37:g.4870249C>T			B2RU02	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.A433	ENST00000252318.2	37	c.1299	CCDS8533.1	12																																																																																			GALNT8	-	NULL	ENSG00000130035		0.527	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GALNT8	HGNC	protein_coding	OTTHUMT00000388277.2		0.00	32	0	C	NM_017417		4870249	+1			no_errors	ENST00000252318	ensembl	human	known	74_37	silent	21.43	11	3	SNP	0.891	T
GAPVD1	26130	genome.wustl.edu	37	9	128094797	128094797	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:128094797G>C	ENST00000495955.1	+	15	2607	c.2317G>C	c.(2317-2319)Gca>Cca	p.A773P	GAPVD1_ENST00000297933.6_Missense_Mutation_p.A773P|GAPVD1_ENST00000312123.9_Missense_Mutation_p.A752P|GAPVD1_ENST00000265956.4_Missense_Mutation_p.A773P|GAPVD1_ENST00000394105.2_Missense_Mutation_p.A773P|GAPVD1_ENST00000394104.2_Missense_Mutation_p.A773P|GAPVD1_ENST00000394083.2_Missense_Mutation_p.A752P|GAPVD1_ENST00000470056.1_Missense_Mutation_p.A773P			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	773					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)	p.A773S(1)		central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						AGGCATAAGTGCAACCTCTGA	0.358																																																	1	Substitution - Missense(1)	skin(1)											80.0	85.0	83.0					9																	128094797		2203	4300	6503	SO:0001583	missense	0				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.2317G>C	9.37:g.128094797G>C	ENSP00000419063:p.Ala773Pro		A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	pfam_RasGAP,pfam_VPS9,superfamily_Rho_GTPase_activation_prot,smart_VPS9_subgr,pfscan_VPS9,pfscan_RasGAP	p.A773P	ENST00000495955.1	37	c.2317		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.520011|4.520011	0.85495|0.85495	.|.	.|.	ENSG00000165219|ENSG00000165219	ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123|ENST00000436712	T;T;T;T;T;T;T;T;T|.	0.15834|.	2.39;2.39;2.39;2.39;2.39;2.39;2.39;2.39;2.39|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51398|0.51398	0.1672|0.1672	N|N	0.14661|0.14661	0.345|0.345	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	0.999;0.998;0.999;0.999;0.999;1.0|.	D;D;D;D;D;D|.	0.83275|.	0.994;0.987;0.991;0.991;0.991;0.996|.	T|T	0.45175|0.45175	-0.9279|-0.9279	10|5	0.31617|.	T|.	0.26|.	.|.	18.8022|18.8022	0.92022|0.92022	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	773;773;773;752;773;773|.	Q14C86-5;Q14C86;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6|.	.;GAPD1_HUMAN;.;.;.;.|.	P|S	773;773;773;773;752;773;773;773;752|609	ENSP00000419767:A773P;ENSP00000377665:A773P;ENSP00000377664:A773P;ENSP00000265956:A773P;ENSP00000377645:A752P;ENSP00000419063:A773P;ENSP00000418747:A773P;ENSP00000297933:A773P;ENSP00000309582:A752P|.	ENSP00000265956:A773P|.	A|C	+|+	1|2	0|0	GAPVD1|GAPVD1	127134618|127134618	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	9.869000|9.869000	0.99810|0.99810	2.697000|2.697000	0.92050|0.92050	0.555000|0.555000	0.69702|0.69702	GCA|TGC	GAPVD1	-	NULL	ENSG00000165219		0.358	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	GAPVD1	HGNC	protein_coding	OTTHUMT00000355644.1		0.00	47	0	G			128094797	+1			no_errors	ENST00000394105	ensembl	human	known	74_37	missense	15.38	11	2	SNP	1.000	C
GDE1	51573	genome.wustl.edu	37	16	19522217	19522217	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr16:19522217C>A	ENST00000353258.3	-	3	667	c.487G>T	c.(487-489)Gag>Tag	p.E163*		NM_016641.3	NP_057725.1	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	163	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol glycerophosphodiesterase activity (GO:0047395)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	13						TTTAGGCACTCTGCAACAGCT	0.378																																																	0													200.0	190.0	193.0					16																	19522217		2197	4300	6497	SO:0001587	stop_gained	0				CCDS10578.1	16p12-p11.2	2011-01-25			ENSG00000006007	ENSG00000006007	3.1.4.46		29644	protein-coding gene	gene with protein product	"""membrane interacting protein of RGS16"""	605943				12576545, 16472945	Standard	NM_016641		Approved	MIR16	uc002dgh.3	Q9NZC3	OTTHUMG00000131454	ENST00000353258.3:c.487G>T	16.37:g.19522217C>A	ENSP00000261386:p.Glu163*		O43334|Q6PKF7|Q7KYR4	Nonsense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.E163*	ENST00000353258.3	37	c.487	CCDS10578.1	16	.	.	.	.	.	.	.	.	.	.	C	39	7.800954	0.98498	.	.	ENSG00000006007	ENST00000353258	.	.	.	5.99	5.99	0.97316	.	0.045455	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-21.9757	20.4574	0.99148	0.0:1.0:0.0:0.0	.	.	.	.	X	163	.	ENSP00000261386:E163X	E	-	1	0	GDE1	19429718	1.000000	0.71417	0.984000	0.44739	0.824000	0.46624	6.958000	0.76025	2.843000	0.97960	0.591000	0.81541	GAG	GDE1	-	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000006007		0.378	GDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDE1	HGNC	protein_coding	OTTHUMT00000254274.2		0.00	67	0	C	NM_016641		19522217	-1			no_errors	ENST00000353258	ensembl	human	known	74_37	nonsense	6.25	30	2	SNP	1.000	A
GH2	2689	genome.wustl.edu	37	17	61958242	61958242	+	Missense_Mutation	SNP	C	C	T	rs61764019		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:61958242C>T	ENST00000423893.2	-	4	407	c.346G>A	c.(346-348)Gtg>Atg	p.V116M	GH2_ENST00000456543.2_Missense_Mutation_p.V116M|GH2_ENST00000449787.2_Missense_Mutation_p.V101M|GH2_ENST00000332800.7_Missense_Mutation_p.V116M			P01242	SOM2_HUMAN	growth hormone 2	116					JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						AGGAGCTGCACGGGCTCCAGC	0.627																																																	0													49.0	52.0	51.0					17																	61958242		2203	4300	6503	SO:0001583	missense	0			J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.346G>A	17.37:g.61958242C>T	ENSP00000409294:p.Val116Met		B1A4H5|B1A4H7|O14643|O14644|P09587	Missense_Mutation	SNP	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	p.V116M	ENST00000423893.2	37	c.346	CCDS11647.1	17	.	.	.	.	.	.	.	.	.	.	c	9.168	1.020495	0.19433	.	.	ENSG00000136487	ENST00000332800;ENST00000456543;ENST00000423893;ENST00000449787	D;D;D;D	0.89552	-2.53;-2.53;-2.53;-2.53	3.1	-0.298	0.12814	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.616553	0.16270	N	0.221804	D	0.91153	0.7214	M	0.68317	2.08	0.36384	D	0.862099	D;D;D;D;D	0.89917	0.988;1.0;0.995;1.0;0.988	P;D;P;D;P	0.97110	0.806;0.998;0.885;1.0;0.806	D	0.88279	0.2935	10	0.62326	D	0.03	.	4.7442	0.13029	0.0:0.5954:0.1789:0.2257	.	116;101;116;116;116	P01242;O14643;O14644;B1A4H7;B1A4H5	SOM2_HUMAN;.;.;.;.	M	116;116;116;101	ENSP00000333157:V116M;ENSP00000394122:V116M;ENSP00000409294:V116M;ENSP00000410618:V101M	ENSP00000333157:V116M	V	-	1	0	GH2	59311974	0.180000	0.23148	0.688000	0.30117	0.004000	0.04260	0.384000	0.20668	-0.123000	0.11745	-0.443000	0.05667	GTG	GH2	-	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	ENSG00000136487		0.627	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GH2	HGNC	protein_coding	OTTHUMT00000417665.1		0.00	93	0	C	NM_002059		61958242	-1			no_errors	ENST00000332800	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.885	T
GNAS	2778	genome.wustl.edu	37	20	57430664	57430664	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr20:57430664G>A	ENST00000371099.2	+	2	2127	c.2124G>A	c.(2122-2124)gcG>gcA	p.A708A	GNAS_ENST00000371102.4_Intron|GNAS_ENST00000371100.4_Intron|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000464624.2_Intron|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371075.3_Intron			P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			ACAGGCCAGCGCCAGCAACCG	0.672			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0																																										SO:0001819	synonymous_variant	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371099.2:c.2124G>A	20.37:g.57430664G>A			A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Silent	SNP	NULL	p.A708	ENST00000371099.2	37	c.2124		20																																																																																			GNAS	-	NULL	ENSG00000087460		0.672	GNAS-058	PUTATIVE	basic	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000267995.2	-	0.00	83	0	G	NM_000516		57430664	+1	tier1	-	no_errors	ENST00000371099	ensembl	human	putative	74_37	silent	26.42	39	14	SNP	1.000	A
GPR83	10888	genome.wustl.edu	37	11	94113381	94113381	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:94113381G>A	ENST00000243673.2	-	4	1377	c.1206C>T	c.(1204-1206)ccC>ccT	p.P402P	GPR83_ENST00000539203.2_Silent_p.P360P	NM_016540.3	NP_057624.3	Q9NYM4	GPR83_HUMAN	G protein-coupled receptor 83	402					response to glucocorticoid (GO:0051384)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			NS(1)|breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GTTGGGAGGTGGGCAGGAGGT	0.577																																																	0													68.0	71.0	70.0					11																	94113381		2201	4298	6499	SO:0001819	synonymous_variant	0			AF236081	CCDS8297.1	11q21	2012-08-21	2003-07-30	2003-08-01	ENSG00000123901	ENSG00000123901		"""GPCR / Class A : Orphans"""	4523	protein-coding gene	gene with protein product		605569	"""G protein-coupled receptor 72"""	GPR72		10760605, 11060465	Standard	NM_016540		Approved		uc001pet.2	Q9NYM4	OTTHUMG00000167779	ENST00000243673.2:c.1206C>T	11.37:g.94113381G>A			B0M0K5|Q6NWR4|Q9P1Y8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.P402	ENST00000243673.2	37	c.1206	CCDS8297.1	11																																																																																			GPR83	-	NULL	ENSG00000123901		0.577	GPR83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR83	HGNC	protein_coding	OTTHUMT00000396232.1	-	0.00	56	0	G	NM_016540		94113381	-1	tier1	-	no_errors	ENST00000243673	ensembl	human	known	74_37	silent	19.23	21	5	SNP	0.000	A
GREB1	9687	genome.wustl.edu	37	2	11765431	11765431	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:11765431G>T	ENST00000381486.2	+	24	4599	c.4299G>T	c.(4297-4299)aaG>aaT	p.K1433N	GREB1_ENST00000396123.1_Missense_Mutation_p.K431N|GREB1_ENST00000234142.5_Missense_Mutation_p.K1433N	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1433						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		AGGGTATAAAGAGTGAAGGTC	0.463																																					Ovarian(39;850 945 2785 23371 33093)												0													221.0	206.0	211.0					2																	11765431		1919	4127	6046	SO:0001583	missense	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.4299G>T	2.37:g.11765431G>T	ENSP00000370896:p.Lys1433Asn		A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.K1433N	ENST00000381486.2	37	c.4299	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	G	4.659	0.122441	0.08931	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	T;T;T	0.25085	3.14;3.14;1.82	5.0	2.17	0.27698	.	0.590649	0.18767	N	0.131713	T	0.13713	0.0332	N	0.19112	0.55	0.27986	N	0.93585	B	0.11235	0.004	B	0.10450	0.005	T	0.17077	-1.0381	10	0.31617	T	0.26	-16.1818	5.4981	0.16813	0.3157:0.2345:0.4499:0.0	.	1433	Q4ZG55	GREB1_HUMAN	N	1433;1433;431	ENSP00000370896:K1433N;ENSP00000234142:K1433N;ENSP00000379429:K431N	ENSP00000234142:K1433N	K	+	3	2	GREB1	11682882	0.086000	0.21541	0.013000	0.15412	0.178000	0.23041	-0.098000	0.11024	0.510000	0.28216	0.655000	0.94253	AAG	GREB1	-	NULL	ENSG00000196208		0.463	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	-	0.00	53	0	G	NM_014668		11765431	+1	tier1	-	no_errors	ENST00000234142	ensembl	human	known	74_37	missense	19.05	17	4	SNP	0.864	T
GRID1	2894	genome.wustl.edu	37	10	87407034	87407034	+	Silent	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:87407034A>C	ENST00000327946.7	-	13	2203	c.2118T>G	c.(2116-2118)gcT>gcG	p.A706A	RP11-93H12.4_ENST00000474115.2_RNA|GRID1_ENST00000536331.1_Silent_p.A277A|RN7SKP238_ENST00000516483.1_RNA	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	706					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GCCAGAGTTCAGCAAACGTGC	0.562										Multiple Myeloma(13;0.14)																																							0													265.0	244.0	251.0					10																	87407034		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2118T>G	10.37:g.87407034A>C			B3KXD5|B7Z7L0|Q8IXT3	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A706	ENST00000327946.7	37	c.2118	CCDS31236.1	10																																																																																			GRID1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000182771		0.562	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	-	0.00	63	0	A	XM_043613		87407034	-1	tier1	-	no_errors	ENST00000327946	ensembl	human	known	74_37	silent	27.08	35	13	SNP	0.018	C
HAP1	9001	genome.wustl.edu	37	17	39887793	39887793	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:39887793G>C	ENST00000310778.5	-	6	1030	c.1021C>G	c.(1021-1023)Ctt>Gtt	p.L341V	HAP1_ENST00000393939.2_Missense_Mutation_p.L341V|HAP1_ENST00000347901.4_Missense_Mutation_p.L341V|RN7SL399P_ENST00000471648.2_RNA|JUP_ENST00000540235.1_Intron|HAP1_ENST00000341193.5_Missense_Mutation_p.L349V			P54257	HAP1_HUMAN	huntingtin-associated protein 1	341	Glu-rich.|HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			TCATCCTCAAGAGTGTCGAGT	0.552																																																	0													148.0	121.0	130.0					17																	39887793		2203	4300	6503	SO:0001583	missense	0			AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1021C>G	17.37:g.39887793G>C	ENSP00000309392:p.Leu341Val		A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Missense_Mutation	SNP	pfam_HAP1_N	p.L341V	ENST00000310778.5	37	c.1021		17	.	.	.	.	.	.	.	.	.	.	G	2.830	-0.242927	0.05906	.	.	ENSG00000173805	ENST00000393939;ENST00000310778;ENST00000347901;ENST00000341193	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	4.14	1.98	0.26296	.	0.299889	0.18373	N	0.143201	T	0.14013	0.0339	L	0.50333	1.59	0.09310	N	1	B;B;B;B	0.28350	0.208;0.208;0.046;0.057	B;B;B;B	0.23574	0.047;0.047;0.019;0.032	T	0.16630	-1.0396	10	0.28530	T	0.3	-11.089	9.0736	0.36508	0.0:0.0:0.6059:0.3941	.	341;349;341;341	P54257-3;P54257-4;P54257-2;P54257	.;.;.;HAP1_HUMAN	V	341;341;341;349	ENSP00000377513:L341V;ENSP00000309392:L341V;ENSP00000334002:L341V;ENSP00000343170:L349V	ENSP00000309392:L341V	L	-	1	0	HAP1	37141319	0.957000	0.32711	0.403000	0.26384	0.351000	0.29236	0.933000	0.28897	0.939000	0.37446	-0.169000	0.13324	CTT	HAP1	-	pfam_HAP1_N	ENSG00000173805		0.552	HAP1-006	KNOWN	basic|appris_principal	protein_coding	HAP1	HGNC	protein_coding	OTTHUMT00000389619.1	-	0.00	123	0	G	NM_003949		39887793	-1	tier1	-	no_errors	ENST00000310778	ensembl	human	known	74_37	missense	13.15	185	28	SNP	0.047	C
HDAC2	3066	genome.wustl.edu	37	6	114277793	114277793	+	Silent	SNP	G	G	A	rs373430125		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:114277793G>A	ENST00000519065.1	-	4	724	c.348C>T	c.(346-348)ggC>ggT	p.G116G	HDAC2_ENST00000368632.2_Silent_p.G86G|HDAC2_ENST00000519108.1_Silent_p.G86G|HDAC2_ENST00000398283.2_Silent_p.G210G			Q92769	HDAC2_HUMAN	histone deacetylase 2	116	Histone deacetylase.				ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|cardiac muscle cell development (GO:0055013)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|dendrite development (GO:0016358)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|hair follicle placode formation (GO:0060789)|hippocampus development (GO:0021766)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|maintenance of chromatin silencing (GO:0006344)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell cycle (GO:0045786)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of neuron projection development (GO:0010977)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of proteolysis (GO:0045862)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein deacetylation (GO:0090311)|regulation of protein kinase B signaling (GO:0051896)|regulation of sarcomere organization (GO:0060297)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|replication fork (GO:0005657)|Sin3 complex (GO:0016580)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|poly(A) RNA binding (GO:0044822)|protein deacetylase activity (GO:0033558)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			biliary_tract(1)|central_nervous_system(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(2)	27		all_cancers(87;0.000629)|all_epithelial(87;0.00274)|Colorectal(196;0.0317)|all_lung(197;0.24)		all cancers(137;0.00318)|OV - Ovarian serous cystadenocarcinoma(136;0.00569)|Epithelial(106;0.0112)|GBM - Glioblastoma multiforme(226;0.0832)	Aminophylline(DB01223)|Lovastatin(DB00227)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Valproic Acid(DB00313)|Vorinostat(DB02546)	CAACTGAACCGCCAGTTGAGA	0.358																																																	0								G		0,3712		0,0,1856	71.0	70.0	70.0		348	3.4	1.0	6		70	1,8169		0,1,4084	no	coding-synonymous	HDAC2	NM_001527.3		0,1,5940	AA,AG,GG		0.0122,0.0,0.0084		116/489	114277793	1,11881	1856	4085	5941	SO:0001819	synonymous_variant	0			U31814	CCDS43493.1, CCDS43493.2	6q21	2008-08-29			ENSG00000196591	ENSG00000196591			4853	protein-coding gene	gene with protein product		605164				9782097	Standard	NM_001527		Approved	RPD3, YAF1	uc003pwd.2	Q92769	OTTHUMG00000015411	ENST00000519065.1:c.348C>T	6.37:g.114277793G>A			B3KRS5|B4DL58|E1P561|Q5SRI8|Q5SZ86|Q8NEH4	Silent	SNP	pfam_His_deacetylse_dom,prints_His_deacetylse_1,prints_His_deacetylse	p.G210	ENST00000519065.1	37	c.630	CCDS43493.2	6																																																																																			HDAC2	-	pfam_His_deacetylse_dom,prints_His_deacetylse_1	ENSG00000196591		0.358	HDAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC2	HGNC	protein_coding	OTTHUMT00000041909.2		0.00	50	0	G			114277793	-1			no_errors	ENST00000398283	ensembl	human	known	74_37	silent	9.52	19	2	SNP	0.998	A
HEATR1	55127	genome.wustl.edu	37	1	236749748	236749748	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:236749748C>T	ENST00000366582.3	-	15	1834	c.1720G>A	c.(1720-1722)Gag>Aag	p.E574K	HEATR1_ENST00000366581.2_Missense_Mutation_p.E574K	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	574					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)	p.E574K(2)		NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TTAAGTACCTCGTACCTAAAA	0.368																																																	2	Substitution - Missense(2)	breast(2)											82.0	85.0	84.0					1																	236749748		2201	4299	6500	SO:0001583	missense	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.1720G>A	1.37:g.236749748C>T	ENSP00000355541:p.Glu574Lys		Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.E574K	ENST00000366582.3	37	c.1720	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.545232	0.00926	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.38401	1.14;1.14	5.28	-1.04	0.10068	Armadillo-like helical (1);Armadillo-type fold (1);	0.797254	0.12163	N	0.493770	T	0.12433	0.0302	N	0.02916	-0.46	0.09310	N	0.999998	B	0.02656	0.0	B	0.01281	0.0	T	0.33266	-0.9875	10	0.02654	T	1	.	10.9619	0.47389	0.0:0.4097:0.0:0.5903	.	574	Q9H583	HEAT1_HUMAN	K	574	ENSP00000355541:E574K;ENSP00000355540:E574K	ENSP00000355540:E574K	E	-	1	0	HEATR1	234816371	0.903000	0.30736	0.054000	0.19295	0.257000	0.26127	0.775000	0.26689	-0.137000	0.11455	-1.320000	0.01293	GAG	HEATR1	-	superfamily_ARM-type_fold	ENSG00000119285		0.368	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1		0.00	23	0	C	XM_375853		236749748	-1			no_errors	ENST00000366582	ensembl	human	known	74_37	missense	9.09	20	2	SNP	0.138	T
HEATR5A	25938	genome.wustl.edu	37	14	31855727	31855727	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:31855727G>A	ENST00000389961.3	-	8	1225	c.1226C>T	c.(1225-1227)gCc>gTc	p.A409V	HEATR5A_ENST00000404677.3_Missense_Mutation_p.A415V|HEATR5A_ENST00000543095.2_Missense_Mutation_p.A415V|HEATR5A_ENST00000439727.1_Missense_Mutation_p.A122V|HEATR5A_ENST00000439348.1_Missense_Mutation_p.A409V			Q86XA9	HTR5A_HUMAN	HEAT repeat containing 5A	409										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)	26	Hepatocellular(127;0.0877)|Breast(36;0.137)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.0797)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0059)		TTGGCTAGCGGCTACATCTGT	0.418																																																	0													131.0	130.0	130.0					14																	31855727		1870	4106	5976	SO:0001583	missense	0			AB037737		14q12	2012-04-19	2007-01-02	2007-01-02	ENSG00000129493	ENSG00000129493			20276	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 125"""	C14orf125			Standard	NM_015473		Approved	DKFZP434I1735	uc001wrf.4	Q86XA9	OTTHUMG00000169043	ENST00000389961.3:c.1226C>T	14.37:g.31855727G>A	ENSP00000374611:p.Ala409Val		Q68DD8|Q6P3S5|Q6P5R9|Q9H8D7|Q9NXB7|Q9P2N0|Q9UFQ3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A409V	ENST00000389961.3	37	c.1226		14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.35|17.35	3.367036|3.367036	0.61513|0.61513	.|.	.|.	ENSG00000129493|ENSG00000129493	ENST00000389961;ENST00000439348;ENST00000439727;ENST00000543095;ENST00000404677|ENST00000538864	T;T;T;T;T|.	0.65178|.	3.26;3.26;-0.14;3.26;3.26|.	5.93|5.93	5.02|5.02	0.67125|0.67125	Armadillo-type fold (1);|.	0.315315|.	0.33610|.	N|.	0.004724|.	T|T	0.51924|0.51924	0.1703|0.1703	L|L	0.55481|0.55481	1.735|1.735	0.28550|0.28550	N|N	0.911679|0.911679	B;B;B|.	0.24258|.	0.033;0.1;0.012|.	B;B;B|.	0.24541|.	0.044;0.041;0.054|.	T|T	0.47497|0.47497	-0.9113|-0.9113	10|5	0.13470|.	T|.	0.59|.	.|.	11.4696|11.4696	0.50261|0.50261	0.0677:0.1264:0.8059:0.0|0.0677:0.1264:0.8059:0.0	.|.	415;409;409|.	B5MC49;Q86XA9-2;Q86XA9|.	.;.;HTR5A_HUMAN|.	V|S	409;409;122;415;415|43	ENSP00000374611:A409V;ENSP00000405407:A409V;ENSP00000408681:A122V;ENSP00000437968:A415V;ENSP00000384646:A415V|.	ENSP00000374611:A409V|.	A|P	-|-	2|1	0|0	HEATR5A|HEATR5A	30925478|30925478	0.670000|0.670000	0.27512|0.27512	1.000000|1.000000	0.80357|0.80357	0.940000|0.940000	0.58332|0.58332	3.347000|3.347000	0.52200|0.52200	2.814000|2.814000	0.96858|0.96858	0.591000|0.591000	0.81541|0.81541	GCC|CCG	HEATR5A	-	superfamily_ARM-type_fold	ENSG00000129493		0.418	HEATR5A-201	KNOWN	basic|appris_candidate	protein_coding	HEATR5A	HGNC	protein_coding		-	0.00	50	0	G	NM_015473		31855727	-1	tier1	-	no_errors	ENST00000389961	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.894	A
HIST1H3C	8352	genome.wustl.edu	37	6	26045967	26045968	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:26045967_26045968delTG	ENST00000540144.1	+	1	329_330	c.329_330delTG	c.(328-330)ctgfs	p.L110fs	HIST1H2BB_ENST00000357905.2_5'Flank	NM_003531.2	NP_003522.1	P68431	H31_HUMAN	histone cluster 1, H3c	110					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|skin(1)	8						GACACCAATCTGTGCGCTATTC	0.564																																																	0																																										SO:0001589	frameshift_variant	0			X57128	CCDS4576.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196532	ENSG00000278272		"""Histones / Replication-dependent"""	4768	protein-coding gene	gene with protein product		602812	"""H3 histone family, member C"", ""histone 1, H3c"""	H3FC		8227173, 9119399, 12408966	Standard	NM_003531		Approved	H3/c, H3.1	uc003nfv.3	P68431	OTTHUMG00000014416	ENST00000540144.1:c.329_330delTG	6.37:g.26045969_26045970delTG	ENSP00000439493:p.Leu110fs		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Frame_Shift_Del	DEL	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.C111fs	ENST00000540144.1	37	c.329_330	CCDS4576.1	6																																																																																			HIST1H3C	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000196532		0.564	HIST1H3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3C	HGNC	protein_coding	OTTHUMT00000040078.1		0.00	123	0	TG	NM_003531		26045968	+1	tier1		no_errors	ENST00000540144	ensembl	human	known	74_37	frame_shift_del	55.77	23	29	DEL	1.000:1.000	-
HMCN1	83872	genome.wustl.edu	37	1	185878509	185878509	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:185878509T>G	ENST00000271588.4	+	5	891	c.662T>G	c.(661-663)gTt>gGt	p.V221G	HMCN1_ENST00000367492.2_Missense_Mutation_p.V221G	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	221					response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						GCCTCCAAAGTTCACCTTTTA	0.393																																																	0													100.0	96.0	98.0					1																	185878509		2203	4300	6503	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.662T>G	1.37:g.185878509T>G	ENSP00000271588:p.Val221Gly		A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd_dom,pfam_Thrombospondin_1_rpt,superfamily_GFP,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like_dom	p.V221G	ENST00000271588.4	37	c.662	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.731657	0.89390	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.77620	-1.1;-1.11	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	D	0.89444	0.6717	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.90871	0.4746	10	0.87932	D	0	.	16.635	0.85050	0.0:0.0:0.0:1.0	.	221	Q96RW7	HMCN1_HUMAN	G	221	ENSP00000271588:V221G;ENSP00000356462:V221G	ENSP00000271588:V221G	V	+	2	0	HMCN1	184145132	1.000000	0.71417	0.986000	0.45419	0.977000	0.68977	8.013000	0.88655	2.330000	0.79161	0.477000	0.44152	GTT	HMCN1	-	NULL	ENSG00000143341		0.393	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	104	0	T	NM_031935		185878509	+1	tier1	-	no_errors	ENST00000271588	ensembl	human	known	74_37	missense	21.67	47	13	SNP	1.000	G
HOXB7	3217	genome.wustl.edu	37	17	46685288	46685288	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:46685288C>T	ENST00000239165.7	-	2	668	c.570G>A	c.(568-570)atG>atA	p.M190I	HOXB7_ENST00000567101.2_5'UTR|HOXB-AS3_ENST00000491264.1_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB6_ENST00000484302.2_5'Flank|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000494420.1_RNA|HOXB6_ENST00000225648.3_5'Flank|HOXB-AS3_ENST00000467155.2_RNA	NM_004502.3	NP_004493.3	P09629	HXB7_HUMAN	homeobox B7	190					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	8						TTTTCCACTTCATGCGCCGGT	0.592																																																	0													110.0	119.0	116.0					17																	46685288		2203	4300	6503	SO:0001583	missense	0				CCDS11532.1	17q21.32	2013-05-22	2005-12-22					"""Homeoboxes / ANTP class : HOXL subclass"""	5118	protein-coding gene	gene with protein product		142962	"""homeo box B7"""	HOX2, HOX2C		1973146, 1358459	Standard	NM_004502		Approved		uc002inv.3	P09629	OTTHUMG00000170231	ENST00000239165.7:c.570G>A	17.37:g.46685288C>T	ENSP00000239165:p.Met190Ile		A8K3N8|Q15957|Q53FN3|Q96BQ6	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.M190I	ENST00000239165.7	37	c.570	CCDS11532.1	17	.	.	.	.	.	.	.	.	.	.	C	19.63	3.864337	0.71949	.	.	ENSG00000120087	ENST00000239165;ENST00000494244	D	0.96136	-3.92	4.72	4.72	0.59763	Homeobox, eukaryotic (1);Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.94676	0.8283	L	0.58510	1.815	0.80722	D	1	B	0.20887	0.049	B	0.30782	0.12	D	0.93209	0.6598	10	0.87932	D	0	.	17.5097	0.87756	0.0:1.0:0.0:0.0	.	190	P09629	HXB7_HUMAN	I	190;1	ENSP00000239165:M190I	ENSP00000239165:M190I	M	-	3	0	HOXB7	44040287	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.643000	0.83403	2.445000	0.82738	0.563000	0.77884	ATG	HOXB7	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_Homeobox_metazoa	ENSG00000260027		0.592	HOXB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB7	HGNC	protein_coding	OTTHUMT00000358097.3		0.00	78	0	C			46685288	-1			no_errors	ENST00000239165	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
HRH3	11255	genome.wustl.edu	37	20	60791867	60791867	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr20:60791867G>A	ENST00000340177.5	-	3	817	c.533C>T	c.(532-534)tCc>tTc	p.S178F	HRH3_ENST00000317393.6_Missense_Mutation_p.S178F	NM_007232.2	NP_009163.2	Q9Y5N1	HRH3_HUMAN	histamine receptor H3	178					brain development (GO:0007420)|drinking behavior (GO:0042756)|eating behavior (GO:0042755)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of gamma-aminobutyric acid secretion (GO:0014053)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of serotonin secretion (GO:0014063)|neurotransmitter secretion (GO:0007269)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|regulation of norepinephrine secretion (GO:0014061)|response to organic cyclic compound (GO:0014070)	integral component of plasma membrane (GO:0005887)|myelin sheath (GO:0043209)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|histamine receptor activity (GO:0004969)			breast(1)|endometrium(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	9	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;7.08e-07)		Betahistine(DB06698)|Histamine Phosphate(DB00667)|Mirtazapine(DB00370)	GCTGCCCCCGGACAGGTACTC	0.622																																																	0													56.0	51.0	52.0					20																	60791867		2203	4300	6503	SO:0001583	missense	0			AF140538	CCDS13493.1	20q13.33	2013-09-19			ENSG00000101180	ENSG00000101180		"""GPCR / Class A : Histamine receptors"""	5184	protein-coding gene	gene with protein product		604525				10347254	Standard	NM_007232		Approved	GPCR97	uc002ycf.2	Q9Y5N1	OTTHUMG00000032899	ENST00000340177.5:c.533C>T	20.37:g.60791867G>A	ENSP00000342560:p.Ser178Phe		Q4QRI7|Q9GZX2|Q9H4K8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Histamine_H3_rcpt,prints_GPCR_Rhodpsn,prints_Musac_Ach_rcpt	p.S178F	ENST00000340177.5	37	c.533	CCDS13493.1	20	.	.	.	.	.	.	.	.	.	.	G	19.64	3.866353	0.71949	.	.	ENSG00000101180	ENST00000340177;ENST00000317393;ENST00000370797	T;T	0.37584	1.19;1.19	4.53	4.53	0.55603	GPCR, rhodopsin-like superfamily (1);	0.203559	0.43919	D	0.000503	T	0.53498	0.1800	L	0.55017	1.72	0.44289	D	0.997152	D;D;P;D	0.59767	0.985;0.986;0.952;0.984	P;P;P;P	0.61874	0.693;0.895;0.837;0.884	T	0.56866	-0.7908	10	0.56958	D	0.05	-35.4727	17.606	0.88037	0.0:0.0:1.0:0.0	.	178;178;178;178	Q9Y5N1-2;E7EWA7;Q8WXZ9;Q9Y5N1	.;.;.;HRH3_HUMAN	F	178	ENSP00000342560:S178F;ENSP00000321482:S178F	ENSP00000321482:S178F	S	-	2	0	HRH3	60225262	1.000000	0.71417	0.921000	0.36526	0.898000	0.52572	5.199000	0.65152	2.208000	0.71279	0.407000	0.27541	TCC	HRH3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Histamine_H3_rcpt,prints_Musac_Ach_rcpt	ENSG00000101180		0.622	HRH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH3	HGNC	protein_coding	OTTHUMT00000079994.1	-	0.00	23	0	G	NM_007232		60791867	-1	tier1	-	no_errors	ENST00000317393	ensembl	human	known	74_37	missense	25.00	12	4	SNP	0.996	A
HS3ST3A1	9955	genome.wustl.edu	37	17	13504307	13504307	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:13504307T>C	ENST00000284110.1	-	1	937	c.140A>G	c.(139-141)cAg>cGg	p.Q47R		NM_006042.1	NP_006033.1	Q9Y663	HS3SA_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1	47					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)|sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		GGACAGGGTCTGGCAGCGCTC	0.721																																																	0													22.0	19.0	20.0					17																	13504307		2170	4275	6445	SO:0001583	missense	0			AF105376	CCDS11165.1	17p12	2007-04-02			ENSG00000153976	ENSG00000153976	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5196	protein-coding gene	gene with protein product		604057				9988767	Standard	NM_006042		Approved	3OST3A1, 30ST3A1	uc002gob.1	Q9Y663	OTTHUMG00000058768	ENST00000284110.1:c.140A>G	17.37:g.13504307T>C	ENSP00000284110:p.Gln47Arg		A8K7N2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.Q47R	ENST00000284110.1	37	c.140	CCDS11165.1	17	.	.	.	.	.	.	.	.	.	.	T	11.64	1.697837	0.30142	.	.	ENSG00000153976	ENST00000284110	T	0.40756	1.02	3.03	1.9	0.25705	.	.	.	.	.	T	0.22666	0.0547	N	0.24115	0.695	0.80722	D	1	B	0.14012	0.009	B	0.10450	0.005	T	0.05517	-1.0880	9	0.16896	T	0.51	.	4.759	0.13099	0.1793:0.0:0.1996:0.6211	.	47	Q9Y663	HS3SA_HUMAN	R	47	ENSP00000284110:Q47R	ENSP00000284110:Q47R	Q	-	2	0	HS3ST3A1	13445032	0.003000	0.15002	0.974000	0.42286	0.983000	0.72400	-0.588000	0.05774	0.525000	0.28522	0.533000	0.62120	CAG	HS3ST3A1	-	NULL	ENSG00000153976		0.721	HS3ST3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST3A1	HGNC	protein_coding	OTTHUMT00000129952.1		0.00	77	0	T	NM_006042		13504307	-1			no_errors	ENST00000284110	ensembl	human	known	74_37	missense	10.34	26	3	SNP	0.970	C
HSF2	3298	genome.wustl.edu	37	6	122743317	122743317	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:122743317G>T	ENST00000368455.4	+	8	896	c.704G>T	c.(703-705)gGt>gTt	p.G235V	HSF2_ENST00000452194.1_Missense_Mutation_p.G235V	NM_004506.3	NP_004497.1	Q03933	HSF2_HUMAN	heat shock transcription factor 2	235					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to stress (GO:0006950)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II intronic transcription regulatory region sequence-specific DNA binding (GO:0001162)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			large_intestine(4)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(136;0.00371)|all cancers(137;0.0299)|GBM - Glioblastoma multiforme(226;0.0586)		AGGACTGAAGGTTTAAAGCCA	0.308																																																	0													92.0	94.0	93.0					6																	122743317		2203	4299	6502	SO:0001583	missense	0			M65217	CCDS5124.1, CCDS47470.1	6q22	2008-08-29			ENSG00000025156	ENSG00000025156			5225	protein-coding gene	gene with protein product		140581				1871106	Standard	NM_004506		Approved		uc003pyu.2	Q03933	OTTHUMG00000016216	ENST00000368455.4:c.704G>T	6.37:g.122743317G>T	ENSP00000357440:p.Gly235Val		B4DGJ4|Q0VAH9|Q2M1K4|Q9H445	Missense_Mutation	SNP	pfam_Vert_HSTF_C,pfam_HSF_DNA-bd,smart_HSF_DNA-bd,prints_HSF_DNA-bd	p.G235V	ENST00000368455.4	37	c.704	CCDS5124.1	6	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939919	0.73557	.	.	ENSG00000025156	ENST00000368455;ENST00000452194	.	.	.	5.65	5.65	0.86999	Vertebrate heat shock transcription factor (1);	0.000000	0.85682	D	0.000000	T	0.69260	0.3091	L	0.56769	1.78	0.80722	D	1	D;D	0.59357	0.981;0.985	P;D	0.63283	0.858;0.913	T	0.61352	-0.7080	9	0.26408	T	0.33	-36.2378	20.1057	0.97893	0.0:0.0:1.0:0.0	.	235;235	Q03933-2;Q03933	.;HSF2_HUMAN	V	235	.	ENSP00000357440:G235V	G	+	2	0	HSF2	122785016	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.425000	0.80255	2.827000	0.97445	0.650000	0.86243	GGT	HSF2	-	pfam_Vert_HSTF_C	ENSG00000025156		0.308	HSF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF2	HGNC	protein_coding	OTTHUMT00000043520.1	-	0.00	57	0	G	NM_004506		122743317	+1	tier1	-	no_errors	ENST00000368455	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	T
IGF1R	3480	genome.wustl.edu	37	15	99467158	99467158	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:99467158T>C	ENST00000268035.6	+	12	3150	c.2539T>C	c.(2539-2541)Tcc>Ccc	p.S847P	IGF1R_ENST00000558762.1_Missense_Mutation_p.S847P	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	847	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GCCTGAAAACTCCATCTTTTT	0.458																																																	0													85.0	89.0	88.0					15																	99467158		2197	4297	6494	SO:0001583	missense	0			M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2539T>C	15.37:g.99467158T>C	ENSP00000268035:p.Ser847Pro		B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.S847P	ENST00000268035.6	37	c.2539	CCDS10378.1	15	.	.	.	.	.	.	.	.	.	.	T	16.76	3.211315	0.58343	.	.	ENSG00000140443	ENST00000268035	T	0.63417	-0.04	5.81	3.37	0.38596	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.361853	0.23058	N	0.052405	T	0.69869	0.3159	M	0.91038	3.17	0.30703	N	0.750068	B;B	0.33238	0.403;0.003	B;B	0.41691	0.364;0.022	T	0.70791	-0.4776	10	0.45353	T	0.12	.	5.6697	0.17715	0.4549:0.0:0.1164:0.4287	.	847;847	C9J5X1;P08069	.;IGF1R_HUMAN	P	847	ENSP00000268035:S847P	ENSP00000268035:S847P	S	+	1	0	IGF1R	97284681	0.988000	0.35896	1.000000	0.80357	0.997000	0.91878	3.113000	0.50376	0.994000	0.38892	0.482000	0.46254	TCC	IGF1R	-	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000140443		0.458	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	IGF1R	HGNC	protein_coding	OTTHUMT00000313537.2	-	0.00	98	0	T	NM_000875		99467158	+1	tier1	-	no_errors	ENST00000268035	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	C
IGHMBP2	3508	genome.wustl.edu	37	11	68673634	68673634	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:68673634C>T	ENST00000255078.3	+	2	295	c.184C>T	c.(184-186)Cgg>Tgg	p.R62W	IGHMBP2_ENST00000539224.1_Missense_Mutation_p.R62W|MRPL21_ENST00000450904.2_5'Flank|MRPL21_ENST00000362034.2_5'Flank|MRPL21_ENST00000567045.1_5'Flank	NM_002180.2	NP_002171.2	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	62					ATP catabolic process (GO:0006200)|cell death (GO:0008219)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)	axon (GO:0030424)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent 5'-3' RNA helicase activity (GO:0032575)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|ribosome binding (GO:0043022)|RNA binding (GO:0003723)|RNA-dependent ATPase activity (GO:0008186)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|tRNA binding (GO:0000049)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|liver(1)|lung(15)|ovary(2)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GCTGTACGGACGGCTGCTGGT	0.577																																																	0													96.0	95.0	95.0					11																	68673634		2200	4294	6494	SO:0001583	missense	0			L14754	CCDS8187.1	11q13.3	2014-09-17			ENSG00000132740	ENSG00000132740		"""Zinc fingers, AN1-type domain containing"""	5542	protein-coding gene	gene with protein product	"""cardiac transcription factor 1"", ""zinc finger, AN1-type domain 7"""	600502				8349627	Standard	NM_002180		Approved	ZFAND7, SMUBP2, CATF1, SMARD1, HCSA, HMN6	uc001ook.1	P38935	OTTHUMG00000167894	ENST00000255078.3:c.184C>T	11.37:g.68673634C>T	ENSP00000255078:p.Arg62Trp		A0PJD2|Q00443|Q14177	Missense_Mutation	SNP	pfam_R3H_ss-bd,pfam_Znf_AN1,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_AAA+_ATPase,smart_R3H_ss-bd,smart_Znf_AN1,pfscan_Znf_AN1,pfscan_R3H_ss-bd,tigrfam_DNA_helicase_put	p.R62W	ENST00000255078.3	37	c.184	CCDS8187.1	11	.	.	.	.	.	.	.	.	.	.	C	18.44	3.623759	0.66901	.	.	ENSG00000132740	ENST00000255078;ENST00000539224	D;T	0.91521	-2.86;-0.73	3.63	2.69	0.31865	.	0.227263	0.36893	N	0.002358	D	0.94725	0.8298	M	0.86953	2.85	0.42217	D	0.991834	D	0.89917	1.0	D	0.68621	0.959	D	0.94462	0.7677	10	0.87932	D	0	-4.7386	10.3266	0.43796	0.1979:0.8021:0.0:0.0	.	62	P38935	SMBP2_HUMAN	W	62	ENSP00000255078:R62W;ENSP00000440465:R62W	ENSP00000255078:R62W	R	+	1	2	IGHMBP2	68430210	0.965000	0.33210	0.861000	0.33841	0.914000	0.54420	2.167000	0.42415	0.827000	0.34685	0.561000	0.74099	CGG	IGHMBP2	-	tigrfam_DNA_helicase_put	ENSG00000132740		0.577	IGHMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGHMBP2	HGNC	protein_coding	OTTHUMT00000396862.1	-	0.00	62	0	C	NM_002180		68673634	+1	tier1	-	no_errors	ENST00000255078	ensembl	human	known	74_37	missense	44.44	20	16	SNP	0.976	T
INADL	10207	genome.wustl.edu	37	1	62349918	62349918	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:62349918C>T	ENST00000371158.2	+	22	3083	c.2969C>T	c.(2968-2970)cCg>cTg	p.P990L	INADL_ENST00000316485.6_Missense_Mutation_p.P990L	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	990					cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)		p.P990Q(1)		breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GGCATGATCCCGAATGATGTC	0.468																																																	1	Substitution - Missense(1)	lung(1)											165.0	152.0	156.0					1																	62349918		2203	4300	6503	SO:0001583	missense	0			AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.2969C>T	1.37:g.62349918C>T	ENSP00000360200:p.Pro990Leu		O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_L27,smart_PDZ,pfscan_L27,pfscan_PDZ	p.P990L	ENST00000371158.2	37	c.2969	CCDS617.2	1	.	.	.	.	.	.	.	.	.	.	C	8.779	0.927732	0.18056	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000255202	T;T	0.12879	2.79;2.64	5.13	2.25	0.28309	.	0.566616	0.17879	N	0.158914	T	0.12475	0.0303	M	0.68317	2.08	0.09310	N	0.999999	P;B;D	0.53312	0.809;0.071;0.959	B;B;B	0.42771	0.169;0.01;0.397	T	0.14727	-1.0462	10	0.08381	T	0.77	.	5.8899	0.18904	0.0:0.6747:0.154:0.1714	.	990;990;990	F8W8T2;Q8NI35;Q8NI35-4	.;INADL_HUMAN;.	L	990	ENSP00000360200:P990L;ENSP00000326199:P990L	ENSP00000255202:P990L	P	+	2	0	INADL	62122506	0.010000	0.17322	0.060000	0.19600	0.006000	0.05464	0.731000	0.26058	0.322000	0.23283	-1.808000	0.00615	CCG	INADL	-	NULL	ENSG00000132849		0.468	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INADL	HGNC	protein_coding	OTTHUMT00000023639.2	-	0.00	68	0	C	NM_170605		62349918	+1	tier1	-	no_errors	ENST00000371158	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.026	T
INPP4A	3631	genome.wustl.edu	37	2	99172091	99172091	+	Missense_Mutation	SNP	C	C	T	rs372335775	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:99172091C>T	ENST00000523221.1	+	15	1657	c.1657C>T	c.(1657-1659)Cgg>Tgg	p.R553W	INPP4A_ENST00000074304.5_Missense_Mutation_p.R553W|INPP4A_ENST00000409016.4_Missense_Mutation_p.R553W|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409851.3_Missense_Mutation_p.R548W|INPP4A_ENST00000545415.1_Missense_Mutation_p.R553W|INPP4A_ENST00000409540.3_Missense_Mutation_p.R553W			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	553					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						GCAGAAGGAGCGGCTGCATGG	0.572																																																	0													62.0	73.0	69.0					2																	99172091		2171	4290	6461	SO:0001583	missense	0			U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.1657C>T	2.37:g.99172091C>T	ENSP00000427722:p.Arg553Trp		O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	superfamily_C2_dom	p.R553W	ENST00000523221.1	37	c.1657	CCDS46369.1	2	.	.	.	.	.	.	.	.	.	.	C	26.2	4.714578	0.89112	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000074304;ENST00000545415;ENST00000409540;ENST00000523221	T;T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14;2.14	5.82	5.82	0.92795	.	0.052462	0.64402	D	0.000001	T	0.43545	0.1252	L	0.51422	1.61	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.72075	0.95;0.967;0.976;0.976	T	0.14448	-1.0472	10	0.72032	D	0.01	-17.2061	19.0835	0.93192	0.0:1.0:0.0:0.0	.	553;553;553;548	Q96PE3-2;Q96PE3-4;Q96PE3;Q96PE3-3	.;.;INP4A_HUMAN;.	W	553;548;553;553;553;553	ENSP00000386704:R553W;ENSP00000386777:R548W;ENSP00000074304:R553W;ENSP00000442149:R553W;ENSP00000387294:R553W;ENSP00000427722:R553W	ENSP00000074304:R553W	R	+	1	2	INPP4A	98538523	1.000000	0.71417	0.998000	0.56505	0.864000	0.49448	4.915000	0.63355	2.767000	0.95098	0.655000	0.94253	CGG	INPP4A	-	NULL	ENSG00000040933		0.572	INPP4A-009	KNOWN	basic|CCDS	protein_coding	INPP4A	HGNC	protein_coding	OTTHUMT00000376095.1	-	0.00	63	0	C	NM_001566		99172091	+1	tier1	-	no_errors	ENST00000074304	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
INPP5D	3635	genome.wustl.edu	37	2	234094499	234094499	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:234094499G>T	ENST00000359570.5	+	23	2250	c.2250G>T	c.(2248-2250)aaG>aaT	p.K750N	INPP5D_ENST00000455936.2_Missense_Mutation_p.K514N|INPP5D_ENST00000450745.1_Missense_Mutation_p.K514N			Q92835	SHIP1_HUMAN	inositol polyphosphate-5-phosphatase, 145kDa	762					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|determination of adult lifespan (GO:0008340)|immunoglobulin mediated immune response (GO:0016064)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of bone resorption (GO:0045779)|negative regulation of immune response (GO:0050777)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of neutrophil differentiation (GO:0045659)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of signal transduction (GO:0009968)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of erythrocyte differentiation (GO:0045648)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|membrane (GO:0016020)	inositol-polyphosphate 5-phosphatase activity (GO:0004445)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)			central_nervous_system(1)|ovary(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		GTTTTGTCAAGAGTCAGGAAG	0.488																																					NSCLC(82;1215 1426 16163 20348 41018)												0													70.0	72.0	71.0					2																	234094499		1879	4105	5984	SO:0001583	missense	0			U57650	CCDS74672.1	2q37.1	2013-02-14	2002-08-29		ENSG00000168918	ENSG00000168918		"""SH2 domain containing"""	6079	protein-coding gene	gene with protein product		601582	"""inositol polyphosphate-5-phosphatase, 145kD"""			8643691, 8874179	Standard	NM_001017915		Approved	SHIP, hp51CN	uc010zmp.2	Q92835	OTTHUMG00000133688	ENST00000359570.5:c.2250G>T	2.37:g.234094499G>T	ENSP00000352575:p.Lys750Asn		O00145|Q13544|Q13545|Q6P5A4|Q92656|Q9UE80	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_SH2,superfamily_Endo/exonuclease/phosphatase,smart_SH2,smart_IPPc,pfscan_SH2,prints_SH2	p.K750N	ENST00000359570.5	37	c.2250		2	.	.	.	.	.	.	.	.	.	.	G	19.59	3.856835	0.71834	.	.	ENSG00000168918	ENST00000359570;ENST00000450745;ENST00000455936;ENST00000435188;ENST00000415617;ENST00000445964	D;D;D;D;D;D	0.97232	-4.25;-4.3;-4.3;-4.28;-4.28;-4.28	5.45	4.56	0.56223	.	0.146857	0.64402	D	0.000012	D	0.97885	0.9305	.	.	.	0.38152	D	0.938761	D;D	0.62365	0.991;0.985	P;P	0.61275	0.886;0.773	D	0.98871	1.0766	9	0.44086	T	0.13	.	14.6361	0.68692	0.0705:0.0:0.9295:0.0	.	761;762	Q92835-2;Q92835	.;SHIP1_HUMAN	N	750;514;514;383;383;383	ENSP00000352575:K750N;ENSP00000407916:K514N;ENSP00000404610:K514N;ENSP00000400151:K383N;ENSP00000397421:K383N;ENSP00000405338:K383N	ENSP00000352575:K750N	K	+	3	2	INPP5D	233759238	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.020000	0.57189	1.282000	0.44496	0.650000	0.86243	AAG	INPP5D	-	NULL	ENSG00000168918		0.488	INPP5D-201	KNOWN	basic|appris_principal	protein_coding	INPP5D	HGNC	protein_coding		-	0.00	77	0	G	NM_001017915		234094499	+1	tier1	-	no_errors	ENST00000359570	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
INSR	3643	genome.wustl.edu	37	19	7168031	7168031	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:7168031A>G	ENST00000302850.5	-	7	1700	c.1558T>C	c.(1558-1560)Tgg>Cgg	p.W520R	INSR_ENST00000341500.5_Missense_Mutation_p.W520R	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	520					activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TCGGGGGGCCAGTACGGCTCC	0.473																																																	0													57.0	61.0	60.0					19																	7168031		2203	4300	6503	SO:0001583	missense	0			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.1558T>C	19.37:g.7168031A>G	ENSP00000303830:p.Trp520Arg		Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom	p.W520R	ENST00000302850.5	37	c.1558	CCDS12176.1	19	.	.	.	.	.	.	.	.	.	.	A	5.450	0.268187	0.10349	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.66995	-0.24;-0.24	4.62	4.62	0.57501	Fibronectin, type III (1);	0.000000	0.43579	D	0.000543	T	0.47619	0.1455	N	0.24115	0.695	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.39231	-0.9624	10	0.07482	T	0.82	.	12.0441	0.53469	1.0:0.0:0.0:0.0	.	511;520;520	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	R	520	ENSP00000303830:W520R;ENSP00000342838:W520R	ENSP00000303830:W520R	W	-	1	0	INSR	7119031	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	4.880000	0.63107	1.946000	0.56461	0.379000	0.24179	TGG	INSR	-	pirsf_Tyr_kinase_insulin-like_rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000171105		0.473	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	HGNC	protein_coding	OTTHUMT00000458544.1	-	0.00	71	0	A			7168031	-1	tier1	-	no_errors	ENST00000302850	ensembl	human	known	74_37	missense	15.38	22	4	SNP	1.000	G
IQCD	115811	genome.wustl.edu	37	12	113645642	113645642	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:113645642C>G	ENST00000416617.2	-	2	520	c.330G>C	c.(328-330)gaG>gaC	p.E110D	IQCD_ENST00000546692.1_Missense_Mutation_p.E110D|IQCD_ENST00000299732.2_Missense_Mutation_p.E110D			Q96DY2	IQCD_HUMAN	IQ motif containing D	110										endometrium(2)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						GCCTTTCTTTCTCTTTCAGGC	0.552																																																	0													105.0	102.0	103.0					12																	113645642		2203	4300	6503	SO:0001583	missense	0			BC013151	CCDS9167.1	12q24.21	2014-07-18				ENSG00000166578			25168	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 10"""					23427265, 24804578	Standard	NM_138451		Approved	DRC10, CFAP84	uc001tuu.3	Q96DY2		ENST00000416617.2:c.330G>C	12.37:g.113645642C>G	ENSP00000400669:p.Glu110Asp		Q6ZSU0	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.E110D	ENST00000416617.2	37	c.330		12	.	.	.	.	.	.	.	.	.	.	C	7.922	0.738891	0.15642	.	.	ENSG00000166578	ENST00000299732;ENST00000416617;ENST00000546692;ENST00000392574	T;T;T	0.10005	2.92;2.92;2.92	4.25	-1.31	0.09230	.	0.956752	0.08685	N	0.908784	T	0.04952	0.0133	N	0.16656	0.425	0.09310	N	1	B;B	0.20052	0.041;0.002	B;B	0.20184	0.028;0.004	T	0.45131	-0.9282	10	0.21540	T	0.41	-5.8041	0.6912	0.00891	0.3959:0.2487:0.1336:0.2218	.	110;110	F8VZV9;Q96DY2-2	.;.	D	110	ENSP00000299732:E110D;ENSP00000400669:E110D;ENSP00000446623:E110D	ENSP00000299732:E110D	E	-	3	2	IQCD	112130025	0.000000	0.05858	0.004000	0.12327	0.020000	0.10135	-1.217000	0.02979	-0.123000	0.11745	-0.448000	0.05591	GAG	IQCD	-	NULL	ENSG00000166578		0.552	IQCD-004	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	IQCD	HGNC	protein_coding	OTTHUMT00000405327.1	-	0.00	40	0	C	NM_138451		113645642	-1	tier1	-	no_errors	ENST00000416617	ensembl	human	known	74_37	missense	18.75	13	3	SNP	0.000	G
ISX	91464	genome.wustl.edu	37	22	35481479	35481479	+	Silent	SNP	G	G	A	rs557242882		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr22:35481479G>A	ENST00000308700.6	+	4	1483	c.531G>A	c.(529-531)agG>agA	p.R177R	ISX_ENST00000404699.2_Silent_p.R177R	NM_001008494.1	NP_001008494.1	Q2M1V0	ISX_HUMAN	intestine-specific homeobox	177					regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of vitamin A metabolic process (GO:1901738)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(12)|ovary(3)|prostate(1)|skin(4)	26						CTCTGCGCAGGCTGGCTCCTC	0.607																																																	0													134.0	118.0	123.0					22																	35481479		2203	4300	6503	SO:0001819	synonymous_variant	0			AK025181	CCDS33640.1	22q12.3	2011-06-20			ENSG00000175329	ENSG00000175329		"""Homeoboxes / PRD class"""	28084	protein-coding gene	gene with protein product		612019					Standard	NM_001008494		Approved	RAXLX	uc003anj.3	Q2M1V0	OTTHUMG00000150962	ENST00000308700.6:c.531G>A	22.37:g.35481479G>A			Q68DJ5	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.R177	ENST00000308700.6	37	c.531	CCDS33640.1	22																																																																																			ISX	-	NULL	ENSG00000175329		0.607	ISX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISX	HGNC	protein_coding	OTTHUMT00000320662.1	-	0.00	37	0	G	NM_001008494		35481479	+1	tier1	-	no_errors	ENST00000308700	ensembl	human	known	74_37	silent	17.65	14	3	SNP	0.000	A
ITIH2	3698	genome.wustl.edu	37	10	7759658	7759658	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:7759658C>T	ENST00000358415.4	+	6	703	c.537C>T	c.(535-537)ttC>ttT	p.F179F	ITIH2_ENST00000480387.1_3'UTR|ITIH2_ENST00000379587.4_Silent_p.F168F	NM_002216.2	NP_002207.2	P19823	ITIH2_HUMAN	inter-alpha-trypsin inhibitor heavy chain 2	179	VIT. {ECO:0000255|PROSITE- ProRule:PRU00801}.				hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(2)|breast(1)|endometrium(8)|kidney(1)|large_intestine(17)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64						AGGTGCAGTTCGAACTTCACT	0.507																																																	0													159.0	159.0	159.0					10																	7759658		2203	4300	6503	SO:0001819	synonymous_variant	0			X07173	CCDS31141.1	10p14	2011-10-26	2011-10-26		ENSG00000151655	ENSG00000151655			6167	protein-coding gene	gene with protein product		146640	"""inter-alpha (globulin) inhibitor, H2 polypeptide"""			1385302, 10100603	Standard	NM_002216		Approved	H2P	uc001ijs.3	P19823	OTTHUMG00000017633	ENST00000358415.4:c.537C>T	10.37:g.7759658C>T			Q14659|Q15484|Q5T986	Silent	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.F179	ENST00000358415.4	37	c.537	CCDS31141.1	10																																																																																			ITIH2	-	pfam_VIT,smart_VIT	ENSG00000151655		0.507	ITIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH2	HGNC	protein_coding	OTTHUMT00000046678.2		0.00	56	0	C	NM_002216		7759658	+1			no_errors	ENST00000358415	ensembl	human	known	74_37	silent	6.25	30	2	SNP	0.999	T
JRKL	8690	genome.wustl.edu	37	11	96125281	96125281	+	Missense_Mutation	SNP	G	G	T	rs370255954		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:96125281G>T	ENST00000332349.4	+	2	1715	c.1468G>T	c.(1468-1470)Gat>Tat	p.D490Y	CCDC82_ENST00000542662.1_5'Flank|JRKL_ENST00000458427.1_Missense_Mutation_p.D490Y|JRKL_ENST00000546177.1_Intron|CCDC82_ENST00000525786.1_5'Flank	NM_001261833.1	NP_001248762.1	Q9Y4A0	JERKL_HUMAN	JRK-like	490					central nervous system development (GO:0007417)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)		BRCA - Breast invasive adenocarcinoma(274;0.148)		AAATTTATTGGATTATCTAGA	0.383													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21470	0.0		0.0	False		,,,				2504	0.0																0								G	TYR/ASP	1,4401	2.1+/-5.4	0,1,2200	51.0	44.0	47.0		1468	3.6	1.0	11		47	0,8596		0,0,4298	no	missense	JRKL	NM_003772.3	160	0,1,6498	TT,TG,GG		0.0,0.0227,0.0077	probably-damaging	490/525	96125281	1,12997	2201	4298	6499	SO:0001583	missense	0			AF004715	CCDS8308.1	11q21	2014-03-28	2014-03-28		ENSG00000183340	ENSG00000183340			6200	protein-coding gene	gene with protein product		603211	"""erky (mouse) homolog-like"", ""jerky homolog-like (mouse)"""			9240447	Standard	NM_003772		Approved	HHMJG	uc009ywu.4	Q9Y4A0	OTTHUMG00000154950	ENST00000332349.4:c.1468G>T	11.37:g.96125281G>T	ENSP00000333350:p.Asp490Tyr		A8K3G4|B2RAJ3|Q32MC2	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.D490Y	ENST00000332349.4	37	c.1468	CCDS8308.1	11	.	.	.	.	.	.	.	.	.	.	G	14.44	2.535565	0.45176	2.27E-4	0.0	ENSG00000183340	ENST00000332349;ENST00000458427	T;T	0.24151	1.87;1.87	4.53	3.59	0.41128	.	0.168064	0.28114	N	0.016543	T	0.37348	0.1000	L	0.52573	1.65	0.34968	D	0.752892	D	0.76494	0.999	D	0.64042	0.921	T	0.48514	-0.9029	10	0.59425	D	0.04	-13.653	7.8162	0.29260	0.1144:0.0:0.8856:0.0	.	490	Q9Y4A0	JERKL_HUMAN	Y	490	ENSP00000333350:D490Y;ENSP00000389989:D490Y	ENSP00000333350:D490Y	D	+	1	0	JRKL	95764929	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	3.146000	0.50631	2.228000	0.72767	0.462000	0.41574	GAT	JRKL	-	NULL	ENSG00000183340		0.383	JRKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JRKL	HGNC	protein_coding	OTTHUMT00000337775.2	-	0.00	27	0	G	NM_003772		96125281	+1	tier1	-	no_errors	ENST00000332349	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	T
KCNG2	26251	genome.wustl.edu	37	18	77659371	77659371	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr18:77659371C>T	ENST00000316249.3	+	2	956	c.956C>T	c.(955-957)gCg>gTg	p.A319V	KCNG2_ENST00000590307.1_3'UTR	NM_012283.1	NP_036415.1	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G, member 2	319					energy reserve metabolic process (GO:0006112)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of heart contraction (GO:0008016)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(2)|endometrium(4)|lung(7)|skin(1)|upper_aerodigestive_tract(4)	18		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		CGCCGCTGCGCGCGCGAGTTC	0.741																																																	0													6.0	8.0	7.0					18																	77659371		2074	4063	6137	SO:0001583	missense	0			AJ011021	CCDS12019.1	18q23	2011-07-05			ENSG00000178342	ENSG00000178342		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6249	protein-coding gene	gene with protein product		605696				10551266, 16382104	Standard	NM_012283		Approved	Kv6.2, KCNF2	uc010xfl.2	Q9UJ96	OTTHUMG00000044541	ENST00000316249.3:c.956C>T	18.37:g.77659371C>T	ENSP00000315654:p.Ala319Val			Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv	p.A319V	ENST00000316249.3	37	c.956	CCDS12019.1	18	.	.	.	.	.	.	.	.	.	.	C	14.74	2.625612	0.46840	.	.	ENSG00000178342	ENST00000316249	D	0.98400	-4.91	3.19	2.31	0.28768	Ion transport (1);	0.222920	0.36519	U	0.002555	D	0.92711	0.7683	N	0.25957	0.775	0.30673	N	0.753176	B	0.32829	0.386	B	0.25884	0.064	D	0.87853	0.2659	10	0.02654	T	1	.	9.7774	0.40628	0.0:0.8958:0.0:0.1042	.	319	Q9UJ96	KCNG2_HUMAN	V	319	ENSP00000315654:A319V	ENSP00000315654:A319V	A	+	2	0	KCNG2	75760359	1.000000	0.71417	0.998000	0.56505	0.740000	0.42216	4.981000	0.63819	0.538000	0.28769	0.411000	0.27672	GCG	KCNG2	-	pfam_Ion_trans_dom	ENSG00000178342		0.741	KCNG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG2	HGNC	protein_coding	OTTHUMT00000103906.1	-	0.00	26	0	C	NM_012283		77659371	+1	tier1	-	no_errors	ENST00000316249	ensembl	human	known	74_37	missense	27.78	13	5	SNP	1.000	T
KCNJ12	3768	genome.wustl.edu	37	17	21319751	21319751	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:21319751A>C	ENST00000583088.1	+	3	1992	c.1097A>C	c.(1096-1098)aAg>aCg	p.K366T	KCNJ12_ENST00000331718.5_Missense_Mutation_p.K366T	NM_021012.4	NP_066292.2	Q14500	KCJ12_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 12	366					muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart contraction (GO:0008016)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|intrinsic component of membrane (GO:0031224)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			NS(1)|breast(4)|endometrium(4)|kidney(1)|large_intestine(5)|lung(39)|ovary(5)|skin(8)|stomach(3)	70				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)|Yohimbine(DB01392)	GTAGAGAACAAGTTCCTGCTG	0.587										Prostate(3;0.18)																																							0													100.0	93.0	95.0					17																	21319751		2203	4300	6503	SO:0001583	missense	0			L36069	CCDS11219.1	17p11.1	2011-07-05	2004-01-13		ENSG00000184185	ENSG00000184185		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6258	protein-coding gene	gene with protein product		602323	"""potassium inwardly-rectifying channel, subfamily J, inhibitor 1"""	KCNJN1		7859381, 12417321, 16382105	Standard	NM_021012		Approved	Kir2.2, Kir2.2v, IRK2, hIRK1	uc021tss.1	Q14500	OTTHUMG00000132039	ENST00000583088.1:c.1097A>C	17.37:g.21319751A>C	ENSP00000463778:p.Lys366Thr		O43401|Q15756|Q8NG63	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	p.K366T	ENST00000583088.1	37	c.1097	CCDS11219.1	17	.	.	.	.	.	.	.	.	.	.	A	14.17	2.456347	0.43634	.	.	ENSG00000184185	ENST00000331718	D	0.94576	-3.46	5.65	5.65	0.86999	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.097289	0.64402	D	0.000002	D	0.92545	0.7632	L	0.50333	1.59	0.80722	D	1	B	0.19445	0.036	B	0.20577	0.03	D	0.89791	0.3968	10	0.56958	D	0.05	.	15.8643	0.79052	1.0:0.0:0.0:0.0	.	366	Q14500	IRK12_HUMAN	T	366	ENSP00000328150:K366T	ENSP00000328150:K366T	K	+	2	0	KCNJ12	21260344	1.000000	0.71417	1.000000	0.80357	0.531000	0.34715	9.170000	0.94795	2.154000	0.67381	0.523000	0.50628	AAG	KCNJ12	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir2.2	ENSG00000184185		0.587	KCNJ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ12	HGNC	protein_coding	OTTHUMT00000255060.2	-	0.00	113	0	A	NM_021012		21319751	+1	tier1	-	no_errors	ENST00000331718	ensembl	human	known	74_37	missense	22.81	44	13	SNP	1.000	C
KCNT2	343450	genome.wustl.edu	37	1	196197421	196197421	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:196197421T>A	ENST00000294725.9	-	28	4256	c.3341A>T	c.(3340-3342)gAg>gTg	p.E1114V	KCNT2_ENST00000367433.5_Missense_Mutation_p.E1090V|KCNT2_ENST00000367431.4_Missense_Mutation_p.E1048V|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.E1047V			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1114					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						TCGACTGGGCTCACTGTTTGG	0.348																																																	0													76.0	74.0	75.0					1																	196197421		2203	4300	6503	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.3341A>T	1.37:g.196197421T>A	ENSP00000294725:p.Glu1114Val		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.E1114V	ENST00000294725.9	37	c.3341	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	T	9.102	1.004379	0.19199	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.19532	2.14;2.15;2.42	5.62	2.04	0.26737	.	0.097479	0.44688	D	0.000431	T	0.08626	0.0214	N	0.08118	0	0.80722	D	1	B;B;B	0.18968	0.032;0.032;0.008	B;B;B	0.25614	0.038;0.062;0.01	T	0.16689	-1.0394	10	0.45353	T	0.12	-14.2906	1.5606	0.02594	0.1181:0.1743:0.2937:0.4139	.	1090;1047;1114	Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;KCNT2_HUMAN	V	1090;1048;1114	ENSP00000356403:E1090V;ENSP00000356401:E1048V;ENSP00000294725:E1114V	ENSP00000294725:E1114V	E	-	2	0	KCNT2	194464044	0.984000	0.35163	0.973000	0.42090	0.326000	0.28443	2.360000	0.44151	0.971000	0.38288	-0.361000	0.07541	GAG	KCNT2	-	NULL	ENSG00000162687		0.348	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	-	0.00	78	0	T	NM_198503		196197421	-1	tier1	-	no_errors	ENST00000294725	ensembl	human	known	74_37	missense	34.69	32	17	SNP	0.991	A
KCNT2	343450	genome.wustl.edu	37	1	196577475	196577475	+	5'UTR	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:196577475T>C	ENST00000294725.9	-	0	880				KCNT2_ENST00000367433.5_5'UTR|KCNT2_ENST00000367431.4_5'UTR|KCNT2_ENST00000451324.2_5'UTR|KCNT2_ENST00000609185.1_5'UTR			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2						potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						AAACAACAAATGGAGGAGAGG	0.517																																																	0													60.0	54.0	56.0					1																	196577475		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.-36A>G	1.37:g.196577475T>C			Q3SY59|Q5VTN1|Q6ZMT3	RNA	SNP	-	NULL	ENST00000294725.9	37	NULL	CCDS1384.1	1																																																																																			KCNT2	-	-	ENSG00000162687		0.517	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	-	0.00	58	0	T	NM_198503		196577475	-1	tier1	-	no_errors	ENST00000610076	ensembl	human	known	74_37	rna	30.00	13	6	SNP	0.000	C
KDM6A	7403	genome.wustl.edu	37	X	44941852	44941852	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:44941852A>T	ENST00000377967.4	+	21	3217	c.3176A>T	c.(3175-3177)gAc>gTc	p.D1059V	KDM6A_ENST00000382899.4_Missense_Mutation_p.D1066V|KDM6A_ENST00000543216.1_Missense_Mutation_p.D980V|KDM6A_ENST00000536777.1_Missense_Mutation_p.D1014V	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1059	Interaction with SUPT6H. {ECO:0000250}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						CATCATAAAGACCACTCAGAT	0.328			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)			Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	6	Whole gene deletion(6)	oesophagus(2)|breast(2)|pancreas(2)											104.0	95.0	98.0					X																	44941852		2203	4300	6503	SO:0001583	missense	0			AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.3176A>T	X.37:g.44941852A>T	ENSP00000367203:p.Asp1059Val		Q52LL9|Q5JVQ7	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TPR_1,smart_TPR_repeat,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D1066V	ENST00000377967.4	37	c.3197	CCDS14265.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.86|13.86	2.361658|2.361658	0.41801|0.41801	.|.	.|.	ENSG00000147050|ENSG00000147050	ENST00000334516;ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216|ENST00000414389;ENST00000433797	T;T;T;T|.	0.78003|.	-1.14;-1.14;-1.14;-1.14|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.150423|.	0.64402|.	D|.	0.000020|.	T|T	0.60444|0.60444	0.2269|0.2269	L|L	0.42245|0.42245	1.32|1.32	0.80722|0.80722	D|D	1|1	B;P;P;B;P|.	0.48911|.	0.001;0.852;0.917;0.286;0.628|.	B;P;P;B;B|.	0.53722|.	0.001;0.474;0.733;0.12;0.42|.	T|T	0.57670|0.57670	-0.7771|-0.7771	10|5	0.87932|.	D|.	0|.	-2.3728|-2.3728	14.6404|14.6404	0.68720|0.68720	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	698;1066;1014;1111;1059|.	B4E0L8;F8W8R6;F5H6S1;B7ZKN5;O15550|.	.;.;.;.;KDM6A_HUMAN|.	V|S	756;1059;1014;1066;980|656;701	ENSP00000367203:D1059V;ENSP00000437405:D1014V;ENSP00000372355:D1066V;ENSP00000443078:D980V|.	ENSP00000334340:D756V|.	D|R	+|+	2|3	0|2	KDM6A|KDM6A	44826796|44826796	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.927000|0.927000	0.56198|0.56198	7.165000|7.165000	0.77544|0.77544	1.838000|1.838000	0.53458|0.53458	0.437000|0.437000	0.28790|0.28790	GAC|AGA	KDM6A	-	NULL	ENSG00000147050		0.328	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM6A	HGNC	protein_coding	OTTHUMT00000056324.1	-	0.00	80	0	A	NM_021140		44941852	+1	tier1	-	no_errors	ENST00000382899	ensembl	human	known	74_37	missense	14.29	42	7	SNP	1.000	T
KIAA0319	9856	genome.wustl.edu	37	6	24566912	24566912	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:24566912G>A	ENST00000378214.3	-	14	2729	c.2205C>T	c.(2203-2205)tcC>tcT	p.S735S	KIAA0319_ENST00000430948.2_Silent_p.S690S|KIAA0319_ENST00000543707.1_Silent_p.S735S|KIAA0319_ENST00000535378.1_Silent_p.S726S|KIAA0319_ENST00000537886.1_Silent_p.S735S	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	735	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						CCAAAGTAATGGAATTATTGG	0.448																																																	0													107.0	107.0	107.0					6																	24566912		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.2205C>T	6.37:g.24566912G>A			A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Silent	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_MANSC_N,smart_Fibronectin_type3,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.S735	ENST00000378214.3	37	c.2205	CCDS34348.1	6																																																																																			KIAA0319	-	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_Fibronectin_type3,smart_PKD/Chitinase_dom	ENSG00000137261		0.448	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	HGNC	protein_coding	OTTHUMT00000040009.1		0.00	49	0	G	NM_014809		24566912	-1			no_errors	ENST00000378214	ensembl	human	known	74_37	silent	15.79	16	3	SNP	1.000	A
KIAA1377	57562	genome.wustl.edu	37	11	101833020	101833020	+	Silent	SNP	C	C	T	rs138616617	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:101833020C>T	ENST00000263468.8	+	6	1524	c.1254C>T	c.(1252-1254)agC>agT	p.S418S	KIAA1377_ENST00000537689.1_Silent_p.S219S	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	418										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		TTAAATTTAGCAAATCCCAAA	0.388																																																	0													58.0	61.0	60.0					11																	101833020		2203	4299	6502	SO:0001819	synonymous_variant	0			AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.1254C>T	11.37:g.101833020C>T			Q4G0U6	Silent	SNP	NULL	p.S418	ENST00000263468.8	37	c.1254	CCDS31658.1	11																																																																																			KIAA1377	-	NULL	ENSG00000110318		0.388	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1377	HGNC	protein_coding	OTTHUMT00000394140.1	-	0.00	53	0	C	NM_020802		101833020	+1	tier1	-	no_errors	ENST00000263468	ensembl	human	known	74_37	silent	11.11	24	3	SNP	0.871	T
KIF1B	23095	genome.wustl.edu	37	1	10421049	10421049	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:10421049G>T	ENST00000377086.1	+	39	4320	c.4118G>T	c.(4117-4119)cGa>cTa	p.R1373L	KIF1B_ENST00000465635.1_3'UTR|KIF1B_ENST00000263934.6_Missense_Mutation_p.R1327L|KIF1B_ENST00000377081.1_Missense_Mutation_p.R1373L			O60333	KIF1B_HUMAN	kinesin family member 1B	1373					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CTTCTGAACCGAGTGACACCC	0.483																																																	0													216.0	177.0	190.0					1																	10421049		2203	4300	6503	SO:0001583	missense	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4118G>T	1.37:g.10421049G>T	ENSP00000366290:p.Arg1373Leu		A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R1327L	ENST00000377086.1	37	c.3980		1	.	.	.	.	.	.	.	.	.	.	G	36	5.746051	0.96882	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	D;D;D	0.82433	-1.5;-1.61;-1.61	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.93086	0.7799	M	0.90198	3.095	0.80722	D	1	D;D;P;D;P;P	0.89917	0.99;1.0;0.948;0.999;0.922;0.949	P;D;P;D;P;P	0.91635	0.898;0.999;0.767;0.987;0.605;0.451	D	0.93748	0.7056	10	0.66056	D	0.02	.	19.6223	0.95663	0.0:0.0:1.0:0.0	.	1359;1333;1373;1347;1373;1327	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	L	1373;1327;1373;1373	ENSP00000263934:R1327L;ENSP00000366290:R1373L;ENSP00000366284:R1373L	ENSP00000263934:R1327L	R	+	2	0	KIF1B	10343636	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.813000	0.99286	2.712000	0.92718	0.561000	0.74099	CGA	KIF1B	-	pfam_Kinesin-like	ENSG00000054523		0.483	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1		0.00	58	0	G			10421049	+1			no_errors	ENST00000263934	ensembl	human	known	74_37	missense	8.70	21	2	SNP	1.000	T
KIAA1614	57710	genome.wustl.edu	37	1	180897674	180897674	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:180897674C>T	ENST00000367588.4	+	4	1225	c.1170C>T	c.(1168-1170)agC>agT	p.S390S	KIAA1614_ENST00000367587.1_Silent_p.S11S	NM_020950.1	NP_066001.1	Q5VZ46	K1614_HUMAN	KIAA1614	390										NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(5)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	33						TCCGTGCCAGCCATGACATCG	0.672																																																	0													24.0	29.0	27.0					1																	180897674		2043	4205	6248	SO:0001819	synonymous_variant	0			AB046834	CCDS41442.1	1q25.3	2008-02-05			ENSG00000135835	ENSG00000135835			29327	protein-coding gene	gene with protein product							Standard	NM_020950		Approved		uc001gok.2	Q5VZ46	OTTHUMG00000035183	ENST00000367588.4:c.1170C>T	1.37:g.180897674C>T			Q5VZ45|Q9HCF8	Silent	SNP	NULL	p.S390	ENST00000367588.4	37	c.1170	CCDS41442.1	1																																																																																			KIAA1614	-	NULL	ENSG00000135835		0.672	KIAA1614-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1614	HGNC	protein_coding	OTTHUMT00000085151.1	-	0.00	74	0	C	XM_046531		180897674	+1	tier1	-	no_errors	ENST00000367588	ensembl	human	known	74_37	silent	8.00	46	4	SNP	1.000	T
KLF3	51274	genome.wustl.edu	37	4	38696528	38696528	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:38696528G>T	ENST00000261438.5	+	5	1161		c.e5+1			NM_016531.5	NP_057615.3	P57682	KLF3_HUMAN	Kruppel-like factor 3 (basic)						cellular response to peptide (GO:1901653)|multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18						ACACACACAGGTAATAGAAAC	0.393																																																	0													96.0	85.0	88.0					4																	38696528		2203	4300	6503	SO:0001630	splice_region_variant	0			AF285837	CCDS3444.1	4p16.1-p15.2	2013-01-08			ENSG00000109787	ENSG00000109787		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	16516	protein-coding gene	gene with protein product	"""basic Kruppel-like factor"""	609392				18391014	Standard	NM_016531		Approved	BKLF	uc003gth.4	P57682	OTTHUMG00000097821	ENST00000261438.5:c.856+1G>T	4.37:g.38696528G>T			Q6PIR1|Q86TN0|Q9P2X6	Splice_Site	SNP	-	e4+1	ENST00000261438.5	37	c.856+1	CCDS3444.1	4	.	.	.	.	.	.	.	.	.	.	G	26.1	4.703761	0.88924	.	.	ENSG00000109787	ENST00000261438	.	.	.	6.17	6.17	0.99709	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KLF3	38372923	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	.	KLF3	-	-	ENSG00000109787		0.393	KLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF3	HGNC	protein_coding	OTTHUMT00000215093.2	-	0.00	83	0	G		Intron	38696528	+1	tier1	-	no_errors	ENST00000261438	ensembl	human	known	74_37	splice_site	15.38	22	4	SNP	1.000	T
KIT	3815	genome.wustl.edu	37	4	55592080	55592080	+	Silent	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:55592080G>T	ENST00000288135.5	+	9	1501	c.1404G>T	c.(1402-1404)ccG>ccT	p.P468P		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	468	Ig-like C2-type 5.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.P468P(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CTGGGCCACCGTTTGGAAAGC	0.453		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	1	Substitution - coding silent(1)	central_nervous_system(1)											111.0	101.0	104.0					4																	55592080		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1404G>T	4.37:g.55592080G>T			B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Silent	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.P468	ENST00000288135.5	37	c.1404	CCDS3496.1	4																																																																																			KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt	ENSG00000157404		0.453	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	-	0.00	43	0	G			55592080	+1	tier1	-	no_errors	ENST00000288135	ensembl	human	known	74_37	silent	20.00	16	4	SNP	0.004	T
KLHL8	57563	genome.wustl.edu	37	4	88085157	88085157	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:88085157C>A	ENST00000273963.5	-	9	1953	c.1612G>T	c.(1612-1614)Gca>Tca	p.A538S	KLHL8_ENST00000425278.2_Missense_Mutation_p.A355S|KLHL8_ENST00000545252.1_Missense_Mutation_p.A187S|KLHL8_ENST00000498875.2_Missense_Mutation_p.A462S|KLHL8_ENST00000512111.1_Missense_Mutation_p.A538S	NM_020803.3	NP_065854.3	Q9P2G9	KLHL8_HUMAN	kelch-like family member 8	538					protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		GTAAGTGCTGCCACATAATCC	0.418																																																	0													118.0	114.0	115.0					4																	88085157		2203	4300	6503	SO:0001583	missense	0			AB037799	CCDS3617.1, CCDS75163.1	4q21.3	2013-01-30	2013-01-30		ENSG00000145332	ENSG00000145332		"""Kelch-like"", ""BTB/POZ domain containing"""	18644	protein-coding gene	gene with protein product		611967	"""kelch-like 8 (Drosophila)"""				Standard	XM_005263153		Approved	KIAA1378	uc003hql.1	Q9P2G9	OTTHUMG00000130593	ENST00000273963.5:c.1612G>T	4.37:g.88085157C>A	ENSP00000273963:p.Ala538Ser		Q53XA3|Q6N018	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_Kelch_2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.A538S	ENST00000273963.5	37	c.1612	CCDS3617.1	4	.	.	.	.	.	.	.	.	.	.	C	14.66	2.601601	0.46423	.	.	ENSG00000145332	ENST00000273963;ENST00000498875;ENST00000425278;ENST00000545252;ENST00000512111	T;T;T;T;T	0.78816	-1.21;-1.21;-1.21;-1.21;-1.21	5.53	5.53	0.82687	Galactose oxidase, beta-propeller (1);	0.173187	0.51477	D	0.000085	T	0.71221	0.3314	L	0.41492	1.28	0.44221	D	0.997055	B;B;B	0.17465	0.022;0.013;0.019	B;B;B	0.19946	0.027;0.012;0.026	T	0.67413	-0.5677	10	0.49607	T	0.09	.	14.3079	0.66395	0.1485:0.8515:0.0:0.0	.	355;462;538	Q68DU9;Q6N018;Q9P2G9	.;.;KLHL8_HUMAN	S	538;462;355;187;538	ENSP00000273963:A538S;ENSP00000426451:A462S;ENSP00000408854:A355S;ENSP00000439514:A187S;ENSP00000424131:A538S	ENSP00000273963:A538S	A	-	1	0	KLHL8	88304181	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	2.832000	0.48152	2.583000	0.87209	0.563000	0.77884	GCA	KLHL8	-	pfam_Kelch_1,pfam_Kelch_2,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000145332		0.418	KLHL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL8	HGNC	protein_coding	OTTHUMT00000253040.1		0.00	69	0	C			88085157	-1			no_errors	ENST00000273963	ensembl	human	known	74_37	missense	7.41	25	2	SNP	1.000	A
KLK15	55554	genome.wustl.edu	37	19	51330365	51330365	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:51330365C>G	ENST00000598239.1	-	3	280	c.250G>C	c.(250-252)Gag>Cag	p.E84Q	KLK15_ENST00000416184.1_Missense_Mutation_p.E84Q|KLK15_ENST00000301421.2_Missense_Mutation_p.E84Q|KLK15_ENST00000326856.4_Missense_Mutation_p.E83Q|KLK15_ENST00000596931.1_Missense_Mutation_p.E83Q	NM_017509.2	NP_059979.2	Q9H2R5	KLK15_HUMAN	kallikrein-related peptidase 15	84	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(12)|skin(2)|upper_aerodigestive_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00758)|GBM - Glioblastoma multiforme(134;0.0143)		CGTAGTTGCTCTGGGCCATCG	0.647																																					Pancreas(140;10 2513 7143 9246)												0													82.0	70.0	74.0					19																	51330365		2203	4300	6503	SO:0001583	missense	0			AF242195	CCDS12805.1, CCDS12806.1, CCDS12806.2, CCDS62766.1	19q13.4	2008-02-05	2006-10-27			ENSG00000174562		"""Kallikreins"""	20453	protein-coding gene	gene with protein product		610601	"""kallikrein 15"""			11010966, 12439720, 16800724, 16800723	Standard	NM_017509		Approved	HSRNASPH, ACO, prostinogen	uc002ptl.3	Q9H2R5		ENST00000598239.1:c.250G>C	19.37:g.51330365C>G	ENSP00000469315:p.Glu84Gln		A0AUY8|Q15358|Q6ISI0|Q9H2R3|Q9H2R4|Q9H2R6|Q9HBG9	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.E84Q	ENST00000598239.1	37	c.250	CCDS12805.1	19	.	.	.	.	.	.	.	.	.	.	c	33	5.241245	0.95272	.	.	ENSG00000174562	ENST00000326856;ENST00000416184;ENST00000301421;ENST00000544946	D;D	0.89196	-2.48;-2.48	4.51	4.51	0.55191	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.47093	D	0.000251	D	0.91106	0.7200	L	0.37561	1.115	0.43412	D	0.995559	D;B;D;D	0.76494	0.998;0.181;0.984;0.999	P;B;D;D	0.74674	0.888;0.17;0.95;0.984	D	0.91936	0.5559	10	0.72032	D	0.01	.	15.1071	0.72329	0.0:1.0:0.0:0.0	.	84;83;84;84	Q6UBM2;Q6ISI0;Q9H2R5-4;Q9H2R5	.;.;.;KLK15_HUMAN	Q	84	ENSP00000415136:E84Q;ENSP00000301421:E84Q	ENSP00000301421:E84Q	E	-	1	0	KLK15	56022177	0.999000	0.42202	0.070000	0.20053	0.867000	0.49689	4.372000	0.59530	2.519000	0.84933	0.561000	0.74099	GAG	KLK15	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000174562		0.647	KLK15-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK15	HGNC	protein_coding	OTTHUMT00000465160.1	-	0.00	58	0	C	NM_017509		51330365	-1	tier1	-	no_errors	ENST00000598239	ensembl	human	known	74_37	missense	14.29	30	5	SNP	1.000	G
KMT2E	55904	genome.wustl.edu	37	7	104750965	104750965	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:104750965delC	ENST00000311117.3	+	25	4431	c.3886delC	c.(3886-3888)cagfs	p.Q1296fs	KMT2E_ENST00000334877.4_Intron|SRPK2_ENST00000493638.1_5'Flank|KMT2E_ENST00000257745.4_Frame_Shift_Del_p.Q1296fs|KMT2E_ENST00000334914.7_Frame_Shift_Del_p.Q351fs	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1296					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										GAGTCATGTTCAGTCTTCACC	0.468																																																	0													256.0	243.0	247.0					7																	104750965		2203	4300	6503	SO:0001589	frameshift_variant	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.3886delC	7.37:g.104750965delC	ENSP00000312379:p.Gln1296fs		B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Frame_Shift_Del	DEL	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.Q1296fs	ENST00000311117.3	37	c.3886	CCDS34723.1	7																																																																																			KMT2E	-	NULL	ENSG00000005483		0.468	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KMT2E	HGNC	protein_coding	OTTHUMT00000348697.1		0.00	46	0	C			104750965	+1	tier1		no_errors	ENST00000257745	ensembl	human	known	74_37	frame_shift_del	11.11	16	2	DEL	1.000	-
KMT2C	58508	genome.wustl.edu	37	7	151851097	151851097	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:151851097C>A	ENST00000262189.6	-	48	12492	c.12274G>T	c.(12274-12276)Gag>Tag	p.E4092*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.E4149*|KMT2C_ENST00000485241.1_5'UTR	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	4092					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TCTTTTACCTCAGCAGCTGTA	0.408																																																	0													112.0	113.0	113.0					7																	151851097		2203	4300	6503	SO:0001587	stop_gained	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.12274G>T	7.37:g.151851097C>A	ENSP00000262189:p.Glu4092*		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E4149*	ENST00000262189.6	37	c.12445	CCDS5931.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	55|55	23.738573|23.738573	0.99957|0.99957	.|.	.|.	ENSG00000055609|ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877;ENST00000418061|ENST00000360104	.|.	.|.	.|.	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	0.000000|.	0.45126|.	U|.	0.000393|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.15499|.	T|.	0.54|.	.|.	19.7157|19.7157	0.96119|0.96119	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	4092;4149;709;218|1652	.|.	ENSP00000262189:E4092X|.	E|X	-|-	1|2	0|2	MLL3|MLL3	151482030|151482030	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	6.013000|6.013000	0.70776|0.70776	2.749000|2.749000	0.94314|0.94314	0.655000|0.655000	0.94253|0.94253	GAG|TGA	KMT2C	-	NULL	ENSG00000055609		0.408	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	-	0.00	47	0	C			151851097	-1	tier1	-	no_errors	ENST00000355193	ensembl	human	known	74_37	nonsense	20.59	27	7	SNP	1.000	A
KPRP	448834	genome.wustl.edu	37	1	152732632	152732632	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:152732632A>G	ENST00000606109.1	+	1	596	c.568A>G	c.(568-570)Agt>Ggt	p.S190G	KPRP_ENST00000368773.1_Missense_Mutation_p.S190G			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	190	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCCTATAGCAGTTGTGGCCC	0.562																																																	0													146.0	144.0	144.0					1																	152732632		2203	4300	6503	SO:0001583	missense	0			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.568A>G	1.37:g.152732632A>G	ENSP00000475216:p.Ser190Gly			Missense_Mutation	SNP	NULL	p.S190G	ENST00000606109.1	37	c.568	CCDS30862.1	1	.	.	.	.	.	.	.	.	.	.	A	1.691	-0.503901	0.04261	.	.	ENSG00000203786	ENST00000368773	T	0.13307	2.6	4.73	1.0	0.19881	.	0.817195	0.10860	N	0.626232	T	0.02380	0.0073	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.46345	-0.9198	10	0.34782	T	0.22	-0.9989	6.3096	0.21156	0.6536:0.0:0.3464:0.0	.	190	Q5T749	KPRP_HUMAN	G	190	ENSP00000357762:S190G	ENSP00000357762:S190G	S	+	1	0	KPRP	150999256	0.006000	0.16342	0.001000	0.08648	0.015000	0.08874	0.572000	0.23684	0.075000	0.16796	0.533000	0.62120	AGT	KPRP	-	NULL	ENSG00000203786		0.562	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	HGNC	protein_coding	OTTHUMT00000034522.2	-	0.00	65	0	A	NM_001025231		152732632	+1	tier1	-	no_errors	ENST00000368773	ensembl	human	known	74_37	missense	14.29	30	5	SNP	0.001	G
KRT38	8687	genome.wustl.edu	37	17	39597021	39597021	+	Missense_Mutation	SNP	A	A	T	rs570504021		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:39597021A>T	ENST00000246646.3	-	1	152	c.153T>A	c.(151-153)caT>caA	p.H51Q		NM_006771.3	NP_006762.3	O76015	KRT38_HUMAN	keratin 38	51	Head.					extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	29		Breast(137;0.000496)				CTCGGTTGGCATGTGCCACGT	0.632																																																	0													48.0	50.0	49.0					17																	39597021		2203	4300	6503	SO:0001583	missense	0			Y16794	CCDS11392.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000171360	ENSG00000171360		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6456	protein-coding gene	gene with protein product		604542	"""keratin, hair, acidic, 8"""	KRTHA8		9756910, 16831889	Standard	NM_006771		Approved		uc002hwq.1	O76015	OTTHUMG00000133439	ENST00000246646.3:c.153T>A	17.37:g.39597021A>T	ENSP00000246646:p.His51Gln		A2RRM5|Q6A164	Missense_Mutation	SNP	pfam_IF,prints_Keratin_I	p.H51Q	ENST00000246646.3	37	c.153	CCDS11392.1	17	.	.	.	.	.	.	.	.	.	.	A	10.97	1.502822	0.26949	.	.	ENSG00000171360	ENST00000246646	T	0.81330	-1.48	4.6	-3.41	0.04839	.	0.129647	0.34750	N	0.003708	T	0.66086	0.2754	L	0.47190	1.495	0.09310	N	1	B	0.22346	0.068	B	0.15870	0.014	T	0.50215	-0.8854	10	0.28530	T	0.3	.	6.772	0.23598	0.4732:0.1308:0.3959:0.0	.	51	O76015	KRT38_HUMAN	Q	51	ENSP00000246646:H51Q	ENSP00000246646:H51Q	H	-	3	2	KRT38	36850547	0.000000	0.05858	0.002000	0.10522	0.031000	0.12232	-3.025000	0.00640	-1.029000	0.03317	-2.209000	0.00301	CAT	KRT38	-	NULL	ENSG00000171360		0.632	KRT38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT38	HGNC	protein_coding	OTTHUMT00000257307.2		0.00	38	0	A	NM_006771		39597021	-1			no_errors	ENST00000246646	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.000	T
KRTAP10-9	386676	genome.wustl.edu	37	21	46047294	46047294	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr21:46047294C>T	ENST00000397911.3	+	1	255	c.206C>T	c.(205-207)tCa>tTa	p.S69L	KRTAP10-9_ENST00000484861.1_Intron|TSPEAR_ENST00000323084.4_Intron	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	69	25 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						CCCTGCCAATCAGGCTGCACC	0.701																																																	0													53.0	64.0	60.0					21																	46047294		2194	4292	6486	SO:0001583	missense	0			AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.206C>T	21.37:g.46047294C>T	ENSP00000381009:p.Ser69Leu		A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	NULL	p.S69L	ENST00000397911.3	37	c.206	CCDS42961.1	21	.	.	.	.	.	.	.	.	.	.	c	6.339	0.430610	0.12045	.	.	ENSG00000221837	ENST00000397911	T	0.00801	5.68	3.27	2.35	0.29111	.	.	.	.	.	T	0.01976	0.0062	M	0.89214	3.015	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.35599	-0.9782	8	.	.	.	.	4.8272	0.13421	0.0:0.7192:0.0:0.2808	.	69	P60411	KR109_HUMAN	L	69	ENSP00000381009:S69L	.	S	+	2	0	KRTAP10-9	44871722	0.002000	0.14202	0.006000	0.13384	0.006000	0.05464	1.510000	0.35790	1.530000	0.49136	0.603000	0.83216	TCA	KRTAP10-9	-	NULL	ENSG00000221837		0.701	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	HGNC	protein_coding	OTTHUMT00000128040.1	-	0.00	257	0	C			46047294	+1	tier1	-	no_errors	ENST00000397911	ensembl	human	known	74_37	missense	7.69	84	7	SNP	0.001	T
KRTAP16-1	100505753	genome.wustl.edu	37	17	39464715	39464715	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:39464715C>A	ENST00000391352.1	-	1	790	c.791G>T	c.(790-792)tGc>tTc	p.C264F		NM_001146182.1	NP_001139654.1	A8MUX0	KR161_HUMAN	keratin associated protein 16-1	264	11 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)				haematopoietic_and_lymphoid_tissue(1)	1						AGCTGGCTGGCAGATGCTAGA	0.612																																																	0																																										SO:0001583	missense	0			AP001708	CCDS56032.1	17q21.2	2012-07-04			ENSG00000212657	ENSG00000212657		"""Keratin associated proteins"""	18916	protein-coding gene	gene with protein product							Standard	NM_001146182		Approved	KAP16.1	uc021txi.1	A8MUX0	OTTHUMG00000133640	ENST00000391352.1:c.791G>T	17.37:g.39464715C>A	ENSP00000375147:p.Cys264Phe			Missense_Mutation	SNP	NULL	p.C264F	ENST00000391352.1	37	c.791	CCDS56032.1	17	.	.	.	.	.	.	.	.	.	.	C	11.79	1.744231	0.30865	.	.	ENSG00000212657	ENST00000391352	T	0.02606	4.23	5.4	5.4	0.78164	.	.	.	.	.	T	0.12475	0.0303	M	0.70595	2.14	0.38853	D	0.95631	.	.	.	.	.	.	T	0.00046	-1.2211	7	0.87932	D	0	.	16.7157	0.85397	0.0:1.0:0.0:0.0	.	.	.	.	F	264	ENSP00000375147:C264F	ENSP00000375147:C264F	C	-	2	0	KRTAP16-1	36718241	1.000000	0.71417	0.901000	0.35422	0.014000	0.08584	2.154000	0.42291	2.805000	0.96524	0.655000	0.94253	TGC	KRTAP16-1	-	NULL	ENSG00000212657		0.612	KRTAP16-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP16-1	HGNC	protein_coding	OTTHUMT00000257785.1	-	0.00	34	0	C	NM_001146182		39464715	-1	tier1	-	no_errors	ENST00000391352	ensembl	human	known	74_37	missense	8.33	66	6	SNP	0.985	A
LAMA2	3908	genome.wustl.edu	37	6	129380971	129380971	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:129380971G>T	ENST00000421865.2	+	3	375	c.326G>T	c.(325-327)tGg>tTg	p.W109L		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	109	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		AAGAACACTTGGTGGCAGAGT	0.363																																																	0													128.0	115.0	119.0					6																	129380971		2203	4299	6502	SO:0001583	missense	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.326G>T	6.37:g.129380971G>T	ENSP00000400365:p.Trp109Leu		Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.W109L	ENST00000421865.2	37	c.326	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	28.4	4.916009	0.92178	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	D	0.86497	-2.13	5.51	5.51	0.81932	Laminin, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.95430	0.8516	H	0.94222	3.51	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.96211	0.9153	10	0.87932	D	0	.	19.4688	0.94954	0.0:0.0:1.0:0.0	.	109;109	A6NF00;P24043	.;LAMA2_HUMAN	L	109	ENSP00000400365:W109L	ENSP00000346769:W109L	W	+	2	0	LAMA2	129422664	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.371000	0.97162	2.611000	0.88343	0.580000	0.79431	TGG	LAMA2	-	pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,pfscan_Laminin_N	ENSG00000196569		0.363	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	-	0.00	44	0	G			129380971	+1	tier1	-	no_errors	ENST00000421865	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	T
LAMB2	3913	genome.wustl.edu	37	3	49168865	49168865	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr3:49168865C>T	ENST00000418109.1	-	7	823	c.659G>A	c.(658-660)cGt>cAt	p.R220H	LAMB2_ENST00000305544.4_Missense_Mutation_p.R220H	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	220	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		GTCCAGCACACGATAGATGAC	0.602																																																	0													118.0	110.0	113.0					3																	49168865		2203	4300	6503	SO:0001583	missense	0				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.659G>A	3.37:g.49168865C>T	ENSP00000388325:p.Arg220His		Q16321	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.R220H	ENST00000418109.1	37	c.659	CCDS2789.1	3	.	.	.	.	.	.	.	.	.	.	c	19.73	3.882837	0.72410	.	.	ENSG00000172037	ENST00000418109;ENST00000305544;ENST00000494831	T;T;T	0.77620	-1.11;-1.11;-1.11	4.88	4.88	0.63580	Laminin, N-terminal (3);	0.175345	0.38492	N	0.001672	D	0.88987	0.6587	M	0.86805	2.84	0.44485	D	0.997428	D	0.76494	0.999	D	0.67900	0.954	D	0.89767	0.3951	10	0.48119	T	0.1	.	17.8259	0.88665	0.0:1.0:0.0:0.0	.	220	P55268	LAMB2_HUMAN	H	220;220;71	ENSP00000388325:R220H;ENSP00000307156:R220H;ENSP00000444751:R71H	ENSP00000307156:R220H	R	-	2	0	LAMB2	49143869	0.963000	0.33076	1.000000	0.80357	0.981000	0.71138	2.605000	0.46283	2.541000	0.85698	0.651000	0.88453	CGT	LAMB2	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000172037		0.602	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	HGNC	protein_coding	OTTHUMT00000345939.1	-	0.00	51	0	C	NM_002292		49168865	-1	tier1	-	no_errors	ENST00000305544	ensembl	human	known	74_37	missense	17.39	19	4	SNP	1.000	T
LAMTOR2	28956	genome.wustl.edu	37	1	156028130	156028130	+	Nonsense_Mutation	SNP	G	G	T	rs552090098		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:156028130G>T	ENST00000368305.4	+	4	484	c.346G>T	c.(346-348)Gag>Tag	p.E116*	RAB25_ENST00000361084.5_5'Flank|LAMTOR2_ENST00000368304.5_Nonsense_Mutation_p.E86*|LAMTOR2_ENST00000368302.3_Missense_Mutation_p.G128V	NM_014017.3	NP_054736.1	Q9Y2Q5	LTOR2_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 2	116					activation of MAPKK activity (GO:0000186)|cell growth (GO:0016049)|cellular protein localization (GO:0034613)|cellular response to amino acid stimulus (GO:0071230)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)	extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|Ragulator complex (GO:0071986)		p.E116K(1)		breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	7						GCAGTACCTGGAGGAGCCCCT	0.587																																																	1	Substitution - Missense(1)	cervix(1)											101.0	98.0	99.0					1																	156028130		2203	4300	6503	SO:0001587	stop_gained	0			BC024190	CCDS1128.1, CCDS44243.1	1q22	2014-09-17	2011-02-15	2011-02-15	ENSG00000116586	ENSG00000116586			29796	protein-coding gene	gene with protein product	"""mitogen activated protein binding protein interacting protein"", ""MAPKSP1 adaptor protein"", ""endosomal adaptor protein"""	610389	"""roadblock domain containing 3"""	ROBLD3		11042152	Standard	NM_014017		Approved	MAPBPIP, MAPKSP1AP, p14, ENDAP, Ragulator2	uc001fnb.3	Q9Y2Q5	OTTHUMG00000017462	ENST00000368305.4:c.346G>T	1.37:g.156028130G>T	ENSP00000357288:p.Glu116*		Q5VY97|Q5VY98|Q5VY99	Nonsense_Mutation	SNP	pfam_Dynein_light-rel,smart_Dynein_light-rel	p.E116*	ENST00000368305.4	37	c.346	CCDS1128.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	27.7|27.7	4.855863|4.855863	0.91355|0.91355	.|.	.|.	ENSG00000116586|ENSG00000116586	ENST00000368305;ENST00000368304|ENST00000368302	.|.	.|.	.|.	5.58|5.58	4.67|4.67	0.58626|0.58626	.|.	.|0.000000	.|0.42053	.|U	.|0.000777	.|T	.|0.65354	.|0.2683	.|.	.|.	.|.	0.52501|0.52501	D|D	0.999954|0.999954	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.71451	.|-0.4589	.|6	0.66056|0.87932	D|D	0.02|0	-4.2486|-4.2486	13.1713|13.1713	0.59599|0.59599	0.0776:0.0:0.9224:0.0|0.0776:0.0:0.9224:0.0	.|.	.|.	.|.	.|.	X|V	116;86|128	.|.	ENSP00000357287:E86X|ENSP00000357285:G128V	E|G	+|+	1|2	0|0	LAMTOR2|LAMTOR2	154294754|154294754	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.961000|0.961000	0.63080|0.63080	7.200000|7.200000	0.77838|0.77838	1.370000|1.370000	0.46153|0.46153	-0.136000|-0.136000	0.14681|0.14681	GAG|GGA	LAMTOR2	-	NULL	ENSG00000116586		0.587	LAMTOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMTOR2	HGNC	protein_coding	OTTHUMT00000046197.1		0.00	62	0	G	NM_014017		156028130	+1			no_errors	ENST00000368305	ensembl	human	known	74_37	nonsense	6.06	31	2	SNP	1.000	T
LAYN	143903	genome.wustl.edu	37	11	111425943	111425943	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:111425943G>A	ENST00000375615.3	+	6	795	c.610G>A	c.(610-612)Gag>Aag	p.E204K	LAYN_ENST00000375614.2_Missense_Mutation_p.E196K|LAYN_ENST00000528924.1_3'UTR|LAYN_ENST00000436913.2_Missense_Mutation_p.E51K|LAYN_ENST00000525126.1_Missense_Mutation_p.E204K|LAYN_ENST00000533265.1_Missense_Mutation_p.E196K	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	204						cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)	p.E196K(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	TGAGGAAACAGAGCTGACAAC	0.403																																					Ovarian(17;551 586 12136 22082 22900)												1	Substitution - Missense(1)	endometrium(1)											84.0	79.0	81.0					11																	111425943		2201	4297	6498	SO:0001583	missense	0				CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.610G>A	11.37:g.111425943G>A	ENSP00000364765:p.Glu204Lys		A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.E204K	ENST00000375615.3	37	c.610	CCDS58178.1	11	.	.	.	.	.	.	.	.	.	.	G	10.22	1.290657	0.23564	.	.	ENSG00000204381	ENST00000375614;ENST00000375615;ENST00000525126;ENST00000436913;ENST00000533265;ENST00000541011;ENST00000530962	T;T;T;T	0.06142	3.85;3.44;3.34;4.04	4.99	3.12	0.35913	.	0.373831	0.29093	N	0.013162	T	0.08179	0.0204	M	0.68317	2.08	0.21355	N	0.999716	B;B;B;B;B	0.24043	0.041;0.074;0.022;0.036;0.096	B;B;B;B;B	0.23018	0.026;0.03;0.007;0.015;0.043	T	0.22347	-1.0219	9	.	.	.	-10.2532	8.7408	0.34556	0.1769:0.0:0.8231:0.0	.	51;196;204;204;196	B4DJU0;E9PMI0;Q6UX15;E9PQU7;Q6UX15-2	.;.;LAYN_HUMAN;.;.	K	196;204;204;51;196;159;52	ENSP00000364764:E196K;ENSP00000364765:E204K;ENSP00000434328:E204K;ENSP00000434972:E196K	.	E	+	1	0	LAYN	110931153	0.525000	0.26290	0.053000	0.19242	0.175000	0.22909	1.586000	0.36611	0.816000	0.34421	0.655000	0.94253	GAG	LAYN	-	NULL	ENSG00000204381		0.403	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAYN	HGNC	protein_coding	OTTHUMT00000391187.1		0.00	52	0	G	NM_178834		111425943	+1			no_errors	ENST00000375615	ensembl	human	known	74_37	missense	8.00	23	2	SNP	0.358	A
LCN9	392399	genome.wustl.edu	37	9	138557718	138557718	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:138557718T>C	ENST00000277526.3	+	6	487	c.487T>C	c.(487-489)Tcc>Ccc	p.S163P	LCN9_ENST00000430290.2_3'UTR	NM_001001676.1	NP_001001676.1	Q8WX39	LCN9_HUMAN	lipocalin 9	163						extracellular region (GO:0005576)	pheromone binding (GO:0005550)|transporter activity (GO:0005215)			kidney(1)|large_intestine(2)|lung(2)|urinary_tract(1)	6		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;3.43e-07)|Epithelial(140;1.97e-06)|all cancers(34;6.1e-05)		TCCCTGCTACTCCAAGCATTA	0.687																																																	0													25.0	27.0	26.0					9																	138557718		1927	4136	6063	SO:0001583	missense	0			AY301270	CCDS56593.1	9q34	2011-11-14			ENSG00000148386	ENSG00000148386		"""Lipocalins"""	17442	protein-coding gene	gene with protein product	"""MUP-like lipocalin"", ""epididymal-specific lipocalin-9"""	612903				15363845	Standard	NM_001001676		Approved		uc004cgk.2	Q8WX39	OTTHUMG00000020916	ENST00000277526.3:c.487T>C	9.37:g.138557718T>C	ENSP00000277526:p.Ser163Pro		C9J5F0|Q6JVE7	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Maj_urinary,prints_Odour-bd,prints_Blactoglobulin	p.S163P	ENST00000277526.3	37	c.487	CCDS56593.1	9	.	.	.	.	.	.	.	.	.	.	T	11.44	1.640026	0.29157	.	.	ENSG00000148386	ENST00000277526	T	0.18960	2.18	1.77	-0.771	0.11002	Calycin-like (1);	.	.	.	.	T	0.08537	0.0212	N	0.22421	0.69	0.09310	N	1	P	0.43431	0.807	B	0.31290	0.127	T	0.27739	-1.0065	9	0.23302	T	0.38	13.9993	4.132	0.10154	0.0:0.5161:0.0:0.4839	.	163	Q8WX39	LCN9_HUMAN	P	163	ENSP00000277526:S163P	ENSP00000277526:S177P	S	+	1	0	LCN9	137697539	0.000000	0.05858	0.001000	0.08648	0.135000	0.20990	-0.403000	0.07214	-0.077000	0.12752	0.260000	0.18958	TCC	LCN9	-	superfamily_Calycin-like	ENSG00000148386		0.687	LCN9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LCN9	HGNC	protein_coding	OTTHUMT00000410711.1	-	0.00	48	0	T	NM_001001676		138557718	+1	tier1	-	no_errors	ENST00000277526	ensembl	human	known	74_37	missense	28.57	15	6	SNP	0.000	C
LCP2	3937	genome.wustl.edu	37	5	169702853	169702853	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:169702853T>G	ENST00000046794.5	-	4	815	c.200A>C	c.(199-201)aAg>aCg	p.K67T		NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	67	SAM.				blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		CTGACTTAACTTACTGAGAAT	0.453																																																	0													75.0	70.0	71.0					5																	169702853		1917	4118	6035	SO:0001583	missense	0				CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.200A>C	5.37:g.169702853T>G	ENSP00000046794:p.Lys67Thr		A8KA25|Q53XV4	Missense_Mutation	SNP	pfam_SH2,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,smart_SH2,pfscan_SH2	p.K67T	ENST00000046794.5	37	c.200	CCDS47339.1	5	.	.	.	.	.	.	.	.	.	.	T	18.55	3.649307	0.67358	.	.	ENSG00000043462	ENST00000046794	D	0.89050	-2.46	4.8	3.63	0.41609	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.000000	0.85682	D	0.000000	D	0.92786	0.7706	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91316	0.5078	9	.	.	.	-26.6306	7.4465	0.27213	0.0:0.1018:0.0:0.8982	.	67	Q13094	LCP2_HUMAN	T	67	ENSP00000046794:K67T	.	K	-	2	0	LCP2	169635431	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.567000	0.45956	0.936000	0.37367	0.482000	0.46254	AAG	LCP2	-	pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	ENSG00000043462		0.453	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP2	HGNC	protein_coding	OTTHUMT00000371727.1	-	0.00	88	0	T	NM_005565		169702853	-1	tier1	-	no_errors	ENST00000046794	ensembl	human	known	74_37	missense	35.00	26	14	SNP	1.000	G
MIR99AHG	388815	genome.wustl.edu	37	21	17442878	17442878	+	lincRNA	SNP	C	C	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr21:17442878C>G	ENST00000458468.1	+	0	27					NR_027790.1																						TGTAGGTACTCCATTGTCTGG	0.532																																																	0																																												0																															21.37:g.17442878C>G				RNA	SNP	-	NULL	ENST00000458468.1	37	NULL		21																																																																																			LINC00478	-	-	ENSG00000215386		0.532	LINC00478-001	KNOWN	basic	lincRNA	LINC00478	HGNC	lincRNA	OTTHUMT00000158029.1	-	0.00	51	0	C			17442878	+1	tier1	-	no_errors	ENST00000602935	ensembl	human	known	74_37	rna	17.95	32	7	SNP	1.000	G
LINC00483	55018	genome.wustl.edu	37	17	48844829	48844829	+	RNA	DEL	A	A	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:48844829delA	ENST00000502517.1	-	0	89							Q53H64	CQ073_HUMAN	long intergenic non-protein coding RNA 483																		CATACCTGGGAAAATGACCTT	0.522																																																	0																																												0			AK000701		17q21.33	2013-12-05	2013-12-05	2013-12-05	ENSG00000167117	ENSG00000167117		"""Long non-coding RNAs"""	26080	non-coding RNA	RNA, long non-coding			"""chromosome 17 open reading frame 73"""	C17orf73			Standard	NR_073199		Approved	FLJ20694	uc031rdf.1	Q53H64	OTTHUMG00000132429		17.37:g.48844829delA			Q9NWQ1	RNA	DEL	-	NULL	ENST00000502517.1	37	NULL		17																																																																																			LINC00483	-	-	ENSG00000167117		0.522	LINC00483-004	KNOWN	basic	lincRNA	LINC00483	HGNC	processed_transcript	OTTHUMT00000368129.1		0.00	30	0	A			48844829	-1	tier1		no_errors	ENST00000419688	ensembl	human	known	74_37	rna	5.13	37	2	DEL	0.024	-
RP11-435B5.5	0	genome.wustl.edu	37	1	143391834	143391834	+	lincRNA	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:143391834A>C	ENST00000428624.1	+	0	2050				RP11-435B5.4_ENST00000423249.1_lincRNA																							AAAAATTAGAAGAAATCCATT	0.294																																																	0																																												0																															1.37:g.143391834A>C				RNA	SNP	-	NULL	ENST00000428624.1	37	NULL		1																																																																																			RP11-435B5.5	-	-	ENSG00000238261		0.294	RP11-435B5.5-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	LOC101927345	Clone_based_vega_gene	lincRNA	OTTHUMT00000037971.1	-	0.00	299	0	A			143391834	+1	tier1	-	no_errors	ENST00000412492	ensembl	human	known	74_37	rna	16.88	128	26	SNP	0.998	C
SIRPG	55423	genome.wustl.edu	37	20	1617995	1617995	+	Intron	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr20:1617995A>C	ENST00000303415.3	-	3	495				RP11-77C3.3_ENST00000456177.1_RNA|SIRPG_ENST00000381580.1_Intron|SIRPG_ENST00000344103.4_Intron|SIRPG_ENST00000381583.2_Intron|SIRPG_ENST00000216927.4_Intron|RP11-77C3.3_ENST00000437384.1_RNA	NM_018556.3	NP_061026.2	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein gamma						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|stomach(1)	27						ACTGAAGTCAAGGTACATGGG	0.428																																																	0																																										SO:0001627	intron_variant	0			AB042624	CCDS13020.2, CCDS13021.2, CCDS33434.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000089012	ENSG00000089012		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15757	protein-coding gene	gene with protein product		605466	"""signal-regulatory protein beta 2"""	SIRPB2		11185750, 16339511	Standard	XM_005260749		Approved	bA77C3.1, SIRP-B2, SIRPgamma, CD172g	uc002wfm.1	Q9P1W8	OTTHUMG00000031680	ENST00000303415.3:c.431-844T>G	20.37:g.1617995A>C			B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	RNA	SNP	-	NULL	ENST00000303415.3	37	NULL	CCDS13020.2	20																																																																																			RP11-77C3.3	-	-	ENSG00000237914		0.428	SIRPG-005	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC101929010	Clone_based_vega_gene	protein_coding	OTTHUMT00000077566.2	-	0.00	71	0	A	NM_018556		1617995	+1	tier1	-	no_errors	ENST00000437384	ensembl	human	known	74_37	rna	16.67	40	8	SNP	0.038	C
PDCD6IPP2	646278	genome.wustl.edu	37	15	29052118	29052118	+	RNA	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:29052118C>T	ENST00000562423.1	+	0	601																											AAGAAGCAACCGATAATGATT	0.308																																																	0																																												0																															15.37:g.29052118C>T				RNA	SNP	-	NULL	ENST00000562423.1	37	NULL		15																																																																																			RP11-578F21.12	-	-	ENSG00000261377		0.308	RP11-578F21.12-004	PUTATIVE	basic	processed_transcript	LOC101929232	Clone_based_vega_gene	pseudogene	OTTHUMT00000431789.1	-	0.00	118	0	C			29052118	+1	tier1	-	no_errors	ENST00000562423	ensembl	human	putative	74_37	rna	11.11	48	6	SNP	0.997	T
FAR2P1	440905	genome.wustl.edu	37	2	130748048	130748048	+	IGR	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:130748048A>G								RAB6C (7737 upstream) : AC018865.8 (36369 downstream)																							GGTAGGTGCAAGAATTGGGCA	0.493																																																	0																																										SO:0001628	intergenic_variant	0																															2.37:g.130748048A>G				RNA	SNP	-	NULL		37	NULL		2																																																																																			AC018865.8	-	-	ENSG00000180178	0	0.493					LOC440905	Clone_based_vega_gene			-	0.00	34	0	A			130748048	-1	tier1	-	no_errors	ENST00000440931	ensembl	human	known	74_37	rna	29.63	19	8	SNP	0.996	G
LRP1B	53353	genome.wustl.edu	37	2	141130597	141130597	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:141130597T>C	ENST00000389484.3	-	69	11719	c.10748A>G	c.(10747-10749)gAt>gGt	p.D3583G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	3583	LDL-receptor class A 27. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GCTTTTCTCATCTTCCCCATA	0.363										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												0													217.0	211.0	213.0					2																	141130597		2203	4300	6503	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.10748A>G	2.37:g.141130597T>C	ENSP00000374135:p.Asp3583Gly		Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.D3583G	ENST00000389484.3	37	c.10748	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	T	31	5.066241	0.93898	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.99220	-5.58	5.67	5.67	0.87782	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	U	0.000000	D	0.99674	0.9878	H	0.98155	4.16	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.97338	0.9955	10	0.87932	D	0	.	15.907	0.79439	0.0:0.0:0.0:1.0	.	3583	Q9NZR2	LRP1B_HUMAN	G	3583;3521	ENSP00000374135:D3583G	ENSP00000374135:D3583G	D	-	2	0	LRP1B	140847067	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.694000	0.84235	2.164000	0.68074	0.533000	0.62120	GAT	LRP1B	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,pfscan_LDrepeatLR_classA_rpt	ENSG00000168702		0.363	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	-	0.00	62	0	T	NM_018557		141130597	-1	tier1	-	no_errors	ENST00000389484	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	C
LRP2	4036	genome.wustl.edu	37	2	170048427	170048427	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:170048427C>T	ENST00000263816.3	-	48	9232	c.8947G>A	c.(8947-8949)Gat>Aat	p.D2983N		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2983	LDL-receptor class A 22. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TGATTCTCATCGTAGCCGTCA	0.473																																																	0													97.0	91.0	93.0					2																	170048427		2203	4300	6503	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.8947G>A	2.37:g.170048427C>T	ENSP00000263816:p.Asp2983Asn		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.D2983N	ENST00000263816.3	37	c.8947	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	26.3	4.722723	0.89298	.	.	ENSG00000081479	ENST00000263816	D	0.99214	-5.57	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.99645	0.9869	H	0.95402	3.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97860	1.0280	10	0.87932	D	0	.	19.8764	0.96873	0.0:1.0:0.0:0.0	.	2983	P98164	LRP2_HUMAN	N	2983	ENSP00000263816:D2983N	ENSP00000263816:D2983N	D	-	1	0	LRP2	169756673	1.000000	0.71417	0.954000	0.39281	0.208000	0.24298	7.625000	0.83145	2.700000	0.92200	0.650000	0.86243	GAT	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.473	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	-	0.00	70	0	C	NM_004525		170048427	-1	tier1	-	no_errors	ENST00000263816	ensembl	human	known	74_37	missense	22.22	21	6	SNP	1.000	T
LRRC37A2	474170	genome.wustl.edu	37	17	44626071	44626071	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:44626071G>T	ENST00000576629.1	+	10	4061	c.3566G>T	c.(3565-3567)aGg>aTg	p.R1189M	ARL17A_ENST00000329240.4_Intron|ARL17A_ENST00000337845.7_Intron|ARL17A_ENST00000445552.2_Intron|LRRC37A2_ENST00000333412.3_Missense_Mutation_p.R1189M|ARL17A_ENST00000573185.1_Intron			A6NM11	L37A2_HUMAN	leucine rich repeat containing 37, member A2	1189						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|pancreas(4)|prostate(2)	15		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		AGCATCAGGAGGGAACAGGGT	0.582																																																	0													20.0	35.0	30.0					17																	44626071		1912	4013	5925	SO:0001583	missense	0			AY386262	CCDS42353.1	17q21.31	2013-05-14			ENSG00000238083	ENSG00000238083			32404	protein-coding gene	gene with protein product	"""c114 SLIT-like testicular protein"""						Standard	NM_001006607		Approved	FLJ45049	uc002ikn.1	A6NM11	OTTHUMG00000178032	ENST00000576629.1:c.3566G>T	17.37:g.44626071G>T	ENSP00000459551:p.Arg1189Met		B7ZMC3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.R1189M	ENST00000576629.1	37	c.3566	CCDS42353.1	17	.	.	.	.	.	.	.	.	.	.	g	12.68	2.011889	0.35511	.	.	ENSG00000238083	ENST00000333412	T	0.60797	0.16	3.08	-0.161	0.13371	.	.	.	.	.	T	0.65186	0.2667	L	0.56769	1.78	0.09310	N	1	D;D;D	0.76494	0.99;0.999;0.999	D;D;P	0.69654	0.962;0.965;0.846	T	0.52653	-0.8547	9	0.62326	D	0.03	.	5.088	0.14693	0.4443:0.0:0.5557:0.0	.	1189;150;1189	C9JSP5;B3KRJ4;A6NM11	.;.;L37A2_HUMAN	M	1189	ENSP00000333071:R1189M	ENSP00000333071:R1189M	R	+	2	0	LRRC37A2	41981387	0.001000	0.12720	0.000000	0.03702	0.041000	0.13682	-0.068000	0.11561	0.159000	0.19401	0.175000	0.17021	AGG	LRRC37A2	-	NULL	ENSG00000238083		0.582	LRRC37A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A2	HGNC	protein_coding	OTTHUMT00000440299.2	-	0.00	95	0	G	NM_001006607		44626071	+1	tier1	-	no_errors	ENST00000333412	ensembl	human	known	74_37	missense	12.07	51	7	SNP	0.000	T
MAGEB5	347541	genome.wustl.edu	37	X	26235707	26235707	+	Silent	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:26235707T>C	ENST00000602297.1	+	2	536	c.289T>C	c.(289-291)Ttg>Ctg	p.L97L	MAGEB5_ENST00000379029.2_Silent_p.L97L	NM_001271752.1	NP_001258681.1	Q9BZ81	MAGB5_HUMAN	melanoma antigen family B, 5	97	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									lung(1)|ovary(1)	2						TGCAGTTGACTTGAAGGAAGT	0.438																																																	0																																										SO:0001819	synonymous_variant	0			AF333705	CCDS65233.1	Xp22	2012-04-20			ENSG00000188408	ENSG00000188408			23795	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 3"""	300466				10861452	Standard	NM_001271752		Approved	MAGE-B5, CT3.3	uc031thc.1	Q9BZ81	OTTHUMG00000021288	ENST00000602297.1:c.289T>C	X.37:g.26235707T>C				Silent	SNP	pfam_MAGE,pfscan_MAGE	p.L97	ENST00000602297.1	37	c.289		X																																																																																			MAGEB5	-	pfam_MAGE,pfscan_MAGE	ENSG00000188408		0.438	MAGEB5-001	KNOWN	basic|appris_principal	protein_coding	MAGEB5	HGNC	protein_coding	OTTHUMT00000056126.2	-	0.00	21	0	T	XM_293407		26235707	+1	tier1	-	no_errors	ENST00000379029	ensembl	human	known	74_37	silent	53.33	7	8	SNP	0.000	C
MAGED1	9500	genome.wustl.edu	37	X	51644891	51644891	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:51644891C>T	ENST00000375722.1	+	12	2454	c.2202C>T	c.(2200-2202)ttC>ttT	p.F734F	MAGED1_ENST00000326587.7_Silent_p.F734F|MAGED1_ENST00000375695.2_Silent_p.F790F|MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000375772.3_Silent_p.F734F			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	734					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					CATTTACCTTCTGGGCCAGAT	0.547										Multiple Myeloma(10;0.10)																																							0													90.0	87.0	88.0					X																	51644891		2203	4300	6503	SO:0001819	synonymous_variant	0			AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.2202C>T	X.37:g.51644891C>T			Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.F790	ENST00000375722.1	37	c.2370	CCDS14337.1	X																																																																																			MAGED1	-	NULL	ENSG00000179222		0.547	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAGED1	HGNC	protein_coding	OTTHUMT00000056593.1	-	0.00	35	0	C	NM_001005332		51644891	+1	tier1	-	no_errors	ENST00000375695	ensembl	human	known	74_37	silent	62.50	9	15	SNP	1.000	T
MAGEE2	139599	genome.wustl.edu	37	X	75004002	75004002	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:75004002T>G	ENST00000373359.2	-	1	1077	c.885A>C	c.(883-885)aaA>aaC	p.K295N		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	295										autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGCTTCTTTCTTTGGTTTTGT	0.463																																																	0													69.0	65.0	66.0					X																	75004002		2203	4300	6503	SO:0001583	missense	0			AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.885A>C	X.37:g.75004002T>G	ENSP00000362457:p.Lys295Asn		Q5JSI5	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.K295N	ENST00000373359.2	37	c.885	CCDS14431.1	X	.	.	.	.	.	.	.	.	.	.	T	14.34	2.507363	0.44558	.	.	ENSG00000186675	ENST00000373359	T	0.04083	3.71	2.9	2.9	0.33743	.	.	.	.	.	T	0.05777	0.0151	N	0.08118	0	0.27528	N	0.951186	D	0.69078	0.997	P	0.60682	0.878	T	0.40515	-0.9559	9	0.35671	T	0.21	.	6.6749	0.23087	0.0:0.0:0.0:1.0	.	295	Q8TD90	MAGE2_HUMAN	N	295	ENSP00000362457:K295N	ENSP00000362457:K295N	K	-	3	2	MAGEE2	74920727	1.000000	0.71417	0.925000	0.36789	0.814000	0.46013	2.128000	0.42045	1.376000	0.46267	0.345000	0.21793	AAA	MAGEE2	-	NULL	ENSG00000186675		0.463	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE2	HGNC	protein_coding	OTTHUMT00000057288.1	-	0.00	28	0	T	NM_138703		75004002	-1	tier1	-	no_errors	ENST00000373359	ensembl	human	known	74_37	missense	57.14	9	12	SNP	0.925	G
MAGEE1	57692	genome.wustl.edu	37	X	75650471	75650471	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:75650471A>C	ENST00000361470.2	+	1	2426	c.2148A>C	c.(2146-2148)gaA>gaC	p.E716D		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	716						dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						TTTTTGAGGAAGCTGCTGCAG	0.512																																																	0													58.0	44.0	49.0					X																	75650471		2203	4300	6503	SO:0001583	missense	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.2148A>C	X.37:g.75650471A>C	ENSP00000354912:p.Glu716Asp		Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.E716D	ENST00000361470.2	37	c.2148	CCDS14433.1	X	.	.	.	.	.	.	.	.	.	.	.	12.86	2.063773	0.36373	.	.	ENSG00000198934	ENST00000361470	T	0.03663	3.85	2.26	2.26	0.28386	.	.	.	.	.	T	0.02929	0.0087	L	0.36672	1.1	0.09310	N	1	P	0.50156	0.932	B	0.38954	0.286	T	0.45483	-0.9258	9	0.24483	T	0.36	.	5.7018	0.17887	1.0:0.0:0.0:0.0	.	716	Q9HCI5	MAGE1_HUMAN	D	716	ENSP00000354912:E716D	ENSP00000354912:E716D	E	+	3	2	MAGEE1	75566875	0.998000	0.40836	0.088000	0.20740	0.878000	0.50629	1.772000	0.38552	1.130000	0.42092	0.441000	0.28932	GAA	MAGEE1	-	NULL	ENSG00000198934		0.512	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	-	0.00	31	0	A	NM_020932		75650471	+1	tier1	-	no_errors	ENST00000361470	ensembl	human	known	74_37	missense	44.44	5	4	SNP	0.085	C
MAN2B1	4125	genome.wustl.edu	37	19	12760229	12760229	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:12760229G>A	ENST00000456935.2	-	19	2321	c.2281C>T	c.(2281-2283)Ccc>Tcc	p.P761S	MAN2B1_ENST00000221363.4_Missense_Mutation_p.P760S|CTD-2192J16.22_ENST00000597692.1_5'Flank	NM_000528.3|NM_001173498.1	NP_000519.2|NP_001166969.1	O00754	MA2B1_HUMAN	mannosidase, alpha, class 2B, member 1	761					cellular protein modification process (GO:0006464)|mannose metabolic process (GO:0006013)|protein deglycosylation (GO:0006517)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(10)|ovary(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						TTCCAGGTGGGTCGATAATCC	0.522																																																	0													57.0	44.0	48.0					19																	12760229		2203	4300	6503	SO:0001583	missense	0				CCDS32919.1, CCDS54224.1	19p13.2	2013-09-20			ENSG00000104774	ENSG00000104774	3.2.1.24		6826	protein-coding gene	gene with protein product		609458		MANB			Standard	NM_000528		Approved	LAMAN	uc002mub.2	O00754	OTTHUMG00000156397	ENST00000456935.2:c.2281C>T	19.37:g.12760229G>A	ENSP00000395473:p.Pro761Ser		G5E928|O15330|Q16680|Q93094|Q9BW13	Missense_Mutation	SNP	pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.P761S	ENST00000456935.2	37	c.2281	CCDS32919.1	19	.	.	.	.	.	.	.	.	.	.	G	12.56	1.975543	0.34848	.	.	ENSG00000104774	ENST00000456935;ENST00000536796;ENST00000221363	T;T	0.77750	-1.12;-1.12	4.55	4.55	0.56014	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.38663	N	0.001601	T	0.70902	0.3277	L	0.56280	1.765	0.45930	D	0.998763	P;P	0.50528	0.867;0.936	B;B	0.41619	0.247;0.361	T	0.70806	-0.4772	10	0.33940	T	0.23	-25.2296	10.6638	0.45717	0.0:0.1942:0.8058:0.0	.	760;761	G5E928;O00754	.;MA2B1_HUMAN	S	761;700;760	ENSP00000395473:P761S;ENSP00000221363:P760S	ENSP00000221363:P760S	P	-	1	0	MAN2B1	12621229	1.000000	0.71417	0.945000	0.38365	0.420000	0.31355	3.780000	0.55386	2.376000	0.81061	0.561000	0.74099	CCC	MAN2B1	-	pfam_Glyco_hydro_38_C,superfamily_Gal_mutarotase_SF_dom	ENSG00000104774		0.522	MAN2B1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAN2B1	HGNC	protein_coding	OTTHUMT00000344062.1		0.00	47	0	G			12760229	-1			no_errors	ENST00000456935	ensembl	human	known	74_37	missense	8.82	31	3	SNP	1.000	A
MAOB	4129	genome.wustl.edu	37	X	43702992	43702992	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:43702992A>C	ENST00000378069.4	-	2	212	c.65T>G	c.(64-66)cTt>cGt	p.L22R	MAOB_ENST00000487544.1_5'UTR|MAOB_ENST00000536181.1_Missense_Mutation_p.L6R|MAOB_ENST00000538942.1_Missense_Mutation_p.L6R	NM_000898.4	NP_000889.3	P27338	AOFB_HUMAN	monoamine oxidase B	22					negative regulation of serotonin secretion (GO:0014063)|positive regulation of dopamine metabolic process (GO:0045964)|response to aluminum ion (GO:0010044)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial envelope (GO:0005740)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|primary amine oxidase activity (GO:0008131)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|prostate(2)|skin(5)	21					Amantadine(DB00915)|Amphetamine(DB00182)|Dopamine(DB00988)|Ephedra(DB01363)|Flavin adenine dinucleotide(DB03147)|Furazolidone(DB00614)|Isocarboxazid(DB01247)|Linezolid(DB00601)|Methamphetamine(DB01577)|Moclobemide(DB01171)|Nandrolone decanoate(DB08804)|Nicotine(DB00184)|Pargyline(DB01626)|Phenelzine(DB00780)|Phentermine(DB00191)|Procaine(DB00721)|Rasagiline(DB01367)|Selegiline(DB01037)|Sertraline(DB01104)|Tranylcypromine(DB00752)|Zonisamide(DB00909)	GTCATGCAGAAGTTTGGCTGC	0.493																																																	0													79.0	65.0	69.0					X																	43702992		2203	4300	6503	SO:0001583	missense	0				CCDS14261.1	Xp11.4-p11.3	2008-02-05			ENSG00000069535	ENSG00000069535	1.4.3.4		6834	protein-coding gene	gene with protein product		309860					Standard	NM_000898		Approved		uc004dfz.4	P27338	OTTHUMG00000021388	ENST00000378069.4:c.65T>G	X.37:g.43702992A>C	ENSP00000367309:p.Leu22Arg		B2R6R3|B7Z5H3|D3DWC3|Q7Z6S2	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_mOase_FAD-bd,prints_Flavin_amine_oxidase	p.L22R	ENST00000378069.4	37	c.65	CCDS14261.1	X	.	.	.	.	.	.	.	.	.	.	A	24.8	4.576257	0.86645	.	.	ENSG00000069535	ENST00000378069;ENST00000536181;ENST00000538942	D;D;D	0.91945	-2.94;-2.94;-2.94	5.54	5.54	0.83059	Amine oxidase (1);	0.000000	0.85682	D	0.000000	D	0.93851	0.8033	L	0.51914	1.62	0.80722	D	1	D;D;D	0.76494	0.993;0.997;0.999	D;D;D	0.78314	0.939;0.961;0.991	D	0.91797	0.5448	10	0.16420	T	0.52	-15.6823	14.7116	0.69238	1.0:0.0:0.0:0.0	.	6;22;22	B7Z5H3;Q8TBI1;P27338	.;.;AOFB_HUMAN	R	22;6;6	ENSP00000367309:L22R;ENSP00000441613:L6R;ENSP00000442240:L6R	ENSP00000367309:L22R	L	-	2	0	MAOB	43587936	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.454000	0.90352	1.855000	0.53841	0.486000	0.48141	CTT	MAOB	-	pfam_Amino_oxidase,pfam_FAD-dep_OxRdtase,pfam_FAD_bind_dom,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_mOase_FAD-bd,prints_Flavin_amine_oxidase	ENSG00000069535		0.493	MAOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAOB	HGNC	protein_coding	OTTHUMT00000056303.1	-	0.00	26	0	A	NM_000898		43702992	-1	tier1	-	no_errors	ENST00000378069	ensembl	human	known	74_37	missense	53.33	7	8	SNP	1.000	C
MAP3K12	7786	genome.wustl.edu	37	12	53874997	53874997	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:53874997G>A	ENST00000267079.2	-	15	2774	c.2549C>T	c.(2548-2550)gCc>gTc	p.A850V	MAP3K12_ENST00000547488.1_Missense_Mutation_p.A883V|MAP3K12_ENST00000547035.1_Missense_Mutation_p.A883V	NM_001193511.1|NM_006301.3	NP_001180440.1|NP_006292.3	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase 12	850					histone phosphorylation (GO:0016572)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	37						GGGCCGCAAGGCATCAACGCT	0.418																																																	0													69.0	61.0	64.0					12																	53874997		2203	4300	6503	SO:0001583	missense	0			U07358	CCDS8860.1, CCDS55831.1	12q13.13	2013-10-30			ENSG00000139625	ENSG00000139625		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6851	protein-coding gene	gene with protein product	"""dual leucine zipper kinase DLK"""	600447		ZPK		8037767	Standard	NM_006301		Approved	MUK, DLK, ZPKP1, MEKK12	uc001sdn.2	Q12852	OTTHUMG00000169854	ENST00000267079.2:c.2549C>T	12.37:g.53874997G>A	ENSP00000267079:p.Ala850Val		B3KSS9|G3V1Y2|Q86VQ5|Q8WY25	Missense_Mutation	SNP	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A850V	ENST00000267079.2	37	c.2549	CCDS8860.1	12	.	.	.	.	.	.	.	.	.	.	G	16.17	3.047276	0.55110	.	.	ENSG00000139625	ENST00000267079;ENST00000547488;ENST00000547035	T;T;T	0.75367	-0.92;-0.93;-0.93	4.91	4.01	0.46588	.	0.189766	0.26089	N	0.026412	T	0.53802	0.1819	N	0.08118	0	0.34280	D	0.681985	B;B	0.22414	0.069;0.041	B;B	0.18871	0.023;0.017	T	0.59236	-0.7492	10	0.27082	T	0.32	.	13.3385	0.60530	0.0:0.1599:0.8401:0.0	.	883;850	G3V1Y2;Q12852	.;M3K12_HUMAN	V	850;883;883	ENSP00000267079:A850V;ENSP00000449038:A883V;ENSP00000448689:A883V	ENSP00000267079:A850V	A	-	2	0	MAP3K12	52161264	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.067000	0.41461	1.437000	0.47472	0.655000	0.94253	GCC	MAP3K12	-	pirsf_MAP3K12_MAP3K13	ENSG00000139625		0.418	MAP3K12-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP3K12	HGNC	protein_coding	OTTHUMT00000406267.1	-	0.00	80	0	G	NM_006301		53874997	-1	tier1	-	no_errors	ENST00000267079	ensembl	human	known	74_37	missense	6.25	59	4	SNP	1.000	A
MAP3K5	4217	genome.wustl.edu	37	6	136882733	136882733	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:136882733C>T	ENST00000359015.4	-	28	4285	c.3925G>A	c.(3925-3927)Gaa>Aaa	p.E1309K	MAP3K5_ENST00000355845.4_Missense_Mutation_p.E556K	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	1309					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TCAGAATCTTCAGTATTTGTG	0.383																																																	0													93.0	93.0	93.0					6																	136882733		2203	4300	6503	SO:0001583	missense	0			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.3925G>A	6.37:g.136882733C>T	ENSP00000351908:p.Glu1309Lys		A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E1309K	ENST00000359015.4	37	c.3925	CCDS5179.1	6	.	.	.	.	.	.	.	.	.	.	C	15.33	2.801097	0.50315	.	.	ENSG00000197442	ENST00000359015;ENST00000355845	T;T	0.70869	-0.37;-0.52	5.74	4.87	0.63330	Sterile alpha motif/pointed domain (1);	0.103053	0.64402	N	0.000003	T	0.43144	0.1234	L	0.46157	1.445	0.46260	D	0.998951	B	0.02656	0.0	B	0.04013	0.001	T	0.48352	-0.9043	10	0.06757	T	0.87	.	15.0503	0.71862	0.0:0.9311:0.0:0.0689	.	1309	Q99683	M3K5_HUMAN	K	1309;556	ENSP00000351908:E1309K;ENSP00000348104:E556K	ENSP00000348104:E556K	E	-	1	0	MAP3K5	136924426	1.000000	0.71417	0.995000	0.50966	0.956000	0.61745	4.060000	0.57477	1.423000	0.47198	0.591000	0.81541	GAA	MAP3K5	-	superfamily_SAM/pointed	ENSG00000197442		0.383	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	HGNC	protein_coding	OTTHUMT00000042383.1	-	0.00	53	0	C			136882733	-1	tier1	-	no_errors	ENST00000359015	ensembl	human	known	74_37	missense	23.08	10	3	SNP	0.999	T
MAP3K6	9064	genome.wustl.edu	37	1	27682974	27682974	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:27682974G>A	ENST00000493901.1	-	27	3781	c.3542C>T	c.(3541-3543)gCg>gTg	p.A1181V	MAP3K6_ENST00000374040.3_Missense_Mutation_p.A1173V|MAP3K6_ENST00000357582.2_Missense_Mutation_p.A1181V	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	1181					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		TTCCTTCCCCGCCAGGATTTC	0.632																																																	0													31.0	35.0	34.0					1																	27682974		2203	4300	6503	SO:0001583	missense	0			AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.3542C>T	1.37:g.27682974G>A	ENSP00000419591:p.Ala1181Val		A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.A1181V	ENST00000493901.1	37	c.3542	CCDS299.1	1	.	.	.	.	.	.	.	.	.	.	G	3.869	-0.028381	0.07589	.	.	ENSG00000142733	ENST00000374040;ENST00000493901;ENST00000374036;ENST00000357582	T;T;T	0.62105	0.05;0.06;0.06	5.45	0.308	0.15815	.	.	.	.	.	T	0.36690	0.0976	N	0.13299	0.325	0.09310	N	0.999999	B;B	0.13145	0.007;0.004	B;B	0.06405	0.002;0.001	T	0.16070	-1.0415	8	.	.	.	.	3.7513	0.08568	0.4249:0.0:0.4083:0.1668	.	1173;1181	O95382-3;O95382	.;M3K6_HUMAN	V	1173;1181;19;1181	ENSP00000363152:A1173V;ENSP00000419591:A1181V;ENSP00000350195:A1181V	.	A	-	2	0	MAP3K6	27555561	0.066000	0.20996	0.155000	0.22561	0.014000	0.08584	0.273000	0.18662	0.010000	0.14839	0.655000	0.94253	GCG	MAP3K6	-	NULL	ENSG00000142733		0.632	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MAP3K6	HGNC	protein_coding	OTTHUMT00000013469.2	-	0.00	106	0	G	NM_004672		27682974	-1	tier1	-	no_errors	ENST00000357582	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.130	A
MCM9	254394	genome.wustl.edu	37	6	119243248	119243248	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:119243248G>T	ENST00000316316.6	-	4	911	c.625C>A	c.(625-627)Caa>Aaa	p.Q209K	MCM9_ENST00000316068.3_Missense_Mutation_p.Q209K	NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	209					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.Q209K(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		GATAGCCTTTGAACCTAGCAA	0.338																																																	2	Substitution - Missense(2)	lung(2)											132.0	126.0	128.0					6																	119243248		2203	4300	6503	SO:0001583	missense	0			BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.625C>A	6.37:g.119243248G>T	ENSP00000314505:p.Gln209Lys		B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,prints_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase	p.Q209K	ENST00000316316.6	37	c.625	CCDS56447.1	6	.	.	.	.	.	.	.	.	.	.	G	20.2	3.957767	0.73902	.	.	ENSG00000111877	ENST00000316316;ENST00000316068	T;T	0.04156	3.69;3.69	5.58	5.58	0.84498	.	.	.	.	.	T	0.03095	0.0091	L	0.45137	1.4	0.80722	D	1	P	0.40083	0.702	B	0.37650	0.255	T	0.57631	-0.7778	9	0.21014	T	0.42	.	19.922	0.97089	0.0:0.0:1.0:0.0	.	209	Q9NXL9-2	.	K	209	ENSP00000314505:Q209K;ENSP00000312870:Q209K	ENSP00000312870:Q209K	Q	-	1	0	MCM9	119284947	1.000000	0.71417	1.000000	0.80357	0.804000	0.45430	8.959000	0.93110	2.780000	0.95670	0.655000	0.94253	CAA	MCM9	-	superfamily_NA-bd_OB-fold,smart_MCM_DNA-dep_ATPase	ENSG00000111877		0.338	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM9	HGNC	protein_coding	OTTHUMT00000042005.4		0.00	37	0	G	NM_153255		119243248	-1			no_errors	ENST00000316316	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	T
MDGA2	161357	genome.wustl.edu	37	14	47770715	47770715	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:47770715A>G	ENST00000399232.2	-	2	476	c.112T>C	c.(112-114)Tgt>Cgt	p.C38R	MDGA2_ENST00000472499.2_5'UTR|MDGA2_ENST00000426342.1_5'UTR|MDGA2_ENST00000357362.3_5'UTR|MDGA2_ENST00000439988.3_Missense_Mutation_p.C107R	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	38	Ig-like 1.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TCAATGTTACAGGCCAAGCCT	0.493																																																	0													163.0	142.0	148.0					14																	47770715		692	1591	2283	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.112T>C	14.37:g.47770715A>G	ENSP00000382178:p.Cys38Arg		F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.C107R	ENST00000399232.2	37	c.319		14	.	.	.	.	.	.	.	.	.	.	A	14.98	2.696485	0.48202	.	.	ENSG00000139915	ENST00000439988;ENST00000399232;ENST00000486952	T;T;T	0.62788	0.18;0.01;0.0	5.2	5.2	0.72013	Immunoglobulin-like (1);	0.000000	0.38663	U	0.001616	T	0.72415	0.3457	L	0.52126	1.63	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68788	-0.5316	10	0.24483	T	0.36	.	14.2208	0.65826	1.0:0.0:0.0:0.0	.	38	Q7Z553	MDGA2_HUMAN	R	38;107;62	ENSP00000400011:C38R;ENSP00000382178:C107R;ENSP00000452515:C62R	ENSP00000382178:C107R	C	-	1	0	MDGA2	46840465	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	8.962000	0.93254	2.096000	0.63516	0.528000	0.53228	TGT	MDGA2	-	pfscan_Ig-like_dom	ENSG00000272781		0.493	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	-	0.00	30	0	A	NM_182830		47770715	-1	tier1	-	no_errors	ENST00000439988	ensembl	human	known	74_37	missense	13.64	19	3	SNP	1.000	G
MDN1	23195	genome.wustl.edu	37	6	90388401	90388401	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:90388401T>C	ENST00000369393.3	-	75	12444	c.12329A>G	c.(12328-12330)gAg>gGg	p.E4110G	RP1-122O8.7_ENST00000438877.1_RNA|MDN1_ENST00000428876.1_Missense_Mutation_p.E4110G			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4110					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CCGCTGCTTCTCCTTCTCTGC	0.473																																																	0													152.0	139.0	143.0					6																	90388401		2203	4300	6503	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.12329A>G	6.37:g.90388401T>C	ENSP00000358400:p.Glu4110Gly		O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.E4110G	ENST00000369393.3	37	c.12329	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	T	17.83	3.485969	0.63962	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03889	3.77;3.77	5.13	5.13	0.70059	.	0.061513	0.64402	D	0.000006	T	0.07413	0.0187	M	0.66506	2.035	0.58432	D	0.999996	D	0.59767	0.986	P	0.50970	0.655	T	0.03875	-1.0996	10	0.72032	D	0.01	.	14.9383	0.70975	0.0:0.0:0.0:1.0	.	4110	Q9NU22	MDN1_HUMAN	G	4110	ENSP00000358400:E4110G;ENSP00000413970:E4110G	ENSP00000358400:E4110G	E	-	2	0	MDN1	90445122	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.591000	0.82666	1.935000	0.56089	0.459000	0.35465	GAG	MDN1	-	pirsf_Midasin	ENSG00000112159		0.473	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2		0.00	88	0	T			90388401	-1			no_errors	ENST00000369393	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	C
MED14	9282	genome.wustl.edu	37	X	40588605	40588606	+	Intron	INS	-	-	A	rs200699843|rs369436436		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:40588605_40588606insA	ENST00000324817.1	-	2	334					NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14						androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						AGTCTAAGAAGAAAAAAAAAAA	0.322																																																	0																																										SO:0001627	intron_variant	0			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.216-8->T	X.37:g.40588616_40588616dupA			Q4KMR7|Q9UNB3	RNA	INS	-	NULL	ENST00000324817.1	37	NULL	CCDS14254.1	X																																																																																			MED14	-	-	ENSG00000180182		0.322	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MED14	HGNC	protein_coding	OTTHUMT00000060692.1		0.00	24	0	-	NM_004229		40588606	-1	tier1		no_errors	ENST00000463072	ensembl	human	known	74_37	rna	23.53	13	4	INS	0.000:0.000	A
MFAP3L	9848	genome.wustl.edu	37	4	170913139	170913139	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:170913139C>A	ENST00000361618.3	-	3	927	c.620G>T	c.(619-621)cGc>cTc	p.R207L	RP11-6E9.4_ENST00000508955.1_RNA|MFAP3L_ENST00000393704.3_Missense_Mutation_p.R104L	NM_021647.6	NP_067679.6	O75121	MFA3L_HUMAN	microfibrillar-associated protein 3-like	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0201)|LUSC - Lung squamous cell carcinoma(193;0.116)		GATGGGGATGCGCTTGGCGAT	0.512																																																	0													134.0	139.0	138.0					4																	170913139		2203	4300	6503	SO:0001583	missense	0			AB014526	CCDS34103.1, CCDS43281.1	4q33	2014-08-12			ENSG00000198948	ENSG00000198948		"""Immunoglobulin superfamily / I-set domain containing"""	29083	protein-coding gene	gene with protein product						9734811	Standard	XM_005263366		Approved	KIAA0626, NYD-sp9	uc003isp.4	O75121	OTTHUMG00000160942	ENST00000361618.3:c.620G>T	4.37:g.170913139C>A	ENSP00000354583:p.Arg207Leu		A8K1X6|D3DP35|Q4W5N7|Q4W5N9|Q6TNA8|Q9BVE1|Q9BXK0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.R207L	ENST00000361618.3	37	c.620	CCDS34103.1	4	.	.	.	.	.	.	.	.	.	.	C	26.7	4.762002	0.89932	.	.	ENSG00000198948	ENST00000393704;ENST00000361618;ENST00000512698	D;D;D	0.98958	-5.27;-2.28;-5.01	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.98924	0.9635	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.99886	1.1123	10	0.59425	D	0.04	-22.9421	19.4847	0.95025	0.0:1.0:0.0:0.0	.	207	O75121	MFA3L_HUMAN	L	104;207;104	ENSP00000377307:R104L;ENSP00000354583:R207L;ENSP00000422791:R104L	ENSP00000354583:R207L	R	-	2	0	MFAP3L	171149714	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.818000	0.86416	2.602000	0.87976	0.555000	0.69702	CGC	MFAP3L	-	NULL	ENSG00000198948		0.512	MFAP3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP3L	HGNC	protein_coding	OTTHUMT00000363043.2	-	0.00	35	0	C	NM_021647		170913139	-1	tier1	-	no_errors	ENST00000361618	ensembl	human	known	74_37	missense	37.50	10	6	SNP	1.000	A
NVL	4931	genome.wustl.edu	37	1	224444737	224444738	+	Intron	INS	-	-	T	rs573934358	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:224444737_224444738insT	ENST00000281701.6	-	19	2442				MIR320B2_ENST00000408479.1_RNA|NVL_ENST00000361463.3_Intron|NVL_ENST00000482491.1_Intron|NVL_ENST00000469075.1_Intron|NVL_ENST00000391875.2_Intron|NVL_ENST00000340871.4_Intron	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like							membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		AGACAGAATTCTTTTTTTTTCC	0.431													TTTTTTTTT|TTTTTTTTT|TTTTTTTTTT|insertion	8	0.00159744	0.0008	0.0	5008	,	,		19088	0.001		0.001	False		,,,				2504	0.0051																0																																										SO:0001627	intron_variant	0			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.2183-6717->A	1.37:g.224444746_224444746dupT			B4DMC4|B4DP98|Q96EM7	RNA	INS	-	NULL	ENST00000281701.6	37	NULL	CCDS1541.1	1																																																																																			MIR320B2	-	-	ENSG00000221406		0.431	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MIR320B2	HGNC	protein_coding	OTTHUMT00000091453.2		0.00	87	0	-	NM_002533		224444738	-1	tier1		no_errors	ENST00000408479	ensembl	human	known	74_37	rna	11.54	23	3	INS	0.014:0.020	T
MIR654	724024	genome.wustl.edu	37	14	101506034	101506034	+	RNA	DEL	G	G	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:101506034delG	ENST00000385199.1	+	0	0				AL132709.2_ENST00000579587.1_RNA|MIR376C_ENST00000607441.1_RNA|MIR376A1_ENST00000584362.1_RNA|MIR300_ENST00000401138.1_RNA	NR_030390.1				microRNA 654																		TTTAAAAGGTGGATATTCCTT	0.383																																																	0													106.0	93.0	97.0					14																	101506034		1568	3581	5149			0					14q32.31	2011-09-12		2008-12-18	ENSG00000207934	ENSG00000207934		"""ncRNAs / Micro RNAs"""	32910	non-coding RNA	RNA, micro				MIRN654			Standard	NR_030390		Approved	hsa-mir-654	uc021sda.1				14.37:g.101506034delG				RNA	DEL	-	NULL	ENST00000385199.1	37	NULL		14																																																																																			MIR376C	-	-	ENSG00000271946		0.383	MIR654-201	KNOWN	basic	miRNA	MIR376C	HGNC	miRNA			0.00	57	0	G	NR_030390		101506034	+1	tier1		no_errors	ENST00000607441	ensembl	human	known	74_37	rna	11.11	16	2	DEL	1.000	-
MKI67	4288	genome.wustl.edu	37	10	129904470	129904470	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:129904470C>T	ENST00000368654.3	-	13	6009	c.5634G>A	c.(5632-5634)aaG>aaA	p.K1878K	MKI67_ENST00000368653.3_Silent_p.K1518K	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	1878	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGAGGCTTCTCTTGGGCCGTT	0.468																																																	0													260.0	265.0	263.0					10																	129904470		2203	4300	6503	SO:0001819	synonymous_variant	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.5634G>A	10.37:g.129904470C>T			Q5VWH2	Silent	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.K1878	ENST00000368654.3	37	c.5634	CCDS7659.1	10																																																																																			MKI67	-	pfam_K167R	ENSG00000148773		0.468	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	-	0.00	177	0	C	NM_002417		129904470	-1	tier1	-	no_errors	ENST00000368654	ensembl	human	known	74_37	silent	25.37	50	17	SNP	0.000	T
MKKS	8195	genome.wustl.edu	37	20	10389433	10389433	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr20:10389433G>T	ENST00000347364.3	-	4	1766	c.1004C>A	c.(1003-1005)tCc>tAc	p.S335Y	MKKS_ENST00000399054.2_Missense_Mutation_p.S335Y	NM_170784.2	NP_740754.1	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome	335	Substrate-binding apical domain.				artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|chaperone-mediated protein complex assembly (GO:0051131)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|gonad development (GO:0008406)|heart development (GO:0007507)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of multicellular organism growth (GO:0040018)|protein folding (GO:0006457)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sensory perception of smell (GO:0007608)|social behavior (GO:0035176)|spermatid development (GO:0007286)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|stomach(2)	16						TGAGCCTAGGGATCCAATAGG	0.328																																					Melanoma(79;1979 2212 6640)												0													73.0	70.0	71.0					20																	10389433		2203	4300	6503	SO:0001583	missense	0			AF221993	CCDS13111.1	20p12	2013-01-08			ENSG00000125863	ENSG00000125863		"""Heat Shock Proteins / Chaperonins"""	7108	protein-coding gene	gene with protein product		604896		BBS6		9467007	Standard	NR_072977		Approved		uc002wnu.2	Q9NPJ1	OTTHUMG00000031868	ENST00000347364.3:c.1004C>A	20.37:g.10389433G>T	ENSP00000246062:p.Ser335Tyr		A8K7B0|D3DW18	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	p.S335Y	ENST00000347364.3	37	c.1004	CCDS13111.1	20	.	.	.	.	.	.	.	.	.	.	G	21.0	4.079239	0.76528	.	.	ENSG00000125863	ENST00000347364;ENST00000399054	T;T	0.80480	-1.38;-1.38	5.87	4.92	0.64577	.	0.155854	0.64402	D	0.000015	D	0.87212	0.6121	M	0.75447	2.3	0.58432	D	0.999995	D	0.54397	0.966	P	0.55577	0.779	D	0.88804	0.3287	10	0.62326	D	0.03	-20.3443	17.4292	0.87534	0.0:0.1245:0.8755:0.0	.	335	Q9NPJ1	MKKS_HUMAN	Y	335	ENSP00000246062:S335Y;ENSP00000382008:S335Y	ENSP00000246062:S335Y	S	-	2	0	MKKS	10337433	1.000000	0.71417	0.563000	0.28383	0.867000	0.49689	4.878000	0.63093	1.611000	0.50210	0.655000	0.94253	TCC	MKKS	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom	ENSG00000125863		0.328	MKKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKKS	HGNC	protein_coding	OTTHUMT00000077991.3	-	0.00	45	0	G			10389433	-1	tier1	-	no_errors	ENST00000347364	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.990	T
MKL2	57496	genome.wustl.edu	37	16	14311020	14311020	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr16:14311020G>T	ENST00000341243.5	+	5	357	c.357G>T	c.(355-357)atG>atT	p.M119I	MKL2_ENST00000318282.5_Missense_Mutation_p.M130I|MKL2_ENST00000572567.1_Missense_Mutation_p.M119I|MKL2_ENST00000574045.1_Missense_Mutation_p.M130I|MKL2_ENST00000573051.1_Missense_Mutation_p.M79I|MKL2_ENST00000571589.1_Missense_Mutation_p.M130I			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	119					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTACTCAGATGAAGTTGAAAA	0.393																																																	0													97.0	103.0	101.0					16																	14311020		2197	4300	6497	SO:0001583	missense	0			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.357G>T	16.37:g.14311020G>T	ENSP00000345841:p.Met119Ile		A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_dom,smart_RPEL_repeat,smart_SAP_dom,pfscan_RPEL_repeat,pfscan_SAP_dom	p.M119I	ENST00000341243.5	37	c.357		16	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846081	0.71603	.	.	ENSG00000186260	ENST00000318282;ENST00000389126;ENST00000341243	D;D	0.99836	-7.05;-7.05	5.75	5.75	0.90469	.	0.037553	0.85682	D	0.000000	D	0.99588	0.9851	L	0.35414	1.06	0.58432	D	0.999996	P;P;P;D	0.55172	0.458;0.702;0.861;0.97	B;B;B;D	0.68943	0.137;0.182;0.391;0.961	D	0.98370	1.0553	10	0.37606	T	0.19	-25.9574	19.2924	0.94105	0.0:0.0:1.0:0.0	.	79;130;119;130	Q9ULH7-2;B4DGT8;Q9ULH7;Q9ULH7-4	.;.;MKL2_HUMAN;.	I	130;119;119	ENSP00000339086:M130I;ENSP00000345841:M119I	ENSP00000339086:M130I	M	+	3	0	MKL2	14218521	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.751000	0.98889	2.878000	0.98634	0.650000	0.86243	ATG	MKL2	-	NULL	ENSG00000186260		0.393	MKL2-202	KNOWN	basic	protein_coding	MKL2	HGNC	protein_coding			0.00	48	0	G	NM_014048		14311020	+1			no_errors	ENST00000341243	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
DPM1	8813	genome.wustl.edu	37	20	49575380	49575380	+	5'Flank	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr20:49575380A>G	ENST00000371588.5	-	0	0				DPM1_ENST00000466152.1_5'Flank|MOCS3_ENST00000244051.1_Start_Codon_SNP_p.M1V|DPM1_ENST00000371582.4_5'Flank|DPM1_ENST00000371583.5_5'Flank	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						AGAGGTCGCCATGGCTTCCCG	0.517																																																	0													43.0	41.0	42.0					20																	49575380		2128	4178	6306	SO:0001631	upstream_gene_variant	0			AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742		20.37:g.49575380A>G	Exception_encountered		O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_MoeZ_MoeB,pfam_Rhodanese-like_dom,superfamily_Molybdenum_cofac_synth_MoeB,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	p.M1V	ENST00000371588.5	37	c.1	CCDS13434.1	20	.	.	.	.	.	.	.	.	.	.	A	13.00	2.107745	0.37242	.	.	ENSG00000124217	ENST00000244051	T	0.70749	-0.51	5.25	4.14	0.48551	.	0.000000	0.64402	D	0.000011	T	0.51550	0.1681	.	.	.	0.80722	D	1	B	0.30914	0.3	B	0.26094	0.066	T	0.43228	-0.9404	8	.	.	.	-37.8743	5.8404	0.18630	0.7705:0.0:0.0799:0.1497	.	1	O95396	MOCS3_HUMAN	V	1	ENSP00000244051:M1V	.	M	+	1	0	MOCS3	49008787	1.000000	0.71417	0.896000	0.35187	0.072000	0.16883	2.906000	0.48735	1.089000	0.41292	0.533000	0.62120	ATG	MOCS3	-	NULL	ENSG00000124217		0.517	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOCS3	HGNC	protein_coding	OTTHUMT00000079716.1	-	0.00	18	0	A	NM_003859		49575380	+1	tier1	-	no_errors	ENST00000244051	ensembl	human	known	74_37	missense	50.00	10	10	SNP	0.932	G
MPDU1	9526	genome.wustl.edu	37	17	7489092	7489092	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:7489092G>A	ENST00000250124.6	+	2	362	c.146G>A	c.(145-147)gGc>gAc	p.G49D	AC113189.5_ENST00000417897.1_RNA|MPDU1_ENST00000423172.2_Missense_Mutation_p.G49D|AC113189.5_ENST00000572046.1_RNA|MPDU1_ENST00000396501.4_Missense_Mutation_p.G49D|AC113189.5_ENST00000573187.1_RNA|AC113189.5_ENST00000415124.1_RNA	NM_004870.3	NP_004861.2	O75352	MPU1_HUMAN	mannose-P-dolichol utilization defect 1	49	PQ-loop 1.				dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|oligosaccharide biosynthetic process (GO:0009312)|protein folding (GO:0006457)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)				central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(1)	7						CTGGGGCTGGGCATTGTGGCT	0.542																																																	0													129.0	130.0	130.0					17																	7489092		2203	4300	6503	SO:0001583	missense	0			AF038961	CCDS11115.1	17p13.1-p12	2008-07-03			ENSG00000129255	ENSG00000129255			7207	protein-coding gene	gene with protein product		604041				8663248, 9653160, 11733564	Standard	NM_004870		Approved	SL15, Lec35, PQLC5, CDGIf	uc002ghw.3	O75352	OTTHUMG00000108147	ENST00000250124.6:c.146G>A	17.37:g.7489092G>A	ENSP00000250124:p.Gly49Asp		B3KQP1|B4DT74|Q9BUU8	Missense_Mutation	SNP	smart_CTNS,pirsf_MannP-dilichol_defect-1	p.G49D	ENST00000250124.6	37	c.146	CCDS11115.1	17	.	.	.	.	.	.	.	.	.	.	G	14.27	2.486573	0.44249	.	.	ENSG00000129255	ENST00000250124;ENST00000396501;ENST00000301597;ENST00000423172;ENST00000359822	D;D;D;D	0.98192	-4.78;-4.78;-4.78;-1.55	5.87	3.86	0.44501	.	0.148244	0.64402	N	0.000011	D	0.98560	0.9519	M	0.87827	2.91	0.53005	D	0.999965	B;D;P	0.60575	0.175;0.988;0.911	B;P;P	0.61658	0.159;0.892;0.853	D	0.98452	1.0592	10	0.87932	D	0	-9.0483	8.1075	0.30894	0.084:0.1586:0.7574:0.0	.	49;49;49	B4DT74;B4DLH7;O75352	.;.;MPU1_HUMAN	D	49	ENSP00000250124:G49D;ENSP00000379758:G49D;ENSP00000414071:G49D;ENSP00000352876:G49D	ENSP00000250124:G49D	G	+	2	0	MPDU1	7429816	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.199000	0.42715	0.809000	0.34255	0.511000	0.50034	GGC	MPDU1	-	pirsf_MannP-dilichol_defect-1	ENSG00000129255		0.542	MPDU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPDU1	HGNC	protein_coding	OTTHUMT00000226950.4		0.00	102	0	G			7489092	+1			no_errors	ENST00000250124	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	A
MPHOSPH9	10198	genome.wustl.edu	37	12	123645738	123645738	+	Missense_Mutation	SNP	C	C	T	rs199553878		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:123645738C>T	ENST00000606320.1	-	22	3532	c.3326G>A	c.(3325-3327)cGg>cAg	p.R1109Q	MPHOSPH9_ENST00000392425.3_Missense_Mutation_p.R957Q|MPHOSPH9_ENST00000302349.5_Missense_Mutation_p.R957Q|MPHOSPH9_ENST00000541076.2_Missense_Mutation_p.R1079Q			Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	1109						centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(18)|prostate(2)|skin(1)	33	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		AGCTAGGGTCCGAATTTTTGC	0.348																																																	0													87.0	84.0	85.0					12																	123645738		2203	4300	6503	SO:0001583	missense	0			X98258	CCDS9243.1, CCDS9243.2	12q24	2008-03-03			ENSG00000051825	ENSG00000051825			7215	protein-coding gene	gene with protein product		605501				8885239	Standard	NM_022782		Approved	MPP9	uc001uel.3	Q99550	OTTHUMG00000168849	ENST00000606320.1:c.3326G>A	12.37:g.123645738C>T	ENSP00000475489:p.Arg1109Gln		A1L486|A6NEE2|B3KR87|Q9H976|U3KQ28	Missense_Mutation	SNP	superfamily_Prefoldin	p.R957Q	ENST00000606320.1	37	c.2870		12	.	.	.	.	.	.	.	.	.	.	C	18.89	3.718874	0.68844	.	.	ENSG00000051825	ENST00000541603;ENST00000302349;ENST00000541076	T;T;T	0.46063	0.88;1.5;1.51	5.58	4.68	0.58851	.	0.154220	0.43747	D	0.000526	T	0.25344	0.0616	L	0.48362	1.52	0.31782	N	0.630756	P	0.38167	0.621	B	0.26969	0.075	T	0.38265	-0.9669	10	0.34782	T	0.22	-21.2523	2.2149	0.03957	0.1677:0.5046:0.1625:0.1652	.	957	Q99550	MPP9_HUMAN	Q	135;957;957	ENSP00000446362:R135Q;ENSP00000303597:R957Q;ENSP00000445859:R957Q	ENSP00000303597:R957Q	R	-	2	0	MPHOSPH9	122211691	0.995000	0.38212	0.999000	0.59377	0.978000	0.69477	1.793000	0.38764	1.344000	0.45657	0.563000	0.77884	CGG	MPHOSPH9	-	NULL	ENSG00000051825		0.348	MPHOSPH9-030	NOVEL	basic	protein_coding	MPHOSPH9	HGNC	protein_coding	OTTHUMT00000471390.2	-	0.00	118	0	C			123645738	-1	tier1	rs199553878	no_errors	ENST00000392425	ensembl	human	known	74_37	missense	18.75	39	9	SNP	0.975	T
MRPS2	51116	genome.wustl.edu	37	9	138395457	138395457	+	Silent	SNP	G	G	A	rs369140380		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:138395457G>A	ENST00000371785.1	+	5	578	c.369G>A	c.(367-369)acG>acA	p.T123T	RP11-426A6.5_ENST00000415062.1_RNA|C9orf116_ENST00000371791.1_5'Flank|MRPS2_ENST00000241600.5_Silent_p.T123T|MRPS2_ENST00000488610.1_3'UTR			Q9Y399	RT02_HUMAN	mitochondrial ribosomal protein S2	123					translation (GO:0006412)	mitochondrion (GO:0005739)|small ribosomal subunit (GO:0015935)	structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|prostate(2)|urinary_tract(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.46e-53)|Epithelial(140;2.04e-47)|all cancers(34;1.23e-42)		AGACAGCCACGCACCTCCAGC	0.572																																																	0								G		0,4406		0,0,2203	120.0	90.0	100.0		369	-2.5	0.0	9		100	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	MRPS2	NM_016034.3		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		123/297	138395457	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AB051627	CCDS6990.1	9q34	2012-09-13			ENSG00000122140	ENSG00000122140		"""Mitochondrial ribosomal proteins / small subunits"""	14495	protein-coding gene	gene with protein product		611971					Standard	NM_016034		Approved	CGI-91	uc004cfv.5	Q9Y399	OTTHUMG00000020910	ENST00000371785.1:c.369G>A	9.37:g.138395457G>A			Q5T899|Q9BSQ4	Silent	SNP	pfam_Ribosomal_S2,superfamily_Ribosomal_S2_flav_dom,prints_Ribosomal_S2	p.T123	ENST00000371785.1	37	c.369	CCDS6990.1	9																																																																																			MRPS2	-	pfam_Ribosomal_S2,superfamily_Ribosomal_S2_flav_dom	ENSG00000122140		0.572	MRPS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS2	HGNC	protein_coding	OTTHUMT00000054998.1	-	0.00	32	0	G			138395457	+1	tier1	-	no_errors	ENST00000241600	ensembl	human	known	74_37	silent	38.46	8	5	SNP	0.081	A
MTMR4	9110	genome.wustl.edu	37	17	56584115	56584115	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:56584115C>T	ENST00000323456.5	-	10	1104	c.980G>A	c.(979-981)tGt>tAt	p.C327Y	MTMR4_ENST00000579925.1_Missense_Mutation_p.C327Y	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	327	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TTCACATTCACAGCCTCCACC	0.577																																																	0													71.0	69.0	70.0					17																	56584115		2203	4300	6503	SO:0001583	missense	0			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.980G>A	17.37:g.56584115C>T	ENSP00000325285:p.Cys327Tyr		D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	pfam_Myotubularin-like_Pase_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Tyr/Dual-sp_Pase	p.C327Y	ENST00000323456.5	37	c.980	CCDS11608.1	17	.	.	.	.	.	.	.	.	.	.	C	25.7	4.662525	0.88251	.	.	ENSG00000108389	ENST00000323456	D	0.92348	-3.02	5.39	5.39	0.77823	Myotubularin phosphatase domain (1);Myotubularin-related (1);	0.000000	0.85682	D	0.000000	D	0.92648	0.7664	N	0.20610	0.595	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91711	0.5381	10	0.31617	T	0.26	.	18.5543	0.91077	0.0:1.0:0.0:0.0	.	327	Q9NYA4	MTMR4_HUMAN	Y	327	ENSP00000325285:C327Y	ENSP00000325285:C327Y	C	-	2	0	MTMR4	53939114	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.445000	0.80570	2.713000	0.92767	0.644000	0.83932	TGT	MTMR4	-	pfam_Myotubularin-like_Pase_dom	ENSG00000108389		0.577	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR4	HGNC	protein_coding	OTTHUMT00000444721.1	-	0.00	30	0	C	NM_004687		56584115	-1	tier1	-	no_errors	ENST00000323456	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9059236	9059236	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:9059236G>A	ENST00000397910.4	-	3	28413	c.28210C>T	c.(28210-28212)Cca>Tca	p.P9404S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9406	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)		p.P9404S(1)|p.P5037S(1)		NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACTGACTGTGGAAATCTCTGA	0.537																																																	2	Substitution - Missense(2)	NS(2)											121.0	119.0	120.0					19																	9059236		1995	4183	6178	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.28210C>T	19.37:g.9059236G>A	ENSP00000381008:p.Pro9404Ser		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.P9404S	ENST00000397910.4	37	c.28210	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	3.675	-0.066807	0.07273	.	.	ENSG00000181143	ENST00000397910	T	0.19532	2.14	2.14	-4.29	0.03721	.	.	.	.	.	T	0.10723	0.0262	N	0.19112	0.55	.	.	.	B	0.23540	0.087	B	0.30179	0.112	T	0.36696	-0.9737	8	0.87932	D	0	.	0.1534	0.00096	0.2583:0.1653:0.2584:0.3181	.	9404	B5ME49	.	S	9404	ENSP00000381008:P9404S	ENSP00000381008:P9404S	P	-	1	0	MUC16	8920236	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.995000	0.03712	-1.401000	0.02058	0.306000	0.20318	CCA	MUC16	-	NULL	ENSG00000181143		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1		0.00	68	0	G	NM_024690		9059236	-1			no_errors	ENST00000397910	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.000	A
MUC6	4588	genome.wustl.edu	37	11	1031851	1031853	+	In_Frame_Del	DEL	GAC	GAC	-	rs556441317		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	GAC	GAC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:1031851_1031853delGAC	ENST00000421673.2	-	3	366_368	c.316_318delGTC	c.(316-318)gtcdel	p.V106del		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	106	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGCTCACAGTGACGACGGAGGCC	0.68																																																	0																																										SO:0001651	inframe_deletion	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.316_318delGTC	11.37:g.1031854_1031856delGAC	ENSP00000406861:p.Val106del		O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	In_Frame_Del	DEL	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.V106in_frame_del	ENST00000421673.2	37	c.318_316	CCDS44513.1	11																																																																																			MUC6	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000184956		0.680	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2		0.00	78	0	GAC	XM_290540		1031853	-1	tier1		no_errors	ENST00000421673	ensembl	human	known	74_37	in_frame_del	27.78	26	10	DEL	0.984:0.977:0.367	-
MYEF2	50804	genome.wustl.edu	37	15	48435245	48435245	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:48435245T>G	ENST00000324324.7	-	17	1942	c.1663A>C	c.(1663-1665)Aaa>Caa	p.K555Q	MYEF2_ENST00000267836.6_Missense_Mutation_p.K531Q	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	555	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		TTCTCCATTTTTATTTCTGCA	0.328																																																	0													80.0	81.0	81.0					15																	48435245		2198	4297	6495	SO:0001583	missense	0			AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.1663A>C	15.37:g.48435245T>G	ENSP00000316950:p.Lys555Gln		A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K555Q	ENST00000324324.7	37	c.1663	CCDS32230.1	15	.	.	.	.	.	.	.	.	.	.	T	20.7	4.029983	0.75504	.	.	ENSG00000104177	ENST00000324324;ENST00000267836;ENST00000454655	T;T	0.17054	2.3;2.3	5.38	5.38	0.77491	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.043175	0.85682	D	0.000000	T	0.30262	0.0759	L	0.28192	0.835	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.05500	-1.0881	10	0.62326	D	0.03	-7.9217	15.6816	0.77373	0.0:0.0:0.0:1.0	.	531;555	Q9P2K5-2;Q9P2K5	.;MYEF2_HUMAN	Q	555;531;143	ENSP00000316950:K555Q;ENSP00000267836:K531Q	ENSP00000267836:K531Q	K	-	1	0	MYEF2	46222537	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.968000	0.87980	2.153000	0.67306	0.533000	0.62120	AAA	MYEF2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000104177		0.328	MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYEF2	HGNC	protein_coding	OTTHUMT00000416909.2	-	0.00	36	0	T	NM_016132		48435245	-1	tier1	-	no_errors	ENST00000324324	ensembl	human	known	74_37	missense	22.22	14	4	SNP	1.000	G
MYH3	4621	genome.wustl.edu	37	17	10533220	10533220	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:10533220T>C	ENST00000583535.1	-	39	5684	c.5597A>G	c.(5596-5598)cAg>cGg	p.Q1866R	MYH3_ENST00000226209.7_Missense_Mutation_p.Q1866R	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1866					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CACCAGATCCTGCAATCTCAG	0.532																																																	0													136.0	124.0	128.0					17																	10533220		2203	4300	6503	SO:0001583	missense	0				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.5597A>G	17.37:g.10533220T>C	ENSP00000464317:p.Gln1866Arg		Q15492	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1866R	ENST00000583535.1	37	c.5597	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	T	28.7	4.942758	0.92526	.	.	ENSG00000109063	ENST00000226209	T	0.80480	-1.38	4.96	4.96	0.65561	Myosin tail (1);	.	.	.	.	D	0.90947	0.7154	M	0.92412	3.305	0.44439	D	0.997362	D	0.58970	0.984	P	0.62298	0.9	D	0.93181	0.6574	9	0.87932	D	0	.	15.098	0.72250	0.0:0.0:0.0:1.0	.	1866	P11055	MYH3_HUMAN	R	1866	ENSP00000226209:Q1866R	ENSP00000226209:Q1866R	Q	-	2	0	MYH3	10473945	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.868000	0.87116	2.218000	0.71995	0.533000	0.62120	CAG	MYH3	-	pfam_Myosin_tail	ENSG00000109063		0.532	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	-	0.00	55	0	T	NM_002470		10533220	-1	tier1	-	no_errors	ENST00000226209	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	C
MYH3	4621	genome.wustl.edu	37	17	10555795	10555795	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:10555795delA	ENST00000583535.1	-	4	377	c.290delT	c.(289-291)ctgfs	p.L97fs	MYH3_ENST00000226209.7_Frame_Shift_Del_p.L97fs	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	97	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TGGCTCATTCAGGTGCGTCAG	0.532																																																	0													158.0	132.0	141.0					17																	10555795		2203	4300	6503	SO:0001589	frameshift_variant	0				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.290delT	17.37:g.10555795delA	ENSP00000464317:p.Leu97fs		Q15492	Frame_Shift_Del	DEL	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L97fs	ENST00000583535.1	37	c.290	CCDS11157.1	17																																																																																			MYH3	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000109063		0.532	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2		0.00	73	0	A	NM_002470		10555795	-1	tier1		no_errors	ENST00000226209	ensembl	human	known	74_37	frame_shift_del	10.53	17	2	DEL	1.000	-
MYO15A	51168	genome.wustl.edu	37	17	18022798	18022798	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:18022798C>T	ENST00000205890.5	+	2	1022	c.684C>T	c.(682-684)ggC>ggT	p.G228G		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	228					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GGCTTGAGGGCTTCCAGGACC	0.637																																																	0													40.0	44.0	43.0					17																	18022798		2082	4208	6290	SO:0001819	synonymous_variant	0			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.684C>T	17.37:g.18022798C>T			B4DFC7	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.G228	ENST00000205890.5	37	c.684	CCDS42271.1	17																																																																																			MYO15A	-	NULL	ENSG00000091536		0.637	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1		0.00	11	0	C	NM_016239		18022798	+1			no_errors	ENST00000205890	ensembl	human	known	74_37	silent	33.33	6	3	SNP	1.000	T
MYO5A	4644	genome.wustl.edu	37	15	52700308	52700308	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:52700308G>T	ENST00000399231.3	-	7	1029	c.786C>A	c.(784-786)ttC>ttA	p.F262L	MYO5A_ENST00000553916.1_Missense_Mutation_p.F262L|MYO5A_ENST00000358212.6_Missense_Mutation_p.F262L|MYO5A_ENST00000356338.6_Missense_Mutation_p.F262L|MYO5A_ENST00000399233.2_Missense_Mutation_p.F262L	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	262	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		AAAGCTGATAGAAGATATGAT	0.303																																																	0													106.0	99.0	101.0					15																	52700308		1799	4074	5873	SO:0001583	missense	0				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.786C>A	15.37:g.52700308G>T	ENSP00000382177:p.Phe262Leu		A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F262L	ENST00000399231.3	37	c.786	CCDS42037.1	15	.	.	.	.	.	.	.	.	.	.	G	20.7	4.034300	0.75617	.	.	ENSG00000197535	ENST00000399231;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000553916	D;D;D;D;D	0.98455	-4.94;-4.94;-4.94;-4.94;-4.94	5.51	3.62	0.41486	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.99099	0.9690	H	0.96777	3.88	0.80722	D	1	D;D	0.71674	0.997;0.998	D;D	0.76071	0.986;0.987	D	0.98561	1.0641	10	0.87932	D	0	.	6.6767	0.23098	0.1917:0.1463:0.6621:0.0	.	262;262	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	L	262	ENSP00000382177:F262L;ENSP00000382179:F262L;ENSP00000348693:F262L;ENSP00000350945:F262L;ENSP00000451109:F262L	ENSP00000348693:F262L	F	-	3	2	MYO5A	50487600	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.897000	0.39799	0.793000	0.33875	-0.274000	0.10170	TTC	MYO5A	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000197535		0.303	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1	-	0.00	48	0	G	NM_000259		52700308	-1	tier1	-	no_errors	ENST00000358212	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	T
MYO5B	4645	genome.wustl.edu	37	18	47518679	47518679	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr18:47518679C>T	ENST00000285039.7	-	6	1034	c.735G>A	c.(733-735)gaG>gaA	p.E245E		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	245	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		CTCTGGACTTCTCCAAGAGGT	0.512																																																	0													218.0	206.0	210.0					18																	47518679		1951	4153	6104	SO:0001819	synonymous_variant	0			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.735G>A	18.37:g.47518679C>T			B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E245	ENST00000285039.7	37	c.735	CCDS42436.1	18																																																																																			MYO5B	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom	ENSG00000167306		0.512	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	-	0.00	101	0	C			47518679	-1	tier1	-	no_errors	ENST00000285039	ensembl	human	known	74_37	silent	16.07	47	9	SNP	1.000	T
NACA	4666	genome.wustl.edu	37	12	57112579	57112579	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:57112579G>C	ENST00000454682.1	-	3	3016	c.2735C>G	c.(2734-2736)tCc>tGc	p.S912C	NACA_ENST00000550952.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000548563.1_Intron|NACA_ENST00000551793.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000552540.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	912	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						AGAAGTCATGGATAGAGCAGG	0.597			T	BCL6	NHL																																			Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0													24.0	26.0	26.0					12																	57112579		1563	3558	5121	SO:0001583	missense	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.2735C>G	12.37:g.57112579G>C	ENSP00000403817:p.Ser912Cys			Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx_dom	p.S912C	ENST00000454682.1	37	c.2735		12	.	.	.	.	.	.	.	.	.	.	G	0.788	-0.760018	0.03019	.	.	ENSG00000196531	ENST00000454682	T	0.50813	0.73	1.08	-0.127	0.13510	.	.	.	.	.	T	0.25306	0.0615	.	.	.	0.09310	N	1	P	0.50156	0.932	B	0.37198	0.243	T	0.14254	-1.0479	7	.	.	.	.	1.738	0.02946	0.2483:0.0:0.3943:0.3573	.	912	E9PAV3	.	C	912	ENSP00000403817:S912C	.	S	-	2	0	NACA	55398846	0.001000	0.12720	0.001000	0.08648	0.017000	0.09413	-0.584000	0.05800	-0.042000	0.13535	0.298000	0.19748	TCC	NACA	-	NULL	ENSG00000196531		0.597	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding		-	0.00	71	0	G	NM_005594		57112579	-1	tier1	-	no_errors	ENST00000454682	ensembl	human	known	74_37	missense	9.62	47	5	SNP	0.001	C
NCOA1	8648	genome.wustl.edu	37	2	24905949	24905949	+	Missense_Mutation	SNP	G	G	A	rs375111492		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:24905949G>A	ENST00000406961.1	+	8	1136	c.484G>A	c.(484-486)Gtg>Atg	p.V162M	NCOA1_ENST00000405141.1_Missense_Mutation_p.V162M|NCOA1_ENST00000348332.3_Missense_Mutation_p.V162M|NCOA1_ENST00000288599.5_Missense_Mutation_p.V162M|NCOA1_ENST00000407230.1_Missense_Mutation_p.V11M|NCOA1_ENST00000395856.3_Missense_Mutation_p.V162M|NCOA1_ENST00000538539.1_Missense_Mutation_p.V162M			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1	162	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATACTGCACGTGGGGGATCA	0.388			T	PAX3	alveolar rhadomyosarcoma																																			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0								G	MET/VAL,MET/VAL,MET/VAL	1,4405	2.1+/-5.4	0,1,2202	74.0	72.0	73.0		484,484,484	5.6	1.0	2		73	0,8600		0,0,4300	no	missense,missense,missense	NCOA1	NM_003743.4,NM_147223.2,NM_147233.2	21,21,21	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging	162/1442,162/1400,162/1441	24905949	1,13005	2203	4300	6503	SO:0001583	missense	0			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.484G>A	2.37:g.24905949G>A	ENSP00000385216:p.Val162Met		O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.V162M	ENST00000406961.1	37	c.484	CCDS1712.1	2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.476333	0.84640	2.27E-4	0.0	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	T;T;T;T;T;T;T	0.17370	2.28;2.28;4.32;2.28;2.28;2.28;2.28	5.55	5.55	0.83447	PAS (2);PAS fold (1);	0.000000	0.85682	D	0.000000	T	0.43567	0.1253	M	0.69185	2.1	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.989;1.0	D;D;P;D	0.85130	0.997;0.99;0.867;0.995	T	0.26916	-1.0089	10	0.72032	D	0.01	.	19.0969	0.93255	0.0:0.0:1.0:0.0	.	162;162;162;11	Q15788-3;Q15788;Q15788-2;B5MCN7	.;NCOA1_HUMAN;.;.	M	162;162;11;162;162;162;162	ENSP00000385216:V162M;ENSP00000385097:V162M;ENSP00000385195:V11M;ENSP00000444039:V162M;ENSP00000320940:V162M;ENSP00000288599:V162M;ENSP00000379197:V162M	ENSP00000288599:V162M	V	+	1	0	NCOA1	24759453	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.876000	0.87215	2.616000	0.88540	0.655000	0.94253	GTG	NCOA1	-	pfam_PAS_fold,superfamily_PAS,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS	ENSG00000084676		0.388	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	HGNC	protein_coding	OTTHUMT00000246852.3		0.00	49	0	G	NM_147223		24905949	+1			no_errors	ENST00000348332	ensembl	human	known	74_37	missense	10.00	18	2	SNP	1.000	A
NCKAP5	344148	genome.wustl.edu	37	2	133540288	133540288	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:133540288T>C	ENST00000409261.1	-	14	4469	c.4096A>G	c.(4096-4098)Agt>Ggt	p.S1366G	NCKAP5_ENST00000405974.3_Intron|NCKAP5_ENST00000317721.6_Missense_Mutation_p.S1366G|NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1366										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GGCAACTTACTTGGGCTCCCA	0.632																																																	0													47.0	48.0	48.0					2																	133540288		1935	4140	6075	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.4096A>G	2.37:g.133540288T>C	ENSP00000387128:p.Ser1366Gly		B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.S1366G	ENST00000409261.1	37	c.4096	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	T	10.18	1.278523	0.23307	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.12255	2.7;2.7	5.5	4.36	0.52297	.	0.144113	0.31221	N	0.008028	T	0.08802	0.0218	N	0.20986	0.625	0.80722	D	1	B	0.18166	0.026	B	0.16289	0.015	T	0.15235	-1.0444	10	0.51188	T	0.08	.	6.1211	0.20154	0.1428:0.0755:0.0:0.7817	.	1366	O14513	NCKP5_HUMAN	G	1366	ENSP00000387128:S1366G;ENSP00000380603:S1366G	ENSP00000380603:S1366G	S	-	1	0	NCKAP5	133256758	0.996000	0.38824	0.995000	0.50966	0.961000	0.63080	1.284000	0.33249	1.104000	0.41587	0.533000	0.62120	AGT	NCKAP5	-	NULL	ENSG00000176771		0.632	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	-	0.00	35	0	T	NM_207481		133540288	-1	tier1	-	no_errors	ENST00000317721	ensembl	human	known	74_37	missense	40.00	9	6	SNP	0.996	C
NCOA2	10499	genome.wustl.edu	37	8	71053578	71053578	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:71053578G>A	ENST00000452400.2	-	14	3050	c.2869C>T	c.(2869-2871)Cag>Tag	p.Q957*	NCOA2_ENST00000267974.4_Nonsense_Mutation_p.Q45*	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	957					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GCCGAACTCTGCGGTGCCCAT	0.527			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																			Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0													57.0	60.0	59.0					8																	71053578		2061	4215	6276	SO:0001587	stop_gained	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.2869C>T	8.37:g.71053578G>A	ENSP00000399968:p.Gln957*		Q14CD2	Nonsense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.Q957*	ENST00000452400.2	37	c.2869	CCDS47872.1	8	.	.	.	.	.	.	.	.	.	.	G	43	10.205402	0.99359	.	.	ENSG00000140396	ENST00000452400;ENST00000267974	.	.	.	5.64	5.64	0.86602	.	0.334264	0.32175	N	0.006477	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	20.0691	0.97712	0.0:0.0:1.0:0.0	.	.	.	.	X	957;45	.	ENSP00000267974:Q45X	Q	-	1	0	NCOA2	71216132	1.000000	0.71417	0.954000	0.39281	0.831000	0.47069	5.482000	0.66833	2.820000	0.97059	0.650000	0.86243	CAG	NCOA2	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000140396		0.527	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	-	0.00	39	0	G			71053578	-1	tier1	-	no_errors	ENST00000452400	ensembl	human	known	74_37	nonsense	29.03	22	9	SNP	0.991	A
NEGR1	257194	genome.wustl.edu	37	1	72163744	72163744	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:72163744G>A	ENST00000357731.5	-	4	853	c.614C>T	c.(613-615)gCg>gTg	p.A205V	NEGR1_ENST00000434200.1_Intron|NEGR1_ENST00000306821.3_Missense_Mutation_p.A77V|NEGR1_ENST00000467479.1_5'UTR	NM_173808.2	NP_776169.2	Q7Z3B1	NEGR1_HUMAN	neuronal growth regulator 1	205	Ig-like C2-type 2.				feeding behavior (GO:0007631)|locomotory behavior (GO:0007626)|positive regulation of neuron projection development (GO:0010976)|single organismal cell-cell adhesion (GO:0016337)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(4)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32		all_cancers(4;1.26e-06)|Renal(4;1.32e-08)|all_epithelial(4;5.39e-07)|Hepatocellular(141;0.117)		KIRC - Kidney renal clear cell carcinoma(4;0.00529)|Kidney(4;0.00609)|all cancers(265;0.022)|GBM - Glioblastoma multiforme(62;0.0382)|Epithelial(280;0.242)		ATCATTTTCCGCACTGCATTC	0.353																																																	0													125.0	117.0	120.0					1																	72163744		2202	4300	6502	SO:0001583	missense	0			AK092307	CCDS661.1	1p31.1	2013-01-11			ENSG00000172260	ENSG00000172260		"""Immunoglobulin superfamily / I-set domain containing"""	17302	protein-coding gene	gene with protein product	"""a kindred of IgLON"", ""neurotractin"", ""IgLON family member 4"""	613173				10075727	Standard	NM_173808		Approved	KILON, MGC46680, Ntra, IGLON4	uc001dfw.3	Q7Z3B1	OTTHUMG00000009698	ENST00000357731.5:c.614C>T	1.37:g.72163744G>A	ENSP00000350364:p.Ala205Val		Q5VT21|Q6UY06|Q8N440|Q8NAQ3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.A205V	ENST00000357731.5	37	c.614	CCDS661.1	1	.	.	.	.	.	.	.	.	.	.	G	31	5.069308	0.93950	.	.	ENSG00000172260	ENST00000357731;ENST00000306821	T;T	0.72505	-0.66;-0.66	5.58	5.58	0.84498	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	D	0.84683	0.5526	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.86530	0.1821	10	0.87932	D	0	-12.3259	19.1653	0.93555	0.0:0.0:1.0:0.0	.	205	Q7Z3B1	NEGR1_HUMAN	V	205;77	ENSP00000350364:A205V;ENSP00000305938:A77V	ENSP00000305938:A77V	A	-	2	0	NEGR1	71936332	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	8.666000	0.91149	2.632000	0.89209	0.591000	0.81541	GCG	NEGR1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000172260		0.353	NEGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEGR1	HGNC	protein_coding	OTTHUMT00000026722.4	-	0.00	103	0	G	NM_173808		72163744	-1	tier1	-	no_errors	ENST00000357731	ensembl	human	known	74_37	missense	14.29	42	7	SNP	1.000	A
NELL1	4745	genome.wustl.edu	37	11	20939754	20939754	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:20939754C>G	ENST00000357134.5	+	6	782	c.630C>G	c.(628-630)atC>atG	p.I210M	NELL1_ENST00000532434.1_Missense_Mutation_p.I210M|NELL1_ENST00000298925.5_Missense_Mutation_p.I238M|NELL1_ENST00000325319.5_Missense_Mutation_p.I153M	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	210	Laminin G-like.				cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GGAAGATCATCTTTATGCCGA	0.363																																																	0													159.0	153.0	155.0					11																	20939754		2203	4299	6502	SO:0001583	missense	0			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.630C>G	11.37:g.20939754C>G	ENSP00000349654:p.Ile210Met		B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_VWF_C	p.I210M	ENST00000357134.5	37	c.630	CCDS7855.1	11	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400397	0.62177	.	.	ENSG00000165973	ENST00000298925;ENST00000357134;ENST00000325319;ENST00000532434	T;T;T;T	0.80994	4.37;4.37;-1.44;4.37	5.93	4.01	0.46588	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G, thrombospondin-type, N-terminal (1);	0.117230	0.56097	D	0.000033	D	0.82903	0.5138	L	0.54323	1.7	0.33982	D	0.648121	P;P;P;B	0.44877	0.773;0.664;0.845;0.437	P;B;P;B	0.56751	0.472;0.391;0.805;0.28	D	0.85738	0.1335	10	0.59425	D	0.04	-20.6415	7.1031	0.25348	0.1382:0.71:0.0:0.1518	.	153;238;210;210	F5H6I3;B3KXR2;Q92832-2;Q92832	.;.;.;NELL1_HUMAN	M	238;210;153;210	ENSP00000298925:I238M;ENSP00000349654:I210M;ENSP00000317837:I153M;ENSP00000437170:I210M	ENSP00000298925:I238M	I	+	3	3	NELL1	20896330	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.052000	0.30429	0.789000	0.33779	0.655000	0.94253	ATC	NELL1	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	ENSG00000165973		0.363	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1		0.00	43	0	C	NM_006157		20939754	+1			no_errors	ENST00000357134	ensembl	human	known	74_37	missense	10.34	25	3	SNP	1.000	G
NEUROD4	58158	genome.wustl.edu	37	12	55421014	55421014	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:55421014C>T	ENST00000242994.3	+	2	1169	c.791C>T	c.(790-792)tCc>tTc	p.S264F		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	264					amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						GGGAACTTCTCCTTGAAGCAA	0.512																																																	0													128.0	123.0	125.0					12																	55421014		2203	4300	6503	SO:0001583	missense	0			AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.791C>T	12.37:g.55421014C>T	ENSP00000242994:p.Ser264Phe		B2RAC9	Missense_Mutation	SNP	pfam_Neurogenic_DUF,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pirsf_TF_bHLH_NeuroD,pfscan_bHLH_dom	p.S264F	ENST00000242994.3	37	c.791	CCDS8886.1	12	.	.	.	.	.	.	.	.	.	.	C	23.3	4.397510	0.83120	.	.	ENSG00000123307	ENST00000242994	T	0.74002	-0.8	5.85	5.85	0.93711	Neurogenic differentiation factor, domain of unknown function (1);	0.106321	0.64402	D	0.000004	D	0.85539	0.5720	M	0.70595	2.14	0.80722	D	1	D	0.63880	0.993	D	0.68621	0.959	D	0.85958	0.1468	10	0.87932	D	0	-31.6002	18.0364	0.89305	0.0:1.0:0.0:0.0	.	264	Q9HD90	NDF4_HUMAN	F	264	ENSP00000242994:S264F	ENSP00000242994:S264F	S	+	2	0	NEUROD4	53707281	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.941000	0.99782	0.655000	0.94253	TCC	NEUROD4	-	pfam_Neurogenic_DUF,pirsf_TF_bHLH_NeuroD	ENSG00000123307		0.512	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD4	HGNC	protein_coding	OTTHUMT00000406104.1		0.00	55	0	C			55421014	+1			no_errors	ENST00000242994	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	T
NLRP14	338323	genome.wustl.edu	37	11	7071008	7071008	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:7071008A>C	ENST00000299481.4	+	6	2576	c.2230A>C	c.(2230-2232)Aat>Cat	p.N744H		NM_176822.3	NP_789792.1	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	744					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)			breast(3)|large_intestine(7)|lung(1)|ovary(3)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	21				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TATAGGGGATAATGGAGTAAA	0.363																																																	0													203.0	188.0	193.0					11																	7071008		2201	4296	6497	SO:0001583	missense	0			BK001107	CCDS7776.1	11p15.4	2006-12-08	2006-12-08	2006-12-08		ENSG00000158077		"""Nucleotide-binding domain and leucine rich repeat containing"""	22939	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 14"""	609665	"""NACHT, leucine rich repeat and PYD containing 14"""	NALP14		12563287	Standard	NM_176822		Approved	NOD5, GC-LRR, Nalp-iota, PAN8, CLR11.2	uc001mfb.1	Q86W24		ENST00000299481.4:c.2230A>C	11.37:g.7071008A>C	ENSP00000299481:p.Asn744His		Q7RTR6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.N744H	ENST00000299481.4	37	c.2230	CCDS7776.1	11	.	.	.	.	.	.	.	.	.	.	A	15.26	2.780541	0.49891	.	.	ENSG00000158077	ENST00000299481	T	0.63913	-0.07	5.21	-3.28	0.05033	.	1.663880	0.03174	N	0.171188	T	0.58352	0.2116	L	0.31476	0.935	0.09310	N	1	P	0.45474	0.859	P	0.55455	0.776	T	0.51872	-0.8650	10	0.46703	T	0.11	.	1.7328	0.02935	0.3438:0.1523:0.3562:0.1477	.	744	Q86W24	NAL14_HUMAN	H	744	ENSP00000299481:N744H	ENSP00000299481:N744H	N	+	1	0	NLRP14	7027584	0.000000	0.05858	0.002000	0.10522	0.908000	0.53690	-0.178000	0.09782	-0.178000	0.10672	0.472000	0.43445	AAT	NLRP14	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000158077		0.363	NLRP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP14	HGNC	protein_coding	OTTHUMT00000384551.1		0.00	94	0	A	NM_176822		7071008	+1			no_errors	ENST00000299481	ensembl	human	known	74_37	missense	7.14	39	3	SNP	0.008	C
NPIPB5	100132247	genome.wustl.edu	37	16	22503048	22503048	+	3'UTR	SNP	C	C	T	rs576507983	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr16:22503048C>T	ENST00000415654.1	+	0	1962				SMG1P1_ENST00000431681.1_RNA	NR_002555.2		A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5							integral component of membrane (GO:0016021)											TTCCACTCTTCGGCGAAGCTT	0.408													C|||	2	0.000399361	0.0	0.0	5008	,	,		22690	0.0		0.001	False		,,,				2504	0.001																0																																										SO:0001624	3_prime_UTR_variant	0				CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000415654.1:c.*1959C>T	16.37:g.22503048C>T			B4DK13	RNA	SNP	-	NULL	ENST00000415654.1	37	NULL		16																																																																																			NPIPB5	-	-	ENSG00000243716		0.408	NPIPB5-016	KNOWN	mRNA_end_NF|basic	processed_transcript	NPIPB5	HGNC	protein_coding	OTTHUMT00000402477.1	-	0.00	61	0	C	NM_001135865		22503048	+1	tier1	-	no_errors	ENST00000415654	ensembl	human	known	74_37	rna	10.00	36	4	SNP	1.000	T
NRG2	9542	genome.wustl.edu	37	5	139422030	139422030	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:139422030T>C	ENST00000361474.1	-	1	849	c.625A>G	c.(625-627)Acg>Gcg	p.T209A	NRG2_ENST00000394770.1_Missense_Mutation_p.T209A|NRG2_ENST00000289422.7_Missense_Mutation_p.T209A|NRG2_ENST00000541337.1_Missense_Mutation_p.T209A|NRG2_ENST00000358522.3_Missense_Mutation_p.T209A|NRG2_ENST00000545385.1_Missense_Mutation_p.T209A|NRG2_ENST00000289409.4_Missense_Mutation_p.T209A	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	209					embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAAAGGCCGTCTTAAAGACT	0.582																																																	0													23.0	25.0	24.0					5																	139422030		2203	4300	6503	SO:0001583	missense	0				CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.625A>G	5.37:g.139422030T>C	ENSP00000354910:p.Thr209Ala			Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_EG-like_dom,pfscan_Ig-like_dom	p.T209A	ENST00000361474.1	37	c.625	CCDS4217.1	5	.	.	.	.	.	.	.	.	.	.	T	9.042	0.989955	0.18966	.	.	ENSG00000158458	ENST00000541337;ENST00000289422;ENST00000361474;ENST00000446269;ENST00000545385;ENST00000394770;ENST00000289409;ENST00000358522;ENST00000544729;ENST00000378238	T;T;T;T;T;T;T;T	0.72167	-0.25;-0.42;-0.38;-0.42;-0.46;-0.63;-0.42;-0.46	4.25	4.25	0.50352	.	.	.	.	.	T	0.46054	0.1373	N	0.04203	-0.255	0.35844	D	0.826283	B;B;B;B	0.23854	0.043;0.025;0.092;0.043	B;B;B;B	0.22880	0.019;0.012;0.042;0.028	T	0.49588	-0.8924	9	0.15066	T	0.55	-0.3096	11.6055	0.51029	0.0:0.0:0.0:1.0	.	209;209;209;209	O14511-2;O14511;O14511-4;O14511-3	.;NRG2_HUMAN;.;.	A	209;209;209;209;209;209;209;209;117;209	ENSP00000444235:T209A;ENSP00000289422:T209A;ENSP00000354910:T209A;ENSP00000438753:T209A;ENSP00000378251:T209A;ENSP00000289409:T209A;ENSP00000351323:T209A;ENSP00000367483:T209A	ENSP00000289409:T209A	T	-	1	0	NRG2	139402214	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.881000	0.63114	1.564000	0.49628	0.254000	0.18369	ACG	NRG2	-	NULL	ENSG00000158458		0.582	NRG2-001	KNOWN	basic|CCDS	protein_coding	NRG2	HGNC	protein_coding	OTTHUMT00000251340.1		0.00	117	0	T	NM_013982		139422030	-1			no_errors	ENST00000545385	ensembl	human	known	74_37	missense	5.88	48	3	SNP	1.000	C
NUAK1	9891	genome.wustl.edu	37	12	106466612	106466612	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:106466612A>G	ENST00000261402.2	-	5	1968	c.589T>C	c.(589-591)Ttt>Ctt	p.F197L		NM_014840.2	NP_055655.1	O60285	NUAK1_HUMAN	NUAK family, SNF1-like kinase, 1	197	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cellular response to DNA damage stimulus (GO:0006974)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of cellular senescence (GO:2000772)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	37						GAAAGCCCAAAGTCAGCAATC	0.463																																																	0													127.0	118.0	121.0					12																	106466612		2203	4300	6503	SO:0001583	missense	0			AB011109	CCDS31892.1	12q23.3	2005-08-09				ENSG00000074590			14311	protein-coding gene	gene with protein product	"""AMP-activated protein kinase family member 5"""	608130				12409306, 13679856	Standard	NM_014840		Approved	ARK5, KIAA0537, NuaK1	uc001tlj.1	O60285	OTTHUMG00000169763	ENST00000261402.2:c.589T>C	12.37:g.106466612A>G	ENSP00000261402:p.Phe197Leu		A7MD39|Q96KA8	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.F197L	ENST00000261402.2	37	c.589	CCDS31892.1	12	.	.	.	.	.	.	.	.	.	.	A	33	5.281340	0.95489	.	.	ENSG00000074590	ENST00000261402;ENST00000548902	T;T	0.62232	0.04;0.04	5.89	5.89	0.94794	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000016	T	0.80088	0.4559	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82583	-0.0385	10	0.87932	D	0	.	16.3123	0.82883	1.0:0.0:0.0:0.0	.	197	O60285	NUAK1_HUMAN	L	197;66	ENSP00000261402:F197L;ENSP00000448288:F66L	ENSP00000261402:F197L	F	-	1	0	NUAK1	104990742	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.284000	0.95882	2.254000	0.74563	0.459000	0.35465	TTT	NUAK1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000074590		0.463	NUAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUAK1	HGNC	protein_coding	OTTHUMT00000405767.2	-	0.00	47	0	A	NM_014840		106466612	-1	tier1	-	no_errors	ENST00000261402	ensembl	human	known	74_37	missense	27.27	8	3	SNP	1.000	G
NUTM2G	441457	genome.wustl.edu	37	9	99699643	99699643	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:99699643G>C	ENST00000372322.3	+	5	1301	c.1280G>C	c.(1279-1281)aGc>aCc	p.S427T	NUTM2G_ENST00000354649.3_Missense_Mutation_p.S427T|HIATL2_ENST00000506067.1_Intron	NM_001170741.1	NP_001164212.1	Q5VZR2	NTM2G_HUMAN	NUT family member 2G	427																	GGCCTCCTGAGCTACATTGAC	0.602																																																	0													83.0	96.0	92.0					9																	99699643		1992	4156	6148	SO:0001583	missense	0				CCDS43854.1, CCDS55329.1	9q22.33	2013-05-02	2013-03-14	2013-05-02	ENSG00000188152	ENSG00000188152			23449	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member G"""	FAM22G			Standard	NM_001045477		Approved			Q5VZR2	OTTHUMG00000020305	ENST00000372322.3:c.1280G>C	9.37:g.99699643G>C	ENSP00000361397:p.Ser427Thr		A6NNI5|Q5VZR3	Missense_Mutation	SNP	NULL	p.S427T	ENST00000372322.3	37	c.1280	CCDS55329.1	9	.	.	.	.	.	.	.	.	.	.	.	13.06	2.122907	0.37436	.	.	ENSG00000188152	ENST00000354649;ENST00000372322;ENST00000417159;ENST00000375230	T;T	0.29397	1.57;2.34	1.33	1.33	0.21861	.	0.278775	0.31123	N	0.008205	T	0.44993	0.1320	M	0.62266	1.93	0.20764	N	0.999859	D	0.76494	0.999	D	0.83275	0.996	T	0.08126	-1.0737	10	0.62326	D	0.03	.	6.1314	0.20207	0.0:0.0:1.0:0.0	.	427	Q5VZR2-2	.	T	427;427;276;308	ENSP00000346670:S427T;ENSP00000361397:S427T	ENSP00000346670:S427T	S	+	2	0	FAM22G	98739464	0.802000	0.28943	0.496000	0.27539	0.279000	0.26890	0.272000	0.18644	1.087000	0.41251	0.473000	0.43528	AGC	NUTM2G	-	NULL	ENSG00000188152		0.602	NUTM2G-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUTM2G	HGNC	protein_coding	OTTHUMT00000053291.2	-	0.00	142	0	G	NM_001170741		99699643	+1	tier1	-	no_errors	ENST00000372322	ensembl	human	known	74_37	missense	9.46	67	7	SNP	0.527	C
OGFOD1	55239	genome.wustl.edu	37	16	56485558	56485558	+	Missense_Mutation	SNP	G	G	A	rs200222995		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr16:56485558G>A	ENST00000566157.1	+	1	157	c.34G>A	c.(34-36)Gcc>Acc	p.A12T	OGFOD1_ENST00000568397.1_Missense_Mutation_p.A12T|NUDT21_ENST00000300291.5_5'Flank	NM_018233.3	NP_060703.3	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 1	12					cell proliferation (GO:0008283)|peptidyl-proline hydroxylation (GO:0019511)|protein hydroxylation (GO:0018126)|regulation of translational termination (GO:0006449)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|peptidyl-proline 3-dioxygenase activity (GO:0031544)|peptidyl-proline dioxygenase activity (GO:0031543)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8					Vitamin C(DB00126)	GCCCGGCCCAGCCCGGGTGGG	0.587													G|||	1	0.000199681	0.0	0.0	5008	,	,		15667	0.0		0.001	False		,,,				2504	0.0																0													70.0	85.0	80.0					16																	56485558		2198	4300	6498	SO:0001583	missense	0			BC032919	CCDS10761.2	16q12.2	2010-11-23			ENSG00000087263	ENSG00000087263			25585	protein-coding gene	gene with protein product	"""TPA1, termination and polyadenylation 1, homolog (S. cerevisiae)"""	615857				10997877	Standard	NM_018233		Approved	KIAA1612, FLJ10826, TPA1	uc002ejb.3	Q8N543	OTTHUMG00000133237	ENST00000566157.1:c.34G>A	16.37:g.56485558G>A	ENSP00000457258:p.Ala12Thr		H3BUQ2|Q9H7U5|Q9H9J9|Q9HA87|Q9HCG0|Q9NVB6	Missense_Mutation	SNP	pfam_Oxoglutarate/Fe-dep_Oase_C,smart_Pro_4_hyd_alph	p.A12T	ENST00000566157.1	37	c.34	CCDS10761.2	16	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	12.96	2.093506	0.36952	.	.	ENSG00000087263	ENST00000336111	.	.	.	5.8	4.85	0.62838	.	0.997630	0.08122	N	0.994618	T	0.31295	0.0792	N	0.25647	0.755	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21211	-1.0252	9	0.11794	T	0.64	-11.0737	11.8509	0.52412	0.0815:0.0:0.9185:0.0	.	12	Q8N543	OGFD1_HUMAN	T	12	.	ENSP00000337196:A12T	A	+	1	0	OGFOD1	55043059	0.011000	0.17503	0.002000	0.10522	0.287000	0.27160	1.827000	0.39102	1.463000	0.47967	0.563000	0.77884	GCC	OGFOD1	-	NULL	ENSG00000087263		0.587	OGFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGFOD1	HGNC	protein_coding	OTTHUMT00000256976.3		0.00	70	0	G	NM_018233		56485558	+1			no_errors	ENST00000566157	ensembl	human	known	74_37	missense	8.82	31	3	SNP	0.014	A
OR10Q1	219960	genome.wustl.edu	37	11	57995922	57995922	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:57995922G>A	ENST00000316770.2	-	1	468	c.426C>T	c.(424-426)cgC>cgT	p.R142R		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R142R(1)		autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				TGCACAGCTCGCGGGTCATGA	0.632																																																	1	Substitution - coding silent(1)	ovary(1)											61.0	53.0	56.0					11																	57995922		2201	4295	6496	SO:0001819	synonymous_variant	0			AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.426C>T	11.37:g.57995922G>A			Q6IFG4	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R142	ENST00000316770.2	37	c.426	CCDS31547.1	11																																																																																			OR10Q1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000180475		0.632	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	HGNC	protein_coding	OTTHUMT00000394706.1	-	0.00	37	0	G	NM_001004471		57995922	-1	tier1	-	no_errors	ENST00000316770	ensembl	human	known	74_37	silent	14.81	23	4	SNP	0.000	A
OR10R2	343406	genome.wustl.edu	37	1	158449953	158449953	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:158449953delG	ENST00000368152.1	+	1	286	c.286delG	c.(286-288)gtcfs	p.V96fs	RP11-144L1.4_ENST00000419738.1_RNA|RP11-144L1.4_ENST00000426251.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	96						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					CTACACCTTTGTCATTCTACC	0.433																																																	0													313.0	268.0	283.0					1																	158449953		2203	4300	6503	SO:0001589	frameshift_variant	0			AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.286delG	1.37:g.158449953delG	ENSP00000357134:p.Val96fs		Q5VWM8|Q6IFS1|Q96R61	Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V96fs	ENST00000368152.1	37	c.286	CCDS30898.1	1																																																																																			OR10R2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000198965		0.433	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10R2	HGNC	protein_coding	OTTHUMT00000051847.2		0.00	54	0	G	NM_001004472		158449953	+1	tier1		no_errors	ENST00000368152	ensembl	human	known	74_37	frame_shift_del	11.11	16	2	DEL	0.853	-
OR2M5	127059	genome.wustl.edu	37	1	248308866	248308866	+	Silent	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:248308866A>G	ENST00000366476.1	+	1	417	c.417A>G	c.(415-417)aaA>aaG	p.K139K		NM_001004690.1	NP_001004690.1	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M, member 5	139						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|liver(1)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	49	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)			TGAGACCCAAAATTTGTGGAC	0.473																																																	0													260.0	261.0	261.0					1																	248308866		2203	4298	6501	SO:0001819	synonymous_variant	0				CCDS31105.1	1q44	2012-08-09		2004-03-10	ENSG00000162727	ENSG00000162727		"""GPCR / Class A : Olfactory receptors"""	19576	protein-coding gene	gene with protein product				OR2M5P			Standard	NM_001004690		Approved		uc010pze.2	A3KFT3	OTTHUMG00000040447	ENST00000366476.1:c.417A>G	1.37:g.248308866A>G				Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K139	ENST00000366476.1	37	c.417	CCDS31105.1	1																																																																																			OR2M5	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000162727		0.473	OR2M5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M5	HGNC	protein_coding	OTTHUMT00000097343.1	-	0.00	175	0	A	NM_001004690		248308866	+1	tier1	-	no_errors	ENST00000366476	ensembl	human	known	74_37	silent	30.68	61	27	SNP	0.000	G
OR4B1	119765	genome.wustl.edu	37	11	48239132	48239132	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:48239132G>A	ENST00000309562.2	+	1	789	c.771G>A	c.(769-771)atG>atA	p.M257I		NM_001005470.1	NP_001005470.1	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B, member 1	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						TCCTCTACATGCGACCTTCTT	0.488																																																	0													141.0	109.0	120.0					11																	48239132		2201	4298	6499	SO:0001583	missense	0			AB065848	CCDS31485.1	11p11.2	2012-08-09			ENSG00000175619	ENSG00000175619		"""GPCR / Class A : Olfactory receptors"""	8290	protein-coding gene	gene with protein product							Standard	NM_001005470		Approved	OST208	uc010rhs.2	Q8NGF8	OTTHUMG00000166576	ENST00000309562.2:c.771G>A	11.37:g.48239132G>A	ENSP00000311605:p.Met257Ile		Q6IF75|Q96R64	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M257I	ENST00000309562.2	37	c.771	CCDS31485.1	11	.	.	.	.	.	.	.	.	.	.	G	5.065	0.197673	0.09652	.	.	ENSG00000175619	ENST00000309562	T	0.34859	1.34	5.54	3.62	0.41486	GPCR, rhodopsin-like superfamily (1);	0.455157	0.20794	N	0.085574	T	0.17662	0.0424	N	0.05259	-0.085	0.09310	N	1	B	0.27380	0.177	B	0.33799	0.17	T	0.15636	-1.0430	10	0.34782	T	0.22	.	4.3516	0.11158	0.0844:0.1561:0.5982:0.1613	.	257	Q8NGF8	OR4B1_HUMAN	I	257	ENSP00000311605:M257I	ENSP00000311605:M257I	M	+	3	0	OR4B1	48195708	0.000000	0.05858	0.337000	0.25536	0.043000	0.13939	0.057000	0.14279	0.656000	0.30886	0.508000	0.49915	ATG	OR4B1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000175619		0.488	OR4B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4B1	HGNC	protein_coding	OTTHUMT00000390554.1	-	0.00	69	0	G	NM_001005470		48239132	+1	tier1	-	no_errors	ENST00000309562	ensembl	human	known	74_37	missense	26.92	19	7	SNP	0.060	A
OR4C16	219428	genome.wustl.edu	37	11	55340455	55340455	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:55340455T>G	ENST00000314634.3	+	1	852	c.852T>G	c.(850-852)atT>atG	p.I284M		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				ACCCTGTGATTTACACGCTGA	0.373																																																	0													68.0	64.0	65.0					11																	55340455		2201	4296	6497	SO:0001583	missense	0			AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.852T>G	11.37:g.55340455T>G	ENSP00000324913:p.Ile284Met		Q6IEV8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I284M	ENST00000314634.3	37	c.852	CCDS31502.1	11	.	.	.	.	.	.	.	.	.	.	T	11.47	1.649734	0.29336	.	.	ENSG00000181935	ENST00000314634	T	0.57273	0.41	4.68	2.24	0.28232	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000012	T	0.65903	0.2736	M	0.81112	2.525	0.29027	N	0.88596	D	0.71674	0.998	D	0.69824	0.966	T	0.59789	-0.7388	10	0.87932	D	0	.	3.8056	0.08776	0.3304:0.0933:0.0:0.5763	.	284	Q8NGL9	OR4CG_HUMAN	M	284	ENSP00000324913:I284M	ENSP00000324913:I284M	I	+	3	3	OR4C16	55097031	0.232000	0.23762	0.968000	0.41197	0.047000	0.14425	-0.720000	0.04969	0.800000	0.34041	0.448000	0.29417	ATT	OR4C16	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	ENSG00000181935		0.373	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C16	HGNC	protein_coding	OTTHUMT00000382627.1	-	0.00	44	0	T	NM_001004701		55340455	+1	tier1	-	no_errors	ENST00000314634	ensembl	human	known	74_37	missense	70.59	5	12	SNP	1.000	G
OR4N4	283694	genome.wustl.edu	37	15	22382738	22382738	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:22382738A>G	ENST00000328795.4	+	1	357	c.266A>G	c.(265-267)aAa>aGa	p.K89R	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTCTCTGAGAAAAAGGTAATC	0.507																																																	0													49.0	51.0	50.0					15																	22382738		2185	4257	6442	SO:0001583	missense	0			AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.266A>G	15.37:g.22382738A>G	ENSP00000332500:p.Lys89Arg		Q6IEY3|Q6IF56	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K89R	ENST00000328795.4	37	c.266	CCDS32173.1	15	.	.	.	.	.	.	.	.	.	.	.	0.010	-1.784064	0.00628	.	.	ENSG00000183706	ENST00000328795	T	0.03035	4.07	3.2	3.2	0.36748	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000088	T	0.02083	0.0065	N	0.13235	0.315	0.23791	N	0.996836	B	0.06786	0.001	B	0.08055	0.003	T	0.46843	-0.9162	10	0.06236	T	0.91	-9.5068	9.7766	0.40623	1.0:0.0:0.0:0.0	.	89	Q8N0Y3	OR4N4_HUMAN	R	89	ENSP00000332500:K89R	ENSP00000332500:K89R	K	+	2	0	OR4N4	19884102	0.000000	0.05858	1.000000	0.80357	0.053000	0.15095	0.124000	0.15728	1.461000	0.47929	0.155000	0.16302	AAA	OR4N4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000183706		0.507	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N4	HGNC	protein_coding	OTTHUMT00000414922.1		0.00	42	0	A			22382738	+1			no_errors	ENST00000328795	ensembl	human	known	74_37	missense	25.81	23	8	SNP	0.944	G
P2RY8	286530	genome.wustl.edu	37	X	1584751	1584751	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:1584751C>T	ENST00000381297.4	-	2	911	c.701G>A	c.(700-702)cGc>cAc	p.R234H	P2RY8_ENST00000460672.1_5'Flank	NM_178129.4	NP_835230.1	Q86VZ1	P2RY8_HUMAN	purinergic receptor P2Y, G-protein coupled, 8	234						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(13)|prostate(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GCCCACCGCGCGCCTCCGCTG	0.657			T	CRLF2	"""B-ALL, Downs associated ALL"""								c|||	1	0.000199681	0.0	0.0	5008	,	,		16692	0.0		0.0	False		,,,				2504	0.001							Dom	yes		"""X,Y"""	Xp22.3; Yp11.3	286530	"""purinergic receptor P2Y, G-protein coupled, 8"""		L	0													45.0	37.0	40.0					X																	1584751		2201	4293	6494	SO:0001583	missense	0			AA804531	CCDS14115.1	Xp22.33 and Yp11.3	2012-08-08			ENSG00000182162	ENSG00000182162		"""Pseudoautosomal regions / PAR1"", ""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	15524	protein-coding gene	gene with protein product		300525				11004484	Standard	NM_178129		Approved	P2Y8	uc004cpz.2	Q86VZ1	OTTHUMG00000021060	ENST00000381297.4:c.701G>A	X.37:g.1584751C>T	ENSP00000370697:p.Arg234His			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Protea_act_rcpt	p.R234H	ENST00000381297.4	37	c.701	CCDS14115.1	X	.	.	.	.	.	.	.	.	.	.	c	13.41	2.228024	0.39399	.	.	ENSG00000182162	ENST00000381297	T	0.43688	0.94	2.73	2.73	0.32206	GPCR, rhodopsin-like superfamily (1);	0.077802	0.49305	U	0.000143	T	0.58090	0.2098	L	0.58428	1.81	0.09310	N	1	D	0.89917	1.0	D	0.74674	0.984	T	0.53027	-0.8496	10	0.87932	D	0	.	13.5149	0.61535	0.0:1.0:0.0:0.0	.	234	Q86VZ1	P2RY8_HUMAN	H	234	ENSP00000370697:R234H	ENSP00000370697:R234H	R	-	2	0	P2RY8	1544751	0.884000	0.30299	0.136000	0.22124	0.586000	0.36452	3.326000	0.52037	1.007000	0.39238	0.279000	0.19357	CGC	P2RY8	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000182162		0.657	P2RY8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY8	HGNC	protein_coding	OTTHUMT00000055602.1	-	0.00	60	0	C	NM_178129		1584751	-1	tier1	-	no_errors	ENST00000381297	ensembl	human	known	74_37	missense	20.00	28	7	SNP	0.886	T
SAMD4B	55095	genome.wustl.edu	37	19	39876775	39876775	+	IGR	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:39876775G>A	ENST00000314471.6	+	0	4519				PAF1_ENST00000595564.1_Missense_Mutation_p.A413V|PAF1_ENST00000221265.3_Silent_p.S484S|PAF1_ENST00000221266.7_Missense_Mutation_p.A390V	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			CATTGCTGCCGCTGTCTGAAT	0.617																																																	0													116.0	102.0	106.0					19																	39876775		2203	4300	6503	SO:0001628	intergenic_variant	0				CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9			19.37:g.39876775G>A			A5Z0M6|Q6P194	Missense_Mutation	SNP	pfam_RNA_pol_II-assoc_Paf1	p.A413V	ENST00000314471.6	37	c.1238	CCDS33020.1	19	.	.	.	.	.	.	.	.	.	.	g	8.333	0.826860	0.16749	.	.	ENSG00000006712	ENST00000221266	.	.	.	4.81	-9.17	0.00691	.	.	.	.	.	T	0.48768	0.1518	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.18903	-1.0322	7	0.87932	D	0	-17.0142	14.2195	0.65818	0.7383:0.0:0.2617:0.0	.	390	F8W9Q2	.	V	390	.	ENSP00000221266:A390V	A	-	2	0	PAF1	44568615	0.002000	0.14202	0.872000	0.34217	0.091000	0.18340	-1.932000	0.01554	-1.486000	0.01851	-0.366000	0.07423	GCG	PAF1	-	NULL	ENSG00000006712		0.617	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAF1	HGNC	protein_coding	OTTHUMT00000464467.1	-	0.00	38	0	G	NM_018028		39876775	-1	tier1	-	no_errors	ENST00000595564	ensembl	human	known	74_37	missense	20.00	12	3	SNP	0.949	A
PAFAH1B3	5050	genome.wustl.edu	37	19	42806151	42806151	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:42806151T>G	ENST00000262890.3	-	2	380	c.119A>C	c.(118-120)gAa>gCa	p.E40A	PRR19_ENST00000598490.1_5'Flank|PAFAH1B3_ENST00000538771.1_Missense_Mutation_p.E40A|PRR19_ENST00000341747.3_5'Flank	NM_002573.3	NP_002564.1	Q15102	PA1B3_HUMAN	platelet-activating factor acetylhydrolase 1b, catalytic subunit 3 (29kDa)	40					brain development (GO:0007420)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)			breast(1)|large_intestine(2)|ovary(1)	4		Prostate(69;0.0704)				GAAGACGACTTCGGGTTCCTT	0.647																																																	0													58.0	51.0	53.0					19																	42806151		2196	4292	6488	SO:0001583	missense	0			D63391	CCDS12602.1	19q13.1	2011-10-24	2010-02-10			ENSG00000079462			8576	protein-coding gene	gene with protein product	"""PAF-AH1b alpha 1 subunit"""	603074	"""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit (29kD)"", ""platelet-activating factor acetylhydrolase, isoform Ib, gamma subunit 29kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 3 (29kDa)"""			7669037	Standard	NM_002573		Approved		uc010xwj.1	Q15102		ENST00000262890.3:c.119A>C	19.37:g.42806151T>G	ENSP00000262890:p.Glu40Ala		Q53X88	Missense_Mutation	SNP	NULL	p.E40A	ENST00000262890.3	37	c.119	CCDS12602.1	19	.	.	.	.	.	.	.	.	.	.	T	20.7	4.033273	0.75504	.	.	ENSG00000079462	ENST00000538771;ENST00000262890	T;T	0.43294	0.95;0.95	4.54	4.54	0.55810	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);	0.112315	0.64402	D	0.000014	T	0.34279	0.0892	L	0.52573	1.65	0.51012	D	0.999909	P	0.36874	0.572	B	0.31390	0.129	T	0.20505	-1.0273	10	0.40728	T	0.16	-9.5017	11.8744	0.52539	0.0:0.0:0.0:1.0	.	40	Q15102	PA1B3_HUMAN	A	40	ENSP00000444935:E40A;ENSP00000262890:E40A	ENSP00000262890:E40A	E	-	2	0	PAFAH1B3	47497991	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	5.061000	0.64319	1.910000	0.55303	0.379000	0.24179	GAA	PAFAH1B3	-	NULL	ENSG00000079462		0.647	PAFAH1B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAFAH1B3	HGNC	protein_coding	OTTHUMT00000463726.1	-	0.00	70	0	T	NM_002573		42806151	-1	tier1	-	no_errors	ENST00000262890	ensembl	human	known	74_37	missense	15.79	32	6	SNP	1.000	G
PAPPA2	60676	genome.wustl.edu	37	1	176564689	176564689	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:176564689C>T	ENST00000367662.3	+	3	3113	c.1949C>T	c.(1948-1950)gCt>gTt	p.A650V	PAPPA2_ENST00000367661.3_Missense_Mutation_p.A650V	NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	650	Metalloprotease.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CCCCAGGTGGCTGATGTGCGC	0.537																																																	0													52.0	57.0	55.0					1																	176564689		2165	4266	6431	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.1949C>T	1.37:g.176564689C>T	ENSP00000356634:p.Ala650Val		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.A650V	ENST00000367662.3	37	c.1949	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	C	14.98	2.696535	0.48202	.	.	ENSG00000116183	ENST00000367662;ENST00000367661	T;T	0.32272	4.7;1.46	5.42	5.42	0.78866	.	0.455547	0.24815	N	0.035363	T	0.20495	0.0493	N	0.22421	0.69	0.31423	N	0.674115	B;P	0.36222	0.129;0.544	B;B	0.27170	0.045;0.077	T	0.24764	-1.0151	10	0.72032	D	0.01	-3.4059	14.4588	0.67435	0.0:0.853:0.147:0.0	.	650;650	Q9BXP8;A9Z1Y8	PAPP2_HUMAN;.	V	650	ENSP00000356634:A650V;ENSP00000356633:A650V	ENSP00000356633:A650V	A	+	2	0	PAPPA2	174831312	0.619000	0.27059	0.741000	0.31004	0.400000	0.30750	5.874000	0.69652	2.542000	0.85734	0.650000	0.86243	GCT	PAPPA2	-	NULL	ENSG00000116183		0.537	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	35	0	C			176564689	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.998	T
PAPPA2	60676	genome.wustl.edu	37	1	176668488	176668488	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:176668488A>G	ENST00000367662.3	+	8	4163	c.2999A>G	c.(2998-3000)gAc>gGc	p.D1000G		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1000					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						GGCCCCTTAGACACTTTCTGT	0.512																																																	0													195.0	197.0	197.0					1																	176668488		2131	4251	6382	SO:0001583	missense	0			BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.2999A>G	1.37:g.176668488A>G	ENSP00000356634:p.Asp1000Gly		A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	pfam_Notch_dom,pfam_Sushi_SCR_CCP,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.D1000G	ENST00000367662.3	37	c.2999	CCDS41438.1	1	.	.	.	.	.	.	.	.	.	.	A	18.33	3.599717	0.66332	.	.	ENSG00000116183	ENST00000367662	T	0.01613	4.73	5.38	5.38	0.77491	Fibronectin, type III (2);	0.246169	0.47455	D	0.000228	T	0.02571	0.0078	L	0.36672	1.1	0.80722	D	1	B	0.25563	0.129	B	0.26614	0.071	T	0.55237	-0.8172	10	0.62326	D	0.03	-10.8433	15.2247	0.73342	1.0:0.0:0.0:0.0	.	1000	Q9BXP8	PAPP2_HUMAN	G	1000	ENSP00000356634:D1000G	ENSP00000356634:D1000G	D	+	2	0	PAPPA2	174935111	1.000000	0.71417	0.925000	0.36789	0.999000	0.98932	6.612000	0.74187	2.254000	0.74563	0.533000	0.62120	GAC	PAPPA2	-	superfamily_Fibronectin_type3	ENSG00000116183		0.512	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA2	HGNC	protein_coding	OTTHUMT00000084763.1	-	0.00	60	0	A			176668488	+1	tier1	-	no_errors	ENST00000367662	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.975	G
PARP14	54625	genome.wustl.edu	37	3	122433231	122433232	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr3:122433231_122433232insA	ENST00000474629.2	+	12	4221_4222	c.3955_3956insA	c.(3955-3957)gaafs	p.E1319fs		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	1319	Macro 3. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		GCAGGAGTGTGAAAAAAAAAAT	0.421																																																	0																																										SO:0001589	frameshift_variant	0			AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.3965dupA	3.37:g.122433241_122433241dupA	ENSP00000418194:p.Glu1319fs		B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Frame_Shift_Ins	INS	pfam_Macro_dom,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_WWE-dom,smart_Macro_dom,pfscan_Macro_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.N1322fs	ENST00000474629.2	37	c.3955_3956	CCDS46894.1	3																																																																																			PARP14	-	pfam_Macro_dom,smart_Macro_dom,pfscan_Macro_dom	ENSG00000173193		0.421	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP14	HGNC	protein_coding	OTTHUMT00000356173.2		0.00	70	0	-	NM_017554		122433232	+1	tier1		no_errors	ENST00000474629	ensembl	human	known	74_37	frame_shift_ins	6.25	30	2	INS	1.000:0.974	A
PCDHAC1	56135	genome.wustl.edu	37	5	140306543	140306543	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:140306543C>T	ENST00000253807.2	+	1	66	c.66C>T	c.(64-66)ctC>ctT	p.L22L	PCDHA12_ENST00000398631.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHAC1_ENST00000409700.3_Silent_p.L22L|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	22	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGACAGCTCGAGTACTCAG	0.632																																																	0													100.0	119.0	112.0					5																	140306543		2203	4300	6503	SO:0001819	synonymous_variant	0			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.66C>T	5.37:g.140306543C>T			Q9Y5F5|Q9Y5I5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.L22	ENST00000253807.2	37	c.66	CCDS4241.1	5																																																																																			PCDHAC1	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000248383		0.632	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHAC1	HGNC	protein_coding	OTTHUMT00000251798.1	-	0.00	79	0	C	NM_018898		140306543	+1	tier1	-	no_errors	ENST00000253807	ensembl	human	known	74_37	silent	22.86	27	8	SNP	0.479	T
PCK2	5106	genome.wustl.edu	37	14	24567713	24567713	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:24567713A>G	ENST00000216780.4	+	4	758	c.490A>G	c.(490-492)Atg>Gtg	p.M164V	PCK2_ENST00000561286.1_Missense_Mutation_p.M30V|PCK2_ENST00000545054.2_Missense_Mutation_p.M30V|PCK2_ENST00000558096.1_Missense_Mutation_p.M30V|PCK2_ENST00000559250.1_Missense_Mutation_p.M176V|NRL_ENST00000561028.1_Intron|PCK2_ENST00000396973.4_Missense_Mutation_p.M164V	NM_004563.2	NP_004554.2	Q16822	PCKGM_HUMAN	phosphoenolpyruvate carboxykinase 2 (mitochondrial)	164					carbohydrate metabolic process (GO:0005975)|cellular response to glucose stimulus (GO:0071333)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|NADH oxidation (GO:0006116)|oxaloacetate metabolic process (GO:0006107)|positive regulation of insulin secretion (GO:0032024)|pyruvate metabolic process (GO:0006090)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)|phosphoenolpyruvate carboxykinase activity (GO:0004611)			breast(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(265;0.0184)		TCCATTCAGCATGGGTCCTGT	0.592																																																	0													70.0	60.0	63.0					14																	24567713		2203	4300	6503	SO:0001583	missense	0			AK129934	CCDS9609.1, CCDS41928.1	14q12	2006-06-09			ENSG00000100889	ENSG00000100889	4.1.1.32		8725	protein-coding gene	gene with protein product		614095				8645161, 9657976	Standard	XM_005267726		Approved	PEPCK, PEPCK2	uc001wlt.3	Q16822	OTTHUMG00000028791	ENST00000216780.4:c.490A>G	14.37:g.24567713A>G	ENSP00000216780:p.Met164Val		O43253|Q86U01|Q9BV62	Missense_Mutation	SNP	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	p.M164V	ENST00000216780.4	37	c.490	CCDS9609.1	14	.	.	.	.	.	.	.	.	.	.	A	22.8	4.337561	0.81911	.	.	ENSG00000100889	ENST00000216780;ENST00000396973;ENST00000545054	T;T;T	0.05855	3.38;3.38;3.38	5.67	5.67	0.87782	Phosphoenolpyruvate carboxykinase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.38639	0.1048	H	0.97131	3.945	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.995;0.998;0.995	T	0.57010	-0.7884	10	0.87932	D	0	-24.3306	13.8685	0.63603	1.0:0.0:0.0:0.0	.	30;164;164;164	B4DW73;Q16822;Q16822-2;Q6IB91	.;PCKGM_HUMAN;.;.	V	164;164;30	ENSP00000216780:M164V;ENSP00000380171:M164V;ENSP00000441826:M30V	ENSP00000216780:M164V	M	+	1	0	PCK2	23637553	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.169000	0.68431	0.460000	0.39030	ATG	PCK2	-	pfam_PEP_carboxykinase_GTP,superfamily_PEP_carboxykinase_N,pirsf_PEP_carboxykinase_GTP	ENSG00000100889		0.592	PCK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCK2	HGNC	protein_coding	OTTHUMT00000071900.3	-	0.00	47	0	A	NM_001018073		24567713	+1	tier1	-	no_errors	ENST00000216780	ensembl	human	known	74_37	missense	25.00	9	3	SNP	1.000	G
PCLO	27445	genome.wustl.edu	37	7	82595489	82595489	+	Silent	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:82595489A>C	ENST00000333891.9	-	4	3952	c.3615T>G	c.(3613-3615)gcT>gcG	p.A1205A	PCLO_ENST00000423517.2_Silent_p.A1205A	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GAAGAGCTGAAGCTTTGTCTT	0.348																																																	0													153.0	144.0	147.0					7																	82595489		1797	4080	5877	SO:0001819	synonymous_variant	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.3615T>G	7.37:g.82595489A>C				Silent	SNP	pfam_Znf_piccolo,pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ	p.A1205	ENST00000333891.9	37	c.3615	CCDS47630.1	7																																																																																			PCLO	-	NULL	ENSG00000186472		0.348	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	-	0.00	96	0	A	NM_014510		82595489	-1	tier1	-	no_errors	ENST00000333891	ensembl	human	known	74_37	silent	23.53	52	16	SNP	0.000	C
PCSK7	9159	genome.wustl.edu	37	11	117078536	117078536	+	Intron	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:117078536C>T	ENST00000320934.3	-	14	2417				PCSK7_ENST00000540028.1_Intron|PCSK7_ENST00000529458.1_Intron	NM_004716.2	NP_004707.2	Q16549	PCSK7_HUMAN	proprotein convertase subtilisin/kexin type 7						peptide hormone processing (GO:0016486)|protein processing (GO:0016485)	integral component of Golgi membrane (GO:0030173)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|large_intestine(2)|lung(8)|ovary(1)|skin(1)	16	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.72e-06)|Epithelial(105;6.71e-05)|all cancers(92;0.000537)		GCCCATTTCACGGATGGGCAC	0.483			T	IGH@	MLCLS																																			Dom	yes		11	11q23.3	9159	proprotein convertase subtilisin/kexin type 7		L	0																																										SO:0001627	intron_variant	0			U40623	CCDS8382.1	11q23-q24	2008-02-01			ENSG00000160613	ENSG00000160613			8748	protein-coding gene	gene with protein product		604872				8615762, 9820811	Standard	XM_006718938		Approved	PC7, PC8, LPC, SPC7	uc001pqr.3	Q16549	OTTHUMG00000165640	ENST00000320934.3:c.1786+149G>A	11.37:g.117078536C>T			B0YJ60|Q3C1X1|Q53GM4|Q96FK8|Q9UL57	RNA	SNP	-	NULL	ENST00000320934.3	37	NULL	CCDS8382.1	11																																																																																			PCSK7	-	-	ENSG00000160613		0.483	PCSK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK7	HGNC	protein_coding	OTTHUMT00000385529.2	-	0.00	162	0	C	NM_004716		117078536	-1	tier1	-	no_errors	ENST00000533135	ensembl	human	known	74_37	rna	18.42	62	14	SNP	0.000	T
PDE7A	5150	genome.wustl.edu	37	8	66631622	66631622	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:66631622C>T	ENST00000401827.3	-	13	1795	c.1352G>A	c.(1351-1353)tGg>tAg	p.W451*	PDE7A_ENST00000379419.4_Nonsense_Mutation_p.W425*	NM_001242318.2	NP_001229247.1	Q13946	PDE7A_HUMAN	phosphodiesterase 7A	451	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			large_intestine(5)|lung(3)|stomach(1)|urinary_tract(1)	10			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	CAGTCCCTTCCAGCTGGCTTT	0.468																																																	0													132.0	114.0	120.0					8																	66631622		2203	4300	6503	SO:0001587	stop_gained	0			L12052	CCDS34901.1, CCDS56538.1	8q13	2008-03-18				ENSG00000205268	3.1.4.17	"""Phosphodiesterases"""	8791	protein-coding gene	gene with protein product		171885				8389765, 9521885	Standard	NM_001242318		Approved	HCP1	uc003xvq.3	Q13946		ENST00000401827.3:c.1352G>A	8.37:g.66631622C>T	ENSP00000385632:p.Trp451*		A0AVH6|A8K436|A8K9G5|O15380|Q96T72	Nonsense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.W451*	ENST00000401827.3	37	c.1352	CCDS56538.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.836453|5.836453	0.97009|0.97009	.|.	.|.	ENSG00000066855|ENSG00000205268	ENST00000521247|ENST00000401827;ENST00000379419	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.77232|.	0.4100|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.73662|.	-0.3912|.	5|.	0.52906|.	T|.	0.07|.	.|.	20.6397|20.6397	0.99537|0.99537	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	L|X	130|451;425	.|.	ENSP00000429253:P130L|.	P|W	+|-	2|2	0|0	MTFR1|PDE7A	66794176|66794176	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.729000|7.729000	0.84864|0.84864	2.880000|2.880000	0.98712|0.98712	0.650000|0.650000	0.86243|0.86243	CCA|TGG	PDE7A	-	NULL	ENSG00000205268		0.468	PDE7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE7A	HGNC	protein_coding	OTTHUMT00000378905.1	-	0.00	47	0	C			66631622	-1	tier1	-	no_errors	ENST00000401827	ensembl	human	known	74_37	nonsense	35.00	13	7	SNP	1.000	T
PDHA2	5161	genome.wustl.edu	37	4	96761931	96761931	+	Silent	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:96761931T>C	ENST00000295266.4	+	1	693	c.630T>C	c.(628-630)gcT>gcC	p.A210A		NM_005390.4	NP_005381.1	P29803	ODPAT_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 2	210					glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(23)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	46		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)		ATATGGCAGCTTTATGGAAAT	0.438																																																	0													57.0	62.0	60.0					4																	96761931		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS3644.1	4q22-q23	2009-11-09			ENSG00000163114	ENSG00000163114	1.2.4.1		8807	protein-coding gene	gene with protein product		179061		PDHAL			Standard	NM_005390		Approved		uc003htr.4	P29803	OTTHUMG00000130990	ENST00000295266.4:c.630T>C	4.37:g.96761931T>C			B2R9Q3|Q0VDI5|Q4VC02|Q6NXQ1	Silent	SNP	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	p.A210	ENST00000295266.4	37	c.630	CCDS3644.1	4																																																																																			PDHA2	-	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	ENSG00000163114		0.438	PDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHA2	HGNC	protein_coding	OTTHUMT00000253608.1	-	0.00	77	0	T			96761931	+1	tier1	-	no_errors	ENST00000295266	ensembl	human	known	74_37	silent	19.35	24	6	SNP	0.927	C
PDHX	8050	genome.wustl.edu	37	11	34953026	34953026	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:34953026A>G	ENST00000227868.4	+	2	320	c.236A>G	c.(235-237)aAg>aGg	p.K79R	PDHX_ENST00000430469.2_Missense_Mutation_p.K79R|PDHX_ENST00000448838.3_Missense_Mutation_p.K64R			O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X	79	Lipoyl-binding. {ECO:0000255|PROSITE- ProRule:PRU01066}.				cellular metabolic process (GO:0044237)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	transferase activity, transferring acyl groups (GO:0016746)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(4)|upper_aerodigestive_tract(1)	16	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			TGGCTGAAAAAGGAAGGTGAG	0.353																																																	0													113.0	107.0	109.0					11																	34953026		2202	4298	6500	SO:0001583	missense	0			U82328	CCDS7896.1, CCDS44569.1, CCDS53616.1	11p13	2008-02-05			ENSG00000110435	ENSG00000110435			21350	protein-coding gene	gene with protein product		608769				9467010, 12372595	Standard	NM_003477		Approved	E3BP, proX, PDX1, OPDX, DLDBP	uc001mvt.3	O00330	OTTHUMG00000166491	ENST00000227868.4:c.236A>G	11.37:g.34953026A>G	ENSP00000227868:p.Lys79Arg		B4DW62|D3DR11|E9PB14|E9PBP7|O60221|Q96FV8|Q99783	Missense_Mutation	SNP	pfam_2-oxoacid_DH_actylTfrase,pfam_Biotin_lipoyl,pfam_E3-bd,superfamily_Single_hybrid_motif,superfamily_E3-bd,pfscan_Biotin_lipoyl	p.K79R	ENST00000227868.4	37	c.236	CCDS7896.1	11	.	.	.	.	.	.	.	.	.	.	A	18.58	3.653931	0.67472	.	.	ENSG00000110435	ENST00000533550;ENST00000448838;ENST00000227868;ENST00000430469	T;T;T;T	0.61510	0.1;0.1;0.1;0.1	5.69	4.56	0.56223	Single hybrid motif (1);Biotin/lipoyl attachment (2);	0.000000	0.85682	D	0.000000	T	0.74935	0.3782	M	0.84773	2.715	0.28917	N	0.892342	B;D;D	0.71674	0.002;0.996;0.998	B;D;D	0.74348	0.012;0.936;0.983	T	0.71774	-0.4491	10	0.72032	D	0.01	-11.677	8.5158	0.33246	0.9123:0.0:0.0877:0.0	.	79;64;79	E9PBP7;E9PB14;O00330	.;.;ODPX_HUMAN	R	19;64;79;79	ENSP00000431281:K19R;ENSP00000389404:K64R;ENSP00000227868:K79R;ENSP00000415695:K79R	ENSP00000227868:K79R	K	+	2	0	PDHX	34909602	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	3.480000	0.53172	0.983000	0.38602	0.459000	0.35465	AAG	PDHX	-	pfam_Biotin_lipoyl,superfamily_Single_hybrid_motif,pfscan_Biotin_lipoyl	ENSG00000110435		0.353	PDHX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDHX	HGNC	protein_coding	OTTHUMT00000390017.1	-	0.00	60	0	A	NM_003477		34953026	+1	tier1	-	no_errors	ENST00000227868	ensembl	human	known	74_37	missense	11.54	23	3	SNP	1.000	G
RWDD2A	112611	genome.wustl.edu	37	6	83900566	83900566	+	5'Flank	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:83900566T>C	ENST00000369724.4	+	0	0				PGM3_ENST00000506587.1_Missense_Mutation_p.T84A|PGM3_ENST00000513973.1_Missense_Mutation_p.T56A|PGM3_ENST00000512866.1_Missense_Mutation_p.T56A|RWDD2A_ENST00000539997.1_5'Flank|PGM3_ENST00000283977.4_Intron	NM_033411.3	NP_219479.2	Q9UIY3	RWD2A_HUMAN	RWD domain containing 2A											cervix(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	5		all_cancers(76;2.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00217)		BRCA - Breast invasive adenocarcinoma(397;0.045)		ACTCCTATAGTGGATTTTGTC	0.443																																																	0													216.0	181.0	193.0					6																	83900566		2203	4300	6503	SO:0001631	upstream_gene_variant	0			BC010930	CCDS4998.1	6q15	2012-12-07	2007-07-17	2007-07-17	ENSG00000013392	ENSG00000013392			21385	protein-coding gene	gene with protein product			"""RWD domain containing 2"""	RWDD2			Standard	NM_033411		Approved	MGC13523, dJ747H23.2	uc003pjx.4	Q9UIY3	OTTHUMG00000015109		6.37:g.83900566T>C	Exception_encountered		B4DIQ3|E1P548|Q2M3R3|Q96FH1	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-II,pfam_A-D-PHexomutase_C,superfamily_A-D-PHexomutase_a/b/a-I/II/III,pirsf_PAGM	p.T56A	ENST00000369724.4	37	c.166	CCDS4998.1	6	.	.	.	.	.	.	.	.	.	.	T	12.22	1.871639	0.33069	.	.	ENSG00000013375	ENST00000513973;ENST00000512866;ENST00000506587;ENST00000507554;ENST00000508748;ENST00000503094	T;T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12;0.12	5.76	4.62	0.57501	Alpha-D-phosphohexomutase, alpha/beta/alpha domain I (1);Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (1);	0.143579	0.64402	D	0.000006	T	0.12561	0.0305	N	0.01146	-0.985	0.52501	D	0.999951	B;B	0.11235	0.004;0.004	B;B	0.21546	0.035;0.035	T	0.12915	-1.0529	10	0.22706	T	0.39	-16.9707	8.5046	0.33179	0.0:0.1441:0.0:0.8559	.	84;56	E9PF86;O95394	.;AGM1_HUMAN	A	56;56;84;56;84;84	ENSP00000424874:T56A;ENSP00000421565:T56A;ENSP00000425809:T84A;ENSP00000425558:T56A;ENSP00000424865:T84A;ENSP00000422362:T84A	ENSP00000422362:T84A	T	-	1	0	PGM3	83957285	1.000000	0.71417	0.887000	0.34795	0.564000	0.35744	3.287000	0.51732	2.186000	0.69663	0.533000	0.62120	ACT	PGM3	-	pfam_A-D-PHexomutase_a/b/a-I,pirsf_PAGM	ENSG00000013375		0.443	RWDD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGM3	HGNC	protein_coding	OTTHUMT00000041348.2	-	0.00	100	0	T	NM_033411		83900566	-1	tier1	-	no_errors	ENST00000513973	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.972	C
PKD1	5310	genome.wustl.edu	37	16	2140000	2140000	+	Missense_Mutation	SNP	G	G	A	rs569380424		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr16:2140000G>A	ENST00000262304.4	-	46	12848	c.12640C>T	c.(12640-12642)Cgc>Tgc	p.R4214C	RP11-304L19.1_ENST00000570072.1_RNA|PKD1_ENST00000423118.1_Missense_Mutation_p.R4213C|MIR1225_ENST00000408729.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	4214					anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						GCTTGGAGGCGGGAGGGCTCA	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		13334	0.0		0.0	False		,,,				2504	0.001																0													25.0	25.0	25.0					16																	2140000		2191	4290	6481	SO:0001583	missense	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.12640C>T	16.37:g.2140000G>A	ENSP00000262304:p.Arg4214Cys		Q15140|Q15141	Missense_Mutation	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_PLAT/LH2_dom,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_PLAT/LH2_dom,prints_PKD_1,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_PLAT/LH2_dom,pfscan_REJ-like,pfscan_WSC_carb-bd,tigrfam_Polycystin_cat	p.R4214C	ENST00000262304.4	37	c.12640	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587303	0.46110	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.48836	0.8;0.8	4.88	2.91	0.33838	.	0.000000	0.85682	D	0.000000	T	0.64560	0.2609	M	0.80183	2.485	0.54753	D	0.999981	P;D	0.89917	0.877;1.0	B;D	0.97110	0.038;1.0	T	0.63251	-0.6679	10	0.87932	D	0	.	5.8787	0.18844	0.1607:0.0:0.6857:0.1536	.	4213;4214	P98161-3;P98161	.;PKD1_HUMAN	C	4214;4213;3548	ENSP00000262304:R4214C;ENSP00000399501:R4213C	ENSP00000262304:R4214C	R	-	1	0	PKD1	2080001	0.993000	0.37304	0.734000	0.30879	0.833000	0.47200	2.952000	0.49097	0.467000	0.27218	0.491000	0.48974	CGC	PKD1	-	NULL	ENSG00000008710		0.667	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	-	0.00	66	0	G			2140000	-1	tier1	-	no_errors	ENST00000262304	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.993	A
PLD4	122618	genome.wustl.edu	37	14	105395191	105395191	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:105395191G>T	ENST00000392593.4	+	4	558	c.390G>T	c.(388-390)caG>caT	p.Q130H	PLD4_ENST00000540372.1_Missense_Mutation_p.Q137H	NM_138790.2	NP_620145.2	Q96BZ4	PLD4_HUMAN	phospholipase D family, member 4	130					glycerophospholipid biosynthetic process (GO:0046474)|hematopoietic progenitor cell differentiation (GO:0002244)|inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phagocytosis (GO:0006909)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|trans-Golgi network membrane (GO:0032588)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase D activity (GO:0004630)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	13		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.00067)|OV - Ovarian serous cystadenocarcinoma(23;0.00976)|Epithelial(46;0.0201)|GBM - Glioblastoma multiforme(11;0.116)			ACACTGCCCAGGAGAGCGTCC	0.672																																																	0													42.0	46.0	45.0					14																	105395191		2027	4200	6227	SO:0001583	missense	0				CCDS9995.2	14q32.33	2014-01-28	2005-05-20	2005-05-20	ENSG00000166428	ENSG00000166428			23792	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 175"""	C14orf175			Standard	XM_006720024		Approved		uc001ypu.1	Q96BZ4	OTTHUMG00000144167	ENST00000392593.4:c.390G>T	14.37:g.105395191G>T	ENSP00000376372:p.Gln130His		Q6UWD2	Missense_Mutation	SNP	pfam_PLipase_D/transphosphatidylase,smart_PLipase_D/transphosphatidylase,pfscan_PLipase_D/transphosphatidylase	p.Q130H	ENST00000392593.4	37	c.390	CCDS9995.2	14	.	.	.	.	.	.	.	.	.	.	G	11.91	1.778996	0.31502	.	.	ENSG00000166428	ENST00000540372;ENST00000392593;ENST00000557573	T;T;T	0.15372	2.43;2.43;2.43	4.45	0.2	0.15181	.	0.640222	0.15637	N	0.252083	T	0.13114	0.0318	L	0.46885	1.475	0.80722	D	1	B;B	0.22604	0.072;0.043	B;B	0.31547	0.132;0.062	T	0.14896	-1.0456	10	0.32370	T	0.25	-0.0056	1.943	0.03351	0.185:0.1586:0.4935:0.163	.	137;130	F5H2B5;Q96BZ4	.;PLD4_HUMAN	H	137;130;128	ENSP00000438677:Q137H;ENSP00000376372:Q130H;ENSP00000451278:Q128H	ENSP00000376372:Q130H	Q	+	3	2	PLD4	104466236	0.000000	0.05858	0.293000	0.24932	0.955000	0.61496	0.066000	0.14489	0.058000	0.16222	0.645000	0.84053	CAG	PLD4	-	NULL	ENSG00000166428		0.672	PLD4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLD4	HGNC	protein_coding	OTTHUMT00000291348.2		0.00	106	0	G	NM_138790		105395191	+1			no_errors	ENST00000392593	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.889	T
PLEC	5339	genome.wustl.edu	37	8	144994004	144994004	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:144994004C>A	ENST00000322810.4	-	32	10565	c.10396G>T	c.(10396-10398)Gag>Tag	p.E3466*	PLEC_ENST00000345136.3_Nonsense_Mutation_p.E3329*|PLEC_ENST00000357649.2_Nonsense_Mutation_p.E3333*|PLEC_ENST00000354958.2_Nonsense_Mutation_p.E3307*|PLEC_ENST00000354589.3_Nonsense_Mutation_p.E3329*|PLEC_ENST00000398774.2_Nonsense_Mutation_p.E3297*|PLEC_ENST00000436759.2_Nonsense_Mutation_p.E3356*|PLEC_ENST00000356346.3_Nonsense_Mutation_p.E3315*|PLEC_ENST00000527096.1_Nonsense_Mutation_p.E3352*	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3466	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TTGAGCTGCTCAAACTGGGCT	0.677																																																	0													30.0	35.0	33.0					8																	144994004		2039	4189	6228	SO:0001587	stop_gained	0			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.10396G>T	8.37:g.144994004C>A	ENSP00000323856:p.Glu3466*		Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Nonsense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.E3466*	ENST00000322810.4	37	c.10396	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	C	52	19.672554	0.99922	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	.	.	.	5.11	4.22	0.49857	.	0.166540	0.37261	U	0.002164	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	15.1655	0.72821	0.0:0.8577:0.1423:0.0	.	.	.	.	X	3329;3333;3329;3297;3466;3307;3315;3356;3352	.	ENSP00000323856:E3466X	E	-	1	0	PLEC	145065992	0.994000	0.37717	0.973000	0.42090	0.974000	0.67602	2.686000	0.46968	1.112000	0.41740	0.448000	0.29417	GAG	PLEC	-	NULL	ENSG00000178209		0.677	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	-	0.00	62	0	C	NM_000445		144994004	-1	tier1	-	no_errors	ENST00000322810	ensembl	human	known	74_37	nonsense	10.53	34	4	SNP	0.999	A
PLEKHM3	389072	genome.wustl.edu	37	2	208795838	208795838	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:208795838delC	ENST00000427836.2	-	5	2187	c.1698delG	c.(1696-1698)tcgfs	p.S566fs	PLEKHM3_ENST00000389247.4_Frame_Shift_Del_p.S566fs|PLEKHM3_ENST00000457206.1_Frame_Shift_Del_p.S566fs	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	566					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TGGCCTGCTTCGACACCTACA	0.547																																																	0													57.0	60.0	59.0					2																	208795838		2022	4193	6215	SO:0001589	frameshift_variant	0			AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.1698delG	2.37:g.208795838delC	ENSP00000417003:p.Ser566fs		B9EKV2|Q8WW68	Frame_Shift_Del	DEL	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.K567fs	ENST00000427836.2	37	c.1698	CCDS42808.1	2																																																																																			PLEKHM3	-	NULL	ENSG00000178385		0.547	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM3	HGNC	protein_coding	OTTHUMT00000337036.1		0.00	42	0	C	NM_001080475		208795838	-1	tier1		no_errors	ENST00000427836	ensembl	human	known	74_37	frame_shift_del	16.67	10	2	DEL	0.019	-
PLIN4	729359	genome.wustl.edu	37	19	4512014	4512014	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:4512014A>G	ENST00000301286.3	-	3	1915	c.1916T>C	c.(1915-1917)cTg>cCg	p.L639P		NM_001080400.1	NP_001073869.1	Q96Q06	PLIN4_HUMAN	perilipin 4	639	27 X 33 AA approximate tandem repeat.					cytoplasm (GO:0005737)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)				NS(2)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|soft_tissue(1)|stomach(2)	41						GGTCGTTTTCAGCCCAGTTTG	0.552																																																	0													152.0	156.0	155.0					19																	4512014		2069	4187	6256	SO:0001583	missense	0			AB067468	CCDS45927.1	19p13.3	2009-10-06	2009-08-12	2009-08-12	ENSG00000167676	ENSG00000167676		"""Perilipins"""	29393	protein-coding gene	gene with protein product		613247	"""KIAA1881"""	KIAA1881		11572484, 19638644	Standard	NM_001080400		Approved	S3-12	uc002mar.1	Q96Q06	OTTHUMG00000167571	ENST00000301286.3:c.1916T>C	19.37:g.4512014A>G	ENSP00000301286:p.Leu639Pro		A6NEI2	Missense_Mutation	SNP	pfam_Perilipin,superfamily_Ankyrin_rpt-contain_dom	p.L639P	ENST00000301286.3	37	c.1916	CCDS45927.1	19	.	.	.	.	.	.	.	.	.	.	A	14.82	2.649577	0.47362	.	.	ENSG00000167676	ENST00000301286	T	0.07327	3.2	4.77	4.77	0.60923	.	0.775044	0.10524	N	0.664649	T	0.24084	0.0583	M	0.73962	2.25	0.48452	D	0.999659	D	0.71674	0.998	D	0.66602	0.945	T	0.01276	-1.1398	10	0.40728	T	0.16	-1.7812	6.1992	0.20567	0.8129:0.0:0.1871:0.0	.	639	Q96Q06	PLIN4_HUMAN	P	639	ENSP00000301286:L639P	ENSP00000301286:L639P	L	-	2	0	PLIN4	4463014	0.093000	0.21703	0.143000	0.22291	0.003000	0.03518	2.783000	0.47766	1.785000	0.52413	0.240000	0.17902	CTG	PLIN4	-	NULL	ENSG00000167676		0.552	PLIN4-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PLIN4	HGNC	protein_coding	OTTHUMT00000395095.1	-	0.00	107	0	A	XM_170901		4512014	-1	tier1	-	no_errors	ENST00000301286	ensembl	human	novel	74_37	missense	8.16	45	4	SNP	0.779	G
PLK3	1263	genome.wustl.edu	37	1	45269609	45269609	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:45269609G>T	ENST00000372201.4	+	10	1410	c.1171G>T	c.(1171-1173)Gca>Tca	p.A391S	PLK3_ENST00000465443.1_3'UTR	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3	391					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					CCAGGCTCCAGCAGCTTCTGG	0.642																																																	0													15.0	14.0	15.0					1																	45269609		2115	4147	6262	SO:0001583	missense	0			AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.1171G>T	1.37:g.45269609G>T	ENSP00000361275:p.Ala391Ser		Q15767|Q5JR99|Q96CV1	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_dom	p.A391S	ENST00000372201.4	37	c.1171	CCDS515.1	1	.	.	.	.	.	.	.	.	.	.	G	8.213	0.800739	0.16397	.	.	ENSG00000173846	ENST00000372201;ENST00000543983	T	0.66638	-0.22	4.7	3.74	0.42951	.	.	.	.	.	T	0.49047	0.1534	N	0.22421	0.69	0.22989	N	0.998463	B	0.19200	0.034	B	0.20184	0.028	T	0.19582	-1.0301	9	0.08381	T	0.77	-1.5638	11.8433	0.52368	0.0:0.0:0.8267:0.1733	.	391	Q9H4B4	PLK3_HUMAN	S	391;366	ENSP00000361275:A391S	ENSP00000361275:A391S	A	+	1	0	PLK3	45042196	0.999000	0.42202	1.000000	0.80357	0.942000	0.58702	3.209000	0.51122	2.444000	0.82710	0.591000	0.81541	GCA	PLK3	-	NULL	ENSG00000173846		0.642	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK3	HGNC	protein_coding	OTTHUMT00000023429.1	-	0.00	35	0	G	NM_004073		45269609	+1	tier1	-	no_errors	ENST00000372201	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.990	T
POC1B	282809	genome.wustl.edu	37	12	89864263	89864263	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:89864263C>T	ENST00000313546.3	-	7	813	c.685G>A	c.(685-687)Ggt>Agt	p.G229S	POC1B_ENST00000393179.4_Missense_Mutation_p.G99S|POC1B_ENST00000549035.1_Missense_Mutation_p.G187S|POC1B_ENST00000378528.2_Intron|POC1B_ENST00000549504.1_Intron|POC1B_ENST00000541909.1_Missense_Mutation_p.G99S	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B	229					cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						TTAACTCCACCGCTGTGAACT	0.383																																																	0													111.0	109.0	109.0					12																	89864263		2203	4300	6503	SO:0001583	missense	0			AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.685G>A	12.37:g.89864263C>T	ENSP00000323302:p.Gly229Ser		G3V1X0	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G229S	ENST00000313546.3	37	c.685	CCDS31869.1	12	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819346	0.50633	.	.	ENSG00000139323	ENST00000393179;ENST00000313546;ENST00000549035;ENST00000541909	T;T;T;T	0.80738	0.26;-1.41;0.26;0.26	5.48	-0.352	0.12598	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.410376	0.27518	N	0.019001	T	0.67249	0.2873	L	0.35341	1.055	0.80722	D	1	B	0.16603	0.018	B	0.16722	0.016	T	0.50882	-0.8775	10	0.30078	T	0.28	.	10.1379	0.42717	0.4855:0.4504:0.0:0.0642	.	229	Q8TC44	POC1B_HUMAN	S	99;229;187;99	ENSP00000376877:G99S;ENSP00000323302:G229S;ENSP00000447916:G187S;ENSP00000440301:G99S	ENSP00000323302:G229S	G	-	1	0	POC1B	88388394	0.362000	0.24980	0.056000	0.19401	0.983000	0.72400	2.034000	0.41145	-0.403000	0.07622	0.650000	0.86243	GGT	POC1B	-	pfam_WD40_repeat,pfam_TIF_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000139323		0.383	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC1B	HGNC	protein_coding	OTTHUMT00000406637.1	-	0.00	96	0	C	NM_172240		89864263	-1	tier1	-	no_errors	ENST00000313546	ensembl	human	known	74_37	missense	44.19	24	19	SNP	0.983	T
POLL	27343	genome.wustl.edu	37	10	103345131	103345133	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	GGA	GGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:103345131_103345133delGGA	ENST00000370162.3	-	4	1007_1009	c.513_515delTCC	c.(511-516)cctccc>ccc	p.171_172PP>P	DPCD_ENST00000470165.1_Intron|POLL_ENST00000370169.1_In_Frame_Del_p.171_172PP>P|DPCD_ENST00000416979.2_Intron|POLL_ENST00000456836.2_Intron|POLL_ENST00000339310.3_Intron|DPCD_ENST00000370148.2_5'Flank|POLL_ENST00000370168.3_5'Flank|POLL_ENST00000370172.1_In_Frame_Del_p.83_84PP>P|POLL_ENST00000299206.4_In_Frame_Del_p.171_172PP>P|POLL_ENST00000436284.2_Intron|DPCD_ENST00000370147.1_5'Flank|DPCD_ENST00000370151.4_5'Flank|POLL_ENST00000370158.3_Intron	NM_001174084.1|NM_001174085.1|NM_013274.3	NP_001167555.1|NP_001167556.1|NP_037406.1	Q9UGP5	DPOLL_HUMAN	polymerase (DNA directed), lambda	171					DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|nucleotide-excision repair (GO:0006289)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.234)		Epithelial(162;1.55e-08)|all cancers(201;6.64e-07)		AGGCCTGGTGGGAGGAGGAGGAG	0.591								DNA polymerases (catalytic subunits)																																									0									,,	22,4242		11,0,2121					,,	-0.9	0.0			149	45,8209		19,7,4101	no	coding,coding,coding	POLL	NM_013274.3,NM_001174085.1,NM_001174084.1	,,	30,7,6222	A1A1,A1R,RR		0.5452,0.5159,0.5352	,,	,,		67,12451				SO:0001651	inframe_deletion	0			AF161019	CCDS7513.1	10q23	2012-05-18			ENSG00000166169	ENSG00000166169		"""DNA polymerases"""	9184	protein-coding gene	gene with protein product		606343				17686665	Standard	NM_001174084		Approved		uc001kti.2	Q9UGP5	OTTHUMG00000018933	ENST00000370162.3:c.513_515delTCC	10.37:g.103345140_103345142delGGA	ENSP00000359181:p.Pro172del		D3DR76|Q5JQP5|Q6NUM2|Q9BTN8|Q9HA10|Q9HB35	In_Frame_Del	DEL	pfam_DNA_pol_lambd_fingers_domain,superfamily_DNA_pol_b-like_N,superfamily_DNA_pol_lambd_fingers_domain,superfamily_BRCT_dom,smart_DNA-dir_DNA_pol_X,pfscan_BRCT_dom,prints_DNA_pol_X_beta-like,prints_DNA_pol_X	p.P172in_frame_del	ENST00000370162.3	37	c.515_513	CCDS7513.1	10																																																																																			POLL	-	NULL	ENSG00000166169		0.591	POLL-202	KNOWN	basic|appris_principal|CCDS	protein_coding	POLL	HGNC	protein_coding	OTTHUMT00000049946.1		0.00	98	0	GGA	NM_013274		103345133	-1	tier1		no_errors	ENST00000299206	ensembl	human	known	74_37	in_frame_del	6.00	47	3	DEL	0.001:0.008:0.028	-
PRAMEF6	440561	genome.wustl.edu	37	1	13111576	13111576	+	Silent	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:13111576A>G	ENST00000376182.1	-	3	538	c.439T>C	c.(439-441)Ttg>Ctg	p.L147L	PRAMEF6_ENST00000376192.5_Silent_p.L147L|PRAMEF6_ENST00000414205.2_Silent_p.L147L	NM_001282323.1	NP_001269252.1	Q5VXH4	PRAM6_HUMAN	PRAME family member 6	147					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					NS(1)|kidney(1)|lung(5)|urinary_tract(2)	9	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AACACAGTCAAGGGCTGCTGT	0.493																																																	0																																										SO:0001819	synonymous_variant	0				CCDS30594.1	1p36.21	2013-01-17				ENSG00000232423		"""-"""	30583	protein-coding gene	gene with protein product							Standard	NM_001010889		Approved		uc001auq.2	Q5VXH4	OTTHUMG00000001984	ENST00000376182.1:c.439T>C	1.37:g.13111576A>G			A0AUJ9	Silent	SNP	NULL	p.L147	ENST00000376182.1	37	c.439		1																																																																																			PRAMEF6	-	NULL	ENSG00000232423		0.493	PRAMEF6-201	KNOWN	basic|appris_candidate_longest	protein_coding	PRAMEF6	HGNC	protein_coding		-	0.00	9	0	A	NM_001010889		13111576	-1	tier1	-	no_errors	ENST00000376182	ensembl	human	known	74_37	silent	80.00	1	4	SNP	0.007	G
PPIEL	728448	genome.wustl.edu	37	1	40011415	40011415	+	RNA	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:40011415G>A	ENST00000440190.1	-	0	444				RP11-69E11.4_ENST00000417869.1_RNA																							CTGTGGTCATGGGCACGACGT	0.567																																																	0																																												0																															1.37:g.40011415G>A				RNA	SNP	-	NULL	ENST00000440190.1	37	NULL		1																																																																																			RP11-69E11.4	-	-	ENSG00000182109		0.567	RP11-69E11.4-003	KNOWN	basic	antisense	PPIEL	Clone_based_vega_gene	antisense	OTTHUMT00000025214.1	-	0.00	104	0	G			40011415	-1	tier1	-	no_errors	ENST00000417869	ensembl	human	known	74_37	rna	6.78	55	4	SNP	1.000	A
PRDX6	9588	genome.wustl.edu	37	1	173454533	173454533	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:173454533G>T	ENST00000340385.5	+	3	418	c.286G>T	c.(286-288)Gaa>Taa	p.E96*	PRDX6_ENST00000470017.1_3'UTR	NM_004905.2	NP_004896.1	P30041	PRDX6_HUMAN	peroxiredoxin 6	96	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				hydrogen peroxide catabolic process (GO:0042744)|phospholipid catabolic process (GO:0009395)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|membrane (GO:0016020)	antioxidant activity (GO:0016209)|glutathione peroxidase activity (GO:0004602)|peroxiredoxin activity (GO:0051920)|phospholipase A2 activity (GO:0004623)	p.E96*(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	12						AGAGCCCACAGAAAAGTTACC	0.438																																																	1	Substitution - Nonsense(1)	urinary_tract(1)											145.0	136.0	139.0					1																	173454533		2203	4300	6503	SO:0001587	stop_gained	0			D14662	CCDS1307.1	1q24.1	2008-02-05			ENSG00000117592	ENSG00000117592			16753	protein-coding gene	gene with protein product		602316				11233154	Standard	NM_004905		Approved	AOP2, KIAA0106, 1-Cys, NSGPx, PRX, aiPLA2, MGC46173, p29	uc001giy.1	P30041	OTTHUMG00000034804	ENST00000340385.5:c.286G>T	1.37:g.173454533G>T	ENSP00000342026:p.Glu96*		A8JZY7|P32077|Q5TAH4|Q5ZEZ8	Nonsense_Mutation	SNP	pfam_AhpC/TSA,pfam_Peroxiredoxin_C,pfam_Redoxin,superfamily_Thioredoxin-like_fold	p.E96*	ENST00000340385.5	37	c.286	CCDS1307.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.305991	0.95629	.	.	ENSG00000117592	ENST00000340385	.	.	.	5.27	5.27	0.74061	.	0.273464	0.43110	D	0.000610	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-17.9239	18.0125	0.89229	0.0:0.0:1.0:0.0	.	.	.	.	X	96	.	ENSP00000342026:E96X	E	+	1	0	PRDX6	171721156	0.995000	0.38212	1.000000	0.80357	0.992000	0.81027	2.324000	0.43831	2.614000	0.88457	0.650000	0.86243	GAA	PRDX6	-	pfam_AhpC/TSA,pfam_Redoxin,superfamily_Thioredoxin-like_fold	ENSG00000117592		0.438	PRDX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX6	HGNC	protein_coding	OTTHUMT00000084222.1		0.00	73	0	G	NM_004905		173454533	+1			no_errors	ENST00000340385	ensembl	human	known	74_37	nonsense	7.14	39	3	SNP	0.996	T
PRSS21	10942	genome.wustl.edu	37	16	2871376	2871376	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr16:2871376G>T	ENST00000005995.3	+	6	757	c.715G>T	c.(715-717)Ggt>Tgt	p.G239C	PRSS21_ENST00000450020.3_Missense_Mutation_p.G225C|PRSS21_ENST00000575739.1_Intron|PRSS21_ENST00000455114.1_Missense_Mutation_p.G237C			Q9Y6M0	TEST_HUMAN	protease, serine, 21 (testisin)	239	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				spermatogenesis (GO:0007283)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	15						GGGTGACTCAGGTGGACCCTT	0.637																																																	0													49.0	54.0	52.0					16																	2871376		2198	4300	6498	SO:0001583	missense	0			AF058300	CCDS10478.1, CCDS45388.1	16p13.3	2010-05-07			ENSG00000007038	ENSG00000007038		"""Serine peptidases / Serine peptidases"""	9485	protein-coding gene	gene with protein product		608159				10397266, 9826525	Standard	NM_006799		Approved	ESP-1, TEST1, TESTISIN	uc002crt.4	Q9Y6M0	OTTHUMG00000128931	ENST00000005995.3:c.715G>T	16.37:g.2871376G>T	ENSP00000005995:p.Gly239Cys		Q9NS34|Q9P2V6	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	p.G239C	ENST00000005995.3	37	c.715	CCDS10478.1	16	.	.	.	.	.	.	.	.	.	.	g	21.3	4.133927	0.77662	.	.	ENSG00000007038	ENST00000455114;ENST00000450020;ENST00000005995	D;D;D	0.99871	-7.35;-7.35;-7.35	3.8	2.84	0.33178	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.99914	0.9959	H	0.99697	4.71	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96880	0.9645	9	0.87932	D	0	.	9.1535	0.36978	0.1102:0.0:0.8898:0.0	.	239;237;225	Q9Y6M0;Q9Y6M0-2;Q9Y6M0-3	TEST_HUMAN;.;.	C	237;225;239	ENSP00000400632:G237C;ENSP00000407741:G225C;ENSP00000005995:G239C	ENSP00000005995:G239C	G	+	1	0	PRSS21	2811377	1.000000	0.71417	0.486000	0.27416	0.767000	0.43475	6.563000	0.73964	0.821000	0.34540	0.441000	0.28932	GGT	PRSS21	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Peptidase_S1	ENSG00000007038		0.637	PRSS21-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRSS21	HGNC	protein_coding	OTTHUMT00000250910.1	-	0.00	103	0	G	NM_006799		2871376	+1	tier1	-	no_errors	ENST00000005995	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.983	T
PVRL4	81607	genome.wustl.edu	37	1	161044500	161044500	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:161044500C>T	ENST00000368012.3	-	5	1203	c.901G>A	c.(901-903)Ggc>Agc	p.G301S	PVRL4_ENST00000486694.1_5'Flank|PVRL4_ENST00000453926.2_Missense_Mutation_p.G35S	NM_030916.2	NP_112178.2	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4	301	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|urinary_tract(1)	20	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GGGGGAAAGCCCAAAGTGTCC	0.592																																					NSCLC(76;1160 1387 14476 16172 29359)												0													90.0	88.0	89.0					1																	161044500		2203	4300	6503	SO:0001583	missense	0			AF426163	CCDS1216.1	1q22-q23.2	2013-01-14			ENSG00000143217	ENSG00000143217		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19688	protein-coding gene	gene with protein product		609607				11544254	Standard	NM_030916		Approved	nectin-4, PRR4, LNIR	uc001fxo.2	Q96NY8	OTTHUMG00000031475	ENST00000368012.3:c.901G>A	1.37:g.161044500C>T	ENSP00000356991:p.Gly301Ser		B4DQW3|Q96K15	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.G301S	ENST00000368012.3	37	c.901	CCDS1216.1	1	.	.	.	.	.	.	.	.	.	.	C	9.870	1.198778	0.22121	.	.	ENSG00000143217	ENST00000368012;ENST00000453926	T;T	0.19806	2.12;2.12	4.84	2.74	0.32292	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.203527	0.34959	N	0.003549	T	0.01489	0.0048	N	0.00436	-1.5	0.33933	D	0.642285	B;B	0.06786	0.0;0.001	B;B	0.12156	0.003;0.007	T	0.43114	-0.9411	10	0.22109	T	0.4	.	7.5617	0.27855	0.0:0.7852:0.0:0.2148	.	35;301	B4DQW3;Q96NY8	.;PVRL4_HUMAN	S	301;35	ENSP00000356991:G301S;ENSP00000406015:G35S	ENSP00000356991:G301S	G	-	1	0	PVRL4	159311124	0.997000	0.39634	0.994000	0.49952	0.509000	0.34042	0.204000	0.17335	0.505000	0.28104	0.561000	0.74099	GGC	PVRL4	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000143217		0.592	PVRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL4	HGNC	protein_coding	OTTHUMT00000077074.1	-	0.00	46	0	C	NM_030916		161044500	-1	tier1	-	no_errors	ENST00000368012	ensembl	human	known	74_37	missense	17.14	29	6	SNP	0.999	T
QRFPR	84109	genome.wustl.edu	37	4	122250641	122250641	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:122250641T>G	ENST00000394427.2	-	6	1535	c.1124A>C	c.(1123-1125)aAg>aCg	p.K375T	QRFPR_ENST00000334383.5_3'UTR|Y_RNA_ENST00000384419.1_RNA	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	375					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						GAGGGAAAACTTTGCTTTCTT	0.393																																																	0													209.0	208.0	208.0					4																	122250641		2203	4300	6503	SO:0001583	missense	0			AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.1124A>C	4.37:g.122250641T>G	ENSP00000377948:p.Lys375Thr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NPFF_rcpt	p.K375T	ENST00000394427.2	37	c.1124	CCDS3719.1	4	.	.	.	.	.	.	.	.	.	.	T	10.21	1.287030	0.23478	.	.	ENSG00000186867	ENST00000394427	T	0.72505	-0.66	5.02	-8.06	0.01102	.	1.019980	0.07789	N	0.954622	T	0.44117	0.1278	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21621	-1.0240	10	0.21540	T	0.41	.	2.5389	0.04721	0.1023:0.2181:0.3277:0.3519	.	375	Q96P65	QRFPR_HUMAN	T	375	ENSP00000377948:K375T	ENSP00000377948:K375T	K	-	2	0	QRFPR	122470091	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-1.508000	0.02266	-1.419000	0.02012	-0.619000	0.04042	AAG	QRFPR	-	NULL	ENSG00000186867		0.393	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QRFPR	HGNC	protein_coding	OTTHUMT00000256641.2	-	0.00	65	0	T	NM_198179		122250641	-1	tier1	-	no_errors	ENST00000394427	ensembl	human	known	74_37	missense	46.43	15	13	SNP	0.000	G
RANBP17	64901	genome.wustl.edu	37	5	170597179	170597179	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:170597179C>T	ENST00000523189.1	+	15	1920	c.1756C>T	c.(1756-1758)Cac>Tac	p.H586Y	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	586					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AGATGACAACCACGTTCTAGA	0.269			T	TRD@	ALL																																			Dom	yes		5	5q34	64901	RAN binding protein 17		L	0													144.0	152.0	149.0					5																	170597179		2203	4299	6502	SO:0001583	missense	0			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.1756C>T	5.37:g.170597179C>T	ENSP00000427975:p.His586Tyr		Q8IU74	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.H586Y	ENST00000523189.1	37	c.1756	CCDS34287.1	5	.	.	.	.	.	.	.	.	.	.	C	13.61	2.287353	0.40494	.	.	ENSG00000204764	ENST00000523189;ENST00000534916	T	0.21734	1.99	6.06	6.06	0.98353	Armadillo-type fold (1);	0.283745	0.30752	N	0.008950	T	0.12944	0.0314	N	0.11427	0.14	0.25248	N	0.989699	B	0.23377	0.084	B	0.30179	0.112	T	0.16689	-1.0394	10	0.46703	T	0.11	-12.269	9.6295	0.39772	0.1428:0.7853:0.0:0.0719	.	586	Q9H2T7	RBP17_HUMAN	Y	586;16	ENSP00000427975:H586Y	ENSP00000427975:H586Y	H	+	1	0	RANBP17	170529784	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.320000	0.43797	2.880000	0.98712	0.650000	0.86243	CAC	RANBP17	-	superfamily_ARM-type_fold	ENSG00000204764		0.269	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RANBP17	HGNC	protein_coding	OTTHUMT00000372036.1	-	0.00	95	0	C	NM_022897		170597179	+1	tier1	-	no_errors	ENST00000523189	ensembl	human	known	74_37	missense	30.61	34	15	SNP	0.996	T
RAX	30062	genome.wustl.edu	37	18	56939785	56939785	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr18:56939785G>A	ENST00000334889.3	-	2	537	c.351C>T	c.(349-351)gtC>gtT	p.V117V	RAX_ENST00000256852.7_Intron	NM_013435.2	NP_038463.2	Q9Y2V3	RX_HUMAN	retina and anterior neural fold homeobox	117					camera-type eye development (GO:0043010)|hypothalamus development (GO:0021854)|limb development (GO:0060173)|pattern specification process (GO:0007389)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|visual perception (GO:0007601)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	6		Lung NSC(161;0.0804)|Colorectal(73;0.0946)		STAD - Stomach adenocarcinoma(84;0.18)		TGGCTGGCCCGACGGGCAGCC	0.682																																					GBM(150;770 1898 17679 24325 37807)												0													67.0	70.0	69.0					18																	56939785		2203	4300	6503	SO:0001819	synonymous_variant	0			AF115392	CCDS11972.1	18q21.31	2011-06-20			ENSG00000134438	ENSG00000134438		"""Homeoboxes / PRD class"""	18662	protein-coding gene	gene with protein product		601881				10625658, 10766016, 14662654	Standard	NM_013435		Approved	RX	uc002lhx.3	Q9Y2V3	OTTHUMG00000132757	ENST00000334889.3:c.351C>T	18.37:g.56939785G>A			Q86V11	Silent	SNP	pfam_Homeobox_dom,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_OAR_dom,pfscan_Homeobox_dom	p.V117	ENST00000334889.3	37	c.351	CCDS11972.1	18																																																																																			RAX	-	NULL	ENSG00000134438		0.682	RAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAX	HGNC	protein_coding	OTTHUMT00000256128.2	-	0.00	81	0	G			56939785	-1	tier1	-	no_errors	ENST00000334889	ensembl	human	known	74_37	silent	15.79	32	6	SNP	0.000	A
RERE	473	genome.wustl.edu	37	1	8557522	8557522	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:8557522A>T	ENST00000337907.3	-	10	1581	c.947T>A	c.(946-948)cTg>cAg	p.L316Q	RERE_ENST00000400907.2_Missense_Mutation_p.L316Q|RERE_ENST00000400908.2_Missense_Mutation_p.L316Q|RERE_ENST00000377464.1_Missense_Mutation_p.L48Q	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	316	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CATCCAGACCAGTTCCTCATG	0.468																																																	0													198.0	167.0	178.0					1																	8557522		2203	4300	6503	SO:0001583	missense	0			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.947T>A	1.37:g.8557522A>T	ENSP00000338629:p.Leu316Gln		O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	pfam_Atrophin-like,pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.L316Q	ENST00000337907.3	37	c.947	CCDS95.1	1	.	.	.	.	.	.	.	.	.	.	A	18.76	3.692647	0.68271	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000400907;ENST00000400908	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.84	5.84	0.93424	ELM2 domain (2);	.	.	.	.	T	0.60843	0.2300	L	0.58101	1.795	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.77557	0.977;0.99	T	0.61187	-0.7113	9	0.51188	T	0.08	-12.4752	15.0348	0.71738	1.0:0.0:0.0:0.0	.	48;316	B1AKN3;Q9P2R6	.;RERE_HUMAN	Q	316;48;316;316	ENSP00000338629:L316Q;ENSP00000366684:L48Q;ENSP00000383699:L316Q;ENSP00000383700:L316Q	ENSP00000338629:L316Q	L	-	2	0	RERE	8480109	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	6.962000	0.76048	2.232000	0.73038	0.533000	0.62120	CTG	RERE	-	pfam_ELM2_dom,pfscan_ELM2_dom	ENSG00000142599		0.468	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERE	HGNC	protein_coding	OTTHUMT00000004916.1		0.00	60	0	A			8557522	-1			no_errors	ENST00000337907	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	T
RET	5979	genome.wustl.edu	37	10	43615130	43615130	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:43615130G>C	ENST00000355710.3	+	14	2776	c.2544G>C	c.(2542-2544)atG>atC	p.M848I	RET_ENST00000340058.5_Missense_Mutation_p.M848I	NM_020975.4	NP_066124.1	P07949	RET_HUMAN	ret proto-oncogene	848	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cellular response to retinoic acid (GO:0071300)|embryonic epithelial tube formation (GO:0001838)|enteric nervous system development (GO:0048484)|homophilic cell adhesion (GO:0007156)|innervation (GO:0060384)|lymphocyte migration into lymphoid organs (GO:0097021)|MAPK cascade (GO:0000165)|membrane protein proteolysis (GO:0033619)|neural crest cell migration (GO:0001755)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch morphogenesis (GO:0061146)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell migration (GO:0030335)|positive regulation of cell size (GO:0045793)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of metanephric glomerulus development (GO:0072300)|positive regulation of neuron maturation (GO:0014042)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior midgut development (GO:0007497)|protein phosphorylation (GO:0006468)|regulation of axonogenesis (GO:0050770)|regulation of cell adhesion (GO:0030155)|response to drug (GO:0042493)|response to pain (GO:0048265)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ureter maturation (GO:0035799)|ureteric bud development (GO:0001657)	endosome membrane (GO:0010008)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		CCDC6/RET(4)|KIF5B/RET(79)	NS(2)|adrenal_gland(26)|breast(5)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|lung(27)|ovary(5)|prostate(3)|skin(1)|thyroid(504)|upper_aerodigestive_tract(1)|urinary_tract(1)	607		Ovarian(717;0.0423)			Cabozantinib(DB08875)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	CCCTCACCATGGGCGACCTCA	0.652		1	"""T, Mis, N, F"""	"""H4, PRKAR1A, NCOA4, PCM1, GOLGA5, TRIM33, KTN1, TRIM27, HOOK3, KIF5B, CCDC6"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma, NSCLC"""	"""medullary thyroid,  papillary thyroid, pheochromocytoma"""	Hirschsprung disease		Multiple Endocrine Neoplasia, type 2B;Multiple Endocrine Neoplasia, type 2A;Familial Medullary Thyroid Carcinoma																												Melanoma(102;360 522 3376 9752 9881 14372 17251 18341 20876 24662 34807 43144 48149)		yes	Dom	yes	Multiple endocrine neoplasia 2A/2B	10	10q11.2	5979	ret proto-oncogene	yes	"""E, O"""	0													54.0	48.0	50.0					10																	43615130		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	MEN2B, Wagenmann-Froboese s.;MEN2A, Sipple disease, incl MEN2C;FMTC	BC004257	CCDS7200.1, CCDS53525.1	10q11.2	2014-09-17	2007-02-16		ENSG00000165731	ENSG00000165731		"""Cadherins / Cadherin-related"""	9967	protein-coding gene	gene with protein product	"""cadherin-related family member 16"""	164761	"""multiple endocrine neoplasia and medullary thyroid carcinoma 1"", ""Hirschsprung disease 1"""	HSCR1, MEN2A, MTC1, MEN2B		2687772, 1611909	Standard	NM_020975		Approved	PTC, CDHF12, RET51, CDHR16	uc001jal.3	P07949	OTTHUMG00000018024	ENST00000355710.3:c.2544G>C	10.37:g.43615130G>C	ENSP00000347942:p.Met848Ile		A8K6Z2|Q15250|Q9BTB0|Q9H4A2	Missense_Mutation	SNP	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Cadherin,superfamily_Kinase-like_dom,superfamily_Cadherin-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Cadherin	p.M848I	ENST00000355710.3	37	c.2544	CCDS7200.1	10	.	.	.	.	.	.	.	.	.	.	G	14.20	2.465778	0.43839	.	.	ENSG00000165731	ENST00000355710;ENST00000340058	D;D	0.88586	-2.4;-2.4	5.19	5.19	0.71726	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.87573	0.6211	N	0.05158	-0.105	0.80722	D	1	B;P;D	0.58970	0.189;0.499;0.984	B;P;D	0.71870	0.191;0.479;0.975	D	0.86719	0.1941	10	0.21540	T	0.41	.	18.7095	0.91651	0.0:0.0:1.0:0.0	.	594;848;848	B4DGX8;P07949;P07949-2	.;RET_HUMAN;.	I	848	ENSP00000347942:M848I;ENSP00000344798:M848I	ENSP00000344798:M848I	M	+	3	0	RET	42935136	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.569000	0.67391	2.435000	0.82474	0.313000	0.20887	ATG	RET	-	pirsf_Tyr_kinase_Ret_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000165731		0.652	RET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RET	HGNC	protein_coding	OTTHUMT00000047694.2	-	0.00	73	0	G	NM_020975		43615130	+1	tier1	-	no_errors	ENST00000355710	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	C
RGL3	57139	genome.wustl.edu	37	19	11529358	11529358	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:11529358C>G	ENST00000380456.3	-	2	199	c.136G>C	c.(136-138)Ggg>Cgg	p.G46R	RGL3_ENST00000393423.3_Missense_Mutation_p.G46R	NM_001035223.2|NM_001161616.1	NP_001030300.2|NP_001155088.1	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation stimulator-like 3	46					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(1)|skin(1)	18						TGGCTGCCCCCGGGGCCCTCC	0.731																																					GBM(174;751 2067 17998 27979 33959)												0													3.0	4.0	4.0					19																	11529358		1912	3922	5834	SO:0001583	missense	0			BC014426	CCDS32910.1, CCDS54221.1	19p13.2	2008-02-05				ENSG00000205517			30282	protein-coding gene	gene with protein product						10869344	Standard	NM_001035223		Approved	FLJ32585	uc002mro.2	Q3MIN7		ENST00000380456.3:c.136G>C	19.37:g.11529358C>G	ENSP00000369823:p.Gly46Arg		B5ME84|B7ZL22|Q0P6G0	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.G46R	ENST00000380456.3	37	c.136	CCDS32910.1	19	.	.	.	.	.	.	.	.	.	.	C	8.753	0.921674	0.17982	.	.	ENSG00000205517	ENST00000393423;ENST00000380456;ENST00000453604	T;T	0.39592	1.19;1.07	3.76	2.68	0.31781	.	1.511100	0.04229	N	0.334988	T	0.24236	0.0587	N	0.03115	-0.41	0.09310	N	1	B;B;B	0.22146	0.031;0.065;0.042	B;B;B	0.25291	0.007;0.059;0.01	T	0.22765	-1.0207	10	0.15499	T	0.54	.	11.2105	0.48795	0.0:0.7959:0.2041:0.0	.	46;46;46	B4DPC9;Q3MIN7;B5ME84	.;RGL3_HUMAN;.	R	46	ENSP00000377075:G46R;ENSP00000369823:G46R	ENSP00000369823:G46R	G	-	1	0	RGL3	11390358	0.019000	0.18553	0.006000	0.13384	0.026000	0.11368	2.120000	0.41968	0.660000	0.30964	0.305000	0.20034	GGG	RGL3	-	NULL	ENSG00000205517		0.731	RGL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGL3	HGNC	protein_coding	OTTHUMT00000421208.3	-	0.00	42	0	C	XM_290867		11529358	-1	tier1	-	no_errors	ENST00000393423	ensembl	human	known	74_37	missense	22.22	14	4	SNP	0.077	G
RGS13	6003	genome.wustl.edu	37	1	192613467	192613467	+	Start_Codon_SNP	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:192613467G>T	ENST00000391995.2	+	4	291	c.3G>T	c.(1-3)atG>atT	p.M1I	RGS13_ENST00000543215.1_Start_Codon_SNP_p.M1I	NM_002927.4	NP_002918.1	O14921	RGS13_HUMAN	regulator of G-protein signaling 13	1					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.M1I(2)		endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|skin(1)	19						TTAGAAAAATGAGCAGGCGGA	0.294																																																	2	Substitution - Missense(2)	lung(2)											98.0	109.0	105.0					1																	192613467		2203	4300	6503	SO:0001582	initiator_codon_variant	0			AF030107	CCDS1376.1	1q31.2	2008-02-05	2007-08-14		ENSG00000127074	ENSG00000127074		"""Regulators of G-protein signaling"""	9995	protein-coding gene	gene with protein product		607190	"""regulator of G-protein signalling 13"""			11875076	Standard	NM_144766		Approved		uc001gsk.3	O14921	OTTHUMG00000035601	ENST00000391995.2:c.3G>T	1.37:g.192613467G>T	ENSP00000375853:p.Met1Ile		Q6PGR2|Q8TD63|Q9BX45	Missense_Mutation	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.M1I	ENST00000391995.2	37	c.3	CCDS1376.1	1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505651	0.44558	.	.	ENSG00000127074	ENST00000391995;ENST00000543215	T;T	0.40756	1.02;1.02	5.62	5.62	0.85841	.	0.284540	0.37095	N	0.002260	T	0.62708	0.2450	.	.	.	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	T	0.64807	-0.6320	9	0.87932	D	0	.	15.5018	0.75705	0.0:0.0:1.0:0.0	.	1	O14921	RGS13_HUMAN	I	1	ENSP00000375853:M1I;ENSP00000442837:M1I	ENSP00000375853:M1I	M	+	3	0	RGS13	190880090	1.000000	0.71417	1.000000	0.80357	0.586000	0.36452	5.092000	0.64511	2.795000	0.96236	0.655000	0.94253	ATG	RGS13	-	NULL	ENSG00000127074		0.294	RGS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS13	HGNC	protein_coding	OTTHUMT00000086400.1		0.00	43	0	G	NM_002927	Missense_Mutation	192613467	+1			no_errors	ENST00000391995	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	T
RNF122	79845	genome.wustl.edu	37	8	33406936	33406936	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:33406936delA	ENST00000256257.1	-	5	746	c.345delT	c.(343-345)tttfs	p.F115fs		NM_024787.2	NP_079063.2	Q9H9V4	RN122_HUMAN	ring finger protein 122	115						endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(67;0.0966)|Kidney(114;0.116)		ACTTGCGGTGAAAGGCGTGTT	0.532																																																	0													127.0	99.0	108.0					8																	33406936		2203	4300	6503	SO:0001589	frameshift_variant	0			AK022588	CCDS6091.1	8p12	2013-01-09			ENSG00000133874	ENSG00000133874		"""RING-type (C3HC4) zinc fingers"""	21147	protein-coding gene	gene with protein product							Standard	NM_024787		Approved	FLJ12526	uc003xjo.1	Q9H9V4	OTTHUMG00000163960	ENST00000256257.1:c.345delT	8.37:g.33406936delA	ENSP00000256257:p.Phe115fs		Q52LK3	Frame_Shift_Del	DEL	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.H116fs	ENST00000256257.1	37	c.345	CCDS6091.1	8																																																																																			RNF122	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000133874		0.532	RNF122-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF122	HGNC	protein_coding	OTTHUMT00000376562.1		0.00	45	0	A	NM_024787		33406936	-1	tier1		no_errors	ENST00000256257	ensembl	human	known	74_37	frame_shift_del	6.90	27	2	DEL	0.997	-
ROBO3	64221	genome.wustl.edu	37	11	124744730	124744730	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:124744730G>T	ENST00000397801.1	+	13	2190	c.1998G>T	c.(1996-1998)caG>caT	p.Q666H	ROBO3_ENST00000543966.1_5'Flank|ROBO3_ENST00000538940.1_Missense_Mutation_p.Q644H	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	666					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		GAGGCCAGCAGGGACTGGCGG	0.627																																																	0													15.0	18.0	17.0					11																	124744730		1935	4148	6083	SO:0001583	missense	0			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.1998G>T	11.37:g.124744730G>T	ENSP00000380903:p.Gln666His			Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.Q666H	ENST00000397801.1	37	c.1998	CCDS44755.1	11	.	.	.	.	.	.	.	.	.	.	G	11.68	1.711078	0.30322	.	.	ENSG00000154134	ENST00000397801;ENST00000538940	T;T	0.63096	-0.02;-0.02	4.97	0.263	0.15602	.	1.422640	0.05111	N	0.488977	T	0.52419	0.1733	L	0.40543	1.245	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45160	-0.9280	10	0.66056	D	0.02	.	6.2074	0.20610	0.3656:0.1326:0.5018:0.0	.	666	Q96MS0	ROBO3_HUMAN	H	666;644	ENSP00000380903:Q666H;ENSP00000441797:Q644H	ENSP00000380903:Q666H	Q	+	3	2	ROBO3	124249940	0.302000	0.24454	0.862000	0.33874	0.798000	0.45092	0.597000	0.24059	0.134000	0.18681	0.650000	0.86243	CAG	ROBO3	-	NULL	ENSG00000154134		0.627	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	HGNC	protein_coding	OTTHUMT00000387091.1	-	0.00	60	0	G	XM_370663		124744730	+1	tier1	-	no_errors	ENST00000397801	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.862	T
RP1L1	94137	genome.wustl.edu	37	8	10479151	10479151	+	5'UTR	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:10479151A>C	ENST00000329335.3	-	0	990				RP1L1_ENST00000382483.3_Intron			Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1						cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		ATATTTATGAAGTATTGGTGG	0.502																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000329335.3:c.-546T>G	8.37:g.10479151A>C			Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	RNA	SNP	-	NULL	ENST00000329335.3	37	NULL		8																																																																																			RP1L1	-	-	ENSG00000183638		0.502	RP1L1-002	KNOWN	basic	processed_transcript	RP1L1	HGNC	protein_coding	OTTHUMT00000375674.1	-	0.00	66	0	A			10479151	-1	tier1	-	no_errors	ENST00000329335	ensembl	human	known	74_37	rna	26.32	14	5	SNP	0.002	C
RTN2	6253	genome.wustl.edu	37	19	45997939	45997939	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:45997939C>T	ENST00000245923.4	-	3	639	c.404G>A	c.(403-405)cGc>cAc	p.R135H	PPM1N_ENST00000456399.2_5'Flank|PPM1N_ENST00000396737.2_5'Flank|RTN2_ENST00000430715.2_5'Flank|RTN2_ENST00000590526.1_5'UTR|RTN2_ENST00000344680.4_Missense_Mutation_p.R135H|PPM1N_ENST00000401705.1_Intron|RTN2_ENST00000589384.1_5'UTR	NM_005619.4	NP_005610.1	O75298	RTN2_HUMAN	reticulon 2	135					cell death (GO:0008219)|intracellular protein transmembrane transport (GO:0065002)|regulation of glucose import (GO:0046324)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(4)|skin(1)|urinary_tract(1)	20		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00829)|Epithelial(262;0.184)|GBM - Glioblastoma multiforme(486;0.246)		TTCCAGAGGGCGCTCGGATGG	0.687																																																	0													49.0	56.0	53.0					19																	45997939		2203	4300	6503	SO:0001583	missense	0			AF038540	CCDS12665.1, CCDS12666.1, CCDS46114.1	19q13.2-q13.3	2012-03-30				ENSG00000125744			10468	protein-coding gene	gene with protein product	"""NSP-like protein 1"", ""Neuroendocrine-specific protein-like 1"""	603183	"""spastic paraplegia 12 (autosomal dominant)"""	SPG12		8812484, 9530622, 22232211	Standard	NM_005619		Approved	NSP2, NSPL1	uc002pcb.4	O75298		ENST00000245923.4:c.404G>A	19.37:g.45997939C>T	ENSP00000245923:p.Arg135His		O60509|Q7RTM6|Q7RTN1|Q7RTN2	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.R135H	ENST00000245923.4	37	c.404	CCDS12665.1	19	.	.	.	.	.	.	.	.	.	.	C	7.955	0.745622	0.15710	.	.	ENSG00000125744	ENST00000344680;ENST00000245923	T;T	0.54071	0.65;0.59	5.58	1.86	0.25419	.	0.412390	0.21011	N	0.081687	T	0.33440	0.0863	L	0.27053	0.805	0.09310	N	0.999999	B;B	0.18013	0.025;0.001	B;B	0.14578	0.011;0.001	T	0.14035	-1.0487	10	0.34782	T	0.22	-4.3138	6.0459	0.19760	0.0:0.6222:0.1704:0.2074	.	135;135	O75298-2;O75298	.;RTN2_HUMAN	H	135	ENSP00000345127:R135H;ENSP00000245923:R135H	ENSP00000245923:R135H	R	-	2	0	RTN2	50689779	0.976000	0.34144	0.016000	0.15963	0.223000	0.24884	0.813000	0.27225	0.662000	0.31006	0.563000	0.77884	CGC	RTN2	-	NULL	ENSG00000125744		0.687	RTN2-001	KNOWN	basic|CCDS	protein_coding	RTN2	HGNC	protein_coding	OTTHUMT00000459574.1		0.00	134	0	C	NM_005619		45997939	-1			no_errors	ENST00000245923	ensembl	human	known	74_37	missense	6.78	55	4	SNP	0.002	T
NAALADL1	10004	genome.wustl.edu	37	11	64811901	64811901	+	IGR	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:64811901G>T	ENST00000358658.3	-	0	2699				SAC3D1_ENST00000531072.1_Missense_Mutation_p.R260L|SAC3D1_ENST00000398846.1_Missense_Mutation_p.R260L|SAC3D1_ENST00000530213.1_3'UTR	NM_005468.2	NP_005459.2	Q9UQQ1	NALDL_HUMAN	N-acetylated alpha-linked acidic dipeptidase-like 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	29						GCCCTGGCCCGCTTCGCTCGT	0.652																																																	0													53.0	59.0	57.0					11																	64811901		2053	4191	6244	SO:0001628	intergenic_variant	0			AF010141	CCDS31604.1	11q12	2011-08-16			ENSG00000168060	ENSG00000168060			23536	protein-coding gene	gene with protein product	"""ileal peptidase I100"""	602640				10085079	Standard	NM_005468		Approved		uc001ocn.3	Q9UQQ1	OTTHUMG00000165595		11.37:g.64811901G>T			C9J8A1|C9J964|C9JL35|C9JSN0|O43176	Missense_Mutation	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.R260L	ENST00000358658.3	37	c.779	CCDS31604.1	11	.	.	.	.	.	.	.	.	.	.	G	8.929	0.962956	0.18583	.	.	ENSG00000168061	ENST00000531072;ENST00000398846;ENST00000301885	T;T	0.28454	1.61;1.61	4.72	3.77	0.43336	.	0.389179	0.19101	N	0.122716	T	0.22820	0.0551	L	0.41236	1.265	0.29693	N	0.840799	B	0.25955	0.138	B	0.29862	0.108	T	0.07102	-1.0790	10	0.22706	T	0.39	-16.5914	7.1817	0.25776	0.0:0.1965:0.6248:0.1786	.	306	A6NKF1	SAC31_HUMAN	L	260;260;305	ENSP00000436649:R260L;ENSP00000381824:R260L	ENSP00000301885:R305L	R	+	2	0	SAC3D1	64568477	1.000000	0.71417	0.997000	0.53966	0.734000	0.41952	2.593000	0.46180	2.437000	0.82529	0.650000	0.86243	CGC	SAC3D1	-	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	ENSG00000168061		0.652	NAALADL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAC3D1	HGNC	protein_coding	OTTHUMT00000385162.1		0.00	67	0	G	NM_005468		64811901	+1			no_errors	ENST00000398846	ensembl	human	known	74_37	missense	6.25	45	3	SNP	0.870	T
SEC14L5	9717	genome.wustl.edu	37	16	5038251	5038251	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr16:5038251C>T	ENST00000251170.7	+	4	495	c.315C>T	c.(313-315)cgC>cgT	p.R105R		NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)	105	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.					integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						TCGCCAACCGCGTGGTGGTGA	0.637																																																	0													45.0	49.0	48.0					16																	5038251		2175	4273	6448	SO:0001819	synonymous_variant	0			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.315C>T	16.37:g.5038251C>T				Silent	SNP	pfam_PRELI/MSF1,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,superfamily_GOLD,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,pfscan_PRELI/MSF1,prints_CRAL-bd_toc_tran	p.R105	ENST00000251170.7	37	c.315	CCDS45403.1	16																																																																																			SEC14L5	-	pfam_PRELI/MSF1,pfscan_PRELI/MSF1	ENSG00000103184		0.637	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	HGNC	protein_coding	OTTHUMT00000434379.1	-	0.00	48	0	C			5038251	+1	tier1	-	no_errors	ENST00000251170	ensembl	human	known	74_37	silent	20.00	16	4	SNP	0.148	T
SEMA6D	80031	genome.wustl.edu	37	15	48054408	48054408	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:48054408T>C	ENST00000316364.5	+	8	989	c.550T>C	c.(550-552)Tat>Cat	p.Y184H	SEMA6D_ENST00000537942.1_Missense_Mutation_p.Y184H|SEMA6D_ENST00000389425.3_Missense_Mutation_p.Y184H|SEMA6D_ENST00000355997.3_Missense_Mutation_p.Y184H|SEMA6D_ENST00000389433.2_Missense_Mutation_p.Y184H|SEMA6D_ENST00000358066.4_Missense_Mutation_p.Y184H|SEMA6D_ENST00000558816.1_Missense_Mutation_p.Y184H|SEMA6D_ENST00000558014.1_Missense_Mutation_p.Y184H|SEMA6D_ENST00000389432.2_Missense_Mutation_p.Y184H|SEMA6D_ENST00000354744.4_Missense_Mutation_p.Y184H|SEMA6D_ENST00000536845.2_Missense_Mutation_p.Y184H|SEMA6D_ENST00000389428.3_Missense_Mutation_p.Y184H	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D	184	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TGGGAAGCTGTATTCTGCCAC	0.443																																																	0													111.0	103.0	106.0					15																	48054408		2198	4297	6495	SO:0001583	missense	0			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.550T>C	15.37:g.48054408T>C	ENSP00000324857:p.Tyr184His		A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	pfam_Semap_dom,pfam_Plexin_repeat,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,pfscan_Semap_dom	p.Y184H	ENST00000316364.5	37	c.550	CCDS32225.1	15	.	.	.	.	.	.	.	.	.	.	T	29.1	4.976849	0.92982	.	.	ENSG00000137872	ENST00000537942;ENST00000536845;ENST00000316364;ENST00000389433;ENST00000389432;ENST00000354744;ENST00000358066;ENST00000389428;ENST00000355997;ENST00000389425	T;T;T;T;T;T;T;T;T;T	0.23147	1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92;1.92	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.66076	0.2753	H	0.96301	3.8	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.999;0.998	T	0.77731	-0.2478	10	0.87932	D	0	.	16.8222	0.85835	0.0:0.0:0.0:1.0	.	184;184;184;184;184	Q8NFY4-3;A6NM95;Q8NFY4-4;Q8NFY4;Q8NFY4-2	.;.;.;SEM6D_HUMAN;.	H	184	ENSP00000442040:Y184H;ENSP00000446152:Y184H;ENSP00000324857:Y184H;ENSP00000374084:Y184H;ENSP00000374083:Y184H;ENSP00000346786:Y184H;ENSP00000350770:Y184H;ENSP00000374079:Y184H;ENSP00000348276:Y184H;ENSP00000374076:Y184H	ENSP00000324857:Y184H	Y	+	1	0	SEMA6D	45841700	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	TAT	SEMA6D	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000137872		0.443	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	-	0.00	58	0	T	NM_024966		48054408	+1	tier1	-	no_errors	ENST00000316364	ensembl	human	known	74_37	missense	26.09	17	6	SNP	1.000	C
SETBP1	26040	genome.wustl.edu	37	18	42643107	42643107	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr18:42643107G>T	ENST00000282030.5	+	6	4531	c.4235G>T	c.(4234-4236)cGg>cTg	p.R1412L		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1412						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		TGCGAAGTGCGGAAGATGTGC	0.532									Schinzel-Giedion syndrome																																								0													58.0	54.0	55.0					18																	42643107		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4235G>T	18.37:g.42643107G>T	ENSP00000282030:p.Arg1412Leu		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.R1412L	ENST00000282030.5	37	c.4235	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	G	32	5.168252	0.94768	.	.	ENSG00000152217	ENST00000282030	D	0.83506	-1.73	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000001	D	0.87509	0.6195	L	0.32530	0.975	0.45452	D	0.998424	D	0.89917	1.0	D	0.85130	0.997	D	0.88801	0.3285	10	0.87932	D	0	.	18.8667	0.92294	0.0:0.0:1.0:0.0	.	1412	Q9Y6X0	SETBP_HUMAN	L	1412	ENSP00000282030:R1412L	ENSP00000282030:R1412L	R	+	2	0	SETBP1	40897105	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.044000	0.93805	2.615000	0.88500	0.563000	0.77884	CGG	SETBP1	-	NULL	ENSG00000152217		0.532	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4		0.00	46	0	G	NM_001130110		42643107	+1			no_errors	ENST00000282030	ensembl	human	known	74_37	missense	18.18	9	2	SNP	1.000	T
SHANK1	50944	genome.wustl.edu	37	19	51169688	51169688	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:51169688G>A	ENST00000293441.1	-	22	5547	c.5529C>T	c.(5527-5529)ggC>ggT	p.G1843G	SHANK1_ENST00000359082.3_Silent_p.G1834G|SHANK1_ENST00000391814.1_Silent_p.G1851G|SHANK1_ENST00000391813.1_Silent_p.G1230G|SYT3_ENST00000544769.1_Intron	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1843					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		GTGGGCCCGGGCCCTCCTCCC	0.697																																																	0													11.0	13.0	12.0					19																	51169688		2193	4285	6478	SO:0001819	synonymous_variant	0			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.5529C>T	19.37:g.51169688G>A			A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.G1851	ENST00000293441.1	37	c.5553	CCDS12799.1	19																																																																																			SHANK1	-	NULL	ENSG00000161681		0.697	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	HGNC	protein_coding	OTTHUMT00000268071.1	-	0.00	34	0	G	NM_016148		51169688	-1	tier1	-	no_errors	ENST00000391814	ensembl	human	known	74_37	silent	16.00	21	4	SNP	1.000	A
SIK3	23387	genome.wustl.edu	37	11	116797979	116797979	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr11:116797979G>A	ENST00000292055.4	-	4	433	c.398C>T	c.(397-399)gCt>gTt	p.A133V	SIK3_ENST00000375288.1_5'UTR|SIK3_ENST00000375300.1_Missense_Mutation_p.A191V|SIK3_ENST00000542607.1_Missense_Mutation_p.A133V|SIK3_ENST00000446921.2_Missense_Mutation_p.A191V|SIK3_ENST00000434315.2_Missense_Mutation_p.A32V	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3	133	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						TAAATTTTCAGCTTTTAAATC	0.423																																																	0													140.0	134.0	136.0					11																	116797979		2201	4296	6497	SO:0001583	missense	0			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.398C>T	11.37:g.116797979G>A	ENSP00000292055:p.Ala133Val		A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_dom	p.A191V	ENST00000292055.4	37	c.572	CCDS8379.1	11	.	.	.	.	.	.	.	.	.	.	G	35	5.523491	0.96431	.	.	ENSG00000160584	ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315	T;T;T;T	0.26518	1.73;1.73;1.73;1.73	5.81	5.81	0.92471	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.41097	U	0.000942	T	0.38161	0.1030	N	0.13003	0.285	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.91635	0.999;0.965;0.999	T	0.40421	-0.9564	10	0.87932	D	0	.	20.0784	0.97758	0.0:0.0:1.0:0.0	.	133;32;133	A1A5A8;A1A5A9;Q9Y2K2	.;.;SIK3_HUMAN	V	191;133;133;32	ENSP00000364449:A191V;ENSP00000292055:A133V;ENSP00000438108:A133V;ENSP00000415873:A32V	ENSP00000292055:A133V	A	-	2	0	SIK3	116303189	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.736000	0.93811	0.655000	0.94253	GCT	SIK3	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000160584		0.423	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	HGNC	protein_coding		-	0.00	79	0	G	NM_025164		116797979	-1	tier1	-	no_errors	ENST00000375300	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	A
SIMC1	375484	genome.wustl.edu	37	5	175751685	175751685	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:175751685C>T	ENST00000443967.1	+	9	2446	c.2039C>T	c.(2038-2040)aCc>aTc	p.T680I	SIMC1_ENST00000430704.2_Missense_Mutation_p.T265I|SIMC1_ENST00000341199.6_Missense_Mutation_p.T265I|SIMC1_ENST00000332772.4_Missense_Mutation_p.T141I			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1	680							SUMO polymer binding (GO:0032184)										GTGGACAGGACCCCCACCTGC	0.522																																																	0													94.0	87.0	89.0					5																	175751685		2203	4300	6503	SO:0001583	missense	0			BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	ENST00000443967.1:c.2039C>T	5.37:g.175751685C>T	ENSP00000406571:p.Thr680Ile		J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Missense_Mutation	SNP	NULL	p.T680I	ENST00000443967.1	37	c.2039		5	.	.	.	.	.	.	.	.	.	.	C	22.3	4.268779	0.80469	.	.	ENSG00000170085	ENST00000341199;ENST00000430704;ENST00000443967;ENST00000332772	T;T;T;T	0.33216	1.85;1.85;2.12;1.42	5.35	5.35	0.76521	.	0.384280	0.26311	N	0.025106	T	0.49795	0.1578	L	0.48642	1.525	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.83275	0.996;0.943;0.996	T	0.45160	-0.9280	10	0.72032	D	0.01	-13.3041	16.0862	0.81056	0.0:1.0:0.0:0.0	.	141;265;680	Q8NDZ2-4;Q8NDZ2-3;Q8NDZ2	.;.;CE025_HUMAN	I	265;265;680;141	ENSP00000342075:T265I;ENSP00000409287:T265I;ENSP00000406571:T680I;ENSP00000331311:T141I	ENSP00000331311:T141I	T	+	2	0	C5orf25	175684291	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.800000	0.62524	2.785000	0.95823	0.591000	0.81541	ACC	SIMC1	-	NULL	ENSG00000170085		0.522	SIMC1-001	KNOWN	basic	protein_coding	SIMC1	HGNC	protein_coding	OTTHUMT00000253155.2	-	0.00	77	0	C	NM_198567		175751685	+1	tier1	-	no_errors	ENST00000443967	ensembl	human	known	74_37	missense	7.02	53	4	SNP	1.000	T
SLC28A1	9154	genome.wustl.edu	37	15	85478705	85478705	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:85478705G>T	ENST00000286749.3	+	14	1627	c.1537G>T	c.(1537-1539)Gca>Tca	p.A513S	RNU6-339P_ENST00000384310.1_RNA|SLC28A1_ENST00000537216.1_Missense_Mutation_p.A513S|SLC28A1_ENST00000538177.1_Intron|SLC28A1_ENST00000537624.1_Missense_Mutation_p.A513S|SLC28A1_ENST00000394573.1_Missense_Mutation_p.A513S			O00337	S28A1_HUMAN	solute carrier family 28 (concentrative nucleoside transporter), member 1	513					nucleobase-containing compound metabolic process (GO:0006139)|nucleoside transmembrane transport (GO:1901642)|nucleoside transport (GO:0015858)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	nucleoside binding (GO:0001882)|nucleoside transmembrane transporter activity (GO:0005337)|nucleoside:sodium symporter activity (GO:0005415)			breast(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(17)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	41			BRCA - Breast invasive adenocarcinoma(143;0.0587)		Gemcitabine(DB00441)|Stavudine(DB00649)|Zidovudine(DB00495)	ACGCCGCCTGGCAGGGGCCGA	0.612																																																	0													107.0	103.0	104.0					15																	85478705		2203	4299	6502	SO:0001583	missense	0			U62967	CCDS10334.1, CCDS10335.1, CCDS73777.1	15q25.3	2013-07-17	2013-07-17		ENSG00000156222	ENSG00000156222		"""Solute carriers"""	11001	protein-coding gene	gene with protein product		606207	"""solute carrier family 28 (sodium-coupled nucleoside transporter), member 1"""			9124315	Standard	NM_004213		Approved	CNT1	uc002blg.3	O00337	OTTHUMG00000148668	ENST00000286749.3:c.1537G>T	15.37:g.85478705G>T	ENSP00000286749:p.Ala513Ser		A0AV42|A8K7I2|O00335|O00336|Q5U5S6|Q5U648|Q9UEZ9	Missense_Mutation	SNP	pfam_Nucleos_tra2_C,pfam_Nuclsd_transpt2,pfam_Nucleoside_recog_Gate,tigrfam_C_nuclsd_transpt_met_bac	p.A513S	ENST00000286749.3	37	c.1537	CCDS10334.1	15	.	.	.	.	.	.	.	.	.	.	G	0.180	-1.063471	0.01934	.	.	ENSG00000156222	ENST00000537216;ENST00000537624;ENST00000286749;ENST00000394573	T;T;T;T	0.01854	4.6;4.68;4.71;4.71	5.12	3.24	0.37175	Na dependent nucleoside transporter, C-terminal (1);	0.405878	0.27442	N	0.019352	T	0.00845	0.0028	N	0.01779	-0.725	0.09310	N	0.999997	B;B;B	0.12013	0.005;0.002;0.005	B;B;B	0.16289	0.01;0.006;0.015	T	0.48352	-0.9043	10	0.02654	T	1	-15.1387	6.1332	0.20217	0.0863:0.0:0.5827:0.331	.	513;513;513	B7Z533;F5H560;O00337	.;.;S28A1_HUMAN	S	513	ENSP00000440546:A513S;ENSP00000444700:A513S;ENSP00000286749:A513S;ENSP00000378074:A513S	ENSP00000286749:A513S	A	+	1	0	SLC28A1	83279709	0.000000	0.05858	0.404000	0.26397	0.558000	0.35554	0.279000	0.18771	0.735000	0.32537	0.455000	0.32223	GCA	SLC28A1	-	pfam_Nucleos_tra2_C,tigrfam_C_nuclsd_transpt_met_bac	ENSG00000156222		0.612	SLC28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC28A1	HGNC	protein_coding	OTTHUMT00000308998.2	-	0.00	47	0	G			85478705	+1	tier1	-	no_errors	ENST00000286749	ensembl	human	known	74_37	missense	12.90	27	4	SNP	0.007	T
SLC39A12	221074	genome.wustl.edu	37	10	18254526	18254526	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:18254526G>A	ENST00000377369.2	+	4	931	c.658G>A	c.(658-660)Gtt>Att	p.V220I	SLC39A12_ENST00000377374.4_Missense_Mutation_p.V220I|SLC39A12_ENST00000377371.3_Missense_Mutation_p.V220I|SLC39A12_ENST00000539911.1_Missense_Mutation_p.V86I	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	220					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						CCTCCAGGGTGTTTGTCTGGG	0.448																																																	0													89.0	84.0	86.0					10																	18254526		2203	4300	6503	SO:0001583	missense	0				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.658G>A	10.37:g.18254526G>A	ENSP00000366586:p.Val220Ile		B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	pfam_ZIP	p.V220I	ENST00000377369.2	37	c.658	CCDS44362.1	10	.	.	.	.	.	.	.	.	.	.	G	13.38	2.220796	0.39201	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.62639	0.14;0.01;0.14;0.05	6.02	6.02	0.97574	.	0.126782	0.56097	D	0.000033	T	0.63628	0.2527	M	0.77616	2.38	0.44780	D	0.99778	B;B;B	0.24043	0.096;0.058;0.096	B;B;B	0.24006	0.05;0.022;0.05	T	0.58418	-0.7640	10	0.27082	T	0.32	-25.4085	14.6603	0.68865	0.0688:0.0:0.9312:0.0	.	220;220;220	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	I	220;220;220;86;140	ENSP00000366586:V220I;ENSP00000366591:V220I;ENSP00000366588:V220I;ENSP00000440445:V86I	ENSP00000366586:V220I	V	+	1	0	SLC39A12	18294532	1.000000	0.71417	0.992000	0.48379	0.924000	0.55760	3.096000	0.50243	2.865000	0.98341	0.655000	0.94253	GTT	SLC39A12	-	NULL	ENSG00000148482		0.448	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A12	HGNC	protein_coding		-	0.00	71	0	G	NM_152725		18254526	+1	tier1	-	no_errors	ENST00000377369	ensembl	human	known	74_37	missense	19.35	25	6	SNP	0.992	A
SLC7A1	6541	genome.wustl.edu	37	13	30091410	30091410	+	Silent	SNP	A	A	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr13:30091410A>T	ENST00000380752.5	-	11	1934	c.1548T>A	c.(1546-1548)ctT>ctA	p.L516L	SLC7A1_ENST00000473577.1_5'UTR	NM_003045.4	NP_003036.1	P30825	CTR1_HUMAN	solute carrier family 7 (cationic amino acid transporter, y+ system), member 1	516					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arginine transmembrane transporter activity (GO:0015181)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|stomach(1)|urinary_tract(2)	24		Lung SC(185;0.0257)|Breast(139;0.238)		all cancers(112;0.0148)|OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(112;0.0875)|GBM - Glioblastoma multiforme(144;0.179)	L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CCTCCCTTCCAAGCACGGTCA	0.572																																																	0													50.0	42.0	45.0					13																	30091410		2203	4300	6503	SO:0001819	synonymous_variant	0			AF078107	CCDS9333.1	13q12.3	2013-05-22			ENSG00000139514	ENSG00000139514		"""Solute carriers"""	11057	protein-coding gene	gene with protein product	"""ecotropic retroviral receptor"", ""amino acid transporter, cationic 1"""	104615		ERR, ATRC1		1348489	Standard	NM_003045		Approved	CAT-1, HCAT1, REC1L	uc001uso.3	P30825	OTTHUMG00000016658	ENST00000380752.5:c.1548T>A	13.37:g.30091410A>T			Q5JR50	Silent	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	p.L516	ENST00000380752.5	37	c.1548	CCDS9333.1	13																																																																																			SLC7A1	-	pirsf_AA/rel_permease1,tigrfam_Cat_AA_permease	ENSG00000139514		0.572	SLC7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A1	HGNC	protein_coding	OTTHUMT00000044337.2	-	0.00	30	0	A	NM_003045		30091410	-1	tier1	-	no_errors	ENST00000380752	ensembl	human	known	74_37	silent	23.08	10	3	SNP	0.022	T
SLCO1B3	28234	genome.wustl.edu	37	12	21028386	21028386	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:21028386delA	ENST00000381545.3	+	9	1164	c.945delA	c.(943-945)ggafs	p.G315fs	LST3_ENST00000381541.3_Intron|LST3_ENST00000540229.1_Frame_Shift_Del_p.G315fs|SLCO1B3_ENST00000261196.2_Frame_Shift_Del_p.G315fs|SLCO1B3_ENST00000553473.1_Frame_Shift_Del_p.G315fs|SLCO1B7_ENST00000554957.1_Intron	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	315					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	CCAACCAAGGAAAAAATGTTA	0.299																																																	0													39.0	40.0	40.0					12																	21028386		2202	4299	6501	SO:0001589	frameshift_variant	0				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.945delA	12.37:g.21028386delA	ENSP00000370956:p.Gly315fs		E7EMT8|Q5JAR4	Frame_Shift_Del	DEL	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.N317fs	ENST00000381545.3	37	c.945	CCDS8684.1	12																																																																																			SLCO1B3	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000111700		0.299	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	SLCO1B3	HGNC	protein_coding	OTTHUMT00000401936.1		0.00	91	0	A	NM_019844		21028386	+1	tier1		no_errors	ENST00000553473	ensembl	human	known	74_37	frame_shift_del	5.26	36	2	DEL	0.000	-
SMARCA1	6594	genome.wustl.edu	37	X	128633806	128633806	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:128633806A>C	ENST00000371122.4	-	10	1309	c.1180T>G	c.(1180-1182)Ttt>Gtt	p.F394V	SMARCA1_ENST00000371121.3_Missense_Mutation_p.F394V|SMARCA1_ENST00000371123.1_Missense_Mutation_p.F394V	NM_003069.3	NP_003060.2	P28370	SMCA1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 1	394					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|DNA strand renaturation (GO:0000733)|neuron differentiation (GO:0030182)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)	CERF complex (GO:0090537)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|NURF complex (GO:0016589)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(13)|ovary(5)|prostate(1)|skin(1)	45						CGTAACAAAAATGGTTTTAAA	0.289																																																	0													82.0	86.0	85.0					X																	128633806		2202	4298	6500	SO:0001583	missense	0			M88163	CCDS14612.1, CCDS76018.1, CCDS76019.1	Xq25	2008-02-05			ENSG00000102038	ENSG00000102038			11097	protein-coding gene	gene with protein product		300012		SNF2L1, SNF2L		1408766, 14609955	Standard	XM_005262461		Approved	SNF2LB, NURF140, ISWI, SWI	uc004eun.4	P28370	OTTHUMG00000022370	ENST00000371122.4:c.1180T>G	X.37:g.128633806A>C	ENSP00000360163:p.Phe394Val		Q5JV41|Q5JV42	Missense_Mutation	SNP	pfam_SNF2_N,pfam_SLIDE,pfam_ISWI_HAND-dom,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,superfamily_ISWI_HAND-dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_SANT/Myb,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.F394V	ENST00000371122.4	37	c.1180	CCDS14612.1	X	.	.	.	.	.	.	.	.	.	.	A	23.3	4.405046	0.83230	.	.	ENSG00000102038	ENST00000371121;ENST00000371123;ENST00000371122;ENST00000450039	D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41	5.24	5.24	0.73138	SNF2-related (1);	0.000000	0.64402	D	0.000004	D	0.97235	0.9096	M	0.91872	3.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.83275	0.996;0.996;0.994;0.996	D	0.98063	1.0394	10	0.87932	D	0	-14.4292	14.2206	0.65823	1.0:0.0:0.0:0.0	.	373;394;394;394	E9PCY3;B7ZLQ5;P28370-2;P28370	.;.;.;SMCA1_HUMAN	V	394;394;394;373	ENSP00000360162:F394V;ENSP00000360164:F394V;ENSP00000360163:F394V;ENSP00000404275:F373V	ENSP00000360162:F394V	F	-	1	0	SMARCA1	128461487	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.284000	0.95882	1.736000	0.51660	0.414000	0.27820	TTT	SMARCA1	-	pfam_SNF2_N,superfamily_P-loop_NTPase	ENSG00000102038		0.289	SMARCA1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCA1	HGNC	protein_coding	OTTHUMT00000058206.1	-	0.00	34	0	A	NM_003069		128633806	-1	tier1	-	no_errors	ENST00000371122	ensembl	human	known	74_37	missense	27.27	8	3	SNP	1.000	C
SMDT1	91689	genome.wustl.edu	37	22	42478046	42478048	+	In_Frame_Del	DEL	GAT	GAT	-	rs141840500		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	GAT	GAT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr22:42478046_42478048delGAT	ENST00000331479.3	+	2	378_380	c.304_306delGAT	c.(304-306)gatdel	p.D107del		NM_033318.4	NP_201575.3	Q9H4I9	EMRE_HUMAN	single-pass membrane protein with aspartate-rich tail 1	107	Asp/Glu-rich.				calcium ion transmembrane import into mitochondrion (GO:0036444)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)	integral component of mitochondrial inner membrane (GO:0031305)|uniplex complex (GO:1990246)											TGTTCCAGAGGATGATGATGATG	0.478																																																	0										0,4264		0,0,2132						3.7	1.0			147	3,8251		0,3,4124	no	coding	C22orf32	NM_033318.4		0,3,6256	A1A1,A1R,RR		0.0363,0.0,0.024				3,12515				SO:0001651	inframe_deletion	0			BC024237	CCDS14031.1	22q13.2	2013-03-08	2013-03-08	2013-03-08	ENSG00000183172	ENSG00000183172			25055	protein-coding gene	gene with protein product		615588	"""chromosome 22 open reading frame 32"""	C22orf32		12477932	Standard	NM_033318		Approved	dJ186O1.1, DDDD	uc003bca.3	Q9H4I9	OTTHUMG00000151286	ENST00000331479.3:c.304_306delGAT	22.37:g.42478055_42478057delGAT	ENSP00000327467:p.Asp107del		B2R5D1|Q8TAB9	In_Frame_Del	DEL	pfam_UPF0466	p.D105in_frame_del	ENST00000331479.3	37	c.304_306	CCDS14031.1	22																																																																																			SMDT1	-	pfam_UPF0466	ENSG00000183172		0.478	SMDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMDT1	HGNC	protein_coding	OTTHUMT00000322086.1		0.00	62	0	GAT	NM_033318		42478048	+1	tier1		no_errors	ENST00000331479	ensembl	human	known	74_37	in_frame_del	11.11	32	4	DEL	1.000:1.000:0.998	-
SND1	27044	genome.wustl.edu	37	7	127729559	127729559	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:127729559G>A	ENST00000354725.3	+	22	2631	c.2437G>A	c.(2437-2439)Gcc>Acc	p.A813T		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	813					gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						CCGCACGGACGCCGTGGACAG	0.587																																																	0													108.0	96.0	100.0					7																	127729559		2203	4300	6503	SO:0001583	missense	0				CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.2437G>A	7.37:g.127729559G>A	ENSP00000346762:p.Ala813Thr		Q13122|Q96AG0	Missense_Mutation	SNP	pfam_Staphylococal_nuclease_OB-fold,pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Staphylococal_nuclease_OB-fold,smart_Tudor,pirsf_Silence_cplx_Nase-comp_TudorSN,pfscan_Tudor,pfscan_Staphylococal_nuclease_OB-fold	p.A813T	ENST00000354725.3	37	c.2437	CCDS34747.1	7	.	.	.	.	.	.	.	.	.	.	G	16.96	3.265750	0.59540	.	.	ENSG00000197157	ENST00000354725;ENST00000438400	T	0.62639	0.01	5.02	5.02	0.67125	Staphylococcal nuclease (SNase-like) (1);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.229105	0.44285	D	0.000464	T	0.57770	0.2076	M	0.61703	1.905	0.54753	D	0.999985	B	0.33073	0.396	B	0.20577	0.03	T	0.64158	-0.6473	10	0.72032	D	0.01	-15.8013	15.8344	0.78787	0.0:0.0:1.0:0.0	.	813	Q7KZF4	SND1_HUMAN	T	813;803	ENSP00000346762:A813T	ENSP00000346762:A813T	A	+	1	0	SND1	127516795	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	7.387000	0.79785	2.346000	0.79739	0.549000	0.68633	GCC	SND1	-	superfamily_Staphylococal_nuclease_OB-fold,pirsf_Silence_cplx_Nase-comp_TudorSN	ENSG00000197157		0.587	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SND1	HGNC	protein_coding	OTTHUMT00000349148.1	-	0.00	72	0	G	NM_014390		127729559	+1	tier1	-	no_errors	ENST00000354725	ensembl	human	known	74_37	missense	17.95	32	7	SNP	1.000	A
SPATA31A6	389730	genome.wustl.edu	37	9	43625456	43625456	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:43625456G>T	ENST00000332857.6	-	4	3259	c.3231C>A	c.(3229-3231)agC>agA	p.S1077R	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	1077					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GCACCAGTTTGCTCCTTCTGG	0.532																																																	0													13.0	11.0	12.0					9																	43625456		611	1516	2127	SO:0001583	missense	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.3231C>A	9.37:g.43625456G>T	ENSP00000329825:p.Ser1077Arg			Missense_Mutation	SNP	NULL	p.S1077R	ENST00000332857.6	37	c.3231	CCDS47973.1	9	.	.	.	.	.	.	.	.	.	.	G	5.068	0.198204	0.09652	.	.	ENSG00000185775	ENST00000332857	T	0.04502	3.61	2.44	-4.88	0.03113	.	1.184840	0.06072	N	0.660300	T	0.03520	0.0101	L	0.31526	0.94	0.09310	N	1	B	0.28636	0.218	B	0.33254	0.16	T	0.40059	-0.9583	10	0.34782	T	0.22	.	0.9884	0.01451	0.3696:0.3007:0.1787:0.1511	.	1077	Q5VVP1	F75A6_HUMAN	R	1077	ENSP00000329825:S1077R	ENSP00000329825:S1077R	S	-	3	2	FAM75A6	43565452	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.385000	0.01062	-1.743000	0.01340	-0.559000	0.04183	AGC	SPATA31A6	-	NULL	ENSG00000185775		0.532	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A6	HGNC	protein_coding	OTTHUMT00000036987.1	-	0.00	292	0	G	NM_001145196		43625456	-1	tier1	-	no_errors	ENST00000332857	ensembl	human	known	74_37	missense	16.28	108	21	SNP	0.000	T
SPATA31D1	389763	genome.wustl.edu	37	9	84609276	84609276	+	Silent	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:84609276G>C	ENST00000344803.2	+	4	3938	c.3891G>C	c.(3889-3891)gtG>gtC	p.V1297V		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1297					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGAGTCCTGTGAGACCCAAAG	0.547																																																	0													37.0	38.0	38.0					9																	84609276		1943	4143	6086	SO:0001819	synonymous_variant	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3891G>C	9.37:g.84609276G>C				Silent	SNP	NULL	p.V1297	ENST00000344803.2	37	c.3891	CCDS47986.1	9																																																																																			SPATA31D1	-	NULL	ENSG00000214929		0.547	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1		0.00	75	0	G	NM_001001670		84609276	+1			no_errors	ENST00000344803	ensembl	human	known	74_37	silent	8.00	23	2	SNP	0.000	C
SPG11	80208	genome.wustl.edu	37	15	44952662	44952662	+	Missense_Mutation	SNP	G	G	A	rs312262714		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr15:44952662G>A	ENST00000261866.7	-	2	426	c.410C>T	c.(409-411)gCa>gTa	p.A137V	SPG11_ENST00000427534.2_Missense_Mutation_p.A137V|SPG11_ENST00000558319.1_Missense_Mutation_p.A137V|SPG11_ENST00000559193.1_Missense_Mutation_p.A137V|SPG11_ENST00000535302.2_Missense_Mutation_p.A137V	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	137					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		CTTTTGCAATGCCTCCCTACT	0.353																																																	0													220.0	203.0	209.0					15																	44952662		2198	4298	6496	SO:0001583	missense	0				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.410C>T	15.37:g.44952662G>A	ENSP00000261866:p.Ala137Val		A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	NULL	p.A137V	ENST00000261866.7	37	c.410	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	G	4.402	0.074305	0.08485	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	T;T;T	0.76839	-1.05;-0.79;-0.79	5.85	-0.613	0.11594	.	0.894601	0.09904	N	0.740671	T	0.49133	0.1539	N	0.03608	-0.345	0.09310	N	1	B;B;B;B	0.22211	0.003;0.066;0.023;0.003	B;B;B;B	0.15484	0.003;0.011;0.013;0.003	T	0.38243	-0.9670	10	0.56958	D	0.05	.	1.6494	0.02768	0.3273:0.2191:0.3415:0.1121	.	137;137;137;137	C4B7M2;F5H3N6;B9EK60;Q96JI7	.;.;.;SPTCS_HUMAN	V	137	ENSP00000261866:A137V;ENSP00000445278:A137V;ENSP00000396110:A137V	ENSP00000261866:A137V	A	-	2	0	SPG11	42739954	0.001000	0.12720	0.005000	0.12908	0.091000	0.18340	0.161000	0.16481	-0.096000	0.12329	-0.781000	0.03364	GCA	SPG11	-	NULL	ENSG00000104133		0.353	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	HGNC	protein_coding	OTTHUMT00000253927.1		0.00	56	0	G			44952662	-1			no_errors	ENST00000261866	ensembl	human	known	74_37	missense	13.51	32	5	SNP	0.000	A
SPRED3	399473	genome.wustl.edu	37	19	38882864	38882866	+	In_Frame_Del	DEL	CCT	CCT	-	rs151129136		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	CCT	CCT					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:38882864_38882866delCCT	ENST00000338502.4	+	3	462_464	c.359_361delCCT	c.(358-363)ccctcc>ccc	p.S128del	SPRED3_ENST00000587564.2_3'UTR|SPRED3_ENST00000586301.1_In_Frame_Del_p.S128del|SPRED3_ENST00000587013.1_In_Frame_Del_p.S172del	NM_001042522.2	NP_001035987.1	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	128	Ser-rich.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)	plasma membrane (GO:0005886)				central_nervous_system(2)|large_intestine(1)|lung(5)|skin(1)	9	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TCACTCAccccctcctcctcctc	0.645																																																	0									,	401,4,3395		26,0,349,0,4,1521					,	3.3	0.9		dbSNP_134	44	1035,11,6892		107,0,821,1,9,3031	no	codingComplex,codingComplex	SPRED3	NM_001042522.1,NM_001039616.1	,	133,0,1170,1,13,4552	A1A1,A1A2,A1R,A2A2,A2R,RR		13.1771,10.6579,12.3616	,	,		1436,15,10287				SO:0001651	inframe_deletion	0				CCDS42560.1	19q13	2007-10-05				ENSG00000188766			31041	protein-coding gene	gene with protein product		609293				14618415	Standard	NM_001042522		Approved		uc002oim.4	Q2MJR0		ENST00000338502.4:c.359_361delCCT	19.37:g.38882873_38882875delCCT	ENSP00000345405:p.Ser128del		Q2MJR1	In_Frame_Del	DEL	pfam_Sprouty,pfam_WH1/EVH1,smart_WH1/EVH1,pfscan_WH1/EVH1	p.S124in_frame_del	ENST00000338502.4	37	c.359_361	CCDS42560.1	19																																																																																			SPRED3	-	NULL	ENSG00000188766		0.645	SPRED3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRED3	HGNC	protein_coding	OTTHUMT00000459216.1		0.00	29	0	CCT	XM_351191		38882866	+1	tier1		no_errors	ENST00000338502	ensembl	human	known	74_37	in_frame_del	12.90	27	4	DEL	1.000:0.995:0.997	-
ST7L	54879	genome.wustl.edu	37	1	113159540	113159540	+	Intron	SNP	A	A	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:113159540A>T	ENST00000358039.4	-	2	510				ST7L_ENST00000490067.1_Intron|ST7L_ENST00000463235.1_Intron|ST7L_ENST00000360743.4_Intron|ST7L_ENST00000538187.1_Intron|ST7L_ENST00000369666.1_Intron|ST7L_ENST00000369669.1_Intron|ST7L_ENST00000369668.2_Intron|CAPZA1_ENST00000263168.3_5'Flank|ST7L_ENST00000543570.1_Intron|ST7L_ENST00000544629.1_Intron|ST7L_ENST00000343210.7_Intron	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7 like						negative regulation of cell growth (GO:0030308)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(3)|lung(1)|prostate(2)|stomach(1)|urinary_tract(3)	15	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAAGAATCAAAGTTTTAAAAA	0.308																																																	0													60.0	65.0	63.0					1																	113159540		2203	4299	6502	SO:0001627	intron_variant	0			AB081317	CCDS848.1, CCDS849.1, CCDS850.1, CCDS852.1	1p13.1	2008-06-06			ENSG00000007341	ENSG00000007341			18441	protein-coding gene	gene with protein product						12012006	Standard	NM_138729		Approved	FLJ20284, STLR, ST7R, FAM4B	uc001ecd.3	Q8TDW4	OTTHUMG00000011753	ENST00000358039.4:c.206-23T>A	1.37:g.113159540A>T			A8K4S7|Q49AH6|Q5TEI4|Q5U5K6|Q6N067|Q7Z2Z0|Q7Z3C2|Q8N7P8|Q8TDW1|Q8TDW2|Q8TDW3|Q9NXF3	RNA	SNP	-	NULL	ENST00000358039.4	37	NULL	CCDS848.1	1																																																																																			ST7L	-	-	ENSG00000007341		0.308	ST7L-001	KNOWN	basic|CCDS	protein_coding	ST7L	HGNC	protein_coding	OTTHUMT00000032504.3	-	0.00	72	0	A			113159540	-1	tier1	-	no_errors	ENST00000485753	ensembl	human	known	74_37	rna	35.90	25	14	SNP	0.000	T
SPTA1	6708	genome.wustl.edu	37	1	158584068	158584068	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:158584068G>C	ENST00000368147.4	-	49	6997	c.6817C>G	c.(6817-6819)Cta>Gta	p.L2273V	SPTA1_ENST00000485680.1_5'Flank	NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2273	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.L2273L(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					AATTCCTTTAGAGTCTCTTCA	0.328																																																	1	Substitution - coding silent(1)	lung(1)											79.0	77.0	78.0					1																	158584068		1805	4068	5873	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.6817C>G	1.37:g.158584068G>C	ENSP00000357129:p.Leu2273Val		Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.L2273V	ENST00000368147.4	37	c.6817	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	G	9.983	1.228763	0.22542	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.23147	1.92;1.92	5.53	1.44	0.22558	EF-hand-like domain (1);	.	.	.	.	T	0.30759	0.0775	M	0.83223	2.63	0.09310	N	1	D	0.67145	0.996	P	0.58454	0.839	T	0.09552	-1.0669	9	0.87932	D	0	.	9.5521	0.39317	0.3049:0.0:0.6951:0.0	.	2273	P02549	SPTA1_HUMAN	V	2273;2270	ENSP00000357130:L2273V;ENSP00000357129:L2270V	ENSP00000357129:L2270V	L	-	1	2	SPTA1	156850692	0.994000	0.37717	0.001000	0.08648	0.030000	0.12068	2.584000	0.46102	0.109000	0.17891	0.650000	0.86243	CTA	SPTA1	-	pfscan_EF_hand_dom	ENSG00000163554		0.328	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	-	0.00	82	0	G	NM_003126		158584068	-1	tier1	-	no_errors	ENST00000368147	ensembl	human	known	74_37	missense	24.44	34	11	SNP	0.018	C
SULF1	23213	genome.wustl.edu	37	8	70476244	70476244	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:70476244G>T	ENST00000260128.4	+	5	751	c.34G>T	c.(34-36)Gtc>Ttc	p.V12F	SULF1_ENST00000419716.3_Missense_Mutation_p.V12F|SULF1_ENST00000402687.4_Missense_Mutation_p.V12F|SULF1_ENST00000458141.2_Missense_Mutation_p.V12F	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	12					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			GGTTTTGGCTGTCCTGGGCAC	0.483																																																	0													145.0	128.0	134.0					8																	70476244		2203	4300	6503	SO:0001583	missense	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.34G>T	8.37:g.70476244G>T	ENSP00000260128:p.Val12Phe		Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.V12F	ENST00000260128.4	37	c.34	CCDS6204.1	8	.	.	.	.	.	.	.	.	.	.	G	15.02	2.709275	0.48517	.	.	ENSG00000137573	ENST00000525061;ENST00000458141;ENST00000260128;ENST00000529134;ENST00000402687;ENST00000419716;ENST00000534179;ENST00000528783;ENST00000525999	D;D;T;D;D;T;D	0.99060	-5.38;-5.38;0.62;-5.38;-5.38;0.58;-4.88	5.87	3.06	0.35304	.	0.331378	0.28499	N	0.015135	D	0.97315	0.9122	M	0.62723	1.935	0.28346	N	0.921115	B	0.14438	0.01	B	0.11329	0.006	D	0.94541	0.7745	10	0.66056	D	0.02	.	7.7017	0.28627	0.1344:0.2514:0.6142:0.0	.	12	Q8IWU6	SULF1_HUMAN	F	12	ENSP00000403040:V12F;ENSP00000260128:V12F;ENSP00000432178:V12F;ENSP00000385704:V12F;ENSP00000390315:V12F;ENSP00000436949:V12F;ENSP00000431753:V12F	ENSP00000260128:V12F	V	+	1	0	SULF1	70638798	1.000000	0.71417	0.962000	0.40283	0.996000	0.88848	2.038000	0.41184	0.366000	0.24427	0.650000	0.86243	GTC	SULF1	-	pirsf_Extracellular_sulfatase	ENSG00000137573		0.483	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	-	0.00	70	0	G	NM_015170		70476244	+1	tier1	-	no_errors	ENST00000260128	ensembl	human	known	74_37	missense	12.31	57	8	SNP	0.997	T
SUPT6H	6830	genome.wustl.edu	37	17	27027397	27027397	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:27027397A>C	ENST00000314616.6	+	35	4956	c.4673A>C	c.(4672-4674)aAc>aCc	p.N1558T	SUPT6H_ENST00000347486.4_Missense_Mutation_p.N1558T	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1558					chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					CTGCCTCAGAACATGACTTCA	0.562																																																	0													139.0	124.0	129.0					17																	27027397		2203	4300	6503	SO:0001583	missense	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.4673A>C	17.37:g.27027397A>C	ENSP00000319104:p.Asn1558Thr		A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.N1558T	ENST00000314616.6	37	c.4673	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	A	14.46	2.542165	0.45280	.	.	ENSG00000109111	ENST00000314616	.	.	.	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.56601	0.1996	L	0.59436	1.845	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.53913	-0.8371	9	0.33141	T	0.24	-22.5418	11.5038	0.50454	0.85:0.15:0.0:0.0	.	1558	Q7KZ85	SPT6H_HUMAN	T	1558	.	ENSP00000319104:N1558T	N	+	2	0	SUPT6H	24051524	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.627000	0.90974	1.916000	0.55485	0.528000	0.53228	AAC	SUPT6H	-	pirsf_TF_Spt6	ENSG00000109111		0.562	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2	-	0.00	58	0	A	NM_003170		27027397	+1	tier1	-	no_errors	ENST00000314616	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	C
SVIL	6840	genome.wustl.edu	37	10	29747401	29747401	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:29747401G>C	ENST00000355867.4	-	37	7272	c.6520C>G	c.(6520-6522)Ctg>Gtg	p.L2174V	PTCHD3P1_ENST00000455774.1_RNA|PTCHD3P1_ENST00000445521.1_RNA|SVIL_ENST00000375400.3_Missense_Mutation_p.L1748V|PTCHD3P1_ENST00000438202.1_RNA|PTCHD3P1_ENST00000414457.1_RNA|SVIL_ENST00000375398.2_Missense_Mutation_p.L2174V|SVIL_ENST00000535393.1_Missense_Mutation_p.L1088V|PTCHD3P1_ENST00000423223.1_RNA|PTCHD3P1_ENST00000446807.1_RNA|PTCHD3P1_ENST00000413405.1_RNA|PTCHD3P1_ENST00000430295.1_RNA	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	2174	HP. {ECO:0000255|PROSITE- ProRule:PRU00595}.				cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TCAAGCTTCAGAGGATCGACC	0.582																																																	0													43.0	45.0	44.0					10																	29747401		2203	4299	6502	SO:0001583	missense	0			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.6520C>G	10.37:g.29747401G>C	ENSP00000348128:p.Leu2174Val		D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.L2174V	ENST00000355867.4	37	c.6520	CCDS7164.1	10	.	.	.	.	.	.	.	.	.	.	G	14.18	2.457263	0.43634	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393	T;T;T;T	0.19938	2.11;2.11;2.11;2.11	4.39	3.48	0.39840	Villin headpiece (3);	0.000000	0.85682	D	0.000000	T	0.44074	0.1276	M	0.84511	2.7	0.80722	D	1	D;P;P	0.54772	0.968;0.533;0.737	P;P;B	0.61201	0.885;0.479;0.393	T	0.44620	-0.9316	10	0.59425	D	0.04	-3.6183	9.7855	0.40673	0.168:0.0:0.832:0.0	.	1088;1748;2174	F5H2Q5;O95425-2;O95425	.;.;SVIL_HUMAN	V	1748;2174;2174;1088	ENSP00000364549:L1748V;ENSP00000364547:L2174V;ENSP00000348128:L2174V;ENSP00000445472:L1088V	ENSP00000348128:L2174V	L	-	1	2	SVIL	29787407	1.000000	0.71417	0.698000	0.30274	0.046000	0.14306	5.409000	0.66374	1.059000	0.40554	0.644000	0.83932	CTG	SVIL	-	superfamily_Villin_headpiece,pfscan_Villin_headpiece	ENSG00000197321		0.582	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	HGNC	protein_coding	OTTHUMT00000047395.1		0.00	37	0	G			29747401	-1			no_errors	ENST00000355867	ensembl	human	known	74_37	missense	16.67	10	2	SNP	1.000	C
SYCP2L	221711	genome.wustl.edu	37	6	10887362	10887362	+	Start_Codon_SNP	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:10887362G>T	ENST00000283141.6	+	1	299	c.3G>T	c.(1-3)atG>atT	p.M1I	RP11-637O19.3_ENST00000480294.1_Intron|RP11-637O19.2_ENST00000436249.3_RNA|SYCP2L_ENST00000543878.1_Intron	NM_001040274.2	NP_001035364.2	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	1						nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	36	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			GCCTCGTTATGCAAGCGGTGA	0.692											OREG0017188	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													35.0	44.0	41.0					6																	10887362		1909	4119	6028	SO:0001582	initiator_codon_variant	0			AK128130	CCDS43423.1	6p24.2	2008-11-06	2007-07-02	2007-07-02	ENSG00000153157	ENSG00000153157			21537	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 177"""	C6orf177			Standard	NM_001040274		Approved	dJ62D2.1, NO145	uc003mzo.3	Q5T4T6	OTTHUMG00000014250	ENST00000283141.6:c.3G>T	6.37:g.10887362G>T	ENSP00000283141:p.Met1Ile	668	A6NDS5|Q08GK5|Q6ZRM2|Q96EJ2	Missense_Mutation	SNP	NULL	p.M1I	ENST00000283141.6	37	c.3	CCDS43423.1	6	.	.	.	.	.	.	.	.	.	.	G	10.41	1.343413	0.24339	.	.	ENSG00000153157	ENST00000283141	T	0.16897	2.31	2.71	2.71	0.32032	.	2.076810	0.02627	U	0.103823	T	0.21590	0.0520	.	.	.	0.38278	D	0.942346	D	0.61080	0.989	D	0.70487	0.969	T	0.42749	-0.9433	9	0.22706	T	0.39	0.8434	9.1021	0.36676	0.0:0.0:1.0:0.0	.	1	Q5T4T6	SYC2L_HUMAN	I	1	ENSP00000283141:M1I	ENSP00000283141:M1I	M	+	3	0	SYCP2L	10995348	0.922000	0.31269	0.081000	0.20488	0.497000	0.33675	2.646000	0.46630	1.804000	0.52760	0.563000	0.77884	ATG	SYCP2L	-	NULL	ENSG00000153157		0.692	SYCP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2L	HGNC	protein_coding	OTTHUMT00000039845.3		0.00	116	0	G	NM_194299	Missense_Mutation	10887362	+1			no_errors	ENST00000283141	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.105	T
SYNE1	23345	genome.wustl.edu	37	6	152771897	152771897	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:152771897C>T	ENST00000367255.5	-	27	3859	c.3258G>A	c.(3256-3258)gtG>gtA	p.V1086V	SYNE1_ENST00000367248.3_Silent_p.V1076V|SYNE1_ENST00000423061.1_Silent_p.V1093V|SYNE1_ENST00000448038.1_Silent_p.V1093V|SYNE1_ENST00000367253.4_Silent_p.V1086V|SYNE1_ENST00000265368.4_Silent_p.V1086V|SYNE1_ENST00000413186.2_Silent_p.V1086V|SYNE1_ENST00000341594.5_Silent_p.V1152V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1086					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTGGGAGTTTCACACAGAGTT	0.463										HNSCC(10;0.0054)																																							0													157.0	152.0	154.0					6																	152771897		2203	4300	6503	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.3258G>A	6.37:g.152771897C>T			E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.V1086	ENST00000367255.5	37	c.3258	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom	ENSG00000131018		0.463	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	63	0	C	NM_182961		152771897	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	silent	9.52	38	4	SNP	0.792	T
SYT16	83851	genome.wustl.edu	37	14	62550971	62550971	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:62550971delA	ENST00000430451.2	+	5	1689	c.1492delA	c.(1492-1494)acgfs	p.T498fs		NM_031914.2	NP_114120.2	Q17RD7	SYT16_HUMAN	synaptotagmin XVI	498					exocytosis (GO:0006887)					central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	35				OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)		TACTTCATCCACGCAGTCGCT	0.557																																																	0													111.0	108.0	109.0					14																	62550971		2005	4172	6177	SO:0001589	frameshift_variant	0			BC040924	CCDS45121.1	14q23.2	2014-07-02	2005-07-15	2005-07-15	ENSG00000139973	ENSG00000139973		"""Synaptotagmins"""	23142	protein-coding gene	gene with protein product	"""synaptotagmin XIV-related"", "" chr14 synaptotagmin"""	610950	"""synaptotagmin XIV-like"""	SYT14L		11543631	Standard	NM_031914		Approved	yt14r, CHR14SYT, Strep14	uc001xfu.1	Q17RD7	OTTHUMG00000171106	ENST00000430451.2:c.1492delA	14.37:g.62550971delA	ENSP00000394700:p.Thr498fs		B4DZH2|B7ZL60|C9J8I3|Q707N2|Q7Z441|Q8IUU0|Q9BQR8	Frame_Shift_Del	DEL	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.T498fs	ENST00000430451.2	37	c.1492	CCDS45121.1	14																																																																																			SYT16	-	NULL	ENSG00000139973		0.557	SYT16-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SYT16	HGNC	protein_coding	OTTHUMT00000411700.1		0.00	65	0	A	NM_031914		62550971	+1	tier1		no_errors	ENST00000430451	ensembl	human	novel	74_37	frame_shift_del	11.76	15	2	DEL	1.000	-
SYT5	6861	genome.wustl.edu	37	19	55686690	55686690	+	Silent	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:55686690C>A	ENST00000354308.3	-	6	927	c.558G>T	c.(556-558)ctG>ctT	p.L186L	SYT5_ENST00000590851.1_Silent_p.L183L|SYT5_ENST00000537500.1_Silent_p.L186L|CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000592935.1_5'Flank	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	186	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		CCCTGCCCCCCAGCTCCACGT	0.612																																																	0													35.0	30.0	32.0					19																	55686690		2202	4300	6502	SO:0001819	synonymous_variant	0			X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.558G>T	19.37:g.55686690C>A			B3KWJ8|B7Z300|Q86X72	Silent	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin,prints_C2_dom	p.L186	ENST00000354308.3	37	c.558	CCDS12919.1	19																																																																																			SYT5	-	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom,prints_Synaptotagmin	ENSG00000129990		0.612	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT5	HGNC	protein_coding	OTTHUMT00000452501.1	-	0.00	50	0	C	NM_003180		55686690	-1	tier1	-	no_errors	ENST00000354308	ensembl	human	known	74_37	silent	17.95	31	7	SNP	1.000	A
TCEB3CL2	100506888	genome.wustl.edu	37	18	44543396	44543396	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr18:44543396A>G	ENST00000591973.2	-	1	1211	c.976T>C	c.(976-978)Tcc>Ccc	p.S326P	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000356157.7_Intron	NM_001242907.1	NP_001229836.1	A6NLF2	EA3L2_HUMAN	transcription elongation factor B polypeptide 3C-like 2	326	Activation domain. {ECO:0000250}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)										GCAGGCCTGGAGCCCGAGTAC	0.667																																																	0													1.0	1.0	1.0					18																	44543396		95	441	536	SO:0001583	missense	0				CCDS59316.1	18q21.1	2012-10-25			ENSG00000266996	ENSG00000274744			33511	protein-coding gene	gene with protein product							Standard	NM_001242907		Approved		uc021ujk.1	A6NLF2	OTTHUMG00000180382	ENST00000591973.2:c.976T>C	18.37:g.44543396A>G	ENSP00000468046:p.Ser326Pro			Missense_Mutation	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.S326P	ENST00000591973.2	37	c.976	CCDS59316.1	18																																																																																			TCEB3CL2	-	NULL	ENSG00000266996		0.667	TCEB3CL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3CL2	HGNC	protein_coding	OTTHUMT00000451070.1	-	0.00	56	0	A	XM_929328		44543396	-1	tier1	-	no_errors	ENST00000591973	ensembl	human	known	74_37	missense	20.69	23	6	SNP	0.007	G
TCOF1	6949	genome.wustl.edu	37	5	149776309	149776309	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:149776309G>A	ENST00000504761.2	+	24	4246	c.4246G>A	c.(4246-4248)Gag>Aag	p.E1416K	TCOF1_ENST00000451292.1_Missense_Mutation_p.E1453K|TCOF1_ENST00000439160.2_Missense_Mutation_p.E1379K|TCOF1_ENST00000445265.2_Missense_Mutation_p.E1340K|TCOF1_ENST00000323668.7_Missense_Mutation_p.E1339K|TCOF1_ENST00000513346.1_Missense_Mutation_p.E1416K|TCOF1_ENST00000377797.3_Missense_Mutation_p.E1417K			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	1416					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGCCAAGGACGAGCCAGAAGA	0.522																																																	0													21.0	19.0	20.0					5																	149776309		2202	4298	6500	SO:0001583	missense	0				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.4246G>A	5.37:g.149776309G>A	ENSP00000421655:p.Glu1416Lys		A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	pfam_TCS_treacle,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_Treacle-like_TCS	p.E1453K	ENST00000504761.2	37	c.4357	CCDS54936.1	5	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.617562	0.00828	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000427724;ENST00000504761;ENST00000513346;ENST00000515516	T;T;T;T;T;T;T;T;D	0.81821	-0.06;-0.05;-0.04;-0.04;-0.05;-0.04;-0.06;-0.04;-1.54	4.42	3.14	0.36123	.	0.161847	0.29616	N	0.011652	T	0.36331	0.0963	N	0.00112	-2.095	0.21416	N	0.999699	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.50171	-0.8859	10	0.02654	T	1	-16.2449	6.8393	0.23953	0.8889:0.0:0.1111:0.0	.	1379;1339;1378;1416;1340	Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8	.;.;.;TCOF_HUMAN;.	K	1453;1417;1340;1339;1379;1378;1416;1416;116	ENSP00000400939:E1453K;ENSP00000367028:E1417K;ENSP00000409944:E1340K;ENSP00000325223:E1339K;ENSP00000406888:E1379K;ENSP00000390717:E1378K;ENSP00000421655:E1416K;ENSP00000427484:E1416K;ENSP00000426471:E116K	ENSP00000325223:E1339K	E	+	1	0	TCOF1	149756502	0.364000	0.24997	0.891000	0.34965	0.070000	0.16714	2.085000	0.41634	0.646000	0.30693	-0.459000	0.05422	GAG	TCOF1	-	NULL	ENSG00000070814		0.522	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCOF1	HGNC	protein_coding	OTTHUMT00000380552.1		0.00	102	0	G	NM_001008656		149776309	+1			no_errors	ENST00000451292	ensembl	human	known	74_37	missense	5.00	37	2	SNP	0.958	A
TCTN3	26123	genome.wustl.edu	37	10	97453624	97453624	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:97453624C>T	ENST00000371217.5	-	1	56	c.33G>A	c.(31-33)gtG>gtA	p.V11V	TCTN3_ENST00000371209.5_Silent_p.V11V|TCTN3_ENST00000430368.2_Silent_p.V11V|TCTN3_ENST00000265993.9_Silent_p.V29V			Q6NUS6	TECT3_HUMAN	tectonic family member 3	11					apoptotic process (GO:0006915)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(3)|endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		CCAGAAAGAACACTTGCAGGA	0.667											OREG0020392	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													29.0	38.0	35.0					10																	97453624		692	1591	2283	SO:0001819	synonymous_variant	0			AK098295	CCDS31258.2, CCDS44461.1	10q24.1	2014-01-28	2007-08-20	2007-08-20	ENSG00000119977	ENSG00000119977		"""Tectonic proteins"""	24519	protein-coding gene	gene with protein product		613847	"""chromosome 10 open reading frame 61"""	C10orf61		12975309	Standard	NM_015631		Approved	DKFZP564D116, TECT3, JBTS18	uc001klb.4	Q6NUS6	OTTHUMG00000018814	ENST00000371217.5:c.33G>A	10.37:g.97453624C>T		1328	A6NIC8|B0QZ90|B4DR81|Q6P7P3|Q6UW27|Q6ZQQ0|Q8N7K1|Q8NBQ0|Q96GF7|Q9Y3U1	Silent	SNP	pfam_DUF1619	p.V11	ENST00000371217.5	37	c.33	CCDS31258.2	10																																																																																			TCTN3	-	NULL	ENSG00000119977		0.667	TCTN3-009	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	TCTN3	HGNC	protein_coding	OTTHUMT00000471858.1	-	0.00	71	0	C	NM_015631		97453624	-1	tier1	-	no_errors	ENST00000371217	ensembl	human	known	74_37	silent	25.71	24	9	SNP	0.936	T
TENM3	55714	genome.wustl.edu	37	4	183694653	183694653	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr4:183694653G>A	ENST00000511685.1	+	23	5044	c.4921G>A	c.(4921-4923)Gtt>Att	p.V1641I	TENM3_ENST00000406950.2_Missense_Mutation_p.V1641I|RP11-18D7.2_ENST00000513255.1_RNA			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	1641					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TCTGACAAATGTTACGTTTCC	0.413																																																	0													168.0	158.0	161.0					4																	183694653		1996	4179	6175	SO:0001583	missense	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.4921G>A	4.37:g.183694653G>A	ENSP00000424226:p.Val1641Ile		Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c-like_dom,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.V1641I	ENST00000511685.1	37	c.4921	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458881	0.63401	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	T;T	0.16897	2.31;2.31	5.26	5.26	0.73747	.	.	.	.	.	T	0.41190	0.1148	M	0.77313	2.365	0.80722	D	1	P	0.44690	0.841	P	0.55824	0.785	T	0.10800	-1.0614	9	0.48119	T	0.1	.	19.0748	0.93156	0.0:0.0:1.0:0.0	.	1641	Q9P273	TEN3_HUMAN	I	1641	ENSP00000424226:V1641I;ENSP00000385276:V1641I	ENSP00000385276:V1641I	V	+	1	0	ODZ3	183931647	1.000000	0.71417	0.411000	0.26484	0.214000	0.24535	9.263000	0.95617	2.733000	0.93635	0.655000	0.94253	GTT	TENM3	-	tigrfam_YD	ENSG00000218336		0.413	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM3	HGNC	protein_coding	OTTHUMT00000361734.1	-	0.00	79	0	G			183694653	+1	tier1	-	no_errors	ENST00000406950	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	A
TFR2	7036	genome.wustl.edu	37	7	100238621	100238621	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:100238621C>T	ENST00000462107.1	-	3	551	c.264G>A	c.(262-264)acG>acA	p.T88T	TFR2_ENST00000223051.3_Silent_p.T88T|TFR2_ENST00000431692.1_Silent_p.T88T			Q9UP52	TFR2_HUMAN	transferrin receptor 2	88					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transferrin receptor activity (GO:0004998)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(1)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)				Gallium nitrate(DB05260)	TCAGCAGGGCCGTCAGGACCA	0.657																																																	0													21.0	24.0	23.0					7																	100238621		2199	4298	6497	SO:0001819	synonymous_variant	0			AF053356	CCDS34707.1	7q22	2003-01-27			ENSG00000106327	ENSG00000106327			11762	protein-coding gene	gene with protein product		604720				9799793, 12130528	Standard	NM_003227		Approved	HFE3, TFRC2	uc003uvv.1	Q9UP52	OTTHUMG00000159598	ENST00000462107.1:c.264G>A	7.37:g.100238621C>T			A6NGM7|O75422|Q1HE13|Q9HA99|Q9NX67	Silent	SNP	pfam_TFR-like_dimer_dom,pfam_Peptidase_M28,pfam_Protease-assoc_domain,superfamily_TFR-like_dimer_dom	p.T88	ENST00000462107.1	37	c.264	CCDS34707.1	7																																																																																			TFR2	-	NULL	ENSG00000106327		0.657	TFR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFR2	HGNC	protein_coding	OTTHUMT00000356392.3	-	0.00	64	0	C	NM_003227		100238621	-1	tier1	-	no_errors	ENST00000223051	ensembl	human	known	74_37	silent	10.91	49	6	SNP	0.000	T
THBS4	7060	genome.wustl.edu	37	5	79351798	79351798	+	Silent	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:79351798T>C	ENST00000350881.2	+	3	673	c.483T>C	c.(481-483)gcT>gcC	p.A161A	THBS4_ENST00000511733.1_Silent_p.A70A|CTD-2201I18.1_ENST00000503007.1_RNA	NM_003248.4	NP_003239.2	P35443	TSP4_HUMAN	thrombospondin 4	161	Laminin G-like.				behavioral response to pain (GO:0048266)|endothelial cell-cell adhesion (GO:0071603)|myoblast migration (GO:0051451)|negative regulation of angiogenesis (GO:0016525)|positive regulation of cell division (GO:0051781)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of tissue remodeling (GO:0034103)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)|tissue remodeling (GO:0048771)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|stomach(3)	34		Lung NSC(167;0.00328)|all_lung(232;0.00355)|Ovarian(174;0.0261)		OV - Ovarian serous cystadenocarcinoma(54;6.3e-45)|Epithelial(54;1.77e-39)|all cancers(79;3.2e-34)		GGGCCTTTGCTGGCCCCTCCC	0.547																																																	0													35.0	40.0	39.0					5																	79351798		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4049.1	5q13	2008-05-15			ENSG00000113296	ENSG00000113296			11788	protein-coding gene	gene with protein product		600715				7852353	Standard	NM_003248		Approved		uc021yaw.1	P35443	OTTHUMG00000108173	ENST00000350881.2:c.483T>C	5.37:g.79351798T>C			B2R909|Q86TG2	Silent	SNP	pfam_Thrombospondin_C,pfam_Thbs/COMP_coiled-coil,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom	p.A161	ENST00000350881.2	37	c.483	CCDS4049.1	5																																																																																			THBS4	-	superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	ENSG00000113296		0.547	THBS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS4	HGNC	protein_coding	OTTHUMT00000226977.1	-	0.00	26	0	T			79351798	+1	tier1	-	no_errors	ENST00000350881	ensembl	human	known	74_37	silent	21.43	11	3	SNP	0.939	C
THRA	7067	genome.wustl.edu	37	17	38241009	38241009	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:38241009G>A	ENST00000264637.4	+	6	1097	c.517G>A	c.(517-519)Gag>Aag	p.E173K	THRA_ENST00000450525.2_Missense_Mutation_p.E173K|THRA_ENST00000394121.4_Missense_Mutation_p.E173K|THRA_ENST00000584985.1_Missense_Mutation_p.E173K|THRA_ENST00000546243.1_Missense_Mutation_p.E173K	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	173					cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CATTGCCACAGAGGCCCATCG	0.607																																																	0													83.0	82.0	83.0					17																	38241009		2203	4300	6503	SO:0001583	missense	0			J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.517G>A	17.37:g.38241009G>A	ENSP00000264637:p.Glu173Lys		A8K3B5|P21205|Q8N6A1|Q96H73	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.E173K	ENST00000264637.4	37	c.517	CCDS11360.1	17	.	.	.	.	.	.	.	.	.	.	G	16.33	3.092923	0.56075	.	.	ENSG00000126351	ENST00000394121;ENST00000264637;ENST00000450525;ENST00000546243	D;D;D;D	0.93488	-3.08;-3.08;-3.23;-3.23	4.48	4.48	0.54585	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.92090	0.7493	M	0.81802	2.56	0.80722	D	1	B;B;B	0.19331	0.022;0.035;0.0	B;B;B	0.16722	0.016;0.012;0.001	D	0.88751	0.3250	10	0.07175	T	0.84	.	16.9662	0.86286	0.0:0.0:1.0:0.0	.	173;173;173	P10827-3;P10827;Q6FH41	.;THA_HUMAN;.	K	173	ENSP00000377679:E173K;ENSP00000264637:E173K;ENSP00000395641:E173K;ENSP00000443972:E173K	ENSP00000264637:E173K	E	+	1	0	THRA	35494535	1.000000	0.71417	0.987000	0.45799	0.986000	0.74619	9.631000	0.98424	2.310000	0.77875	0.436000	0.28706	GAG	THRA	-	superfamily_Nucl_hormone_rcpt_ligand-bd,prints_ThyrH_rcpt	ENSG00000126351		0.607	THRA-001	KNOWN	basic|CCDS	protein_coding	THRA	HGNC	protein_coding	OTTHUMT00000257160.2	-	0.00	34	0	G			38241009	+1	tier1	-	no_errors	ENST00000264637	ensembl	human	known	74_37	missense	29.63	57	24	SNP	1.000	A
TIMELESS	8914	genome.wustl.edu	37	12	56815246	56815246	+	Silent	SNP	T	T	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:56815246T>C	ENST00000553532.1	-	23	2907	c.2757A>G	c.(2755-2757)acA>acG	p.T919T	TIMELESS_ENST00000229201.4_Silent_p.T918T|TIMELESS_ENST00000554616.1_Silent_p.T416T					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						AGCGTTTGGCTGTGATATTCT	0.473																																																	0													137.0	138.0	138.0					12																	56815246		2203	4300	6503	SO:0001819	synonymous_variant	0			AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.2757A>G	12.37:g.56815246T>C				Silent	SNP	pfam_TIMELESS_C,pfam_Timeless	p.T919	ENST00000553532.1	37	c.2757	CCDS8918.1	12																																																																																			TIMELESS	-	pfam_TIMELESS_C	ENSG00000111602		0.473	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TIMELESS	HGNC	protein_coding	OTTHUMT00000409771.1	-	0.00	32	0	T	NM_003920		56815246	-1	tier1	-	no_errors	ENST00000553532	ensembl	human	known	74_37	silent	26.67	11	4	SNP	0.997	C
TMPRSS15	5651	genome.wustl.edu	37	21	19685373	19685373	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr21:19685373G>A	ENST00000284885.3	-	18	2087	c.2054C>T	c.(2053-2055)aCg>aTg	p.T685M		NM_002772.2	NP_002763	P98073	ENTK_HUMAN	transmembrane protease, serine 15	685	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.					brush border (GO:0005903)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(7)|large_intestine(19)|lung(36)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	85						ATTGTTGTTCGTtgtgccatt	0.443																																																	0													130.0	114.0	120.0					21																	19685373		2203	4300	6503	SO:0001583	missense	0				CCDS13571.1	21q21	2010-12-09	2010-04-21	2010-04-21	ENSG00000154646	ENSG00000154646		"""Serine peptidases / Transmembrane"""	9490	protein-coding gene	gene with protein product	"""proenterokinase"", ""enteropeptidase"""	606635	"""protease, serine, 7 (enterokinase)"""	PRSS7		8052624	Standard	NM_002772		Approved	ENTK, MGC133046	uc002ykw.3	P98073	OTTHUMG00000074518	ENST00000284885.3:c.2054C>T	21.37:g.19685373G>A	ENSP00000284885:p.Thr685Met		Q2NKL7	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_CUB_dom,pfam_MAM_dom,pfam_SEA_dom,pfam_LDrepeatLR_classA_rpt,pfam_Peptidase_S1A_nudel,pfam_SRCR,superfamily_Trypsin-like_Pept_dom,superfamily_ConA-like_lec_gl_sf,superfamily_CUB_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_SEA_dom,smart_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_MAM_dom,smart_Srcr_rcpt-rel,smart_Peptidase_S1,pfscan_CUB_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom,pfscan_SEA_dom,pfscan_SRCR,pfscan_Peptidase_S1,prints_Peptidase_S1A,prints_LDrepeatLR_classA_rpt	p.T685M	ENST00000284885.3	37	c.2054	CCDS13571.1	21	.	.	.	.	.	.	.	.	.	.	g	0.063	-1.218729	0.01542	.	.	ENSG00000154646	ENST00000284885	T	0.30182	1.54	5.71	-11.4	0.00090	Speract/scavenger receptor (2);Speract/scavenger receptor-related (2);	1.755870	0.02854	N	0.129460	T	0.12347	0.0300	N	0.15975	0.35	0.09310	N	1	B	0.16603	0.018	B	0.12837	0.008	T	0.14090	-1.0485	9	.	.	.	.	2.6936	0.05127	0.5408:0.1996:0.0686:0.191	.	685	P98073	ENTK_HUMAN	M	685	ENSP00000284885:T685M	.	T	-	2	0	TMPRSS15	18607244	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-3.937000	0.00330	-4.286000	0.00059	-2.029000	0.00425	ACG	TMPRSS15	-	pfam_SRCR,superfamily_LDrepeatLR_classA_rpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_SRCR	ENSG00000154646		0.443	TMPRSS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS15	HGNC	protein_coding	OTTHUMT00000158231.2	-	0.00	62	0	G	NM_002772		19685373	-1	tier1	-	no_errors	ENST00000284885	ensembl	human	known	74_37	missense	20.69	23	6	SNP	0.000	A
TNFAIP6	7130	genome.wustl.edu	37	2	152214210	152214210	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:152214210G>T	ENST00000243347.3	+	1	105	c.30G>T	c.(28-30)ttG>ttT	p.L10F		NM_007115.3	NP_009046.2	P98066	TSG6_HUMAN	tumor necrosis factor, alpha-induced protein 6	10					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)		hyaluronic acid binding (GO:0005540)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.131)	Hyaluronan(DB08818)	TATTTCTCTTGCTATGGGAAG	0.408																																																	0													157.0	150.0	153.0					2																	152214210		2203	4300	6503	SO:0001583	missense	0				CCDS2193.1	2q23.3	2008-11-18			ENSG00000123610	ENSG00000123610			11898	protein-coding gene	gene with protein product		600410				1730767, 8568267, 15060082	Standard	NM_007115		Approved	TSG6, TSG-6	uc002txk.3	P98066	OTTHUMG00000131884	ENST00000243347.3:c.30G>T	2.37:g.152214210G>T	ENSP00000243347:p.Leu10Phe		Q53TI7|Q8WWI9	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Link,superfamily_CUB_dom,superfamily_C-type_lectin_fold,smart_Link,smart_CUB_dom,pfscan_CUB_dom,pfscan_Link,prints_Link	p.L10F	ENST00000243347.3	37	c.30	CCDS2193.1	2	.	.	.	.	.	.	.	.	.	.	G	11.60	1.687487	0.29962	.	.	ENSG00000123610	ENST00000243347	T	0.19806	2.12	5.71	4.74	0.60224	.	0.312543	0.30791	N	0.008873	T	0.13798	0.0334	N	0.17082	0.46	0.35564	D	0.804963	B	0.02656	0.0	B	0.01281	0.0	T	0.11591	-1.0581	10	0.25106	T	0.35	.	13.9598	0.64172	0.0795:0.0:0.9205:0.0	.	10	P98066	TSG6_HUMAN	F	10	ENSP00000243347:L10F	ENSP00000243347:L10F	L	+	3	2	TNFAIP6	151922456	1.000000	0.71417	0.999000	0.59377	0.516000	0.34256	2.292000	0.43549	1.247000	0.43917	0.650000	0.86243	TTG	TNFAIP6	-	NULL	ENSG00000123610		0.408	TNFAIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP6	HGNC	protein_coding	OTTHUMT00000254834.2		0.00	75	0	G	NM_007115		152214210	+1			no_errors	ENST00000243347	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7578406	7578406	+	Missense_Mutation	SNP	C	C	T	rs28934578		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:7578406C>T	ENST00000269305.4	-	5	713	c.524G>A	c.(523-525)cGc>cAc	p.R175H	TP53_ENST00000574684.1_5'UTR|TP53_ENST00000455263.2_Missense_Mutation_p.R175H|TP53_ENST00000445888.2_Missense_Mutation_p.R175H|TP53_ENST00000413465.2_Missense_Mutation_p.R175H|TP53_ENST00000420246.2_Missense_Mutation_p.R175H|TP53_ENST00000359597.4_Missense_Mutation_p.R175H	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	175	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; reduces interaction with ZNF385A; dbSNP:rs28934578). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:8825920}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R175H(847)|p.R43H(36)|p.R82H(36)|p.R175L(19)|p.0?(8)|p.R175P(6)|p.R174fs*24(3)|p.R175_E180delRCPHHE(3)|p.V173fs*59(2)|p.R174fs*1(2)|p.V157_C176del20(1)|p.V173fs*69(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R174_H178>S(1)|p.V172_E180delVVRRCPHHE(1)|p.R174_H179delRRCPHH(1)|p.E171fs*1(1)|p.R175_H178>X(1)|p.R175fs*5(1)|p.R42fs*24(1)|p.R174_C176delRRC(1)|p.H168fs*69(1)|p.R174fs*70(1)|p.E171_H179delEVVRRCPHH(1)|p.R81fs*24(1)|p.R174_E180>K(1)|p.R174fs*3(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GTGGGGGCAGCGCCTCACAAC	0.652	R175H(AU565_BREAST)|R175H(CAL33_UPPER_AERODIGESTIVE_TRACT)|R175H(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|R175H(HCC1395_BREAST)|R175H(HUCCT1_BILIARY_TRACT)|R175H(KLE_ENDOMETRIUM)|R175H(KMS26_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R175H(LS123_LARGE_INTESTINE)|R175H(NCIH196_LUNG)|R175H(RKN_OVARY)|R175H(SKBR3_BREAST)|R175H(SKUT1_SOFT_TISSUE)|R175H(TYKNU_OVARY)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	980	Substitution - Missense(944)|Deletion - Frameshift(17)|Whole gene deletion(8)|Deletion - In frame(8)|Complex - deletion inframe(3)	large_intestine(350)|breast(103)|upper_aerodigestive_tract(74)|stomach(70)|central_nervous_system(69)|oesophagus(67)|ovary(58)|lung(40)|haematopoietic_and_lymphoid_tissue(39)|urinary_tract(22)|prostate(17)|liver(14)|pancreas(11)|endometrium(10)|biliary_tract(10)|bone(9)|kidney(4)|cervix(4)|skin(3)|vulva(2)|soft_tissue(2)|penis(1)|adrenal_gland(1)	GRCh37	CM062017|CM951224	TP53	M	rs28934578						50.0	50.0	50.0					17																	7578406		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.524G>A	17.37:g.7578406C>T	ENSP00000269305:p.Arg175His		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R175H	ENST00000269305.4	37	c.524	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.079737	0.94050	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99889	-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55;-7.55	5.41	5.41	0.78517	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.101149	0.64402	D	0.000008	D	0.99908	0.9956	M	0.92784	3.345	0.80722	A	1	D;P;D;D;P;B;D	0.89917	0.999;0.578;1.0;0.998;0.632;0.213;0.999	D;B;D;D;B;B;D	0.91635	0.985;0.26;0.999;0.921;0.378;0.144;0.939	D	0.96278	0.9204	9	0.87932	D	0	-11.8679	17.0767	0.86588	0.0:1.0:0.0:0.0	rs28934578	136;175;175;82;175;175;175	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	H	175;175;175;175;175;175;164;82;43;82;43	ENSP00000410739:R175H;ENSP00000352610:R175H;ENSP00000269305:R175H;ENSP00000398846:R175H;ENSP00000391127:R175H;ENSP00000391478:R175H;ENSP00000425104:R43H;ENSP00000423862:R82H	ENSP00000269305:R175H	R	-	2	0	TP53	7519131	1.000000	0.71417	0.989000	0.46669	0.795000	0.44927	6.042000	0.70996	2.702000	0.92279	0.655000	0.94253	CGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	44	0	C	NM_000546		7578406	-1	tier1	rs28934578	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	44.83	16	13	SNP	1.000	T
TOP3A	7156	genome.wustl.edu	37	17	18181536	18181536	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:18181536G>A	ENST00000321105.5	-	18	2494	c.2280C>T	c.(2278-2280)agC>agT	p.S760S	TOP3A_ENST00000540524.1_Silent_p.S290S|TOP3A_ENST00000542570.1_Silent_p.S665S	NM_004618.3	NP_004609.1	Q13472	TOP3A_HUMAN	topoisomerase (DNA) III alpha	760					DNA topological change (GO:0006265)|meiotic nuclear division (GO:0007126)	chromosome (GO:0005694)|nucleus (GO:0005634)|PML body (GO:0016605)	DNA binding (GO:0003677)|DNA topoisomerase type I activity (GO:0003917)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|skin(6)|stomach(2)|urinary_tract(1)	36						CAGAGGGCTGGCTAGCCCTGG	0.627																																																	0													37.0	45.0	42.0					17																	18181536		2203	4300	6503	SO:0001819	synonymous_variant	0			U43431	CCDS11194.1	17p12-p11.2	2014-02-18			ENSG00000177302	ENSG00000177302			11992	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 7"""	601243		TOP3		9450867	Standard	NM_004618		Approved	ZGRF7	uc002gsx.1	Q13472	OTTHUMG00000059391	ENST00000321105.5:c.2280C>T	17.37:g.18181536G>A			A8KA61|B4DK80|D3DXC7|Q13473	Silent	SNP	pfam_Topo_IA_cen,pfam_Znf_GRF,pfam_Toprim_domain,pfam_Topo_IA_Znf,superfamily_Topo_IA_core_domain,superfamily_Znf_CCHC,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_DNA-bd,prints_Topo_IA	p.S760	ENST00000321105.5	37	c.2280	CCDS11194.1	17																																																																																			TOP3A	-	NULL	ENSG00000177302		0.627	TOP3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOP3A	HGNC	protein_coding	OTTHUMT00000132052.2		0.00	77	0	G			18181536	-1			no_errors	ENST00000321105	ensembl	human	known	74_37	silent	8.89	41	4	SNP	0.989	A
TRDMT1	1787	genome.wustl.edu	37	10	17195487	17195487	+	Intron	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:17195487C>T	ENST00000377799.3	-	10	1123				TRDMT1_ENST00000358282.7_Intron|TRDMT1_ENST00000377766.5_Intron|TRDMT1_ENST00000452380.2_Intron|TRDMT1_ENST00000351358.4_Intron|TRDMT1_ENST00000457442.2_Intron|TRDMT1_ENST00000488990.1_Missense_Mutation_p.R242K|TRDMT1_ENST00000412821.3_Intron	NM_004412.5	NP_004403.1	O14717	TRDMT_HUMAN	tRNA aspartic acid methyltransferase 1						C-5 methylation of cytosine (GO:0090116)|response to amphetamine (GO:0001975)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|tRNA methyltransferase activity (GO:0008175)			breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	18					Pentamidine(DB00738)	AAGCTGAATTCTGCACGTATC	0.378																																																	0													88.0	83.0	85.0					10																	17195487		2203	4300	6503	SO:0001627	intron_variant	0			AJ223333	CCDS7114.1	10p15.1	2006-10-23	2006-10-23	2006-10-23	ENSG00000107614	ENSG00000107614	2.1.1.37		2977	protein-coding gene	gene with protein product		602478	"""DNA (cytosine-5-)-methyltransferase 2"""	DNMT2		9425235, 9763678, 16424344	Standard	NM_004412		Approved	RNMT1	uc001iop.3	O14717	OTTHUMG00000017745	ENST00000377799.3:c.1075+18G>A	10.37:g.17195487C>T			B0YJ02|B0YJ03|B0YJ07|B0YJ08|O43669|Q86WW6	Missense_Mutation	SNP	pfam_C5_MeTfrase	p.R242K	ENST00000377799.3	37	c.725	CCDS7114.1	10	.	.	.	.	.	.	.	.	.	.	C	10.40	1.339409	0.24339	.	.	ENSG00000107614	ENST00000488990	.	.	.	4.44	1.6	0.23607	.	.	.	.	.	T	0.27313	0.0670	.	.	.	0.09310	N	1	B	0.23185	0.081	B	0.17722	0.019	T	0.20075	-1.0286	7	0.49607	T	0.09	.	4.9189	0.13860	0.1429:0.5392:0.0:0.3179	.	242	B7Z8H2	.	K	242	.	ENSP00000419625:R242K	R	-	2	0	TRDMT1	17235493	0.000000	0.05858	0.001000	0.08648	0.077000	0.17291	-0.208000	0.09371	0.384000	0.24942	0.585000	0.79938	AGA	TRDMT1	-	NULL	ENSG00000107614		0.378	TRDMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRDMT1	HGNC	protein_coding	OTTHUMT00000047024.3	-	0.00	90	0	C	NM_004412		17195487	-1	tier1	-	no_errors	ENST00000488990	ensembl	human	putative	74_37	missense	24.00	38	12	SNP	0.000	T
TRIM8	81603	genome.wustl.edu	37	10	104416539	104416539	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:104416539G>A	ENST00000302424.7	+	6	1206	c.1084G>A	c.(1084-1086)Gtc>Atc	p.V362I	TRIM8_ENST00000487927.1_3'UTR	NM_030912.2	NP_112174.2	Q9BZR9	TRIM8_HUMAN	tripartite motif containing 8	362					innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|PML body (GO:0016605)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Colorectal(252;0.122)		Epithelial(162;3.93e-09)|all cancers(201;1.02e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CCTGCAGAGTGTCCCCCTGTA	0.647																																																	0													88.0	90.0	89.0					10																	104416539		2203	4300	6503	SO:0001583	missense	0			AF281046	CCDS31274.1	10q24.3	2013-01-09	2011-01-25	2002-06-14	ENSG00000171206	ENSG00000171206		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15579	protein-coding gene	gene with protein product	"""glioblastoma expressed ring finger protein"""	606125	"""ring finger protein 27"", ""tripartite motif-containing 8"""	RNF27		11118312, 12163497	Standard	NM_030912		Approved	GERP	uc001kvz.2	Q9BZR9	OTTHUMG00000018964	ENST00000302424.7:c.1084G>A	10.37:g.104416539G>A	ENSP00000302120:p.Val362Ile		A6NI31|Q9C028	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.V362I	ENST00000302424.7	37	c.1084	CCDS31274.1	10	.	.	.	.	.	.	.	.	.	.	G	6.744	0.506054	0.12883	.	.	ENSG00000171206	ENST00000302424;ENST00000369896	T	0.78003	-1.14	5.31	3.45	0.39498	.	0.233891	0.38897	N	0.001529	T	0.45955	0.1368	N	0.03608	-0.345	0.33875	D	0.635392	B	0.06786	0.001	B	0.04013	0.001	T	0.49163	-0.8968	10	0.02654	T	1	.	5.0512	0.14508	0.4085:0.0:0.5915:0.0	.	362	Q9BZR9	TRIM8_HUMAN	I	362;361	ENSP00000302120:V362I	ENSP00000302120:V362I	V	+	1	0	TRIM8	104406529	1.000000	0.71417	0.997000	0.53966	0.959000	0.62525	3.093000	0.50217	1.245000	0.43885	0.491000	0.48974	GTC	TRIM8	-	NULL	ENSG00000171206		0.647	TRIM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM8	HGNC	protein_coding	OTTHUMT00000050084.3	-	0.00	48	0	G	NM_030912		104416539	+1	tier1	-	no_errors	ENST00000302424	ensembl	human	known	74_37	missense	22.22	28	8	SNP	0.958	A
TRIOBP	11078	genome.wustl.edu	37	22	38120335	38120335	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr22:38120335A>G	ENST00000406386.3	+	7	2027	c.1772A>G	c.(1771-1773)aAt>aGt	p.N591S		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	591					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)	p.N591S(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					TCCTCTCCCAATAGAGCTACA	0.577																																																	1	Substitution - Missense(1)	skin(1)											119.0	176.0	158.0					22																	38120335		1965	4179	6144	SO:0001583	missense	0			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.1772A>G	22.37:g.38120335A>G	ENSP00000384312:p.Asn591Ser		B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.N591S	ENST00000406386.3	37	c.1772	CCDS43015.1	22	.	.	.	.	.	.	.	.	.	.	-	1.813	-0.474278	0.04414	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.18960	2.18	2.74	-1.14	0.09741	.	.	.	.	.	T	0.10723	0.0262	L	0.34521	1.04	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.40515	-0.9559	9	0.09084	T	0.74	.	2.6614	0.05028	0.4721:0.0:0.1285:0.3994	.	591	Q9H2D6	TARA_HUMAN	S	591	ENSP00000384312:N591S	ENSP00000384312:N591S	N	+	2	0	TRIOBP	36450281	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.442000	0.06871	-0.530000	0.06349	-2.173000	0.00322	AAT	TRIOBP	-	NULL	ENSG00000100106		0.577	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2		0.00	364	0	A			38120335	+1			no_errors	ENST00000406386	ensembl	human	known	74_37	missense	5.30	125	7	SNP	0.002	G
TRIP12	9320	genome.wustl.edu	37	2	230678737	230678737	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:230678737G>A	ENST00000283943.5	-	12	1869	c.1691C>T	c.(1690-1692)gCa>gTa	p.A564V	TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Missense_Mutation_p.A612V|TRIP12_ENST00000389045.3_Missense_Mutation_p.A267V	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	564					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CAAGCAGTCTGCCAAACCACC	0.343																																																	0													47.0	47.0	47.0					2																	230678737		2203	4300	6503	SO:0001583	missense	0			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1691C>T	2.37:g.230678737G>A	ENSP00000283943:p.Ala564Val		D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.A564V	ENST00000283943.5	37	c.1691	CCDS33391.1	2	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294686	0.81025	.	.	ENSG00000153827	ENST00000283943;ENST00000389045;ENST00000389044	T;T;T	0.35236	1.32;1.32;1.32	5.89	5.89	0.94794	Armadillo-like helical (1);Armadillo-type fold (1);	0.146548	0.64402	D	0.000009	T	0.40119	0.1104	N	0.26042	0.785	0.80722	D	1	P;B;B;B	0.51057	0.941;0.437;0.437;0.437	P;B;B;B	0.49332	0.607;0.097;0.097;0.097	T	0.20107	-1.0285	10	0.66056	D	0.02	.	20.3201	0.98661	0.0:0.0:1.0:0.0	.	570;267;612;564	D4HL82;Q14CF1;Q14CA3;Q14669	.;.;.;TRIPC_HUMAN	V	564;267;612	ENSP00000283943:A564V;ENSP00000373697:A267V;ENSP00000373696:A612V	ENSP00000283943:A564V	A	-	2	0	TRIP12	230386981	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.827000	0.99397	2.807000	0.96579	0.551000	0.68910	GCA	TRIP12	-	superfamily_ARM-type_fold	ENSG00000153827		0.343	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	-	0.00	67	0	G	NM_004238		230678737	-1	tier1	-	no_errors	ENST00000283943	ensembl	human	known	74_37	missense	12.00	22	3	SNP	1.000	A
TRPA1	8989	genome.wustl.edu	37	8	72966069	72966069	+	Silent	SNP	C	C	A	rs369662285	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:72966069C>A	ENST00000262209.4	-	13	1770	c.1563G>T	c.(1561-1563)gcG>gcT	p.A521A	RP11-383H13.1_ENST00000457356.4_3'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	521					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	CGCCCATGGACGCATGATGCA	0.478																																																	0													71.0	59.0	63.0					8																	72966069		2203	4300	6503	SO:0001819	synonymous_variant	0			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.1563G>T	8.37:g.72966069C>A			A6NIN6	Silent	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A521	ENST00000262209.4	37	c.1563	CCDS34908.1	8																																																																																			TRPA1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000104321		0.478	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	HGNC	protein_coding	OTTHUMT00000379079.2	-	0.00	49	0	C	NM_007332		72966069	-1	tier1	-	no_errors	ENST00000262209	ensembl	human	known	74_37	silent	33.33	30	15	SNP	0.834	A
TSGA10	80705	genome.wustl.edu	37	2	99743565	99743565	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:99743565C>T	ENST00000393483.3	-	0	299				TSGA10_ENST00000542655.1_5'UTR|TSGA10_ENST00000355053.4_5'UTR|TSGA10_ENST00000478090.1_5'UTR|TSGA10_ENST00000539964.1_5'UTR	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10						cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						CTTGTTCTAGCTGGAGAGTAT	0.388																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.-546G>A	2.37:g.99743565C>T			B7Z925|D3DVH7|Q8NEP0|Q9BWX0	RNA	SNP	-	NULL	ENST00000393483.3	37	NULL	CCDS2037.1	2																																																																																			TSGA10	-	-	ENSG00000135951		0.388	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	-	0.00	97	0	C	NM_182911		99743565	-1	tier1	-	no_errors	ENST00000476849	ensembl	human	known	74_37	rna	8.70	42	4	SNP	0.998	T
TSPAN9	10867	genome.wustl.edu	37	12	3390494	3390494	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr12:3390494C>T	ENST00000011898.5	+	7	724	c.563C>T	c.(562-564)aCg>aTg	p.T188M	TSPAN9_ENST00000537971.1_Splice_Site_p.T188M|TSPAN9_ENST00000407263.1_Splice_Site_p.T188M	NM_006675.4	NP_006666.1	O75954	TSN9_HUMAN	tetraspanin 9	188						focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)				endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			TTGTGGAGAACGGTGAGGCTG	0.672																																																	0													22.0	18.0	19.0					12																	3390494		2040	3875	5915	SO:0001630	splice_region_variant	0			AF089749	CCDS8520.1	12p13.33-p13.32	2013-02-14			ENSG00000011105	ENSG00000011105		"""Tetraspanins"""	21640	protein-coding gene	gene with protein product		613137				10719184, 11739647	Standard	NM_006675		Approved	NET-5	uc021qtd.1	O75954	OTTHUMG00000150333	ENST00000011898.5:c.564+1C>T	12.37:g.3390494C>T			D3DUQ7|Q53FV2|Q6FGJ8	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.T188M	ENST00000011898.5	37	c.563	CCDS8520.1	12	.	.	.	.	.	.	.	.	.	.	C	16.35	3.097969	0.56183	.	.	ENSG00000011105	ENST00000537971;ENST00000011898;ENST00000407263	T;T;T	0.79845	-1.31;-1.31;-1.31	4.86	4.86	0.63082	Tetraspanin, EC2 domain (1);	0.222293	0.39146	N	0.001459	T	0.81880	0.4916	L	0.46157	1.445	0.38087	D	0.936848	P	0.51653	0.947	P	0.51487	0.671	D	0.85517	0.1201	10	0.62326	D	0.03	.	15.4916	0.75611	0.0:1.0:0.0:0.0	.	188	O75954	TSN9_HUMAN	M	188	ENSP00000444799:T188M;ENSP00000011898:T188M;ENSP00000384488:T188M	ENSP00000011898:T188M	T	+	2	0	TSPAN9	3260755	1.000000	0.71417	0.992000	0.48379	0.560000	0.35617	4.608000	0.61141	2.241000	0.73720	0.561000	0.74099	ACG	TSPAN9	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000011105		0.672	TSPAN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN9	HGNC	protein_coding	OTTHUMT00000317606.2	-	0.00	89	0	C	NM_006675	Missense_Mutation	3390494	+1	tier1	-	no_errors	ENST00000011898	ensembl	human	known	74_37	missense	11.63	38	5	SNP	0.996	T
TTC1	7265	genome.wustl.edu	37	5	159437569	159437569	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:159437569G>A	ENST00000231238.5	+	2	144	c.34G>A	c.(34-36)Gag>Aag	p.E12K	TTC1_ENST00000522793.1_Missense_Mutation_p.E12K|Y_RNA_ENST00000362528.1_RNA	NM_001282500.1|NM_003314.1	NP_001269429.1|NP_003305.1	Q99614	TTC1_HUMAN	tetratricopeptide repeat domain 1	12					protein folding (GO:0006457)	peroxisomal membrane (GO:0005778)	unfolded protein binding (GO:0051082)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|prostate(1)|skin(1)	12	Renal(175;0.00196)	all_hematologic(541;0.00014)|Breast(839;0.0101)|all_neural(177;0.0281)|Medulloblastoma(196;0.0425)|Lung NSC(249;0.119)|all_lung(500;0.163)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	Epithelial(171;8.37e-05)|all cancers(165;0.000694)|OV - Ovarian serous cystadenocarcinoma(192;0.0402)		TGGGGTTCCAGAGGATCTGTT	0.493																																																	0													53.0	62.0	59.0					5																	159437569		2202	4300	6502	SO:0001583	missense	0			U46570	CCDS4348.1	5q32-q33.2	2013-01-10			ENSG00000113312	ENSG00000113312		"""Tetratricopeptide (TTC) repeat domain containing"""	12391	protein-coding gene	gene with protein product		601963				8836031	Standard	NM_003314		Approved	TPR1	uc003lxu.3	Q99614	OTTHUMG00000130326	ENST00000231238.5:c.34G>A	5.37:g.159437569G>A	ENSP00000231238:p.Glu12Lys		B2RCT2|D3DQJ8|Q9BVT3	Missense_Mutation	SNP	pfam_TPR_1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E12K	ENST00000231238.5	37	c.34	CCDS4348.1	5	.	.	.	.	.	.	.	.	.	.	G	13.29	2.194432	0.38806	.	.	ENSG00000113312	ENST00000231238;ENST00000522793	T;T	0.22134	1.97;1.97	5.25	5.25	0.73442	.	0.239948	0.41500	D	0.000866	T	0.19805	0.0476	M	0.66939	2.045	0.39919	D	0.974131	P	0.45348	0.856	B	0.31390	0.129	T	0.11641	-1.0579	10	0.30854	T	0.27	-23.3123	14.3464	0.66668	0.0:0.0:1.0:0.0	.	12	Q99614	TTC1_HUMAN	K	12	ENSP00000231238:E12K;ENSP00000429225:E12K	ENSP00000231238:E12K	E	+	1	0	TTC1	159370147	1.000000	0.71417	0.988000	0.46212	0.017000	0.09413	3.650000	0.54424	2.434000	0.82447	0.555000	0.69702	GAG	TTC1	-	NULL	ENSG00000113312		0.493	TTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC1	HGNC	protein_coding	OTTHUMT00000252675.3	-	0.00	69	0	G	NM_003314		159437569	+1	tier1	-	no_errors	ENST00000231238	ensembl	human	known	74_37	missense	17.39	19	4	SNP	0.999	A
CFAP70	118491	genome.wustl.edu	37	10	75056899	75056899	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:75056899G>T	ENST00000310715.3	-	16	1875	c.1755C>A	c.(1753-1755)taC>taA	p.Y585*	TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000355577.3_Nonsense_Mutation_p.Y54*|TTC18_ENST00000394865.1_Nonsense_Mutation_p.Y585*|TTC18_ENST00000401621.2_Nonsense_Mutation_p.Y585*|TTC18_ENST00000340329.3_Intron	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		585						extracellular vesicular exosome (GO:0070062)		p.Y585*(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					TTGTCTTCAAGTATTTATCTC	0.438																																																	1	Substitution - Nonsense(1)	lung(1)											190.0	169.0	176.0					10																	75056899		2203	4300	6503	SO:0001587	stop_gained	0																														ENST00000310715.3:c.1755C>A	10.37:g.75056899G>T	ENSP00000310829:p.Tyr585*		C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Nonsense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Y585*	ENST00000310715.3	37	c.1755	CCDS7324.3	10	.	.	.	.	.	.	.	.	.	.	G	39	7.411247	0.98269	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000394865	.	.	.	5.12	-0.215	0.13157	.	0.368822	0.29028	N	0.013376	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.1514	9.0313	0.36260	0.4977:0.0:0.5023:0.0	.	.	.	.	X	585	.	ENSP00000310829:Y585X	Y	-	3	2	TTC18	74726905	1.000000	0.71417	0.878000	0.34440	0.971000	0.66376	0.828000	0.27435	-0.238000	0.09724	0.557000	0.71058	TAC	TTC18	-	NULL	ENSG00000156042		0.438	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC18	HGNC	protein_coding			0.00	63	0	G			75056899	-1			no_errors	ENST00000310715	ensembl	human	known	74_37	nonsense	8.70	21	2	SNP	0.833	T
TTC3	7267	genome.wustl.edu	37	21	38460554	38460554	+	Silent	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr21:38460554C>T	ENST00000399017.2	+	4	2993	c.246C>T	c.(244-246)tgC>tgT	p.C82C	TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000540756.1_Intron|TTC3_ENST00000399010.1_Silent_p.C82C|TTC3_ENST00000355666.1_Silent_p.C82C|TTC3_ENST00000354749.2_Silent_p.C82C	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	82					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.C82C(1)		breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				AAGATTATTGCGATGCCATTA	0.343																																					Ovarian(38;194 1649 35661)												1	Substitution - coding silent(1)	endometrium(1)											91.0	81.0	84.0					21																	38460554		2203	4300	6503	SO:0001819	synonymous_variant	0			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.246C>T	21.37:g.38460554C>T			A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Silent	SNP	pfam_Znf_C3HC4_RING-type,superfamily_DEATH-like_dom,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.C82	ENST00000399017.2	37	c.246	CCDS13651.1	21																																																																																			TTC3	-	NULL	ENSG00000182670		0.343	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1	-	0.00	57	0	C			38460554	+1	tier1	-	no_errors	ENST00000354749	ensembl	human	known	74_37	silent	41.94	18	13	SNP	1.000	T
TTF1	7270	genome.wustl.edu	37	9	135273587	135273587	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:135273587G>A	ENST00000334270.2	-	4	1757	c.1718C>T	c.(1717-1719)cCt>cTt	p.P573L		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	573					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)	p.P573H(1)		endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		TTTTTCCTCAGGATATCTGTC	0.403																																																	1	Substitution - Missense(1)	lung(1)											166.0	144.0	151.0					9																	135273587		2203	4300	6503	SO:0001583	missense	0			BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1718C>T	9.37:g.135273587G>A	ENSP00000333920:p.Pro573Leu		A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.P573L	ENST00000334270.2	37	c.1718	CCDS6948.1	9	.	.	.	.	.	.	.	.	.	.	G	14.90	2.674887	0.47781	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.11821	2.74	5.41	5.41	0.78517	.	0.170516	0.40064	N	0.001195	T	0.31734	0.0806	L	0.51422	1.61	0.53688	D	0.999978	D	0.89917	1.0	D	0.85130	0.997	T	0.00686	-1.1610	10	0.52906	T	0.07	.	14.7151	0.69262	0.0:0.0:1.0:0.0	.	573	Q15361	TTF1_HUMAN	L	573	ENSP00000333920:P573L	ENSP00000245588:P573L	P	-	2	0	TTF1	134263408	1.000000	0.71417	0.943000	0.38184	0.046000	0.14306	4.201000	0.58439	2.539000	0.85634	0.655000	0.94253	CCT	TTF1	-	NULL	ENSG00000125482		0.403	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF1	HGNC	protein_coding	OTTHUMT00000054784.2		0.00	100	0	G	NM_007344		135273587	-1			no_errors	ENST00000334270	ensembl	human	known	74_37	missense	9.38	29	3	SNP	0.991	A
TUBA3C	7278	genome.wustl.edu	37	13	19748175	19748175	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr13:19748175T>G	ENST00000400113.3	-	5	1285	c.1181A>C	c.(1180-1182)aAg>aCg	p.K394T		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	394					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GAGATCGAACTTATGGTCCAG	0.642																																																	0													125.0	114.0	117.0					13																	19748175		2203	4300	6503	SO:0001583	missense	0			AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.1181A>C	13.37:g.19748175T>G	ENSP00000382982:p.Lys394Thr		A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.K394T	ENST00000400113.3	37	c.1181	CCDS9284.1	13	.	.	.	.	.	.	.	.	.	.	t	12.88	2.071228	0.36566	.	.	ENSG00000198033	ENST00000400113	D	0.85955	-2.05	1.22	1.22	0.21188	.	0.000000	0.49305	U	0.000150	D	0.85864	0.5796	.	.	.	0.42575	D	0.993195	.	.	.	.	.	.	D	0.84442	0.0583	7	0.87932	D	0	.	6.5693	0.22529	0.0:0.0:0.0:1.0	.	.	.	.	T	394	ENSP00000382982:K394T	ENSP00000382982:K394T	K	-	2	0	TUBA3C	18646175	1.000000	0.71417	0.978000	0.43139	0.932000	0.56968	4.841000	0.62824	0.813000	0.34350	0.163000	0.16589	AAG	TUBA3C	-	superfamily_Tub_FtsZ_C,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin	ENSG00000198033		0.642	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	TUBA3C	HGNC	protein_coding	OTTHUMT00000044007.2	-	0.00	106	0	T	NM_006001		19748175	-1	tier1	-	no_errors	ENST00000400113	ensembl	human	known	74_37	missense	12.28	50	7	SNP	1.000	G
TWIST1	7291	genome.wustl.edu	37	7	19156445	19156445	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:19156445T>G	ENST00000242261.5	-	1	850	c.500A>C	c.(499-501)gAg>gCg	p.E167A	AC003986.6_ENST00000419944.1_RNA	NM_000474.3	NP_000465.1	Q15672	TWST1_HUMAN	twist family bHLH transcription factor 1	167	Sufficient for transactivation activity. {ECO:0000250}.				aortic valve morphogenesis (GO:0003180)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in heart valve development (GO:2000793)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|cranial suture morphogenesis (GO:0060363)|embryonic camera-type eye formation (GO:0060900)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cushion morphogenesis (GO:0003203)|eyelid development in camera-type eye (GO:0061029)|in utero embryonic development (GO:0001701)|mitral valve morphogenesis (GO:0003183)|muscle organ development (GO:0007517)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone acetylation (GO:0035067)|negative regulation of histone phosphorylation (GO:0033128)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of oxidative phosphorylation uncoupler activity (GO:2000276)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|outer ear morphogenesis (GO:0042473)|palate development (GO:0060021)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell motility (GO:2000147)|positive regulation of endocardial cushion to mesenchymal transition involved in heart valve formation (GO:2000802)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of monocyte chemotactic protein-1 production (GO:0071639)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of bone mineralization (GO:0030500)|rhythmic process (GO:0048511)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription factor binding (GO:0008134)			lung(2)|upper_aerodigestive_tract(1)	3						GGAGTCCAGCTCGTCGCTCTG	0.617																																																	0													92.0	76.0	81.0					7																	19156445		2203	4300	6503	SO:0001583	missense	0			U80998	CCDS5367.1	7p21	2014-02-07	2013-10-17	2003-03-28	ENSG00000122691	ENSG00000122691		"""Basic helix-loop-helix proteins"""	12428	protein-coding gene	gene with protein product	"""Saethre-Chotzen syndrome"""	601622	"""blepharophimosis, epicanthus inversus and ptosis 3"", ""acrocephalosyndactyly 3"", ""twist homolog 1 (Drosophila)"", ""twist basic helix-loop-helix transcription factor 1"", ""craniosynostosis"""	ACS3, BPES3, TWIST, CRS		8995765, 11474656, 17343269	Standard	XR_428085		Approved	SCS, H-twist, BPES2, bHLHa38, CRS1	uc003sum.3	Q15672	OTTHUMG00000090821	ENST00000242261.5:c.500A>C	7.37:g.19156445T>G	ENSP00000242261:p.Glu167Ala		A4D128|Q92487|Q99804	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.E167A	ENST00000242261.5	37	c.500	CCDS5367.1	7	.	.	.	.	.	.	.	.	.	.	t	14.11	2.438214	0.43326	.	.	ENSG00000122691	ENST00000242261	D	0.98531	-4.98	4.77	4.77	0.60923	Helix-loop-helix DNA-binding (1);	0.000000	0.48767	D	0.000164	D	0.95953	0.8682	L	0.43152	1.355	0.80722	D	1	B	0.28998	0.23	B	0.24006	0.05	D	0.95055	0.8190	10	0.54805	T	0.06	-16.7111	13.9616	0.64182	0.0:0.0:0.0:1.0	.	167	Q15672	TWST1_HUMAN	A	167	ENSP00000242261:E167A	ENSP00000242261:E167A	E	-	2	0	TWIST1	19122970	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.908000	0.87438	1.780000	0.52325	0.374000	0.22700	GAG	TWIST1	-	superfamily_bHLH_dom	ENSG00000122691		0.617	TWIST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWIST1	HGNC	protein_coding	OTTHUMT00000207625.1	-	0.00	60	0	T	NM_000474		19156445	-1	tier1	-	no_errors	ENST00000242261	ensembl	human	known	74_37	missense	28.21	28	11	SNP	1.000	G
TXNDC15	79770	genome.wustl.edu	37	5	134229230	134229230	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr5:134229230C>A	ENST00000358387.4	+	3	1265	c.640C>A	c.(640-642)Ctg>Atg	p.L214M	TXNDC15_ENST00000546290.1_Missense_Mutation_p.L191M	NM_024715.3	NP_078991.3	Q96J42	TXD15_HUMAN	thioredoxin domain containing 15	214	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	17			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TACTCTAGTCCTGTTTTACAC	0.458																																																	0													196.0	193.0	194.0					5																	134229230		2203	4300	6503	SO:0001583	missense	0			AK026278	CCDS4180.1	5q31.1	2008-02-05	2007-08-16	2007-08-16	ENSG00000113621	ENSG00000113621			20652	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 14"""	C5orf14			Standard	NM_024715		Approved	2310047H23Rik, FLJ22625	uc003lac.1	Q96J42	OTTHUMG00000129115	ENST00000358387.4:c.640C>A	5.37:g.134229230C>A	ENSP00000351157:p.Leu214Met		D3DQA9|Q96MT2|Q9H639	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.L214M	ENST00000358387.4	37	c.640	CCDS4180.1	5	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721500	0.68959	.	.	ENSG00000113621	ENST00000441965;ENST00000358387;ENST00000546290	T;T	0.22945	1.93;1.93	6.07	2.94	0.34122	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.40619	0.1124	L	0.48935	1.535	0.58432	D	0.999995	D	0.89917	1.0	D	0.97110	1.0	T	0.15435	-1.0437	10	0.54805	T	0.06	-2.0814	10.7683	0.46308	0.0:0.7197:0.0:0.2803	.	214	Q96J42	TXD15_HUMAN	M	198;214;191	ENSP00000351157:L214M;ENSP00000443942:L191M	ENSP00000351157:L214M	L	+	1	2	TXNDC15	134257129	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	0.737000	0.26144	0.901000	0.36495	0.655000	0.94253	CTG	TXNDC15	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000113621		0.458	TXNDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNDC15	HGNC	protein_coding	OTTHUMT00000251160.1	-	0.00	99	0	C	NM_024715		134229230	+1	tier1	-	no_errors	ENST00000358387	ensembl	human	known	74_37	missense	10.26	35	4	SNP	1.000	A
USP11	8237	genome.wustl.edu	37	X	47104088	47104088	+	Silent	SNP	C	C	T	rs144034150	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:47104088C>T	ENST00000218348.3	+	15	1980	c.1980C>T	c.(1978-1980)gaC>gaT	p.D660D	USP11_ENST00000377107.2_Silent_p.D617D	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	660	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)	p.D660D(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						TAGAAGATGACGAGGAGGATA	0.582																																																	1	Substitution - coding silent(1)	breast(1)						C		0,3834		0,0,0,1632,570	25.0	19.0	21.0		1980	-3.7	0.0	X	dbSNP_134	21	1,6726		0,0,1,2428,1870	no	coding-synonymous	USP11	NM_004651.3		0,0,1,4060,2440	TT,TC,T,CC,C		0.0149,0.0,0.0095		660/964	47104088	1,10560	2202	4299	6501	SO:0001819	synonymous_variant	0			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.1980C>T	X.37:g.47104088C>T			B2RTX1|Q8IUG6|Q9BWE1	Silent	SNP	pfam_Peptidase_C19/C67,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19/C67	p.D660	ENST00000218348.3	37	c.1980	CCDS14277.1	X																																																																																			USP11	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000102226		0.582	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP11	HGNC	protein_coding		-	0.00	27	0	C	NM_004651		47104088	+1	tier1	rs144034150	no_errors	ENST00000218348	ensembl	human	known	74_37	silent	23.08	10	3	SNP	0.000	T
USP17L2	377630	genome.wustl.edu	37	8	11995085	11995085	+	Silent	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:11995085G>A	ENST00000333796.3	-	1	1501	c.1185C>T	c.(1183-1185)ggC>ggT	p.G395G	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	395					apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.G395G(1)		central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						TGTCTTCAGCGCCGAGGGCTC	0.562																																																	1	Substitution - coding silent(1)	lung(1)											33.0	35.0	35.0					8																	11995085		1714	3892	5606	SO:0001819	synonymous_variant	0			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.1185C>T	8.37:g.11995085G>A				Silent	SNP	pfam_Peptidase_C19/C67,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19/C67	p.G395	ENST00000333796.3	37	c.1185	CCDS43713.1	8																																																																																			USP17L2	-	pfam_HABP4_PAIRBP1-bd	ENSG00000223443		0.562	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	HGNC	protein_coding	OTTHUMT00000383303.2	-	0.00	263	0	G	NM_201402		11995085	-1	tier1	-	no_errors	ENST00000333796	ensembl	human	known	74_37	silent	9.23	118	12	SNP	0.000	A
CCDC144A	9720	genome.wustl.edu	37	17	16706720	16706720	+	3'UTR	SNP	C	C	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr17:16706720C>A	ENST00000443444.2	+	0	7865				RP11-219A15.2_ENST00000582895.1_lincRNA|RP11-219A15.1_ENST00000448331.3_3'UTR|RP11-219A15.4_ENST00000602730.1_RNA|USP32P1_ENST00000393005.2_RNA			A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A																		AGAACGCATGCAAATGAACTT	0.358																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000443444.2:c.*3441C>A	17.37:g.16706720C>A			O60311|Q6ZU57	RNA	SNP	-	NULL	ENST00000443444.2	37	NULL	CCDS45621.1	17																																																																																			USP32P1	-	-	ENSG00000188933		0.358	CCDC144A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP32P1	HGNC	protein_coding		-	0.00	179	0	C			16706720	+1	tier1	-	no_errors	ENST00000341745	ensembl	human	known	74_37	rna	9.91	100	11	SNP	0.214	A
UTRN	7402	genome.wustl.edu	37	6	144858790	144858790	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr6:144858790G>T	ENST00000367545.3	+	43	6306	c.6306G>T	c.(6304-6306)aaG>aaT	p.K2102N		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2102					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		GGTTAACAAAGGCTGAGCATG	0.353																																																	0													124.0	111.0	116.0					6																	144858790		2203	4300	6503	SO:0001583	missense	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.6306G>T	6.37:g.144858790G>T	ENSP00000356515:p.Lys2102Asn		Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_dom,superfamily_CH-domain,superfamily_WW_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_dom,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_dom,pfscan_Znf_ZZ	p.K2102N	ENST00000367545.3	37	c.6306	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	G	10.35	1.326743	0.24080	.	.	ENSG00000152818	ENST00000367545	T	0.34275	1.37	4.89	3.07	0.35406	.	0.226238	0.30742	N	0.008973	T	0.06234	0.0161	N	0.19112	0.55	0.19775	N	0.99996	B	0.02656	0.0	B	0.04013	0.001	T	0.35525	-0.9785	10	0.17369	T	0.5	.	4.2696	0.10780	0.2709:0.0:0.528:0.2011	.	2102	P46939	UTRO_HUMAN	N	2102	ENSP00000356515:K2102N	ENSP00000356515:K2102N	K	+	3	2	UTRN	144900483	0.992000	0.36948	0.149000	0.22428	0.632000	0.37999	0.469000	0.22067	0.707000	0.31934	0.655000	0.94253	AAG	UTRN	-	smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000152818		0.353	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	-	0.00	68	0	G			144858790	+1	tier1	-	no_errors	ENST00000367545	ensembl	human	known	74_37	missense	9.52	38	4	SNP	0.159	T
VIL1	7429	genome.wustl.edu	37	2	219301231	219301231	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr2:219301231delC	ENST00000248444.5	+	16	1941	c.1853delC	c.(1852-1854)accfs	p.T618fs	VIL1_ENST00000392114.2_Frame_Shift_Del_p.T307fs	NM_007127.2	NP_009058.2	P09327	VILI_HUMAN	villin 1	618	Core.				actin filament capping (GO:0051693)|actin filament depolymerization (GO:0030042)|actin filament polymerization (GO:0030041)|actin filament severing (GO:0051014)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cytoplasmic actin-based contraction involved in cell motility (GO:0060327)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell differentiation (GO:0030855)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell migration (GO:0010634)|protein complex assembly (GO:0006461)|regulation of actin nucleation (GO:0051125)|regulation of cell shape (GO:0008360)|regulation of lamellipodium morphogenesis (GO:2000392)|regulation of wound healing (GO:0061041)|response to bacterium (GO:0009617)	actin filament bundle (GO:0032432)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|ruffle (GO:0001726)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|identical protein binding (GO:0042802)|lysophosphatidic acid binding (GO:0035727)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Renal(207;0.0474)		Epithelial(149;6.88e-07)|all cancers(144;0.00013)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTGGTCATCACCCCCCGGCTC	0.502																																																	0													142.0	150.0	147.0					2																	219301231		2203	4300	6503	SO:0001589	frameshift_variant	0			X12901	CCDS2417.1	2q35	2012-10-02			ENSG00000127831	ENSG00000127831			12690	protein-coding gene	gene with protein product		193040		VIL		2846586	Standard	NM_007127		Approved	D2S1471	uc002via.3	P09327	OTTHUMG00000133112	ENST00000248444.5:c.1853delC	2.37:g.219301231delC	ENSP00000248444:p.Thr618fs		B2R9A7|Q53S11|Q96AC8	Frame_Shift_Del	DEL	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Villin/Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Villin/Gelsolin	p.R620fs	ENST00000248444.5	37	c.1853	CCDS2417.1	2																																																																																			VIL1	-	smart_Villin/Gelsolin	ENSG00000127831		0.502	VIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIL1	HGNC	protein_coding	OTTHUMT00000256778.3		0.00	59	0	C	NM_007127		219301231	+1	tier1		no_errors	ENST00000248444	ensembl	human	known	74_37	frame_shift_del	7.69	24	2	DEL	0.000	-
VPS26A	9559	genome.wustl.edu	37	10	70930990	70930990	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr10:70930990G>A	ENST00000373382.1	+	10	1602	c.949G>A	c.(949-951)Gaa>Aaa	p.E317K	VPS26A_ENST00000490696.1_3'UTR|VPS26A_ENST00000489794.1_3'UTR|VPS26A_ENST00000395098.1_3'UTR|VPS26A_ENST00000263559.6_Missense_Mutation_p.E317K|VPS26A_ENST00000546041.1_Missense_Mutation_p.E300K|VPS26A_ENST00000541711.1_Missense_Mutation_p.E206K			O75436	VP26A_HUMAN	vacuolar protein sorting 26 homolog A (S. pombe)	317					retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|vesicle (GO:0031982)	protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)	8						TGAATCTCCAGAATCACAGGC	0.383																																					Colon(90;545 1358 4729 6702 16773)												0													74.0	83.0	80.0					10																	70930990		2202	4300	6502	SO:0001583	missense	0			AF054179	CCDS7286.1, CCDS41536.1	10q21.1	2007-01-12	2007-01-12	2005-10-11	ENSG00000122958	ENSG00000122958			12711	protein-coding gene	gene with protein product		605506	"""vacuolar protein sorting 26 (yeast homolog)"", ""vacuolar protein sorting 26 (yeast)"", ""vacuolar protein sorting 26 homolog A (yeast)"""	VPS26		1638986, 9653160	Standard	NM_004896		Approved	Hbeta58, PEP8A	uc001jpb.3	O75436	OTTHUMG00000018376	ENST00000373382.1:c.949G>A	10.37:g.70930990G>A	ENSP00000362480:p.Glu317Lys		A8MZ56|B2RDD3|Q8TBH4|Q9H982	Missense_Mutation	SNP	pfam_VPS26	p.E317K	ENST00000373382.1	37	c.949	CCDS7286.1	10	.	.	.	.	.	.	.	.	.	.	G	17.58	3.424688	0.62733	.	.	ENSG00000122958	ENST00000373382;ENST00000263559;ENST00000546041;ENST00000541711	.	.	.	5.14	5.14	0.70334	.	0.190796	0.53938	D	0.000041	T	0.38719	0.1051	N	0.14661	0.345	0.80722	D	1	B;B	0.29301	0.241;0.005	B;B	0.23419	0.046;0.008	T	0.33111	-0.9881	9	0.07175	T	0.84	-13.399	18.9802	0.92752	0.0:0.0:1.0:0.0	.	300;317	F5H4L7;O75436	.;VP26A_HUMAN	K	317;317;300;206	.	ENSP00000263559:E317K	E	+	1	0	VPS26A	70600996	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	9.563000	0.98148	2.550000	0.86006	0.467000	0.42956	GAA	VPS26A	-	NULL	ENSG00000122958		0.383	VPS26A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS26A	HGNC	protein_coding	OTTHUMT00000048403.1	-	0.00	52	0	G	NM_004896		70930990	+1	tier1	-	no_errors	ENST00000263559	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	A
VWA5B1	127731	genome.wustl.edu	37	1	20644148	20644148	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:20644148delG	ENST00000375079.2	+	5	885	c.689delG	c.(688-690)cgtfs	p.R230fs	VWA5B1_ENST00000375083.4_Frame_Shift_Del_p.R230fs|VWA5B1_ENST00000289825.4_5'UTR|VWA5B1_ENST00000289815.8_Frame_Shift_Del_p.R230fs|RP4-745E8.2_ENST00000444923.1_RNA	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	230						extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						CTGGAGATCCGTGGGCCATGT	0.602																																																	0													90.0	79.0	82.0					1																	20644148		692	1591	2283	SO:0001589	frameshift_variant	0			AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.689delG	1.37:g.20644148delG	ENSP00000364220:p.Arg230fs		A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Frame_Shift_Del	DEL	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R230fs	ENST00000375079.2	37	c.689		1																																																																																			VWA5B1	-	NULL	ENSG00000158816		0.602	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	VWA5B1	HGNC	protein_coding	OTTHUMT00000007945.4		0.00	51	0	G	XM_001722222		20644148	+1	tier1		no_errors	ENST00000289815	ensembl	human	known	74_37	frame_shift_del	11.76	15	2	DEL	0.996	-
VWA5B1	127731	genome.wustl.edu	37	1	20662937	20662937	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:20662937delA	ENST00000375079.2	+	13	2096	c.1900delA	c.(1900-1902)aaafs	p.K634fs	VWA5B1_ENST00000525343.1_3'UTR|VWA5B1_ENST00000375083.4_Frame_Shift_Del_p.K634fs|VWA5B1_ENST00000289825.4_Frame_Shift_Del_p.K351fs|VWA5B1_ENST00000289815.8_Frame_Shift_Del_p.K634fs	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1	634			K -> R (in dbSNP:rs10916769).			extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						AGGGCAGGCCAAAAATGCCCG	0.572																																																	0													43.0	43.0	43.0					1																	20662937		692	1591	2283	SO:0001589	frameshift_variant	0			AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.1900delA	1.37:g.20662937delA	ENSP00000364220:p.Lys634fs		A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Frame_Shift_Del	DEL	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.N635fs	ENST00000375079.2	37	c.1900		1																																																																																			VWA5B1	-	NULL	ENSG00000158816		0.572	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	VWA5B1	HGNC	protein_coding	OTTHUMT00000007945.4		0.00	27	0	A	XM_001722222		20662937	+1	tier1		no_errors	ENST00000289815	ensembl	human	known	74_37	frame_shift_del	16.67	10	2	DEL	0.007	-
WBSCR17	64409	genome.wustl.edu	37	7	71135008	71135008	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:71135008A>C	ENST00000333538.5	+	8	1952	c.1318A>C	c.(1318-1320)Agt>Cgt	p.S440R	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	440					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ATTAAGGAAAAGTTTAAAGTG	0.448																																																	0													133.0	133.0	133.0					7																	71135008		2203	4300	6503	SO:0001583	missense	0			AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1318A>C	7.37:g.71135008A>C	ENSP00000329654:p.Ser440Arg		Q8NFV9|Q9NTA8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.S440R	ENST00000333538.5	37	c.1318	CCDS5540.1	7	.	.	.	.	.	.	.	.	.	.	A	5.368	0.253144	0.10185	.	.	ENSG00000185274	ENST00000333538	T	0.29655	1.56	5.0	5.0	0.66597	.	0.140585	0.64402	D	0.000006	T	0.07908	0.0198	N	0.00230	-1.795	0.47621	D	0.999477	B	0.06786	0.001	B	0.04013	0.001	T	0.25916	-1.0118	10	0.07990	T	0.79	.	13.8811	0.63682	1.0:0.0:0.0:0.0	.	440	Q6IS24	GLTL3_HUMAN	R	440	ENSP00000329654:S440R	ENSP00000329654:S440R	S	+	1	0	WBSCR17	70772944	1.000000	0.71417	1.000000	0.80357	0.567000	0.35839	6.108000	0.71522	1.878000	0.54408	0.482000	0.46254	AGT	WBSCR17	-	NULL	ENSG00000185274		0.448	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR17	HGNC	protein_coding	OTTHUMT00000252006.1	-	0.00	77	0	A	NM_022479		71135008	+1	tier1	-	no_errors	ENST00000333538	ensembl	human	known	74_37	missense	25.49	38	13	SNP	1.000	C
WDR34	89891	genome.wustl.edu	37	9	131403128	131403128	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr9:131403128C>T	ENST00000372715.2	-	2	337	c.277G>A	c.(277-279)Gtg>Atg	p.V93M		NM_052844.3	NP_443076.2	Q96EX3	WDR34_HUMAN	WD repeat domain 34	93						axoneme (GO:0005930)|centriole (GO:0005814)|ciliary basal body (GO:0036064)				central_nervous_system(2)|lung(5)|skin(1)|urinary_tract(1)	9						CTGACAGGCACGGGGGCCTCC	0.627																																																	0													49.0	45.0	47.0					9																	131403128		2203	4300	6503	SO:0001583	missense	0			BC011874	CCDS6906.2	9q34.11	2013-11-15	2013-02-19	2013-02-19	ENSG00000119333	ENSG00000119333		"""WD repeat domain containing"""	28296	protein-coding gene	gene with protein product		613363				19521662, 21953912, 24183451	Standard	NM_052844		Approved	DIC5, MGC20486, bA216B9.3, FAP133	uc004bvq.1	Q96EX3	OTTHUMG00000020750	ENST00000372715.2:c.277G>A	9.37:g.131403128C>T	ENSP00000361800:p.Val93Met		Q5VXV4|Q9BV46	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.V93M	ENST00000372715.2	37	c.277	CCDS6906.2	9	.	.	.	.	.	.	.	.	.	.	C	11.93	1.785852	0.31593	.	.	ENSG00000119333	ENST00000372715;ENST00000451652;ENST00000419989	T	0.64618	-0.11	5.33	0.907	0.19321	.	2.809240	0.01365	N	0.012372	T	0.48909	0.1526	N	0.22421	0.69	0.09310	N	1	B;B	0.19583	0.007;0.037	B;B	0.11329	0.004;0.006	T	0.35475	-0.9787	10	0.46703	T	0.11	12.1484	6.1254	0.20176	0.1287:0.495:0.0:0.3763	.	78;93	A2A3F8;Q96EX3	.;WDR34_HUMAN	M	93;84;78	ENSP00000361800:V93M	ENSP00000361800:V93M	V	-	1	0	WDR34	130442949	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.008000	0.12788	0.258000	0.21686	-0.140000	0.14226	GTG	WDR34	-	NULL	ENSG00000119333		0.627	WDR34-005	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR34	HGNC	protein_coding	OTTHUMT00000054463.1	-	0.00	55	0	C	NM_052844		131403128	-1	tier1	-	no_errors	ENST00000372715	ensembl	human	known	74_37	missense	22.73	17	5	SNP	0.000	T
WDR62	284403	genome.wustl.edu	37	19	36562584	36562584	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:36562584C>G	ENST00000270301.7	+	8	1009	c.1009C>G	c.(1009-1011)Ctt>Gtt	p.L337V	WDR62_ENST00000388999.3_Missense_Mutation_p.L337V|WDR62_ENST00000401500.2_Missense_Mutation_p.L337V|WDR62_ENST00000378860.4_3'UTR			O43379	WDR62_HUMAN	WD repeat domain 62	337					cerebral cortex development (GO:0021987)|neurogenesis (GO:0022008)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle pole (GO:0000922)				cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(15)|prostate(4)|stomach(2)|urinary_tract(3)	43	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GCCACACTACCTTGGGGTAGA	0.617																																																	0													58.0	52.0	54.0					19																	36562584		2203	4300	6503	SO:0001583	missense	0			BX647726	CCDS33001.1, CCDS46059.1	19q13.12	2013-01-09	2005-05-09	2005-05-09	ENSG00000075702	ENSG00000075702		"""WD repeat domain containing"""	24502	protein-coding gene	gene with protein product		613583	"""chromosome 19 open reading frame 14"", ""microcephaly, primary autosomal recessive 2"""	C19orf14, MCPH2		19910486, 20729831, 20890278, 21496009	Standard	NM_001083961		Approved	DKFZP434J046, FLJ33298	uc002odd.2	O43379	OTTHUMG00000048139	ENST00000270301.7:c.1009C>G	19.37:g.36562584C>G	ENSP00000270301:p.Leu337Val		Q63HP9|Q659D7|Q8NBF7|Q96AD9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L337V	ENST00000270301.7	37	c.1009	CCDS33001.1	19	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225638	0.79576	.	.	ENSG00000075702	ENST00000401500;ENST00000388999;ENST00000378860;ENST00000270301;ENST00000427823	T;T;T;T	0.59906	0.43;0.23;5.0;0.35	5.96	3.84	0.44239	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.74306	0.3699	M	0.81341	2.54	0.58432	D	0.99999	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.87578	0.998;0.971;0.996	T	0.76342	-0.2994	10	0.51188	T	0.08	-22.5894	11.1906	0.48683	0.0:0.8479:0.0:0.1521	.	337;337;337	O43379-4;O43379;O43379-3	.;WDR62_HUMAN;.	V	337;337;337;337;359	ENSP00000384792:L337V;ENSP00000373651:L337V;ENSP00000368137:L337V;ENSP00000270301:L337V	ENSP00000270301:L337V	L	+	1	0	WDR62	41254424	1.000000	0.71417	0.994000	0.49952	0.861000	0.49209	2.564000	0.45931	1.538000	0.49270	-0.140000	0.14226	CTT	WDR62	-	superfamily_WD40_repeat_dom	ENSG00000075702		0.617	WDR62-006	NOVEL	basic|appris_candidate|CCDS	protein_coding	WDR62	HGNC	protein_coding	OTTHUMT00000457436.1	-	0.00	42	0	C	NM_015671		36562584	+1	tier1	-	no_errors	ENST00000401500	ensembl	human	known	74_37	missense	38.24	21	13	SNP	1.000	G
WDR64	128025	genome.wustl.edu	37	1	241934999	241934999	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr1:241934999G>T	ENST00000366552.2	+	18	2467	c.2260G>T	c.(2260-2262)Ggt>Tgt	p.G754C	WDR64_ENST00000437684.2_Intron	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	754										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TGAGGTTAAAGGTCAGTATGA	0.353																																																	0													160.0	134.0	142.0					1																	241934999		692	1590	2282	SO:0001630	splice_region_variant	0			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.2260+1G>T	1.37:g.241934999G>T			B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G754C	ENST00000366552.2	37	c.2260		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.58|17.58	3.425108|3.425108	0.62733|0.62733	.|.	.|.	ENSG00000162843|ENSG00000162843	ENST00000366552|ENST00000425826	T|T	0.52983|0.57436	0.64|0.4	5.37|5.37	5.37|5.37	0.77165|0.77165	WD40 repeat-like-containing domain (1);|.	0.803554|.	0.11353|.	N|.	0.572706|.	T|T	0.62146|0.62146	0.2404|0.2404	M|M	0.62723|0.62723	1.935|1.935	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	P|.	0.59703|.	0.862|.	T|T	0.57883|0.57883	-0.7734|-0.7734	10|7	0.38643|0.29301	T|T	0.18|0.29	-15.3808|-15.3808	14.6103|14.6103	0.68512|0.68512	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	754|.	B1ANS9|.	WDR64_HUMAN|.	C|N	754|232	ENSP00000355510:G754C|ENSP00000406342:K232N	ENSP00000355510:G754C|ENSP00000406342:K232N	G|K	+|+	1|3	0|2	WDR64|WDR64	240001622|240001622	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.626000|0.626000	0.37791|0.37791	2.894000|2.894000	0.48640|0.48640	2.509000|2.509000	0.84616|0.84616	0.655000|0.655000	0.94253|0.94253	GGT|AAG	WDR64	-	superfamily_WD40_repeat_dom	ENSG00000162843		0.353	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	HGNC	protein_coding			0.00	54	0	G	NM_144625	Missense_Mutation	241934999	+1			no_errors	ENST00000366552	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
WEE2	494551	genome.wustl.edu	37	7	141424037	141424037	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:141424037G>T	ENST00000397541.2	+	8	1589	c.1183G>T	c.(1183-1185)Gga>Tga	p.G395*	WEE2-AS1_ENST00000486906.1_RNA|WEE2-AS1_ENST00000459753.1_RNA|WEE2-AS1_ENST00000478332.1_RNA|WEE2-AS1_ENST00000462383.1_RNA|WEE2-AS1_ENST00000484172.1_RNA|WEE2-AS1_ENST00000495800.1_RNA|WEE2-AS1_ENST00000465110.1_RNA|WEE2-AS1_ENST00000488785.1_RNA|WEE2-AS1_ENST00000471512.1_RNA	NM_001105558.1	NP_001099028.1	P0C1S8	WEE2_HUMAN	WEE1 homolog 2 (S. pombe)	395	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				female meiotic division (GO:0007143)|female pronucleus assembly (GO:0035038)|mitotic nuclear division (GO:0007067)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of oocyte maturation (GO:1900194)|regulation of meiosis I (GO:0060631)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(2)|stomach(1)	31	Melanoma(164;0.0171)					AGTGGAAGAAGGAGATAGTCG	0.363																																																	0													113.0	109.0	110.0					7																	141424037		1833	4081	5914	SO:0001587	stop_gained	0			AK131218	CCDS43660.1	7q32	2008-07-02			ENSG00000214102	ENSG00000214102			19684	protein-coding gene	gene with protein product		614084					Standard	NM_001105558		Approved	FLJ16107	uc003vwn.2	P0C1S8	OTTHUMG00000157536	ENST00000397541.2:c.1183G>T	7.37:g.141424037G>T	ENSP00000380675:p.Gly395*			Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Wee1-like_protein_kinase,pfscan_Prot_kinase_dom	p.G395*	ENST00000397541.2	37	c.1183	CCDS43660.1	7	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002598	0.93227	.	.	ENSG00000214102	ENST00000397541;ENST00000493845	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	U	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.3368	0.98748	0.0:0.0:1.0:0.0	.	.	.	.	X	395;170	.	ENSP00000380675:G395X	G	+	1	0	WEE2	141070506	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	8.994000	0.93529	2.805000	0.96524	0.655000	0.94253	GGA	WEE2	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Wee1-like_protein_kinase,pfscan_Prot_kinase_dom	ENSG00000214102		0.363	WEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WEE2	HGNC	protein_coding	OTTHUMT00000349091.1	-	0.00	45	0	G	NM_001105558		141424037	+1	tier1	-	no_errors	ENST00000397541	ensembl	human	known	74_37	nonsense	11.11	32	4	SNP	1.000	T
WHSC1L1	54904	genome.wustl.edu	37	8	38137195	38137195	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:38137195C>T	ENST00000317025.8	-	21	4140	c.3623G>A	c.(3622-3624)cGt>cAt	p.R1208H	RP11-513D5.5_ENST00000529325.1_RNA|WHSC1L1_ENST00000433384.2_Missense_Mutation_p.R1159H|WHSC1L1_ENST00000527502.1_Missense_Mutation_p.R1197H	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	1208	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			ATCAATTATACGGTCCTTCAG	0.403			T	NUP98	AML																																			Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	0													98.0	89.0	92.0					8																	38137195		1855	4105	5960	SO:0001583	missense	0			AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.3623G>A	8.37:g.38137195C>T	ENSP00000313983:p.Arg1208His		B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Missense_Mutation	SNP	pfam_PWWP_dom,pfam_SET_dom,superfamily_Znf_FYVE_PHD,smart_PWWP_dom,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.R1208H	ENST00000317025.8	37	c.3623	CCDS43729.1	8	.	.	.	.	.	.	.	.	.	.	C	35	5.439182	0.96168	.	.	ENSG00000147548	ENST00000433384;ENST00000317025;ENST00000446459;ENST00000527502	D;D;D	0.89196	-2.48;-2.48;-2.48	5.74	5.74	0.90152	SET domain (3);	0.000000	0.47455	U	0.000227	D	0.93687	0.7983	L	0.60957	1.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.93294	0.6671	10	0.56958	D	0.05	.	19.9179	0.97070	0.0:1.0:0.0:0.0	.	1197;1159;1208	B7ZL11;Q9BZ95-2;Q9BZ95	.;.;NSD3_HUMAN	H	1159;1208;1145;1197	ENSP00000393284:R1159H;ENSP00000313983:R1208H;ENSP00000434730:R1197H	ENSP00000313983:R1208H	R	-	2	0	WHSC1L1	38256352	1.000000	0.71417	0.997000	0.53966	0.916000	0.54674	7.818000	0.86416	2.723000	0.93209	0.655000	0.94253	CGT	WHSC1L1	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000147548		0.403	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1L1	HGNC	protein_coding	OTTHUMT00000381924.3	-	0.00	94	0	C	NM_023034		38137195	-1	tier1	-	no_errors	ENST00000317025	ensembl	human	known	74_37	missense	9.43	47	5	SNP	1.000	T
XIST	7503	genome.wustl.edu	37	X	73067337	73067337	+	lincRNA	SNP	G	G	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:73067337G>A	ENST00000429829.1	-	0	5251					NR_001564.2				X inactive specific transcript (non-protein coding)																		ttacaggtgtgagccaccaca	0.448																																																	0													1.0	1.0	1.0					X																	73067337		420	927	1347			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73067337G>A				RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.448	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1		0.00	10	0	G	NR_001564		73067337	-1			no_errors	ENST00000429829	ensembl	human	known	74_37	rna	30.00	7	3	SNP	0.003	A
XRCC6	2547	genome.wustl.edu	37	22	42032238	42032238	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr22:42032238A>G	ENST00000359308.4	+	3	972	c.317A>G	c.(316-318)cAg>cGg	p.Q106R	XRCC6_ENST00000402580.3_Splice_Site|XRCC6_ENST00000428575.2_5'UTR|XRCC6_ENST00000405506.1_Missense_Mutation_p.Q56R|XRCC6_ENST00000360079.3_Missense_Mutation_p.Q106R|XRCC6_ENST00000405878.1_Missense_Mutation_p.Q106R			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	106					brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						TACGTCTTACAGGAGCTGGAT	0.368								Non-homologous end-joining																																									0													48.0	50.0	49.0					22																	42032238		2203	4300	6503	SO:0001583	missense	0			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.317A>G	22.37:g.42032238A>G	ENSP00000352257:p.Gln106Arg		B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Splice_Site	SNP	-	e3-2	ENST00000359308.4	37	c.196-2	CCDS14021.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	23.6|23.6	4.434766|4.434766	0.83885|0.83885	.|.	.|.	ENSG00000196419|ENSG00000196419	ENST00000402580|ENST00000360079;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	.|.	.|.	.|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|Ku70/Ku80, N-terminal alpha/beta (1);	.|0.112509	.|0.64402	.|D	.|0.000010	.|T	.|0.77811	.|0.4186	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	.|D;P;P	.|0.54207	.|0.965;0.929;0.929	.|D;D;D	.|0.79108	.|0.992;0.989;0.987	.|T	.|0.75124	.|-0.3428	.|9	.|0.09084	.|T	.|0.74	.|-18.911	15.9958|15.9958	0.80243|0.80243	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|56;106;106	.|B1AHC9;B1AHC7;P12956	.|.;.;XRCC6_HUMAN	.|R	-1|106;106;106;106;56	.|.	.|ENSP00000352257:Q106R	.|Q	+|+	.|2	.|0	XRCC6|XRCC6	40362184|40362184	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	8.415000|8.415000	0.90241|0.90241	2.188000|2.188000	0.69820|0.69820	0.533000|0.533000	0.62120|0.62120	.|CAG	XRCC6	-	-	ENSG00000196419		0.368	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC6	HGNC	protein_coding	OTTHUMT00000321688.1	-	0.00	81	0	A	NM_001469		42032238	+1	tier1	-	no_errors	ENST00000402580	ensembl	human	novel	74_37	splice_site	10.53	34	4	SNP	1.000	G
ZBTB46	140685	genome.wustl.edu	37	20	62422008	62422008	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr20:62422008C>T	ENST00000245663.4	-	2	253	c.103G>A	c.(103-105)Gtg>Atg	p.V35M	ZBTB46_ENST00000480766.1_5'Flank|ZBTB46_ENST00000395104.1_Missense_Mutation_p.V35M|ZBTB46_ENST00000302995.2_Missense_Mutation_p.V35M	NM_025224.3	NP_079500.2	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	35	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of dendritic cell differentiation (GO:2001200)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					TCCACGACCACGCAGACGTCG	0.602																																																	0													70.0	55.0	60.0					20																	62422008		2203	4300	6503	SO:0001583	missense	0			AK131482	CCDS13538.1	20q13.33	2013-01-08	2006-09-19	2006-09-19	ENSG00000130584	ENSG00000130584		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16094	protein-coding gene	gene with protein product	"""BTB-ZF protein expressed in effector lymphocytes"""	614639	"""BTB (POZ) domain containing 4"""	ZNF340, BTBD4			Standard	NM_025224		Approved	FLJ13502, RINZF, BZEL	uc002ygv.2	Q86UZ6	OTTHUMG00000033001	ENST00000245663.4:c.103G>A	20.37:g.62422008C>T	ENSP00000245663:p.Val35Met		E1P5K9|Q5JWJ3|Q6GMV4|Q9BQK3|Q9H3Z8|Q9H3Z9	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_DUF3342,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.V35M	ENST00000245663.4	37	c.103	CCDS13538.1	20	.	.	.	.	.	.	.	.	.	.	C	12.07	1.828667	0.32329	.	.	ENSG00000130584	ENST00000245663;ENST00000302995;ENST00000395104	T;T;T	0.72394	-0.65;-0.65;-0.65	5.39	2.05	0.26809	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.139101	0.48286	D	0.000190	T	0.80660	0.4665	M	0.87381	2.88	0.25276	N	0.989477	D	0.59767	0.986	D	0.63283	0.913	T	0.70185	-0.4941	10	0.87932	D	0	.	5.3129	0.15841	0.0:0.4663:0.0:0.5337	.	35	Q86UZ6	ZBT46_HUMAN	M	35	ENSP00000245663:V35M;ENSP00000303102:V35M;ENSP00000378536:V35M	ENSP00000245663:V35M	V	-	1	0	ZBTB46	61892452	0.969000	0.33509	0.005000	0.12908	0.004000	0.04260	2.118000	0.41949	0.666000	0.31087	-0.150000	0.13652	GTG	ZBTB46	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000130584		0.602	ZBTB46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB46	HGNC	protein_coding	OTTHUMT00000080232.2		0.00	18	0	C	NM_025224		62422008	-1			no_errors	ENST00000245663	ensembl	human	known	74_37	missense	27.27	8	3	SNP	0.219	T
ZCCHC12	170261	genome.wustl.edu	37	X	117959806	117959806	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chrX:117959806C>T	ENST00000310164.2	+	4	1106	c.599C>T	c.(598-600)gCa>gTa	p.A200V		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	200					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						AGGATGTATGCAAATGAGCAG	0.478																																																	0													60.0	59.0	60.0					X																	117959806		2201	4298	6499	SO:0001583	missense	0			AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.599C>T	X.37:g.117959806C>T	ENSP00000308921:p.Ala200Val		B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	superfamily_Znf_CCHC	p.A200V	ENST00000310164.2	37	c.599	CCDS14574.1	X	.	.	.	.	.	.	.	.	.	.	C	15.74	2.921390	0.52653	.	.	ENSG00000174460	ENST00000310164	T	0.10099	2.91	3.1	3.1	0.35709	.	0.218041	0.23439	N	0.048161	T	0.27489	0.0675	M	0.79123	2.44	0.30993	N	0.721145	D	0.76494	0.999	D	0.83275	0.996	T	0.08432	-1.0722	10	0.22109	T	0.4	-4.2912	8.8036	0.34923	0.0:1.0:0.0:0.0	.	200	Q6PEW1	ZCH12_HUMAN	V	200	ENSP00000308921:A200V	ENSP00000308921:A200V	A	+	2	0	ZCCHC12	117843834	0.990000	0.36364	0.994000	0.49952	0.935000	0.57460	0.912000	0.28597	1.806000	0.52798	0.600000	0.82982	GCA	ZCCHC12	-	NULL	ENSG00000174460		0.478	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC12	HGNC	protein_coding	OTTHUMT00000058014.1		0.00	29	0	C	NM_173798		117959806	+1			no_errors	ENST00000310164	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.994	T
ZFP82	284406	genome.wustl.edu	37	19	36883755	36883755	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:36883755T>G	ENST00000392161.3	-	5	1729	c.1487A>C	c.(1486-1488)cAt>cCt	p.H496P	ZFP82_ENST00000392171.1_Missense_Mutation_p.H496P	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	496					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AATTCTCAGATGTTGAATAAG	0.368																																																	0													74.0	73.0	74.0					19																	36883755		2203	4300	6503	SO:0001583	missense	0			AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.1487A>C	19.37:g.36883755T>G	ENSP00000431265:p.His496Pro		Q8NC63|Q8TF53	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H496P	ENST00000392161.3	37	c.1487	CCDS12493.1	19	.	.	.	.	.	.	.	.	.	.	T	17.07	3.296061	0.60086	.	.	ENSG00000181007	ENST00000392161;ENST00000392171	D;D	0.86865	-2.18;-2.18	4.2	4.2	0.49525	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43110	D	0.000619	D	0.95589	0.8566	H	0.98155	4.16	0.46586	D	0.999117	D	0.89917	1.0	D	0.97110	1.0	D	0.96329	0.9242	10	0.87932	D	0	.	11.5587	0.50764	0.0:0.0:0.0:1.0	.	496	Q8N141	ZFP82_HUMAN	P	496	ENSP00000431265:H496P;ENSP00000446080:H496P	ENSP00000431265:H496P	H	-	2	0	ZFP82	41575595	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.888000	0.69758	1.905000	0.55150	0.482000	0.46254	CAT	ZFP82	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181007		0.368	ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFP82	HGNC	protein_coding	OTTHUMT00000109552.2	-	0.00	88	0	T	NM_133466		36883755	-1	tier1	-	no_errors	ENST00000392161	ensembl	human	known	74_37	missense	26.32	42	15	SNP	1.000	G
ZFP90	146198	genome.wustl.edu	37	16	68598462	68598462	+	Missense_Mutation	SNP	G	G	A	rs543784734		TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr16:68598462G>A	ENST00000570495.1	+	5	2064	c.1772G>A	c.(1771-1773)cGa>cAa	p.R591Q	ZFP90_ENST00000398253.2_Missense_Mutation_p.R591Q|ZFP90_ENST00000563169.2_Missense_Mutation_p.R591Q			Q8TF47	ZFP90_HUMAN	ZFP90 zinc finger protein	591					negative regulation of DNA binding (GO:0043392)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(2)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)		AGAGCCTTCCGAAAAAAAACC	0.413													G|||	1	0.000199681	0.0	0.0	5008	,	,		19808	0.0		0.0	False		,,,				2504	0.001																0													118.0	132.0	127.0					16																	68598462		2159	4286	6445	SO:0001583	missense	0			AK074332	CCDS42183.1	16q22.1	2013-01-08	2012-11-27			ENSG00000184939		"""Zinc fingers, C2H2-type"", ""-"""	23329	protein-coding gene	gene with protein product		609451	"""zinc finger protein 90 homolog (mouse)"""			7576184	Standard	NM_133458		Approved	KIAA1954, NK10, ZNF756	uc002ewc.3	Q8TF47		ENST00000570495.1:c.1772G>A	16.37:g.68598462G>A	ENSP00000460547:p.Arg591Gln		B2RU00|B3KVE7|Q49AD1|Q96MQ6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R591Q	ENST00000570495.1	37	c.1772	CCDS42183.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.29|14.29	2.492146|2.492146	0.44352|0.44352	.|.	.|.	ENSG00000184939|ENSG00000184939	ENST00000327567|ENST00000398253	.|T	.|0.04275	.|3.66	5.64|5.64	4.62|4.62	0.57501|0.57501	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	T|T	0.13200|0.13200	0.0320|0.0320	M|M	0.71581|0.71581	2.175|2.175	0.09310|0.09310	N|N	1|1	.|D	.|0.63046	.|0.992	.|P	.|0.54629	.|0.757	T|T	0.08743|0.08743	-1.0707|-1.0707	6|9	0.22706|0.48119	T|T	0.39|0.1	-7.9213|-7.9213	9.0529|9.0529	0.36387|0.36387	0.0:0.1584:0.6777:0.1639|0.0:0.1584:0.6777:0.1639	.|.	.|591	.|Q8TF47	.|ZFP90_HUMAN	K|Q	64|591	.|ENSP00000381304:R591Q	ENSP00000329859:E64K|ENSP00000381304:R591Q	E|R	+|+	1|2	0|0	ZFP90|ZFP90	67155963|67155963	0.000000|0.000000	0.05858|0.05858	1.000000|1.000000	0.80357|0.80357	0.839000|0.839000	0.47603|0.47603	0.295000|0.295000	0.19065|0.19065	2.833000|2.833000	0.97629|0.97629	0.555000|0.555000	0.69702|0.69702	GAA|CGA	ZFP90	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000184939		0.413	ZFP90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP90	HGNC	protein_coding	OTTHUMT00000436217.3		0.00	77	0	G	XM_085375		68598462	+1			no_errors	ENST00000398253	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.099	A
ZFPM2	23414	genome.wustl.edu	37	8	106646475	106646475	+	Splice_Site	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr8:106646475A>C	ENST00000407775.2	+	5	672	c.422A>C	c.(421-423)aAg>aCg	p.K141T	ZFPM2_ENST00000520492.1_Splice_Site_p.K9T|ZFPM2_ENST00000517361.1_Splice_Site_p.K9T	NM_012082.3	NP_036214.2	Q8WW38	FOG2_HUMAN	zinc finger protein, FOG family member 2	141					blood coagulation (GO:0007596)|embryonic organ development (GO:0048568)|gonadal mesoderm development (GO:0007506)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|negative regulation of cell death (GO:0060548)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of female gonad development (GO:2000195)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract septum morphogenesis (GO:0003148)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|right ventricular cardiac muscle tissue morphogenesis (GO:0003221)|vasculogenesis (GO:0001570)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(4)|breast(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(11)|liver(2)|lung(48)|ovary(4)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	99			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TTTCTACAGAAGACAAAGGCT	0.383																																																	0													76.0	72.0	73.0					8																	106646475		1960	4162	6122	SO:0001630	splice_region_variant	0			AF119334	CCDS47908.1	8q23	2013-01-10	2012-11-27		ENSG00000169946	ENSG00000169946		"""Zinc fingers, C2H2-type"", ""Zinc fingers, C2HC-type containing"""	16700	protein-coding gene	gene with protein product		603693	"""zinc finger protein, multitype 2"""			9927675, 10438528	Standard	NM_012082		Approved	FOG2, hFOG-2, ZNF89B, ZC2HC11B	uc003ymd.3	Q8WW38	OTTHUMG00000164818	ENST00000407775.2:c.421-1A>C	8.37:g.106646475A>C			Q32MA6|Q9NPL7|Q9NPS4|Q9UNI5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K141T	ENST00000407775.2	37	c.422	CCDS47908.1	8	.	.	.	.	.	.	.	.	.	.	A	20.6	4.023438	0.75390	.	.	ENSG00000169946	ENST00000407775;ENST00000520492;ENST00000520027;ENST00000517361	T;T;T	0.21361	2.01;2.26;2.26	5.56	5.56	0.83823	.	0.121923	0.52532	D	0.000061	T	0.35278	0.0926	L	0.29908	0.895	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.07404	-1.0774	10	0.51188	T	0.08	.	16.021	0.80493	1.0:0.0:0.0:0.0	.	141	Q8WW38	FOG2_HUMAN	T	141;9;9;9	ENSP00000384179:K141T;ENSP00000430757:K9T;ENSP00000428720:K9T	ENSP00000384179:K141T	K	+	2	0	ZFPM2	106715651	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.910000	0.92685	2.240000	0.73641	0.533000	0.62120	AAG	ZFPM2	-	NULL	ENSG00000169946		0.383	ZFPM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPM2	HGNC	protein_coding	OTTHUMT00000380614.1	-	0.00	59	0	A		Missense_Mutation	106646475	+1	tier1	-	no_errors	ENST00000407775	ensembl	human	known	74_37	missense	28.30	38	15	SNP	1.000	C
ZFYVE21	79038	genome.wustl.edu	37	14	104194146	104194146	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr14:104194146C>T	ENST00000311141.2	+	3	287	c.253C>T	c.(253-255)Cgg>Tgg	p.R85W	ZFYVE21_ENST00000216602.6_Missense_Mutation_p.R85W|Y_RNA_ENST00000517287.1_RNA	NM_024071.3	NP_076976.1	Q9BQ24	ZFY21_HUMAN	zinc finger, FYVE domain containing 21	85						cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(2)	8		Melanoma(154;0.226)		Epithelial(152;0.245)		GGTGCCGCTGCGGCGCATGTG	0.657																																																	0													50.0	47.0	48.0					14																	104194146		2202	4300	6502	SO:0001583	missense	0			AK057816	CCDS9985.1, CCDS55948.1	14q32.33	2011-09-07						"""Zinc fingers, FYVE domain containing"""	20760	protein-coding gene	gene with protein product		613504				21768110	Standard	NM_024071		Approved	MGC2550, ZF21	uc001yod.3	Q9BQ24		ENST00000311141.2:c.253C>T	14.37:g.104194146C>T	ENSP00000310543:p.Arg85Trp		A8K3A4|Q86T05|Q96LT1	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.R85W	ENST00000311141.2	37	c.253	CCDS9985.1	14	.	.	.	.	.	.	.	.	.	.	C	26.1	4.702245	0.88924	.	.	ENSG00000100711	ENST00000216602;ENST00000311141	T;T	0.43294	0.95;0.95	4.2	3.3	0.37823	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, FYVE-type (2);Zinc finger, FYVE-related (1);Zinc finger, FYVE/PHD-type (1);	0.253915	0.39475	N	0.001360	T	0.51702	0.1690	L	0.43923	1.385	0.35044	D	0.760016	D;D	0.76494	0.998;0.999	P;P	0.61397	0.888;0.862	T	0.65886	-0.6059	10	0.87932	D	0	0.0751	13.3211	0.60434	0.1596:0.8404:0.0:0.0	.	85;85	Q9BQ24-2;Q9BQ24	.;ZFY21_HUMAN	W	85	ENSP00000216602:R85W;ENSP00000310543:R85W	ENSP00000216602:R85W	R	+	1	2	ZFYVE21	103263899	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.837000	0.55820	0.948000	0.37687	0.561000	0.74099	CGG	ZFYVE21	-	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	ENSG00000100711		0.657	ZFYVE21-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZFYVE21	HGNC	protein_coding	OTTHUMT00000414616.1	-	0.00	61	0	C	NM_024071		104194146	+1	tier1	-	no_errors	ENST00000216602	ensembl	human	known	74_37	missense	13.79	25	4	SNP	1.000	T
ZNF138	7697	genome.wustl.edu	37	7	64293429	64293430	+	3'UTR	DEL	TA	TA	-	rs149239632	byFrequency	TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	TA	TA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr7:64293429_64293430delTA	ENST00000359735.3	+	0	1985_1986				ZNF138_ENST00000397136.2_3'UTR|ZNF138_ENST00000440598.1_3'UTR|ZNF138_ENST00000437743.1_3'UTR|ZNF138_ENST00000430838.2_3'UTR	NM_001271637.1|NM_001271639.1	NP_001258566.1|NP_001258568.1	P52744	ZN138_HUMAN	zinc finger protein 138						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(2)|stomach(1)	7		Lung NSC(55;0.0795)|all_lung(88;0.18)				CAACACTTACTATACATAAGAT	0.327																																																	0																																										SO:0001624	3_prime_UTR_variant	0			U09847	CCDS34645.1, CCDS34645.2, CCDS55115.1, CCDS64659.1, CCDS64660.1, CCDS64661.1, CCDS75607.1	7q11.21	2013-01-08	2005-07-11		ENSG00000197008	ENSG00000197008		"""Zinc fingers, C2H2-type"", ""-"""	12922	protein-coding gene	gene with protein product		604080	"""zinc finger protein 138 (clone pHZ-32)"""				Standard	NM_006524		Approved	pHZ-32	uc031sxl.1	P52744	OTTHUMG00000156603	ENST00000359735.3:c.*850TA>-	7.37:g.64293431_64293432delTA			B4DFX2|B4DP87|E9PHI7|E9PHK7	RNA	DEL	-	NULL	ENST00000359735.3	37	NULL		7																																																																																			ZNF138	-	-	ENSG00000197008		0.327	ZNF138-201	KNOWN	basic	protein_coding	ZNF138	HGNC	protein_coding			0.00	74	0	TA	NM_006524		64293430	+1	tier1		no_errors	ENST00000430838	ensembl	human	known	74_37	rna	5.71	33	2	DEL	0.000:0.000	-
ZNF559	84527	genome.wustl.edu	37	19	9448586	9448586	+	Intron	SNP	T	T	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:9448586T>G	ENST00000393883.2	+	2	592				ZNF559_ENST00000592504.1_Intron|ZNF559_ENST00000586255.1_5'UTR|ZNF177_ENST00000446085.4_Intron|ZNF559_ENST00000317221.7_Intron|ZNF177_ENST00000605471.1_Intron|ZNF177_ENST00000602738.1_Intron|ZNF559_ENST00000538743.1_Intron|ZNF559_ENST00000585352.1_Intron|ZNF177_ENST00000541595.2_Intron|ZNF559_ENST00000587557.1_Intron|ZNF559_ENST00000603380.1_Intron|ZNF177_ENST00000602856.1_Intron|ZNF559_ENST00000592896.1_5'UTR	NM_001202412.1	NP_001189341.1	Q9BR84	ZN559_HUMAN	zinc finger protein 559						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|large_intestine(7)|lung(15)|ovary(1)|urinary_tract(1)	26						TGAGATTGACTTACCCATAAG	0.438																																																	0																																										SO:0001627	intron_variant	0			AL389937	CCDS12211.1, CCDS59349.1, CCDS62531.1, CCDS62532.1	19p13.2	2013-09-20			ENSG00000188321	ENSG00000188321		"""Zinc fingers, C2H2-type"", ""-"""	28197	protein-coding gene	gene with protein product						12477932	Standard	NM_001202406		Approved	MGC13105	uc002mle.4	Q9BR84	OTTHUMG00000179942	ENST00000393883.2:c.-57+52T>G	19.37:g.9448586T>G			K7EMG6	RNA	SNP	-	NULL	ENST00000393883.2	37	NULL	CCDS12211.1	19																																																																																			ZNF177	-	-	ENSG00000270011		0.438	ZNF559-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF559-ZNF177	Uniprot_gn	protein_coding	OTTHUMT00000449021.1	-	0.00	57	0	T	NM_032497		9448586	+1	tier1	-	no_errors	ENST00000605301	ensembl	human	known	74_37	rna	33.33	16	8	SNP	0.001	G
ZNF266	10781	genome.wustl.edu	37	19	9524071	9524071	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:9524071A>C	ENST00000592904.1	-	5	3606	c.1530T>G	c.(1528-1530)caT>caG	p.H510Q	ZNF266_ENST00000361151.1_Missense_Mutation_p.H510Q|ZNF266_ENST00000588933.1_Missense_Mutation_p.H510Q|ZNF266_ENST00000361451.2_Missense_Mutation_p.H510Q|ZNF266_ENST00000590306.1_Missense_Mutation_p.H510Q|ZNF266_ENST00000588221.1_Missense_Mutation_p.H510Q|ZNF266_ENST00000592292.1_Missense_Mutation_p.H510Q			Q14584	ZN266_HUMAN	zinc finger protein 266	510					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|large_intestine(11)|lung(8)|ovary(1)|skin(2)|stomach(1)	28						GAGTTCGTTCATGTAACTGAA	0.443																																																	0													102.0	77.0	85.0					19																	9524071		2203	4300	6503	SO:0001583	missense	0			X78924	CCDS12213.1	19p13.2	2013-01-08				ENSG00000174652		"""Zinc fingers, C2H2-type"""	13059	protein-coding gene	gene with protein product		604751				7865130	Standard	NM_006631		Approved	HZF1	uc002mlo.4	Q14584		ENST00000592904.1:c.1530T>G	19.37:g.9524071A>C	ENSP00000466714:p.His510Gln		A0AV90|A4FU85|Q6IQ07|Q6U8A5|Q8IVG3|Q8WVX1|Q96SX9	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H510Q	ENST00000592904.1	37	c.1530	CCDS12213.1	19	.	.	.	.	.	.	.	.	.	.	A	16.48	3.134550	0.56828	.	.	ENSG00000174652	ENST00000361451;ENST00000361151	D;D	0.86865	-2.18;-2.18	2.34	1.31	0.21738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94069	0.8099	H	0.95294	3.65	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84366	0.0541	9	0.87932	D	0	.	5.4008	0.16295	0.8439:0.0:0.1561:0.0	.	510	Q14584	ZN266_HUMAN	Q	510	ENSP00000354680:H510Q;ENSP00000355047:H510Q	ENSP00000355047:H510Q	H	-	3	2	ZNF266	9385071	0.001000	0.12720	0.003000	0.11579	0.600000	0.36913	-0.295000	0.08298	0.348000	0.23949	0.374000	0.22700	CAT	ZNF266	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000174652		0.443	ZNF266-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF266	HGNC	protein_coding	OTTHUMT00000449033.1		0.00	79	0	A			9524071	-1			no_errors	ENST00000361151	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.091	C
ZNF675	171392	genome.wustl.edu	37	19	23836558	23836558	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:23836558C>G	ENST00000359788.4	-	4	1345	c.1177G>C	c.(1177-1179)Gag>Cag	p.E393Q	ZNF675_ENST00000601935.1_Intron|ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000600313.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	393					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TAGGGTTTCTCTTCGGTATGA	0.398																																																	0													65.0	64.0	64.0					19																	23836558		2203	4300	6503	SO:0001583	missense	0				CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1177G>C	19.37:g.23836558C>G	ENSP00000352836:p.Glu393Gln		Q8N211	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E393Q	ENST00000359788.4	37	c.1177	CCDS32981.1	19	.	.	.	.	.	.	.	.	.	.	.	12.98	2.100646	0.37048	.	.	ENSG00000197372	ENST00000359788	T	0.25912	1.77	0.225	0.225	0.15325	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32406	0.0828	L	0.49699	1.58	0.31038	N	0.716655	P	0.48764	0.915	P	0.53593	0.73	T	0.37596	-0.9699	9	0.72032	D	0.01	.	7.9744	0.30147	0.0:0.9999:0.0:1.0E-4	.	393	Q8TD23	ZN675_HUMAN	Q	393	ENSP00000352836:E393Q	ENSP00000352836:E393Q	E	-	1	0	ZNF675	23628398	0.237000	0.23815	0.004000	0.12327	0.004000	0.04260	0.533000	0.23082	0.300000	0.22699	0.305000	0.20034	GAG	ZNF675	-	pfscan_Znf_C2H2	ENSG00000197372		0.398	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF675	HGNC	protein_coding	OTTHUMT00000466433.1	-	0.00	99	0	C	NM_138330		23836558	-1	tier1	-	no_errors	ENST00000359788	ensembl	human	known	74_37	missense	13.64	38	6	SNP	1.000	G
ZNF254	9534	genome.wustl.edu	37	19	24310680	24310680	+	Silent	SNP	A	A	G			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:24310680A>G	ENST00000357002.4	+	4	1993	c.1878A>G	c.(1876-1878)ggA>ggG	p.G626G	ZNF254_ENST00000342944.6_Silent_p.G541G	NM_001278661.1|NM_001278662.1|NM_001278664.1|NM_001278677.1|NM_001278678.1|NM_203282.2	NP_001265590.1|NP_001265591.1|NP_001265593.1|NP_001265606.1|NP_001265607.1|NP_975011.3	O75437	ZN254_HUMAN	zinc finger protein 254	626					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				TTCATACTGGAGAGCAACCCT	0.388																																																	0													65.0	68.0	67.0					19																	24310680		2202	4299	6501	SO:0001819	synonymous_variant	0			AF054180	CCDS32983.1, CCDS62622.1, CCDS62623.1, CCDS74323.1, CCDS74324.1	19p13	2013-01-08				ENSG00000213096		"""Zinc fingers, C2H2-type"", ""-"""	13047	protein-coding gene	gene with protein product		604768	"""zinc finger protein 539"""	ZNF91L, ZNF539		9653160	Standard	NM_001278661		Approved	HD-ZNF1, BMZF-5	uc002nru.3	O75437		ENST00000357002.4:c.1878A>G	19.37:g.24310680A>G			A4QPC0|Q86XL7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G626	ENST00000357002.4	37	c.1878	CCDS32983.1	19																																																																																			ZNF254	-	pfscan_Znf_C2H2	ENSG00000213096		0.388	ZNF254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF254	HGNC	protein_coding	OTTHUMT00000466453.1	-	0.00	60	0	A	NM_004876		24310680	+1	tier1	-	no_errors	ENST00000357002	ensembl	human	known	74_37	silent	16.22	31	6	SNP	0.997	G
ZNF880	400713	genome.wustl.edu	37	19	52876492	52876492	+	Splice_Site	SNP	T	T	A			TCGA-L5-A8NG-01A-11D-A37C-09	TCGA-L5-A8NG-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	c63e7bd8-4fcd-42af-9df4-5403e90653ae	ba900120-b0b0-4733-8a20-d6f83a03b0d0	g.chr19:52876492T>A	ENST00000422689.2	+	2	154		c.e2+2		ZNF880_ENST00000424032.2_Splice_Site|ZNF880_ENST00000600321.1_Splice_Site|ZNF880_ENST00000344085.5_Splice_Site|ZNF880_ENST00000597976.1_Splice_Site	NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						TCTTTCTGGGTGAGGATAATG	0.468																																																	0													67.0	65.0	66.0					19																	52876492		692	1591	2283	SO:0001630	splice_region_variant	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.139+2T>A	19.37:g.52876492T>A			B4DNA6	Splice_Site	SNP	-	e2+2	ENST00000422689.2	37	c.139+2	CCDS46164.1	19	.	.	.	.	.	.	.	.	.	.	N	1.061	-0.672759	0.03403	.	.	ENSG00000221923	ENST00000424032;ENST00000344085;ENST00000422689	.	.	.	1.62	0.469	0.16741	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.5393	0.12049	0.0:0.1921:0.0:0.8079	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF880	57568304	1.000000	0.71417	0.217000	0.23759	0.028000	0.11728	2.553000	0.45837	-0.094000	0.12374	0.260000	0.18958	.	ZNF880	-	-	ENSG00000221923		0.468	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	-	0.00	98	0	T	NM_001145434	Intron	52876492	+1	tier1	-	no_errors	ENST00000422689	ensembl	human	known	74_37	splice_site	6.25	60	4	SNP	0.876	A
