#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
AADACL4	343066	genome.wustl.edu	37	1	12726318	12726318	+	Missense_Mutation	SNP	G	G	A	rs139261871		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:12726318G>A	ENST00000376221.1	+	4	796	c.796G>A	c.(796-798)Gcc>Acc	p.A266T		NM_001013630.1	NP_001013652.1	Q5VUY2	ADCL4_HUMAN	arylacetamide deacetylase-like 4	266						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)	p.A266T(2)		breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)	17	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000937)|all_lung(284;0.00122)|Colorectal(325;0.00215)|Breast(348;0.0042)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.81e-07)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0384)		CTGGCGTGACGCCATCTTGAA	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		19682	0.0		0.001	False		,,,				2504	0.0																2	Substitution - Missense(2)	large_intestine(2)						G	THR/ALA	0,4406		0,0,2203	137.0	134.0	135.0		796	2.4	0.0	1	dbSNP_134	135	1,8599	1.2+/-3.3	0,1,4299	no	missense	AADACL4	NM_001013630.1	58	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	266/408	12726318	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS30590.1	1p36.21	2010-12-14			ENSG00000204518	ENSG00000204518			32038	protein-coding gene	gene with protein product							Standard	XM_006710608		Approved	OTTHUMG00000001889	uc001auf.3	Q5VUY2	OTTHUMG00000001889	ENST00000376221.1:c.796G>A	1.37:g.12726318G>A	ENSP00000365395:p.Ala266Thr			Missense_Mutation	SNP	pfam_AB_hydrolase_3,pirsf_Arylacetamide_deacetylase	p.A266T	ENST00000376221.1	37	c.796	CCDS30590.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	11.05	1.524004	0.27299	0.0	1.16E-4	ENSG00000204518	ENST00000376221	T	0.59083	0.29	4.38	2.44	0.29823	.	0.382752	0.24561	N	0.037470	T	0.38268	0.1034	L	0.31294	0.92	0.09310	N	1	B	0.32731	0.382	B	0.28139	0.086	T	0.16541	-1.0399	10	0.32370	T	0.25	-20.033	7.5085	0.27560	0.1645:0.1364:0.6991:0.0	.	266	Q5VUY2	ADCL4_HUMAN	T	266	ENSP00000365395:A266T	ENSP00000365395:A266T	A	+	1	0	AADACL4	12648905	0.000000	0.05858	0.006000	0.13384	0.002000	0.02628	-0.356000	0.07661	1.034000	0.39945	0.655000	0.94253	GCC	AADACL4	-	pirsf_Arylacetamide_deacetylase	ENSG00000204518		0.502	AADACL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AADACL4	HGNC	protein_coding	OTTHUMT00000005328.1		0.00	26	0	G	NM_001013630		12726318	+1			no_errors	ENST00000376221	ensembl	human	known	74_37	missense	13.33	13	2	SNP	0.001	A
ABCA12	26154	genome.wustl.edu	37	2	215815790	215815790	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:215815790A>C	ENST00000272895.7	-	45	6884	c.6665T>G	c.(6664-6666)tTt>tGt	p.F2222C	ABCA12_ENST00000389661.4_Missense_Mutation_p.F1904C|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2222					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TGAAGAATTAAATTTTCTGAA	0.373																																					Ovarian(66;664 1488 5121 34295)												0													139.0	139.0	139.0					2																	215815790		2203	4300	6503	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6665T>G	2.37:g.215815790A>C	ENSP00000272895:p.Phe2222Cys		Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.F2222C	ENST00000272895.7	37	c.6665	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	A	13.75	2.329043	0.41197	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.88818	-2.43;-2.43	5.61	5.61	0.85477	.	0.218651	0.31246	N	0.008000	D	0.86969	0.6061	N	0.19112	0.55	0.80722	D	1	P;P	0.49358	0.898;0.923	B;P	0.53401	0.428;0.725	D	0.87037	0.2138	10	0.38643	T	0.18	.	14.8048	0.69945	1.0:0.0:0.0:0.0	.	2222;1904	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	C	2222;1904	ENSP00000272895:F2222C;ENSP00000374312:F1904C	ENSP00000272895:F2222C	F	-	2	0	ABCA12	215524035	0.992000	0.36948	0.796000	0.32109	0.979000	0.70002	2.331000	0.43894	2.133000	0.65898	0.454000	0.30748	TTT	ABCA12	-	NULL	ENSG00000144452		0.373	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	-	0.00	50	0	A	NM_173076		215815790	-1	tier1	-	no_errors	ENST00000272895	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.994	C
ABCA13	154664	genome.wustl.edu	37	7	48315875	48315875	+	Silent	SNP	T	T	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:48315875T>G	ENST00000435803.1	+	17	6636	c.6612T>G	c.(6610-6612)ctT>ctG	p.L2204L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2204					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTCAGCTGCTTTTTGAAAACA	0.333																																																	0													26.0	23.0	24.0					7																	48315875		1805	4062	5867	SO:0001819	synonymous_variant	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.6612T>G	7.37:g.48315875T>G			K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Silent	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L2204	ENST00000435803.1	37	c.6612	CCDS47584.1	7																																																																																			ABCA13	-	NULL	ENSG00000179869		0.333	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	-	0.00	72	0	T	NM_152701		48315875	+1	tier1	-	no_errors	ENST00000435803	ensembl	human	known	74_37	silent	34.62	51	27	SNP	0.975	G
ABCA3	21	genome.wustl.edu	37	16	2338177	2338177	+	Missense_Mutation	SNP	C	C	T	rs144138653	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:2338177C>T	ENST00000301732.5	-	21	3554	c.2854G>A	c.(2854-2856)Gac>Aac	p.D952N	ABCA3_ENST00000382381.3_Missense_Mutation_p.D894N	NM_001089.2	NP_001080.2	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 3	952					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)	alveolar lamellar body (GO:0097208)|alveolar lamellar body membrane (GO:0097233)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(7)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(7)|prostate(5)|skin(6)|upper_aerodigestive_tract(1)	70		Ovarian(90;0.17)			Imatinib(DB00619)	ATGGGGTCGTCGAAGAGCTCC	0.642													C|||	2	0.000399361	0.0	0.0	5008	,	,		15806	0.0		0.002	False		,,,				2504	0.0																0								C	ASN/ASP	4,4392	8.1+/-20.4	0,4,2194	65.0	53.0	57.0		2854	5.3	0.1	16	dbSNP_134	57	0,8598		0,0,4299	yes	missense	ABCA3	NM_001089.2	23	0,4,6493	TT,TC,CC		0.0,0.091,0.0308	benign	952/1705	2338177	4,12990	2198	4299	6497	SO:0001583	missense	0			U78735	CCDS10466.1	16p13.3	2012-03-14			ENSG00000167972	ENSG00000167972		"""ATP binding cassette transporters / subfamily A"""	33	protein-coding gene	gene with protein product		601615		ABC3		8706931	Standard	NM_001089		Approved	ABC-C, EST111653, LBM180	uc002cpy.1	Q99758	OTTHUMG00000128845	ENST00000301732.5:c.2854G>A	16.37:g.2338177C>T	ENSP00000301732:p.Asp952Asn		B2RU09|Q54A95|Q6P5P9|Q92473	Missense_Mutation	SNP	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.D952N	ENST00000301732.5	37	c.2854	CCDS10466.1	16	.	.	.	.	.	.	.	.	.	.	C	10.29	1.308188	0.23821	9.1E-4	0.0	ENSG00000167972	ENST00000301732;ENST00000382381	D	0.95980	-3.87	5.27	5.27	0.74061	.	0.103112	0.64402	D	0.000004	D	0.94315	0.8173	L	0.59912	1.85	0.80722	D	1	B;B	0.33288	0.406;0.245	B;B	0.35240	0.198;0.09	D	0.93629	0.6954	10	0.51188	T	0.08	.	17.6531	0.88170	0.0:1.0:0.0:0.0	.	956;952	Q4LE27;Q99758	.;ABCA3_HUMAN	N	952;956	ENSP00000301732:D952N	ENSP00000301732:D952N	D	-	1	0	ABCA3	2278178	0.985000	0.35326	0.082000	0.20525	0.087000	0.18053	3.208000	0.51114	2.735000	0.93741	0.655000	0.94253	GAC	ABCA3	-	NULL	ENSG00000167972		0.642	ABCA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA3	HGNC	protein_coding	OTTHUMT00000250784.2	-	0.00	60	0	C	NM_001089		2338177	-1	tier1	rs144138653	no_errors	ENST00000301732	ensembl	human	known	74_37	missense	47.50	21	19	SNP	0.409	T
ABCC11	85320	genome.wustl.edu	37	16	48220864	48220864	+	Splice_Site	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:48220864T>C	ENST00000394747.1	-	21	3420	c.3071A>G	c.(3070-3072)cAg>cGg	p.Q1024R	ABCC11_ENST00000565329.1_5'UTR|ABCC11_ENST00000353782.5_Splice_Site_p.Q1024R|ABCC11_ENST00000394748.1_Splice_Site_p.Q1024R|ABCC11_ENST00000356608.2_Splice_Site_p.Q1024R	NM_033151.3	NP_149163.2	Q96J66	ABCCB_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 11	1024	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				organic anion transport (GO:0015711)|purine nucleotide transport (GO:0015865)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)|purine nucleotide transmembrane transporter activity (GO:0015216)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(3)|prostate(2)|skin(5)|urinary_tract(2)	83		all_cancers(37;0.127)|all_lung(18;0.132)|Breast(268;0.166)			Conjugated Estrogens(DB00286)|Folic Acid(DB00158)|Indomethacin(DB00328)|Methotrexate(DB00563)|Probenecid(DB01032)	AAGGACTCACTGGCTGATGAA	0.498																																																	0													77.0	70.0	72.0					16																	48220864		2201	4300	6501	SO:0001630	splice_region_variant	0			AF367202	CCDS10732.1, CCDS10733.1	16q12	2012-03-14			ENSG00000121270	ENSG00000121270		"""ATP binding cassette transporters / subfamily C"""	14639	protein-coding gene	gene with protein product		607040				11483364, 11435397	Standard	NM_033151		Approved	MRP8	uc002efg.1	Q96J66	OTTHUMG00000133146	ENST00000394747.1:c.3071+1A>G	16.37:g.48220864T>C			Q8TDJ0|Q96JA6|Q9BX80	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.Q1024R	ENST00000394747.1	37	c.3071	CCDS10732.1	16	.	.	.	.	.	.	.	.	.	.	T	2.587	-0.296156	0.05532	.	.	ENSG00000121270	ENST00000353782;ENST00000356608;ENST00000394748;ENST00000394747	D;D;D;D	0.87029	-2.2;-2.2;-2.2;-2.2	5.58	1.97	0.26223	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	1.391760	0.04531	N	0.386330	T	0.67154	0.2863	N	0.01779	-0.725	0.80722	D	1	B;B	0.15719	0.014;0.006	B;B	0.17098	0.004;0.017	T	0.60010	-0.7346	9	.	.	.	-0.7787	2.2272	0.03987	0.1567:0.0858:0.1635:0.5941	.	1024;1024	Q96J66-2;Q96J66	.;ABCCB_HUMAN	R	1024	ENSP00000311326:Q1024R;ENSP00000349017:Q1024R;ENSP00000378231:Q1024R;ENSP00000378230:Q1024R	.	Q	-	2	0	ABCC11	46778365	0.001000	0.12720	0.206000	0.23566	0.982000	0.71751	-0.418000	0.07080	0.052000	0.16007	0.460000	0.39030	CAG	ABCC11	-	pfam_ABC_transptr_TM_dom,superfamily_ABC1_TM_dom,pfscan_ABC1_TM_dom	ENSG00000121270		0.498	ABCC11-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABCC11	HGNC	protein_coding	OTTHUMT00000429984.1	-	0.00	55	0	T	NM_032583	Missense_Mutation	48220864	-1	tier1	-	no_errors	ENST00000356608	ensembl	human	known	74_37	missense	27.78	26	10	SNP	0.151	C
ABI3BP	25890	genome.wustl.edu	37	3	100539928	100539928	+	Intron	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:100539928G>T	ENST00000284322.5	-	19	1707				ABI3BP_ENST00000495063.1_Missense_Mutation_p.L893I|ABI3BP_ENST00000383691.4_Missense_Mutation_p.L257I|ABI3BP_ENST00000471714.1_Missense_Mutation_p.L980I	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein						extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						TCAGTTCTGAGTGTAACAGGT	0.363																																																	0																																										SO:0001627	intron_variant	0			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1598-12849C>A	3.37:g.100539928G>T			B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.L257I	ENST00000284322.5	37	c.769	CCDS46880.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.255|7.255	0.604038|0.604038	0.14002|0.14002	.|.	.|.	ENSG00000154175|ENSG00000154175	ENST00000495591;ENST00000471901|ENST00000471714;ENST00000383691;ENST00000495063	.|T;T;T	.|0.56941	.|0.43;0.43;0.43	5.25|5.25	-3.09|-3.09	0.05331|0.05331	.|.	.|.	.|.	.|.	.|.	T|T	0.29817|0.29817	0.0745|0.0745	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.06786	.|0.0;0.001;0.0	.|B;B;B	.|0.08055	.|0.001;0.003;0.001	T|T	0.18085|0.18085	-1.0348|-1.0348	4|8	.|0.37606	.|T	.|0.19	.|.	0.7352|0.7352	0.00964|0.00964	0.1999:0.2498:0.2986:0.2518|0.1999:0.2498:0.2986:0.2518	.|.	.|257;893;980	.|B4DSV9;Q5JPC9;D3YTG3	.|.;.;.	Q|I	358;102|980;257;893	.|ENSP00000420524:L980I;ENSP00000373189:L257I;ENSP00000433993:L893I	.|ENSP00000373189:L257I	H|L	-|-	3|1	2|0	ABI3BP|ABI3BP	102022618|102022618	0.001000|0.001000	0.12720|0.12720	0.003000|0.003000	0.11579|0.11579	0.658000|0.658000	0.38924|0.38924	-0.629000|-0.629000	0.05508|0.05508	-0.438000|-0.438000	0.07232|0.07232	0.655000|0.655000	0.94253|0.94253	CAC|CTC	ABI3BP	-	NULL	ENSG00000154175		0.363	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	HGNC	protein_coding	OTTHUMT00000353260.1	-	0.00	68	0	G			100539928	-1	tier1	-	no_errors	ENST00000383691	ensembl	human	known	74_37	missense	10.00	36	4	SNP	0.002	T
ADAD2	161931	genome.wustl.edu	37	16	84230321	84230321	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:84230321G>T	ENST00000315906.5	+	9	1647	c.1595G>T	c.(1594-1596)aGg>aTg	p.R532M	RP11-486L19.2_ENST00000569834.1_RNA|RP11-486L19.2_ENST00000536986.1_RNA|ADAD2_ENST00000268624.3_Missense_Mutation_p.R614M|RP11-486L19.2_ENST00000561900.1_RNA|RP11-486L19.2_ENST00000565643.1_RNA	NM_001145400.1	NP_001138872.1	Q8NCV1	ADAD2_HUMAN	adenosine deaminase domain containing 2	532	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				RNA processing (GO:0006396)		adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|skin(1)	13						CAGGCGGCCAGGGCTGTGGGG	0.657																																																	0													61.0	64.0	63.0					16																	84230321		2200	4300	6500	SO:0001583	missense	0			AF447586	CCDS10944.1, CCDS45536.1	16q24.1	2007-05-31			ENSG00000140955	ENSG00000140955			30714	protein-coding gene	gene with protein product							Standard	NM_139174		Approved	TENRL, FLJ00337	uc002fhr.2	Q8NCV1	OTTHUMG00000137637	ENST00000315906.5:c.1595G>T	16.37:g.84230321G>T	ENSP00000325153:p.Arg532Met		B2RCL6|Q8NA94	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA-bd_dom,smart_A_deamin,pfscan_dsRNA-bd_dom,pfscan_A_deamin	p.R614M	ENST00000315906.5	37	c.1841	CCDS45536.1	16	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941736	0.34283	.	.	ENSG00000140955	ENST00000315906;ENST00000268624	D;D	0.93953	-3.32;-3.32	5.27	-5.3	0.02738	Adenosine deaminase/editase (2);	2.272360	0.01894	N	0.038796	D	0.94255	0.8155	M	0.74467	2.265	0.09310	N	1	D;D	0.62365	0.98;0.991	P;P	0.54060	0.656;0.741	D	0.88476	0.3065	10	0.66056	D	0.02	2.9537	7.6471	0.28327	0.639:0.1219:0.2391:0.0	.	532;614	Q8NCV1;Q8NCV1-2	ADAD2_HUMAN;.	M	532;614	ENSP00000325153:R532M;ENSP00000268624:R614M	ENSP00000268624:R614M	R	+	2	0	ADAD2	82787822	0.000000	0.05858	0.000000	0.03702	0.133000	0.20885	-0.291000	0.08343	-1.206000	0.02641	0.585000	0.79938	AGG	ADAD2	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin	ENSG00000140955		0.657	ADAD2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD2	HGNC	protein_coding	OTTHUMT00000433385.1		0.00	60	0	G	NM_139174		84230321	+1			no_errors	ENST00000268624	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.000	T
ADAM21P1	145241	genome.wustl.edu	37	14	70713687	70713687	+	RNA	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr14:70713687C>T	ENST00000530196.1	-	0	831					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		TCCTCTTGCACCTTTGAGATG	0.383																																																	0																																												0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713687C>T				RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.383	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1		0.00	84	0	C	NG_002467		70713687	-1			no_errors	ENST00000530196	ensembl	human	known	74_37	rna	8.57	64	6	SNP	0.004	T
ADAM28	10863	genome.wustl.edu	37	8	24199233	24199233	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:24199233G>T	ENST00000265769.4	+	16	1903	c.1793G>T	c.(1792-1794)gGc>gTc	p.G598V	RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM28_ENST00000397649.3_Missense_Mutation_p.G345V	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	598	Cys-rich.				spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		CAAGAAATAGGCATGGTGGCC	0.403																																					NSCLC(193;488 2149 22258 34798 40734)												0													188.0	180.0	182.0					8																	24199233		2203	4300	6503	SO:0001583	missense	0			AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.1793G>T	8.37:g.24199233G>T	ENSP00000265769:p.Gly598Val		B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.G598V	ENST00000265769.4	37	c.1793	CCDS34865.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.66|13.66	2.302086|2.302086	0.40694|0.40694	.|.	.|.	ENSG00000042980|ENSG00000042980	ENST00000265769;ENST00000397649|ENST00000521629;ENST00000518326	T;T|.	0.18016|.	2.24;2.24|.	5.84|5.84	0.255|0.255	0.15561|0.15561	ADAM, cysteine-rich (1);|.	.|.	.|.	.|.	.|.	T|T	0.73313|0.73313	0.3571|0.3571	M|M	0.92784|0.92784	3.345|3.345	0.54753|0.54753	D|D	0.999989|0.999989	D;D|.	0.62365|.	0.991;0.991|.	P;P|.	0.62740|.	0.906;0.906|.	T|T	0.70586|0.70586	-0.4831|-0.4831	9|5	0.87932|.	D|.	0|.	.|.	1.2949|1.2949	0.02067|0.02067	0.4453:0.1601:0.249:0.1456|0.4453:0.1601:0.249:0.1456	.|.	598;598|.	B2RMV5;Q9UKQ2|.	.;ADA28_HUMAN|.	V|S	598;345|230;23	ENSP00000265769:G598V;ENSP00000380770:G345V|.	ENSP00000265769:G598V|.	G|R	+|+	2|3	0|2	ADAM28|ADAM28	24255178|24255178	0.988000|0.988000	0.35896|0.35896	0.958000|0.958000	0.39756|0.39756	0.538000|0.538000	0.34931|0.34931	0.591000|0.591000	0.23969|0.23969	0.309000|0.309000	0.22966|0.22966	-0.136000|-0.136000	0.14681|0.14681	GGC|AGG	ADAM28	-	smart_ADAM_Cys-rich	ENSG00000042980		0.403	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	HGNC	protein_coding	OTTHUMT00000375441.2	-	0.00	72	0	G	NM_021778		24199233	+1	tier1	-	no_errors	ENST00000265769	ensembl	human	known	74_37	missense	25.64	58	20	SNP	0.025	T
ADAMTS2	9509	genome.wustl.edu	37	5	178585827	178585827	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:178585827G>A	ENST00000251582.7	-	6	1130	c.1029C>T	c.(1027-1029)tgC>tgT	p.C343C	ADAMTS2_ENST00000274609.5_Silent_p.C343C	NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	343	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		AGGCCCAGCGGCAGACATTCT	0.602																																																	0													102.0	91.0	95.0					5																	178585827		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.1029C>T	5.37:g.178585827G>A				Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS	p.C343	ENST00000251582.7	37	c.1029	CCDS4444.1	5																																																																																			ADAMTS2	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000087116		0.602	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	-	0.00	38	0	G	NM_014244		178585827	-1	tier1	-	no_errors	ENST00000251582	ensembl	human	known	74_37	silent	18.18	18	4	SNP	1.000	A
ADH1A	124	genome.wustl.edu	37	4	100205628	100205628	+	Silent	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:100205628C>T	ENST00000209668.2	-	5	608	c.495G>A	c.(493-495)tcG>tcA	p.S165S	ADH1A_ENST00000511656.1_5'Flank|RP11-696N14.1_ENST00000500358.2_RNA	NM_000667.3	NP_000658.1	P07327	ADH1A_HUMAN	alcohol dehydrogenase 1A (class I), alpha polypeptide	165					alcohol metabolic process (GO:0006066)|drug metabolic process (GO:0017144)|ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|zinc ion binding (GO:0008270)	p.S165S(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(1)	25				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Ethanol(DB00898)|Fomepizole(DB01213)	TCTCTAGAGGCGAGGCTGCAT	0.478																																																	1	Substitution - coding silent(1)	large_intestine(1)											97.0	93.0	95.0					4																	100205628		2203	4300	6503	SO:0001819	synonymous_variant	0			M12963	CCDS3648.1	4q23	2009-12-04			ENSG00000187758	ENSG00000187758	1.1.1.1	"""Alcohol dehydrogenases"""	249	protein-coding gene	gene with protein product		103700		ADH1		3006456	Standard	NM_000667		Approved		uc003hur.2	P07327	OTTHUMG00000131026	ENST00000209668.2:c.495G>A	4.37:g.100205628C>T			A8K3E3|Q17R68	Silent	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,smart_PKS_ER	p.S165	ENST00000209668.2	37	c.495	CCDS3648.1	4																																																																																			ADH1A	-	superfamily_GroES-like,smart_PKS_ER	ENSG00000187758		0.478	ADH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADH1A	HGNC	protein_coding	OTTHUMT00000253669.1	-	0.00	82	0	C	NM_000667		100205628	-1	tier1	-	no_errors	ENST00000209668	ensembl	human	known	74_37	silent	71.19	17	42	SNP	0.952	T
ADRB2	154	genome.wustl.edu	37	5	148206658	148206659	+	Frame_Shift_Ins	INS	-	-	T	rs145233416		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:148206658_148206659insT	ENST00000305988.4	+	1	503_504	c.264_265insT	c.(265-267)tttfs	p.F89fs		NM_000024.5	NP_000015	P07550	ADRB2_HUMAN	adrenoceptor beta 2, surface	89					activation of adenylate cyclase activity (GO:0007190)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|bone resorption (GO:0045453)|brown fat cell differentiation (GO:0050873)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway by arrestin (GO:0002032)|diet induced thermogenesis (GO:0002024)|endosome to lysosome transport (GO:0008333)|heat generation (GO:0031649)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of smooth muscle contraction (GO:0045986)|positive regulation of bone mineralization (GO:0030501)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor-mediated endocytosis (GO:0006898)|regulation of sodium ion transport (GO:0002028)|regulation of vasodilation (GO:0042312)|response to cold (GO:0009409)|vasodilation by norepinephrine-epinephrine involved in regulation of systemic arterial blood pressure (GO:0002025)	apical plasma membrane (GO:0016324)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	beta2-adrenergic receptor activity (GO:0004941)|norepinephrine binding (GO:0051380)|potassium channel regulator activity (GO:0015459)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|lung(8)|ovary(1)|prostate(3)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Acebutolol(DB01193)|Alprenolol(DB00866)|Amitriptyline(DB00321)|Amphetamine(DB00182)|Arbutamine(DB01102)|Arformoterol(DB01274)|Asenapine(DB06216)|Atenolol(DB00335)|Bambuterol(DB01408)|Betaxolol(DB00195)|Bethanidine(DB00217)|Bevantolol(DB01295)|Bisoprolol(DB00612)|Bopindolol(DB08807)|Bupranolol(DB08808)|Cabergoline(DB00248)|Carteolol(DB00521)|Carvedilol(DB01136)|Clenbuterol(DB01407)|Desipramine(DB01151)|Dipivefrin(DB00449)|Dobutamine(DB00841)|Droxidopa(DB06262)|Ephedra(DB01363)|Epinephrine(DB00668)|Fenoterol(DB01288)|Formoterol(DB00983)|Indacaterol(DB05039)|Isoetarine(DB00221)|Isoprenaline(DB01064)|Labetalol(DB00598)|Levobunolol(DB01210)|Mephentermine(DB01365)|Metipranolol(DB01214)|Metoprolol(DB00264)|Mirtazapine(DB00370)|Nadolol(DB01203)|Nebivolol(DB04861)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Orciprenaline(DB00816)|Oxprenolol(DB01580)|Penbutolol(DB01359)|Phenoxybenzamine(DB00925)|Phenylpropanolamine(DB00397)|Pindolol(DB00960)|Pirbuterol(DB01291)|Procaterol(DB01366)|Propranolol(DB00571)|Pseudoephedrine(DB00852)|Ritodrine(DB00867)|Salbutamol(DB01001)|Salmeterol(DB00938)|Sotalol(DB00489)|Terbutaline(DB00871)|Timolol(DB00373)|Trimipramine(DB00726)	CAGTGGTGCCCTTTGGGGCCGC	0.53																																																	0																																										SO:0001589	frameshift_variant	0			AF022953	CCDS4292.1	5q31-q32	2012-08-08	2012-05-09		ENSG00000169252	ENSG00000169252		"""GPCR / Class A : Adrenoceptors : beta"""	286	protein-coding gene	gene with protein product		109690	"""adrenergic, beta-2-, receptor, surface"""	ADRB2R			Standard	NM_000024		Approved	ADRBR, BAR, B2AR	uc003lpr.2	P07550	OTTHUMG00000129933	ENST00000305988.4:c.267dupT	5.37:g.148206661_148206661dupT	ENSP00000305372:p.Phe89fs		B0LPE4|B2R7X2|O14823|O14824|O14825|O14826|Q4JG18|Q53GA6|Q6GMT4|Q6P4D8|Q8NEQ9|Q96EC3|Q9UCZ0|Q9UCZ1|Q9UCZ2|Q9UCZ3|Q9UH95|Q9UHA1|Q9UMZ5	Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ADRB2_rcpt,prints_GPCR_Rhodpsn,prints_ADR_fam	p.G89fs	ENST00000305988.4	37	c.264_265	CCDS4292.1	5																																																																																			ADRB2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_ADR_fam	ENSG00000169252		0.530	ADRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADRB2	HGNC	protein_coding	OTTHUMT00000252189.1		0.00	41	0	-	NM_000024		148206659	+1	tier1		no_errors	ENST00000305988	ensembl	human	known	74_37	frame_shift_ins	13.33	13	2	INS	0.996:1.000	T
AGO4	192670	genome.wustl.edu	37	1	36291647	36291647	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:36291647C>A	ENST00000373210.3	+	6	991	c.746C>A	c.(745-747)aCc>aAc	p.T249N		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	249	PAZ. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										GTCAAATTTACCAAAGAAATC	0.463																																																	0													109.0	103.0	105.0					1																	36291647		2203	4300	6503	SO:0001583	missense	0			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.746C>A	1.37:g.36291647C>A	ENSP00000362306:p.Thr249Asn		A7MD27	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.T249N	ENST00000373210.3	37	c.746	CCDS397.1	1	.	.	.	.	.	.	.	.	.	.	C	18.43	3.622250	0.66787	.	.	ENSG00000134698	ENST00000373210	T	0.14266	2.52	5.53	5.53	0.82687	Argonaute/Dicer protein, PAZ (4);	0.000000	0.85682	D	0.000000	T	0.21921	0.0528	L	0.60067	1.865	0.80722	D	1	B	0.14805	0.011	B	0.30401	0.115	T	0.02546	-1.1143	10	0.41790	T	0.15	-11.8358	19.4664	0.94945	0.0:1.0:0.0:0.0	.	249	Q9HCK5	AGO4_HUMAN	N	249	ENSP00000362306:T249N	ENSP00000362306:T249N	T	+	2	0	EIF2C4	36064234	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.595000	0.87683	0.557000	0.71058	ACC	AGO4	-	pfam_PAZ_dom,superfamily_PAZ_dom,smart_PAZ_dom,pfscan_PAZ_dom	ENSG00000134698		0.463	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGO4	HGNC	protein_coding	OTTHUMT00000012213.3	-	0.00	47	0	C	NM_017629		36291647	+1	tier1	-	no_errors	ENST00000373210	ensembl	human	known	74_37	missense	10.81	33	4	SNP	1.000	A
AHCYL2	23382	genome.wustl.edu	37	7	129040146	129040146	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:129040146C>T	ENST00000325006.3	+	6	893	c.839C>T	c.(838-840)gCc>gTc	p.A280V	AHCYL2_ENST00000474594.1_Missense_Mutation_p.A177V|AHCYL2_ENST00000446544.2_Missense_Mutation_p.A279V|AHCYL2_ENST00000446212.1_Missense_Mutation_p.A178V|AHCYL2_ENST00000490911.1_Missense_Mutation_p.A177V|AHCYL2_ENST00000531335.2_Missense_Mutation_p.A199V	NM_001130720.2|NM_015328.3	NP_001124192.1|NP_056143.1	Q96HN2	SAHH3_HUMAN	adenosylhomocysteinase-like 2	280					one-carbon metabolic process (GO:0006730)		adenosylhomocysteinase activity (GO:0004013)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	22						CCTGTTTTTGCCTGGAAGGGA	0.438																																					Pancreas(160;1736 1964 29875 40941 45605)												0													172.0	172.0	172.0					7																	129040146		2203	4300	6503	SO:0001583	missense	0			AB020635	CCDS5812.1, CCDS47706.1, CCDS47707.1, CCDS47708.1, CCDS47707.2	7q32.1	2009-06-12	2009-06-12		ENSG00000158467	ENSG00000158467			22204	protein-coding gene	gene with protein product			"""S-adenosylhomocysteine hydrolase-like 2"""				Standard	NM_001130720		Approved	KIAA0828	uc011kov.2	Q96HN2	OTTHUMG00000157677	ENST00000325006.3:c.839C>T	7.37:g.129040146C>T	ENSP00000315931:p.Ala280Val		B4DIZ5|D9N155|O94917	Missense_Mutation	SNP	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,tigrfam_Adenosylhomocysteinase	p.A280V	ENST00000325006.3	37	c.839	CCDS5812.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.309818|5.309818	0.95629|0.95629	.|.	.|.	ENSG00000158467|ENSG00000158467	ENST00000325006;ENST00000446544;ENST00000531335;ENST00000474594;ENST00000446212;ENST00000490911;ENST00000466993|ENST00000466924	D;D;D;D;D;D;D|.	0.84442|.	-1.85;-1.85;-1.85;-1.85;-1.85;-1.85;-1.69|.	4.96|4.96	4.96|4.96	0.65561|0.65561	.|.	0.049538|.	0.85682|.	D|.	0.000000|.	D|D	0.90823|0.90823	0.7118|0.7118	H|H	0.98721|0.98721	4.31|4.31	0.58432|0.58432	D|D	0.999997|0.999997	P;D;D;D;D|.	0.65815|.	0.854;0.994;0.995;0.994;0.994|.	P;P;P;P;P|.	0.59948|.	0.538;0.866;0.763;0.866;0.65|.	D|D	0.94568|0.94568	0.7768|0.7768	10|5	0.87932|.	D|.	0|.	-15.4281|-15.4281	17.128|17.128	0.86719|0.86719	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	177;178;280;177;279|.	B4DIZ5;D7UEQ7;Q96HN2;D9N155;Q96HN2-2|.	.;.;SAHH3_HUMAN;.;.|.	V|S	280;279;199;177;178;177;178|187	ENSP00000315931:A280V;ENSP00000413639:A279V;ENSP00000431787:A199V;ENSP00000420459:A177V;ENSP00000405267:A178V;ENSP00000420801:A177V;ENSP00000419608:A178V|.	ENSP00000315931:A280V|.	A|P	+|+	2|1	0|0	AHCYL2|AHCYL2	128827382|128827382	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.948000|0.948000	0.59901|0.59901	7.450000|7.450000	0.80656|0.80656	2.446000|2.446000	0.82766|0.82766	0.563000|0.563000	0.77884|0.77884	GCC|CCT	AHCYL2	-	pfam_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	ENSG00000158467		0.438	AHCYL2-012	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHCYL2	HGNC	protein_coding	OTTHUMT00000354065.1	-	0.00	74	0	C			129040146	+1	tier1	-	no_errors	ENST00000325006	ensembl	human	known	74_37	missense	6.56	57	4	SNP	1.000	T
AKAP1	8165	genome.wustl.edu	37	17	55195798	55195798	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:55195798A>C	ENST00000337714.3	+	9	2790	c.2557A>C	c.(2557-2559)Aca>Cca	p.T853P	AKAP1_ENST00000571629.1_Missense_Mutation_p.T853P|AKAP1_ENST00000572557.1_Missense_Mutation_p.T853P|AKAP1_ENST00000539273.1_Missense_Mutation_p.T853P	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	853					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					GACGGGGAATACAGCACTGCT	0.557																																																	0													113.0	100.0	104.0					17																	55195798		2203	4300	6503	SO:0001583	missense	0			X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.2557A>C	17.37:g.55195798A>C	ENSP00000337736:p.Thr853Pro		A8K8Q1|D3DTZ0|Q13320|Q9BW14	Missense_Mutation	SNP	pfam_Tudor,pfam_KH_dom_type_1,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.T853P	ENST00000337714.3	37	c.2557	CCDS11594.1	17	.	.	.	.	.	.	.	.	.	.	A	11.99	1.804368	0.31869	.	.	ENSG00000121057	ENST00000337714;ENST00000427138;ENST00000539273	T;T	0.15139	2.45;2.45	5.09	1.64	0.23874	.	0.186206	0.49305	D	0.000151	T	0.19406	0.0466	N	0.22421	0.69	0.42641	D	0.993413	D	0.71674	0.998	P	0.59221	0.854	T	0.01648	-1.1304	10	0.59425	D	0.04	-5.535	8.3012	0.32014	0.6565:0.0:0.3435:0.0	.	853	Q92667	AKAP1_HUMAN	P	853;895;853	ENSP00000337736:T853P;ENSP00000443139:T853P	ENSP00000337736:T853P	T	+	1	0	AKAP1	52550797	0.234000	0.23783	0.524000	0.27887	0.952000	0.60782	1.076000	0.30729	0.087000	0.17167	0.533000	0.62120	ACA	AKAP1	-	NULL	ENSG00000121057		0.557	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP1	HGNC	protein_coding	OTTHUMT00000277069.1	-	0.00	47	0	A			55195798	+1	tier1	-	no_errors	ENST00000337714	ensembl	human	known	74_37	missense	30.00	21	9	SNP	0.342	C
ALPK1	80216	genome.wustl.edu	37	4	113345108	113345108	+	Silent	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:113345108T>C	ENST00000458497.1	+	6	763	c.484T>C	c.(484-486)Tta>Cta	p.L162L	ALPK1_ENST00000504176.2_Silent_p.L84L|ALPK1_ENST00000177648.9_Silent_p.L162L	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	162							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		AGGAAAACTTTTAAAAGCAGA	0.378																																																	0													104.0	98.0	100.0					4																	113345108		2203	4300	6503	SO:0001819	synonymous_variant	0			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.484T>C	4.37:g.113345108T>C			B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	NULL	p.F110S	ENST00000458497.1	37	c.329	CCDS3697.1	4																																																																																			ALPK1	-	NULL	ENSG00000073331		0.378	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	HGNC	protein_coding	OTTHUMT00000256421.2		0.00	88	0	T	NM_025144		113345108	+1			no_errors	ENST00000509722	ensembl	human	known	74_37	missense	6.25	30	2	SNP	0.096	C
AMICA1	120425	genome.wustl.edu	37	11	118083141	118083141	+	Nonsense_Mutation	SNP	G	G	T	rs377011204		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:118083141G>T	ENST00000356289.5	-	3	352	c.179C>A	c.(178-180)tCa>tAa	p.S60*	AMICA1_ENST00000533261.1_Nonsense_Mutation_p.S60*|AMICA1_ENST00000526620.1_Nonsense_Mutation_p.S21*|AMICA1_ENST00000292067.7_Nonsense_Mutation_p.S50*	NM_001098526.1	NP_001091996.1	Q86YT9	JAML1_HUMAN	adhesion molecule, interacts with CXADR antigen 1	60	Ig-like V-type 1.				blood coagulation (GO:0007596)|gamma-delta T cell activation (GO:0046629)|heterophilic cell-cell adhesion (GO:0007157)|leukocyte migration (GO:0050900)|monocyte extravasation (GO:0035696)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|regulation of immune response (GO:0050776)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	cell adhesion molecule binding (GO:0050839)|integrin binding (GO:0005178)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(1)|stomach(2)	20	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CTCTCCTGGTGACAGAGTCCA	0.502																																																	0													120.0	108.0	112.0					11																	118083141		2200	4296	6496	SO:0001587	stop_gained	0			AY138965, AY358362	CCDS8391.1, CCDS41723.1, CCDS66240.1	11q23.3	2013-01-11				ENSG00000160593		"""Immunoglobulin superfamily / V-set domain containing"""	19084	protein-coding gene	gene with protein product		609770				12975309	Standard	NM_001098526		Approved	Gm638, AMICA	uc001psk.2	Q86YT9		ENST00000356289.5:c.179C>A	11.37:g.118083141G>T	ENSP00000348635:p.Ser60*		B0YIV1|B0YIV2|Q496M1|Q5DTC6|Q7Z499|Q8N9I7|Q8NF70	Nonsense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	p.S60*	ENST00000356289.5	37	c.179	CCDS41723.1	11	.	.	.	.	.	.	.	.	.	.	G	37	6.163195	0.97338	.	.	ENSG00000160593	ENST00000356289;ENST00000292067;ENST00000533261;ENST00000526620;ENST00000537867;ENST00000524477;ENST00000525565	.	.	.	5.25	4.35	0.52113	.	0.000000	0.39615	N	0.001320	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-13.3033	9.6377	0.39819	0.0932:0.0:0.9068:0.0	.	.	.	.	X	60;50;60;21;21;21;60	.	ENSP00000292067:S50X	S	-	2	0	AMICA1	117588351	0.971000	0.33674	0.025000	0.17156	0.002000	0.02628	4.235000	0.58666	1.452000	0.47756	0.655000	0.94253	TCA	AMICA1	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000160593		0.502	AMICA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMICA1	HGNC	protein_coding	OTTHUMT00000392105.2		0.00	67	0	G	NM_153206		118083141	-1			no_errors	ENST00000356289	ensembl	human	known	74_37	nonsense	10.26	35	4	SNP	0.064	T
AMY2B	280	genome.wustl.edu	37	1	104112709	104112709	+	Intron	SNP	C	C	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:104112709C>G	ENST00000361355.4	+	3	570				AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)						carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TGCATCTGGACCTGGCTGGCC	0.557																																																	0																																										SO:0001627	intron_variant	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.-46-1470C>G	1.37:g.104112709C>G			B3KTI1|B3KXB7|D3DT76|Q9UBH3	RNA	SNP	-	NULL	ENST00000361355.4	37	NULL	CCDS782.1	1																																																																																			AMY2B	-	-	ENSG00000240038		0.557	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	-	0.00	41	0	C	NM_020978		104112709	+1	tier1	-	no_errors	ENST00000491397	ensembl	human	known	74_37	rna	9.52	38	4	SNP	1.000	G
AMPD1	270	genome.wustl.edu	37	1	115221045	115221045	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:115221045G>A	ENST00000520113.2	-	8	1115	c.1100C>T	c.(1099-1101)aCc>aTc	p.T367I	AMPD1_ENST00000369538.3_Missense_Mutation_p.T363I|AMPD1_ENST00000353928.6_Missense_Mutation_p.T334I			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	367					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CTTCTCTTTGGTGCTATAGAC	0.403																																																	0													160.0	155.0	157.0					1																	115221045		2203	4300	6503	SO:0001583	missense	0			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1100C>T	1.37:g.115221045G>A	ENSP00000430075:p.Thr367Ile		A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.T367I	ENST00000520113.2	37	c.1100	CCDS876.2	1	.	.	.	.	.	.	.	.	.	.	G	11.82	1.751458	0.31046	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.83335	-1.71;-1.71;-1.71	5.1	5.1	0.69264	Adenosine/AMP deaminase (1);	0.242186	0.41605	D	0.000843	T	0.69396	0.3106	L	0.34521	1.04	0.35220	D	0.775925	B;B	0.18741	0.03;0.002	B;B	0.17433	0.018;0.014	T	0.68834	-0.5304	10	0.56958	D	0.05	-18.3555	18.8767	0.92341	0.0:0.0:1.0:0.0	.	363;334	Q5TF02;P23109	.;AMPD1_HUMAN	I	367;363;334	ENSP00000430075:T367I;ENSP00000358551:T363I;ENSP00000316520:T334I	ENSP00000316520:T334I	T	-	2	0	AMPD1	115022568	0.184000	0.23200	1.000000	0.80357	0.411000	0.31082	2.070000	0.41491	2.539000	0.85634	0.561000	0.74099	ACC	AMPD1	-	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	ENSG00000116748		0.403	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	HGNC	protein_coding	OTTHUMT00000032860.4	-	0.00	57	0	G			115221045	-1	tier1	-	no_errors	ENST00000520113	ensembl	human	known	74_37	missense	15.79	32	6	SNP	0.995	A
ANK2	287	genome.wustl.edu	37	4	114275201	114275201	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:114275201G>A	ENST00000357077.4	+	38	5480	c.5427G>A	c.(5425-5427)gcG>gcA	p.A1809A	ANK2_ENST00000394537.3_Intron|ANK2_ENST00000264366.6_Silent_p.A1776A|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000510275.2_Intron	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1809	Repeat-rich region.				atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		ATCCAGCTGCGTCACCCTCTC	0.522																																																	0													97.0	107.0	104.0					4																	114275201		2203	4300	6503	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.5427G>A	4.37:g.114275201G>A			Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.A1809	ENST00000357077.4	37	c.5427	CCDS3702.1	4																																																																																			ANK2	-	NULL	ENSG00000145362		0.522	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	-	0.00	45	0	G	NM_001148		114275201	+1	tier1	-	no_errors	ENST00000357077	ensembl	human	known	74_37	silent	20.00	12	3	SNP	0.000	A
ANKRD30BP2	149992	genome.wustl.edu	37	21	14418680	14418680	+	RNA	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr21:14418680T>C	ENST00000507941.1	+	0	1292				RNU6-614P_ENST00000384369.1_RNA					ankyrin repeat domain 30B pseudogene 2																		ATGCTGTTGCTTGTGGATTTA	0.378																																																	0																																												0			AF427490		21q11.2	2010-06-14	2010-06-14	2010-06-14	ENSG00000224309	ENSG00000224309			16620	pseudogene	pseudogene	"""cancer/testis antigen 85"""		"""chromosome 21 open reading frame 99"""	C21orf99		12036297, 17114284	Standard	NR_026916		Approved	CT85, CTSP-1	uc002yja.4		OTTHUMG00000074164		21.37:g.14418680T>C				RNA	SNP	-	NULL	ENST00000507941.1	37	NULL		21																																																																																			ANKRD30BP2	-	-	ENSG00000224309		0.378	ANKRD30BP2-004	KNOWN	basic	processed_transcript	ANKRD30BP2	HGNC	pseudogene	OTTHUMT00000372094.1	-	0.00	172	0	T	NR_026916		14418680	+1	tier1	-	no_errors	ENST00000507941	ensembl	human	known	74_37	rna	14.74	80	14	SNP	0.045	C
ANKRD36BP2	645784	genome.wustl.edu	37	2	89102884	89102884	+	RNA	SNP	G	G	T	rs200478930		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:89102884G>T	ENST00000393525.3	+	0	3358									ankyrin repeat domain 36B pseudogene 2																		AGGTTAACTTGTTCAGAAAGG	0.299																																																	0																																												0					2q11.2	2010-09-30			ENSG00000230006	ENSG00000230006			33607	pseudogene	pseudogene							Standard	NR_015424		Approved		uc010fhg.4		OTTHUMG00000151690		2.37:g.89102884G>T				RNA	SNP	-	NULL	ENST00000393525.3	37	NULL		2																																																																																			ANKRD36BP2	-	-	ENSG00000230006		0.299	ANKRD36BP2-003	KNOWN	basic	processed_transcript	ANKRD36BP2	HGNC	pseudogene	OTTHUMT00000323523.1		0.00	10	0	G			89102884	+1			no_errors	ENST00000393525	ensembl	human	known	74_37	rna	44.44	5	4	SNP	0.019	T
AQP3	360	genome.wustl.edu	37	9	33442476	33442476	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:33442476A>G	ENST00000297991.4	-	5	613	c.533T>C	c.(532-534)aTt>aCt	p.I178T	AQP3_ENST00000493581.1_5'UTR	NM_004925.4	NP_004916.1	Q92482	AQP3_HUMAN	aquaporin 3 (Gill blood group)	178					excretion (GO:0007588)|odontogenesis (GO:0042476)|positive regulation of immune system process (GO:0002684)|regulation of keratinocyte differentiation (GO:0045616)|renal water absorption (GO:0070295)|response to calcium ion (GO:0051592)|response to retinoic acid (GO:0032526)|response to vitamin D (GO:0033280)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urea transport (GO:0015840)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|transporter activity (GO:0005215)|water channel activity (GO:0015250)			endometrium(2)|large_intestine(3)|lung(2)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.0899)		GGGGTCAACAATGGCCAGCAC	0.622																																																	0													48.0	53.0	51.0					9																	33442476		2202	4300	6502	SO:0001583	missense	0				CCDS6542.1	9p13	2014-07-18	2006-02-23		ENSG00000165272	ENSG00000165272		"""Ion channels / Aquaporins"", ""Blood group antigens"""	636	protein-coding gene	gene with protein product	"""Gill blood group"""	600170	"""aquaporin 3"", ""aquaporin 3 (GIL blood group)"""			7558005	Standard	NM_004925		Approved	GIL	uc003zsx.3	Q92482	OTTHUMG00000019769	ENST00000297991.4:c.533T>C	9.37:g.33442476A>G	ENSP00000297991:p.Ile178Thr		A8K843|B2RE16|D3DRL3|O00108|Q6FGT2|Q6FGW6	Missense_Mutation	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_Aquaporin_3,prints_MIP,tigrfam_MIP	p.I178T	ENST00000297991.4	37	c.533	CCDS6542.1	9	.	.	.	.	.	.	.	.	.	.	A	25.5	4.639907	0.87760	.	.	ENSG00000165272	ENST00000297991	T	0.11385	2.78	5.95	5.95	0.96441	Aquaporin-like (2);	0.089576	0.85682	D	0.000000	T	0.39358	0.1075	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.36383	-0.9750	10	0.87932	D	0	0.3069	16.4069	0.83677	1.0:0.0:0.0:0.0	.	178	Q92482	AQP3_HUMAN	T	178	ENSP00000297991:I178T	ENSP00000297991:I178T	I	-	2	0	AQP3	33432476	1.000000	0.71417	0.954000	0.39281	0.966000	0.64601	9.339000	0.96797	2.272000	0.75746	0.460000	0.39030	ATT	AQP3	-	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,tigrfam_MIP	ENSG00000165272		0.622	AQP3-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	AQP3	HGNC	protein_coding	OTTHUMT00000052055.1		0.00	50	0	A	NM_004925		33442476	-1			no_errors	ENST00000297991	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	G
ARHGAP32	9743	genome.wustl.edu	37	11	128844193	128844193	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:128844193G>T	ENST00000310343.9	-	20	2856	c.2857C>A	c.(2857-2859)Ccc>Acc	p.P953T	ARHGAP32_ENST00000524655.1_Missense_Mutation_p.P879T|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.P604T|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.P604T	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	953					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						ATCTGGGTGGGGGATCTATTT	0.458																																																	0													215.0	216.0	216.0					11																	128844193		2201	4297	6498	SO:0001583	missense	0			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.2857C>A	11.37:g.128844193G>T	ENSP00000310561:p.Pro953Thr		I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.P953T	ENST00000310343.9	37	c.2857	CCDS44769.1	11	.	.	.	.	.	.	.	.	.	.	G	12.25	1.882632	0.33255	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000524655;ENST00000457677;ENST00000527272	T;T;T;T	0.15952	2.38;2.38;2.38;2.38	5.61	4.7	0.59300	.	0.190997	0.44483	D	0.000456	T	0.39009	0.1062	M	0.66939	2.045	0.35316	D	0.784371	B;D	0.89917	0.19;1.0	B;D	0.78314	0.063;0.991	T	0.54873	-0.8228	10	0.72032	D	0.01	.	12.8875	0.58053	0.0753:0.0:0.9247:0.0	.	887;953	Q86T64;A7KAX9	.;RHG32_HUMAN	T	953;604;879;887;604	ENSP00000310561:P953T;ENSP00000376425:P604T;ENSP00000432468:P879T;ENSP00000432862:P604T	ENSP00000310561:P953T	P	-	1	0	ARHGAP32	128349403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.701000	0.61810	1.500000	0.48636	0.655000	0.94253	CCC	ARHGAP32	-	NULL	ENSG00000134909		0.458	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP32	HGNC	protein_coding	OTTHUMT00000386151.3		0.00	41	0	G	NM_014715		128844193	-1			no_errors	ENST00000310343	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
ARHGEF10	9639	genome.wustl.edu	37	8	1851472	1851472	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:1851472G>A	ENST00000398564.1	+	16	1751	c.1751G>A	c.(1750-1752)gGc>gAc	p.G584D	ARHGEF10_ENST00000349830.3_Missense_Mutation_p.G559D|ARHGEF10_ENST00000262112.6_Missense_Mutation_p.G584D|ARHGEF10_ENST00000398560.1_Missense_Mutation_p.G545D|ARHGEF10_ENST00000520359.1_Missense_Mutation_p.G521D|ARHGEF10_ENST00000518288.1_Missense_Mutation_p.G583D			O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10	584	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				centrosome duplication (GO:0051298)|myelination in peripheral nervous system (GO:0022011)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of stress fiber assembly (GO:0051496)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cytosol (GO:0005829)	kinesin binding (GO:0019894)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.G584D(1)|p.G336D(1)|p.G559D(1)		endometrium(3)|large_intestine(11)|lung(11)|prostate(3)|skin(3)|stomach(3)|urinary_tract(1)	35		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		ACCTCCAAAGGCCACCCCGAC	0.537																																																	3	Substitution - Missense(3)	prostate(3)											126.0	125.0	125.0					8																	1851472		2203	4300	6503	SO:0001583	missense	0			AF009205	CCDS34794.1	8p23	2014-09-17			ENSG00000104728	ENSG00000104728		"""Rho guanine nucleotide exchange factors"""	14103	protein-coding gene	gene with protein product		608136				9205841, 16896804	Standard	XM_005266039		Approved	KIAA0294, Gef10	uc003wpr.3	O15013	OTTHUMG00000163626	ENST00000398564.1:c.1751G>A	8.37:g.1851472G>A	ENSP00000381571:p.Gly584Asp		O14665|Q2KHR8|Q68D55|Q8IWD9|Q8IY77	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.G584D	ENST00000398564.1	37	c.1751		8	.	.	.	.	.	.	.	.	.	.	G	17.06	3.293141	0.60086	.	.	ENSG00000104728	ENST00000349830;ENST00000520359;ENST00000518288;ENST00000398560;ENST00000398564;ENST00000262112;ENST00000522435	T;T;T;T;T;T;T	0.61040	0.14;0.14;0.14;0.14;0.14;0.14;0.14	5.06	5.06	0.68205	Dbl homology (DH) domain (5);	0.000000	0.85682	D	0.000000	T	0.66626	0.2808	N	0.25647	0.755	0.80722	D	1	D;P;D;D	0.89917	1.0;0.858;1.0;1.0	D;P;D;D	0.97110	1.0;0.627;1.0;0.998	T	0.70132	-0.4956	10	0.56958	D	0.05	-34.2797	18.4361	0.90646	0.0:0.0:1.0:0.0	.	584;545;521;559	O15013;E9PB39;O15013-7;O15013-5	ARHGA_HUMAN;.;.;.	D	559;521;583;545;584;584;232	ENSP00000340297:G559D;ENSP00000427909:G521D;ENSP00000431012:G583D;ENSP00000381568:G545D;ENSP00000381571:G584D;ENSP00000262112:G584D;ENSP00000427768:G232D	ENSP00000262112:G584D	G	+	2	0	ARHGEF10	1838879	1.000000	0.71417	0.516000	0.27786	0.029000	0.11900	8.989000	0.93506	2.344000	0.79699	0.511000	0.50034	GGC	ARHGEF10	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000104728		0.537	ARHGEF10-203	KNOWN	basic	protein_coding	ARHGEF10	HGNC	protein_coding			0.00	27	0	G			1851472	+1			no_errors	ENST00000398564	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	A
ARHGEF18	23370	genome.wustl.edu	37	19	7511987	7511987	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:7511987A>T	ENST00000359920.6	+	5	1359	c.1106A>T	c.(1105-1107)cAc>cTc	p.H369L	ARHGEF18_ENST00000319670.9_Missense_Mutation_p.H211L|CTD-2207O23.3_ENST00000593531.1_Missense_Mutation_p.T327S	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	369	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				TGTAGTGGCCACAATGAAGCT	0.313																																																	0													77.0	74.0	75.0					19																	7511987		2203	4300	6503	SO:0001583	missense	0			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.1106A>T	19.37:g.7511987A>T	ENSP00000352995:p.His369Leu		A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.H369L	ENST00000359920.6	37	c.1106	CCDS45946.1	19	.	.	.	.	.	.	.	.	.	.	A	18.27	3.588069	0.66105	.	.	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.68765	-0.35;-0.35	4.85	4.85	0.62838	Dbl homology (DH) domain (5);	0.000000	0.64402	D	0.000017	D	0.84160	0.5411	M	0.91717	3.235	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.81914	0.994;0.995	D	0.87526	0.2449	10	0.87932	D	0	-31.9075	12.4151	0.55490	1.0:0.0:0.0:0.0	.	211;369	Q6ZSZ5-2;Q6ZSZ5	.;ARHGI_HUMAN	L	211;369	ENSP00000319200:H211L;ENSP00000352995:H369L	ENSP00000319200:H211L	H	+	2	0	ARHGEF18	7417987	1.000000	0.71417	0.996000	0.52242	0.424000	0.31475	9.228000	0.95250	1.815000	0.52974	0.459000	0.35465	CAC	ARHGEF18	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000104880		0.313	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF18	HGNC	protein_coding	OTTHUMT00000436340.1		0.00	68	0	A	NM_015318		7511987	+1			no_errors	ENST00000359920	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
ARSJ	79642	genome.wustl.edu	37	4	114823494	114823494	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:114823494T>A	ENST00000315366.7	-	2	2602	c.1736A>T	c.(1735-1737)aAg>aTg	p.K579M	ARSJ_ENST00000541197.1_Missense_Mutation_p.K579M	NM_024590.3	NP_078866.3	Q5FYB0	ARSJ_HUMAN	arylsulfatase family, member J	579					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)	p.K579fs*>21(1)		endometrium(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	21		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		tttcttcttcttttttttgct	0.388																																																	1	Deletion - Frameshift(1)	large_intestine(1)											66.0	60.0	61.0					4																	114823494		1854	4092	5946	SO:0001583	missense	0				CCDS43264.1	4q26	2013-02-14	2006-03-07		ENSG00000180801	ENSG00000180801		"""Arylsulfatase family"""	26286	protein-coding gene	gene with protein product		610010	"""arylsulfatase J"""			12975309, 16174644	Standard	NM_024590		Approved	FLJ23548	uc003ibq.1	Q5FYB0	OTTHUMG00000161067	ENST00000315366.7:c.1736A>T	4.37:g.114823494T>A	ENSP00000320219:p.Lys579Met		A2RUG0|B7ZM45|Q1HA39|Q5FWE4|Q6UWT9	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.K579M	ENST00000315366.7	37	c.1736	CCDS43264.1	4	.	.	.	.	.	.	.	.	.	.	T	10.59	1.394111	0.25205	.	.	ENSG00000180801	ENST00000315366;ENST00000541197;ENST00000545965	D;D	0.97480	-4.4;-4.38	5.3	2.88	0.33553	.	0.522470	0.16284	U	0.221191	D	0.92721	0.7686	L	0.34521	1.04	0.23150	N	0.998214	B;P	0.39624	0.412;0.681	B;B	0.37833	0.259;0.259	D	0.86492	0.1798	10	0.51188	T	0.08	.	5.5412	0.17039	0.0:0.1604:0.1633:0.6763	.	579;579	Q1HA39;Q5FYB0	.;ARSJ_HUMAN	M	579;579;148	ENSP00000320219:K579M;ENSP00000438836:K579M	ENSP00000320219:K579M	K	-	2	0	ARSJ	115042943	0.889000	0.30405	0.175000	0.22980	0.903000	0.53119	1.327000	0.33746	0.332000	0.23536	0.529000	0.55759	AAG	ARSJ	-	NULL	ENSG00000180801		0.388	ARSJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSJ	HGNC	protein_coding	OTTHUMT00000363650.1		0.00	35	0	T	NM_024590		114823494	-1			no_errors	ENST00000315366	ensembl	human	known	74_37	missense	7.41	25	2	SNP	0.628	A
ART5	116969	genome.wustl.edu	37	11	3661402	3661402	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:3661402G>T	ENST00000397068.3	-	2	649	c.257C>A	c.(256-258)cCt>cAt	p.P86H	TRPC2_ENST00000526541.1_RNA|ART5_ENST00000359918.4_Missense_Mutation_p.P86H|ART5_ENST00000397067.3_Missense_Mutation_p.P86H	NM_053017.3	NP_443750.2	Q96L15	NAR5_HUMAN	ADP-ribosyltransferase 5	86					protein ADP-ribosylation (GO:0006471)	extracellular region (GO:0005576)|membrane (GO:0016020)	NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ nucleosidase activity (GO:0003953)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)	11		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0336)|LUSC - Lung squamous cell carcinoma(625;0.19)		TTTGAAGCCAGGGGGCAAGGT	0.592																																																	0													77.0	73.0	75.0					11																	3661402		2201	4298	6499	SO:0001583	missense	0			Y16835	CCDS7743.1, CCDS73242.1	11p15.4	2008-02-05			ENSG00000167311	ENSG00000167311			24049	protein-coding gene	gene with protein product		610625				11587854, 10448534	Standard	NM_001079536		Approved		uc001lyb.1	Q96L15	OTTHUMG00000011842	ENST00000397068.3:c.257C>A	11.37:g.3661402G>T	ENSP00000380258:p.Pro86His		C9IYG7|Q6UX84|Q86W02	Missense_Mutation	SNP	pfam_ART,prints_ART	p.P86H	ENST00000397068.3	37	c.257	CCDS7743.1	11	.	.	.	.	.	.	.	.	.	.	G	11.16	1.557278	0.27827	.	.	ENSG00000167311	ENST00000397068;ENST00000397067;ENST00000359918;ENST00000425767	T;T;T;T	0.08193	3.12;3.12;3.12;3.12	6.07	1.54	0.23209	.	0.632124	0.16203	N	0.224832	T	0.26085	0.0636	M	0.84511	2.7	0.22266	N	0.99925	D;D	0.89917	1.0;0.999	D;D	0.74348	0.983;0.971	T	0.03103	-1.1072	10	0.48119	T	0.1	-3.7979	6.8314	0.23913	0.2367:0.0:0.6327:0.1306	.	86;86	Q96L15-2;Q96L15	.;NAR5_HUMAN	H	86;86;86;65	ENSP00000380258:P86H;ENSP00000380257:P86H;ENSP00000352992:P86H;ENSP00000413852:P65H	ENSP00000352992:P86H	P	-	2	0	ART5	3617978	0.003000	0.15002	0.847000	0.33407	0.191000	0.23601	0.571000	0.23669	0.426000	0.26116	0.655000	0.94253	CCT	ART5	-	pfam_ART	ENSG00000167311		0.592	ART5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ART5	HGNC	protein_coding	OTTHUMT00000032760.2	-	0.00	59	0	G	NM_053017		3661402	-1	tier1	-	no_errors	ENST00000359918	ensembl	human	known	74_37	missense	8.93	51	5	SNP	0.579	T
ASH1L	55870	genome.wustl.edu	37	1	155448058	155448058	+	Missense_Mutation	SNP	G	G	T	rs563815033		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:155448058G>T	ENST00000368346.3	-	3	5242	c.4603C>A	c.(4603-4605)Cgt>Agt	p.R1535S	ASH1L_ENST00000392403.3_Missense_Mutation_p.R1535S			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1535					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			ATGTGACAACGGTGCTTTTCC	0.468																																																	0													160.0	151.0	154.0					1																	155448058		2203	4300	6503	SO:0001583	missense	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.4603C>A	1.37:g.155448058G>T	ENSP00000357330:p.Arg1535Ser		Q59GP1|Q5T714|Q5T715|Q9P2C7	Missense_Mutation	SNP	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.R1535S	ENST00000368346.3	37	c.4603		1	.	.	.	.	.	.	.	.	.	.	G	14.85	2.657348	0.47467	.	.	ENSG00000116539	ENST00000368346;ENST00000392403	D;D	0.89050	-2.46;-2.46	5.44	4.5	0.54988	.	0.345742	0.26421	N	0.024466	D	0.85617	0.5738	N	0.14661	0.345	0.80722	D	1	D;D	0.67145	0.993;0.996	D;D	0.79108	0.982;0.992	D	0.89195	0.3553	10	0.72032	D	0.01	.	12.8472	0.57837	0.0:0.0:0.5863:0.4137	.	1535;1535	Q9NR48;Q9NR48-2	ASH1L_HUMAN;.	S	1535	ENSP00000357330:R1535S;ENSP00000376204:R1535S	ENSP00000357330:R1535S	R	-	1	0	ASH1L	153714682	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.194000	0.32174	1.466000	0.48025	0.655000	0.94253	CGT	ASH1L	-	NULL	ENSG00000116539		0.468	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	-	0.00	71	0	G	NM_018489		155448058	-1	tier1	-	no_errors	ENST00000368346	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
ASTN2	23245	genome.wustl.edu	37	9	120176909	120176911	+	In_Frame_Del	DEL	GCG	GCG	-			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	GCG	GCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:120176909_120176911delGCG	ENST00000313400.4	-	1	406_408	c.306_308delCGC	c.(304-309)gccgcg>gcg	p.102_103AA>A	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_In_Frame_Del_p.102_103AA>A|ASTN2_ENST00000361209.2_In_Frame_Del_p.102_103AA>A			O75129	ASTN2_HUMAN	astrotactin 2	102					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GCCCGGGGACGCGGCGGCGGCGG	0.788																																																	0										52,31,2535		15,0,22,3,25,1244						2.2	1.0			5	7,76,5503		3,0,1,3,70,2716	no	codingComplex	ASTN2	NM_014010.4		18,0,23,6,95,3960	A1A1,A1A2,A1R,A2A2,A2R,RR		1.4859,3.1704,2.0234				59,107,8038				SO:0001651	inframe_deletion	0			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.306_308delCGC	9.37:g.120176918_120176920delGCG	ENSP00000314038:p.Ala103del		A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	In_Frame_Del	DEL	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.A103in_frame_del	ENST00000313400.4	37	c.308_306		9																																																																																			ASTN2	-	NULL	ENSG00000148219		0.788	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding			0.00	35	0	GCG	NM_014010		120176911	-1	tier1		no_errors	ENST00000313400	ensembl	human	known	74_37	in_frame_del	15.79	16	3	DEL	1.000:1.000:1.000	-
AUNIP	79000	genome.wustl.edu	37	1	26185816	26185816	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:26185816G>A	ENST00000374298.3	-	1	87	c.33C>T	c.(31-33)tgC>tgT	p.C11C	AUNIP_ENST00000538789.1_Silent_p.C11C|RP1-125I3.2_ENST00000455431.1_RNA	NM_024037.1	NP_076942.1	Q9H7T9	AUNIP_HUMAN	aurora kinase A and ninein interacting protein	11					spindle organization (GO:0007051)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)											GCCACACGCCGCAGGCCTCCT	0.716																																																	0													19.0	15.0	16.0					1																	26185816		2171	4273	6444	SO:0001819	synonymous_variant	0				CCDS266.1, CCDS72731.1	1p36.11	2012-08-07	2012-08-07	2012-08-07	ENSG00000127423	ENSG00000127423			28363	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 135"""	C1orf135		20596670	Standard	NM_001287490		Approved	MGC2603, AIBp	uc001bkw.1	Q9H7T9	OTTHUMG00000007372	ENST00000374298.3:c.33C>T	1.37:g.26185816G>A			C9EI59|Q53F70	Silent	SNP	NULL	p.C11	ENST00000374298.3	37	c.33	CCDS266.1	1																																																																																			AUNIP	-	NULL	ENSG00000127423		0.716	AUNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AUNIP	HGNC	protein_coding	OTTHUMT00000019309.2	-	0.00	41	0	G	NM_024037		26185816	-1	tier1	-	no_errors	ENST00000538789	ensembl	human	known	74_37	silent	16.67	25	5	SNP	0.969	A
B4GALT3	8703	genome.wustl.edu	37	1	161144995	161144995	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:161144995T>C	ENST00000319769.5	-	4	499	c.277A>G	c.(277-279)Agc>Ggc	p.S93G	B4GALT3_ENST00000470882.1_5'UTR|PPOX_ENST00000432542.2_Intron|PPOX_ENST00000535223.1_Intron|PPOX_ENST00000495483.1_Intron|B4GALT3_ENST00000367998.1_Missense_Mutation_p.S93G	NM_001199873.1|NM_003779.3	NP_001186802.1|NP_003770.1	O60512	B4GT3_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 3	93					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)|N-acetyllactosamine synthase activity (GO:0003945)			cervix(1)|endometrium(5)|large_intestine(6)|lung(6)	18	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		N-Acetyl-D-glucosamine(DB00141)	GGCACTGGGCTAAAGGACACC	0.577																																																	0													50.0	49.0	49.0					1																	161144995		2203	4300	6503	SO:0001583	missense	0			BC006099	CCDS1222.1	1q21-q23	2013-02-19			ENSG00000158850	ENSG00000158850		"""Beta 4-glycosyltransferases"""	926	protein-coding gene	gene with protein product		604014				9405390, 9597550	Standard	NM_001199873		Approved	beta4Gal-T3	uc001fys.2	O60512	OTTHUMG00000034348	ENST00000319769.5:c.277A>G	1.37:g.161144995T>C	ENSP00000320965:p.Ser93Gly		D3DVG3|O60910|Q9BPZ4|Q9H8T2	Missense_Mutation	SNP	pfam_Galactosyl_T_C,prints_Galactosyl_T	p.S93G	ENST00000319769.5	37	c.277	CCDS1222.1	1	.	.	.	.	.	.	.	.	.	.	T	15.38	2.815255	0.50527	.	.	ENSG00000158850	ENST00000319769;ENST00000407555;ENST00000541560;ENST00000310413;ENST00000367998;ENST00000367997	T;T	0.24350	1.86;1.86	5.14	5.14	0.70334	.	0.337365	0.38959	N	0.001509	T	0.12220	0.0297	L	0.58428	1.81	0.34521	D	0.708124	B;B	0.09022	0.002;0.002	B;B	0.09377	0.004;0.004	T	0.07986	-1.0744	10	0.51188	T	0.08	-16.5713	7.5497	0.27788	0.0:0.0928:0.0:0.9072	.	93;93	B3KPV4;O60512	.;B4GT3_HUMAN	G	93;70;93;93;93;93	ENSP00000320965:S93G;ENSP00000356977:S93G	ENSP00000308551:S93G	S	-	1	0	B4GALT3	159411619	0.999000	0.42202	1.000000	0.80357	0.991000	0.79684	1.732000	0.38146	2.155000	0.67459	0.460000	0.39030	AGC	B4GALT3	-	pfam_Galactosyl_T_C	ENSG00000158850		0.577	B4GALT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT3	HGNC	protein_coding	OTTHUMT00000083054.1	-	0.00	60	0	T	NM_003779		161144995	-1	tier1	-	no_errors	ENST00000319769	ensembl	human	known	74_37	missense	5.80	65	4	SNP	1.000	C
BAI3	577	genome.wustl.edu	37	6	70042868	70042868	+	Silent	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:70042868A>G	ENST00000370598.1	+	24	3977	c.3156A>G	c.(3154-3156)ggA>ggG	p.G1052G	BAI3_ENST00000238918.8_Silent_p.G258G|BAI3_ENST00000546190.1_Silent_p.G16G	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1052					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CCAGAGATGGAATCCTAGATA	0.373																																																	0													111.0	111.0	111.0					6																	70042868		2203	4299	6502	SO:0001819	synonymous_variant	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3156A>G	6.37:g.70042868A>G			B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.G1052	ENST00000370598.1	37	c.3156	CCDS4968.1	6																																																																																			BAI3	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000135298		0.373	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	62	0	A			70042868	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	silent	12.16	65	9	SNP	0.981	G
BCLAF1	9774	genome.wustl.edu	37	6	136599172	136599172	+	Silent	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:136599172G>T	ENST00000531224.1	-	4	1099	c.847C>A	c.(847-849)Cga>Aga	p.R283R	BCLAF1_ENST00000530767.1_Silent_p.R283R|BCLAF1_ENST00000353331.4_Silent_p.R281R|BCLAF1_ENST00000527536.1_Silent_p.R283R|BCLAF1_ENST00000527759.1_Silent_p.R281R|BCLAF1_ENST00000392348.2_Silent_p.R281R	NM_001077441.1|NM_014739.2	NP_001070909.1|NP_055554.1	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1	283					apoptotic process (GO:0006915)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA-templated transcription, initiation (GO:2000144)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of response to DNA damage stimulus (GO:2001022)|regulation of DNA-templated transcription in response to stress (GO:0043620)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|ovary(1)|skin(1)	9	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		GGACTGTATCGACTAGATCCA	0.438																																					Colon(142;1534 1789 5427 7063 28491)												0													107.0	95.0	99.0					6																	136599172		2203	4300	6503	SO:0001819	synonymous_variant	0			AF249273	CCDS5177.1, CCDS47485.1, CCDS47486.1, CCDS75525.1	6q22-q23	2007-03-02			ENSG00000029363	ENSG00000029363			16863	protein-coding gene	gene with protein product		612588				8724849, 10330179	Standard	NM_001077440		Approved	KIAA0164, BTF	uc003qgx.1	Q9NYF8	OTTHUMG00000033323	ENST00000531224.1:c.847C>A	6.37:g.136599172G>T			A2RU75|B7ZM58|E1P586|Q14673|Q86WU6|Q86WY0	Silent	SNP	NULL	p.R283	ENST00000531224.1	37	c.847	CCDS5177.1	6																																																																																			BCLAF1	-	NULL	ENSG00000029363		0.438	BCLAF1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCLAF1	HGNC	protein_coding	OTTHUMT00000042375.2	-	0.00	180	0	G	NM_014739		136599172	-1	tier1	-	no_errors	ENST00000531224	ensembl	human	known	74_37	silent	11.21	103	13	SNP	1.000	T
BCR	613	genome.wustl.edu	37	22	23656185	23656185	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr22:23656185G>A	ENST00000305877.8	+	21	4239	c.3488G>A	c.(3487-3489)tGc>tAc	p.C1163Y	BCR_ENST00000359540.3_Missense_Mutation_p.C1119Y|BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	1163	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	AAGGAGAGCTGCATGCTCAAC	0.592			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0													152.0	138.0	143.0					22																	23656185		2203	4300	6503	SO:0001583	missense	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3488G>A	22.37:g.23656185G>A	ENSP00000303507:p.Cys1163Tyr		P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Bcr-Abl_oncoprot_oligo,pfam_DH-domain,pfam_C2_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_Bcr-Abl_oncoprot_oligo,superfamily_C2_dom,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RhoGAP_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.C1163Y	ENST00000305877.8	37	c.3488	CCDS13806.1	22	.	.	.	.	.	.	.	.	.	.	.	17.64	3.439312	0.63067	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149	T;T	0.18174	2.23;2.23	4.51	4.51	0.55191	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.35068	0.0919	L	0.52823	1.66	0.80722	D	1	P;P;P	0.51933	0.949;0.702;0.86	P;B;P	0.62649	0.905;0.382;0.797	T	0.03231	-1.1058	10	0.41790	T	0.15	.	16.5916	0.84767	0.0:0.0:1.0:0.0	.	752;1119;1163	B4E065;P11274-2;P11274	.;.;BCR_HUMAN	Y	1163;1119;828	ENSP00000303507:C1163Y;ENSP00000352535:C1119Y	ENSP00000303507:C1163Y	C	+	2	0	BCR	21986185	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.540000	0.98080	2.255000	0.74692	0.455000	0.32223	TGC	BCR	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000186716		0.592	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	-	0.00	138	0	G	NM_004327		23656185	+1	tier1	-	no_errors	ENST00000305877	ensembl	human	known	74_37	missense	6.25	75	5	SNP	1.000	A
BEX1	55859	genome.wustl.edu	37	X	102318197	102318197	+	Missense_Mutation	SNP	C	C	A	rs143348113		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:102318197C>A	ENST00000372728.3	-	3	245	c.6G>T	c.(4-6)gaG>gaT	p.E2D		NM_018476.3	NP_060946.3	Q9HBH7	BEX1_HUMAN	brain expressed, X-linked 1	2					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II activating transcription factor binding (GO:0001102)			endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12						TCTCTTTGGACTCCATTACTC	0.478																																																	0													143.0	148.0	146.0					X																	102318197		2199	4279	6478	SO:0001583	missense	0				CCDS35354.1	Xq22.1	2014-03-21			ENSG00000133169	ENSG00000133169			1036	protein-coding gene	gene with protein product		300690				16221301	Standard	NM_018476		Approved		uc004ejt.1	Q9HBH7	OTTHUMG00000022708	ENST00000372728.3:c.6G>T	X.37:g.102318197C>A	ENSP00000361813:p.Glu2Asp		A0AVN1|A8K4J3|Q9NZ33	Missense_Mutation	SNP	pfam_TF_A-like/BEX-like,pirsf_BEX	p.E2D	ENST00000372728.3	37	c.6	CCDS35354.1	X	.	.	.	.	.	.	.	.	.	.	C	3.785	-0.044784	0.07452	.	.	ENSG00000133169	ENST00000372728	T	0.12255	2.7	3.1	-1.02	0.10135	.	0.552403	0.15133	N	0.278725	T	0.08492	0.0211	L	0.46157	1.445	0.09310	N	1	P	0.35155	0.487	B	0.25884	0.064	T	0.30001	-0.9993	10	0.24483	T	0.36	.	6.5655	0.22509	0.0:0.4372:0.0:0.5628	.	2	Q9HBH7	BEX1_HUMAN	D	2	ENSP00000361813:E2D	ENSP00000361813:E2D	E	-	3	2	BEX1	102204853	0.003000	0.15002	0.025000	0.17156	0.290000	0.27261	-1.258000	0.02863	-0.407000	0.07576	-0.340000	0.08031	GAG	BEX1	-	pirsf_BEX	ENSG00000133169		0.478	BEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEX1	HGNC	protein_coding	OTTHUMT00000058925.1		0.00	42	0	C	NM_018476		102318197	-1			no_errors	ENST00000372728	ensembl	human	known	74_37	missense	8.33	33	3	SNP	0.022	A
BZW1	9689	genome.wustl.edu	37	2	201684807	201684807	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:201684807A>G	ENST00000409600.1	+	10	1524	c.1069A>G	c.(1069-1071)Aaa>Gaa	p.K357E	BZW1_ENST00000452790.2_Missense_Mutation_p.K389E|BZW1_ENST00000409226.1_Missense_Mutation_p.K361E	NM_001207067.1|NM_014670.3	NP_001193996.1|NP_055485.2	Q7L1Q6	BZW1_HUMAN	basic leucine zipper and W2 domains 1	357	W2. {ECO:0000255|PROSITE- ProRule:PRU00695}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(1)|kidney(2)|large_intestine(1)|lung(2)	6						TCATTTCATGAAAGCCTTCCA	0.328																																																	0													33.0	28.0	29.0					2																	201684807		1796	4062	5858	SO:0001583	missense	0			D13630	CCDS56154.1, CCDS56155.1, CCDS56156.1	2q33	2010-04-09			ENSG00000082153	ENSG00000082153			18380	protein-coding gene	gene with protein product						10964520, 11524015	Standard	NM_001207067		Approved	BZAP45, KIAA0005	uc021vus.1	Q7L1Q6	OTTHUMG00000154560	ENST00000409600.1:c.1069A>G	2.37:g.201684807A>G	ENSP00000386474:p.Lys357Glu		B4DLZ8|B4DWF7|Q14281|Q15394|Q9BUY0	Missense_Mutation	SNP	pfam_W2_domain,superfamily_ARM-type_fold,smart_W2_domain	p.K357E	ENST00000409600.1	37	c.1069	CCDS56156.1	2	.	.	.	.	.	.	.	.	.	.	A	28.3	4.904490	0.92035	.	.	ENSG00000082153	ENST00000409600;ENST00000409226;ENST00000452790	D;D;D	0.82893	-1.66;-1.66;-1.66	5.76	5.76	0.90799	eIF4-gamma/eIF5/eIF2-epsilon (3);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.047982	0.85682	D	0.000000	D	0.93523	0.7933	H	0.94808	3.585	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.978	D	0.94751	0.7927	10	0.56958	D	0.05	-5.959	16.3786	0.83431	1.0:0.0:0.0:0.0	.	389;357	B4DLZ8;Q7L1Q6	.;BZW1_HUMAN	E	357;361;389	ENSP00000386474:K357E;ENSP00000386837:K361E;ENSP00000394316:K389E	ENSP00000386837:K361E	K	+	1	0	BZW1	201393052	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.230000	0.95299	2.323000	0.78572	0.528000	0.53228	AAA	BZW1	-	pfam_W2_domain,superfamily_ARM-type_fold,smart_W2_domain	ENSG00000082153		0.328	BZW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BZW1	HGNC	protein_coding	OTTHUMT00000335975.1		0.00	39	0	A	NM_014670		201684807	+1			no_errors	ENST00000409600	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	G
LINC01465	283416	genome.wustl.edu	37	12	62996769	62996769	+	Missense_Mutation	SNP	C	C	T	rs377607051		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:62996769C>T	ENST00000408887.2	-	1	445	c.350G>A	c.(349-351)cGt>cAt	p.R117H	RP11-631N16.2_ENST00000550290.1_RNA|MIRLET7I_ENST00000362309.1_RNA	NM_175895.3	NP_787091.1	Q8N7H1	CL061_HUMAN		117										cervix(1)|lung(2)	3			BRCA - Breast invasive adenocarcinoma(9;0.0399)	GBM - Glioblastoma multiforme(28;0.134)		TAGAGCTGAACGGGAATTCCC	0.652																																																	0													29.0	32.0	31.0					12																	62996769		2203	4300	6503	SO:0001583	missense	0																														ENST00000408887.2:c.350G>A	12.37:g.62996769C>T	ENSP00000386169:p.Arg117His		B2RMN9|Q3ZCV4	Missense_Mutation	SNP	NULL	p.R117H	ENST00000408887.2	37	c.350	CCDS8964.1	12	.	.	.	.	.	.	.	.	.	.	C	12.92	2.082440	0.36758	.	.	ENSG00000221949	ENST00000408887	.	.	.	2.04	2.04	0.26737	.	.	.	.	.	T	0.30135	0.0755	N	0.08118	0	0.09310	N	1	D	0.69078	0.997	P	0.60286	0.872	T	0.11421	-1.0588	7	.	.	.	.	7.5997	0.28069	0.0:1.0:0.0:0.0	.	117	Q8N7H1	CL061_HUMAN	H	117	.	.	R	-	2	0	C12orf61	61283036	0.015000	0.18098	0.004000	0.12327	0.026000	0.11368	0.389000	0.20751	1.444000	0.47605	0.561000	0.74099	CGT	C12orf61	-	NULL	ENSG00000221949		0.652	C12orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf61	HGNC	protein_coding	OTTHUMT00000406740.2	-	0.00	76	0	C			62996769	-1	tier1	-	no_errors	ENST00000408887	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.010	T
CFAP54	144535	genome.wustl.edu	37	12	96958311	96958311	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:96958311G>T	ENST00000524981.4	+	18	2499	c.2476G>T	c.(2476-2478)Gga>Tga	p.G826*	C12orf55_ENST00000554108.2_Intron			Q96N23	CL055_HUMAN		0																	AAAACAATCTGGAAGCACTGA	0.323																																																	0																																										SO:0001587	stop_gained	0																														ENST00000524981.4:c.2476G>T	12.37:g.96958311G>T	ENSP00000431759:p.Gly826*			Nonsense_Mutation	SNP	superfamily_Fibronectin_type3	p.G826*	ENST00000524981.4	37	c.2476		12	.	.	.	.	.	.	.	.	.	.	G	34	5.382197	0.95967	.	.	ENSG00000188596	ENST00000524981	.	.	.	5.46	-3.94	0.04130	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	11.8869	0.52608	0.6201:0.0:0.3799:0.0	.	.	.	.	X	826	.	ENSP00000431759:G826X	G	+	1	0	C12orf63	95482442	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.717000	0.04986	-0.864000	0.04078	-0.216000	0.12614	GGA	C12orf55	-	NULL	ENSG00000188596		0.323	C12orf55-003	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf55	HGNC	protein_coding	OTTHUMT00000395046.4	-	0.00	50	0	G			96958311	+1	tier1	-	no_errors	ENST00000524981	ensembl	human	putative	74_37	nonsense	20.69	23	6	SNP	0.000	T
MRPL30	51263	genome.wustl.edu	37	2	99811355	99811355	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:99811355G>A	ENST00000338148.3	+	4	472	c.274G>A	c.(274-276)Gaa>Aaa	p.E92K	MRPL30_ENST00000409145.1_Missense_Mutation_p.E92K|MRPL30_ENST00000410042.1_Missense_Mutation_p.E92K|MRPL30_ENST00000465432.1_3'UTR|C2orf15_ENST00000512183.2_Missense_Mutation_p.E92K	NM_145212.3	NP_660213.1	Q8TCC3	RM30_HUMAN	mitochondrial ribosomal protein L30	92						mitochondrion (GO:0005739)|ribosome (GO:0005840)		p.E92Q(1)		breast(1)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10						GCTTGGATTAGAAAAAGTATG	0.269																																																	1	Substitution - Missense(1)	breast(1)											46.0	50.0	49.0					2																	99811355		2200	4296	6496	SO:0001583	missense	0			AB051342	CCDS2041.1	2q11.2	2012-09-13			ENSG00000185414	ENSG00000185414		"""Mitochondrial ribosomal proteins / large subunits"""	14036	protein-coding gene	gene with protein product		611838					Standard	NM_145212		Approved	MRP-L28, RPML28	uc002szv.3	Q8TCC3	OTTHUMG00000130642	ENST00000338148.3:c.274G>A	2.37:g.99811355G>A	ENSP00000338057:p.Glu92Lys		A6NIC6|D3DVI0|D3DVI3|Q0D2Q7|Q6ZTP4|Q96Q69|Q9P0N0	Missense_Mutation	SNP	pfam_Ribosomal_L30_ferredoxin-like,superfamily_Ribosomal_L30_ferredoxin-like	p.E122K	ENST00000338148.3	37	c.364	CCDS2041.1	2	.	.	.	.	.	.	.	.	.	.	G	6.786	0.513948	0.12944	.	.	ENSG00000241962;ENSG00000241962;ENSG00000185414;ENSG00000185414;ENSG00000185414;ENSG00000185414	ENST00000512183;ENST00000308644;ENST00000410042;ENST00000338148;ENST00000409145;ENST00000409841	T;T;T	0.43688	0.94;0.94;0.94	4.24	-3.07	0.05363	Ribosomal protein L30, ferredoxin-like fold domain (3);	0.865236	0.10212	N	0.702011	T	0.30262	0.0759	N	0.11313	0.125	0.09310	N	0.999998	B;B	0.29212	0.237;0.082	B;B	0.34590	0.186;0.053	T	0.09930	-1.0652	10	0.27082	T	0.32	-3.5943	22.1265	0.99967	0.0:0.8246:0.1754:0.0	.	92;92	Q8TCC3;Q8TCC3-3	RM30_HUMAN;.	K	92;105;92;92;92;92	ENSP00000420959:E92K;ENSP00000338057:E92K;ENSP00000386752:E92K	ENSP00000312464:E105K	E	+	1	0	C2orf15;MRPL30	99177787	0.999000	0.42202	0.673000	0.29887	0.230000	0.25150	0.751000	0.26348	-0.809000	0.04381	-0.951000	0.02657	GAA	C2orf15	-	pfam_Ribosomal_L30_ferredoxin-like,superfamily_Ribosomal_L30_ferredoxin-like	ENSG00000241962		0.269	MRPL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf15	HGNC	protein_coding	OTTHUMT00000253130.2		0.00	60	0	G			99811355	+1			no_errors	ENST00000424491	ensembl	human	known	74_37	missense	6.67	42	3	SNP	0.343	A
C5orf34	375444	genome.wustl.edu	37	5	43490755	43490755	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:43490755A>G	ENST00000306862.2	-	11	2032	c.1657T>C	c.(1657-1659)Tct>Cct	p.S553P	RP11-159F24.3_ENST00000505645.1_RNA	NM_198566.2	NP_940968	Q96MH7	CE034_HUMAN	chromosome 5 open reading frame 34	553										breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|stomach(2)	21	Lung NSC(6;2.07e-05)					AGAACAGAAGATGACGAATGA	0.328																																																	0													82.0	78.0	79.0					5																	43490755		2203	4300	6503	SO:0001583	missense	0			AK056925	CCDS3946.1	5p12	2012-02-23			ENSG00000172244	ENSG00000172244			24738	protein-coding gene	gene with protein product						12477932	Standard	XM_006714473		Approved	FLJ32363	uc003jnz.2	Q96MH7	OTTHUMG00000131151	ENST00000306862.2:c.1657T>C	5.37:g.43490755A>G	ENSP00000303490:p.Ser553Pro			Missense_Mutation	SNP	NULL	p.S553P	ENST00000306862.2	37	c.1657	CCDS3946.1	5	.	.	.	.	.	.	.	.	.	.	A	10.17	1.276775	0.23307	.	.	ENSG00000172244	ENST00000306862	T	0.47869	0.83	5.17	-0.199	0.13220	.	0.762465	0.12396	N	0.472580	T	0.36880	0.0983	M	0.63428	1.95	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.38023	-0.9680	10	0.48119	T	0.1	-0.2643	0.9524	0.01379	0.4318:0.1557:0.2621:0.1504	.	553	Q96MH7	CE034_HUMAN	P	553	ENSP00000303490:S553P	ENSP00000303490:S553P	S	-	1	0	C5orf34	43526512	0.018000	0.18449	0.001000	0.08648	0.055000	0.15305	0.241000	0.18065	-0.187000	0.10516	-0.256000	0.11100	TCT	C5orf34	-	NULL	ENSG00000172244		0.328	C5orf34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf34	HGNC	protein_coding	OTTHUMT00000253843.1	-	0.00	58	0	A	NM_198566		43490755	-1	tier1	-	no_errors	ENST00000306862	ensembl	human	known	74_37	missense	17.07	68	14	SNP	0.001	G
C8B	732	genome.wustl.edu	37	1	57431535	57431535	+	Silent	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:57431535G>T	ENST00000371237.4	-	1	153	c.87C>A	c.(85-87)ggC>ggA	p.G29G	C8B_ENST00000543257.1_5'UTR|C8B_ENST00000494324.1_5'UTR|AL161740.1_ENST00000408664.1_RNA|C8B_ENST00000535057.1_5'UTR|RP5-1103B4.3_ENST00000417420.1_RNA	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	29					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)		p.G29G(1)		breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						CTTACCTGGAGCCAGGCAAAC	0.493																																																	1	Substitution - coding silent(1)	lung(1)											74.0	74.0	74.0					1																	57431535		2203	4300	6503	SO:0001819	synonymous_variant	0			M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.87C>A	1.37:g.57431535G>T			A1L4K7	Silent	SNP	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.G29	ENST00000371237.4	37	c.87	CCDS30730.1	1																																																																																			C8B	-	NULL	ENSG00000021852		0.493	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8B	HGNC	protein_coding	OTTHUMT00000022886.2	-	0.00	33	0	G			57431535	-1	tier1	-	no_errors	ENST00000371237	ensembl	human	known	74_37	silent	18.75	26	6	SNP	0.877	T
C9orf89	84270	genome.wustl.edu	37	9	95872944	95872944	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:95872944G>A	ENST00000375464.2	+	3	373	c.245G>A	c.(244-246)cGa>cAa	p.R82Q	C9orf89_ENST00000488630.1_3'UTR	NM_032310.3	NP_115686.3	Q96LW7	BINCA_HUMAN	chromosome 9 open reading frame 89	82	CARD.				negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	CARD domain binding (GO:0050700)			endometrium(1)|kidney(1)|lung(3)|ovary(1)|skin(1)	7						GAGTTCTACCGAGCCCTGTAT	0.642																																																	0													70.0	69.0	70.0					9																	95872944		2203	4300	6503	SO:0001583	missense	0			AK057716	CCDS6702.2	9q22.32	2012-03-16			ENSG00000165233	ENSG00000165233			28148	protein-coding gene	gene with protein product	"""Bcl10-interacting protein with CARD"""					12477932	Standard	XM_005252273		Approved	MGC11115, bA370F5.1, BinCARD	uc004atd.3	Q96LW7	OTTHUMG00000020243	ENST00000375464.2:c.245G>A	9.37:g.95872944G>A	ENSP00000364613:p.Arg82Gln		Q5BJH8|Q9BSY2	Missense_Mutation	SNP	superfamily_DEATH-like_dom	p.R82Q	ENST00000375464.2	37	c.245	CCDS6702.2	9	.	.	.	.	.	.	.	.	.	.	G	31	5.088167	0.94100	.	.	ENSG00000165233	ENST00000375464	T	0.14516	2.5	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.39462	0.1079	.	.	.	0.48135	D	0.999595	D	0.89917	1.0	D	0.85130	0.997	T	0.32561	-0.9902	9	0.87932	D	0	.	15.7277	0.77774	0.0:0.0:1.0:0.0	.	82	Q96LW7-2	.	Q	82	ENSP00000364613:R82Q	ENSP00000364613:R82Q	R	+	2	0	C9orf89	94912765	1.000000	0.71417	0.963000	0.40424	0.957000	0.61999	7.238000	0.78173	2.386000	0.81285	0.491000	0.48974	CGA	C9orf89	-	superfamily_DEATH-like_dom	ENSG00000165233		0.642	C9orf89-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf89	HGNC	protein_coding	OTTHUMT00000053128.1	-	0.00	126	0	G	NM_032310		95872944	+1	tier1	-	no_errors	ENST00000466409	ensembl	human	known	74_37	missense	6.41	73	5	SNP	0.990	A
CACNA1D	776	genome.wustl.edu	37	3	53796067	53796067	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:53796067G>A	ENST00000350061.5	+	30	4340	c.3829G>A	c.(3829-3831)Gta>Ata	p.V1277I	CACNA1D_ENST00000540742.1_Missense_Mutation_p.V184I|CACNA1D_ENST00000422281.2_Missense_Mutation_p.V1277I|CACNA1D_ENST00000288139.4_Missense_Mutation_p.V1297I	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1277					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CTCCCTCATCGTAATCGGCAG	0.547																																																	0													173.0	137.0	149.0					3																	53796067		2203	4300	6503	SO:0001583	missense	0			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.3829G>A	3.37:g.53796067G>A	ENSP00000288133:p.Val1277Ile		B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.V1297I	ENST00000350061.5	37	c.3889	CCDS46848.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.526206	0.96431	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000540742	D;D;D;D	0.98762	-5.12;-5.12;-5.12;-5.12	5.59	5.59	0.84812	Ion transport (1);	0.072440	0.53938	D	0.000049	D	0.99239	0.9735	M	0.85041	2.73	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.91635	0.954;0.991;0.998;0.999	D	0.99593	1.0976	10	0.87932	D	0	.	19.96	0.97242	0.0:0.0:1.0:0.0	.	1277;184;1277;1297	B0FYA3;F5H313;Q01668;Q01668-2	.;.;CAC1D_HUMAN;.	I	1277;1297;1277;184	ENSP00000288133:V1277I;ENSP00000288139:V1297I;ENSP00000409174:V1277I;ENSP00000438229:V184I	ENSP00000288139:V1297I	V	+	1	0	CACNA1D	53771107	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.779000	0.99018	2.793000	0.96121	0.561000	0.74099	GTA	CACNA1D	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000157388		0.547	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1	-	0.00	29	0	G	NM_000720		53796067	+1	tier1	-	no_errors	ENST00000288139	ensembl	human	known	74_37	missense	34.48	19	10	SNP	1.000	A
CAPN11	11131	genome.wustl.edu	37	6	44137711	44137711	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:44137711C>T	ENST00000398776.1	+	4	446	c.408C>T	c.(406-408)ctC>ctT	p.L136L	CAPN11_ENST00000542245.1_Splice_Site_p.L136L	NM_007058.3	NP_008989.2	Q9UMQ6	CAN11_HUMAN	calpain 11	136	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|peptidase activity (GO:0008233)			breast(3)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)	36	all_cancers(18;3.19e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			AGGGGATCCTCGGTGAGTGGG	0.547																																																	0													39.0	41.0	40.0					6																	44137711		1916	4114	6030	SO:0001630	splice_region_variant	0			AJ242832	CCDS47436.1	6p12	2013-01-10			ENSG00000137225	ENSG00000137225		"""EF-hand domain containing"""	1478	protein-coding gene	gene with protein product		604822				10409436	Standard	NM_007058		Approved		uc003owt.1	Q9UMQ6	OTTHUMG00000014758	ENST00000398776.1:c.409+1C>T	6.37:g.44137711C>T			B2RA64|Q5T3G1|Q8N4R5	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.L136	ENST00000398776.1	37	c.408	CCDS47436.1	6																																																																																			CAPN11	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	ENSG00000137225		0.547	CAPN11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAPN11	HGNC	protein_coding	OTTHUMT00000040714.3		0.00	69	0	C		Silent	44137711	+1			no_errors	ENST00000398776	ensembl	human	known	74_37	silent	5.19	73	4	SNP	0.239	T
CAPN6	827	genome.wustl.edu	37	X	110495608	110495608	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:110495608T>A	ENST00000324068.1	-	5	793	c.626A>T	c.(625-627)gAg>gTg	p.E209V	CAPN6_ENST00000541758.1_Intron	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	209	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						GTACTTCTCCTCAACAAGCTC	0.433																																																	0													169.0	121.0	137.0					X																	110495608		2203	4300	6503	SO:0001583	missense	0			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.626A>T	X.37:g.110495608T>A	ENSP00000317214:p.Glu209Val		D3DUY7|Q9UEQ1|Q9UJA8	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,pfam_C2_dom,superfamily_Calpain_domain_III,superfamily_C2_dom,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_C2_dom,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.E209V	ENST00000324068.1	37	c.626	CCDS14555.1	X	.	.	.	.	.	.	.	.	.	.	T	12.94	2.089625	0.36855	.	.	ENSG00000077274	ENST00000324068	D	0.90324	-2.65	5.97	3.51	0.40186	Peptidase C2, calpain, catalytic domain (3);	0.391519	0.28790	N	0.014131	D	0.85635	0.5742	L	0.49778	1.585	0.18873	N	0.999989	B	0.33777	0.425	B	0.36289	0.221	T	0.78219	-0.2289	10	0.54805	T	0.06	.	4.6643	0.12657	0.2649:0.0:0.2722:0.4629	.	209	Q9Y6Q1	CAN6_HUMAN	V	209	ENSP00000317214:E209V	ENSP00000317214:E209V	E	-	2	0	CAPN6	110382264	0.959000	0.32827	0.999000	0.59377	0.924000	0.55760	1.914000	0.39966	2.018000	0.59344	0.486000	0.48141	GAG	CAPN6	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat	ENSG00000077274		0.433	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN6	HGNC	protein_coding	OTTHUMT00000057922.1	-	0.00	39	0	T			110495608	-1	tier1	-	no_errors	ENST00000324068	ensembl	human	known	74_37	missense	11.11	32	4	SNP	0.169	A
CBLN4	140689	genome.wustl.edu	37	20	54575877	54575878	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr20:54575877_54575878insA	ENST00000064571.2	-	2	1617_1618	c.317_318insT	c.(316-318)ttcfs	p.F106fs		NM_080617.5	NP_542184.1	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	106	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein secretion (GO:0009306)	cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				endometrium(2)|large_intestine(1)|lung(10)|ovary(3)|pancreas(1)	17			Colorectal(105;0.202)			ACTCCAATGTGAAAAAATTACC	0.312																																																	0																																										SO:0001589	frameshift_variant	0			AY358527	CCDS13448.1	20q13	2004-08-19	2004-08-19	2004-08-19	ENSG00000054803	ENSG00000054803			16231	protein-coding gene	gene with protein product		615029	"""cerebellin precursor-like 1"""	CBLNL1			Standard	NM_080617		Approved	dJ885A10.1	uc002xxa.4	Q9NTU7	OTTHUMG00000032782	ENST00000064571.2:c.318dupT	20.37:g.54575883_54575883dupA	ENSP00000064571:p.Phe106fs		A8K0S5	Frame_Shift_Ins	INS	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.T107fs	ENST00000064571.2	37	c.318_317	CCDS13448.1	20																																																																																			CBLN4	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000054803		0.312	CBLN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLN4	HGNC	protein_coding	OTTHUMT00000079783.2		0.00	23	0	-	NM_080617		54575878	-1	tier1		no_errors	ENST00000064571	ensembl	human	known	74_37	frame_shift_ins	17.07	34	7	INS	1.000:1.000	A
CBX3	11335	genome.wustl.edu	37	7	26246030	26246030	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:26246030G>T	ENST00000337620.4	+	3	495	c.67G>T	c.(67-69)Gaa>Taa	p.E23*	CBX3_ENST00000497498.1_3'UTR|CBX3_ENST00000409747.1_Nonsense_Mutation_p.E23*|CBX3_ENST00000396386.2_Nonsense_Mutation_p.E23*	NM_007276.4	NP_009207.2	Q13185	CBX3_HUMAN	chromobox homolog 3	23					chromatin remodeling (GO:0006338)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|condensed chromosome, centromeric region (GO:0000779)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nuclear pericentric heterochromatin (GO:0031618)|nucleus (GO:0005634)|spindle (GO:0005819)	enzyme binding (GO:0019899)|histone methyltransferase binding (GO:1990226)|identical protein binding (GO:0042802)|protein domain specific binding (GO:0019904)			endometrium(4)|large_intestine(2)|lung(2)|ovary(1)	9						TAAAAAAGTTGAAGAGGCAGA	0.333																																																	0													93.0	95.0	94.0					7																	26246030		2203	4300	6503	SO:0001587	stop_gained	0			U26312	CCDS5398.1	7p15.2	2010-07-06	2010-06-24		ENSG00000122565	ENSG00000122565			1553	protein-coding gene	gene with protein product	"""HP1 gamma homolog (Drosophila)"""	604477	"""chromobox homolog 3 (Drosophila HP1 gamma)"""			8663349	Standard	NM_016587		Approved	HP1Hs-gamma	uc003sxu.3	Q13185	OTTHUMG00000022911	ENST00000337620.4:c.67G>T	7.37:g.26246030G>T	ENSP00000336687:p.Glu23*		Q96CD7|Q99409|Q9BVS3|Q9P0Z6	Nonsense_Mutation	SNP	pfam_Chromo_shadow_dom,pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Chromo_shadow_dom,pfscan_Chromo_domain/shadow,prints_Chromo_dom_subgr	p.E23*	ENST00000337620.4	37	c.67	CCDS5398.1	7	.	.	.	.	.	.	.	.	.	.	G	45	11.638799	0.99585	.	.	ENSG00000122565	ENST00000337620;ENST00000396386;ENST00000456948;ENST00000409747	.	.	.	5.75	5.75	0.90469	.	0.155203	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	.	20.312	0.98644	0.0:0.0:1.0:0.0	.	.	.	.	X	23	.	ENSP00000336687:E23X	E	+	1	0	CBX3	26212555	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.215000	0.65241	2.880000	0.98712	0.655000	0.94253	GAA	CBX3	-	superfamily_Chromodomain-like	ENSG00000122565		0.333	CBX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX3	HGNC	protein_coding	OTTHUMT00000214117.1	-	0.00	49	0	G	NM_007276		26246030	+1	tier1	-	no_errors	ENST00000337620	ensembl	human	known	74_37	nonsense	7.84	47	4	SNP	1.000	T
CCAR1	55749	genome.wustl.edu	37	10	70507295	70507295	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr10:70507295G>T	ENST00000265872.6	+	8	917	c.798G>T	c.(796-798)caG>caT	p.Q266H	CCAR1_ENST00000543719.1_Missense_Mutation_p.Q251H|CCAR1_ENST00000535016.1_Missense_Mutation_p.Q251H	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	266					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						CTCAACCACAGCCCTTATTAC	0.413																																																	0													131.0	129.0	130.0					10																	70507295		2203	4300	6503	SO:0001583	missense	0			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.798G>T	10.37:g.70507295G>T	ENSP00000265872:p.Gln266His		A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Missense_Mutation	SNP	pfam_SAP_dom,superfamily_NA-bd_OB-fold,smart_SAP_dom,pfscan_SAP_dom	p.Q266H	ENST00000265872.6	37	c.798	CCDS7282.1	10	.	.	.	.	.	.	.	.	.	.	G	15.03	2.711573	0.48517	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012;ENST00000540807	T;T;T;T;T;T	0.29655	1.56;1.78;1.78;1.8;1.82;1.83	5.06	4.15	0.48705	.	0.060773	0.64402	D	0.000002	T	0.29223	0.0727	L	0.36672	1.1	0.51767	D	0.999938	P;P;P	0.46277	0.785;0.875;0.867	P;B;P	0.48141	0.466;0.365;0.568	T	0.02431	-1.1160	10	0.40728	T	0.16	-7.9493	8.5716	0.33572	0.0774:0.0:0.7708:0.1518	.	251;266;240	Q8IX12-2;Q8IX12;F5H2E6	.;CCAR1_HUMAN;.	H	266;251;251;251;240;71;71	ENSP00000265872:Q266H;ENSP00000441820:Q251H;ENSP00000445254:Q251H;ENSP00000439252:Q251H;ENSP00000438610:Q240H;ENSP00000439642:Q71H	ENSP00000265872:Q266H	Q	+	3	2	CCAR1	70177301	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.172000	0.65003	1.266000	0.44231	0.655000	0.94253	CAG	CCAR1	-	NULL	ENSG00000060339		0.413	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	HGNC	protein_coding	OTTHUMT00000048356.2	-	0.00	99	0	G	NM_018237		70507295	+1	tier1	-	no_errors	ENST00000265872	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
CCDC112	153733	genome.wustl.edu	37	5	114606915	114606915	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:114606915C>A	ENST00000512261.1	-	8	1494	c.1078G>T	c.(1078-1080)Gaa>Taa	p.E360*	CCDC112_ENST00000506442.1_Nonsense_Mutation_p.E360*|CCDC112_ENST00000395557.4_Nonsense_Mutation_p.E360*|CCDC112_ENST00000379611.5_Nonsense_Mutation_p.E443*			Q8NEF3	CC112_HUMAN	coiled-coil domain containing 112	360								p.E443K(1)		endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|skin(1)	20		all_cancers(142;0.000523)|all_epithelial(76;6.44e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;4.09e-08)|Epithelial(69;5.28e-08)|all cancers(49;7.06e-06)		CTCACTCTTTCTTGAAATCTG	0.313																																																	1	Substitution - Missense(1)	large_intestine(1)											64.0	69.0	67.0					5																	114606915		2201	4297	6498	SO:0001587	stop_gained	0			BC031242	CCDS4117.1, CCDS34213.1	5q22.3	2009-04-17			ENSG00000164221	ENSG00000164221			28599	protein-coding gene	gene with protein product						12477932	Standard	NM_001040440		Approved	MGC39633	uc003kqz.2	Q8NEF3	OTTHUMG00000128894	ENST00000512261.1:c.1078G>T	5.37:g.114606915C>A	ENSP00000423712:p.Glu360*		Q6A334	Nonsense_Mutation	SNP	superfamily_Homeodomain-like	p.E443*	ENST00000512261.1	37	c.1327	CCDS4117.1	5	.	.	.	.	.	.	.	.	.	.	C	42	9.174780	0.99089	.	.	ENSG00000164221	ENST00000379611;ENST00000512261;ENST00000506442;ENST00000395557	.	.	.	6.17	5.31	0.75309	.	0.243252	0.42172	D	0.000759	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-25.3998	14.7193	0.69294	0.0:0.9298:0.0:0.0702	.	.	.	.	X	443;360;360;360	.	ENSP00000368931:E443X	E	-	1	0	CCDC112	114634814	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.457000	0.66672	1.626000	0.50381	0.655000	0.94253	GAA	CCDC112	-	NULL	ENSG00000164221		0.313	CCDC112-003	PUTATIVE	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	CCDC112	HGNC	protein_coding	OTTHUMT00000370999.1	-	0.00	45	0	C	NM_152549		114606915	-1	tier1	-	no_errors	ENST00000379611	ensembl	human	known	74_37	nonsense	15.00	17	3	SNP	1.000	A
CCDC6	8030	genome.wustl.edu	37	10	61566744	61566744	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr10:61566744T>C	ENST00000263102.6	-	6	1171	c.940A>G	c.(940-942)Aga>Gga	p.R314G		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	314						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		GCTTCTCTTCTCTCCATCTCC	0.478			T	RET	NSCLC																																			Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	0													123.0	107.0	112.0					10																	61566744		2203	4300	6503	SO:0001583	missense	0			S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.940A>G	10.37:g.61566744T>C	ENSP00000263102:p.Arg314Gly		Q15250|Q6GSG7	Missense_Mutation	SNP	pfam_DUF2046	p.R314G	ENST00000263102.6	37	c.940	CCDS7257.1	10	.	.	.	.	.	.	.	.	.	.	T	21.7	4.184396	0.78677	.	.	ENSG00000108091	ENST00000263102	D	0.94092	-3.35	5.37	1.59	0.23543	.	0.000000	0.85682	D	0.000000	D	0.95601	0.8570	M	0.69358	2.11	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.95081	0.8213	10	0.87932	D	0	-13.5242	14.1751	0.65537	0.0:0.0:0.5558:0.4442	.	314	Q16204	CCDC6_HUMAN	G	314	ENSP00000263102:R314G	ENSP00000263102:R314G	R	-	1	2	CCDC6	61236750	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.820000	0.48057	0.320000	0.23234	0.378000	0.23410	AGA	CCDC6	-	pfam_DUF2046	ENSG00000108091		0.478	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC6	HGNC	protein_coding	OTTHUMT00000048176.2		0.00	71	0	T	NM_005436		61566744	-1			no_errors	ENST00000263102	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	C
CCDC8	83987	genome.wustl.edu	37	19	46915557	46915557	+	Missense_Mutation	SNP	G	G	A	rs574968989		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:46915557G>A	ENST00000307522.3	-	1	1284	c.511C>T	c.(511-513)Cgc>Tgc	p.R171C		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	171					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		TTGACGCGGCGGCGGGCAGGC	0.652																																																	0													28.0	33.0	31.0					19																	46915557		2203	4297	6500	SO:0001583	missense	0			BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.511C>T	19.37:g.46915557G>A	ENSP00000303158:p.Arg171Cys		Q8TB26	Missense_Mutation	SNP	NULL	p.R171C	ENST00000307522.3	37	c.511	CCDS12685.1	19	.	.	.	.	.	.	.	.	.	.	G	15.53	2.859876	0.51482	.	.	ENSG00000169515	ENST00000307522	T	0.20200	2.09	4.66	2.55	0.30701	.	0.346876	0.21248	N	0.077695	T	0.34106	0.0886	M	0.62723	1.935	0.36009	D	0.837952	D	0.89917	1.0	D	0.67382	0.951	T	0.42344	-0.9457	10	0.87932	D	0	-1.5585	3.5307	0.07775	0.2051:0.0:0.5933:0.2016	.	171	Q9H0W5	CCDC8_HUMAN	C	171	ENSP00000303158:R171C	ENSP00000303158:R171C	R	-	1	0	CCDC8	51607397	0.189000	0.23263	0.834000	0.33040	0.397000	0.30659	2.512000	0.45485	1.276000	0.44395	0.655000	0.94253	CGC	CCDC8	-	NULL	ENSG00000169515		0.652	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC8	HGNC	protein_coding	OTTHUMT00000368598.1	-	0.00	25	0	G	NM_032040		46915557	-1	tier1	-	no_errors	ENST00000307522	ensembl	human	known	74_37	missense	47.37	10	9	SNP	0.718	A
CCNC	892	genome.wustl.edu	37	6	100006343	100006343	+	Intron	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:100006343C>T	ENST00000520429.1	-	5	792				CCNC_ENST00000521017.1_Intron|CCNC_ENST00000523799.1_Intron|CCNC_ENST00000482541.2_Missense_Mutation_p.D126N|CCNC_ENST00000369220.4_Intron|CCNC_ENST00000518714.1_Intron|CCNC_ENST00000523985.1_Intron|CCNC_ENST00000520371.1_Intron	NM_001013399.1|NM_005190.3	NP_001013417.1|NP_005181.2	P24863	CCNC_HUMAN	cyclin C						gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|mediator complex (GO:0016592)|nucleoplasm (GO:0005654)							all_cancers(76;8.46e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.064)		AGAATTACATCCTTAAAGCAG	0.313																																					GBM(57;273 1020 40094 44454 49348)												0													93.0	93.0	93.0					6																	100006343		2203	4299	6502	SO:0001627	intron_variant	0				CCDS34502.1, CCDS47461.1	6q21	2008-02-05			ENSG00000112237	ENSG00000112237			1581	protein-coding gene	gene with protein product		123838				1833066	Standard	XM_005267202		Approved	CycC	uc003pqe.3	P24863	OTTHUMG00000015268	ENST00000520429.1:c.346+29G>A	6.37:g.100006343C>T			B4DPZ1|Q9H543	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.D126N	ENST00000520429.1	37	c.376	CCDS34502.1	6	.	.	.	.	.	.	.	.	.	.	C	4.812	0.151000	0.09185	.	.	ENSG00000112237	ENST00000482541	T	0.10860	2.83	5.54	-3.21	0.05140	.	.	.	.	.	T	0.01156	0.0038	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.48375	-0.9041	7	.	.	.	.	1.3112	0.02098	0.2828:0.2257:0.0911:0.4004	.	159	Q05CF7	.	N	126	ENSP00000417072:D126N	.	D	-	1	0	CCNC	100113064	0.000000	0.05858	0.000000	0.03702	0.391000	0.30476	-0.382000	0.07408	-0.493000	0.06678	0.655000	0.94253	GAT	CCNC	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000112237		0.313	CCNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCNC	HGNC	protein_coding	OTTHUMT00000041613.2	-	0.00	55	0	C	NM_005190		100006343	-1	tier1	-	no_errors	ENST00000482541	ensembl	human	putative	74_37	missense	47.73	23	21	SNP	0.000	T
CD2	914	genome.wustl.edu	37	1	117311133	117311133	+	Missense_Mutation	SNP	G	G	A	rs373098399		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:117311133G>A	ENST00000369478.3	+	5	892	c.784G>A	c.(784-786)Ggc>Agc	p.G262S		NM_001767.3	NP_001758.2	P06729	CD2_HUMAN	CD2 molecule	262					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|heterotypic cell-cell adhesion (GO:0034113)|leukocyte migration (GO:0050900)|membrane raft polarization (GO:0001766)|natural killer cell activation (GO:0030101)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of myeloid dendritic cell activation (GO:0030887)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of T cell differentiation (GO:0045580)|single organismal cell-cell adhesion (GO:0016337)|T cell activation (GO:0042110)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			NS(1)|breast(2)|large_intestine(3)|liver(1)|lung(8)|skin(2)|stomach(1)	18	Lung SC(450;0.225)	all_cancers(81;3.15e-06)|Acute lymphoblastic leukemia(138;1.7e-08)|all_epithelial(167;8.38e-07)|all_lung(203;3.37e-06)|Lung NSC(69;2.31e-05)		Epithelial(280;6.71e-26)|OV - Ovarian serous cystadenocarcinoma(397;4.74e-24)|all cancers(265;1.93e-22)|Lung(183;0.0543)|Kidney(133;0.0813)|Colorectal(144;0.174)|KIRC - Kidney renal clear cell carcinoma(1967;0.176)|LUSC - Lung squamous cell carcinoma(189;0.189)|BRCA - Breast invasive adenocarcinoma(282;0.201)	Alefacept(DB00092)	TGAAGAAAGGGGCCGGAAGCC	0.512																																					NSCLC(14;263 555 26380 43512 51332)												0								G	SER/GLY	1,4405	2.1+/-5.4	0,1,2202	66.0	63.0	64.0		784	-2.4	0.0	1		64	0,8600		0,0,4300	no	missense	CD2	NM_001767.3	56	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	262/352	117311133	1,13005	2203	4300	6503	SO:0001583	missense	0			BC033583	CCDS889.1	1p13	2013-01-11	2006-03-28		ENSG00000116824	ENSG00000116824		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1639	protein-coding gene	gene with protein product		186990	"""CD2 antigen (p50), sheep red blood cell receptor"""	SRBC		2437578	Standard	NM_001767		Approved		uc001egu.4	P06729	OTTHUMG00000022750	ENST00000369478.3:c.784G>A	1.37:g.117311133G>A	ENSP00000358490:p.Gly262Ser		Q96TE5	Missense_Mutation	SNP	pfam_Ig_C2-set,pfam_Ig_V-set,prints_CD2	p.G262S	ENST00000369478.3	37	c.784	CCDS889.1	1	.	.	.	.	.	.	.	.	.	.	G	11.25	1.584012	0.28268	2.27E-4	0.0	ENSG00000116824	ENST00000369478	T	0.42900	0.96	5.14	-2.41	0.06562	.	1.102310	0.06788	N	0.786583	T	0.10809	0.0264	L	0.35854	1.095	0.09310	N	1	B	0.21905	0.062	B	0.20767	0.031	T	0.31861	-0.9928	10	0.10377	T	0.69	-1.9949	9.5221	0.39143	0.5178:0.0:0.4822:0.0	.	262	P06729	CD2_HUMAN	S	262	ENSP00000358490:G262S	ENSP00000358490:G262S	G	+	1	0	CD2	117112656	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-0.330000	0.07925	-0.444000	0.07170	-0.290000	0.09829	GGC	CD2	-	NULL	ENSG00000116824		0.512	CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD2	HGNC	protein_coding	OTTHUMT00000059039.2	-	0.00	40	0	G	NM_001767		117311133	+1	tier1	-	no_errors	ENST00000369478	ensembl	human	known	74_37	missense	14.81	23	4	SNP	0.000	A
CD46	4179	genome.wustl.edu	37	1	207930986	207930986	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:207930986G>T	ENST00000358170.2	+	3	544	c.388G>T	c.(388-390)Ggt>Tgt	p.G130C	CD46_ENST00000360212.2_Splice_Site_p.G130C|CD46_ENST00000361067.1_Splice_Site_p.G130C|CD46_ENST00000322875.4_Splice_Site_p.G130C|CD46_ENST00000441839.2_Splice_Site_p.G130C|CD46_ENST00000354848.1_Splice_Site_p.G130C|CD46_ENST00000367047.1_Splice_Site_p.G67C|CD46_ENST00000367041.1_Splice_Site_p.G130C|CD46_ENST00000322918.5_Splice_Site_p.G130C|CD46_ENST00000480003.1_Splice_Site_p.G130C|CD46_ENST00000357714.1_Splice_Site_p.G130C|CD46_ENST00000367042.1_Splice_Site_p.G130C|CD46_ENST00000469535.1_3'UTR	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein	130	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						TTGTAATGAGGGGTAAGTTGC	0.358																																																	0													47.0	44.0	45.0					1																	207930986		2203	4300	6503	SO:0001630	splice_region_variant	0			BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.389+1G>T	1.37:g.207930986G>T			A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	Missense_Mutation	SNP	pirsf_M_CF_CD46,pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.G130C	ENST00000358170.2	37	c.388	CCDS1485.1	1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.218212	0.39201	.	.	ENSG00000117335	ENST00000358170;ENST00000354848;ENST00000322918;ENST00000367042;ENST00000367041;ENST00000357714;ENST00000322875;ENST00000367047;ENST00000441839;ENST00000361067;ENST00000360212;ENST00000480003	T;T;T;T;T;T;T;T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1;-1.1	4.07	4.07	0.47477	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.44285	D	0.000465	D	0.92485	0.7614	H	0.99182	4.46	0.54753	D	0.999989	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.94360	0.7587	10	0.87932	D	0	.	11.9311	0.52847	0.0:0.0:1.0:0.0	.	130;130;130;130;130;130;130;130;130;130;130;130;130;130	P15529-4;P15529-5;P15529-14;P15529-3;P15529-12;P15529-13;P15529-2;P15529-11;P15529-7;P15529-9;P15529-15;P15529-6;P15529-8;P15529	.;.;.;.;.;.;.;.;.;.;.;.;.;MCP_HUMAN	C	130;130;130;130;130;130;130;67;130;130;130;130	ENSP00000350893:G130C;ENSP00000346912:G130C;ENSP00000314664:G130C;ENSP00000356009:G130C;ENSP00000356008:G130C;ENSP00000350346:G130C;ENSP00000313875:G130C;ENSP00000356014:G67C;ENSP00000413543:G130C;ENSP00000354358:G130C;ENSP00000353342:G130C;ENSP00000418471:G130C	ENSP00000313875:G130C	G	+	1	0	CD46	205997609	0.995000	0.38212	0.910000	0.35882	0.109000	0.19521	3.625000	0.54238	2.251000	0.74343	0.491000	0.48974	GGT	CD46	-	pirsf_M_CF_CD46,pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000117335		0.358	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD46	HGNC	protein_coding	OTTHUMT00000088588.3		0.00	63	0	G	NM_172361	Missense_Mutation	207930986	+1			no_errors	ENST00000322875	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.941	T
CD5	921	genome.wustl.edu	37	11	60885646	60885646	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:60885646G>A	ENST00000347785.3	+	3	260		c.e3-1			NM_014207.3	NP_055022.2	P06127	CD5_HUMAN	CD5 molecule						apoptotic signaling pathway (GO:0097190)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)	p.?(1)		central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		CTGACCCCCAGATTTCCAGGC	0.637																																																	1	Unknown(1)	lung(1)											81.0	86.0	84.0					11																	60885646		2203	4299	6502	SO:0001630	splice_region_variant	0			X04391	CCDS8000.1	11q13	2008-07-18	2006-03-28		ENSG00000110448	ENSG00000110448		"""CD molecules"""	1685	protein-coding gene	gene with protein product		153340	"""CD5 antigen (p56-62)"""	LEU1		1711157	Standard	NM_014207		Approved	T1	uc009ynk.3	P06127	OTTHUMG00000167825	ENST00000347785.3:c.95-1G>A	11.37:g.60885646G>A			A0N0P4|A8K9I3	Splice_Site	SNP	-	e3-1	ENST00000347785.3	37	c.95-1	CCDS8000.1	11	.	.	.	.	.	.	.	.	.	.	G	12.11	1.838430	0.32513	.	.	ENSG00000110448	ENST00000347785;ENST00000544014	.	.	.	3.8	3.8	0.43715	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4784	0.50312	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CD5	60642222	0.994000	0.37717	0.220000	0.23810	0.157000	0.22087	4.078000	0.57606	2.424000	0.82194	0.561000	0.74099	.	CD5	-	-	ENSG00000110448		0.637	CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD5	HGNC	protein_coding	OTTHUMT00000396465.2		0.00	58	0	G	NM_014207	Intron	60885646	+1			no_errors	ENST00000347785	ensembl	human	known	74_37	splice_site	5.00	38	2	SNP	0.234	A
CELP	1057	genome.wustl.edu	37	9	135957946	135957946	+	RNA	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:135957946C>T	ENST00000411440.2	+	0	21					NR_001275.2				carboxyl ester lipase pseudogene																		CTGATGCTCACCATGGGGCGC	0.627																																																	0																																												0			L14813		9q34.2	2014-03-18	2003-02-28	2003-03-07	ENSG00000170827	ENSG00000170827			1849	pseudogene	pseudogene			"""carboxyl ester lipase-like (bile salt-stimulated lipase-like)"""	CELL		1639390	Standard	NR_001275		Approved		uc011mcu.1		OTTHUMG00000020857		9.37:g.135957946C>T				RNA	SNP	-	NULL	ENST00000411440.2	37	NULL		9																																																																																			CELP	-	-	ENSG00000170827		0.627	CELP-002	KNOWN	basic	processed_transcript	CELP	HGNC	pseudogene	OTTHUMT00000339837.1	-	0.00	52	0	C	NM_001808		135957946	+1	tier1	-	no_errors	ENST00000411440	ensembl	human	known	74_37	rna	10.53	34	4	SNP	0.622	T
CELSR1	9620	genome.wustl.edu	37	22	46760103	46760103	+	Missense_Mutation	SNP	G	G	A	rs149360981		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr22:46760103G>A	ENST00000262738.3	-	34	8824	c.8825C>T	c.(8824-8826)aCg>aTg	p.T2942M		NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	2942					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CGTCTGCTCCGTCAGCGTCAG	0.662																																																	0								G	MET/THR	0,4400		0,0,2200	38.0	47.0	44.0		8825	0.6	0.3	22	dbSNP_134	44	2,8584		0,2,4291	no	missense	CELSR1	NM_014246.1	81	0,2,6491	AA,AG,GG		0.0233,0.0,0.0154	possibly-damaging	2942/3015	46760103	2,12984	2200	4293	6493	SO:0001583	missense	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.8825C>T	22.37:g.46760103G>A	ENSP00000262738:p.Thr2942Met		O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.T2942M	ENST00000262738.3	37	c.8825	CCDS14076.1	22	.	.	.	.	.	.	.	.	.	.	G	9.593	1.126565	0.20959	0.0	2.33E-4	ENSG00000075275	ENST00000262738	T	0.69175	-0.38	0.637	0.637	0.17735	.	0.104040	0.34460	U	0.003952	T	0.64283	0.2584	M	0.65498	2.005	0.46954	D	0.999262	D	0.61697	0.99	P	0.45971	0.499	T	0.67538	-0.5645	9	0.54805	T	0.06	.	.	.	.	.	2942	Q9NYQ6	CELR1_HUMAN	M	2942	ENSP00000262738:T2942M	ENSP00000262738:T2942M	T	-	2	0	CELSR1	45138767	0.028000	0.19301	0.284000	0.24805	0.366000	0.29705	1.482000	0.35486	0.591000	0.29711	0.313000	0.20887	ACG	CELSR1	-	NULL	ENSG00000075275		0.662	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1		0.00	48	0	G	NM_014246		46760103	-1			no_errors	ENST00000262738	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.775	A
CENPF	1063	genome.wustl.edu	37	1	214814805	214814805	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:214814805A>T	ENST00000366955.3	+	12	3292	c.3124A>T	c.(3124-3126)Aaa>Taa	p.K1042*		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)	p.K1042Q(1)		NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TCTTAGTCAAAAATACAAAGC	0.323																																					Colon(80;575 1284 11000 14801 43496)												1	Substitution - Missense(1)	large_intestine(1)											47.0	53.0	51.0					1																	214814805		2203	4299	6502	SO:0001587	stop_gained	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3124A>T	1.37:g.214814805A>T	ENSP00000355922:p.Lys1042*		Q13171|Q13246|Q5VVM7	Nonsense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_CenpF/LEK1_Rb-prot-bd	p.K1042*	ENST00000366955.3	37	c.3124	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	A	40	8.447118	0.98815	.	.	ENSG00000117724	ENST00000366955	.	.	.	4.86	3.7	0.42460	.	0.576602	0.14479	N	0.317056	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.9839	0.24718	0.7731:0.1476:0.0793:0.0	.	.	.	.	X	1042	.	ENSP00000355922:K1042X	K	+	1	0	CENPF	212881428	0.986000	0.35501	0.242000	0.24170	0.749000	0.42624	2.670000	0.46833	0.767000	0.33267	0.496000	0.49642	AAA	CENPF	-	NULL	ENSG00000117724		0.323	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1		0.00	30	0	A	NM_016343		214814805	+1			no_errors	ENST00000366955	ensembl	human	known	74_37	nonsense	6.45	29	2	SNP	0.812	T
CHD2	1106	genome.wustl.edu	37	15	93485157	93485157	+	Silent	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr15:93485157C>A	ENST00000394196.4	+	8	1866	c.798C>A	c.(796-798)gtC>gtA	p.V266V	CHD2_ENST00000536619.1_Silent_p.V279V|CHD2_ENST00000420239.2_Silent_p.V266V|CHD2_ENST00000557381.1_Silent_p.V266V	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	266	Chromo 1. {ECO:0000255|PROSITE- ProRule:PRU00053}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			TTGAAAAGGTCTTAGATTCAA	0.343																																																	0													108.0	109.0	109.0					15																	93485157		2197	4298	6495	SO:0001819	synonymous_variant	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.798C>A	15.37:g.93485157C>A			C6G482|Q96IP5	Silent	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.V266	ENST00000394196.4	37	c.798	CCDS10374.2	15																																																																																			CHD2	-	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	ENSG00000173575		0.343	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3		0.00	55	0	C	NM_001271		93485157	+1			no_errors	ENST00000420239	ensembl	human	known	74_37	silent	8.82	31	3	SNP	0.997	A
CHIA	27159	genome.wustl.edu	37	1	111861155	111861155	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:111861155C>T	ENST00000369740.1	+	9	873	c.770C>T	c.(769-771)gCt>gTt	p.A257V	CHIA_ENST00000343320.6_Missense_Mutation_p.A257V|CHIA_ENST00000353665.6_Missense_Mutation_p.A96V|RP5-1125M8.2_ENST00000426321.1_RNA|CHIA_ENST00000451398.2_Missense_Mutation_p.A96V|CHIA_ENST00000483391.1_Missense_Mutation_p.A96V|CHIA_ENST00000430615.1_Missense_Mutation_p.A149V	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	257					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		GGAGCACCAGCTGAGAAGCTC	0.507																																																	0													127.0	114.0	118.0					1																	111861155		2203	4300	6503	SO:0001583	missense	0			AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.770C>T	1.37:g.111861155C>T	ENSP00000358755:p.Ala257Val		Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,pfam_Chitin-bd_dom,superfamily_Glycoside_hydrolase_SF,superfamily_Chitin-bd_dom,smart_Chitinase_II,smart_Chitin-bd_dom,pfscan_Chitin-bd_dom	p.A257V	ENST00000369740.1	37	c.770	CCDS41368.1	1	.	.	.	.	.	.	.	.	.	.	C	14.24	2.475839	0.44044	.	.	ENSG00000134216	ENST00000422815;ENST00000483391;ENST00000369740;ENST00000343320;ENST00000451398;ENST00000353665;ENST00000489524;ENST00000430615	T;T;T;T;T;T;T;T	0.08102	3.13;3.13;3.13;3.13;3.13;3.13;3.13;3.13	4.57	3.66	0.41972	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.64402	U	0.000016	T	0.11410	0.0278	M	0.86028	2.79	0.38178	D	0.93952	P	0.45078	0.85	P	0.50537	0.643	T	0.02167	-1.1202	10	0.36615	T	0.2	-5.6018	10.5943	0.45327	0.0:0.9037:0.0:0.0963	.	257	Q9BZP6	CHIA_HUMAN	V	201;96;257;257;96;96;96;149	ENSP00000387671:A201V;ENSP00000436946:A96V;ENSP00000358755:A257V;ENSP00000341828:A257V;ENSP00000390476:A96V;ENSP00000338970:A96V;ENSP00000433309:A96V;ENSP00000391132:A149V	ENSP00000341828:A257V	A	+	2	0	CHIA	111662678	0.175000	0.23083	0.995000	0.50966	0.493000	0.33554	1.026000	0.30103	1.038000	0.40049	0.563000	0.77884	GCT	CHIA	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000134216		0.507	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIA	HGNC	protein_coding	OTTHUMT00000030710.1		0.00	54	0	C			111861155	+1			no_errors	ENST00000343320	ensembl	human	known	74_37	missense	9.68	28	3	SNP	0.992	T
CHL1	10752	genome.wustl.edu	37	3	423958	423958	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:423958T>G	ENST00000256509.2	+	17	2615	c.1973T>G	c.(1972-1974)aTt>aGt	p.I658S	CHL1-AS1_ENST00000417612.1_RNA|CHL1_ENST00000397491.2_Missense_Mutation_p.I642S	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		AACAGCAATATTAGCGGTAGG	0.413																																																	0													68.0	73.0	71.0					3																	423958		2203	4300	6503	SO:0001583	missense	0			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.1973T>G	3.37:g.423958T>G	ENSP00000256509:p.Ile658Ser		Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.I658S	ENST00000256509.2	37	c.1973	CCDS2556.1	3	.	.	.	.	.	.	.	.	.	.	T	26.1	4.709639	0.89018	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.62364	0.03;0.03	4.86	4.86	0.63082	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.258640	0.36815	N	0.002383	D	0.82903	0.5138	H	0.94222	3.51	0.25067	N	0.99102	D;D;B	0.55385	0.971;0.971;0.044	P;P;B	0.62184	0.899;0.899;0.073	T	0.79252	-0.1880	10	0.72032	D	0.01	.	14.7359	0.69414	0.0:0.0:0.0:1.0	.	642;642;658	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	S	658;642	ENSP00000256509:I658S;ENSP00000380628:I642S	ENSP00000256509:I658S	I	+	2	0	CHL1	398958	0.928000	0.31464	0.020000	0.16555	0.921000	0.55340	3.929000	0.56514	1.950000	0.56595	0.482000	0.46254	ATT	CHL1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134121		0.413	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	HGNC	protein_coding	OTTHUMT00000207155.2	-	0.00	65	0	T	NM_006614		423958	+1	tier1	-	no_errors	ENST00000256509	ensembl	human	known	74_37	missense	14.29	36	6	SNP	0.147	G
CHPF2	54480	genome.wustl.edu	37	7	150932498	150932498	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:150932498G>A	ENST00000035307.2	+	2	2141	c.628G>A	c.(628-630)Gca>Aca	p.A210T	CHPF2_ENST00000495645.1_Missense_Mutation_p.A202T	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	210					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)	p.A210T(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						CTTAGGCCGGGCAGAGGAGTT	0.602																																																	1	Substitution - Missense(1)	skin(1)											92.0	91.0	91.0					7																	150932498		2203	4300	6503	SO:0001583	missense	0			AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.628G>A	7.37:g.150932498G>A	ENSP00000035307:p.Ala210Thr		B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.A210T	ENST00000035307.2	37	c.628	CCDS34779.1	7	.	.	.	.	.	.	.	.	.	.	G	17.51	3.406730	0.62399	.	.	ENSG00000033100	ENST00000495645;ENST00000035307;ENST00000377851	T;T	0.26660	1.72;1.73	5.52	3.7	0.42460	.	0.047280	0.85682	D	0.000000	T	0.11623	0.0283	N	0.14661	0.345	0.58432	D	0.999993	P;B	0.41597	0.756;0.137	B;B	0.36134	0.218;0.068	T	0.14337	-1.0476	9	.	.	.	-2.3365	5.9655	0.19322	0.0725:0.1349:0.6528:0.1398	.	210;202	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	T	202;210;210	ENSP00000418914:A202T;ENSP00000035307:A210T	.	A	+	1	0	CHPF2	150563431	1.000000	0.71417	0.977000	0.42913	0.991000	0.79684	2.707000	0.47143	0.685000	0.31468	0.655000	0.94253	GCA	CHPF2	-	pfam_Fringe-like	ENSG00000033100		0.602	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHPF2	HGNC	protein_coding	OTTHUMT00000348648.2		0.00	38	0	G	NM_019015		150932498	+1			no_errors	ENST00000035307	ensembl	human	known	74_37	missense	5.41	34	2	SNP	0.999	A
CHRNG	1146	genome.wustl.edu	37	2	233409225	233409225	+	Missense_Mutation	SNP	G	G	A	rs375087506		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:233409225G>A	ENST00000389494.3	+	10	1205	c.1184G>A	c.(1183-1185)cGc>cAc	p.R395H	CHRNG_ENST00000389492.3_Missense_Mutation_p.R343H	NM_005199.4	NP_005190.4	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma (muscle)	395					muscle contraction (GO:0006936)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)			breast(2)|endometrium(3)|large_intestine(4)|lung(12)|upper_aerodigestive_tract(1)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)	Galantamine(DB00674)	TGCCTGCCTCGCAGTGAACTC	0.657																																																	0								G	HIS/ARG	1,4405	2.1+/-5.4	0,1,2202	60.0	61.0	60.0		1184	4.3	1.0	2		60	0,8600		0,0,4300	no	missense	CHRNG	NM_005199.4	29	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging	395/518	233409225	1,13005	2203	4300	6503	SO:0001583	missense	0			X01715	CCDS33400.1	2q37.1	2012-10-02	2012-02-07		ENSG00000196811	ENSG00000196811		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1967	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, gamma (muscle)"""	100730	"""cholinergic receptor, nicotinic, gamma"""	ACHRG			Standard	NM_005199		Approved		uc002vsx.1	P07510	OTTHUMG00000153327	ENST00000389494.3:c.1184G>A	2.37:g.233409225G>A	ENSP00000374145:p.Arg395His		B3KWM8|Q14DU4|Q53RG2	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.R395H	ENST00000389494.3	37	c.1184	CCDS33400.1	2	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288997	0.80914	2.27E-4	0.0	ENSG00000196811	ENST00000389494;ENST00000541596;ENST00000389492	D;D	0.84873	-1.91;-1.91	5.21	4.29	0.51040	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.36972	U	0.002312	D	0.85873	0.5798	M	0.63428	1.95	0.45883	D	0.998735	B;P	0.43973	0.403;0.823	B;P	0.47376	0.126;0.545	D	0.86091	0.1550	10	0.72032	D	0.01	.	11.4937	0.50396	0.0943:0.0:0.9057:0.0	.	343;395	Q14DU4;P07510	.;ACHG_HUMAN	H	395;395;343	ENSP00000374145:R395H;ENSP00000374143:R343H	ENSP00000374143:R343H	R	+	2	0	CHRNG	233117469	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	3.982000	0.56909	1.081000	0.41110	0.462000	0.41574	CGC	CHRNG	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM	ENSG00000196811		0.657	CHRNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNG	HGNC	protein_coding	OTTHUMT00000330743.1	-	0.00	56	0	G	NM_005199		233409225	+1	tier1	-	no_errors	ENST00000389494	ensembl	human	known	74_37	missense	24.49	37	12	SNP	0.985	A
CHST7	56548	genome.wustl.edu	37	X	46433672	46433672	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:46433672G>A	ENST00000276055.3	+	1	454	c.306G>A	c.(304-306)caG>caA	p.Q102Q		NM_019886.2	NP_063939.2	Q9NS84	CHST7_HUMAN	carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7	102					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|N-acetylglucosamine metabolic process (GO:0006044)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|N-acetylglucosamine 6-O-sulfotransferase activity (GO:0001517)			breast(3)|endometrium(2)|kidney(1)|lung(2)	8						GCGAGAAGCAGCACATCTACG	0.647																																																	0													35.0	29.0	31.0					X																	46433672		2203	4300	6503	SO:0001819	synonymous_variant	0			AB040711	CCDS14268.1	Xp11.3	2008-02-05			ENSG00000147119	ENSG00000147119		"""Sulfotransferases, membrane-bound"""	13817	protein-coding gene	gene with protein product		300375				10781596	Standard	NM_019886		Approved	C6ST-2, C6ST2	uc004dgt.3	Q9NS84	OTTHUMG00000021423	ENST00000276055.3:c.306G>A	X.37:g.46433672G>A			O75667	Silent	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	p.Q102	ENST00000276055.3	37	c.306	CCDS14268.1	X																																																																																			CHST7	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,pirsf_Carbohydrate_sulfotransferase	ENSG00000147119		0.647	CHST7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST7	HGNC	protein_coding	OTTHUMT00000056362.1	-	0.00	57	0	G	NM_019886		46433672	+1	tier1	-	no_errors	ENST00000276055	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.906	A
CLSTN3	9746	genome.wustl.edu	37	12	7301683	7301683	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:7301683G>A	ENST00000266546.6	+	13	2413	c.1963G>A	c.(1963-1965)Gct>Act	p.A655T	CLSTN3_ENST00000537408.1_Missense_Mutation_p.A667T	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	655					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						TGCCCGCCCAGCTGTGGACTT	0.572																																																	0													81.0	67.0	71.0					12																	7301683		2203	4300	6503	SO:0001583	missense	0			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.1963G>A	12.37:g.7301683G>A	ENSP00000266546:p.Ala655Thr		D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A655T	ENST00000266546.6	37	c.1963	CCDS8575.1	12	.	.	.	.	.	.	.	.	.	.	G	31	5.058284	0.93846	.	.	ENSG00000139182	ENST00000266546;ENST00000537408	T;T	0.39229	1.09;1.09	5.71	4.82	0.62117	.	0.172000	0.50627	N	0.000106	T	0.57125	0.2032	M	0.64997	1.995	0.58432	D	0.999996	P;D	0.58268	0.675;0.982	B;P	0.59288	0.173;0.855	T	0.59467	-0.7449	10	0.51188	T	0.08	-7.1171	14.6135	0.68531	0.07:0.0:0.93:0.0	.	667;655	Q5UE57;Q9BQT9	.;CSTN3_HUMAN	T	655;667	ENSP00000266546:A655T;ENSP00000440679:A667T	ENSP00000266546:A655T	A	+	1	0	CLSTN3	7192950	1.000000	0.71417	0.927000	0.36925	0.803000	0.45373	6.676000	0.74498	1.413000	0.46997	0.561000	0.74099	GCT	CLSTN3	-	NULL	ENSG00000139182		0.572	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN3	HGNC	protein_coding	OTTHUMT00000398560.2		0.00	47	0	G	NM_014718		7301683	+1			no_errors	ENST00000266546	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.998	A
CNGA1	1259	genome.wustl.edu	37	4	47939078	47939078	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:47939078C>T	ENST00000514170.1	-	11	1752	c.1433G>A	c.(1432-1434)cGc>cAc	p.R478H	CNGA1_ENST00000358519.4_Missense_Mutation_p.R478H|CNGA1_ENST00000420489.2_Missense_Mutation_p.R478H|CNGA1_ENST00000402813.3_Missense_Mutation_p.R547H|CNGA1_ENST00000544810.1_Missense_Mutation_p.R478H			P29973	CNGA1_HUMAN	cyclic nucleotide gated channel alpha 1	478					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|urinary_tract(1)	28						AGCAAAAATGCGTACCTTTTT	0.378																																																	0													177.0	167.0	170.0					4																	47939078		1919	4150	6069	SO:0001583	missense	0			M84741	CCDS43226.1, CCDS47050.1	4p12	2013-02-14				ENSG00000198515		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2148	protein-coding gene	gene with protein product		123825		CNCG1, CNCG		7683629, 16382102	Standard	NM_000087		Approved	RCNC1, RCNCa, CNG1, RP49	uc003gxu.3	P29973		ENST00000514170.1:c.1433G>A	4.37:g.47939078C>T	ENSP00000426862:p.Arg478His		A8K7K6|J3KPZ2|Q16279|Q16485|Q4W5E3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.R547H	ENST00000514170.1	37	c.1640	CCDS43226.1	4	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350139	0.41599	.	.	ENSG00000198515	ENST00000402813;ENST00000514170;ENST00000544810;ENST00000358519;ENST00000420489	D;D;D;D;D	0.96651	-4.08;-4.08;-4.08;-4.08;-4.08	5.22	4.38	0.52667	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);	0.000000	0.85682	D	0.000000	D	0.94810	0.8324	M	0.86651	2.83	0.58432	D	0.999997	P;P	0.44260	0.83;0.83	B;B	0.26693	0.072;0.072	D	0.93962	0.7241	10	0.66056	D	0.02	.	13.6822	0.62493	0.0:0.9258:0.0:0.0742	.	478;478	Q4W5E3;P29973	.;CNGA1_HUMAN	H	547;478;478;478;478	ENSP00000384264:R547H;ENSP00000426862:R478H;ENSP00000443401:R478H;ENSP00000351320:R478H;ENSP00000389881:R478H	ENSP00000351320:R478H	R	-	2	0	CNGA1	47633835	1.000000	0.71417	0.776000	0.31678	0.291000	0.27294	7.487000	0.81328	1.203000	0.43233	-0.339000	0.08088	CGC	CNGA1	-	superfamily_cNMP-bd-like	ENSG00000198515		0.378	CNGA1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	CNGA1	HGNC	protein_coding	OTTHUMT00000372070.2	-	0.00	28	0	C	NM_000087		47939078	-1	tier1	-	no_errors	ENST00000402813	ensembl	human	known	74_37	missense	30.30	23	10	SNP	0.980	T
CNRIP1	25927	genome.wustl.edu	37	2	68544362	68544362	+	Missense_Mutation	SNP	G	G	A	rs377749015		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:68544362G>A	ENST00000263655.3	-	2	862	c.257C>T	c.(256-258)aCg>aTg	p.T86M	CNRIP1_ENST00000409559.3_Missense_Mutation_p.T86M|CNRIP1_ENST00000481714.1_5'UTR|CNRIP1_ENST00000409862.1_Missense_Mutation_p.T86M	NM_015463.2	NP_056278.1	Q96F85	CNRP1_HUMAN	cannabinoid receptor interacting protein 1	86										kidney(1)|large_intestine(5)|liver(1)|lung(1)|skin(1)	9						ATATGTACCCGTATAAACAAC	0.493																																																	0								G	MET/THR,MET/THR	0,4406		0,0,2203	161.0	138.0	146.0		257,257	4.3	1.0	2		146	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CNRIP1	NM_001111101.1,NM_015463.2	81,81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	86/129,86/165	68544362	1,13005	2203	4300	6503	SO:0001583	missense	0			AL110235	CCDS1886.1, CCDS46311.1	2p13	2008-02-05	2007-11-29	2007-11-29	ENSG00000119865	ENSG00000119865			24546	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 32"""	C2orf32		12477932	Standard	NM_015463		Approved	DKFZP566K1924, CRIP1, CRIP1a, CRIP1b	uc002sek.4	Q96F85	OTTHUMG00000129565	ENST00000263655.3:c.257C>T	2.37:g.68544362G>A	ENSP00000263655:p.Thr86Met		B2R4D0|Q49AN4|Q9UFZ0	Missense_Mutation	SNP	NULL	p.T86M	ENST00000263655.3	37	c.257	CCDS1886.1	2	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725079	0.68959	0.0	1.16E-4	ENSG00000119865	ENST00000409559;ENST00000263655;ENST00000409862	.	.	.	5.16	4.29	0.51040	.	0.233242	0.41823	D	0.000820	T	0.60637	0.2284	L	0.46157	1.445	0.38978	D	0.958883	D;D;P	0.59357	0.979;0.985;0.904	P;P;B	0.52823	0.502;0.71;0.226	T	0.66567	-0.5891	9	0.66056	D	0.02	-3.7973	12.1144	0.53858	0.0789:0.0:0.9211:0.0	.	86;86;86	B8ZZB8;Q96F85;Q96F85-2	.;CNRP1_HUMAN;.	M	86	.	ENSP00000263655:T86M	T	-	2	0	CNRIP1	68397866	0.789000	0.28775	0.996000	0.52242	0.996000	0.88848	1.037000	0.30241	1.418000	0.47098	0.555000	0.69702	ACG	CNRIP1	-	NULL	ENSG00000119865		0.493	CNRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNRIP1	HGNC	protein_coding	OTTHUMT00000251758.1	-	0.00	64	0	G	NM_015463		68544362	-1	tier1	-	no_errors	ENST00000263655	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.888	A
CNTNAP4	85445	genome.wustl.edu	37	16	76592524	76592524	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:76592524A>G	ENST00000476707.1	+	23	4019	c.3880A>G	c.(3880-3882)Agt>Ggt	p.S1294G	CNTNAP4_ENST00000469589.1_3'UTR|CNTNAP4_ENST00000377504.4_Missense_Mutation_p.S1242G|CNTNAP4_ENST00000478060.1_Missense_Mutation_p.S1218G|CNTNAP4_ENST00000307431.8_Missense_Mutation_p.S1290G|RP11-58C22.1_ENST00000563764.1_Intron			Q9C0A0	CNTP4_HUMAN	contactin associated protein-like 4	1291					cell adhesion (GO:0007155)|regulation of grooming behavior (GO:2000821)|regulation of synaptic transmission, dopaminergic (GO:0032225)|regulation of synaptic transmission, GABAergic (GO:0032228)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|presynaptic membrane (GO:0042734)				breast(4)|central_nervous_system(1)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(33)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	64						TGTTCTGAAAAGTGAGCTTAA	0.343																																																	0													72.0	70.0	70.0					16																	76592524		1883	4129	6012	SO:0001583	missense	0			AB051550	CCDS10924.1, CCDS10924.2, CCDS73915.1	16q23.1	2008-02-05			ENSG00000152910	ENSG00000152910			18747	protein-coding gene	gene with protein product		610518				12093160	Standard	NM_033401		Approved	CASPR4, KIAA1763	uc010chb.1	Q9C0A0	OTTHUMG00000137617	ENST00000476707.1:c.3880A>G	16.37:g.76592524A>G	ENSP00000417628:p.Ser1294Gly		E9PFZ6|Q86YZ7	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.S1290G	ENST00000476707.1	37	c.3868		16	.	.	.	.	.	.	.	.	.	.	A	14.07	2.425103	0.43020	.	.	ENSG00000152910	ENST00000307431;ENST00000377504;ENST00000478060;ENST00000476707	D;D;D;D	0.88277	-2.22;-2.32;-2.32;-2.36	5.65	5.65	0.86999	.	0.141196	0.32386	N	0.006165	D	0.84520	0.5490	.	.	.	0.36860	D	0.888339	B;B;P	0.40431	0.009;0.215;0.717	B;B;B	0.32677	0.008;0.101;0.15	D	0.88252	0.2917	9	0.54805	T	0.06	.	16.0399	0.80667	1.0:0.0:0.0:0.0	.	1218;1294;1291	E9PFZ6;E9PDN6;Q9C0A0	.;.;CNTP4_HUMAN	G	1290;1242;1218;1294	ENSP00000306893:S1290G;ENSP00000439733:S1242G;ENSP00000418741:S1218G;ENSP00000417628:S1294G	ENSP00000306893:S1290G	S	+	1	0	CNTNAP4	75150025	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.236000	0.65354	2.371000	0.80710	0.533000	0.62120	AGT	CNTNAP4	-	NULL	ENSG00000152910		0.343	CNTNAP4-005	PUTATIVE	basic	protein_coding	CNTNAP4	HGNC	protein_coding	OTTHUMT00000348216.1	-	0.00	53	0	A	NM_033401		76592524	+1	tier1	-	no_errors	ENST00000307431	ensembl	human	known	74_37	missense	12.20	36	5	SNP	1.000	G
COL11A2	1302	genome.wustl.edu	37	6	33144959	33144959	+	Splice_Site	SNP	T	T	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:33144959T>G	ENST00000374708.4	-	22	2015	c.1757A>C	c.(1756-1758)aAg>aCg	p.K586T	COL11A2_ENST00000477772.1_5'UTR|COL11A2_ENST00000374713.1_Splice_Site_p.K625T|COL11A2_ENST00000374714.1_Splice_Site_p.K646T|COL11A2_ENST00000341947.2_Splice_Site_p.K672T|COL11A2_ENST00000357486.1_Splice_Site_p.K651T|COL11A2_ENST00000361917.1_Splice_Site_p.K565T|COL11A2_ENST00000395197.1_Splice_Site_p.K612T|COL11A2_ENST00000374712.1_Splice_Site_p.K591T	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	672	Collagen-like 3.|Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						GTCACTTACCTTCTCTCCATG	0.547																																					Melanoma(1;90 116 3946 5341 17093)												0													57.0	66.0	63.0					6																	33144959		1509	2708	4217	SO:0001630	splice_region_variant	0			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1758+1A>C	6.37:g.33144959T>G			A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C_dom,smart_Laminin_G,smart_Fib_collagen_C	p.K672T	ENST00000374708.4	37	c.2015	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	T	19.21	3.784210	0.70222	.	.	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	D;D;D;D;D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07	4.16	4.16	0.48862	.	0.000000	0.85682	D	0.000000	D	0.95778	0.8626	L	0.48362	1.52	0.58432	D	0.999999	D;D;D	0.62365	0.971;0.989;0.991	P;D;P	0.68943	0.907;0.961;0.771	D	0.95491	0.8569	10	0.48119	T	0.1	.	11.2112	0.48799	0.0:0.0:0.0:1.0	.	565;586;672	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	T	586;672;651;646;625;612;591;565	ENSP00000363840:K586T;ENSP00000339915:K672T;ENSP00000350079:K651T;ENSP00000363846:K646T;ENSP00000363845:K625T;ENSP00000378623:K612T;ENSP00000363844:K591T;ENSP00000355123:K565T	ENSP00000339915:K672T	K	-	2	0	COL11A2	33252937	1.000000	0.71417	0.997000	0.53966	0.685000	0.39939	4.385000	0.59613	1.755000	0.51935	0.523000	0.50628	AAG	COL11A2	-	NULL	ENSG00000204248		0.547	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	-	0.00	41	0	T		Missense_Mutation	33144959	-1	tier1	-	no_errors	ENST00000341947	ensembl	human	known	74_37	missense	17.86	23	5	SNP	1.000	G
CSMD2	114784	genome.wustl.edu	37	1	34238271	34238271	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:34238271G>T	ENST00000338325.1	-	7	981	c.569C>A	c.(568-570)aCa>aAa	p.T190K	CSMD2_ENST00000373381.4_Missense_Mutation_p.T582K			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	542	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				AAACTTGAGTGTGTCACCGTG	0.557																																																	0													121.0	112.0	115.0					1																	34238271		2203	4300	6503	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000338325.1:c.569C>A	1.37:g.34238271G>T	ENSP00000340311:p.Thr190Lys		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.T582K	ENST00000338325.1	37	c.1745		1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.932377	0.52866	.	.	ENSG00000121904	ENST00000373381;ENST00000338325	T;T	0.63096	-0.02;-0.02	6.06	6.06	0.98353	Complement control module (2);Sushi/SCR/CCP (3);	0.236808	0.41938	D	0.000789	T	0.56949	0.2020	L	0.46670	1.46	0.80722	D	1	B;B	0.10296	0.003;0.002	B;B	0.21360	0.034;0.034	T	0.48581	-0.9023	10	0.27082	T	0.32	.	15.5725	0.76352	0.0:0.1381:0.8619:0.0	.	542;582	Q7Z408;E7EUA6	CSMD2_HUMAN;.	K	582;190	ENSP00000362479:T582K;ENSP00000340311:T190K	ENSP00000241312:T542K	T	-	2	0	CSMD2	34010858	0.998000	0.40836	0.915000	0.36163	0.995000	0.86356	2.750000	0.47500	2.882000	0.98803	0.655000	0.94253	ACA	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.557	CSMD2-004	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000036404.2		0.00	34	0	G	NM_052896		34238271	-1			no_errors	ENST00000373381	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.946	T
CSTF2	1478	genome.wustl.edu	37	X	100081702	100081702	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:100081702C>T	ENST00000372972.2	+	7	798	c.782C>T	c.(781-783)cCa>cTa	p.P261L	CSTF2_ENST00000415585.2_Missense_Mutation_p.P261L	NM_001325.2	NP_001316.1	P33240	CSTF2_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	261	Gly/Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cleavage body (GO:0071920)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	13						GGGCAAATGCCAGCTGCTGTC	0.493																																																	0													110.0	82.0	91.0					X																	100081702		2203	4300	6503	SO:0001583	missense	0			BC017712	CCDS14473.1	Xq22.1	2013-02-12	2002-08-29		ENSG00000101811	ENSG00000101811		"""RNA binding motif (RRM) containing"""	2484	protein-coding gene	gene with protein product		300907	"""cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kD"""			1741396	Standard	XM_006724622		Approved		uc004egh.3	P33240	OTTHUMG00000022709	ENST00000372972.2:c.782C>T	X.37:g.100081702C>T	ENSP00000362063:p.Pro261Leu		Q5H951|Q6LA74|Q8N502	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P261L	ENST00000372972.2	37	c.782	CCDS14473.1	X	.	.	.	.	.	.	.	.	.	.	C	6.890	0.533747	0.13188	.	.	ENSG00000101811	ENST00000415585;ENST00000372972;ENST00000458320	T;T	0.15372	2.43;2.43	4.56	3.68	0.42216	.	0.382983	0.28393	N	0.015506	T	0.14830	0.0358	N	0.24115	0.695	0.23003	N	0.998441	B;B;B	0.32918	0.017;0.39;0.148	B;B;B	0.38755	0.021;0.281;0.075	T	0.14727	-1.0462	10	0.48119	T	0.1	0.0622	12.8014	0.57588	0.0:0.6938:0.3062:0.0	.	261;244;261	E7EWR4;P33240-2;P33240	.;.;CSTF2_HUMAN	L	261;261;237	ENSP00000387996:P261L;ENSP00000362063:P261L	ENSP00000362063:P261L	P	+	2	0	CSTF2	99968358	0.711000	0.27906	0.005000	0.12908	0.116000	0.19942	3.217000	0.51184	0.836000	0.34901	0.462000	0.41574	CCA	CSTF2	-	NULL	ENSG00000101811		0.493	CSTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF2	HGNC	protein_coding	OTTHUMT00000058926.1		0.00	49	0	C	NM_001325		100081702	+1			no_errors	ENST00000415585	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.279	T
CT47B1	643311	genome.wustl.edu	37	X	120008762	120008762	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:120008762C>T	ENST00000371311.3	-	1	1017	c.763G>A	c.(763-765)Gtg>Atg	p.V255M		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	255										breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						TCGGGGGCCACGGCCTCCTCT	0.687																																																	0													30.0	29.0	30.0					X																	120008762		692	1590	2282	SO:0001583	missense	0				CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.763G>A	X.37:g.120008762C>T	ENSP00000360360:p.Val255Met		A6NM97	Missense_Mutation	SNP	NULL	p.V255M	ENST00000371311.3	37	c.763	CCDS48161.1	X	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.571767	0.00895	.	.	ENSG00000236446	ENST00000371311	.	.	.	1.23	-2.46	0.06461	.	.	.	.	.	T	0.14356	0.0347	N	0.08118	0	0.09310	N	1	B	0.27594	0.182	B	0.12837	0.008	T	0.05666	-1.0871	8	0.51188	T	0.08	.	2.9144	0.05748	0.3478:0.3814:0.0:0.2708	.	255	P0C2W7	CT47B_HUMAN	M	255	.	ENSP00000360360:V255M	V	-	1	0	CT47B1	119892790	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-3.742000	0.00378	-3.845000	0.00099	-3.056000	0.00068	GTG	CT47B1	-	NULL	ENSG00000236446		0.687	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CT47B1	HGNC	protein_coding	OTTHUMT00000058121.1	-	0.00	86	0	C	NM_001145718		120008762	-1	tier1	-	no_errors	ENST00000371311	ensembl	human	known	74_37	missense	5.88	79	5	SNP	0.000	T
RTP5	285093	genome.wustl.edu	37	2	242815414	242815414	+	Silent	SNP	G	G	A	rs542496668		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:242815414G>A	ENST00000343216.3	+	2	1735	c.1707G>A	c.(1705-1707)ccG>ccA	p.P569P		NM_173821.2	NP_776182.2																					GGATCTACCCGCAGCAAGTGT	0.657																																																	0													89.0	98.0	95.0					2																	242815414		1980	4052	6032	SO:0001819	synonymous_variant	0																														ENST00000343216.3:c.1707G>A	2.37:g.242815414G>A				Silent	SNP	NULL	p.P569	ENST00000343216.3	37	c.1707	CCDS42843.1	2																																																																																			CXXC11	-	NULL	ENSG00000188011		0.657	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXXC11	HGNC	protein_coding	OTTHUMT00000322310.1	-	0.00	97	0	G			242815414	+1	tier1	-	no_errors	ENST00000343216	ensembl	human	known	74_37	silent	12.07	51	7	SNP	0.004	A
CYP4A22	284541	genome.wustl.edu	37	1	47609456	47609456	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:47609456G>A	ENST00000371891.3	+	6	689	c.658G>A	c.(658-660)Gcc>Acc	p.A220T	CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4A22_ENST00000485117.1_3'UTR|CYP4A22_ENST00000294337.3_Missense_Mutation_p.A220T|CYP4A22_ENST00000371890.3_Intron	NM_001010969.2	NP_001010969.2	Q5TCH4	CP4AM_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 22	220						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CTACATCCAGGCCATTAGTGA	0.527																																					Pancreas(88;1240 1470 2099 14214 37557)												0													119.0	109.0	113.0					1																	47609456		2203	4300	6503	SO:0001583	missense	0				CCDS30707.1	1p33	2007-12-14			ENSG00000162365	ENSG00000162365		"""Cytochrome P450s"""	20575	protein-coding gene	gene with protein product		615341					Standard	XM_005270768		Approved		uc001cqv.1	Q5TCH4	OTTHUMG00000007845	ENST00000371891.3:c.658G>A	1.37:g.47609456G>A	ENSP00000360958:p.Ala220Thr		Q5TCH3|Q6JXK7|Q6JXK8|Q9NRM4	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV	p.A220T	ENST00000371891.3	37	c.658	CCDS30707.1	1	.	.	.	.	.	.	.	.	.	.	g	15.52	2.857686	0.51376	.	.	ENSG00000162365	ENST00000371891;ENST00000294337	T;T	0.70869	-0.52;-0.52	1.7	0.703	0.18116	.	0.111229	0.64402	D	0.000011	T	0.80879	0.4708	M	0.85710	2.77	0.26484	N	0.975067	D	0.63046	0.992	D	0.65773	0.938	T	0.71248	-0.4649	10	0.56958	D	0.05	.	7.8939	0.29695	0.1357:0.0:0.8643:0.0	.	220	Q5TCH4	CP4AM_HUMAN	T	220	ENSP00000360958:A220T;ENSP00000294337:A220T	ENSP00000294337:A220T	A	+	1	0	CYP4A22	47382043	0.997000	0.39634	0.002000	0.10522	0.023000	0.10783	5.029000	0.64121	0.071000	0.16664	0.205000	0.17691	GCC	CYP4A22	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000162365		0.527	CYP4A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4A22	HGNC	protein_coding	OTTHUMT00000021635.1		0.00	105	0	G	XM_208213		47609456	+1			no_errors	ENST00000371891	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.382	A
D2HGDH	728294	genome.wustl.edu	37	2	242681948	242681948	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:242681948C>T	ENST00000321264.4	+	4	658	c.449C>T	c.(448-450)aCt>aTt	p.T150I	D2HGDH_ENST00000403782.1_Missense_Mutation_p.T16I|D2HGDH_ENST00000342518.6_Missense_Mutation_p.T150I|D2HGDH_ENST00000537090.1_Missense_Mutation_p.T150I	NM_152783.3	NP_689996.4	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase	150	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular protein metabolic process (GO:0044267)|response to cobalt ion (GO:0032025)|response to manganese ion (GO:0010042)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	(R)-2-hydroxyglutarate dehydrogenase activity (GO:0051990)|flavin adenine dinucleotide binding (GO:0050660)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			breast(1)|endometrium(3)|lung(10)|skin(1)|urinary_tract(1)	16		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		ATCCTCTCCACTGCCCGCATG	0.642																																																	0													106.0	83.0	90.0					2																	242681948		2203	4296	6499	SO:0001583	missense	0			AK091725	CCDS33426.1, CCDS74684.1	2p25.3	2010-05-11			ENSG00000180902	ENSG00000180902	1.1.99.-		28358	protein-coding gene	gene with protein product		609186				15070399, 15609246	Standard	NM_152783		Approved	MGC25181, D2HGD, FLJ42195	uc002wce.1	Q8N465	OTTHUMG00000151474	ENST00000321264.4:c.449C>T	2.37:g.242681948C>T	ENSP00000315351:p.Thr150Ile		B4E3L6|E7ENP2|Q6IQ24|Q8N5Q8	Missense_Mutation	SNP	pfam_FAD-linked_oxidase_C,pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2,superfamily_FAD-linked_Oxase-like_C	p.T150I	ENST00000321264.4	37	c.449	CCDS33426.1	2	.	.	.	.	.	.	.	.	.	.	C	23.7	4.450015	0.84101	.	.	ENSG00000180902	ENST00000537090;ENST00000321264;ENST00000403782;ENST00000342518;ENST00000437164;ENST00000454048	D;D;D;D;D;D	0.96136	-3.92;-3.92;-3.92;-3.92;-3.92;-3.89	5.06	5.06	0.68205	FAD-binding, type 2, subdomain 1 (1);FAD-binding, type 2 (2);FAD linked oxidase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96987	0.9016	M	0.83852	2.665	0.80722	D	1	P	0.36587	0.559	P	0.48089	0.566	D	0.97280	0.9917	10	0.52906	T	0.07	.	18.4273	0.90613	0.0:1.0:0.0:0.0	.	150	Q8N465	D2HDH_HUMAN	I	150;150;16;150;34;20	ENSP00000442796:T150I;ENSP00000315351:T150I;ENSP00000384723:T16I;ENSP00000339536:T150I;ENSP00000412511:T34I;ENSP00000404596:T20I	ENSP00000315351:T150I	T	+	2	0	D2HGDH	242330621	1.000000	0.71417	0.994000	0.49952	0.609000	0.37215	7.164000	0.77533	2.362000	0.80069	0.555000	0.69702	ACT	D2HGDH	-	pfam_Oxid_FAD_bind_N,superfamily_FAD-bd_2	ENSG00000180902		0.642	D2HGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	D2HGDH	HGNC	protein_coding	OTTHUMT00000322794.2		0.00	15	0	C	NM_152783		242681948	+1			no_errors	ENST00000321264	ensembl	human	known	74_37	missense	19.05	17	4	SNP	1.000	T
DACT2	168002	genome.wustl.edu	37	6	168708819	168708819	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:168708819G>C	ENST00000366795.3	-	4	1706	c.1618C>G	c.(1618-1620)Ccc>Gcc	p.P540A	DACT2_ENST00000610183.1_Missense_Mutation_p.P370A|DACT2_ENST00000607983.1_Missense_Mutation_p.P132A|DACT2_ENST00000366796.3_Intron	NM_214462.3	NP_999627.2	Q5SW24	DACT2_HUMAN	dishevelled-binding antagonist of beta-catenin 2	540					epithelial cell morphogenesis (GO:0003382)|hematopoietic progenitor cell differentiation (GO:0002244)|inner medullary collecting duct development (GO:0072061)|negative regulation of cell adhesion (GO:0007162)|negative regulation of nodal signaling pathway (GO:1900108)|skin development (GO:0043588)	mitochondrion (GO:0005739)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)|transcription factor binding (GO:0008134)			endometrium(1)	1		Breast(66;1.46e-05)|Ovarian(120;0.0728)		OV - Ovarian serous cystadenocarcinoma(33;5.33e-21)|BRCA - Breast invasive adenocarcinoma(81;1.18e-06)|GBM - Glioblastoma multiforme(31;0.000957)		CTCCCTGTGGGCCAGTGGGCA	0.697																																																	0													8.0	13.0	11.0					6																	168708819		690	1587	2277	SO:0001583	missense	0			AF318336	CCDS47519.1, CCDS69241.1, CCDS75554.1	6q27	2013-05-15	2013-05-15	2003-09-17	ENSG00000164488	ENSG00000164488			21231	protein-coding gene	gene with protein product		608966	"""chromosome 6 open reading frame 116"", ""dapper homolog 2, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)"""	C6orf116			Standard	NM_001286351		Approved	bA503C24.7, DAPPER2	uc003qwq.3	Q5SW24	OTTHUMG00000016046	ENST00000366795.3:c.1618C>G	6.37:g.168708819G>C	ENSP00000355760:p.Pro540Ala		Q2NKJ2|Q569G0|Q8WYW2	Missense_Mutation	SNP	NULL	p.P540A	ENST00000366795.3	37	c.1618	CCDS47519.1	6	.	.	.	.	.	.	.	.	.	.	G	3.239	-0.155673	0.06544	.	.	ENSG00000164488	ENST00000366795	T	0.38722	1.12	3.05	-3.17	0.05202	.	7.078100	0.00508	N	0.000168	T	0.16385	0.0394	M	0.65498	2.005	0.09310	N	0.999998	B	0.20164	0.042	B	0.24155	0.051	T	0.08994	-1.0695	10	0.27785	T	0.31	-3.6992	3.0278	0.06097	0.273:0.1211:0.4839:0.122	.	540	Q5SW24	DACT2_HUMAN	A	540	ENSP00000355760:P540A	ENSP00000355760:P540A	P	-	1	0	DACT2	168451668	0.015000	0.18098	0.000000	0.03702	0.000000	0.00434	0.801000	0.27055	-1.202000	0.02655	-3.357000	0.00042	CCC	DACT2	-	NULL	ENSG00000164488		0.697	DACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DACT2	HGNC	protein_coding	OTTHUMT00000043193.1	-	0.00	86	0	G			168708819	-1	tier1	-	no_errors	ENST00000366795	ensembl	human	known	74_37	missense	8.70	63	6	SNP	0.000	C
DCDC1	341019	genome.wustl.edu	37	11	31263095	31263095	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:31263095C>A	ENST00000597505.1	-	7	1122	c.1123G>T	c.(1123-1125)Gga>Tga	p.G375*				P59894	DCDC1_HUMAN	doublecortin domain containing 1	240					intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					AAACCTTCTCCCTTAGAGACC	0.403																																																	0																																										SO:0001587	stop_gained	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000597505.1:c.1123G>T	11.37:g.31263095C>A	ENSP00000472625:p.Gly375*		A6PVL6|B7WNX6|Q6ZU04	Nonsense_Mutation	SNP	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Doublecortin_dom,pfscan_Doublecortin_dom,pfscan_Ricin_B_lectin	p.G375*	ENST00000597505.1	37	c.1123		11																																																																																			DCDC1	-	NULL	ENSG00000170959		0.403	DCDC1-010	PUTATIVE	basic	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000463167.1	-	0.00	72	0	C	NM_181807		31263095	-1	tier1	-	no_errors	ENST00000597505	ensembl	human	putative	74_37	nonsense	13.11	53	8	SNP	1.000	A
DCLK3	85443	genome.wustl.edu	37	3	36779750	36779750	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:36779750C>T	ENST00000416516.2	-	2	891	c.401G>A	c.(400-402)gGt>gAt	p.G134D		NM_033403.1	NP_208382.1	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	134						cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.G134V(1)		breast(3)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	48						GATAATTTCACCCGAGGTCTT	0.572																																																	1	Substitution - Missense(1)	lung(1)											142.0	142.0	142.0					3																	36779750		1885	4116	6001	SO:0001583	missense	0			AB051552	CCDS43064.1	3p22.3	2007-04-02	2007-04-02	2007-04-02	ENSG00000163673	ENSG00000163673			19005	protein-coding gene	gene with protein product		613167	"""doublecortin and CaM kinase-like 3"""	DCAMKL3		11214970, 16869982	Standard	NM_033403		Approved	KIAA1765, DCDC3C	uc003cgi.2	Q9C098	OTTHUMG00000155805	ENST00000416516.2:c.401G>A	3.37:g.36779750C>T	ENSP00000394484:p.Gly134Asp			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.G134D	ENST00000416516.2	37	c.401	CCDS43064.1	3	.	.	.	.	.	.	.	.	.	.	C	16.16	3.045783	0.55110	.	.	ENSG00000163673	ENST00000416516	T	0.68181	-0.31	4.7	4.7	0.59300	.	0.000000	0.33419	N	0.004924	T	0.66117	0.2757	L	0.34521	1.04	0.27530	N	0.95112	D	0.60160	0.987	P	0.56612	0.802	T	0.61436	-0.7063	10	0.62326	D	0.03	.	9.869	0.41162	0.0:0.866:0.0:0.134	.	134	Q9C098	DCLK3_HUMAN	D	134	ENSP00000394484:G134D	ENSP00000394484:G134D	G	-	2	0	DCLK3	36754754	0.179000	0.23135	0.117000	0.21633	0.886000	0.51366	1.120000	0.31271	2.339000	0.79563	0.655000	0.94253	GGT	DCLK3	-	NULL	ENSG00000163673		0.572	DCLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLK3	HGNC	protein_coding	OTTHUMT00000341727.1		0.00	43	0	C	XM_047355		36779750	-1			no_errors	ENST00000416516	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.553	T
DCLRE1A	9937	genome.wustl.edu	37	10	115609026	115609026	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr10:115609026T>C	ENST00000361384.2	-	2	2755	c.1838A>G	c.(1837-1839)gAt>gGt	p.D613G	DCLRE1A_ENST00000369305.1_Missense_Mutation_p.D613G	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	613	Nuclear focus formation.				mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		AGTACTTGCATCAAATTCTAA	0.378								Other identified genes with known or suspected DNA repair function																																									0													123.0	121.0	122.0					10																	115609026		2203	4300	6503	SO:0001583	missense	0				CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.1838A>G	10.37:g.115609026T>C	ENSP00000355185:p.Asp613Gly		D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Missense_Mutation	SNP	pfam_DRMBL	p.D613G	ENST00000361384.2	37	c.1838	CCDS7584.1	10	.	.	.	.	.	.	.	.	.	.	T	16.17	3.047381	0.55110	.	.	ENSG00000198924	ENST00000361384;ENST00000369305	T;T	0.65549	-0.16;-0.16	5.73	5.73	0.89815	.	0.448545	0.26082	N	0.026449	T	0.64114	0.2569	L	0.59436	1.845	0.43130	D	0.994869	D	0.53619	0.961	P	0.49637	0.617	T	0.66002	-0.6031	10	0.44086	T	0.13	-21.863	9.7453	0.40442	0.1919:0.0:0.0:0.8081	.	613	Q6PJP8	DCR1A_HUMAN	G	613	ENSP00000355185:D613G;ENSP00000358311:D613G	ENSP00000355185:D613G	D	-	2	0	DCLRE1A	115599016	0.140000	0.22579	1.000000	0.80357	0.805000	0.45488	2.566000	0.45948	2.302000	0.77476	0.533000	0.62120	GAT	DCLRE1A	-	NULL	ENSG00000198924		0.378	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1A	HGNC	protein_coding	OTTHUMT00000050444.1	-	0.00	54	0	T	NM_014881		115609026	-1	tier1	-	no_errors	ENST00000361384	ensembl	human	known	74_37	missense	13.33	39	6	SNP	0.907	C
DCST1	149095	genome.wustl.edu	37	1	155013913	155013913	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:155013913C>A	ENST00000295542.1	+	7	668	c.572C>A	c.(571-573)tCc>tAc	p.S191Y	DCST1_ENST00000423025.2_Missense_Mutation_p.S166Y|DCST1_ENST00000392480.1_Missense_Mutation_p.S191Y|DCST1_ENST00000368419.2_Missense_Mutation_p.S191Y	NM_152494.3	NP_689707.2	Q5T197	DCST1_HUMAN	DC-STAMP domain containing 1	191						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	27	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			CGGAACATCTCCGCCACTTTT	0.582																																																	0													47.0	46.0	46.0					1																	155013913		2203	4300	6503	SO:0001583	missense	0			AK057347	CCDS1083.1, CCDS44235.1	1q22	2008-02-05			ENSG00000163357	ENSG00000163357			26539	protein-coding gene	gene with protein product							Standard	NM_152494		Approved	FLJ32785	uc001fgn.2	Q5T197	OTTHUMG00000041314	ENST00000295542.1:c.572C>A	1.37:g.155013913C>A	ENSP00000295542:p.Ser191Tyr		B4DXA0|E9PHV3|Q5T198|Q6P1W6|Q71S70|Q96M70	Missense_Mutation	SNP	pfam_DC_STAMP-like,pfscan_Znf_RING	p.S191Y	ENST00000295542.1	37	c.572	CCDS1083.1	1	.	.	.	.	.	.	.	.	.	.	C	14.77	2.635835	0.47049	.	.	ENSG00000163357	ENST00000295542;ENST00000392480;ENST00000423025;ENST00000368419	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	4.29	4.29	0.51040	.	0.729827	0.11580	N	0.549879	T	0.38719	0.1051	L	0.50333	1.59	0.31902	N	0.615778	P;P;P	0.48089	0.905;0.893;0.883	B;B;B	0.43052	0.386;0.406;0.312	T	0.39187	-0.9626	10	0.59425	D	0.04	-20.8804	8.2697	0.31836	0.0:0.8928:0.0:0.1071	.	166;216;191	E9PHV3;E9PJX3;Q5T197	.;.;DCST1_HUMAN	Y	191;191;166;191	ENSP00000295542:S191Y;ENSP00000376271:S191Y;ENSP00000387369:S166Y;ENSP00000357404:S191Y	ENSP00000295542:S191Y	S	+	2	0	DCST1	153280537	0.908000	0.30866	0.853000	0.33588	0.109000	0.19521	1.783000	0.38664	2.403000	0.81681	0.313000	0.20887	TCC	DCST1	-	NULL	ENSG00000163357		0.582	DCST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCST1	HGNC	protein_coding	OTTHUMT00000099006.1	-	0.00	46	0	C	NM_152494		155013913	+1	tier1	-	no_errors	ENST00000295542	ensembl	human	known	74_37	missense	20.00	48	12	SNP	0.730	A
DDB2	1643	genome.wustl.edu	37	11	47254427	47254427	+	Silent	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:47254427C>T	ENST00000256996.4	+	4	714	c.519C>T	c.(517-519)taC>taT	p.Y173Y	DDB2_ENST00000378601.3_Silent_p.Y173Y|DDB2_ENST00000378600.3_Intron|DDB2_ENST00000378603.3_Silent_p.Y109Y	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa	173					DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						ACCAGTTTTACGCCTCCTCAA	0.463			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	0													167.0	138.0	148.0					11																	47254427		2201	4298	6499	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.519C>T	11.37:g.47254427C>T			B2R875|Q76E54|Q76E55|Q76E56|Q76E57	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y173	ENST00000256996.4	37	c.519	CCDS7927.1	11																																																																																			DDB2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000134574		0.463	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DDB2	HGNC	protein_coding		-	0.00	55	0	C	NM_000107		47254427	+1	tier1	-	no_errors	ENST00000256996	ensembl	human	known	74_37	silent	8.16	45	4	SNP	0.990	T
DECR1	1666	genome.wustl.edu	37	8	91063956	91063956	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:91063956G>T	ENST00000220764.2	+	9	1025	c.937G>T	c.(937-939)Gac>Tac	p.D313Y	DECR1_ENST00000522161.1_Missense_Mutation_p.D304Y	NM_001359.1	NP_001350.1	Q16698	DECR_HUMAN	2,4-dienoyl CoA reductase 1, mitochondrial	313					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	2,4-dienoyl-CoA reductase (NADPH) activity (GO:0008670)|NADPH binding (GO:0070402)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	15			BRCA - Breast invasive adenocarcinoma(11;0.00953)			GGAATTCAACGACCTGAGAAA	0.313																																																	0													87.0	91.0	89.0					8																	91063956		2203	4300	6503	SO:0001583	missense	0			L26050	CCDS6250.1	8q21.3	2011-09-14			ENSG00000104325	ENSG00000104325		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	2753	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 18C, member 1"""	222745		DECR		7818482, 19027726	Standard	NM_001359		Approved	SDR18C1	uc003yek.1	Q16698	OTTHUMG00000163829	ENST00000220764.2:c.937G>T	8.37:g.91063956G>T	ENSP00000220764:p.Asp313Tyr		B7Z6B8|Q2M304|Q93085	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH	p.D313Y	ENST00000220764.2	37	c.937	CCDS6250.1	8	.	.	.	.	.	.	.	.	.	.	G	0	-2.607565	0.00121	.	.	ENSG00000104325	ENST00000220764;ENST00000522161	D;D	0.84800	-1.76;-1.9	5.88	0.0319	0.14173	.	0.664559	0.16799	N	0.199043	T	0.66208	0.2766	L	0.29908	0.895	0.20074	N	0.999935	B;B	0.22211	0.066;0.013	B;B	0.22152	0.038;0.008	T	0.51196	-0.8736	10	0.02654	T	1	.	1.1638	0.01811	0.4486:0.2125:0.124:0.2149	.	304;313	B7Z6B8;Q16698	.;DECR_HUMAN	Y	313;304	ENSP00000220764:D313Y;ENSP00000429779:D304Y	ENSP00000220764:D313Y	D	+	1	0	DECR1	91133132	0.048000	0.20356	0.115000	0.21578	0.014000	0.08584	0.318000	0.19504	0.100000	0.17581	-0.290000	0.09829	GAC	DECR1	-	NULL	ENSG00000104325		0.313	DECR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DECR1	HGNC	protein_coding	OTTHUMT00000375822.1	-	0.00	73	0	G			91063956	+1	tier1	-	no_errors	ENST00000220764	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.031	T
DGKI	9162	genome.wustl.edu	37	7	137075144	137075144	+	IGR	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:137075144A>G	ENST00000288490.5	-	0	3895				DGKI_ENST00000494390.1_5'UTR|DGKI_ENST00000453654.2_3'UTR	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						CAAAAGGCAAAGATGGCTACA	0.498																																																	0																																										SO:0001628	intergenic_variant	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697		7.37:g.137075144A>G			A4D1Q9|Q9NZ49	RNA	SNP	-	NULL	ENST00000288490.5	37	NULL	CCDS5845.1	7																																																																																			DGKI	-	-	ENSG00000157680		0.498	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	-	0.00	37	0	A	NM_004717		137075144	-1	tier1	-	no_errors	ENST00000494390	ensembl	human	known	74_37	rna	29.41	12	5	SNP	1.000	G
DNAH5	1767	genome.wustl.edu	37	5	13845021	13845021	+	Silent	SNP	C	C	T	rs201484389		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:13845021C>T	ENST00000265104.4	-	32	5300	c.5196G>A	c.(5194-5196)gcG>gcA	p.A1732A		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1732	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GGGAGTCCGACGCCTGCCCCA	0.468									Kartagener syndrome																																								0													110.0	110.0	110.0					5																	13845021		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.5196G>A	5.37:g.13845021C>T			Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.A1732	ENST00000265104.4	37	c.5196	CCDS3882.1	5																																																																																			DNAH5	-	pfam_Dynein_heavy_dom-2	ENSG00000039139		0.468	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	-	0.00	56	0	C	NM_001369		13845021	-1	tier1	-	no_errors	ENST00000265104	ensembl	human	known	74_37	silent	35.62	47	26	SNP	0.464	T
DNAH9	1770	genome.wustl.edu	37	17	11573044	11573044	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:11573044C>A	ENST00000262442.4	+	17	3354	c.3286C>A	c.(3286-3288)Ctg>Atg	p.L1096M	DNAH9_ENST00000454412.2_Missense_Mutation_p.L1096M	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1096	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TAAGGCATCTCTGCTGAATAT	0.458																																																	0													130.0	133.0	132.0					17																	11573044		2203	4300	6503	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3286C>A	17.37:g.11573044C>A	ENSP00000262442:p.Leu1096Met		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.L1096M	ENST00000262442.4	37	c.3286	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	12.63	1.994235	0.35226	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.47528	0.88;0.84	4.73	3.76	0.43208	.	0.000000	0.56097	D	0.000021	T	0.66645	0.2810	M	0.84846	2.72	0.80722	D	1	D	0.62365	0.991	P	0.62649	0.905	T	0.70784	-0.4778	10	0.72032	D	0.01	.	10.184	0.42986	0.0:0.8221:0.0:0.1779	.	1096	Q9NYC9	DYH9_HUMAN	M	1096	ENSP00000262442:L1096M;ENSP00000414874:L1096M	ENSP00000262442:L1096M	L	+	1	2	DNAH9	11513769	0.705000	0.27846	0.951000	0.38953	0.195000	0.23768	1.131000	0.31406	1.111000	0.41721	0.591000	0.81541	CTG	DNAH9	-	NULL	ENSG00000007174		0.458	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	27	0	C	NM_001372		11573044	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	17.95	32	7	SNP	0.937	A
DNAH9	1770	genome.wustl.edu	37	17	11840831	11840831	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:11840831G>A	ENST00000262442.4	+	66	12720	c.12652G>A	c.(12652-12654)Gaa>Aaa	p.E4218K	DNAH9_ENST00000608377.1_Missense_Mutation_p.E530K|DNAH9_ENST00000454412.2_Missense_Mutation_p.E4142K|DNAH9_ENST00000396001.2_3'UTR	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	4218					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CGCCACAAGAGAAGAAAAGGT	0.587																																																	0													65.0	74.0	71.0					17																	11840831		2203	4300	6503	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.12652G>A	17.37:g.11840831G>A	ENSP00000262442:p.Glu4218Lys		A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E4218K	ENST00000262442.4	37	c.12652	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663867	0.67700	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703;ENST00000396001	T;T;T	0.11169	2.8;2.8;2.8	4.87	4.87	0.63330	Dynein heavy chain (1);	0.257056	0.44688	D	0.000433	T	0.45013	0.1321	H	0.95402	3.665	0.80722	D	1	D	0.56746	0.977	P	0.62560	0.904	T	0.62445	-0.6853	10	0.87932	D	0	.	18.5672	0.91120	0.0:0.0:1.0:0.0	.	4218	Q9NYC9	DYH9_HUMAN	K	4218;4142;2724;530	ENSP00000262442:E4218K;ENSP00000414874:E4142K;ENSP00000379323:E530K	ENSP00000262442:E4218K	E	+	1	0	DNAH9	11781556	1.000000	0.71417	0.961000	0.40146	0.270000	0.26580	9.561000	0.98142	2.689000	0.91719	0.551000	0.68910	GAA	DNAH9	-	pfam_Dynein_heavy_dom	ENSG00000007174		0.587	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	-	0.00	61	0	G	NM_001372		11840831	+1	tier1	-	no_errors	ENST00000262442	ensembl	human	known	74_37	missense	21.15	41	11	SNP	1.000	A
DOCK10	55619	genome.wustl.edu	37	2	225662608	225662608	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:225662608T>C	ENST00000258390.7	-	42	4652	c.4585A>G	c.(4585-4587)Aat>Gat	p.N1529D	DOCK10_ENST00000409592.3_Missense_Mutation_p.N1523D	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1529					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GCTGACTGATTGACTTGGAAA	0.413																																																	0													160.0	155.0	157.0					2																	225662608		1931	4138	6069	SO:0001583	missense	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.4585A>G	2.37:g.225662608T>C	ENSP00000258390:p.Asn1529Asp		B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.N1529D	ENST00000258390.7	37	c.4585	CCDS46528.1	2	.	.	.	.	.	.	.	.	.	.	T	17.27	3.346123	0.61073	.	.	ENSG00000135905	ENST00000409592;ENST00000258390;ENST00000373702	T;T	0.63417	0.11;-0.04	5.95	5.95	0.96441	.	0.041989	0.85682	D	0.000000	T	0.67344	0.2883	M	0.69185	2.1	0.35063	D	0.761742	P;P;P;B	0.46395	0.568;0.877;0.774;0.35	B;B;P;B	0.45913	0.127;0.339;0.497;0.138	T	0.77638	-0.2513	10	0.49607	T	0.09	.	16.4237	0.83790	0.0:0.0:0.0:1.0	.	1529;383;1523;191	Q96BY6;B4DF07;B3FL70;B4DEY4	DOC10_HUMAN;.;.;.	D	1523;1529;67	ENSP00000386694:N1523D;ENSP00000258390:N1529D	ENSP00000258390:N1529D	N	-	1	0	DOCK10	225370852	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.499000	0.81566	2.279000	0.76181	0.533000	0.62120	AAT	DOCK10	-	superfamily_ARM-type_fold	ENSG00000135905		0.413	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	-	0.00	68	0	T			225662608	-1	tier1	-	no_errors	ENST00000258390	ensembl	human	known	74_37	missense	17.39	38	8	SNP	1.000	C
DOCK11	139818	genome.wustl.edu	37	X	117814625	117814625	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:117814625G>T	ENST00000276202.7	+	49	5704	c.5641G>T	c.(5641-5643)Gaa>Taa	p.E1881*	DOCK11_ENST00000276204.6_Nonsense_Mutation_p.E1881*	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1881	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						CTGTATAGAAGAACAGTGCAA	0.378																																																	0													107.0	113.0	111.0					X																	117814625		2203	4300	6503	SO:0001587	stop_gained	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.5641G>T	X.37:g.117814625G>T	ENSP00000276202:p.Glu1881*		A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Nonsense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E1881*	ENST00000276202.7	37	c.5641	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	G	46	12.400481	0.99664	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-16.8381	17.0065	0.86394	0.0:0.0:1.0:0.0	.	.	.	.	X	1881	.	ENSP00000276202:E1881X	E	+	1	0	DOCK11	117698653	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.441000	0.97557	2.224000	0.72417	0.422000	0.28245	GAA	DOCK11	-	pfam_DOCK_C	ENSG00000147251		0.378	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1		0.00	53	0	G	NM_144658		117814625	+1			no_errors	ENST00000276202	ensembl	human	known	74_37	nonsense	9.30	39	4	SNP	1.000	T
DPCR1	135656	genome.wustl.edu	37	6	30917649	30917649	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:30917649G>A	ENST00000462446.1	+	2	1436	c.1408G>A	c.(1408-1410)Gag>Aag	p.E470K	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_5'UTR			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	362						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						GACAGCCAACGAGAAGACCAC	0.493																																																	0													327.0	395.0	374.0					6																	30917649		692	1591	2283	SO:0001583	missense	0			AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.1408G>A	6.37:g.30917649G>A	ENSP00000417182:p.Glu470Lys		C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	NULL	p.E470K	ENST00000462446.1	37	c.1408	CCDS4692.2	6	.	.	.	.	.	.	.	.	.	.	-	5.088	0.201879	0.09652	.	.	ENSG00000168631	ENST00000462446	T	0.42900	0.96	1.06	-1.18	0.09617	.	.	.	.	.	T	0.09468	0.0233	L	0.59436	1.845	0.48341	D	0.999636	P	0.40476	0.718	B	0.19946	0.027	T	0.38929	-0.9638	9	0.10902	T	0.67	.	5.0526	0.14516	0.62:0.0:0.38:0.0	.	470	E9PEI6	.	K	470	ENSP00000417182:E470K	ENSP00000417182:E470K	E	+	1	0	DPCR1	31025628	0.000000	0.05858	0.002000	0.10522	0.334000	0.28698	-0.026000	0.12392	-0.312000	0.08741	0.361000	0.22055	GAG	DPCR1	-	NULL	ENSG00000168631		0.493	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	DPCR1	HGNC	protein_coding	OTTHUMT00000076173.3	-	0.00	88	0	G	NM_080870		30917649	+1	tier1	-	no_errors	ENST00000462446	ensembl	human	novel	74_37	missense	6.41	73	5	SNP	0.748	A
DPP9	91039	genome.wustl.edu	37	19	4703929	4703929	+	Silent	SNP	G	G	A	rs368915583		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:4703929G>A	ENST00000598800.1	-	8	1156	c.651C>T	c.(649-651)ggC>ggT	p.G217G	DPP9_ENST00000262960.9_Silent_p.G246G|DPP9_ENST00000597849.1_Silent_p.G246G|DPP9_ENST00000594671.1_Silent_p.G217G			Q86TI2	DPP9_HUMAN	dipeptidyl-peptidase 9	217						cytoplasm (GO:0005737)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|identical protein binding (GO:0042802)|serine-type peptidase activity (GO:0008236)			cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00884)		GCCGCTCCTCGCCTGTCTCGA	0.642																																																	0													32.0	36.0	35.0					19																	4703929		2019	4163	6182	SO:0001819	synonymous_variant	0			AF452102	CCDS45928.1	19p13.3	2014-06-11	2006-01-12		ENSG00000142002	ENSG00000142002			18648	protein-coding gene	gene with protein product		608258	"""dipeptidylpeptidase 9"""				Standard	NM_139159		Approved		uc002mba.3	Q86TI2	OTTHUMG00000182040	ENST00000598800.1:c.651C>T	19.37:g.4703929G>A			O75273|O75868|Q1ZZB8|Q6AI37|Q6UAL0|Q6ZMT2|Q6ZNJ5|Q8N2J7|Q8N3F5|Q8WXD8|Q96NT8|Q9BVR3	Silent	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9,pfam_X-Pro-like_dom	p.G246	ENST00000598800.1	37	c.738		19																																																																																			DPP9	-	pfam_Peptidase_S9B	ENSG00000142002		0.642	DPP9-026	NOVEL	basic	protein_coding	DPP9	HGNC	protein_coding	OTTHUMT00000459343.2	-	0.00	108	0	G			4703929	-1	tier1	-	no_errors	ENST00000262960	ensembl	human	known	74_37	silent	60.87	17	28	SNP	0.858	A
DPRX	503834	genome.wustl.edu	37	19	54140176	54140176	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:54140176A>C	ENST00000376650.1	+	3	561	c.510A>C	c.(508-510)caA>caC	p.Q170H		NM_001012728.1	NP_001012746.1	A6NFQ7	DPRX_HUMAN	divergent-paired related homeobox	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(4)|large_intestine(1)|lung(7)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.013)		TGGAATCCCAAGTTTGCGCTC	0.438																																																	0													116.0	113.0	114.0					19																	54140176		2203	4300	6503	SO:0001583	missense	0				CCDS33103.1	19q13.42	2011-06-20			ENSG00000204595	ENSG00000204595		"""Homeoboxes / PRD class"""	32166	protein-coding gene	gene with protein product		611165					Standard	NM_001012728		Approved		uc002qcf.1	A6NFQ7		ENST00000376650.1:c.510A>C	19.37:g.54140176A>C	ENSP00000365838:p.Gln170His			Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.Q170H	ENST00000376650.1	37	c.510	CCDS33103.1	19	.	.	.	.	.	.	.	.	.	.	a	6.722	0.501941	0.12822	.	.	ENSG00000204595	ENST00000376650	D	0.94650	-3.48	1.45	-1.42	0.08913	.	.	.	.	.	D	0.86581	0.5967	N	0.14661	0.345	0.09310	N	1	D	0.59357	0.985	P	0.46172	0.506	T	0.79356	-0.1837	9	0.51188	T	0.08	.	1.5018	0.02478	0.4243:0.0:0.2693:0.3064	.	170	A6NFQ7	DPRX_HUMAN	H	170	ENSP00000365838:Q170H	ENSP00000365838:Q170H	Q	+	3	2	DPRX	58831988	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.275000	0.08525	-0.484000	0.06763	-0.366000	0.07423	CAA	DPRX	-	NULL	ENSG00000204595		0.438	DPRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPRX	HGNC	protein_coding	OTTHUMT00000409880.1	-	0.00	30	0	A	NM_001012728		54140176	+1	tier1	-	no_errors	ENST00000376650	ensembl	human	known	74_37	missense	72.97	10	27	SNP	0.000	C
DPY19L2	283417	genome.wustl.edu	37	12	64062089	64062089	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:64062089G>A	ENST00000324472.4	-	1	268	c.85C>T	c.(85-87)Cgg>Tgg	p.R29W	RP11-415I12.3_ENST00000509615.2_RNA	NM_173812.4	NP_776173.3	Q6NUT2	D19L2_HUMAN	dpy-19-like 2 (C. elegans)	29					multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nucleus (GO:0005634)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	45			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		TCCGGCTCCCGGGCGAGGGAG	0.622																																																	0													19.0	25.0	23.0					12																	64062089		2179	4291	6470	SO:0001583	missense	0				CCDS31851.1	12q14.2	2012-11-14			ENSG00000177990	ENSG00000177990			19414	protein-coding gene	gene with protein product	"""spermatogenesis associated 34"""	613893				12975309	Standard	XM_006719348		Approved	FLJ32949, SPATA34	uc001srp.1	Q6NUT2	OTTHUMG00000168712	ENST00000324472.4:c.85C>T	12.37:g.64062089G>A	ENSP00000315988:p.Arg29Trp		A4FVC1|B4E191|Q3ZCX2|Q6UWG8|Q96LZ9	Missense_Mutation	SNP	pfam_Dpy-19	p.R29W	ENST00000324472.4	37	c.85	CCDS31851.1	12	.	.	.	.	.	.	.	.	.	.	G	4.063	0.009476	0.07912	.	.	ENSG00000177990	ENST00000324472;ENST00000542209	T;T	0.40476	1.03;1.8	1.61	-0.663	0.11410	.	1.252950	0.06544	U	0.743693	T	0.18425	0.0442	N	0.19112	0.55	0.09310	N	0.999998	P	0.40107	0.703	B	0.22880	0.042	T	0.12967	-1.0527	9	.	.	.	.	3.1408	0.06455	0.0:0.5084:0.2893:0.2022	.	29	Q6NUT2	D19L2_HUMAN	W	29	ENSP00000315988:R29W;ENSP00000444932:R29W	.	R	-	1	2	DPY19L2	62348356	0.217000	0.23597	0.022000	0.16811	0.026000	0.11368	0.178000	0.16820	-0.202000	0.10268	0.195000	0.17529	CGG	DPY19L2	-	NULL	ENSG00000177990		0.622	DPY19L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L2	HGNC	protein_coding	OTTHUMT00000400689.2		0.00	82	0	G	NM_173812		64062089	-1			no_errors	ENST00000324472	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.031	A
DSEL	92126	genome.wustl.edu	37	18	65179637	65179637	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr18:65179637C>A	ENST00000310045.7	-	2	3712	c.2239G>T	c.(2239-2241)Gcc>Tcc	p.A747S	CTD-2541J13.2_ENST00000581951.1_RNA|CTD-2541J13.2_ENST00000583493.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	737					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GCCACACTGGCAAAGCCACCG	0.388																																																	0													51.0	53.0	52.0					18																	65179637		2203	4300	6503	SO:0001583	missense	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.2239G>T	18.37:g.65179637C>A	ENSP00000310565:p.Ala747Ser		Q17RH1|Q6P5Z3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,superfamily_Chondroitin_lyas	p.A747S	ENST00000310045.7	37	c.2239	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	C	14.84	2.655715	0.47467	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.20881	2.04	5.39	5.39	0.77823	.	0.152975	0.41605	U	0.000853	T	0.35422	0.0931	M	0.72118	2.19	0.46542	D	0.999093	D	0.56968	0.978	P	0.48270	0.572	T	0.17961	-1.0352	10	0.56958	D	0.05	.	18.7445	0.91787	0.0:1.0:0.0:0.0	.	737	Q8IZU8	DSEL_HUMAN	S	747;737	ENSP00000310565:A747S	ENSP00000310565:A747S	A	-	1	0	DSEL	63330617	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.829000	0.62737	2.548000	0.85928	0.455000	0.32223	GCC	DSEL	-	NULL	ENSG00000171451		0.388	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	-	0.00	29	0	C	NM_032160		65179637	-1	tier1	-	no_errors	ENST00000310045	ensembl	human	known	74_37	missense	23.53	13	4	SNP	1.000	A
DST	667	genome.wustl.edu	37	6	56480682	56480682	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:56480682C>T	ENST00000370765.6	-	24	7690	c.7583G>A	c.(7582-7584)gGc>gAc	p.G2528D	DST_ENST00000370754.5_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000361203.3_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000446842.2_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1824					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GATGGGATGGCCAATCCCTGT	0.453																																																	0													90.0	90.0	90.0					6																	56480682		2203	4300	6503	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7583G>A	6.37:g.56480682C>T	ENSP00000359801:p.Gly2528Asp		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_Spectrin_repeat,superfamily_Ig/albumin-bd,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.G2528D	ENST00000370765.6	37	c.7583	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	C	6.317	0.426538	0.11987	.	.	ENSG00000151914	ENST00000370765	T	0.68181	-0.31	5.94	3.05	0.35203	.	.	.	.	.	T	0.35970	0.0950	.	.	.	0.18873	N	0.999983	B	0.26547	0.152	B	0.18871	0.023	T	0.32929	-0.9888	7	0.72032	D	0.01	.	7.6654	0.28428	0.3457:0.4147:0.2395:0.0	.	2528	Q03001-3	.	D	2528	ENSP00000359801:G2528D	ENSP00000359801:G2528D	G	-	2	0	DST	56588641	0.001000	0.12720	0.142000	0.22268	0.895000	0.52256	1.208000	0.32345	1.484000	0.48361	0.557000	0.71058	GGC	DST	-	smart_Plectin_repeat	ENSG00000151914		0.453	DST-010	KNOWN	basic|CCDS	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041027.2	-	0.00	42	0	C	NM_001723		56480682	-1	tier1	-	no_errors	ENST00000370765	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.004	T
DYNC2H1	79659	genome.wustl.edu	37	11	103104821	103104821	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:103104821G>T	ENST00000375735.2	+	61	9643	c.9499G>T	c.(9499-9501)Gaa>Taa	p.E3167*	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Nonsense_Mutation_p.E3167*	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3167	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CAAGGCACAAGAAACAATCAA	0.383																																																	0													52.0	50.0	51.0					11																	103104821		1841	4089	5930	SO:0001587	stop_gained	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.9499G>T	11.37:g.103104821G>T	ENSP00000364887:p.Glu3167*		O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.E3167*	ENST00000375735.2	37	c.9499	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	51	17.472987	0.99887	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	.	.	.	5.31	5.31	0.75309	.	0.180499	0.49305	D	0.000156	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.1358	0.59409	0.084:0.0:0.916:0.0	.	.	.	.	X	3167	.	ENSP00000364887:E3167X	E	+	1	0	DYNC2H1	102610031	1.000000	0.71417	0.988000	0.46212	0.993000	0.82548	5.605000	0.67634	2.645000	0.89757	0.585000	0.79938	GAA	DYNC2H1	-	NULL	ENSG00000187240		0.383	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	-	0.00	68	0	G	XM_370652		103104821	+1	tier1	-	no_errors	ENST00000398093	ensembl	human	known	74_37	nonsense	7.94	58	5	SNP	0.995	T
EDNRB	1910	genome.wustl.edu	37	13	78492294	78492294	+	Missense_Mutation	SNP	A	A	C	rs143042375		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr13:78492294A>C	ENST00000334286.5	-	1	651	c.415T>G	c.(415-417)Ttg>Gtg	p.L139V	EDNRB_ENST00000377211.4_Missense_Mutation_p.L229V|RNF219-AS1_ENST00000607862.1_RNA|EDNRB_ENST00000446573.1_Missense_Mutation_p.L139V|EDNRB_ENST00000475537.1_5'Flank	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	139					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	CTGGCGATCAAGATATTGGGA	0.507																																																	0								A	VAL/LEU,VAL/LEU,VAL/LEU,VAL/LEU	0,4406		0,0,2203	126.0	114.0	118.0		415,415,685,415	-1.9	1.0	13	dbSNP_134	118	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense	EDNRB	NM_000115.3,NM_001122659.2,NM_001201397.1,NM_003991.3	32,32,32,32	0,1,6502	CC,CA,AA		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging,possibly-damaging	139/443,139/443,229/533,139/437	78492294	1,13005	2203	4300	6503	SO:0001583	missense	0			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.415T>G	13.37:g.78492294A>C	ENSP00000335311:p.Leu139Val		A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ETB_rcpt,prints_Endthln_rcpt,prints_GPCR_Rhodpsn,prints_Bombsn_rcpt	p.L139V	ENST00000334286.5	37	c.415	CCDS9461.1	13	.	.	.	.	.	.	.	.	.	.	A	20.4	3.980002	0.74474	0.0	1.16E-4	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.75367	-0.93;-0.93;-0.93	5.05	-1.92	0.07618	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.85695	0.5756	M	0.91090	3.175	0.48830	D	0.999714	D;P;D	0.71674	0.997;0.863;0.998	D;P;D	0.72982	0.919;0.614;0.979	D	0.85593	0.1247	10	0.54805	T	0.06	-12.599	11.6717	0.51406	0.2632:0.0:0.7368:0.0	.	139;229;139	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	V	229;139;139	ENSP00000366416:L229V;ENSP00000403401:L139V;ENSP00000335311:L139V	ENSP00000335311:L139V	L	-	1	2	EDNRB	77390295	1.000000	0.71417	0.995000	0.50966	0.985000	0.73830	2.549000	0.45803	-0.157000	0.11059	-0.256000	0.11100	TTG	EDNRB	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000136160		0.507	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRB	HGNC	protein_coding	OTTHUMT00000276505.1	-	0.00	93	0	A			78492294	-1	tier1	rs143042375	no_errors	ENST00000334286	ensembl	human	known	74_37	missense	30.77	54	24	SNP	1.000	C
EEF2K	29904	genome.wustl.edu	37	16	22295238	22295238	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:22295238C>T	ENST00000263026.5	+	18	2573	c.2099C>T	c.(2098-2100)gCg>gTg	p.A700V	RP11-141O15.1_ENST00000568125.1_RNA|RP11-141O15.1_ENST00000562376.1_RNA	NM_013302.3	NP_037434	O00418	EF2K_HUMAN	eukaryotic elongation factor-2 kinase	700					insulin receptor signaling pathway (GO:0008286)|protein autophosphorylation (GO:0046777)|regulation of protein autophosphorylation (GO:0031952)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|elongation factor-2 kinase activity (GO:0004686)|protein kinase activity (GO:0004672)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(8)|large_intestine(2)|lung(13)|ovary(1)|prostate(1)|skin(2)	29				GBM - Glioblastoma multiforme(48;0.0223)		GCAGAGGCAGCGATGGAAGCC	0.562																																					NSCLC(195;1411 2157 20319 27471 51856)												0													31.0	26.0	28.0					16																	22295238		2193	4293	6486	SO:0001583	missense	0			U93850	CCDS10604.1	16p12	2008-02-05			ENSG00000103319	ENSG00000103319			24615	protein-coding gene	gene with protein product		606968				9144159, 12051769	Standard	NM_013302		Approved	eEF-2K	uc002dki.3	O00418	OTTHUMG00000094771	ENST00000263026.5:c.2099C>T	16.37:g.22295238C>T	ENSP00000263026:p.Ala700Val		Q8N588	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Sel1-like,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pirsf_Elongation_factor_2_kinase,pfscan_MHCK_EF2_kinase	p.A700V	ENST00000263026.5	37	c.2099	CCDS10604.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.639551	0.96693	.	.	ENSG00000103319	ENST00000263026	T	0.35048	1.33	5.71	5.71	0.89125	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.64638	0.2616	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67047	-0.5769	10	0.87932	D	0	-21.326	19.8575	0.96767	0.0:1.0:0.0:0.0	.	700	O00418	EF2K_HUMAN	V	700	ENSP00000263026:A700V	ENSP00000263026:A700V	A	+	2	0	EEF2K	22202739	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	7.416000	0.80143	2.698000	0.92095	0.561000	0.74099	GCG	EEF2K	-	pirsf_Elongation_factor_2_kinase	ENSG00000103319		0.562	EEF2K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2K	HGNC	protein_coding	OTTHUMT00000211580.2	-	0.00	82	0	C	NM_013302		22295238	+1	tier1	-	no_errors	ENST00000263026	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
EIF3H	8667	genome.wustl.edu	37	8	117658786	117658786	+	Silent	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:117658786C>T	ENST00000276682.4	-	9	1693	c.927G>A	c.(925-927)ccG>ccA	p.P309P	EIF3H_ENST00000521861.1_Silent_p.P295P					eukaryotic translation initiation factor 3, subunit H											large_intestine(2)|lung(10)|skin(1)	13	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)					CCTCAGGGAGCGGGGGTTCTC	0.527																																																	0													157.0	166.0	163.0					8																	117658786		2203	4300	6503	SO:0001819	synonymous_variant	0			U54559	CCDS6319.1	8q24.11	2007-07-27	2007-07-27	2007-07-27	ENSG00000147677	ENSG00000147677			3273	protein-coding gene	gene with protein product		603912	"""eukaryotic translation initiation factor 3, subunit 3 gamma, 40kDa"""	EIF3S3		9341143	Standard	NM_003756		Approved	eIF3-gamma, eIF3-p40, eIF3h	uc003yoa.3	O15372	OTTHUMG00000164919	ENST00000276682.4:c.927G>A	8.37:g.117658786C>T				Silent	SNP	pfam_JAB_MPN_dom,smart_JAB_MPN_dom	p.P295	ENST00000276682.4	37	c.885		8																																																																																			EIF3H	-	NULL	ENSG00000147677		0.527	EIF3H-003	PUTATIVE	basic|exp_conf	protein_coding	EIF3H	HGNC	protein_coding	OTTHUMT00000380913.1	-	0.00	79	0	C	NM_003756		117658786	-1	tier1	-	no_errors	ENST00000521861	ensembl	human	known	74_37	silent	35.85	34	19	SNP	0.030	T
EMP3	2014	genome.wustl.edu	37	19	48830165	48830165	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:48830165G>T	ENST00000270221.6	+	2	365	c.64G>T	c.(64-66)Gcc>Tcc	p.A22S	EMP3_ENST00000597279.1_Missense_Mutation_p.A22S|EMP3_ENST00000596315.1_Intron	NM_001425.2	NP_001416.1	P54852	EMP3_HUMAN	epithelial membrane protein 3	22					cell growth (GO:0016049)|negative regulation of cell proliferation (GO:0008285)	integral component of membrane (GO:0016021)		p.A22T(1)		lung(1)	1		all_epithelial(76;6.08e-07)|all_lung(116;5.76e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.00989)|Prostate(7;0.0143)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000138)|all cancers(93;0.00017)|Epithelial(262;0.0138)|GBM - Glioblastoma multiforme(486;0.0146)		GCTTTTCGTGGCCACTTTGGA	0.577																																																	1	Substitution - Missense(1)	lung(1)											251.0	217.0	228.0					19																	48830165		2203	4300	6503	SO:0001583	missense	0			U52101	CCDS12715.1	19q13.3	2008-07-16				ENSG00000142227			3335	protein-coding gene	gene with protein product		602335				8996089, 10331954	Standard	NM_001425		Approved	YMP	uc002piv.2	P54852		ENST00000270221.6:c.64G>T	19.37:g.48830165G>T	ENSP00000270221:p.Ala22Ser		Q6FH01	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_EMP_3,prints_PMP22_EMP_MP20	p.A22S	ENST00000270221.6	37	c.64	CCDS12715.1	19	.	.	.	.	.	.	.	.	.	.	G	13.97	2.397200	0.42512	.	.	ENSG00000142227	ENST00000270221	D	0.89196	-2.48	3.91	2.87	0.33458	.	0.054642	0.64402	D	0.000001	T	0.80544	0.4643	L	0.31157	0.91	0.53005	D	0.99996	P	0.43750	0.816	B	0.43225	0.412	T	0.75422	-0.3323	10	0.09084	T	0.74	.	9.6098	0.39657	0.1027:0.0:0.8973:0.0	.	22	P54852	EMP3_HUMAN	S	22	ENSP00000270221:A22S	ENSP00000270221:A22S	A	+	1	0	EMP3	53521977	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.391000	0.66266	1.222000	0.43521	0.650000	0.86243	GCC	EMP3	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000142227		0.577	EMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMP3	HGNC	protein_coding	OTTHUMT00000465613.1		0.00	52	0	G	NM_001425		48830165	+1			no_errors	ENST00000270221	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
ACER3	55331	genome.wustl.edu	37	11	76589350	76589350	+	Intron	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:76589350C>T	ENST00000532485.1	+	1	207				AP002498.1_ENST00000390741.1_RNA|ACER3_ENST00000526597.1_Intron|ACER3_ENST00000538157.1_Intron|ACER3_ENST00000533873.1_Intron|ACER3_ENST00000530182.1_Intron	NM_018367.5	NP_060837.3	Q9NUN7	ACER3_HUMAN	alkaline ceramidase 3						ceramide metabolic process (GO:0006672)|phytosphingosine biosynthetic process (GO:0071602)|positive regulation of cell proliferation (GO:0008284)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of Golgi membrane (GO:0030173)	phytoceramidase activity (GO:0070774)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)	9						attacttttgcaatgacctaa	0.333																																																	0																																										SO:0001627	intron_variant	0			AF214454	CCDS8247.1, CCDS73352.1	11q13.5	2013-01-25	2008-12-19	2008-12-19	ENSG00000078124	ENSG00000078124	3.5.1.23	"""Alkaline ceramidase"""	16066	protein-coding gene	gene with protein product	"""alkaline phytoceramidase"""		"""phytoceramidase, alkaline"""	PHCA		11356846, 18619555	Standard	XM_005274090		Approved	FLJ11238, APHC	uc009yum.1	Q9NUN7	OTTHUMG00000165225	ENST00000532485.1:c.103+17227C>T	11.37:g.76589350C>T			B2RC99	RNA	SNP	-	NULL	ENST00000532485.1	37	NULL	CCDS8247.1	11																																																																																			AP002498.1	-	-	ENSG00000212030		0.333	ACER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000212030	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000382770.2	-	0.00	41	0	C	NM_018367		76589350	+1	tier1	-	no_errors	ENST00000390741	ensembl	human	novel	74_37	rna	20.37	43	11	SNP	0.017	T
ZNF971P	100419895	genome.wustl.edu	37	16	34682141	34682141	+	RNA	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:34682141T>C	ENST00000568619.1	-	0	338																											GGCTGAAGGCTCTACCACATT	0.378																																																	0																																												0																															16.37:g.34682141T>C				RNA	SNP	-	NULL	ENST00000568619.1	37	NULL		16																																																																																			RP11-80F22.10	-	-	ENSG00000214581		0.378	RP11-80F22.10-002	KNOWN	basic	processed_transcript	ENSG00000214581	Clone_based_vega_gene	pseudogene	OTTHUMT00000431371.1	-	0.00	107	0	T			34682141	-1	tier1	-	no_errors	ENST00000568619	ensembl	human	known	74_37	rna	10.29	61	7	SNP	0.931	C
AC131094.1	0	genome.wustl.edu	37	4	176394154	176394154	+	RNA	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:176394154G>A	ENST00000408209.1	+	0	2																											gagtgagaccggctcttgccc	0.552																																																	0																																												0																															4.37:g.176394154G>A				RNA	SNP	-	NULL	ENST00000408209.1	37	NULL		4																																																																																			AC131094.1	-	-	ENSG00000221136		0.552	AC131094.1-201	NOVEL	basic	miRNA	ENSG00000221136	Clone_based_ensembl_gene	miRNA		-	0.00	72	0	G			176394154	+1	tier1	-	no_errors	ENST00000408209	ensembl	human	novel	74_37	rna	13.64	38	6	SNP	0.010	A
RP11-764K9.1	0	genome.wustl.edu	37	9	68400475	68400475	+	lincRNA	SNP	T	T	G	rs75317582	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:68400475T>G	ENST00000417843.2	-	0	1344																											CAGGCCACAGTGTGGACtgtt	0.488																																																	0																																												0																															9.37:g.68400475T>G				RNA	SNP	-	NULL	ENST00000417843.2	37	NULL		9																																																																																			RP11-764K9.1	-	-	ENSG00000225411		0.488	RP11-764K9.1-001	KNOWN	basic	lincRNA	ENSG00000225411	Clone_based_vega_gene	lincRNA	OTTHUMT00000129817.2	-	0.00	27	0	T			68400475	-1	tier1	rs75317582	no_errors	ENST00000417843	ensembl	human	known	74_37	rna	25.00	27	9	SNP	0.010	G
USH2A	7399	genome.wustl.edu	37	1	216246190	216246191	+	Intron	DEL	TG	TG	-			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:216246190_216246191delTG	ENST00000307340.3	-	29	6244				RP11-22M7.2_ENST00000430890.1_RNA|USH2A_ENST00000366943.2_Intron|RP11-22M7.2_ENST00000446411.1_RNA|RP11-22M7.2_ENST00000445619.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)						hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AATACATGCATGTGTGTGTGTG	0.391										HNSCC(13;0.011)																																							0																																										SO:0001627	intron_variant	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.5857+39CA>-	1.37:g.216246200_216246201delTG			Q5VVM9|Q6S362|Q9NS27	RNA	DEL	-	NULL	ENST00000307340.3	37	NULL	CCDS31025.1	1																																																																																			RP11-22M7.2	-	-	ENSG00000233620		0.391	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000233620	Clone_based_vega_gene	protein_coding	OTTHUMT00000128138.1		0.00	21	0	TG	NM_007123		216246191	+1	tier1		no_errors	ENST00000445619	ensembl	human	known	74_37	rna	23.08	10	3	DEL	0.001:0.002	-
FRG2DP	146481	genome.wustl.edu	37	16	34712338	34712338	+	RNA	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:34712338T>C	ENST00000569028.2	-	0	1016																											AGCCAGTTCTTAGCAGGGAAG	0.562																																																	0																																												0																															16.37:g.34712338T>C				RNA	SNP	-	NULL	ENST00000569028.2	37	NULL		16																																																																																			RP11-80F22.9	-	-	ENSG00000261711		0.562	RP11-80F22.9-002	KNOWN	basic	processed_transcript	ENSG00000261711	Clone_based_vega_gene	pseudogene	OTTHUMT00000431372.2	-	0.00	54	0	T			34712338	-1	tier1	-	no_errors	ENST00000569028	ensembl	human	known	74_37	rna	26.83	30	11	SNP	0.050	C
EPB41L2	2037	genome.wustl.edu	37	6	131229998	131229998	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:131229998C>G	ENST00000337057.3	-	5	997	c.816G>C	c.(814-816)tgG>tgC	p.W272C	EPB41L2_ENST00000368128.2_Missense_Mutation_p.W272C|EPB41L2_ENST00000528282.1_Missense_Mutation_p.W272C|EPB41L2_ENST00000445890.2_Missense_Mutation_p.W272C|EPB41L2_ENST00000527411.1_Missense_Mutation_p.W272C|EPB41L2_ENST00000529208.1_Missense_Mutation_p.W272C|EPB41L2_ENST00000525271.1_Missense_Mutation_p.W272C|EPB41L2_ENST00000530481.1_Missense_Mutation_p.W272C|EPB41L2_ENST00000392427.3_Missense_Mutation_p.W272C|EPB41L2_ENST00000527659.1_Missense_Mutation_p.W272C|EPB41L2_ENST00000530148.1_5'UTR|EPB41L2_ENST00000525193.1_Missense_Mutation_p.W272C	NM_001431.3	NP_001422.1	O43491	E41L2_HUMAN	erythrocyte membrane protein band 4.1-like 2	272	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cortical actin cytoskeleton organization (GO:0030866)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|spectrin (GO:0008091)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(23)|prostate(1)|skin(2)	44	Breast(56;0.0639)			OV - Ovarian serous cystadenocarcinoma(155;0.0271)|GBM - Glioblastoma multiforme(226;0.0355)		CAGGATCTAACCAGTTCTGCA	0.264																																																	0													49.0	50.0	49.0					6																	131229998		2195	4283	6478	SO:0001583	missense	0			AF027299	CCDS5141.1, CCDS47474.1, CCDS56450.1, CCDS59037.1	6q23	2008-08-29			ENSG00000079819	ENSG00000079819			3379	protein-coding gene	gene with protein product		603237				9598318, 9828140	Standard	NM_001431		Approved	4.1-G	uc003qch.2	O43491	OTTHUMG00000015560	ENST00000337057.3:c.816G>C	6.37:g.131229998C>G	ENSP00000338481:p.Trp272Cys		B4DHI8|E9PPD9|Q5T4F0|Q68DV2	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB_dom,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin_like,pfscan_FERM_domain	p.W272C	ENST00000337057.3	37	c.816	CCDS5141.1	6	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352350	0.41700	.	.	ENSG00000079819	ENST00000528282;ENST00000530481;ENST00000445890;ENST00000337057;ENST00000392427;ENST00000425439;ENST00000368128;ENST00000527411;ENST00000525271;ENST00000525193;ENST00000527659;ENST00000529208	D;D;D;D;D;D;D;D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1;-2.1;-2.1;-2.1;-2.1;-2.1;-2.1;-2.1	4.92	4.92	0.64577	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);FERM conserved site (1);	0.122449	0.64402	D	0.000011	D	0.96386	0.8821	H	0.99026	4.405	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.999;0.985;0.999	D	0.98063	1.0394	10	0.87932	D	0	.	17.8935	0.88879	0.0:1.0:0.0:0.0	.	272;272;272;272;272	E9PHY5;B4DHI8;E9PPD9;O43491;Q68DV2	.;.;.;E41L2_HUMAN;.	C	272	ENSP00000434308:W272C;ENSP00000434576:W272C;ENSP00000402041:W272C;ENSP00000338481:W272C;ENSP00000376222:W272C;ENSP00000357110:W272C;ENSP00000436348:W272C;ENSP00000432803:W272C;ENSP00000431988:W272C;ENSP00000431647:W272C;ENSP00000436641:W272C	ENSP00000338481:W272C	W	-	3	0	EPB41L2	131271691	1.000000	0.71417	1.000000	0.80357	0.019000	0.09904	6.990000	0.76225	2.539000	0.85634	0.561000	0.74099	TGG	EPB41L2	-	pirsf_Band_41_protein,pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000079819		0.264	EPB41L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L2	HGNC	protein_coding	OTTHUMT00000042204.3	-	0.00	109	0	C			131229998	-1	tier1	-	no_errors	ENST00000337057	ensembl	human	known	74_37	missense	7.61	85	7	SNP	1.000	G
EPHA6	285220	genome.wustl.edu	37	3	97185278	97185278	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:97185278G>C	ENST00000514100.1	+	4	264	c.22G>C	c.(22-24)Gtg>Ctg	p.V8L	EPHA6_ENST00000442602.2_Intron|EPHA6_ENST00000389672.5_Intron|EPHA6_ENST00000502694.1_Missense_Mutation_p.V8L	NM_001278300.1	NP_001265229.1	Q9UF33	EPHA6_HUMAN	EPH receptor A6	0						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						tccatttcaagtgacaaaact	0.418																																																	0													116.0	110.0	112.0					3																	97185278		1850	4100	5950	SO:0001583	missense	0			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000514100.1:c.22G>C	3.37:g.97185278G>C	ENSP00000421711:p.Val8Leu		D6RAL5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.V8L	ENST00000514100.1	37	c.22		3	.	.	.	.	.	.	.	.	.	.	G	8.335	0.827433	0.16749	.	.	ENSG00000080224	ENST00000514100;ENST00000502694	D;T	0.81908	-1.55;-1.3	3.35	-0.949	0.10376	.	.	.	.	.	T	0.61022	0.2314	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46190	-0.9209	9	0.37606	T	0.19	.	2.9463	0.05847	0.375:0.0:0.4289:0.1961	.	8;8	Q9UF33-2;D6RAL5	.;.	L	8	ENSP00000421711:V8L;ENSP00000423950:V8L	ENSP00000423950:V8L	V	+	1	0	EPHA6	98667968	0.001000	0.12720	0.000000	0.03702	0.007000	0.05969	-0.100000	0.10990	-0.222000	0.09958	-0.478000	0.04885	GTG	EPHA6	-	NULL	ENSG00000080224		0.418	EPHA6-007	NOVEL	basic|exp_conf	protein_coding	EPHA6	HGNC	protein_coding	OTTHUMT00000359997.1	-	0.00	40	0	G	NM_001080448		97185278	+1	tier1	-	no_errors	ENST00000502694	ensembl	human	known	74_37	missense	18.52	22	5	SNP	0.000	C
EPN1	29924	genome.wustl.edu	37	19	56206211	56206211	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:56206211A>G	ENST00000270460.6	+	10	1695	c.1384A>G	c.(1384-1386)Act>Gct	p.T462A	EPN1_ENST00000085079.7_Missense_Mutation_p.T436A|AC010525.7_ENST00000589698.1_lincRNA|AC010525.4_ENST00000585559.1_RNA|EPN1_ENST00000411543.2_Missense_Mutation_p.T548A|AC010525.6_ENST00000587937.1_lincRNA	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1	462	Ala/Gly/Pro-rich.				embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		AGCCACACCAACTCCCACGCC	0.706																																																	0													17.0	29.0	25.0					19																	56206211		2056	4183	6239	SO:0001583	missense	0			AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.1384A>G	19.37:g.56206211A>G	ENSP00000270460:p.Thr462Ala		Q86ST3|Q9HA18	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_ANTH_dom,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.T548A	ENST00000270460.6	37	c.1642	CCDS46199.1	19	.	.	.	.	.	.	.	.	.	.	A	3.333	-0.136253	0.06711	.	.	ENSG00000063245	ENST00000270460;ENST00000085079;ENST00000544375;ENST00000411543	T;T;T	0.13420	2.62;2.62;2.59	4.27	1.07	0.20283	.	0.833948	0.10359	N	0.684147	T	0.05868	0.0153	N	0.08118	0	0.33607	D	0.603127	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.08055	0.0;0.003;0.0;0.001	T	0.42632	-0.9440	10	0.08179	T	0.78	-11.3068	8.1961	0.31398	0.7318:0.0:0.2682:0.0	.	422;548;462;436	B4DU91;Q9Y6I3-1;Q9Y6I3;Q9Y6I3-3	.;.;EPN1_HUMAN;.	A	462;436;422;548	ENSP00000270460:T462A;ENSP00000085079:T436A;ENSP00000406209:T548A	ENSP00000085079:T436A	T	+	1	0	EPN1	60898023	0.020000	0.18652	0.226000	0.23910	0.190000	0.23558	0.615000	0.24329	0.298000	0.22638	0.459000	0.35465	ACT	EPN1	-	NULL	ENSG00000063245		0.706	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN1	HGNC	protein_coding	OTTHUMT00000453610.1		0.00	100	0	A	NM_013333		56206211	+1			no_errors	ENST00000411543	ensembl	human	known	74_37	missense	6.56	56	4	SNP	0.345	G
ERCC6L2	375748	genome.wustl.edu	37	9	98678666	98678666	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:98678666A>G	ENST00000288985.7	+	6	1446	c.1141A>G	c.(1141-1143)Agg>Ggg	p.R381G	ERCC6L2_ENST00000466840.1_3'UTR|ERCC6L2_ENST00000437817.1_Missense_Mutation_p.R192G	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	381					DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										CTGGTTTCTCAGGCGCACCAA	0.428																																																	0													65.0	69.0	68.0					9																	98678666		2203	4300	6503	SO:0001583	missense	0			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.1141A>G	9.37:g.98678666A>G	ENSP00000288985:p.Arg381Gly		A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R192G	ENST00000288985.7	37	c.574	CCDS35072.1	9	.	.	.	.	.	.	.	.	.	.	A	19.05	3.751576	0.69533	.	.	ENSG00000182150	ENST00000405401;ENST00000288985;ENST00000437817	D;D	0.96913	-4.17;-4.17	4.79	0.922	0.19408	SNF2-related (1);	0.000000	0.56097	D	0.000022	D	0.98645	0.9546	H	0.98155	4.16	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.77557	0.964;0.99;0.99	D	0.98688	1.0695	10	0.87932	D	0	-15.734	12.7171	0.57121	0.5754:0.4246:0.0:0.0	.	192;63;381	Q5T890-2;F2Z2R4;Q5T890	.;.;RAD26_HUMAN	G	63;381;192	ENSP00000288985:R381G;ENSP00000416286:R192G	ENSP00000288985:R381G	R	+	1	2	C9orf102	97718487	1.000000	0.71417	0.993000	0.49108	0.963000	0.63663	2.423000	0.44705	0.055000	0.16094	0.454000	0.30748	AGG	ERCC6L2	-	pfam_SNF2_N,superfamily_P-loop_NTPase	ENSG00000182150		0.428	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ERCC6L2	HGNC	protein_coding	OTTHUMT00000053247.2	-	0.00	84	0	A	NM_001010895		98678666	+1	tier1	-	no_errors	ENST00000437817	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.999	G
ERP27	121506	genome.wustl.edu	37	12	15068588	15068588	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:15068588T>G	ENST00000266397.2	-	6	1182	c.609A>C	c.(607-609)aaA>aaC	p.K203N	ERP27_ENST00000540097.1_Missense_Mutation_p.K102N|ERP27_ENST00000544881.1_5'UTR	NM_152321.2	NP_689534.1	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27	203						endoplasmic reticulum (GO:0005783)				breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(3)|prostate(2)|skin(1)	19						TCCCATTTTCTTTCATACCAC	0.418																																																	0													73.0	70.0	71.0					12																	15068588		2203	4300	6503	SO:0001583	missense	0			AK056677	CCDS8670.1, CCDS73450.1	12p12.3	2011-10-19	2009-02-23	2007-03-26	ENSG00000139055	ENSG00000139055		"""Protein disulfide isomerases"""	26495	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 8"""	610642	"""chromosome 12 open reading frame 46"", ""endoplasmic reticulum protein 27 kDa"""	C12orf46		12975309, 16940051	Standard	XM_005253303		Approved	FLJ32115, ERp27, PDIA8	uc001rco.3	Q96DN0	OTTHUMG00000168741	ENST00000266397.2:c.609A>C	12.37:g.15068588T>G	ENSP00000266397:p.Lys203Asn			Missense_Mutation	SNP	superfamily_Thioredoxin-like_fold	p.K203N	ENST00000266397.2	37	c.609	CCDS8670.1	12	.	.	.	.	.	.	.	.	.	.	T	12.37	1.918012	0.33815	.	.	ENSG00000139055	ENST00000266397;ENST00000540097	T;T	0.46451	1.87;0.87	4.79	1.98	0.26296	Thioredoxin-like fold (1);	0.207707	0.48767	D	0.000163	T	0.42086	0.1187	L	0.55481	1.735	0.09310	N	1	P	0.51147	0.942	P	0.49999	0.628	T	0.23547	-1.0185	10	0.52906	T	0.07	-0.2546	6.4796	0.22055	0.0:0.6953:0.0:0.3047	.	203	Q96DN0	ERP27_HUMAN	N	203;102	ENSP00000266397:K203N;ENSP00000440573:K102N	ENSP00000266397:K203N	K	-	3	2	ERP27	14959855	0.341000	0.24801	0.003000	0.11579	0.284000	0.27059	1.133000	0.31430	0.475000	0.27415	-0.242000	0.12053	AAA	ERP27	-	superfamily_Thioredoxin-like_fold	ENSG00000139055		0.418	ERP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERP27	HGNC	protein_coding	OTTHUMT00000400868.1	-	0.00	76	0	T	NM_152321		15068588	-1	tier1	-	no_errors	ENST00000266397	ensembl	human	known	74_37	missense	30.51	41	18	SNP	0.004	G
ETV3	2117	genome.wustl.edu	37	1	157095505	157095505	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:157095505G>T	ENST00000368192.4	-	5	731	c.667C>A	c.(667-669)Cag>Aag	p.Q223K		NM_001145312.1	NP_001138784.1	P41162	ETV3_HUMAN	ets variant 3	223					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	9	Hepatocellular(266;0.158)	Prostate(1639;0.174)				TTGCGTTTCTGATGGCCAATC	0.597																																																	0													89.0	88.0	88.0					1																	157095505		692	1591	2283	SO:0001583	missense	0			BC022868	CCDS1164.1, CCDS44250.1	1q21-q23	2008-09-12	2008-09-12		ENSG00000117036	ENSG00000117036			3492	protein-coding gene	gene with protein product		164873	"""ets variant gene 3, ETS family transcriptional repressor"", ""ets variant gene 3"""			8020980	Standard	NM_005240		Approved	PE-1	uc001fqr.2	P41162	OTTHUMG00000034298	ENST00000368192.4:c.667C>A	1.37:g.157095505G>T	ENSP00000357175:p.Gln223Lys		B4E3M7|Q8TAC8|Q9BX30	Missense_Mutation	SNP	pfam_Ets_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.Q223K	ENST00000368192.4	37	c.667	CCDS44250.1	1	.	.	.	.	.	.	.	.	.	.	G	11.78	1.739529	0.30774	.	.	ENSG00000117036	ENST00000368192	T	0.14144	2.53	4.85	3.93	0.45458	.	0.214071	0.30930	N	0.008586	T	0.04907	0.0132	L	0.44542	1.39	0.80722	D	1	B	0.23540	0.087	B	0.20767	0.031	T	0.15464	-1.0436	10	0.14656	T	0.56	.	13.829	0.63368	0.0:0.0:0.8455:0.1545	.	223	P41162	ETV3_HUMAN	K	223	ENSP00000357175:Q223K	ENSP00000357175:Q223K	Q	-	1	0	ETV3	155362129	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	4.748000	0.62148	1.381000	0.46364	0.561000	0.74099	CAG	ETV3	-	NULL	ENSG00000117036		0.597	ETV3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV3	HGNC	protein_coding	OTTHUMT00000082843.2	-	0.00	53	0	G	NM_005240		157095505	-1	tier1	-	no_errors	ENST00000368192	ensembl	human	known	74_37	missense	6.67	56	4	SNP	0.999	T
EYA2	2139	genome.wustl.edu	37	20	45771716	45771716	+	Missense_Mutation	SNP	C	C	T	rs368297287		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr20:45771716C>T	ENST00000327619.5	+	10	1281	c.907C>T	c.(907-909)Cgc>Tgc	p.R303C	EYA2_ENST00000357410.3_Missense_Mutation_p.R303C|EYA2_ENST00000317304.6_Intron	NM_005244.4	NP_005235.3	O00167	EYA2_HUMAN	EYA transcriptional coactivator and phosphatase 2	303					DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|histone dephosphorylation (GO:0016576)|mesodermal cell fate specification (GO:0007501)|mitochondrial outer membrane permeabilization (GO:0097345)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of transcription, DNA-templated (GO:0006355)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|protein tyrosine phosphatase activity (GO:0004725)	p.R303C(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0241)				GACGTCCGTGCGCATTGGCCT	0.488													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19649	0.0		0.0	False		,,,				2504	0.0				Pancreas(120;56 1725 18501 25218 43520)												1	Substitution - Missense(1)	large_intestine(1)						C	CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	197.0	148.0	165.0		907,907	4.0	1.0	20		165	0,8600		0,0,4300	no	missense,missense	EYA2	NM_005244.4,NM_172110.3	180,180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging	303/539,303/460	45771716	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS13403.1, CCDS54471.1	20q13.1	2014-06-19	2014-06-19		ENSG00000064655	ENSG00000064655		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3520	protein-coding gene	gene with protein product		601654	"""eyes absent (Drosophila) homolog 2"", ""eyes absent homolog 2 (Drosophila)"""			9020840	Standard	NM_005244		Approved	EAB1	uc002xsm.3	O00167	OTTHUMG00000033041	ENST00000327619.5:c.907C>T	20.37:g.45771716C>T	ENSP00000333640:p.Arg303Cys		Q5JSW8|Q86U84|Q96CV6|Q96H97|Q99503|Q99812|Q9BWF6|Q9H4S3|Q9H4S9|Q9NPZ4|Q9UIX7	Missense_Mutation	SNP	pfam_HAD-like_dom,superfamily_HAD-like_dom,tigrfam_EYA	p.R303C	ENST00000327619.5	37	c.907	CCDS13403.1	20	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953744	0.53293	2.27E-4	0.0	ENSG00000064655	ENST00000327619;ENST00000357410;ENST00000458636	D;D;D	0.81821	-1.54;-1.54;-1.54	6.08	3.97	0.46021	EYA (1);Haloacid dehalogenase-like hydrolase (1);	0.105617	0.64402	D	0.000005	D	0.86155	0.5865	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.68765	0.96;0.928;0.928	D	0.87928	0.2708	10	0.72032	D	0.01	-22.8238	15.728	0.77777	0.3686:0.6314:0.0:0.0	.	303;303;303	O00167-3;A8KAG7;O00167	.;.;EYA2_HUMAN	C	303;303;174	ENSP00000333640:R303C;ENSP00000349986:R303C;ENSP00000395427:R174C	ENSP00000333640:R303C	R	+	1	0	EYA2	45205123	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	0.791000	0.26915	1.521000	0.48983	0.655000	0.94253	CGC	EYA2	-	pfam_HAD-like_dom,tigrfam_EYA	ENSG00000064655		0.488	EYA2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EYA2	HGNC	protein_coding	OTTHUMT00000080326.2		0.00	31	0	C	NM_005244		45771716	+1			no_errors	ENST00000327619	ensembl	human	known	74_37	missense	5.77	49	3	SNP	0.999	T
EZH2	2146	genome.wustl.edu	37	7	148524336	148524336	+	Silent	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:148524336C>A	ENST00000460911.1	-	7	736	c.648G>T	c.(646-648)cgG>cgT	p.R216R	EZH2_ENST00000536783.1_Silent_p.R107R|EZH2_ENST00000483967.1_Silent_p.R207R|EZH2_ENST00000476773.1_Silent_p.R207R|EZH2_ENST00000541220.1_Silent_p.R207R|EZH2_ENST00000350995.2_Silent_p.R177R|EZH2_ENST00000478654.1_Silent_p.R207R|EZH2_ENST00000320356.2_Silent_p.R216R			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	216	Interaction with DNMT1, DNMT3A and DNMT3B.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			AAGGAAATTTCCGAGGTGGGC	0.338			Mis		DLBCL																																			Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	0													105.0	112.0	110.0					7																	148524336		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.648G>T	7.37:g.148524336C>A			B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Silent	SNP	pfam_SET_dom,pfam_EZH2_WD-Binding,superfamily_Homeodomain-like,smart_SANT/Myb,smart_SET_dom,pfscan_SET_dom	p.R216	ENST00000460911.1	37	c.648	CCDS56516.1	7																																																																																			EZH2	-	smart_SANT/Myb	ENSG00000106462		0.338	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	EZH2	HGNC	protein_coding	OTTHUMT00000352744.1	-	0.00	60	0	C	NM_004456		148524336	-1	tier1	-	no_errors	ENST00000320356	ensembl	human	known	74_37	silent	5.19	73	4	SNP	1.000	A
F2R	2149	genome.wustl.edu	37	5	76028151	76028151	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:76028151C>T	ENST00000319211.4	+	2	366	c.101C>T	c.(100-102)aCa>aTa	p.T34I		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	34					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	TCAAAAGCAACAAATGCCACC	0.343																																																	0													50.0	52.0	51.0					5																	76028151		2137	4280	6417	SO:0001583	missense	0			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.101C>T	5.37:g.76028151C>T	ENSP00000321326:p.Thr34Ile		Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Thrmbn_rcpt,prints_GPCR_Rhodpsn,prints_Protea_act_rcpt	p.T34I	ENST00000319211.4	37	c.101	CCDS4032.1	5	.	.	.	.	.	.	.	.	.	.	C	9.615	1.132291	0.21041	.	.	ENSG00000181104	ENST00000319211	T	0.75050	-0.9	5.2	1.03	0.20045	.	3.336030	0.00775	N	0.001228	T	0.66655	0.2811	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.47586	-0.9106	10	0.37606	T	0.19	0.7007	7.8818	0.29627	0.5546:0.253:0.1924:0.0	.	34	P25116	PAR1_HUMAN	I	34	ENSP00000321326:T34I	ENSP00000321326:T34I	T	+	2	0	F2R	76063907	0.000000	0.05858	0.007000	0.13788	0.032000	0.12392	0.393000	0.20817	0.090000	0.17273	-0.181000	0.13052	ACA	F2R	-	NULL	ENSG00000181104		0.343	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2R	HGNC	protein_coding	OTTHUMT00000254068.2	-	0.00	48	0	C			76028151	+1	tier1	-	no_errors	ENST00000319211	ensembl	human	known	74_37	missense	40.91	13	9	SNP	0.003	T
FAAH2	158584	genome.wustl.edu	37	X	57313372	57313372	+	Silent	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:57313372A>G	ENST00000374900.4	+	1	234	c.114A>G	c.(112-114)tcA>tcG	p.S38S		NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	38						integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						AGTTTGCCTCAAAGACCCCTC	0.537										HNSCC(52;0.14)																																							0													36.0	34.0	34.0					X																	57313372		2203	4300	6503	SO:0001819	synonymous_variant	0			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.114A>G	X.37:g.57313372A>G			Q86VT2|Q96N98	Silent	SNP	pfam_Amidase,superfamily_Amidase_dom	p.S38	ENST00000374900.4	37	c.114	CCDS14375.1	X																																																																																			FAAH2	-	superfamily_Amidase_dom	ENSG00000165591		0.537	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH2	HGNC	protein_coding	OTTHUMT00000056919.1	-	0.00	48	0	A	NM_174912		57313372	+1	tier1	-	no_errors	ENST00000374900	ensembl	human	known	74_37	silent	10.42	43	5	SNP	0.033	G
FAM166B	730112	genome.wustl.edu	37	9	35562544	35562544	+	Missense_Mutation	SNP	C	C	T	rs375788499		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:35562544C>T	ENST00000399742.2	-	5	642	c.572G>A	c.(571-573)cGc>cAc	p.R191H	FAM166B_ENST00000492890.1_Intron	NM_001099951.2|NM_001164310.1	NP_001093421.1|NP_001157782.1	A8MTA8	F166B_HUMAN	family with sequence similarity 166, member B	191										kidney(3)|large_intestine(1)|lung(4)|ovary(1)	9						GAAGAGGAAGCGGGCGCAGGG	0.622																																																	0								C	,HIS/ARG	0,4346		0,0,2173	41.0	51.0	47.0		,572	4.9	1.0	9		47	1,8559		0,1,4279	no	intron,missense	FAM166B	NM_001099951.2,NM_001164310.1	,29	0,1,6452	TT,TC,CC		0.0117,0.0,0.0077	,probably-damaging	,191/276	35562544	1,12905	2173	4280	6453	SO:0001583	missense	0			BC129999	CCDS47963.1, CCDS56572.1	9p13.3	2008-06-10			ENSG00000215187	ENSG00000215187			34242	protein-coding gene	gene with protein product							Standard	NM_001099951		Approved		uc010mkr.3	A8MTA8	OTTHUMG00000019858	ENST00000399742.2:c.572G>A	9.37:g.35562544C>T	ENSP00000382646:p.Arg191His		A1L3B2|B7ZBJ0	Missense_Mutation	SNP	pfam_UPF0573/UPF0605	p.R191H	ENST00000399742.2	37	c.572	CCDS56572.1	9	.	.	.	.	.	.	.	.	.	.	C	26.1	4.707206	0.89018	0.0	1.17E-4	ENSG00000215187	ENST00000399742	T	0.47177	0.85	4.9	4.9	0.64082	.	55.170300	0.01433	U	0.014818	T	0.71367	0.3331	M	0.70275	2.135	0.33124	D	0.542198	D	0.89917	1.0	D	0.64595	0.927	T	0.56475	-0.7973	10	0.72032	D	0.01	0.357	13.9211	0.63933	0.0:1.0:0.0:0.0	.	191	A8MTA8	F166B_HUMAN	H	191	ENSP00000382646:R191H	ENSP00000382646:R191H	R	-	2	0	FAM166B	35552544	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	1.480000	0.35464	2.404000	0.81709	0.563000	0.77884	CGC	FAM166B	-	pfam_UPF0573/UPF0605	ENSG00000215187		0.622	FAM166B-005	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM166B	HGNC	protein_coding	OTTHUMT00000336563.1		0.00	73	0	C	NM_001099951		35562544	-1			no_errors	ENST00000399742	ensembl	human	novel	74_37	missense	8.89	41	4	SNP	1.000	T
FAM230A	653203	genome.wustl.edu	37	22	20708880	20708880	+	Silent	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr22:20708880C>T	ENST00000434783.3	+	8	796	c.612C>T	c.(610-612)aaC>aaT	p.N204N	USP41_ENST00000486536.2_Intron|USP41_ENST00000454608.2_Intron					family with sequence similarity 230, member A																		ACATCGCTAACGAGGATGCCA	0.642																																																	0																																										SO:0001819	synonymous_variant	0			JX456222		22q11.21	2014-08-13			ENSG00000188280	ENSG00000188280			45045	other	unknown							Standard	XM_006724099		Approved	DGCR15			OTTHUMG00000150686	ENST00000434783.3:c.612C>T	22.37:g.20708880C>T				Silent	SNP	pfam_Ret-finger_pr-like_3_antisense,superfamily_Kinase-like_dom	p.N204	ENST00000434783.3	37	c.612		22																																																																																			FAM230A	-	superfamily_Kinase-like_dom	ENSG00000188280		0.642	FAM230A-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	FAM230A	HGNC	protein_coding	OTTHUMT00000319609.4	-	0.00	94	0	C			20708880	+1	tier1	-	no_errors	ENST00000434783	ensembl	human	known	74_37	silent	29.31	41	17	SNP	0.733	T
FAM65B	9750	genome.wustl.edu	37	6	24843687	24843687	+	Nonsense_Mutation	SNP	G	G	T	rs375535589		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:24843687G>T	ENST00000259698.4	-	14	1498	c.1323C>A	c.(1321-1323)tgC>tgA	p.C441*	FAM65B_ENST00000538035.1_Nonsense_Mutation_p.C420*|FAM65B_ENST00000510784.2_Nonsense_Mutation_p.C425*|FAM65B_ENST00000473070.1_5'Flank|FAM65B_ENST00000378023.4_Nonsense_Mutation_p.C391*|FAM65B_ENST00000540914.1_Nonsense_Mutation_p.C391*	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	441					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						AGGTGAGGGCGCAGTCCCCGT	0.522																																																	0													72.0	73.0	73.0					6																	24843687		2014	4171	6185	SO:0001587	stop_gained	0			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.1323C>A	6.37:g.24843687G>T	ENSP00000259698:p.Cys441*		A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.C441*	ENST00000259698.4	37	c.1323	CCDS47383.1	6	.	.	.	.	.	.	.	.	.	.	G	29.5	5.015004	0.93404	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	.	.	.	5.23	-4.28	0.03732	.	0.227351	0.43416	D	0.000577	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	-12.3452	14.884	0.70555	0.4966:0.0:0.5034:0.0	.	.	.	.	X	441;420;391;391;425	.	ENSP00000259698:C441X	C	-	3	2	FAM65B	24951666	0.000000	0.05858	0.007000	0.13788	0.180000	0.23129	-0.990000	0.03732	-0.845000	0.04179	-0.254000	0.11334	TGC	FAM65B	-	NULL	ENSG00000111913		0.522	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM65B	HGNC	protein_coding	OTTHUMT00000040024.2	-	0.00	98	0	G			24843687	-1	tier1	-	no_errors	ENST00000259698	ensembl	human	known	74_37	nonsense	5.13	74	4	SNP	0.002	T
FAM46A	55603	genome.wustl.edu	37	6	82461324	82461324	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:82461324T>C	ENST00000320172.6	-	2	849	c.535A>G	c.(535-537)Aca>Gca	p.T179A	FAM46A_ENST00000369756.3_Missense_Mutation_p.T260A|FAM46A_ENST00000369754.3_Missense_Mutation_p.T198A	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	179					regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		GTGAGTGGTGTGATCTTCTCT	0.607																																																	0													120.0	96.0	104.0					6																	82461324		2203	4300	6503	SO:0001583	missense	0			AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.535A>G	6.37:g.82461324T>C	ENSP00000318298:p.Thr179Ala		A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Missense_Mutation	SNP	pfam_DUF1693	p.T198A	ENST00000320172.6	37	c.592	CCDS34489.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.70|15.70	2.910396|2.910396	0.52439|0.52439	.|.	.|.	ENSG00000112773|ENSG00000112773	ENST00000412306|ENST00000369754;ENST00000320172;ENST00000369756	.|T;T;T	.|0.23348	.|1.91;1.91;1.91	5.28|5.28	5.28|5.28	0.74379|0.74379	.|Domain of unknown function DUF1693 (1);	.|0.142496	.|0.64402	.|D	.|0.000006	T|T	0.27489|0.27489	0.0675|0.0675	M|M	0.87180|0.87180	2.865|2.865	0.80722|0.80722	D|D	1|1	.|B;B	.|0.32101	.|0.124;0.356	.|B;B	.|0.35182	.|0.172;0.197	T|T	0.19224|0.19224	-1.0312|-1.0312	5|10	.|0.56958	.|D	.|0.05	-28.654|-28.654	15.0433|15.0433	0.71807|0.71807	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|179;198	.|Q96IP4;Q96IP4-2	.|FA46A_HUMAN;.	R|A	69|198;179;260	.|ENSP00000358769:T198A;ENSP00000318298:T179A;ENSP00000358771:T260A	.|ENSP00000318298:T179A	H|T	-|-	2|1	0|0	FAM46A|FAM46A	82518043|82518043	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.352000|0.352000	0.29268|0.29268	4.911000|4.911000	0.63328|0.63328	2.210000|2.210000	0.71456|0.71456	0.533000|0.533000	0.62120|0.62120	CAC|ACA	FAM46A	-	pfam_DUF1693	ENSG00000112773		0.607	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM46A	HGNC	protein_coding	OTTHUMT00000041331.1	-	0.00	44	0	T			82461324	-1	tier1	-	no_errors	ENST00000369754	ensembl	human	known	74_37	missense	14.29	24	4	SNP	1.000	C
TPRXL	348825	genome.wustl.edu	37	3	13978095	13978095	+	5'Flank	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:13978095G>A	ENST00000326972.8	+	0	0				FGD5P1_ENST00000502451.1_RNA			Q17RH7	TPRXL_HUMAN	tetra-peptide repeat homeobox-like											endometrium(1)	1						CGACTCCCCGGACAAGTACAA	0.542																																																	0																																										SO:0001631	upstream_gene_variant	0			AK092426		3p25.1	2011-06-20			ENSG00000180438	ENSG00000180438		"""Homeoboxes / PRD class"""	32178	pseudogene	pseudogene		611167					Standard	NR_002223		Approved	FLJ35107	uc003byg.3	Q17RH7	OTTHUMG00000155509		3.37:g.13978095G>A	Exception_encountered		Q8NAM5	RNA	SNP	-	NULL	ENST00000326972.8	37	NULL		3																																																																																			FGD5P1	-	-	ENSG00000250439		0.542	TPRXL-001	KNOWN	basic|appris_principal	protein_coding	FGD5P1	HGNC	protein_coding	OTTHUMT00000340434.2	-	0.00	25	0	G	NR_002223		13978095	+1	tier1	-	no_errors	ENST00000502451	ensembl	human	known	74_37	rna	14.81	23	4	SNP	0.691	A
FLI1	2313	genome.wustl.edu	37	11	128680809	128680809	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:128680809G>C	ENST00000527786.2	+	9	1774	c.1285G>C	c.(1285-1287)Gga>Cga	p.G429R	FLI1_ENST00000534087.2_Missense_Mutation_p.G396R|FLI1_ENST00000525560.1_Missense_Mutation_p.G236R|FLI1_ENST00000344954.6_Missense_Mutation_p.G396R|FLI1_ENST00000281428.8_Missense_Mutation_p.G363R	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	429					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G429R(1)	EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		CCCCACGGGGGGAATCTACCC	0.562			T	EWSR1	Ewing sarcoma																																			Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	1	Substitution - Missense(1)	lung(1)											105.0	107.0	106.0					11																	128680809		1973	4153	6126	SO:0001583	missense	0			M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.1285G>C	11.37:g.128680809G>C	ENSP00000433488:p.Gly429Arg		B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	pfam_Ets_dom,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets_dom,pfscan_Ets_dom,prints_Ets_dom	p.G429R	ENST00000527786.2	37	c.1285	CCDS44768.1	11	.	.	.	.	.	.	.	.	.	.	G	13.82	2.349805	0.41599	.	.	ENSG00000151702	ENST00000525560;ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T;T	0.22743	1.94;2.54;2.54;2.54;2.54	5.46	5.46	0.80206	.	0.144785	0.64402	D	0.000006	T	0.21022	0.0506	L	0.44542	1.39	0.50313	D	0.999866	P;B;P	0.40602	0.554;0.282;0.723	B;B;B	0.44224	0.258;0.138;0.444	T	0.01159	-1.1433	10	0.59425	D	0.04	.	6.577	0.22573	0.2015:0.0:0.7985:0.0	.	429;236;363	Q01543;B4DFV4;Q01543-2	FLI1_HUMAN;.;.	R	236;396;429;396;363	ENSP00000437124:G236R;ENSP00000339627:G396R;ENSP00000399985:G429R;ENSP00000432950:G396R;ENSP00000281428:G363R	ENSP00000281428:G363R	G	+	1	0	FLI1	128186019	1.000000	0.71417	0.335000	0.25508	0.985000	0.73830	6.055000	0.71103	2.840000	0.97914	0.655000	0.94253	GGA	FLI1	-	NULL	ENSG00000151702		0.562	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLI1	HGNC	protein_coding	OTTHUMT00000386226.2		0.00	37	0	G	NM_002017		128680809	+1			no_errors	ENST00000527786	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.946	C
FLJ36000	284124	genome.wustl.edu	37	17	21911267	21911268	+	lincRNA	DEL	TG	TG	-	rs377372339|rs572886648		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	TG	TG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:21911267_21911268delTG	ENST00000581223.2	+	0	1992_1993					NR_027084.1																						tttttgtttctgtgtgtgtgtg	0.505																																																	0																																												0																															17.37:g.21911277_21911278delTG				RNA	DEL	-	NULL	ENST00000581223.2	37	NULL		17																																																																																			RP11-744K17.9	-	-	ENSG00000266795		0.505	RP11-744K17.9-001	KNOWN	basic	lincRNA	FLJ36000	Clone_based_vega_gene	lincRNA	OTTHUMT00000451067.1		0.00	9	0	TG			21911268	+1			no_errors	ENST00000581223	ensembl	human	known	74_37	rna	33.33	6	3	DEL	0.024:0.043	0
FMR1	2332	genome.wustl.edu	37	X	147011714	147011714	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:147011714C>G	ENST00000370475.4	+	7	709	c.581C>G	c.(580-582)aCt>aGt	p.T194S	FMR1_ENST00000218200.8_Missense_Mutation_p.T194S|FMR1_ENST00000370471.3_Missense_Mutation_p.T194S|FMR1_ENST00000334557.6_Missense_Mutation_p.T194S|FMR1_ENST00000440235.2_5'Flank|FMR1_ENST00000439526.2_Missense_Mutation_p.T194S|FMR1_ENST00000370470.1_Missense_Mutation_p.T194S|FMR1_ENST00000370477.1_Missense_Mutation_p.T194S	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	194					central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					AGTCTGCGCACTAAGTTGTCT	0.398									Fragile X syndrome																																								0													141.0	117.0	125.0					X																	147011714		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.581C>G	X.37:g.147011714C>G	ENSP00000359506:p.Thr194Ser		A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,smart_KH_dom,pfscan_KH_dom_type_1	p.T194S	ENST00000370475.4	37	c.581	CCDS14682.1	X	.	.	.	.	.	.	.	.	.	.	C	18.01	3.528670	0.64860	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000334557;ENST00000439526;ENST00000370470	T;T;T;T;T;T;T	0.56275	1.22;0.47;1.25;1.23;1.53;1.25;1.25	5.06	5.06	0.68205	.	0.043932	0.85682	D	0.000000	T	0.49338	0.1551	M	0.62723	1.935	0.80722	D	1	B;B;P;P;P	0.43578	0.086;0.264;0.64;0.811;0.778	B;B;B;B;B	0.37989	0.066;0.074;0.213;0.227;0.262	T	0.50074	-0.8870	10	0.22109	T	0.4	-30.983	16.6447	0.85173	0.0:1.0:0.0:0.0	.	194;194;110;194;194	Q8IXW7;Q06787;Q59GC1;Q06787-8;G3V0J0	.;FMR1_HUMAN;.;.;.	S	194	ENSP00000218200:T194S;ENSP00000359502:T194S;ENSP00000359508:T194S;ENSP00000359506:T194S;ENSP00000355115:T194S;ENSP00000395923:T194S;ENSP00000359501:T194S	ENSP00000218200:T194S	T	+	2	0	FMR1	146819406	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.924000	0.70054	2.221000	0.72209	0.600000	0.82982	ACT	FMR1	-	NULL	ENSG00000102081		0.398	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMR1	HGNC	protein_coding	OTTHUMT00000058655.1	-	0.00	30	0	C	NM_002024		147011714	+1	tier1	-	no_errors	ENST00000370475	ensembl	human	known	74_37	missense	11.43	31	4	SNP	1.000	G
FN1	2335	genome.wustl.edu	37	2	216264040	216264040	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:216264040G>A	ENST00000359671.1	-	21	3553	c.3288C>T	c.(3286-3288)acC>acT	p.T1096T	FN1_ENST00000356005.4_Silent_p.T1096T|FN1_ENST00000354785.4_Silent_p.T1096T|FN1_ENST00000323926.6_Silent_p.T1096T|FN1_ENST00000336916.4_Silent_p.T1096T|FN1_ENST00000432072.2_Silent_p.T1096T|FN1_ENST00000346544.3_Silent_p.T1096T|FN1_ENST00000357009.2_Silent_p.T1096T|FN1_ENST00000421182.1_Silent_p.T1096T|FN1_ENST00000345488.5_Silent_p.T1096T|FN1_ENST00000446046.1_Silent_p.T1096T|FN1_ENST00000443816.1_Silent_p.T1096T|FN1_ENST00000357867.4_Silent_p.T1096T			P02751	FINC_HUMAN	fibronectin 1	1096	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316, ECO:0000255|PROSITE-ProRule:PRU00478, ECO:0000255|PROSITE-ProRule:PRU00479}.				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CAGTCACCTCGGTGTTGTAAG	0.443																																																	0													154.0	145.0	148.0					2																	216264040		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.3288C>T	2.37:g.216264040G>A			B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.T1096	ENST00000359671.1	37	c.3288		2																																																																																			FN1	-	pfam_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000115414		0.443	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding		-	0.00	39	0	G	NM_212476		216264040	-1	tier1	-	no_errors	ENST00000354785	ensembl	human	known	74_37	silent	14.29	24	4	SNP	0.074	A
GABRP	2568	genome.wustl.edu	37	5	170224476	170224476	+	Silent	SNP	G	G	A	rs148144716	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:170224476G>A	ENST00000518525.1	+	7	929	c.465G>A	c.(463-465)acG>acA	p.T155T	GABRP_ENST00000519598.1_Silent_p.T155T|GABRP_ENST00000519385.1_Silent_p.T155T|GABRP_ENST00000265294.4_Silent_p.T155T			O00591	GBRP_HUMAN	gamma-aminobutyric acid (GABA) A receptor, pi	155					signal transduction (GO:0007165)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(5)|large_intestine(4)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	29	Renal(175;0.000159)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTAGAATCACGACAACTGTTG	0.423													A|||	35	0.00698882	0.025	0.0	5008	,	,		22369	0.0		0.001	False		,,,				2504	0.001																0								A		87,4319	818.5+/-416.3	0,87,2116	148.0	135.0	139.0		465	-11.0	0.0	5	dbSNP_134	139	2,8598	819.2+/-406.8	0,2,4298	no	coding-synonymous	GABRP	NM_014211.2		0,89,6414	AA,AG,GG		0.0233,1.9746,0.6843		155/441	170224476	89,12917	2203	4300	6503	SO:0001819	synonymous_variant	0			U95367	CCDS4375.1, CCDS75368.1	5q35.1	2012-06-22			ENSG00000094755	ENSG00000094755		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4089	protein-coding gene	gene with protein product	"""GABA(A) receptor, pi"""	602729				9182563	Standard	NM_014211		Approved		uc003mau.3	O00591	OTTHUMG00000130443	ENST00000518525.1:c.465G>A	5.37:g.170224476G>A			A8KA36|D3DQL2|Q32MJ1	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAp_rcpt,prints_GABAA_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.T155	ENST00000518525.1	37	c.465	CCDS4375.1	5																																																																																			GABRP	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000094755		0.423	GABRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRP	HGNC	protein_coding	OTTHUMT00000252834.3		0.00	88	0	G	NM_014211		170224476	+1			no_errors	ENST00000265294	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.001	A
GBP1	2633	genome.wustl.edu	37	1	89520498	89520498	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:89520498C>G	ENST00000370473.4	-	10	1751	c.1532G>C	c.(1531-1533)aGa>aCa	p.R511T	GBP1_ENST00000484970.1_5'UTR	NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	511					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		CTCATTCTTTCTTTGCATTTC	0.443																																																	0													391.0	401.0	397.0					1																	89520498		2203	4300	6503	SO:0001583	missense	0			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.1532G>C	1.37:g.89520498C>G	ENSP00000359504:p.Arg511Thr		D3DT26|Q5T8M1	Missense_Mutation	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C,superfamily_P-loop_NTPase	p.R511T	ENST00000370473.4	37	c.1532	CCDS718.1	1	.	.	.	.	.	.	.	.	.	.	C	5.792	0.330377	0.10956	.	.	ENSG00000117228	ENST00000370473;ENST00000542693	T	0.02067	4.47	4.67	-3.64	0.04515	Guanylate-binding protein, C-terminal (3);	1.289840	0.04894	N	0.450063	T	0.00815	0.0027	L	0.55213	1.73	0.09310	N	1	B	0.18741	0.03	B	0.20767	0.031	T	0.45498	-0.9257	10	0.39692	T	0.17	.	4.0045	0.09595	0.449:0.2968:0.0:0.2541	.	511	P32455	GBP1_HUMAN	T	511;474	ENSP00000359504:R511T	ENSP00000359504:R511T	R	-	2	0	GBP1	89293086	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	-1.985000	0.01485	-1.192000	0.02691	0.491000	0.48974	AGA	GBP1	-	pfam_Guanylate-bd_C,superfamily_Guanylate-bd_C	ENSG00000117228		0.443	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP1	HGNC	protein_coding	OTTHUMT00000029289.3	-	0.00	81	0	C	NM_002053		89520498	-1	tier1	-	no_errors	ENST00000370473	ensembl	human	known	74_37	missense	12.28	50	7	SNP	0.000	G
GDF6	392255	genome.wustl.edu	37	8	97157145	97157145	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:97157145G>A	ENST00000287020.5	-	2	1113	c.1014C>T	c.(1012-1014)ttC>ttT	p.F338F		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	338					activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)				breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					GGCGACTGGCGAAGGCCGTgc	0.746																																																	0													23.0	19.0	20.0					8																	97157145		2202	4298	6500	SO:0001819	synonymous_variant	0				CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.1014C>T	8.37:g.97157145G>A			Q6PI58	Silent	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C	p.F338	ENST00000287020.5	37	c.1014	CCDS34926.1	8																																																																																			GDF6	-	NULL	ENSG00000156466		0.746	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF6	HGNC	protein_coding	OTTHUMT00000379862.2	-	0.00	42	0	G	NM_001001557		97157145	-1	tier1	-	no_errors	ENST00000287020	ensembl	human	known	74_37	silent	27.27	16	6	SNP	0.896	A
GFOD2	81577	genome.wustl.edu	37	16	67709267	67709267	+	Missense_Mutation	SNP	A	A	G	rs139441064		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:67709267A>G	ENST00000268797.7	-	3	1294	c.949T>C	c.(949-951)Tcc>Ccc	p.S317P	GFOD2_ENST00000602377.1_5'UTR	NM_030819.3	NP_110446.3	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain containing 2	317					extracellular matrix organization (GO:0030198)	proteinaceous extracellular matrix (GO:0005578)	oxidoreductase activity (GO:0016491)			breast(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		CCCTGGAAGGACTGGCGCAAG	0.677																																																	0													66.0	60.0	62.0					16																	67709267		2198	4300	6498	SO:0001583	missense	0			AK074382	CCDS10845.1, CCDS59268.1	16q22.1	2008-02-05			ENSG00000141098	ENSG00000141098			28159	protein-coding gene	gene with protein product						12975309	Standard	NM_030819		Approved	FLJ23802, MGC11335	uc002eub.3	Q3B7J2	OTTHUMG00000137537	ENST00000268797.7:c.949T>C	16.37:g.67709267A>G	ENSP00000268797:p.Ser317Pro		Q69YL9|Q6UXX6|Q7L648|Q8TE86|Q9BQ07|R4GNG5	Missense_Mutation	SNP	pfam_Oxidoreductase_N	p.S317P	ENST00000268797.7	37	c.949	CCDS10845.1	16	.	.	.	.	.	.	.	.	.	.	A	18.77	3.695027	0.68386	.	.	ENSG00000141098	ENST00000268797	T	0.47869	0.83	5.28	4.16	0.48862	.	0.158510	0.64402	D	0.000018	T	0.46983	0.1421	M	0.62723	1.935	0.58432	D	0.999991	B	0.20671	0.047	B	0.25140	0.058	T	0.46219	-0.9207	10	0.72032	D	0.01	-24.0213	12.09	0.53719	0.8558:0.1442:0.0:0.0	.	317	Q3B7J2	GFOD2_HUMAN	P	317	ENSP00000268797:S317P	ENSP00000268797:S317P	S	-	1	0	GFOD2	66266768	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	2.608000	0.46308	0.913000	0.36797	0.455000	0.32223	TCC	GFOD2	-	NULL	ENSG00000141098		0.677	GFOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFOD2	HGNC	protein_coding	OTTHUMT00000268868.2		0.00	90	0	A	NM_030819		67709267	-1			no_errors	ENST00000268797	ensembl	human	known	74_37	missense	5.56	85	5	SNP	1.000	G
GFOD2	81577	genome.wustl.edu	37	16	67719533	67719533	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:67719533G>T	ENST00000268797.7	-	2	431	c.86C>A	c.(85-87)aCt>aAt	p.T29N	GFOD2_ENST00000602377.1_5'UTR	NM_030819.3	NP_110446.3	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain containing 2	29					extracellular matrix organization (GO:0030198)	proteinaceous extracellular matrix (GO:0005578)	oxidoreductase activity (GO:0016491)			breast(2)|endometrium(1)|large_intestine(4)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	19		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		GGCCTCAACAGTGAACCCTTC	0.592																																																	0													74.0	64.0	67.0					16																	67719533		2198	4300	6498	SO:0001583	missense	0			AK074382	CCDS10845.1, CCDS59268.1	16q22.1	2008-02-05			ENSG00000141098	ENSG00000141098			28159	protein-coding gene	gene with protein product						12975309	Standard	NM_030819		Approved	FLJ23802, MGC11335	uc002eub.3	Q3B7J2	OTTHUMG00000137537	ENST00000268797.7:c.86C>A	16.37:g.67719533G>T	ENSP00000268797:p.Thr29Asn		Q69YL9|Q6UXX6|Q7L648|Q8TE86|Q9BQ07|R4GNG5	Missense_Mutation	SNP	pfam_Oxidoreductase_N	p.T29N	ENST00000268797.7	37	c.86	CCDS10845.1	16	.	.	.	.	.	.	.	.	.	.	G	10.85	1.467353	0.26335	.	.	ENSG00000141098	ENST00000268797	T	0.21734	1.99	5.43	5.43	0.79202	Oxidoreductase, N-terminal (1);NAD(P)-binding domain (1);	0.335632	0.31031	N	0.008385	T	0.13884	0.0336	N	0.14661	0.345	0.32250	N	0.571576	B	0.09022	0.002	B	0.15052	0.012	T	0.07385	-1.0775	10	0.30854	T	0.27	-20.9149	14.4558	0.67416	0.0:0.1473:0.8527:0.0	.	29	Q3B7J2	GFOD2_HUMAN	N	29	ENSP00000268797:T29N	ENSP00000268797:T29N	T	-	2	0	GFOD2	66277034	1.000000	0.71417	0.959000	0.39883	0.915000	0.54546	5.171000	0.64996	2.541000	0.85698	0.561000	0.74099	ACT	GFOD2	-	pfam_Oxidoreductase_N	ENSG00000141098		0.592	GFOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFOD2	HGNC	protein_coding	OTTHUMT00000268868.2	-	0.00	53	0	G	NM_030819		67719533	-1	tier1	-	no_errors	ENST00000268797	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.940	T
GLI1	2735	genome.wustl.edu	37	12	57861915	57861915	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:57861915G>A	ENST00000228682.2	+	10	1307	c.1216G>A	c.(1216-1218)Gca>Aca	p.A406T	GLI1_ENST00000543426.1_Missense_Mutation_p.A278T|GLI1_ENST00000546141.1_Missense_Mutation_p.A365T	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	406					cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CCTGCCTCGGGCACCATCCAT	0.587																																					Pancreas(157;841 1936 10503 41495 50368)												0													58.0	51.0	53.0					12																	57861915		2203	4300	6503	SO:0001583	missense	0				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.1216G>A	12.37:g.57861915G>A	ENSP00000228682:p.Ala406Thr		D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A406T	ENST00000228682.2	37	c.1216	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	G	10.64	1.406044	0.25378	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T	0.13089	2.72;2.62;2.69;2.69	4.42	4.42	0.53409	.	0.437824	0.19104	N	0.122626	T	0.08670	0.0215	N	0.22421	0.69	0.31803	N	0.628107	B	0.06786	0.001	B	0.09377	0.004	T	0.03587	-1.1022	10	0.36615	T	0.2	.	6.8413	0.23965	0.1916:0.0:0.8084:0.0	.	406	P08151	GLI1_HUMAN	T	278;406;365;365;278	ENSP00000437607:A278T;ENSP00000228682:A406T;ENSP00000441006:A365T;ENSP00000434408:A365T	ENSP00000228682:A406T	A	+	1	0	GLI1	56148182	0.846000	0.29590	0.974000	0.42286	0.028000	0.11728	1.745000	0.38278	2.449000	0.82847	0.655000	0.94253	GCA	GLI1	-	NULL	ENSG00000111087		0.587	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	HGNC	protein_coding	OTTHUMT00000394197.1	-	0.00	33	0	G	NM_005269		57861915	+1	tier1	-	no_errors	ENST00000228682	ensembl	human	known	74_37	missense	13.79	25	4	SNP	0.994	A
GLYCTK	132158	genome.wustl.edu	37	3	52327061	52327061	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:52327061G>C	ENST00000436784.2	+	5	1551	c.1491G>C	c.(1489-1491)caG>caC	p.Q497H	MIR135A1_ENST00000385191.1_RNA|GLYCTK_ENST00000305690.8_Splice_Site|GLYCTK_ENST00000471180.1_Splice_Site|GLYCTK-AS1_ENST00000493616.1_RNA|GLYCTK_ENST00000473032.1_Splice_Site|GLYCTK_ENST00000354773.4_3'UTR|GLYCTK_ENST00000461183.1_Splice_Site			Q8IVS8	GLCTK_HUMAN	glycerate kinase	497					protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glycerate kinase activity (GO:0008887)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|urinary_tract(1)	9				BRCA - Breast invasive adenocarcinoma(193;3.56e-05)|Kidney(197;0.00171)|KIRC - Kidney renal clear cell carcinoma(197;0.00194)|OV - Ovarian serous cystadenocarcinoma(275;0.235)		GCTGCCTCCAGGGTGGGGCAC	0.582																																																	0													95.0	89.0	91.0					3																	52327061		2203	4300	6503	SO:0001583	missense	0				CCDS2852.1, CCDS46841.1	3p21.1	2008-01-22			ENSG00000168237	ENSG00000168237	2.7.1.31		24247	protein-coding gene	gene with protein product		610516				16753811	Standard	NM_145262		Approved	HBEBP4, HBEBP2	uc003ddo.3	Q8IVS8	OTTHUMG00000158380	ENST00000436784.2:c.1491G>C	3.37:g.52327061G>C	ENSP00000389175:p.Gln497His		Q0P630|Q2EZ43|Q6Y2K6|Q7Z6G5|Q86YR8|Q8TED2|Q8WTY2	Splice_Site	SNP	-	e5-1	ENST00000436784.2	37	c.1016-1	CCDS2852.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	0.026|0.026	-1.366919|-1.366919	0.01225|0.01225	.|.	.|.	ENSG00000168237|ENSG00000168237	ENST00000461183;ENST00000473032;ENST00000305690;ENST00000471180|ENST00000436784;ENST00000411757	.|T	.|0.54479	.|0.57	5.46|5.46	0.311|0.311	0.15831|0.15831	.|MOFRL domain (2);	.|0.360368	.|0.30464	.|N	.|0.009576	.|T	.|0.32734	.|0.0839	L|L	0.38175|0.38175	1.15|1.15	0.09310|0.09310	N|N	0.999996|0.999996	.|B	.|0.13594	.|0.008	.|B	.|0.21151	.|0.033	.|T	.|0.11036	.|-1.0604	.|9	.|.	.|.	.|.	.|-2.7969	1.7985|1.7985	0.03066|0.03066	0.2471:0.2186:0.4132:0.121|0.2471:0.2186:0.4132:0.121	.|.	.|497	.|Q8IVS8	.|GLCTK_HUMAN	.|H	-1|497;431	.|ENSP00000389175:Q497H	.|.	.|Q	+|+	.|3	.|2	GLYCTK|GLYCTK	52302101|52302101	0.846000|0.846000	0.29590|0.29590	0.002000|0.002000	0.10522|0.10522	0.007000|0.007000	0.05969|0.05969	0.059000|0.059000	0.14322|0.14322	-0.244000|-0.244000	0.09639|0.09639	-0.175000|-0.175000	0.13238|0.13238	.|CAG	GLYCTK	-	-	ENSG00000168237		0.582	GLYCTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYCTK	HGNC	protein_coding	OTTHUMT00000350835.1	-	0.00	30	0	G	NM_145262		52327061	+1	tier1	-	no_errors	ENST00000305690	ensembl	human	known	74_37	splice_site	13.64	19	3	SNP	0.041	C
GOLGA8M	653720	genome.wustl.edu	37	15	28953410	28953410	+	Silent	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr15:28953410G>T	ENST00000340249.3	-	5	556	c.15C>A	c.(13-15)gtC>gtA	p.V5V	GOLGA8M_ENST00000563213.1_5'Flank|GOLGA8M_ENST00000563027.1_Intron					golgin A8 family, member M																		AATGCCCCAGGACAGGCCCAC	0.567																																																	0																																										SO:0001819	synonymous_variant	0				CCDS61572.1	15q13.1	2014-03-21			ENSG00000188626	ENSG00000188626			44404	protein-coding gene	gene with protein product							Standard	NM_001282468		Approved			H3BSY2	OTTHUMG00000176338	ENST00000340249.3:c.15C>A	15.37:g.28953410G>T				Silent	SNP	NULL	p.V5	ENST00000340249.3	37	c.15		15																																																																																			GOLGA8M	-	NULL	ENSG00000188626		0.567	GOLGA8M-201	KNOWN	basic|appris_candidate	protein_coding	GOLGA8M	HGNC	protein_coding		-	0.00	202	0	G			28953410	-1	tier1	-	no_errors	ENST00000340249	ensembl	human	known	74_37	silent	31.15	84	38	SNP	0.293	T
GPR126	57211	genome.wustl.edu	37	6	142689023	142689023	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:142689023G>T	ENST00000230173.6	+	3	897	c.421G>T	c.(421-423)Ggt>Tgt	p.G141C	GPR126_ENST00000545477.1_3'UTR|GPR126_ENST00000367609.3_Missense_Mutation_p.G141C|GPR126_ENST00000367608.2_Missense_Mutation_p.G141C|GPR126_ENST00000296932.8_Missense_Mutation_p.G141C	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	141	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		CCAGAAGAAAGGTTTCAATGC	0.413																																																	0													77.0	72.0	74.0					6																	142689023		1902	4116	6018	SO:0001583	missense	0			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.421G>T	6.37:g.142689023G>T	ENSP00000230173:p.Gly141Cys		Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_CUB_dom,pfam_GPS_dom,pfam_Pentaxin,superfamily_CUB_dom,superfamily_ConA-like_lec_gl_sf,smart_CUB_dom,smart_Pentaxin,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.G141C	ENST00000230173.6	37	c.421	CCDS47490.1	6	.	.	.	.	.	.	.	.	.	.	G	27.4	4.830901	0.91036	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609;ENST00000541199;ENST00000435011	T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27	5.38	5.38	0.77491	CUB (5);	0.000000	0.64402	D	0.000007	T	0.73552	0.3601	H	0.98388	4.22	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.84939	0.0864	10	0.87932	D	0	.	19.1362	0.93429	0.0:0.0:1.0:0.0	.	141;141;141;141;140	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4;F5H2L1	.;.;.;GP126_HUMAN;.	C	141;141;141;141;140;141	ENSP00000230173:G141C;ENSP00000356580:G141C;ENSP00000296932:G141C;ENSP00000356581:G141C;ENSP00000446287:G140C;ENSP00000438366:G141C	ENSP00000230173:G141C	G	+	1	0	GPR126	142730716	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.476000	0.97823	2.516000	0.84829	0.650000	0.86243	GGT	GPR126	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000112414		0.413	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	HGNC	protein_coding	OTTHUMT00000042487.2		0.00	16	0	G			142689023	+1			no_errors	ENST00000367609	ensembl	human	known	74_37	missense	14.29	18	3	SNP	1.000	T
GPR139	124274	genome.wustl.edu	37	16	20084821	20084821	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:20084821C>T	ENST00000570682.1	-	1	418	c.118G>A	c.(118-120)Ggt>Agt	p.G40S		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	40					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						CCTGGTAAACCGAGGCACAGC	0.672																																																	0													36.0	36.0	36.0					16																	20084821		2202	4299	6501	SO:0001583	missense	0			AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.118G>A	16.37:g.20084821C>T	ENSP00000458791:p.Gly40Ser		A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.G40S	ENST00000570682.1	37	c.118	CCDS32398.1	16	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409443	0.62399	.	.	ENSG00000180269	ENST00000326571	.	.	.	4.32	4.32	0.51571	.	0.000000	0.64402	D	0.000001	T	0.30230	0.0758	N	0.08118	0	0.48696	D	0.999691	B	0.32604	0.377	B	0.25614	0.062	T	0.33548	-0.9864	9	0.72032	D	0.01	-0.088	12.1817	0.54216	0.0:1.0:0.0:0.0	.	40	Q6DWJ6	GP139_HUMAN	S	40	.	ENSP00000370779:G40S	G	-	1	0	GPR139	19992322	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.660000	0.54496	2.216000	0.71823	0.455000	0.32223	GGT	GPR139	-	prints_GPCR_Rhodpsn	ENSG00000180269		0.672	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR139	HGNC	protein_coding	OTTHUMT00000438522.1	-	0.00	138	0	C	NM_001002911		20084821	-1	tier1	-	no_errors	ENST00000570682	ensembl	human	known	74_37	missense	44.44	45	36	SNP	1.000	T
GRIK3	2899	genome.wustl.edu	37	1	37270590	37270591	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:37270590_37270591insCT	ENST00000373091.3	-	15	2578_2579	c.2562_2563insAG	c.(2560-2565)gagcagfs	p.Q855fs	GRIK3_ENST00000373093.4_Frame_Shift_Ins_p.Q855fs	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	855					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)			breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				AGGCTTACCTGCTCTCTCTCTG	0.569																																																	0																																										SO:0001589	frameshift_variant	0			U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.2561_2562dupAG	1.37:g.37270599_37270600dupCT	ENSP00000362183:p.Gln855fs		A9Z1Z8|B1AMS6|Q13004|Q16136	Frame_Shift_Ins	INS	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Q854fs	ENST00000373091.3	37	c.2563_2562	CCDS416.1	1																																																																																			GRIK3	-	NULL	ENSG00000163873		0.569	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK3	HGNC	protein_coding	OTTHUMT00000012053.1		0.00	35	0	-	NM_000831		37270591	-1	tier1		no_errors	ENST00000373091	ensembl	human	known	74_37	frame_shift_ins	23.08	20	6	INS	1.000:1.000	CT
GRIK4	2900	genome.wustl.edu	37	11	120827629	120827629	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:120827629G>A	ENST00000527524.2	+	16	2128	c.1841G>A	c.(1840-1842)cGc>cAc	p.R614H	GRIK4_ENST00000438375.2_Missense_Mutation_p.R614H	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	614					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		ATCGCCCCTCGCGCCTTATCC	0.642																																																	0													49.0	39.0	42.0					11																	120827629		2203	4299	6502	SO:0001583	missense	0			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1841G>A	11.37:g.120827629G>A	ENSP00000435648:p.Arg614His		A8K9L1	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R614H	ENST00000527524.2	37	c.1841	CCDS8433.1	11	.	.	.	.	.	.	.	.	.	.	G	26.8	4.770367	0.90108	.	.	ENSG00000149403	ENST00000527524;ENST00000438375	T;T	0.57752	0.38;0.38	4.96	4.96	0.65561	Ionotropic glutamate receptor (2);	0.049659	0.85682	D	0.000000	T	0.69333	0.3099	M	0.68593	2.085	0.51767	D	0.999939	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	T	0.72384	-0.4310	10	0.87932	D	0	.	13.0023	0.58683	0.0806:0.0:0.9194:0.0	.	614;614	A6H8K8;Q16099	.;GRIK4_HUMAN	H	614	ENSP00000435648:R614H;ENSP00000404063:R614H	ENSP00000404063:R614H	R	+	2	0	GRIK4	120332839	1.000000	0.71417	0.401000	0.26359	0.976000	0.68499	6.705000	0.74644	2.458000	0.83093	0.655000	0.94253	CGC	GRIK4	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000149403		0.642	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	HGNC	protein_coding	OTTHUMT00000109760.4	-	0.00	94	0	G	NM_014619		120827629	+1	tier1	-	no_errors	ENST00000527524	ensembl	human	known	74_37	missense	25.86	43	15	SNP	0.980	A
GRN	2896	genome.wustl.edu	37	17	42428797	42428797	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:42428797C>T	ENST00000053867.3	+	9	964	c.902C>T	c.(901-903)tCg>tTg	p.S301L	GRN_ENST00000589265.1_Intron|GRN_ENST00000589923.1_3'UTR	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	301					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CGTCTACAGTCGGGGGCCTGG	0.642																																																	0													51.0	52.0	52.0					17																	42428797		2203	4300	6503	SO:0001583	missense	0			M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.902C>T	17.37:g.42428797C>T	ENSP00000053867:p.Ser301Leu		D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Missense_Mutation	SNP	pfam_Granulin,smart_Granulin	p.S301L	ENST00000053867.3	37	c.902	CCDS11483.1	17	.	.	.	.	.	.	.	.	.	.	C	19.08	3.757926	0.69648	.	.	ENSG00000030582	ENST00000053867;ENST00000357351;ENST00000393566	T	0.73152	-0.72	4.95	4.95	0.65309	Granulin (2);	0.840764	0.10401	N	0.679165	T	0.79857	0.4518	M	0.82517	2.595	0.49213	D	0.99976	D;D	0.56035	0.96;0.974	B;P	0.50659	0.435;0.647	T	0.75551	-0.3278	10	0.21540	T	0.41	-6.9258	15.7227	0.77724	0.0:1.0:0.0:0.0	.	238;301	B4DJI2;P28799	.;GRN_HUMAN	L	301;301;121	ENSP00000053867:S301L	ENSP00000053867:S301L	S	+	2	0	GRN	39784323	0.000000	0.05858	0.007000	0.13788	0.941000	0.58515	0.532000	0.23067	2.572000	0.86782	0.491000	0.48974	TCG	GRN	-	pfam_Granulin,smart_Granulin	ENSG00000030582		0.642	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRN	HGNC	protein_coding	OTTHUMT00000457766.1	-	0.00	67	0	C	NM_002087		42428797	+1	tier1	-	no_errors	ENST00000053867	ensembl	human	known	74_37	missense	12.00	44	6	SNP	0.024	T
GSTM5	2949	genome.wustl.edu	37	1	110256361	110256361	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:110256361G>A	ENST00000256593.3	+	5	396	c.338G>A	c.(337-339)aGa>aAa	p.R113K	GSTM5_ENST00000369812.5_Missense_Mutation_p.R132K|GSTM5_ENST00000369813.1_Missense_Mutation_p.R72K|GSTM5_ENST00000492718.1_3'UTR	NM_000851.3	NP_000842.2	P46439	GSTM5_HUMAN	glutathione S-transferase mu 5	113	GST C-terminal.				glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	glutathione transferase activity (GO:0004364)			NS(1)|central_nervous_system(6)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	21		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Colorectal(144;0.0131)|all cancers(265;0.0252)|Epithelial(280;0.0265)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.0474)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)	GAGCTGGTCAGACTGTGCTAT	0.532																																																	0													392.0	230.0	285.0					1																	110256361		2203	4300	6503	SO:0001583	missense	0			L02321	CCDS811.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134201	ENSG00000134201	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4637	protein-coding gene	gene with protein product		138385	"""glutathione S-transferase M5"""			8473333	Standard	NM_000851		Approved		uc001dyn.3	P46439	OTTHUMG00000011644	ENST00000256593.3:c.338G>A	1.37:g.110256361G>A	ENSP00000256593:p.Arg113Lys		A8K0V8|Q6PD78	Missense_Mutation	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_mu	p.R132K	ENST00000256593.3	37	c.395	CCDS811.1	1	.	.	.	.	.	.	.	.	.	.	G	7.275	0.607966	0.14002	.	.	ENSG00000134201	ENST00000256593;ENST00000369813;ENST00000369812	T;T;T	0.02177	4.41;4.41;4.41	1.95	-3.89	0.04193	Glutathione S-transferase, C-terminal-like (2);Glutathione S-transferase/chloride channel, C-terminal (1);Glutathione S-transferase, C-terminal (1);	0.275476	0.27941	U	0.017222	T	0.00608	0.0020	L	0.43757	1.38	0.09310	N	1	B;B	0.19445	0.036;0.001	B;B	0.21360	0.034;0.005	T	0.43956	-0.9359	10	0.45353	T	0.12	.	4.2322	0.10608	0.0:0.2835:0.3539:0.3625	.	72;113	Q5T8Q9;P46439	.;GSTM5_HUMAN	K	113;72;132	ENSP00000256593:R113K;ENSP00000358828:R72K;ENSP00000358827:R132K	ENSP00000256593:R113K	R	+	2	0	GSTM5	110057884	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.213000	0.09305	-1.017000	0.03367	-0.598000	0.04106	AGA	GSTM5	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000134201		0.532	GSTM5-001	KNOWN	basic|CCDS	protein_coding	GSTM5	HGNC	protein_coding	OTTHUMT00000032200.1	-	0.00	76	0	G	NM_000851		110256361	+1	tier1	-	no_errors	ENST00000369812	ensembl	human	known	74_37	missense	11.76	45	6	SNP	0.004	A
HAP1	9001	genome.wustl.edu	37	17	39884552	39884552	+	Silent	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:39884552C>T	ENST00000310778.5	-	7	1110	c.1101G>A	c.(1099-1101)tcG>tcA	p.S367S	JUP_ENST00000540235.1_Intron|HAP1_ENST00000341193.5_Silent_p.S375S|RN7SL399P_ENST00000471648.2_RNA|HAP1_ENST00000347901.4_Silent_p.S367S|HAP1_ENST00000393939.2_Silent_p.S367S			P54257	HAP1_HUMAN	huntingtin-associated protein 1	367	Glu-rich.|HAP1 N-terminal.				anterograde axon cargo transport (GO:0008089)|autophagy (GO:0006914)|brain development (GO:0007420)|cell projection organization (GO:0030030)|exocytosis (GO:0006887)|negative regulation of beta-amyloid formation (GO:1902430)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|positive regulation of neurotrophin production (GO:0032901)|positive regulation of nonmotile primary cilium assembly (GO:1902857)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|protein localization (GO:0008104)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)|regulation of organelle transport along microtubule (GO:1902513)|retrograde axon cargo transport (GO:0008090)|synaptic transmission (GO:0007268)|vesicle transport along microtubule (GO:0047496)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|inclusion body (GO:0016234)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|synapse (GO:0045202)	brain-derived neurotrophic factor binding (GO:0048403)|ion channel binding (GO:0044325)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(4)|skin(1)	21		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			CCAGCACCTCCGACAGCTCAG	0.672																																																	0													42.0	37.0	39.0					17																	39884552		2203	4299	6502	SO:0001819	synonymous_variant	0			AF040723	CCDS11406.1, CCDS42338.1, CCDS42339.1	17q21.2-q21.3	2008-04-23	2008-04-23		ENSG00000173805	ENSG00000173805			4812	protein-coding gene	gene with protein product	"""neuroan 1"""	600947		HAP2		7477378, 9668110	Standard	NM_177977		Approved	HLP, hHLP1, HIP5	uc002hxn.1	P54257	OTTHUMG00000133498	ENST00000310778.5:c.1101G>A	17.37:g.39884552C>T			A8MQB5|O75358|Q59GK4|Q9H4G3|Q9HA98|Q9NY90	Silent	SNP	pfam_HAP1_N	p.S367	ENST00000310778.5	37	c.1101		17																																																																																			HAP1	-	pfam_HAP1_N	ENSG00000173805		0.672	HAP1-006	KNOWN	basic|appris_principal	protein_coding	HAP1	HGNC	protein_coding	OTTHUMT00000389619.1	-	0.00	74	0	C	NM_003949		39884552	-1	tier1	-	no_errors	ENST00000310778	ensembl	human	known	74_37	silent	18.45	84	19	SNP	0.002	T
HAPLN3	145864	genome.wustl.edu	37	15	89422500	89422500	+	Splice_Site	SNP	C	C	A	rs369432073		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr15:89422500C>A	ENST00000359595.3	-	4	708	c.494G>T	c.(493-495)gGt>gTt	p.G165V	HAPLN3_ENST00000562889.1_Splice_Site_p.G227V	NM_178232.2	NP_839946.1	Q96S86	HPLN3_HUMAN	hyaluronan and proteoglycan link protein 3	165					cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	17	Lung NSC(78;0.0392)|all_lung(78;0.077)				Hyaluronan(DB08818)	AAAGACCACACCTGCAGGGGA	0.637											OREG0023445	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													31.0	36.0	34.0					15																	89422500		2200	4299	6499	SO:0001630	splice_region_variant	0			AY262759	CCDS10346.1	15q26.1	2013-01-11			ENSG00000140511	ENSG00000140511		"""Immunoglobulin superfamily / V-set domain containing"""	21446	protein-coding gene	gene with protein product			"""extracellular link domain containing, 1"""	EXLD1		12663660	Standard	NM_178232		Approved	HsT19883	uc002bnc.3	Q96S86	OTTHUMG00000148680	ENST00000359595.3:c.494-1G>T	15.37:g.89422500C>A		1267	A8K7P0	Missense_Mutation	SNP	pfam_Link,pfam_Ig_V-set,superfamily_C-type_lectin_fold,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,pfscan_Link,pfscan_Ig-like_dom,prints_Link	p.G165V	ENST00000359595.3	37	c.494	CCDS10346.1	15	.	.	.	.	.	.	.	.	.	.	C	13.70	2.314947	0.40996	.	.	ENSG00000140511	ENST00000359595	T	0.13778	2.56	4.02	4.02	0.46733	Link (2);	0.000000	0.85682	D	0.000000	T	0.47377	0.1442	M	0.93854	3.465	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.62407	-0.6861	10	0.54805	T	0.06	.	15.1725	0.72884	0.0:1.0:0.0:0.0	.	165;165	A8K7T8;Q96S86	.;HPLN3_HUMAN	V	165	ENSP00000352606:G165V	ENSP00000352606:G165V	G	-	2	0	HAPLN3	87223504	1.000000	0.71417	0.995000	0.50966	0.327000	0.28475	7.376000	0.79658	1.966000	0.57179	0.549000	0.68633	GGT	HAPLN3	-	pfam_Link,smart_Link	ENSG00000140511		0.637	HAPLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAPLN3	HGNC	protein_coding	OTTHUMT00000309070.1	-	0.00	122	0	C	NM_178232	Missense_Mutation	89422500	-1	tier1	-	no_errors	ENST00000359595	ensembl	human	known	74_37	missense	59.68	25	37	SNP	1.000	A
HERC2P8	440366	genome.wustl.edu	37	16	33123821	33123821	+	IGR	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:33123821A>G								HERC2P8 (3035 upstream) : RP11-19N8.7 (16815 downstream)																							GAAATGCCTGAGAATGGTCCC	0.537																																																	0																																										SO:0001628	intergenic_variant	0																															16.37:g.33123821A>G				RNA	SNP	-	NULL		37	NULL		16																																																																																			HERC2P8	-	-	ENSG00000261599	0	0.537					HERC2P8	HGNC			-	0.00	384	0	A			33123821	-1	tier1	-	no_errors	ENST00000567073	ensembl	human	known	74_37	rna	14.94	205	36	SNP	0.978	G
HHAT	55733	genome.wustl.edu	37	1	210796984	210796984	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:210796984A>G	ENST00000367010.1	+	11	1587	c.1360A>G	c.(1360-1362)Aaa>Gaa	p.K454E	HHAT_ENST00000413764.2_Missense_Mutation_p.K454E|HHAT_ENST00000541565.1_Missense_Mutation_p.K317E|HHAT_ENST00000537898.1_Missense_Mutation_p.K389E|HHAT_ENST00000261458.3_Missense_Mutation_p.K454E|HHAT_ENST00000391905.3_Missense_Mutation_p.K454E|HHAT_ENST00000545154.1_Missense_Mutation_p.K455E|HHAT_ENST00000545781.1_Missense_Mutation_p.K391E|HHAT_ENST00000308852.6_Missense_Mutation_p.K409E|HHAT_ENST00000367009.1_Missense_Mutation_p.K144E	NM_001170580.1	NP_001164051.1	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase	454	GTP-binding. {ECO:0000305}.				multicellular organismal development (GO:0007275)|protein palmitoylation (GO:0018345)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)|palmitoyltransferase activity (GO:0016409)			breast(3)|central_nervous_system(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	27				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		TGAGGTTGGGAAAACCTACTG	0.483																																																	0													285.0	271.0	276.0					1																	210796984		2203	4300	6503	SO:0001583	missense	0			AK001586	CCDS1495.1, CCDS53471.1, CCDS53472.1, CCDS53473.1	1q32	2008-02-05			ENSG00000054392	ENSG00000054392			18270	protein-coding gene	gene with protein product		605743				11160356	Standard	NM_001170587		Approved	FLJ10724, MART-2, MART2, Skn, ski, rasp, sit, GUP2	uc009xcx.3	Q5VTY9	OTTHUMG00000036447	ENST00000367010.1:c.1360A>G	1.37:g.210796984A>G	ENSP00000355977:p.Lys454Glu		B7Z4D5|B7Z5I1|B7Z868|B7ZA75|D3DT91|F5H444|Q17RZ7|Q4G0K3|Q5CZ95|Q5TGI2|Q9NVH9|Q9Y3N8	Missense_Mutation	SNP	pfam_MBOAT_fam	p.K454E	ENST00000367010.1	37	c.1360	CCDS1495.1	1	.	.	.	.	.	.	.	.	.	.	A	13.95	2.391264	0.42410	.	.	ENSG00000054392	ENST00000413764;ENST00000541565;ENST00000545154;ENST00000537898;ENST00000391905;ENST00000545781;ENST00000261458;ENST00000308852;ENST00000367010;ENST00000367009	T;T;T;T;T;T;T;T;T;T	0.44083	2.26;0.93;2.25;2.27;2.27;2.27;2.26;2.25;2.26;0.96	6.16	2.33	0.28932	.	0.155147	0.56097	D	0.000026	T	0.24084	0.0583	N	0.22421	0.69	0.28512	N	0.913505	B;B;B;B;B	0.15473	0.001;0.006;0.013;0.004;0.001	B;B;B;B;B	0.13407	0.003;0.009;0.005;0.004;0.002	T	0.14420	-1.0473	10	0.22109	T	0.4	-6.6976	7.0385	0.25006	0.5799:0.3437:0.0764:0.0	.	409;455;317;389;454	B7Z2U8;F5H444;B7Z4D5;B7Z5I1;Q5VTY9	.;.;.;.;HHAT_HUMAN	E	454;317;455;389;454;391;454;409;454;144	ENSP00000416845:K454E;ENSP00000444995:K317E;ENSP00000438468:K455E;ENSP00000442625:K389E;ENSP00000375773:K454E;ENSP00000439229:K391E;ENSP00000261458:K454E;ENSP00000308628:K409E;ENSP00000355977:K454E;ENSP00000355976:K144E	ENSP00000261458:K454E	K	+	1	0	HHAT	208863607	0.980000	0.34600	0.998000	0.56505	0.947000	0.59692	3.019000	0.49635	0.511000	0.28236	0.528000	0.53228	AAA	HHAT	-	NULL	ENSG00000054392		0.483	HHAT-004	KNOWN	basic|appris_principal|CCDS	protein_coding	HHAT	HGNC	protein_coding	OTTHUMT00000088662.1	-	0.00	109	0	A	NM_018194		210796984	+1	tier1	-	no_errors	ENST00000391905	ensembl	human	known	74_37	missense	17.80	97	21	SNP	0.977	G
HN1L	90861	genome.wustl.edu	37	16	1748984	1748984	+	Silent	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:1748984C>T	ENST00000248098.3	+	5	615	c.558C>T	c.(556-558)agC>agT	p.S186S	HN1L_ENST00000561516.1_3'UTR|HN1L_ENST00000562684.1_Silent_p.S214S|HN1L_ENST00000382711.5_Silent_p.S170S|HN1L_ENST00000569765.1_3'UTR|HN1L_ENST00000569256.1_3'UTR|HN1L_ENST00000382710.4_Silent_p.S174S	NM_144570.2	NP_653171.1	Q9H910	HN1L_HUMAN	hematological and neurological expressed 1-like	186						cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|kidney(2)|lung(3)|upper_aerodigestive_tract(1)	9						GCAAATCCAGCATCTCCTTCT	0.577																																																	0													42.0	52.0	49.0					16																	1748984		2199	4298	6497	SO:0001819	synonymous_variant	0			AK023154	CCDS10441.1	16p13.3	2006-12-13	2006-12-13	2006-12-13	ENSG00000206053	ENSG00000206053			14137	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 34"""	C16orf34		15094197	Standard	NM_144570		Approved	FLJ13092, L11, KIAA1426	uc002cmg.3	Q9H910	OTTHUMG00000047859	ENST00000248098.3:c.558C>T	16.37:g.1748984C>T			B1AJY2|Q6EIC7	Silent	SNP	NULL	p.S186	ENST00000248098.3	37	c.558	CCDS10441.1	16																																																																																			HN1L	-	NULL	ENSG00000206053		0.577	HN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HN1L	HGNC	protein_coding	OTTHUMT00000109086.2	-	0.00	121	0	C	NM_144570		1748984	+1	tier1	-	no_errors	ENST00000248098	ensembl	human	known	74_37	silent	6.67	56	4	SNP	1.000	T
HNRNPM	4670	genome.wustl.edu	37	19	8551084	8551084	+	Missense_Mutation	SNP	G	G	C	rs531807844	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:8551084G>C	ENST00000325495.4	+	14	1813	c.1772G>C	c.(1771-1773)cGc>cCc	p.R591P	HNRNPM_ENST00000348943.3_Missense_Mutation_p.R552P	NM_005968.4	NP_005959.2	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M	591	27 X 6 AA repeats of [GEVSTPAN]-[ILMV]- [DE]-[RH]-[MLVI]-[GAV].				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein domain specific binding (GO:0019904)|RNA binding (GO:0003723)			endometrium(5)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)	25						AGCCTCGAGCGCATGGGCCCT	0.701																																																	0													28.0	31.0	30.0					19																	8551084		2199	4292	6491	SO:0001583	missense	0			L03532	CCDS12203.1, CCDS12204.1	19p13.2	2013-06-12		2008-04-18	ENSG00000099783	ENSG00000099783		"""RNA binding motif (RRM) containing"""	5046	protein-coding gene	gene with protein product	"""CEA receptor"""	160994		NAGR1, HNRPM		8441656, 7558047	Standard	NM_005968		Approved	HTGR1, HNRNPM4, HNRPM4, CEAR	uc010dwe.3	P52272	OTTHUMG00000182383	ENST00000325495.4:c.1772G>C	19.37:g.8551084G>C	ENSP00000325376:p.Arg591Pro		Q15584|Q8WZ44|Q96H56|Q9BWL9|Q9Y492	Missense_Mutation	SNP	pfam_RRM_dom,pfam_HnRNP_M_PY-NLS,smart_RRM_dom,pfscan_RRM_dom	p.R591P	ENST00000325495.4	37	c.1772	CCDS12203.1	19	.	.	.	.	.	.	.	.	.	.	G	19.73	3.882025	0.72294	.	.	ENSG00000099783	ENST00000325495;ENST00000348943;ENST00000544159;ENST00000539473	T;T	0.16196	2.36;2.67	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.37100	0.0991	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.76494	0.997;0.988;0.986;0.999	P;P;P;D	0.64877	0.852;0.769;0.706;0.93	T	0.01977	-1.1236	10	0.72032	D	0.01	.	18.655	0.91450	0.0:0.0:1.0:0.0	.	431;591;552;476	Q7KYM9;P52272;P52272-2;Q59ES8	.;HNRPM_HUMAN;.;.	P	591;552;476;148	ENSP00000325376:R591P;ENSP00000325732:R552P	ENSP00000325376:R591P	R	+	2	0	HNRNPM	8457084	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.871000	0.92346	2.746000	0.94184	0.591000	0.81541	CGC	HNRNPM	-	NULL	ENSG00000099783		0.701	HNRNPM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HNRNPM	HGNC	protein_coding	OTTHUMT00000460894.1	-	0.00	62	0	G			8551084	+1	tier1	-	no_errors	ENST00000325495	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	C
HRNR	388697	genome.wustl.edu	37	1	152191913	152191913	+	Missense_Mutation	SNP	G	G	A	rs370652380		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:152191913G>A	ENST00000368801.2	-	3	2267	c.2192C>T	c.(2191-2193)tCt>tTt	p.S731F	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	731					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCTGACCTAGAGCCGTGTTT	0.542																																																	0													203.0	200.0	201.0					1																	152191913		2203	4300	6503	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2192C>T	1.37:g.152191913G>A	ENSP00000357791:p.Ser731Phe		Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.S731F	ENST00000368801.2	37	c.2192	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	-	2.723	-0.266083	0.05754	.	.	ENSG00000197915	ENST00000368801	T	0.03635	3.86	2.62	0.549	0.17213	.	.	.	.	.	T	0.02267	0.0070	L	0.46157	1.445	0.09310	N	1	D	0.55172	0.97	P	0.53313	0.723	T	0.43861	-0.9365	9	0.40728	T	0.16	.	4.9685	0.14103	0.0:0.2386:0.5164:0.245	.	731	Q86YZ3	HORN_HUMAN	F	731	ENSP00000357791:S731F	ENSP00000357791:S731F	S	-	2	0	HRNR	150458537	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.209000	0.09358	0.008000	0.14787	-0.291000	0.09656	TCT	HRNR	-	NULL	ENSG00000197915		0.542	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	-	0.00	131	0	G	XM_373868		152191913	-1	tier1	-	no_errors	ENST00000368801	ensembl	human	known	74_37	missense	18.02	91	20	SNP	0.000	A
HS1BP3	64342	genome.wustl.edu	37	2	20824580	20824580	+	Missense_Mutation	SNP	G	G	T	rs376195521		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:20824580G>T	ENST00000304031.3	-	5	721	c.696C>A	c.(694-696)gaC>gaA	p.D232E		NM_022460.3	NP_071905.3	Q53T59	H1BP3_HUMAN	HCLS1 binding protein 3	232	Pro-rich.						phosphatidylinositol binding (GO:0035091)			endometrium(4)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	15	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCACCTCCTCGTCAAAGATGG	0.592																																																	0													79.0	85.0	83.0					2																	20824580		2203	4300	6503	SO:0001583	missense	0				CCDS1700.1	2p24.1	2006-08-15			ENSG00000118960	ENSG00000118960			24979	protein-coding gene	gene with protein product		609359				10590261, 15699368	Standard	NM_022460		Approved	HS1-BP3,FLJ14249	uc002rdw.1	Q53T59	OTTHUMG00000122099	ENST00000304031.3:c.696C>A	2.37:g.20824580G>T	ENSP00000305193:p.Asp232Glu		B2RAW2|D6W529|Q86VC2|Q8N367	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.D232E	ENST00000304031.3	37	c.696	CCDS1700.1	2	.	.	.	.	.	.	.	.	.	.	G	14.68	2.606894	0.46527	.	.	ENSG00000118960	ENST00000304031;ENST00000458740	T;T	0.37235	1.9;1.21	4.7	-5.71	0.02413	.	0.540532	0.17848	N	0.159963	T	0.45013	0.1321	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.55522	-0.8128	10	0.20046	T	0.44	-8.5683	13.0135	0.58743	0.4017:0.0:0.5983:0.0	.	232	Q53T59	H1BP3_HUMAN	E	232;51	ENSP00000305193:D232E;ENSP00000392203:D51E	ENSP00000305193:D232E	D	-	3	2	HS1BP3	20688061	0.670000	0.27512	0.957000	0.39632	0.626000	0.37791	-0.513000	0.06305	-0.959000	0.03618	-2.048000	0.00412	GAC	HS1BP3	-	NULL	ENSG00000118960		0.592	HS1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS1BP3	HGNC	protein_coding	OTTHUMT00000242863.1	-	0.00	77	0	G	NM_022460		20824580	-1	tier1	-	no_errors	ENST00000304031	ensembl	human	known	74_37	missense	8.77	52	5	SNP	0.914	T
HS3ST3A1	9955	genome.wustl.edu	37	17	13503953	13503953	+	Missense_Mutation	SNP	G	G	A	rs374947064		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:13503953G>A	ENST00000284110.1	-	1	1291	c.494C>T	c.(493-495)aCg>aTg	p.T165M		NM_006042.1	NP_006033.1	Q9Y663	HS3SA_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1	165					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)|sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CAGCGCCCGCGTGCCGCCCTT	0.721																																																	0													7.0	8.0	8.0					17																	13503953		2157	4194	6351	SO:0001583	missense	0			AF105376	CCDS11165.1	17p12	2007-04-02			ENSG00000153976	ENSG00000153976	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5196	protein-coding gene	gene with protein product		604057				9988767	Standard	NM_006042		Approved	3OST3A1, 30ST3A1	uc002gob.1	Q9Y663	OTTHUMG00000058768	ENST00000284110.1:c.494C>T	17.37:g.13503953G>A	ENSP00000284110:p.Thr165Met		A8K7N2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	p.T165M	ENST00000284110.1	37	c.494	CCDS11165.1	17	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345437	0.82022	.	.	ENSG00000153976	ENST00000284110	T	0.73469	-0.75	3.11	3.11	0.35812	Sulfotransferase domain (1);	0.000000	0.85682	U	0.000000	D	0.91092	0.7196	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94550	0.7753	10	0.87932	D	0	.	15.0645	0.71983	0.0:0.0:1.0:0.0	.	165	Q9Y663	HS3SA_HUMAN	M	165	ENSP00000284110:T165M	ENSP00000284110:T165M	T	-	2	0	HS3ST3A1	13444678	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.922000	0.75811	2.031000	0.59945	0.561000	0.74099	ACG	HS3ST3A1	-	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase	ENSG00000153976		0.721	HS3ST3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST3A1	HGNC	protein_coding	OTTHUMT00000129952.1		0.00	42	0	G	NM_006042		13503953	-1			no_errors	ENST00000284110	ensembl	human	known	74_37	missense	16.67	20	4	SNP	1.000	A
HSPH1	10808	genome.wustl.edu	37	13	31725825	31725825	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr13:31725825G>T	ENST00000320027.5	-	6	928	c.584C>A	c.(583-585)cCt>cAt	p.P195H	HSPH1_ENST00000380406.5_Missense_Mutation_p.P154H|HSPH1_ENST00000380405.4_Missense_Mutation_p.P195H|HSPH1_ENST00000429785.2_Intron|HSPH1_ENST00000445273.2_Missense_Mutation_p.P197H	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	195					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		CACTATCCGAGGTTTCTCATC	0.353																																																	0													79.0	75.0	76.0					13																	31725825		2203	4300	6503	SO:0001583	missense	0			AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.584C>A	13.37:g.31725825G>T	ENSP00000318687:p.Pro195His		B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.P197H	ENST00000320027.5	37	c.590	CCDS9340.1	13	.	.	.	.	.	.	.	.	.	.	G	29.6	5.019456	0.93462	.	.	ENSG00000120694	ENST00000320027;ENST00000380405;ENST00000380406;ENST00000445273;ENST00000438061	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.61110	0.2321	M	0.78223	2.4	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.994;0.998	T	0.61417	-0.7067	10	0.87932	D	0	-18.0995	20.6525	0.99598	0.0:0.0:1.0:0.0	.	154;197;195;195	Q92598-3;B4DYH1;Q92598-2;Q92598	.;.;.;HS105_HUMAN	H	195;195;154;197;246	ENSP00000318687:P195H;ENSP00000369768:P195H;ENSP00000369769:P154H;ENSP00000396090:P197H	ENSP00000318687:P195H	P	-	2	0	HSPH1	30623825	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.476000	0.97823	2.890000	0.99128	0.585000	0.79938	CCT	HSPH1	-	pfam_Hsp_70_fam,pfam_MreB_Mrl	ENSG00000120694		0.353	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPH1	HGNC	protein_coding	OTTHUMT00000044384.1		0.00	46	0	G			31725825	-1			no_errors	ENST00000445273	ensembl	human	known	74_37	missense	8.33	33	3	SNP	1.000	T
IFT140	9742	genome.wustl.edu	37	16	1570179	1570179	+	Missense_Mutation	SNP	C	C	A	rs200065348		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:1570179C>A	ENST00000426508.2	-	28	4189	c.3826G>T	c.(3826-3828)Ggg>Tgg	p.G1276W	IFT140_ENST00000361339.5_Missense_Mutation_p.G470W	NM_014714.3	NP_055529.2	Q96RY7	IF140_HUMAN	intraflagellar transport 140	1276					cilium assembly (GO:0042384)|intraciliary retrograde transport (GO:0035721)|protein localization to cilium (GO:0061512)|regulation of cilium assembly (GO:1902017)|renal system development (GO:0072001)|retina development in camera-type eye (GO:0060041)|skeletal system morphogenesis (GO:0048705)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle A (GO:0030991)|photoreceptor connecting cilium (GO:0032391)				breast(1)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(12)|lung(10)|ovary(5)|pancreas(1)|prostate(4)|skin(4)|stomach(2)|urinary_tract(1)	53		Hepatocellular(780;0.219)				AGGGCCCGCCCCTTGGTGTAG	0.627																																																	0													83.0	81.0	81.0					16																	1570179		2199	4300	6499	SO:0001583	missense	0			AB011162	CCDS10439.1	16p13.3	2014-07-03	2014-07-03	2005-11-02	ENSG00000187535	ENSG00000187535		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	29077	protein-coding gene	gene with protein product		614620	"""WD and tetratricopeptide repeats 2"", ""intraflagellar transport 140 homolog (Chlamydomonas)"""	WDTC2		9628581	Standard	NM_014714		Approved	gs114, KIAA0590	uc002cmb.3	Q96RY7	OTTHUMG00000128585	ENST00000426508.2:c.3826G>T	16.37:g.1570179C>A	ENSP00000406012:p.Gly1276Trp		A2A2A8|D3DU75|O60332|Q9UG52	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G1276W	ENST00000426508.2	37	c.3826	CCDS10439.1	16	.	.	.	.	.	.	.	.	.	.	C	24.7	4.556824	0.86231	.	.	ENSG00000187535	ENST00000397417;ENST00000361339;ENST00000426508	T;T	0.49432	0.78;0.78	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.75413	0.3846	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.77645	-0.2510	10	0.72032	D	0.01	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	1276;963	Q96RY7;B4DR58	IF140_HUMAN;.	W	1276;470;1276	ENSP00000354895:G470W;ENSP00000406012:G1276W	ENSP00000354895:G470W	G	-	1	0	IFT140	1510180	1.000000	0.71417	0.982000	0.44146	0.973000	0.67179	7.751000	0.85126	2.865000	0.98341	0.655000	0.94253	GGG	IFT140	-	NULL	ENSG00000187535		0.627	IFT140-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT140	HGNC	protein_coding	OTTHUMT00000250438.2	-	0.00	53	0	C	NM_014714		1570179	-1	tier1	-	no_errors	ENST00000426508	ensembl	human	known	74_37	missense	13.16	33	5	SNP	1.000	A
IGFN1	91156	genome.wustl.edu	37	1	201181077	201181077	+	Silent	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:201181077A>G	ENST00000335211.4	+	12	7186	c.7056A>G	c.(7054-7056)ccA>ccG	p.P2352P	IGFN1_ENST00000295591.8_5'UTR|IGFN1_ENST00000451870.2_Intron	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						AAACGGGACCAGAGGGTAAGA	0.562																																																	0													23.0	18.0	19.0					1																	201181077		691	1591	2282	SO:0001819	synonymous_variant	0			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.7056A>G	1.37:g.201181077A>G			F8WAI1|Q9NT72	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.P2352	ENST00000335211.4	37	c.7056	CCDS53455.1	1																																																																																			IGFN1	-	NULL	ENSG00000163395		0.562	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		-	0.00	87	0	A	NM_178275		201181077	+1	tier1	-	no_errors	ENST00000335211	ensembl	human	known	74_37	silent	25.71	52	18	SNP	0.001	G
IL17RC	84818	genome.wustl.edu	37	3	9975157	9975157	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:9975157G>A	ENST00000295981.3	+	19	2474	c.2256G>A	c.(2254-2256)gcG>gcA	p.A752A	CRELD1_ENST00000383811.3_5'Flank|CRELD1_ENST00000397170.3_5'Flank|CRELD1_ENST00000326434.5_5'Flank|IL17RC_ENST00000455057.1_Silent_p.A649A|IL17RC_ENST00000498214.1_3'UTR|RP11-1020A11.1_ENST00000602411.1_RNA|CRELD1_ENST00000452070.1_5'Flank|IL17RC_ENST00000403601.3_Silent_p.A681A|IL17RC_ENST00000383812.4_Silent_p.A666A|IL17RC_ENST00000413608.1_Silent_p.A668A|IL17RC_ENST00000416074.2_Silent_p.A507A	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	752					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AAGAGAGAGCGGAGCAAGTGT	0.721																																																	0													12.0	16.0	15.0					3																	9975157		2167	4265	6432	SO:0001819	synonymous_variant	0			BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.2256G>A	3.37:g.9975157G>A			E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Silent	SNP	pfam_SEFIR	p.A752	ENST00000295981.3	37	c.2256	CCDS2590.1	3																																																																																			IL17RC	-	NULL	ENSG00000163702		0.721	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL17RC	HGNC	protein_coding	OTTHUMT00000250526.2	-	0.00	20	0	G	NM_032732		9975157	+1	tier1	-	no_errors	ENST00000295981	ensembl	human	known	74_37	silent	33.33	8	4	SNP	0.000	A
IL1RAPL1	11141	genome.wustl.edu	37	X	29938112	29938112	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:29938112A>C	ENST00000378993.1	+	8	1631	c.958A>C	c.(958-960)Att>Ctt	p.I320L	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.I320L	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	320	Ig-like C2-type 3.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						CATCTCATTAATTGTGGACTC	0.403																																																	0													210.0	177.0	188.0					X																	29938112		2202	4300	6502	SO:0001583	missense	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.958A>C	X.37:g.29938112A>C	ENSP00000368278:p.Ile320Leu		A0AVG4|Q9UJ53	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like_dom	p.I320L	ENST00000378993.1	37	c.958	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	A	17.20	3.329895	0.60743	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.67171	-0.25;-0.25	5.91	5.91	0.95273	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.050355	0.85682	D	0.000000	T	0.64811	0.2632	L	0.43152	1.355	0.39397	D	0.966511	B	0.32283	0.362	B	0.40228	0.323	T	0.63211	-0.6688	9	.	.	.	.	15.3142	0.74059	1.0:0.0:0.0:0.0	.	320	Q9NZN1	IRPL1_HUMAN	L	320	ENSP00000368278:I320L;ENSP00000305200:I320L	.	I	+	1	0	IL1RAPL1	29848033	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.962000	0.93254	2.000000	0.58554	0.425000	0.28330	ATT	IL1RAPL1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000169306		0.403	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	-	0.00	56	0	A	NM_014271		29938112	+1	tier1	-	no_errors	ENST00000302196	ensembl	human	known	74_37	missense	65.12	15	28	SNP	1.000	C
IPO8	10526	genome.wustl.edu	37	12	30789961	30789961	+	Missense_Mutation	SNP	G	G	A	rs376809979		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:30789961G>A	ENST00000256079.4	-	22	2988	c.2650C>T	c.(2650-2652)Cgg>Tgg	p.R884W	IPO8_ENST00000544829.1_Missense_Mutation_p.R679W	NM_006390.3	NP_006381.2	O15397	IPO8_HUMAN	importin 8	884					intracellular protein transport (GO:0006886)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	Ran GTPase binding (GO:0008536)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(16)|liver(1)|lung(22)|prostate(2)|skin(2)|urinary_tract(2)	52	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					CGATCTTCCCGGTTTACCAGT	0.393																																																	0								G	TRP/ARG,TRP/ARG	0,4406		0,0,2203	110.0	103.0	105.0		2035,2650	3.2	0.0	12		105	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	IPO8	NM_001190995.1,NM_006390.3	101,101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	679/833,884/1038	30789961	1,13005	2203	4300	6503	SO:0001583	missense	0			U77494	CCDS8719.1, CCDS53773.1	12p11.21	2011-05-23	2003-03-11	2003-03-14	ENSG00000133704	ENSG00000133704		"""Importins"""	9853	protein-coding gene	gene with protein product		605600	"""RAN binding protein 8"""	RANBP8		9214382	Standard	NM_006390		Approved	IMP8	uc001rjd.3	O15397	OTTHUMG00000169172	ENST00000256079.4:c.2650C>T	12.37:g.30789961G>A	ENSP00000256079:p.Arg884Trp		B7Z7M3	Missense_Mutation	SNP	pfam_Importin-beta_N,pfam_Cse1,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.R884W	ENST00000256079.4	37	c.2650	CCDS8719.1	12	.	.	.	.	.	.	.	.	.	.	G	9.904	1.207689	0.22205	0.0	1.16E-4	ENSG00000133704	ENST00000256079;ENST00000545286;ENST00000544829	T;T	0.68025	-0.3;-0.3	5.06	3.22	0.36961	Armadillo-type fold (1);	0.335945	0.33382	N	0.004964	T	0.49983	0.1589	N	0.08118	0	0.32483	N	0.541247	D;D;P	0.63880	0.967;0.993;0.877	B;P;B	0.47376	0.289;0.545;0.121	T	0.62923	-0.6751	10	0.72032	D	0.01	-4.3399	10.3483	0.43920	0.0709:0.0:0.7943:0.1347	.	679;360;884	B7Z7M3;Q59F59;O15397	.;.;IPO8_HUMAN	W	884;360;679	ENSP00000256079:R884W;ENSP00000444520:R679W	ENSP00000256079:R884W	R	-	1	2	IPO8	30681228	0.965000	0.33210	0.010000	0.14722	0.011000	0.07611	1.573000	0.36472	0.640000	0.30582	-0.896000	0.02909	CGG	IPO8	-	superfamily_ARM-type_fold	ENSG00000133704		0.393	IPO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO8	HGNC	protein_coding	OTTHUMT00000402700.2	-	0.00	30	0	G	NM_006390		30789961	-1	tier1	-	no_errors	ENST00000256079	ensembl	human	known	74_37	missense	12.12	29	4	SNP	0.873	A
INHBC	3626	genome.wustl.edu	37	12	57843760	57843760	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:57843760G>T	ENST00000309668.2	+	2	1141	c.1014G>T	c.(1012-1014)aaG>aaT	p.K338N		NM_005538.2	NP_005529.1	P55103	INHBC_HUMAN	inhibin, beta C	338					growth (GO:0040007)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	transforming growth factor beta receptor binding (GO:0005160)			breast(2)|endometrium(1)|large_intestine(6)|liver(2)|lung(4)|prostate(1)	16						ACATTGTCAAGACTGACATAC	0.562																																																	0													76.0	79.0	78.0					12																	57843760		2203	4300	6503	SO:0001583	missense	0				CCDS8938.1	12q13	2008-02-05				ENSG00000175189			6068	protein-coding gene	gene with protein product		601233				7826378	Standard	NM_005538		Approved		uc001snv.1	P55103	OTTHUMG00000169994	ENST00000309668.2:c.1014G>T	12.37:g.57843760G>T	ENSP00000308716:p.Lys338Asn		A1L3Y2	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaC	p.K338N	ENST00000309668.2	37	c.1014	CCDS8938.1	12	.	.	.	.	.	.	.	.	.	.	G	19.18	3.776884	0.70107	.	.	ENSG00000175189	ENST00000309668	T	0.63580	-0.05	4.27	3.38	0.38709	Transforming growth factor-beta, C-terminal (3);	0.049552	0.85682	D	0.000000	T	0.78329	0.4266	M	0.82517	2.595	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80355	-0.1417	9	.	.	.	-22.9539	11.838	0.52338	0.0887:0.0:0.9113:0.0	.	338	P55103	INHBC_HUMAN	N	338	ENSP00000308716:K338N	.	K	+	3	2	INHBC	56130027	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.150000	0.50662	1.402000	0.46780	0.655000	0.94253	AAG	INHBC	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000175189		0.562	INHBC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBC	HGNC	protein_coding	OTTHUMT00000406770.1		0.00	40	0	G	NM_005538		57843760	+1			no_errors	ENST00000309668	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	T
ITGAL	3683	genome.wustl.edu	37	16	30522438	30522438	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:30522438A>T	ENST00000356798.6	+	24	2947	c.2767A>T	c.(2767-2769)Atc>Ttc	p.I923F	ITGAL_ENST00000358164.5_Missense_Mutation_p.I839F|ITGAL_ENST00000433423.2_Missense_Mutation_p.I157F	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	923					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	CCTGTACCCCATCAACATCCT	0.582																																					NSCLC(110;1462 1641 3311 33990 49495)												0													195.0	168.0	177.0					16																	30522438		2197	4300	6497	SO:0001583	missense	0				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.2767A>T	16.37:g.30522438A>T	ENSP00000349252:p.Ile923Phe		O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,prints_Integrin_alpha,pfscan_VWF_A	p.I923F	ENST00000356798.6	37	c.2767	CCDS32433.1	16	.	.	.	.	.	.	.	.	.	.	A	14.08	2.428276	0.43122	.	.	ENSG00000005844	ENST00000356798;ENST00000358164;ENST00000433423	T;T;T	0.46819	0.86;0.86;0.86	5.0	-2.18	0.07037	Integrin alpha-2 (1);	0.738090	0.12210	N	0.489428	T	0.55970	0.1954	L	0.54323	1.7	0.80722	D	1	D;D;D	0.62365	0.991;0.979;0.962	P;P;P	0.62491	0.903;0.791;0.794	T	0.60801	-0.7191	10	0.87932	D	0	.	10.4253	0.44373	0.4433:0.0:0.5567:0.0	.	157;839;923	B4E021;Q96HB1;P20701	.;.;ITAL_HUMAN	F	923;839;157	ENSP00000349252:I923F;ENSP00000350886:I839F;ENSP00000409377:I157F	ENSP00000349252:I923F	I	+	1	0	ITGAL	30429939	0.021000	0.18746	0.981000	0.43875	0.100000	0.18952	-0.435000	0.06931	-0.291000	0.09012	-0.375000	0.07067	ATC	ITGAL	-	pfam_Integrin_alpha-2	ENSG00000005844		0.582	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	HGNC	protein_coding	OTTHUMT00000434508.2	-	0.00	79	0	A			30522438	+1	tier1	-	no_errors	ENST00000356798	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.774	T
KCNH8	131096	genome.wustl.edu	37	3	19295323	19295323	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:19295323A>C	ENST00000328405.2	+	2	520	c.254A>C	c.(253-255)aAg>aCg	p.K85T		NM_144633.2	NP_653234.2	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 8	85	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(3)|lung(37)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	77						CAAATAGAAAAGTCACTGGAG	0.423																																					NSCLC(124;1625 1765 8018 24930 42026)												0													110.0	122.0	118.0					3																	19295323		2203	4300	6503	SO:0001583	missense	0			AY053503	CCDS2632.1	3p24.3	2012-07-05			ENSG00000183960	ENSG00000183960		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18864	protein-coding gene	gene with protein product		608260				16382104	Standard	NM_144633		Approved	Kv12.1, elk3	uc003cbk.1	Q96L42	OTTHUMG00000129891	ENST00000328405.2:c.254A>C	3.37:g.19295323A>C	ENSP00000328813:p.Lys85Thr		B7Z2I7|Q59GQ6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,superfamily_tRNA-bd_arm,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_EAG,tigrfam_PAS	p.K85T	ENST00000328405.2	37	c.254	CCDS2632.1	3	.	.	.	.	.	.	.	.	.	.	A	16.22	3.061746	0.55432	.	.	ENSG00000183960	ENST00000328405	D	0.99652	-6.3	5.48	4.32	0.51571	PAS fold-3 (1);PAS (1);	0.000000	0.32819	U	0.005603	D	0.98143	0.9387	L	0.33293	1	0.39817	D	0.972781	B;P	0.36837	0.026;0.571	B;B	0.42959	0.1;0.403	D	0.97079	0.9783	9	.	.	.	.	6.546	0.22406	0.7896:0.0:0.0731:0.1373	.	85;85	B7Z398;Q96L42	.;KCNH8_HUMAN	T	85	ENSP00000328813:K85T	.	K	+	2	0	KCNH8	19270327	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.854000	0.62918	0.905000	0.36596	-0.256000	0.11100	AAG	KCNH8	-	pfam_PAS_fold_3,pfam_PAS_4,pfam_PAS_fold,superfamily_PAS,tigrfam_PAS	ENSG00000183960		0.423	KCNH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH8	HGNC	protein_coding	OTTHUMT00000252139.2	-	0.00	43	0	A	NM_144633		19295323	+1	tier1	-	no_errors	ENST00000328405	ensembl	human	known	74_37	missense	32.14	19	9	SNP	1.000	C
KCNJ8	3764	genome.wustl.edu	37	12	21919003	21919003	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:21919003C>G	ENST00000240662.2	-	3	1274	c.929G>C	c.(928-930)cGa>cCa	p.R310P	RP11-59N23.1_ENST00000542489.1_RNA	NM_004982.3	NP_004973.1	Q15842	KCNJ8_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 8	310					defense response to virus (GO:0051607)|heart development (GO:0007507)|kidney development (GO:0001822)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to pH (GO:0009268)|synaptic transmission (GO:0007268)|vasodilation (GO:0042311)	ATP-sensitive potassium channel complex (GO:0008282)|mitochondrion (GO:0005739)|myofibril (GO:0030016)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Gliquidone(DB01251)|Glisoxepide(DB01289)|Glyburide(DB01016)|Levosimendan(DB00922)|Phenformin(DB00914)|Thiamylal(DB01154)|Yohimbine(DB01392)	GTAGGAGGTTCGTGCTTGTGT	0.483																																																	0													99.0	83.0	88.0					12																	21919003		2203	4300	6503	SO:0001583	missense	0			BC000544	CCDS8692.1	12p12.1	2011-07-05			ENSG00000121361	ENSG00000121361		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6269	protein-coding gene	gene with protein product		600935				8595887, 16382105	Standard	NM_004982		Approved	Kir6.1	uc001rff.4	Q15842	OTTHUMG00000169093	ENST00000240662.2:c.929G>C	12.37:g.21919003C>G	ENSP00000240662:p.Arg310Pro		O00657	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir6.1	p.R310P	ENST00000240662.2	37	c.929	CCDS8692.1	12	.	.	.	.	.	.	.	.	.	.	C	24.3	4.513973	0.85389	.	.	ENSG00000121361	ENST00000240662;ENST00000539350	D	0.94897	-3.55	5.35	5.35	0.76521	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.000000	0.85682	D	0.000000	D	0.98314	0.9441	H	0.95917	3.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99139	1.0855	10	0.87932	D	0	.	19.2644	0.93980	0.0:1.0:0.0:0.0	.	310	Q15842	IRK8_HUMAN	P	310	ENSP00000240662:R310P	ENSP00000240662:R310P	R	-	2	0	KCNJ8	21810270	1.000000	0.71417	0.840000	0.33206	0.998000	0.95712	7.638000	0.83328	2.782000	0.95742	0.563000	0.77884	CGA	KCNJ8	-	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir	ENSG00000121361		0.483	KCNJ8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ8	HGNC	protein_coding	OTTHUMT00000402226.1	-	0.00	50	0	C	NM_004982		21919003	-1	tier1	-	no_errors	ENST00000240662	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.997	G
KCNN1	3780	genome.wustl.edu	37	19	18099331	18099331	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:18099331G>T	ENST00000222249.9	+	7	1486	c.1167G>T	c.(1165-1167)aaG>aaT	p.K389N		NM_002248.3	NP_002239.2	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1	389	Calmodulin-binding. {ECO:0000250}.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|small conductance calcium-activated potassium channel activity (GO:0016286)			endometrium(1)|kidney(1)|lung(5)|urinary_tract(1)	8					Miconazole(DB01110)|Procaine(DB00721)	AGCTCACCAAGCGGGTGAGGA	0.617																																																	0													60.0	59.0	59.0					19																	18099331		2203	4299	6502	SO:0001583	missense	0			U69883	CCDS67611.1	19p13.1	2012-07-05				ENSG00000105642		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6290	protein-coding gene	gene with protein product		602982				8781233, 10516439, 16382103	Standard	NM_002248		Approved	KCa2.1, hSK1	uc002nht.3	Q92952		ENST00000222249.9:c.1167G>T	19.37:g.18099331G>T	ENSP00000476519:p.Lys389Asn		Q5KR10|Q6DJU4	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_2pore_dom_K_chnl_dom,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.K389N	ENST00000222249.9	37	c.1167		19	.	.	.	.	.	.	.	.	.	.	G	19.41	3.821965	0.71028	.	.	ENSG00000105642	ENST00000222249;ENST00000536713	.	.	.	4.76	4.76	0.60689	Calmodulin-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.75946	0.3919	M	0.80982	2.52	0.53688	D	0.999971	P	0.51351	0.944	P	0.57620	0.824	T	0.77440	-0.2587	9	0.40728	T	0.16	-32.1669	15.2768	0.73748	0.0:0.0:1.0:0.0	.	389	Q92952	KCNN1_HUMAN	N	406;389	.	ENSP00000222249:K406N	K	+	3	2	KCNN1	17960331	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.913000	0.63341	2.198000	0.70561	0.561000	0.74099	AAG	KCNN1	-	pfam_CaM-bd_dom,superfamily_CaM-bd_dom	ENSG00000105642		0.617	KCNN1-001	KNOWN	basic|appris_principal	protein_coding	KCNN1	HGNC	protein_coding	OTTHUMT00000471896.2	-	0.00	57	0	G	NM_002248		18099331	+1	tier1	-	no_errors	ENST00000222249	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
KCNT2	343450	genome.wustl.edu	37	1	196459008	196459008	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:196459008T>A	ENST00000294725.9	-	3	1150	c.235A>T	c.(235-237)Atc>Ttc	p.I79F	KCNT2_ENST00000609185.1_Missense_Mutation_p.I79F|KCNT2_ENST00000367431.4_Missense_Mutation_p.I79F|KCNT2_ENST00000451324.2_5'UTR|KCNT2_ENST00000367433.5_Missense_Mutation_p.I79F			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	79					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						AGTACTCGGATTATGTATAAT	0.303																																																	0													103.0	112.0	109.0					1																	196459008		2203	4292	6495	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.235A>T	1.37:g.196459008T>A	ENSP00000294725:p.Ile79Phe		Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_2pore_dom_K_chnl_dom	p.I79F	ENST00000294725.9	37	c.235	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.140930	0.37825	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.18960	2.18;2.19;2.45	5.35	5.35	0.76521	.	0.000000	0.64402	D	0.000009	T	0.13030	0.0316	N	0.19112	0.55	0.80722	D	1	B;B;B;B	0.14012	0.005;0.002;0.009;0.005	B;B;B;B	0.16289	0.006;0.005;0.015;0.006	T	0.09930	-1.0652	10	0.35671	T	0.21	-6.4588	8.2032	0.31436	0.0:0.0893:0.0:0.9107	.	79;79;79;79	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	F	79	ENSP00000356403:I79F;ENSP00000356401:I79F;ENSP00000294725:I79F	ENSP00000294725:I79F	I	-	1	0	KCNT2	194725631	0.971000	0.33674	1.000000	0.80357	0.997000	0.91878	0.464000	0.21988	2.154000	0.67381	0.533000	0.62120	ATC	KCNT2	-	NULL	ENSG00000162687		0.303	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	-	0.00	45	0	T	NM_198503		196459008	-1	tier1	-	no_errors	ENST00000294725	ensembl	human	known	74_37	missense	56.16	32	41	SNP	1.000	A
KIAA0319	9856	genome.wustl.edu	37	6	24570135	24570135	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:24570135C>T	ENST00000378214.3	-	12	2511	c.1987G>A	c.(1987-1989)Gtc>Atc	p.V663I	KIAA0319_ENST00000535378.1_Missense_Mutation_p.V654I|KIAA0319_ENST00000430948.2_Missense_Mutation_p.V618I|KIAA0319_ENST00000543707.1_Missense_Mutation_p.V663I|KIAA0319_ENST00000537886.1_Missense_Mutation_p.V663I	NM_001168375.1|NM_014809.3	NP_001161847.1|NP_055624.2	Q5VV43	K0319_HUMAN	KIAA0319	663	PKD 4. {ECO:0000255|PROSITE- ProRule:PRU00151}.				negative regulation of dendrite development (GO:2000171)|neuron migration (GO:0001764)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|endometrium(6)|kidney(3)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	53						GACTACCTGACGTGCTCCCAG	0.522																																																	0													112.0	100.0	104.0					6																	24570135		2203	4300	6503	SO:0001583	missense	0			AB002317	CCDS34348.1, CCDS54969.1, CCDS54970.1, CCDS54971.1, CCDS75409.1	6p22.3	2013-12-13			ENSG00000137261	ENSG00000137261			21580	protein-coding gene	gene with protein product	"""neuronal migration"""	609269				9205841, 15514892	Standard	NM_014809		Approved	NMIG	uc003neh.1	Q5VV43	OTTHUMG00000014358	ENST00000378214.3:c.1987G>A	6.37:g.24570135C>T	ENSP00000367459:p.Val663Ile		A7MD37|B2RTU7|B4DHA7|B4DK75|B7ZML3|F5H123|Q9UJC8|Q9Y4G7	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_MANSC_N,smart_Fibronectin_type3,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.V663I	ENST00000378214.3	37	c.1987	CCDS34348.1	6	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.723353	0.00700	.	.	ENSG00000137261	ENST00000537886;ENST00000535378;ENST00000430948;ENST00000378214;ENST00000543707	T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58	3.97	-2.58	0.06228	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD domain (1);	0.683951	0.12519	N	0.461844	T	0.01421	0.0046	N	0.05230	-0.09	0.09310	N	0.999999	B;B;B	0.16802	0.005;0.015;0.019	B;B;B	0.12156	0.006;0.004;0.007	T	0.46148	-0.9212	10	0.10111	T	0.7	.	11.6597	0.51339	0.0:0.1608:0.0:0.8392	.	663;654;663	F5H123;Q5VV43-2;Q5VV43	.;.;K0319_HUMAN	I	663;654;618;663;663	ENSP00000439700:V663I;ENSP00000442403:V654I;ENSP00000401086:V618I;ENSP00000367459:V663I;ENSP00000437656:V663I	ENSP00000367459:V663I	V	-	1	0	KIAA0319	24678114	0.001000	0.12720	0.021000	0.16686	0.229000	0.25112	-0.256000	0.08757	-0.598000	0.05806	-0.951000	0.02657	GTC	KIAA0319	-	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_Fibronectin_type3,smart_PKD/Chitinase_dom	ENSG00000137261		0.522	KIAA0319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319	HGNC	protein_coding	OTTHUMT00000040009.1	-	0.00	57	0	C	NM_014809		24570135	-1	tier1	-	no_errors	ENST00000378214	ensembl	human	known	74_37	missense	36.96	29	17	SNP	0.143	T
KIF1B	23095	genome.wustl.edu	37	1	10356961	10356961	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:10356961G>A	ENST00000377086.1	+	21	2070	c.1868G>A	c.(1867-1869)cGt>cAt	p.R623H	KIF1B_ENST00000263934.6_Missense_Mutation_p.R577H|KIF1B_ENST00000377093.4_Missense_Mutation_p.R577H|KIF1B_ENST00000377081.1_Missense_Mutation_p.R623H|KIF1B_ENST00000377083.1_Missense_Mutation_p.R577H|RNU6-37P_ENST00000362692.1_RNA			O60333	KIF1B_HUMAN	kinesin family member 1B	623					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CTAGGAAACCGTATCATCATG	0.413																																																	0													47.0	50.0	49.0					1																	10356961		2202	4300	6502	SO:0001583	missense	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.1868G>A	1.37:g.10356961G>A	ENSP00000366290:p.Arg623His		A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_P-loop_NTPase,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R577H	ENST00000377086.1	37	c.1730		1	.	.	.	.	.	.	.	.	.	.	G	33	5.234510	0.95207	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377093;ENST00000377086;ENST00000377083;ENST00000377081	T;T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19;-1.19	6.03	6.03	0.97812	Forkhead-associated (FHA) domain (2);SMAD/FHA domain (1);	0.167757	0.51477	D	0.000094	D	0.91613	0.7350	M	0.92604	3.325	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D	0.87578	0.993;0.988;0.998;0.993;0.998;0.957;0.996	D	0.92468	0.5983	10	0.87932	D	0	.	20.5666	0.99351	0.0:0.0:1.0:0.0	.	609;583;623;597;623;577;577	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2;O60333-3	.;.;.;.;KIF1B_HUMAN;.;.	H	623;577;577;623;577;623	ENSP00000263934:R577H;ENSP00000366297:R577H;ENSP00000366290:R623H;ENSP00000366287:R577H;ENSP00000366284:R623H	ENSP00000263934:R577H	R	+	2	0	KIF1B	10279548	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.854000	0.98071	0.655000	0.94253	CGT	KIF1B	-	pfam_FHA_dom,superfamily_SMAD_FHA_domain	ENSG00000054523		0.413	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1		0.00	40	0	G			10356961	+1			no_errors	ENST00000263934	ensembl	human	known	74_37	missense	6.67	28	2	SNP	1.000	A
KIF23	9493	genome.wustl.edu	37	15	69732685	69732685	+	Silent	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr15:69732685T>C	ENST00000260363.4	+	17	2043	c.1926T>C	c.(1924-1926)aaT>aaC	p.N642N	KIF23_ENST00000395392.2_Silent_p.N642N|KIF23_ENST00000537891.1_Silent_p.N459N|KIF23_ENST00000559279.1_Silent_p.N642N|KIF23_ENST00000352331.4_Silent_p.N642N|KIF23_ENST00000558585.1_Silent_p.N459N	NM_138555.2	NP_612565.1	Q02241	KIF23_HUMAN	kinesin family member 23	642					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytokinesis (GO:0000910)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle elongation (GO:0000022)|positive regulation of cytokinesis (GO:0032467)|spindle midzone assembly involved in mitosis (GO:0051256)	centralspindlin complex (GO:0097149)|centrosome (GO:0005813)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|intercellular bridge (GO:0045171)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			central_nervous_system(1)|endometrium(4)|large_intestine(7)|lung(6)|prostate(2)|skin(1)	21						AGATGCAGAATAAACTCTGGG	0.448																																																	0													76.0	76.0	76.0					15																	69732685		2199	4298	6497	SO:0001819	synonymous_variant	0			X67155	CCDS32278.1, CCDS32279.1	15q23	2008-03-03	2003-01-13	2003-01-17		ENSG00000137807		"""Kinesins"""	6392	protein-coding gene	gene with protein product		605064	"""kinesin-like 5 (mitotic kinesin-like protein 1)"""	KNSL5		1406973	Standard	NM_138555		Approved	MKLP1, MKLP-1	uc002asb.3	Q02241		ENST00000260363.4:c.1926T>C	15.37:g.69732685T>C			Q8WVP0	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.N642	ENST00000260363.4	37	c.1926	CCDS32278.1	15																																																																																			KIF23	-	NULL	ENSG00000137807		0.448	KIF23-201	KNOWN	basic|CCDS	protein_coding	KIF23	HGNC	protein_coding			0.00	22	0	T			69732685	+1			no_errors	ENST00000260363	ensembl	human	known	74_37	silent	10.00	18	2	SNP	1.000	C
KIF6	221458	genome.wustl.edu	37	6	39693059	39693059	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:39693059C>T	ENST00000287152.7	-	1	122	c.28G>A	c.(28-30)Gcg>Acg	p.A10T	KIF6_ENST00000373216.3_Missense_Mutation_p.A10T|KIF6_ENST00000538893.1_Missense_Mutation_p.A10T|KIF6_ENST00000373215.3_Missense_Mutation_p.A10T	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	10	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TTCACCCTCGCGAATATCTGG	0.667																																																	0													171.0	182.0	178.0					6																	39693059		2203	4300	6503	SO:0001583	missense	0			AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.28G>A	6.37:g.39693059C>T	ENSP00000287152:p.Ala10Thr		Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A10T	ENST00000287152.7	37	c.28	CCDS4844.1	6	.	.	.	.	.	.	.	.	.	.	C	26.5	4.742385	0.89573	.	.	ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373215;ENST00000538893	T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73	4.75	4.75	0.60458	Kinesin, motor domain (3);	.	.	.	.	T	0.70885	0.3275	L	0.54323	1.7	0.80722	D	1	D;D;D	0.71674	0.993;0.994;0.998	P;P;P	0.54346	0.749;0.746;0.739	T	0.74785	-0.3547	9	0.72032	D	0.01	.	16.051	0.80763	0.0:1.0:0.0:0.0	.	10;10;10	E7EUN7;F6VGH2;Q6ZMV9	.;.;KIF6_HUMAN	T	10	ENSP00000287152:A10T;ENSP00000362312:A10T;ENSP00000362311:A10T;ENSP00000441435:A10T	ENSP00000287152:A10T	A	-	1	0	KIF6	39801037	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.421000	0.59848	2.623000	0.88846	0.655000	0.94253	GCG	KIF6	-	superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000164627		0.667	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF6	HGNC	protein_coding	OTTHUMT00000040455.2	-	0.00	57	0	C	NM_145027		39693059	-1	tier1	-	no_errors	ENST00000287152	ensembl	human	known	74_37	missense	16.28	36	7	SNP	1.000	T
KIT	3815	genome.wustl.edu	37	4	55594207	55594207	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:55594207T>C	ENST00000288135.5	+	13	2007	c.1910T>C	c.(1909-1911)cTc>cCc	p.L637P		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	637	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CGGGAAGCCCTCATGTCTGAA	0.453		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0													139.0	127.0	131.0					4																	55594207		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1910T>C	4.37:g.55594207T>C	ENSP00000288135:p.Leu637Pro		B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.L637P	ENST00000288135.5	37	c.1910	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	T	21.6	4.174152	0.78452	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.85339	-1.97;-1.97	6.06	6.06	0.98353	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.48767	D	0.000173	D	0.93400	0.7895	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.94277	0.7516	10	0.87932	D	0	.	16.6093	0.84858	0.0:0.0:0.0:1.0	.	144;633;637	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	P	637;633	ENSP00000288135:L637P;ENSP00000390987:L633P	ENSP00000288135:L637P	L	+	2	0	KIT	55288964	1.000000	0.71417	0.983000	0.44433	0.651000	0.38670	7.963000	0.87922	2.324000	0.78689	0.533000	0.62120	CTC	KIT	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	ENSG00000157404		0.453	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	-	0.00	60	0	T			55594207	+1	tier1	-	no_errors	ENST00000288135	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	C
KLHL34	257240	genome.wustl.edu	37	X	21674920	21674922	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	CTC	CTC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:21674920_21674922delCTC	ENST00000379499.2	-	1	1526_1528	c.985_987delGAG	c.(985-987)gagdel	p.E329del		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	329	Glu-rich.					extracellular space (GO:0005615)				cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						TGAGCTCCCActcctcctcctcc	0.65														17	0.00450331	0.0061	0.0	3775	,	,		12349	0.006		0.0	False		,,,				2504	0.0031																0										3,72,3595		0,0,3,0,6,40,20,1530,492						4.9	1.0			25	6,150,6231		0,0,3,3,3,93,51,2244,1647	no	codingComplex	KLHL34	NM_153270.1		0,0,6,3,9,133,71,3774,2139	A1A1,A1A2,A1R,A1,A2A2,A2R,A2,RR,R		2.4425,2.0436,2.2969				9,222,9826				SO:0001651	inframe_deletion	0			AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.985_987delGAG	X.37:g.21674929_21674931delCTC	ENSP00000368813:p.Glu329del			In_Frame_Del	DEL	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.E329in_frame_del	ENST00000379499.2	37	c.987_985	CCDS14199.1	X																																																																																			KLHL34	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000185915		0.650	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL34	HGNC	protein_coding	OTTHUMT00000056022.1		0.00	12	0	CTC	NM_153270		21674922	-1			no_errors	ENST00000379499	ensembl	human	known	74_37	in_frame_del	33.33	4	2	DEL	0.870:0.875:0.865	0
KRTAP2-3	730755	genome.wustl.edu	37	17	39216158	39216158	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:39216158G>A	ENST00000391418.2	-	1	186	c.145C>T	c.(145-147)Cgc>Tgc	p.R49C		NM_001165252.1	NP_001158724.1	P0C7H8	KRA23_HUMAN	keratin associated protein 2-3	49	10 X 5 AA repeats of C-C-[CDPQRWG]- [APRS]-[CIPSTVD].					keratin filament (GO:0045095)											CGCGTGCAGCGGGGCACGCAG	0.761																																																	0													1.0	1.0	1.0					17																	39216158		281	877	1158	SO:0001583	missense	0			BC012486	CCDS54123.1	17q21.2	2012-08-03			ENSG00000212724	ENSG00000212724		"""Keratin associated proteins"""	18906	protein-coding gene	gene with protein product							Standard	NM_001165252		Approved	KAP2.3	uc002hvx.3	P0C7H8	OTTHUMG00000133655	ENST00000391418.2:c.145C>T	17.37:g.39216158G>A	ENSP00000375237:p.Arg49Cys			Missense_Mutation	SNP	pfam_Keratin-assoc	p.R49C	ENST00000391418.2	37	c.145	CCDS54123.1	17	.	.	.	.	.	.	.	.	.	.	.	17.90	3.501518	0.64298	.	.	ENSG00000212724	ENST00000391418	T	0.32515	1.45	5.63	4.58	0.56647	.	1.389680	0.05259	U	0.515458	T	0.28995	0.0720	.	.	.	0.33412	D	0.578704	B	0.22851	0.076	B	0.15870	0.014	T	0.09465	-1.0673	9	0.52906	T	0.07	.	12.5703	0.56332	0.0:0.0:0.823:0.177	.	49	Q9BYR9	KRA24_HUMAN	C	49	ENSP00000375237:R49C	ENSP00000375237:R49C	R	-	1	0	KRTAP2-3	36469684	0.994000	0.37717	1.000000	0.80357	0.991000	0.79684	1.204000	0.32296	2.672000	0.90937	0.556000	0.70494	CGC	KRTAP2-3	-	pfam_Keratin-assoc	ENSG00000212724		0.761	KRTAP2-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP2-3	HGNC	protein_coding	OTTHUMT00000257692.1	-	0.00	62	0	G	NM_001165252		39216158	-1	tier1	-	no_errors	ENST00000391418	ensembl	human	known	74_37	missense	20.00	36	9	SNP	0.997	A
LARS	51520	genome.wustl.edu	37	5	145508678	145508678	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:145508678C>G	ENST00000394434.2	-	26	2798	c.2632G>C	c.(2632-2634)Gac>Cac	p.D878H	LARS_ENST00000274562.9_Missense_Mutation_p.D851H|LARS_ENST00000510191.1_Missense_Mutation_p.D824H|LARS_ENST00000545646.1_Missense_Mutation_p.D832H	NM_020117.9	NP_064502.9	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	878					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|skin(2)|stomach(8)	34			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	ATAATTGAGTCAGGCTTTTAA	0.338																																																	0													69.0	74.0	73.0					5																	145508678		2203	4298	6501	SO:0001583	missense	0			AF151026	CCDS34265.1	5q32	2012-10-02			ENSG00000133706	ENSG00000133706	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	6512	protein-coding gene	gene with protein product	"""leucine tRNA ligase 1, cytoplasmic"""	151350				6933703	Standard	NM_020117		Approved	HSPC192, FLJ10595, FLJ21788, LARS1, LEUS, RNTLS	uc003lnx.1	Q9P2J5	OTTHUMG00000163429	ENST00000394434.2:c.2632G>C	5.37:g.145508678C>G	ENSP00000377954:p.Asp878His		A2RRR4|A7E266|B4DJ10|Q2TU79|Q9NSE1	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Cys-tRNA/MSH_ligase,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Val/Leu/Ile-tRNA-synth_edit,tigrfam_Leu-tRNA-synth_Ia_arc/euk	p.D878H	ENST00000394434.2	37	c.2632	CCDS34265.1	5	.	.	.	.	.	.	.	.	.	.	C	4.933	0.173286	0.09391	.	.	ENSG00000133706	ENST00000394434;ENST00000545646;ENST00000540713;ENST00000510191;ENST00000274562	T;T;T;T	0.14640	2.49;2.49;2.49;2.49	5.73	3.0	0.34707	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (1);Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.494236	0.26126	N	0.026199	T	0.19485	0.0468	L	0.45470	1.425	0.09310	N	0.999997	B;B;B	0.26876	0.162;0.0;0.0	B;B;B	0.43123	0.409;0.004;0.0	T	0.25222	-1.0138	10	0.72032	D	0.01	-22.2189	8.7792	0.34781	0.0:0.7316:0.1321:0.1363	.	851;832;878	B4DER1;F5H698;Q9P2J5	.;.;SYLC_HUMAN	H	878;832;187;824;851	ENSP00000377954:D878H;ENSP00000437791:D832H;ENSP00000426005:D824H;ENSP00000274562:D851H	ENSP00000274562:D851H	D	-	1	0	LARS	145488871	0.003000	0.15002	0.045000	0.18777	0.328000	0.28507	0.736000	0.26130	0.779000	0.33543	-0.137000	0.14449	GAC	LARS	-	pfam_V/L/I-tRNA-synth_anticodon-bd,superfamily_tRNAsynth_1a_anticodon-bd,tigrfam_Leu-tRNA-synth_Ia_arc/euk	ENSG00000133706		0.338	LARS-001	KNOWN	basic|CCDS	protein_coding	LARS	HGNC	protein_coding	OTTHUMT00000373367.1		0.00	109	0	C	NM_020117		145508678	-1			no_errors	ENST00000394434	ensembl	human	known	74_37	missense	5.88	48	3	SNP	0.041	G
LINC00577	100113403	genome.wustl.edu	37	6	105388266	105388266	+	lincRNA	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:105388266A>G	ENST00000369123.3	-	0	136					NR_046407.1				long intergenic non-protein coding RNA 577																		GCGCGCGGAGAGCCGGGAGTC	0.711																																																	0																																												0			AW612153, BF223582		6q21	2012-10-12	2012-03-01	2012-03-01	ENSG00000203809	ENSG00000203809		"""Long non-coding RNAs"""	21553	non-coding RNA	RNA, long non-coding			"""chromosome 6 open reading frame 220"""	C6orf220			Standard	NR_046407		Approved	dJ439I14.1	uc031spf.1		OTTHUMG00000015289		6.37:g.105388266A>G				RNA	SNP	-	NULL	ENST00000369123.3	37	NULL		6	.	.	.	.	.	.	.	.	.	.	A	8.138	0.784526	0.16189	.	.	ENSG00000203809	ENST00000369123	.	.	.	2.17	-2.18	0.07037	.	.	.	.	.	T	0.19765	0.0475	.	.	.	.	.	.	.	.	.	.	.	.	T	0.27400	-1.0075	4	0.87932	D	0	.	4.3639	0.11215	0.2331:0.1875:0.5794:0.0	.	.	.	.	P	46	.	ENSP00000358119:L46P	L	-	2	0	C6orf220	105494959	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.207000	0.03008	-0.505000	0.06568	0.383000	0.25322	CTC	LINC00577	-	-	ENSG00000203809		0.711	LINC00577-001	KNOWN	basic	lincRNA	LINC00577	HGNC	lincRNA	OTTHUMT00000041645.2	-	0.00	35	0	A			105388266	-1	tier1	-	no_errors	ENST00000369123	ensembl	human	known	74_37	rna	12.90	27	4	SNP	0.000	G
LINC00937	389634	genome.wustl.edu	37	12	8543176	8543176	+	lincRNA	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:8543176G>T	ENST00000544461.1	-	0	770									long intergenic non-protein coding RNA 937																		CGCGGGCTCGGTGGGTCCGCG	0.786																																																	0																																												0			BC073935		12p13.31	2013-05-30			ENSG00000226091	ENSG00000226091		"""Long non-coding RNAs"""	48629	non-coding RNA	RNA, long non-coding							Standard	NR_024420		Approved				OTTHUMG00000168663		12.37:g.8543176G>T				RNA	SNP	-	NULL	ENST00000544461.1	37	NULL		12																																																																																			LINC00937	-	-	ENSG00000226091		0.786	LINC00937-001	KNOWN	basic	lincRNA	LINC00937	HGNC	lincRNA	OTTHUMT00000400511.1		0.00	14	0	G			8543176	-1			no_errors	ENST00000420040	ensembl	human	known	74_37	rna	44.44	5	4	SNP	0.992	T
LINC01010	154092	genome.wustl.edu	37	6	134758988	134758988	+	lincRNA	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:134758988A>G	ENST00000431422.1	+	0	135				RP11-557H15.3_ENST00000417483.1_lincRNA	NR_038217.1|NR_038218.1				long intergenic non-protein coding RNA 1010																		CCTACTAAGAATCCTGCCATT	0.353																																																	0																																												0					6q23.2	2013-07-24			ENSG00000236700	ENSG00000236700		"""Long non-coding RNAs"""	48978	non-coding RNA	RNA, long non-coding							Standard	NR_038216		Approved				OTTHUMG00000015616		6.37:g.134758988A>G				RNA	SNP	-	NULL	ENST00000431422.1	37	NULL		6																																																																																			LINC01010	-	-	ENSG00000236700		0.353	LINC01010-001	KNOWN	basic	lincRNA	LINC01010	HGNC	lincRNA	OTTHUMT00000042322.1	-	0.00	52	0	A			134758988	+1	tier1	-	no_errors	ENST00000431422	ensembl	human	known	74_37	rna	23.53	39	12	SNP	0.002	G
LMBR1L	55716	genome.wustl.edu	37	12	49504487	49504488	+	5'UTR	INS	-	-	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:49504487_49504488insA	ENST00000267102.8	-	0	193_194				LMBR1L_ENST00000553204.1_5'Flank|LMBR1L_ENST00000547382.1_5'UTR	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like						endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GGGGCTCAGATACAGTCGTCCG	0.653											OREG0021784	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001623	5_prime_UTR_variant	0			AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.-150->T	12.37:g.49504488_49504488dupA		962	Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	RNA	INS	-	NULL	ENST00000267102.8	37	NULL	CCDS8780.2	12																																																																																			LMBR1L	-	-	ENSG00000139636		0.653	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBR1L	HGNC	protein_coding	OTTHUMT00000318696.1		0.00	26	0	-	NM_018113		49504488	-1	tier1		no_errors	ENST00000548983	ensembl	human	known	74_37	rna	38.46	8	5	INS	0.000:0.001	A
LMOD1	25802	genome.wustl.edu	37	1	201869875	201869875	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:201869875C>T	ENST00000367288.4	-	2	512	c.266G>A	c.(265-267)aGc>aAc	p.S89N	RP11-307B6.3_ENST00000458139.1_RNA|RP11-307B6.3_ENST00000414927.1_RNA	NM_012134.2	NP_036266.2	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	89					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						CACTTGCTTGCTTTCCTAAGA	0.502																																																	0													39.0	39.0	39.0					1																	201869875		1870	4102	5972	SO:0001583	missense	0			X54162	CCDS53457.1	1q32.1	2008-05-22			ENSG00000163431	ENSG00000163431			6647	protein-coding gene	gene with protein product		602715					Standard	NM_012134		Approved	64kD, D1, 1D	uc021phl.1	P29536	OTTHUMG00000035802	ENST00000367288.4:c.266G>A	1.37:g.201869875C>T	ENSP00000356257:p.Ser89Asn		B1APV6|C4AMB1|Q68EN2	Missense_Mutation	SNP	pfam_Tropomodulin,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.S89N	ENST00000367288.4	37	c.266	CCDS53457.1	1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.458435	0.43634	.	.	ENSG00000163431	ENST00000367288;ENST00000400965;ENST00000412469	T	0.12672	2.66	5.77	3.9	0.45041	.	0.287586	0.25009	N	0.033851	T	0.16300	0.0392	L	0.55481	1.735	0.24650	N	0.993528	P;P	0.43231	0.801;0.801	B;B	0.43413	0.419;0.419	T	0.05886	-1.0858	10	0.31617	T	0.26	-27.8988	11.0002	0.47600	0.0:0.8467:0.0:0.1533	.	89;89	B4E3S9;P29536	.;LMOD1_HUMAN	N	89	ENSP00000356257:S89N	ENSP00000356257:S89N	S	-	2	0	LMOD1	200136498	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.091000	0.30915	0.781000	0.33589	0.655000	0.94253	AGC	LMOD1	-	NULL	ENSG00000163431		0.502	LMOD1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	LMOD1	HGNC	protein_coding	OTTHUMT00000087085.2	-	0.00	51	0	C			201869875	-1	tier1	-	no_errors	ENST00000367288	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	T
LOC100128164	100128164	genome.wustl.edu	37	3	169663070	169663070	+	RNA	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:169663070A>G	ENST00000487580.1	-	0	263				RP11-379K17.4_ENST00000483289.2_RNA																							CACTCAGAAAACATGCCACAT	0.393																																																	0																																												0																															3.37:g.169663070A>G				RNA	SNP	-	NULL	ENST00000487580.1	37	NULL		3																																																																																			RP11-379K17.4	-	-	ENSG00000239219		0.393	RP11-379K17.4-003	KNOWN	basic|exp_conf	antisense	LOC100128164	Clone_based_vega_gene	antisense	OTTHUMT00000351957.1	-	0.00	25	0	A			169663070	-1	tier1	-	no_errors	ENST00000483289	ensembl	human	known	74_37	rna	26.32	14	5	SNP	0.047	G
POTEM	641455	genome.wustl.edu	37	14	20010412	20010412	+	Intron	SNP	G	G	A	rs200791687		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr14:20010412G>A	ENST00000551509.1	-	5	969				RNU6-1268P_ENST00000391214.1_RNA|RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						CACCAAGGTTGAAAGGAAGGG	0.368																																																	0																																										SO:0001627	intron_variant	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.918-172C>T	14.37:g.20010412G>A				RNA	SNP	-	NULL	ENST00000551509.1	37	NULL	CCDS45076.1	14																																																																																			RP11-244H18.1	-	-	ENSG00000258276		0.368	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LOC100508046	Clone_based_vega_gene	protein_coding	OTTHUMT00000409490.3	-	0.00	25	0	G	NM_001145442		20010412	+1	tier1	rs200791687	no_errors	ENST00000547584	ensembl	human	known	74_37	rna	31.58	13	6	SNP	0.046	A
POTEM	641455	genome.wustl.edu	37	14	20010484	20010484	+	Intron	SNP	A	A	G	rs201730464		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr14:20010484A>G	ENST00000551509.1	-	5	969				RNU6-1268P_ENST00000391214.1_RNA|RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						CTACTAATTTAAAGTCCTTTG	0.353																																																	0																																										SO:0001627	intron_variant	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.918-244T>C	14.37:g.20010484A>G				RNA	SNP	-	NULL	ENST00000551509.1	37	NULL	CCDS45076.1	14																																																																																			RP11-244H18.1	-	-	ENSG00000258276		0.353	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LOC100508046	Clone_based_vega_gene	protein_coding	OTTHUMT00000409490.3	-	0.00	17	0	A	NM_001145442		20010484	+1	tier1	rs201730464	no_errors	ENST00000547584	ensembl	human	known	74_37	rna	41.67	7	5	SNP	0.325	G
BAALC	79870	genome.wustl.edu	37	8	104178455	104178455	+	Intron	SNP	T	T	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:104178455T>G	ENST00000297574.6	+	1	299				RP11-318M2.2_ENST00000521102.1_RNA|RP11-318M2.2_ENST00000500902.1_RNA|BAALC_ENST00000309982.5_Intron|RP11-318M2.2_ENST00000499522.2_RNA|BAALC_ENST00000306391.6_Intron|BAALC_ENST00000438105.2_Intron|BAALC_ENST00000330955.5_Intron			Q8WXS3	BAALC_HUMAN	brain and acute leukemia, cytoplasmic							cytoplasm (GO:0005737)|membrane (GO:0016020)				kidney(1)|large_intestine(3)|lung(3)	7			OV - Ovarian serous cystadenocarcinoma(57;3.49e-05)|STAD - Stomach adenocarcinoma(118;0.133)			AGTCATTCACTTCTGTAACCT	0.443																																																	0																																										SO:0001627	intron_variant	0			AF363578	CCDS6297.1, CCDS47906.1	8q22.3	2008-07-29			ENSG00000164929	ENSG00000164929			14333	protein-coding gene	gene with protein product		606602				11707601	Standard	NM_024812		Approved		uc003yld.3	Q8WXS3	OTTHUMG00000164782	ENST00000297574.6:c.160+25170T>G	8.37:g.104178455T>G			Q8WTP6|Q8WXS0|Q8WXS1|Q8WXS2|Q9HA93	RNA	SNP	-	NULL	ENST00000297574.6	37	NULL		8																																																																																			RP11-318M2.2	-	-	ENSG00000247081		0.443	BAALC-003	KNOWN	basic	protein_coding	LOC101927343	Clone_based_vega_gene	protein_coding	OTTHUMT00000380257.1	-	0.00	84	0	T			104178455	-1	tier1	-	no_errors	ENST00000499522	ensembl	human	known	74_37	rna	36.54	33	19	SNP	0.000	G
LPA	4018	genome.wustl.edu	37	6	161007564	161007564	+	Missense_Mutation	SNP	G	G	A	rs201200716		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:161007564G>A	ENST00000316300.5	-	25	4090	c.4046C>T	c.(4045-4047)aCg>aTg	p.T1349M	LPA_ENST00000447678.1_Missense_Mutation_p.T1349M			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3857	Kringle 12. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TGGACATTGCGTCAGGTTGCA	0.522																																																	0													134.0	135.0	135.0					6																	161007564		2168	4284	6452	SO:0001583	missense	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.4046C>T	6.37:g.161007564G>A	ENSP00000321334:p.Thr1349Met		Q5VTD7|Q9UD88	Missense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1,prints_Peptidase_S1A,pfscan_Kringle,pfscan_Peptidase_S1	p.T1349M	ENST00000316300.5	37	c.4046	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	g	13.44	2.236416	0.39498	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	T;T	0.62941	-0.01;-0.01	2.39	-4.03	0.04021	Kringle (4);Kringle-like fold (1);	.	.	.	.	T	0.50463	0.1617	L	0.46670	1.46	0.09310	N	0.999999	D	0.71674	0.998	D	0.79784	0.993	T	0.46020	-0.9221	9	0.54805	T	0.06	.	5.0802	0.14653	0.0:0.1932:0.2003:0.6065	.	3857	P08519	APOA_HUMAN	M	1349	ENSP00000321334:T1349M;ENSP00000395608:T1349M	ENSP00000321334:T1349M	T	-	2	0	LPA	160927554	0.002000	0.14202	0.316000	0.25252	0.413000	0.31143	-0.365000	0.07573	-1.024000	0.03338	0.436000	0.28706	ACG	LPA	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000198670		0.522	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1	-	0.00	90	0	G	NM_005577		161007564	-1	tier1	rs201200716	no_errors	ENST00000316300	ensembl	human	known	74_37	missense	37.18	49	29	SNP	0.337	A
LRCH1	23143	genome.wustl.edu	37	13	47263314	47263314	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr13:47263314C>T	ENST00000389798.3	+	7	1194	c.997C>T	c.(997-999)Cga>Tga	p.R333*	LRCH1_ENST00000311191.6_Nonsense_Mutation_p.R333*|LRCH1_ENST00000389797.3_Nonsense_Mutation_p.R333*	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	333										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		TGGAGATAAGCGATTATCTGC	0.358																																																	0													161.0	158.0	159.0					13																	47263314		2203	4300	6503	SO:0001587	stop_gained	0			AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.997C>T	13.37:g.47263314C>T	ENSP00000374448:p.Arg333*		B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.R333*	ENST00000389798.3	37	c.997	CCDS31972.1	13	.	.	.	.	.	.	.	.	.	.	C	37	6.051979	0.97236	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797;ENST00000463929	.	.	.	5.58	4.73	0.59995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.249	14.9294	0.70903	0.144:0.856:0.0:0.0	.	.	.	.	X	333;333;333;79	.	ENSP00000308493:R333X	R	+	1	2	LRCH1	46161315	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.248000	0.43160	1.340000	0.45581	-0.182000	0.12963	CGA	LRCH1	-	NULL	ENSG00000136141		0.358	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRCH1	HGNC	protein_coding	OTTHUMT00000044824.2	-	0.00	84	0	C	NM_015116		47263314	+1	tier1	-	no_errors	ENST00000389798	ensembl	human	known	74_37	nonsense	7.02	53	4	SNP	1.000	T
LRRC28	123355	genome.wustl.edu	37	15	99892671	99892671	+	Silent	SNP	C	C	T	rs144217679		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr15:99892671C>T	ENST00000301981.3	+	7	930	c.690C>T	c.(688-690)tgC>tgT	p.C230C	LRRC28_ENST00000331450.5_Intron|LRRC28_ENST00000422500.2_Silent_p.C161C|LRRC28_ENST00000447360.2_Silent_p.C230C|LRRC28_ENST00000442993.2_3'UTR|LRRC28_ENST00000558879.1_Intron	NM_144598.2	NP_653199.2	Q86X40	LRC28_HUMAN	leucine rich repeat containing 28	230										endometrium(2)|large_intestine(3)|lung(6)|prostate(1)	12	Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00778)|Medulloblastoma(229;0.163)		OV - Ovarian serous cystadenocarcinoma(32;0.00106)			TCATCGGGTGCAGTGGGTAAG	0.378																																																	0								C		0,4394		0,0,2197	129.0	114.0	119.0		690	3.8	1.0	15	dbSNP_134	119	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	LRRC28	NM_144598.2		0,1,6493	TT,TC,CC		0.0116,0.0,0.0077		230/368	99892671	1,12987	2197	4297	6494	SO:0001819	synonymous_variant	0			AK091588	CCDS10380.1, CCDS66873.1	15q26.3	2004-06-29			ENSG00000168904	ENSG00000168904			28355	protein-coding gene	gene with protein product						12975309	Standard	XM_005254861		Approved	MGC24976, FLJ34269, FLJ45242	uc002bva.1	Q86X40	OTTHUMG00000149854	ENST00000301981.3:c.690C>T	15.37:g.99892671C>T			A8KA22|Q6UY49|Q6ZSS6	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.C230	ENST00000301981.3	37	c.690	CCDS10380.1	15																																																																																			LRRC28	-	NULL	ENSG00000168904		0.378	LRRC28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC28	HGNC	protein_coding	OTTHUMT00000313546.1	-	0.00	61	0	C	NM_144598		99892671	+1	tier1	rs144217679	no_errors	ENST00000301981	ensembl	human	known	74_37	silent	7.02	53	4	SNP	1.000	T
LRRK1	79705	genome.wustl.edu	37	15	101608956	101608956	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr15:101608956C>T	ENST00000388948.3	+	34	6310	c.5951C>T	c.(5950-5952)gCc>gTc	p.A1984V	LRRK1_ENST00000284395.5_Missense_Mutation_p.A1981V|LRRK1_ENST00000532145.1_3'UTR|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TGGTGCCTGGCCGTCTGGAGG	0.582																																																	0													79.0	94.0	89.0					15																	101608956		2049	4185	6234	SO:0001583	missense	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.5951C>T	15.37:g.101608956C>T	ENSP00000373600:p.Ala1984Val			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Leu-rich_rpt,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_Ankyrin_rpt-contain_dom,superfamily_WD40_repeat_dom,smart_Ankyrin_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom	p.A1984V	ENST00000388948.3	37	c.5951	CCDS42086.1	15	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995176	0.74703	.	.	ENSG00000154237	ENST00000388948;ENST00000284395	T;T	0.76709	-1.0;-1.04	5.83	4.9	0.64082	.	0.257798	0.38111	N	0.001818	T	0.72684	0.3491	L	0.56769	1.78	0.33186	D	0.550269	P	0.35507	0.506	B	0.24155	0.051	T	0.80734	-0.1250	10	0.66056	D	0.02	.	16.8272	0.85934	0.0:0.8713:0.1287:0.0	.	1984	Q38SD2	LRRK1_HUMAN	V	1984;1981	ENSP00000373600:A1984V;ENSP00000284395:A1981V	ENSP00000284395:A1981V	A	+	2	0	LRRK1	99426479	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.833000	0.55790	1.421000	0.47157	0.655000	0.94253	GCC	LRRK1	-	NULL	ENSG00000154237		0.582	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	-	0.00	61	0	C	NM_024652		101608956	+1	tier1	-	no_errors	ENST00000388948	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
LRTM1	57408	genome.wustl.edu	37	3	54958682	54958682	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:54958682C>T	ENST00000273286.5	-	2	730	c.568G>A	c.(568-570)Ggt>Agt	p.G190S	CACNA2D3_ENST00000415676.2_Intron|CACNA2D3_ENST00000288197.5_Intron|CACNA2D3_ENST00000490478.1_Intron|LRTM1_ENST00000493075.1_Missense_Mutation_p.G114S|CACNA2D3_ENST00000474759.1_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	190	LRRCT.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		AGTTTAAGACCGAGCAAGTGG	0.478																																																	0													88.0	94.0	92.0					3																	54958682		2203	4300	6503	SO:0001583	missense	0			AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.568G>A	3.37:g.54958682C>T	ENSP00000273286:p.Gly190Ser		Q8IUU2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.G190S	ENST00000273286.5	37	c.568	CCDS2876.1	3	.	.	.	.	.	.	.	.	.	.	C	11.73	1.727109	0.30593	.	.	ENSG00000144771	ENST00000273286;ENST00000493075	T;D	0.89875	4.27;-2.58	5.96	2.02	0.26589	Cysteine-rich flanking region, C-terminal (1);	0.203510	0.52532	N	0.000065	T	0.73923	0.3649	N	0.19112	0.55	0.47778	D	0.999517	P	0.38827	0.649	B	0.26416	0.069	T	0.65421	-0.6172	10	0.17369	T	0.5	.	10.2141	0.43158	0.0:0.7357:0.0:0.2643	.	190	Q9HBL6	LRTM1_HUMAN	S	190;114	ENSP00000273286:G190S;ENSP00000419772:G114S	ENSP00000273286:G190S	G	-	1	0	LRTM1	54933722	0.972000	0.33761	0.135000	0.22099	0.528000	0.34623	2.387000	0.44389	0.074000	0.16767	-0.140000	0.14226	GGT	LRTM1	-	smart_Cys-rich_flank_reg_C	ENSG00000144771		0.478	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM1	HGNC	protein_coding	OTTHUMT00000351399.1	-	0.00	44	0	C	NM_020678		54958682	-1	tier1	-	no_errors	ENST00000273286	ensembl	human	known	74_37	missense	50.00	12	12	SNP	0.943	T
MAGEB5	347541	genome.wustl.edu	37	X	26235705	26235705	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:26235705A>C	ENST00000602297.1	+	2	534	c.287A>C	c.(286-288)gAc>gCc	p.D96A	MAGEB5_ENST00000379029.2_Missense_Mutation_p.D96A	NM_001271752.1	NP_001258681.1	Q9BZ81	MAGB5_HUMAN	melanoma antigen family B, 5	96	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									lung(1)|ovary(1)	2						TTTGCAGTTGACTTGAAGGAA	0.433																																																	0																																										SO:0001583	missense	0			AF333705	CCDS65233.1	Xp22	2012-04-20			ENSG00000188408	ENSG00000188408			23795	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 3"""	300466				10861452	Standard	NM_001271752		Approved	MAGE-B5, CT3.3	uc031thc.1	Q9BZ81	OTTHUMG00000021288	ENST00000602297.1:c.287A>C	X.37:g.26235705A>C	ENSP00000473493:p.Asp96Ala			Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.D96A	ENST00000602297.1	37	c.287		X	.	.	.	.	.	.	.	.	.	.	A	13.57	2.277495	0.40294	.	.	ENSG00000188408	ENST00000379029	T	0.04917	3.53	4.06	-1.2	0.09554	.	0.742412	0.12117	U	0.498029	T	0.10294	0.0252	M	0.78285	2.405	0.09310	N	1	.	.	.	.	.	.	T	0.28364	-1.0046	8	0.54805	T	0.06	.	0.2847	0.00249	0.361:0.1987:0.2439:0.1964	.	.	.	.	A	96	ENSP00000368315:D96A	ENSP00000368315:D96A	D	+	2	0	MAGEB5	26145626	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.568000	0.23623	-0.342000	0.08363	0.486000	0.48141	GAC	MAGEB5	-	pfam_MAGE,pfscan_MAGE	ENSG00000188408		0.433	MAGEB5-001	KNOWN	basic|appris_principal	protein_coding	MAGEB5	HGNC	protein_coding	OTTHUMT00000056126.2	-	0.00	25	0	A	XM_293407		26235705	+1	tier1	-	no_errors	ENST00000379029	ensembl	human	known	74_37	missense	83.33	1	5	SNP	0.000	C
MAML3	55534	genome.wustl.edu	37	4	140811081	140811081	+	Silent	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:140811081C>T	ENST00000509479.2	-	2	2365	c.1509G>A	c.(1507-1509)caG>caA	p.Q503Q	MAML3_ENST00000327122.5_Silent_p.Q347Q|MAML3_ENST00000398940.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.527																																																	0													23.0	31.0	29.0					4																	140811081		2165	4290	6455	SO:0001819	synonymous_variant	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1509G>A	4.37:g.140811081C>T				Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q503	ENST00000509479.2	37	c.1509	CCDS54805.1	4																																																																																			MAML3	-	NULL	ENSG00000196782		0.527	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2		0.00	63	0	C			140811081	-1			no_errors	ENST00000509479	ensembl	human	known	74_37	silent	9.38	29	3	SNP	1.000	T
MAP3K4	4216	genome.wustl.edu	37	6	161470619	161470619	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:161470619G>T	ENST00000392142.4	+	3	1463	c.1315G>T	c.(1315-1317)Gag>Tag	p.E439*	MAP3K4_ENST00000348824.7_Nonsense_Mutation_p.E439*|MAP3K4_ENST00000366920.2_Nonsense_Mutation_p.E439*|MAP3K4_ENST00000366919.2_Nonsense_Mutation_p.E439*	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	439					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CAAAGGTAATGAGCCGGAGTA	0.443																																																	0													86.0	85.0	85.0					6																	161470619		2203	4300	6503	SO:0001587	stop_gained	0			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.1315G>T	6.37:g.161470619G>T	ENSP00000375986:p.Glu439*		A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E439*	ENST00000392142.4	37	c.1315	CCDS34565.1	6	.	.	.	.	.	.	.	.	.	.	G	39	7.666391	0.98422	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	.	.	.	5.82	5.82	0.92795	.	0.301547	0.30800	N	0.008847	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	-18.652	18.2771	0.90087	0.0:0.0:1.0:0.0	.	.	.	.	X	439	.	ENSP00000297332:E439X	E	+	1	0	MAP3K4	161390609	1.000000	0.71417	0.026000	0.17262	0.996000	0.88848	8.822000	0.92013	2.751000	0.94390	0.650000	0.86243	GAG	MAP3K4	-	NULL	ENSG00000085511		0.443	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3		0.00	50	0	G			161470619	+1			no_errors	ENST00000392142	ensembl	human	known	74_37	nonsense	6.38	44	3	SNP	0.945	T
MAP7D1	55700	genome.wustl.edu	37	1	36639028	36639028	+	Missense_Mutation	SNP	C	C	T	rs201457297		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:36639028C>T	ENST00000373151.2	+	5	904	c.688C>T	c.(688-690)Cgc>Tgc	p.R230C	MAP7D1_ENST00000316156.4_Missense_Mutation_p.R230C|MAP7D1_ENST00000474796.1_3'UTR|MAP7D1_ENST00000373150.4_Missense_Mutation_p.R230C	NM_018067.3	NP_060537.3	Q3KQU3	MA7D1_HUMAN	MAP7 domain containing 1	230					microtubule cytoskeleton organization (GO:0000226)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)				breast(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(3)|skin(1)|urinary_tract(1)	19		Myeloproliferative disorder(586;0.0393)				CCGGCAGCAGCGCTGGTCCTG	0.632																																																	0													74.0	72.0	73.0					1																	36639028		2203	4300	6503	SO:0001583	missense	0			AK096341	CCDS30673.1, CCDS65492.1, CCDS65493.1	1p34.3	2008-02-05	2007-02-08	2007-02-08	ENSG00000116871	ENSG00000116871			25514	protein-coding gene	gene with protein product			"""proline arginine rich coiled coil 1"", ""arginine/proline rich coiled-coil 1"""	PARCC1, RPRC1		10574461	Standard	XM_005271024		Approved	FLJ10350, FLJ39022	uc001bzz.3	Q3KQU3	OTTHUMG00000007714	ENST00000373151.2:c.688C>T	1.37:g.36639028C>T	ENSP00000362244:p.Arg230Cys		D3DPS4|Q7L8J5|Q8N905|Q8TAK0|Q9HBQ2|Q9NW29|Q9ULN3	Missense_Mutation	SNP	pfam_MAP7	p.R230C	ENST00000373151.2	37	c.688	CCDS30673.1	1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.405796	0.83230	.	.	ENSG00000116871	ENST00000429533;ENST00000316156;ENST00000373150;ENST00000373151	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	5.22	5.22	0.72569	.	0.000000	0.42420	D	0.000702	T	0.41650	0.1168	M	0.81341	2.54	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.76071	0.987;0.977;0.987	T	0.35425	-0.9789	10	0.72032	D	0.01	-14.6252	17.7316	0.88379	0.0:1.0:0.0:0.0	.	230;230;230	Q3KQU3-2;Q3KQU3-4;Q3KQU3	.;.;MA7D1_HUMAN	C	191;230;230;230	ENSP00000390091:R191C;ENSP00000320228:R230C;ENSP00000362243:R230C;ENSP00000362244:R230C	ENSP00000320228:R230C	R	+	1	0	MAP7D1	36411615	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.760000	0.47581	2.620000	0.88729	0.655000	0.94253	CGC	MAP7D1	-	NULL	ENSG00000116871		0.632	MAP7D1-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D1	HGNC	protein_coding	OTTHUMT00000382095.1	-	0.00	97	0	C	NM_018067		36639028	+1	tier1	rs201457297	no_errors	ENST00000373151	ensembl	human	known	74_37	missense	23.64	42	13	SNP	1.000	T
MAPKBP1	23005	genome.wustl.edu	37	15	42116219	42116219	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr15:42116219G>T	ENST00000456763.2	+	30	4387	c.4191G>T	c.(4189-4191)atG>atT	p.M1397I	MAPKBP1_ENST00000221214.6_Missense_Mutation_p.M1274I|RP11-23P13.4_ENST00000512295.1_RNA|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.M1230I|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.M1391I|MAPKBP1_ENST00000514566.1_Intron|RP11-23P13.4_ENST00000510176.1_RNA	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	1397										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		CCAACCCCATGGAATGCACCA	0.632																																																	0													77.0	86.0	83.0					15																	42116219		2203	4300	6503	SO:0001583	missense	0			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.4191G>T	15.37:g.42116219G>T	ENSP00000393099:p.Met1397Ile		A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M1397I	ENST00000456763.2	37	c.4191	CCDS45239.1	15	.	.	.	.	.	.	.	.	.	.	.	12.01	1.809407	0.31961	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763	T;T;T;T	0.40476	1.21;1.37;1.03;1.26	5.81	4.9	0.64082	.	0.543012	0.19772	N	0.106416	T	0.30324	0.0761	L	0.36672	1.1	0.25865	N	0.983777	B;B;B;B;B	0.13145	0.0;0.002;0.003;0.002;0.007	B;B;B;B;B	0.17979	0.0;0.001;0.001;0.003;0.02	T	0.20107	-1.0285	10	0.14252	T	0.57	-3.7761	9.4645	0.38804	0.071:0.0:0.7862:0.1428	.	1230;1274;1230;1397;1391	F8WC21;O60336-3;B4DYK7;O60336;O60336-6	.;.;.;MABP1_HUMAN;.	I	1391;1274;1230;1397	ENSP00000397570:M1391I;ENSP00000221214:M1274I;ENSP00000260357:M1230I;ENSP00000393099:M1397I	ENSP00000221214:M1274I	M	+	3	0	MAPKBP1	39903511	1.000000	0.71417	0.987000	0.45799	0.966000	0.64601	4.748000	0.62148	1.462000	0.47948	0.655000	0.94253	ATG	MAPKBP1	-	NULL	ENSG00000137802		0.632	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	HGNC	protein_coding	OTTHUMT00000359745.1	-	0.00	84	0	G	NM_014994		42116219	+1	tier1	-	no_errors	ENST00000456763	ensembl	human	known	74_37	missense	7.41	50	4	SNP	0.998	T
MBL1P	8512	genome.wustl.edu	37	10	81664758	81664758	+	IGR	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr10:81664758G>A								NUTM2E (54126 upstream) : MBL1P (15175 downstream)																							GTGAATTTCCGTTTCCCGCGG	0.617																																																	0																																										SO:0001628	intergenic_variant	0																															10.37:g.81664758G>A				RNA	SNP	-	NULL		37	NULL		10																																																																																			MBL1P	-	-	ENSG00000242600	0	0.617					MBL1P	HGNC			-	0.00	56	0	G			81664758	+1	tier1	-	no_errors	ENST00000453174	ensembl	human	known	74_37	rna	33.33	20	10	SNP	0.261	A
MDC1	9656	genome.wustl.edu	37	6	30680055	30680055	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:30680055G>A	ENST00000376406.3	-	5	2311	c.1664C>T	c.(1663-1665)gCa>gTa	p.A555V	MDC1_ENST00000494654.1_5'Flank|MDC1_ENST00000376405.2_Missense_Mutation_p.A555V|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	555	Required for nuclear localization (NLS1).				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)			breast(2)|kidney(1)|ovary(1)	4						TCCCCCAACTGCTTTCACATC	0.512								Other conserved DNA damage response genes																																									0													77.0	72.0	74.0					6																	30680055		1511	2709	4220	SO:0001583	missense	0			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.1664C>T	6.37:g.30680055G>A	ENSP00000365588:p.Ala555Val		A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.A555V	ENST00000376406.3	37	c.1664	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	G	9.106	1.005283	0.19199	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	T;T	0.02944	4.19;4.1	4.47	0.103	0.14526	.	.	.	.	.	T	0.00524	0.0017	L	0.27053	0.805	0.09310	N	1	B;B;B;B	0.27882	0.192;0.192;0.056;0.008	B;B;B;B	0.24541	0.054;0.054;0.019;0.025	T	0.46428	-0.9192	9	0.14252	T	0.57	-0.5411	0.8298	0.01128	0.2168:0.1732:0.4076:0.2024	.	555;427;555;555	Q14676-2;B4DYH4;Q14676;Q14676-4	.;.;MDC1_HUMAN;.	V	555;555;555;427	ENSP00000365588:A555V;ENSP00000365587:A555V	ENSP00000365587:A555V	A	-	2	0	MDC1	30788034	0.004000	0.15560	0.139000	0.22197	0.216000	0.24613	0.966000	0.29331	0.147000	0.19030	0.462000	0.41574	GCA	MDC1	-	NULL	ENSG00000137337		0.512	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	-	0.00	32	0	G	NM_014641		30680055	-1	tier1	-	no_errors	ENST00000376406	ensembl	human	known	74_37	missense	23.68	29	9	SNP	0.002	A
MED13	9969	genome.wustl.edu	37	17	60061649	60061649	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:60061649G>C	ENST00000397786.2	-	15	2847	c.2771C>G	c.(2770-2772)cCa>cGa	p.P924R		NM_005121.2	NP_005112.2	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	924					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(4)|central_nervous_system(1)|endometrium(10)|kidney(24)|large_intestine(15)|liver(1)|lung(20)|ovary(1)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ATATTGGCTTGGTAGAGTTTT	0.388																																																	0													91.0	84.0	86.0					17																	60061649		1816	4085	5901	SO:0001583	missense	0			AB011165	CCDS42366.1	17q22-q23	2007-07-30	2007-07-30	2007-07-30		ENSG00000108510			22474	protein-coding gene	gene with protein product		603808	"""thyroid hormone receptor associated protein 1"""	THRAP1		1019863	Standard	NM_005121		Approved	KIAA0593, TRAP240	uc002izo.3	Q9UHV7		ENST00000397786.2:c.2771C>G	17.37:g.60061649G>C	ENSP00000380888:p.Pro924Arg		B2RU05|O60334	Missense_Mutation	SNP	pfam_Mediator_Med13,pfam_Mediator_Med13_N_met/fun	p.P924R	ENST00000397786.2	37	c.2771	CCDS42366.1	17	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387879	0.82902	.	.	ENSG00000108510	ENST00000397786;ENST00000262436	D	0.95554	-3.74	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	D	0.97961	0.9329	M	0.84082	2.675	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.98276	1.0506	10	0.87932	D	0	-18.9456	20.1047	0.97888	0.0:0.0:1.0:0.0	.	924	Q9UHV7	MED13_HUMAN	R	924;923	ENSP00000380888:P924R	ENSP00000262436:P923R	P	-	2	0	MED13	57416431	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.367000	0.97148	2.762000	0.94881	0.655000	0.94253	CCA	MED13	-	NULL	ENSG00000108510		0.388	MED13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED13	HGNC	protein_coding	OTTHUMT00000445461.1		0.00	80	0	G	NM_005121		60061649	-1			no_errors	ENST00000397786	ensembl	human	known	74_37	missense	5.56	66	4	SNP	1.000	C
MEP1A	4224	genome.wustl.edu	37	6	46766383	46766383	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:46766383G>T	ENST00000230588.4	+	4	195	c.186G>T	c.(184-186)caG>caT	p.Q62H		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	62					digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			TCCTCTTGCAGGTGAGTACCT	0.463																																																	0													72.0	71.0	71.0					6																	46766383		2203	4300	6503	SO:0001630	splice_region_variant	0				CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.186+1G>T	6.37:g.46766383G>T			A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Missense_Mutation	SNP	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,pfam_MATH,pfam_MAM_dom,pfam_EG-like_dom,superfamily_TRAF-like,superfamily_ConA-like_lec_gl_sf,smart_Peptidase_Metallo,smart_MAM_dom,smart_MATH,prints_Peptidase_M12A,prints_MAM_dom,pfscan_EG-like_dom,pfscan_MATH,pfscan_MAM_dom	p.Q62H	ENST00000230588.4	37	c.186	CCDS4918.1	6	.	.	.	.	.	.	.	.	.	.	G	6.375	0.437367	0.12104	.	.	ENSG00000112818	ENST00000230588	T	0.24908	1.83	5.17	1.24	0.21308	.	2.341200	0.01911	N	0.039881	T	0.07908	0.0198	L	0.36672	1.1	0.18873	N	0.999989	B;B	0.31859	0.24;0.343	B;B	0.31245	0.109;0.126	T	0.23013	-1.0200	10	0.46703	T	0.11	-0.0013	4.2106	0.10510	0.2908:0.1811:0.5281:0.0	.	90;62	B7ZL91;Q16819	.;MEP1A_HUMAN	H	62	ENSP00000230588:Q62H	ENSP00000230588:Q62H	Q	+	3	2	MEP1A	46874342	0.001000	0.12720	0.321000	0.25320	0.136000	0.21042	-0.524000	0.06222	0.252000	0.21531	0.557000	0.71058	CAG	MEP1A	-	pirsf_Pept_M12A_Meprin	ENSG00000112818		0.463	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEP1A	HGNC	protein_coding	OTTHUMT00000040803.1	-	0.00	42	0	G	NM_005588	Missense_Mutation	46766383	+1	tier1	-	no_errors	ENST00000230588	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.235	T
MKS1	54903	genome.wustl.edu	37	17	56283514	56283514	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:56283514G>A	ENST00000393119.2	-	18	1680	c.1606C>T	c.(1606-1608)Cgg>Tgg	p.R536W	MKS1_ENST00000537529.2_Missense_Mutation_p.R526W|MKS1_ENST00000337050.7_Intron|MKS1_ENST00000546108.1_Missense_Mutation_p.R333W|MKS1_ENST00000313863.6_3'UTR	NM_017777.3	NP_060247.2	Q9NXB0	MKS1_HUMAN	Meckel syndrome, type 1	536					branching morphogenesis of an epithelial tube (GO:0048754)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)		p.R536W(1)		endometrium(5)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	26						ATGCGGCGCCGGGCTCGACGG	0.602																																																	1	Substitution - Missense(1)	prostate(1)											29.0	32.0	31.0					17																	56283514		1895	4111	6006	SO:0001583	missense	0			DQ185029	CCDS11603.2, CCDS54148.1	17q21-q24	2014-09-17			ENSG00000011143	ENSG00000011143			7121	protein-coding gene	gene with protein product	"""POC12 centriolar protein homolog (Chlamydomonas)"""	609883		MKS		7550354, 16415886, 18327255	Standard	NM_017777		Approved	FLJ20345, POC12, BBS13	uc002ivr.2	Q9NXB0	OTTHUMG00000133714	ENST00000393119.2:c.1606C>T	17.37:g.56283514G>A	ENSP00000376827:p.Arg536Trp		B7WNX4|F5H885|Q284T0|Q96G13	Missense_Mutation	SNP	pfam_B9_dom	p.R536W	ENST00000393119.2	37	c.1606	CCDS11603.2	17	.	.	.	.	.	.	.	.	.	.	G	21.9	4.218167	0.79464	.	.	ENSG00000011143	ENST00000537529;ENST00000393119;ENST00000546108	T;T;D	0.83755	-1.38;-1.35;-1.76	5.35	4.34	0.51931	.	0.056863	0.64402	D	0.000002	D	0.88654	0.6495	L	0.58101	1.795	0.52501	D	0.999952	D	0.89917	1.0	D	0.80764	0.994	D	0.89165	0.3533	10	0.87932	D	0	-29.2123	14.3125	0.66424	0.0:0.0:0.8515:0.1485	.	536	Q9NXB0	MKS1_HUMAN	W	526;536;333	ENSP00000442096:R526W;ENSP00000376827:R536W;ENSP00000443012:R333W	ENSP00000376827:R536W	R	-	1	2	MKS1	53638513	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.046000	0.57376	2.788000	0.95919	0.555000	0.69702	CGG	MKS1	-	NULL	ENSG00000011143		0.602	MKS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MKS1	HGNC	protein_coding	OTTHUMT00000258015.2		0.00	73	0	G	NM_017777		56283514	-1			no_errors	ENST00000393119	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	A
MMP25	64386	genome.wustl.edu	37	16	3100009	3100009	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:3100009G>T	ENST00000336577.4	+	3	469		c.e3-1		MMP25_ENST00000570755.1_Splice_Site|RP11-473M20.7_ENST00000576250.1_RNA	NM_022468.4	NP_071913.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 25						negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	14					Marimastat(DB00786)	GTCTCCCGCAGACCCAGGGAC	0.622																																					NSCLC(147;665 1067 3888 6863 19894 30469 40247 45633 51336)												0													77.0	83.0	81.0					16																	3100009		2197	4300	6497	SO:0001630	splice_region_variant	0			AF145442	CCDS10492.1	16p13.3	2008-02-05	2005-08-08			ENSG00000008516			14246	protein-coding gene	gene with protein product		608482	"""matrix metalloproteinase 25"", ""matrix metallopeptidase-like 1"""	MMPL1, MMP20		10628838, 10706098	Standard	NM_022468		Approved	MT6-MMP	uc002cth.3	Q9NPA2		ENST00000336577.4:c.233-1G>T	16.37:g.3100009G>T			Q96F04|Q96TE2	Splice_Site	SNP	-	e3-1	ENST00000336577.4	37	c.233-1	CCDS10492.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.04|15.04	2.715861|2.715861	0.48622|0.48622	.|.	.|.	ENSG00000008516|ENSG00000008516	ENST00000336577|ENST00000325800	.|.	.|.	.|.	4.87|4.87	4.87|4.87	0.63330|0.63330	.|.	.|.	.|.	.|.	.|.	.|T	.|0.73753	.|0.3627	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.77197	.|-0.2676	.|5	.|0.87932	.|D	.|0	.|.	13.8568|13.8568	0.63531|0.63531	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	.|Y	-1|5	.|.	.|ENSP00000324953:D5Y	.|D	+|+	.|1	.|0	MMP25|MMP25	3040010|3040010	1.000000|1.000000	0.71417|0.71417	0.948000|0.948000	0.38648|0.38648	0.018000|0.018000	0.09664|0.09664	6.211000|6.211000	0.72182|0.72182	2.422000|2.422000	0.82143|0.82143	0.655000|0.655000	0.94253|0.94253	.|GAC	MMP25	-	-	ENSG00000008516		0.622	MMP25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP25	HGNC	protein_coding	OTTHUMT00000437116.1		0.00	95	0	G	NM_022468	Intron	3100009	+1			no_errors	ENST00000336577	ensembl	human	known	74_37	splice_site	7.27	51	4	SNP	1.000	T
MST1L	11223	genome.wustl.edu	37	1	17083605	17083605	+	RNA	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:17083605A>G	ENST00000455405.2	-	0	983							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										tcgtttaagaaagtccttggt	0.333																																																	0																																												0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17083605A>G			B7WPB1|Q13209	RNA	SNP	-	NULL	ENST00000455405.2	37	NULL		1																																																																																			MST1L	-	-	ENSG00000186715		0.333	MST1L-002	KNOWN	basic	processed_transcript	MST1L	HGNC	pseudogene	OTTHUMT00000400328.1	-	0.00	81	0	A	NM_001271733		17083605	-1	tier1	-	no_errors	ENST00000455405	ensembl	human	known	74_37	rna	28.57	20	8	SNP	0.000	G
MTTP	4547	genome.wustl.edu	37	4	100534196	100534196	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:100534196T>C	ENST00000265517.5	+	15	2319	c.2116T>C	c.(2116-2118)Ttt>Ctt	p.F706L	MTTP_ENST00000511045.1_Missense_Mutation_p.F733L|MTTP_ENST00000457717.1_Missense_Mutation_p.F706L|RP11-766F14.1_ENST00000508578.1_RNA			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	706					cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	ACCTGTCACCTTTTTCAACGG	0.478																																																	0													190.0	170.0	177.0					4																	100534196		2203	4300	6503	SO:0001583	missense	0				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.2116T>C	4.37:g.100534196T>C	ENSP00000265517:p.Phe706Leu		A8K428|Q08AM4|Q6P5T3	Missense_Mutation	SNP	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.F706L	ENST00000265517.5	37	c.2116	CCDS3651.1	4	.	.	.	.	.	.	.	.	.	.	T	20.8	4.046688	0.75846	.	.	ENSG00000138823	ENST00000511045;ENST00000457717;ENST00000265517	T;T;T	0.68903	-0.36;-0.34;-0.34	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.67804	0.2932	L	0.57536	1.79	0.80722	D	1	P;P	0.49862	0.929;0.787	P;B	0.46172	0.506;0.218	T	0.67829	-0.5569	10	0.33940	T	0.23	-26.2677	15.5644	0.76277	0.0:0.0:0.0:1.0	.	733;706	E9PBP6;P55157	.;MTP_HUMAN	L	733;706;706	ENSP00000427679:F733L;ENSP00000400821:F706L;ENSP00000265517:F706L	ENSP00000265517:F706L	F	+	1	0	MTTP	100753219	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	7.596000	0.82721	2.085000	0.62840	0.477000	0.44152	TTT	MTTP	-	NULL	ENSG00000138823		0.478	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3	-	0.00	68	0	T			100534196	+1	tier1	-	no_errors	ENST00000265517	ensembl	human	known	74_37	missense	9.80	46	5	SNP	0.999	C
MUM1	84939	genome.wustl.edu	37	19	1370705	1370705	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:1370705G>C	ENST00000415183.3	+	11	1643	c.1617G>C	c.(1615-1617)aaG>aaC	p.K539N	MUM1_ENST00000591806.1_Missense_Mutation_p.K539N|MUM1_ENST00000344663.3_Missense_Mutation_p.K539N|MUM1_ENST00000311401.5_Missense_Mutation_p.K470N			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	538					chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AACTGAGCAAGGGGAGCCCCG	0.677																																																	0													10.0	10.0	10.0					19																	1370705		2072	4071	6143	SO:0001583	missense	0			AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.1617G>C	19.37:g.1370705G>C	ENSP00000394925:p.Lys539Asn		A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Missense_Mutation	SNP	pfam_PWWP_dom	p.K539N	ENST00000415183.3	37	c.1617		19	.	.	.	.	.	.	.	.	.	.	G	4.507	0.094128	0.08632	.	.	ENSG00000160953	ENST00000344663;ENST00000311401;ENST00000415183	T;T;T	0.42513	0.97;0.97;0.97	5.0	-4.08	0.03963	.	2.462170	0.00939	N	0.002817	T	0.20333	0.0489	N	0.21373	0.66	0.09310	N	1	B;B;P;B	0.38767	0.069;0.13;0.646;0.017	B;B;B;B	0.34038	0.02;0.037;0.174;0.012	T	0.10497	-1.0627	10	0.13470	T	0.59	.	0.7616	0.01008	0.3533:0.1158:0.2941:0.2368	.	539;539;470;538	B7ZLY8;D6W5Y8;Q2TAK8-2;Q2TAK8	.;.;.;MUM1_HUMAN	N	539;470;539	ENSP00000345789:K539N;ENSP00000309135:K470N;ENSP00000394925:K539N	ENSP00000309135:K470N	K	+	3	2	MUM1	1321705	0.001000	0.12720	0.000000	0.03702	0.011000	0.07611	-0.237000	0.08990	-0.555000	0.06142	-0.409000	0.06214	AAG	MUM1	-	NULL	ENSG00000160953		0.677	MUM1-016	NOVEL	basic|exp_conf	protein_coding	MUM1	HGNC	protein_coding	OTTHUMT00000449510.1	-	0.00	83	0	G	NM_032853		1370705	+1	tier1	-	no_errors	ENST00000344663	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.000	C
MUT	4594	genome.wustl.edu	37	6	49425613	49425613	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:49425613T>A	ENST00000274813.3	-	3	671	c.544A>T	c.(544-546)Atg>Ttg	p.M182L		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	182					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)	p.M182fs*29(1)		endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GAAACTGACATTTTTTCTAAA	0.388																																																	1	Insertion - Frameshift(1)	large_intestine(1)											66.0	68.0	67.0					6																	49425613		2203	4300	6503	SO:0001583	missense	0				CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.544A>T	6.37:g.49425613T>A	ENSP00000274813:p.Met182Leu		A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	pfam_MeMalonylCoA_mutase_a/b_cat,pfam_Cobalamin-bd,superfamily_Cbl-dep_enz_cat,superfamily_Cobalamin-bd,tigrfam_MMCoA_mutase_a_cat,tigrfam_Acid_CoA_mut_C	p.M182L	ENST00000274813.3	37	c.544	CCDS4924.1	6	.	.	.	.	.	.	.	.	.	.	T	20.4	3.985702	0.74589	.	.	ENSG00000146085	ENST00000274813	D	0.98234	-4.81	5.74	5.74	0.90152	Cobalamin (vitamin B12)-dependent enzyme, catalytic (1);Cobalamin (vitamin B12)-dependent enzyme, catalytic subdomain (1);Methylmalonyl-CoA mutase, alpha/beta chain, catalytic (1);Methylmalonyl-CoA mutase, alpha chain, catalytic (1);	0.000000	0.85682	D	0.000000	D	0.98921	0.9634	M	0.91872	3.25	0.80722	D	1	P	0.46020	0.871	P	0.58331	0.837	D	0.99556	1.0967	10	0.72032	D	0.01	-1.6855	15.511	0.75782	0.0:0.0:0.0:1.0	.	182	P22033	MUTA_HUMAN	L	182	ENSP00000274813:M182L	ENSP00000274813:M182L	M	-	1	0	MUT	49533572	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.606000	0.82863	2.317000	0.78254	0.459000	0.35465	ATG	MUT	-	pfam_MeMalonylCoA_mutase_a/b_cat,superfamily_Cbl-dep_enz_cat,tigrfam_MMCoA_mutase_a_cat	ENSG00000146085		0.388	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUT	HGNC	protein_coding	OTTHUMT00000040854.1		0.00	34	0	T			49425613	-1			no_errors	ENST00000274813	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	A
MYCT1	80177	genome.wustl.edu	37	6	153042973	153042973	+	Missense_Mutation	SNP	G	G	A	rs140600605		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:153042973G>A	ENST00000367245.5	+	2	301	c.293G>A	c.(292-294)aGa>aAa	p.R98K	MYCT1_ENST00000529453.1_Intron	NM_025107.2	NP_079383.2	Q8N699	MYCT1_HUMAN	myc target 1	98						nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	20		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;1.33e-10)|BRCA - Breast invasive adenocarcinoma(81;0.143)		CGAAGAAGAAGAGCCAGTGCT	0.493																																																	0													155.0	140.0	145.0					6																	153042973		2203	4300	6503	SO:0001583	missense	0			AF527367	CCDS5239.1	6q25.1	2008-02-05			ENSG00000120279	ENSG00000120279			23172	protein-coding gene	gene with protein product						12477932	Standard	NM_025107		Approved	MTLC, FLJ21269	uc003qpc.4	Q8N699	OTTHUMG00000015850	ENST00000367245.5:c.293G>A	6.37:g.153042973G>A	ENSP00000356214:p.Arg98Lys		Q8N396|Q8TBE8|Q9H763	Missense_Mutation	SNP	NULL	p.R98K	ENST00000367245.5	37	c.293	CCDS5239.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.7|23.7	4.448092|4.448092	0.84101|0.84101	.|.	.|.	ENSG00000120279|ENSG00000120279	ENST00000532295|ENST00000367245	.|T	.|0.54866	.|0.55	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	.|0.448255	.|0.17047	.|U	.|0.189084	T|T	0.67878|0.67878	0.2940|0.2940	M|M	0.74881|0.74881	2.28|2.28	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|D	.|0.76071	.|0.987	T|T	0.62690|0.62690	-0.6801|-0.6801	5|10	.|0.31617	.|T	.|0.26	-22.7629|-22.7629	19.6178|19.6178	0.95640|0.95640	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|98	.|Q8N699	.|MYCT1_HUMAN	K|K	79|98	.|ENSP00000356214:R98K	.|ENSP00000356214:R98K	E|R	+|+	1|2	0|0	MYCT1|MYCT1	153084666|153084666	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	5.524000|5.524000	0.67105|0.67105	2.634000|2.634000	0.89283|0.89283	0.441000|0.441000	0.28932|0.28932	GAG|AGA	MYCT1	-	NULL	ENSG00000120279		0.493	MYCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYCT1	HGNC	protein_coding	OTTHUMT00000042750.2	-	0.00	46	0	G	NM_025107		153042973	+1	tier1	-	no_errors	ENST00000367245	ensembl	human	known	74_37	missense	17.14	29	6	SNP	1.000	A
N6AMT2	221143	genome.wustl.edu	37	13	21306195	21306195	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr13:21306195G>T	ENST00000382758.1	-	4	340	c.293C>A	c.(292-294)tCg>tAg	p.S98*	N6AMT2_ENST00000382754.4_Nonsense_Mutation_p.S98*			Q8WVE0	N6MT2_HUMAN	N-6 adenine-specific DNA methyltransferase 2 (putative)	98						extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(3)|lung(3)	7		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)		all cancers(112;0.000234)|Epithelial(112;0.000471)|OV - Ovarian serous cystadenocarcinoma(117;0.0111)|Lung(94;0.0161)|LUSC - Lung squamous cell carcinoma(192;0.0431)		GATGTATATCGAAAAGTTTTC	0.378																																																	0													89.0	91.0	91.0					13																	21306195		2203	4300	6503	SO:0001587	stop_gained	0			AK055408	CCDS9293.1	13q12.11	2006-12-14			ENSG00000150456	ENSG00000150456			27351	protein-coding gene	gene with protein product						12477932	Standard	NM_174928		Approved		uc001uno.1	Q8WVE0	OTTHUMG00000016519	ENST00000382758.1:c.293C>A	13.37:g.21306195G>T	ENSP00000372206:p.Ser98*		B5G4V1	Nonsense_Mutation	SNP	pfam_N6_adenine_Mtase-rel_euk	p.S98*	ENST00000382758.1	37	c.293	CCDS9293.1	13	.	.	.	.	.	.	.	.	.	.	G	11.83	1.755909	0.31137	.	.	ENSG00000150456	ENST00000382758;ENST00000382754	.	.	.	5.83	4.99	0.66335	.	0.213535	0.51477	D	0.000100	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.8567	0.41090	0.0695:0.0:0.7922:0.1383	.	.	.	.	X	98	.	ENSP00000372202:S98X	S	-	2	0	N6AMT2	20204195	0.986000	0.35501	0.002000	0.10522	0.001000	0.01503	4.906000	0.63293	1.484000	0.48361	0.563000	0.77884	TCG	N6AMT2	-	pfam_N6_adenine_Mtase-rel_euk	ENSG00000150456		0.378	N6AMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	N6AMT2	HGNC	protein_coding	OTTHUMT00000044083.1		0.00	49	0	G	NM_174928		21306195	-1			no_errors	ENST00000382754	ensembl	human	known	74_37	nonsense	6.90	27	2	SNP	0.040	T
NCKAP1	10787	genome.wustl.edu	37	2	183843562	183843562	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:183843562C>T	ENST00000361354.4	-	14	1795	c.1423G>A	c.(1423-1425)Gtt>Att	p.V475I	NCKAP1_ENST00000360982.2_Splice_Site_p.V481I	NM_013436.3	NP_038464.1	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1	475					apical protein localization (GO:0045176)|apoptotic process (GO:0006915)|basal protein localization (GO:0045175)|central nervous system development (GO:0007417)|embryonic body morphogenesis (GO:0010172)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube development (GO:0035050)|endoderm development (GO:0007492)|establishment or maintenance of actin cytoskeleton polarity (GO:0030950)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|mesodermal cell migration (GO:0008078)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|paraxial mesoderm morphogenesis (GO:0048340)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|positive regulation of lamellipodium assembly (GO:0010592)|protein stabilization (GO:0050821)|Rac protein signal transduction (GO:0016601)|regulation of protein localization (GO:0032880)|somitogenesis (GO:0001756)|zygotic determination of anterior/posterior axis, embryo (GO:0007354)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)			breast(3)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(11)|lung(16)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			GGCTTATTACCTTGTTTTACA	0.279																																																	0													46.0	49.0	48.0					2																	183843562		2202	4293	6495	SO:0001630	splice_region_variant	0			AB014509	CCDS2287.1, CCDS2288.1	2q32	2009-08-14			ENSG00000061676	ENSG00000061676			7666	protein-coding gene	gene with protein product		604891				10673335, 12181570, 9344857	Standard	NM_013436		Approved	Nap1, HEM2, NAP125	uc002upb.4	Q9Y2A7	OTTHUMG00000132623	ENST00000361354.4:c.1423+1G>A	2.37:g.183843562C>T			O60329|Q53QN5|Q53S94|Q53Y35	Missense_Mutation	SNP	pfam_Nck-associated_protein-1	p.V481I	ENST00000361354.4	37	c.1441	CCDS2287.1	2	.	.	.	.	.	.	.	.	.	.	C	26.4	4.736722	0.89482	.	.	ENSG00000061676	ENST00000361354;ENST00000360982	T;T	0.36520	1.25;1.25	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.35941	0.0949	L	0.43923	1.385	0.80722	D	1	B;B	0.32128	0.357;0.307	B;B	0.34301	0.179;0.112	T	0.06409	-1.0828	9	.	.	.	-15.8656	19.6286	0.95691	0.0:1.0:0.0:0.0	.	475;481	Q9Y2A7;Q9Y2A7-2	NCKP1_HUMAN;.	I	475;481	ENSP00000355348:V475I;ENSP00000354251:V481I	.	V	-	1	0	NCKAP1	183551807	1.000000	0.71417	1.000000	0.80357	0.655000	0.38815	7.721000	0.84768	2.692000	0.91855	0.650000	0.86243	GTT	NCKAP1	-	pfam_Nck-associated_protein-1	ENSG00000061676		0.279	NCKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1	HGNC	protein_coding	OTTHUMT00000255867.2	-	0.00	58	0	C	NM_205842	Missense_Mutation	183843562	-1	tier1	-	no_errors	ENST00000360982	ensembl	human	known	74_37	missense	8.96	61	6	SNP	1.000	T
NCOA2	10499	genome.wustl.edu	37	8	71053566	71053566	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:71053566C>G	ENST00000452400.2	-	14	3062	c.2881G>C	c.(2881-2883)Gtg>Ctg	p.V961L	NCOA2_ENST00000267974.4_Missense_Mutation_p.V49L	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	961					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GTGACTCTCACAGCCGAACTC	0.557			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																			Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0													61.0	64.0	63.0					8																	71053566		2068	4224	6292	SO:0001583	missense	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.2881G>C	8.37:g.71053566C>G	ENSP00000399968:p.Val961Leu		Q14CD2	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_PAS,superfamily_Nuc_rcpt_coact,superfamily_bHLH_dom,smart_bHLH_dom,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_bHLH_dom	p.V961L	ENST00000452400.2	37	c.2881	CCDS47872.1	8	.	.	.	.	.	.	.	.	.	.	C	13.16	2.152993	0.38021	.	.	ENSG00000140396	ENST00000452400;ENST00000267974	T;T	0.06218	4.77;3.33	5.36	4.48	0.54585	.	0.400091	0.27181	N	0.020545	T	0.19087	0.0458	M	0.69823	2.125	0.40328	D	0.978891	D;P	0.63046	0.992;0.555	P;B	0.60012	0.867;0.171	T	0.04678	-1.0934	10	0.25106	T	0.35	.	14.3767	0.66884	0.0:0.9283:0.0:0.0717	.	49;961	F8WAJ2;Q15596	.;NCOA2_HUMAN	L	961;49	ENSP00000399968:V961L;ENSP00000267974:V49L	ENSP00000267974:V49L	V	-	1	0	NCOA2	71216120	0.998000	0.40836	0.999000	0.59377	0.868000	0.49771	4.050000	0.57404	1.376000	0.46267	-0.145000	0.13849	GTG	NCOA2	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000140396		0.557	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	-	0.00	45	0	C			71053566	-1	tier1	-	no_errors	ENST00000452400	ensembl	human	known	74_37	missense	47.17	28	25	SNP	1.000	G
NDE1	54820	genome.wustl.edu	37	16	15758647	15758647	+	Silent	SNP	C	C	T	rs572790932		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:15758647C>T	ENST00000396353.2	+	3	838	c.12C>T	c.(10-12)tcC>tcT	p.S4S	NDE1_ENST00000396354.1_Silent_p.S4S|NDE1_ENST00000342673.5_Silent_p.S4S|NDE1_ENST00000396355.1_Silent_p.S4S			Q9NXR1	NDE1_HUMAN	nudE neurodevelopment protein 1	4	Self-association. {ECO:0000250}.				centrosome duplication (GO:0051298)|cerebral cortex development (GO:0021987)|establishment of chromosome localization (GO:0051303)|establishment of mitotic spindle orientation (GO:0000132)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuroblast proliferation (GO:0007405)|neuron migration (GO:0001764)|vesicle transport along microtubule (GO:0047496)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole centrosome (GO:0031616)	microtubule binding (GO:0008017)			endometrium(3)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)	13						TGGAGGACTCCGGAAAGACTT	0.463													C|||	1	0.000199681	0.0	0.0	5008	,	,		17449	0.0		0.0	False		,,,				2504	0.001																0													134.0	134.0	134.0					16																	15758647		2197	4300	6497	SO:0001819	synonymous_variant	0			AF124431	CCDS10564.1	16p13.11	2013-08-06	2013-08-06		ENSG00000072864	ENSG00000072864			17619	protein-coding gene	gene with protein product		609449	"""nudE nuclear distribution gene E homolog 1 (A. nidulans)"", ""nudE nuclear distribution E homolog 1 (A. nidulans)"""			10940388, 12427674	Standard	NM_017668		Approved	nudE, FLJ20101, NDE	uc002dds.3	Q9NXR1	OTTHUMG00000129885	ENST00000396353.2:c.12C>T	16.37:g.15758647C>T			Q49AQ2	Silent	SNP	pfam_NUDE_C	p.S4	ENST00000396353.2	37	c.12		16																																																																																			NDE1	-	NULL	ENSG00000072864		0.463	NDE1-202	KNOWN	basic|appris_principal	protein_coding	NDE1	HGNC	protein_coding		-	0.00	35	0	C	NM_017668		15758647	+1	tier1	-	no_errors	ENST00000396353	ensembl	human	known	74_37	silent	36.00	16	9	SNP	0.237	T
NEB	4703	genome.wustl.edu	37	2	152521956	152521956	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:152521956A>C	ENST00000172853.10	-	42	5276	c.5129T>G	c.(5128-5130)aTt>aGt	p.I1710S	NEB_ENST00000603639.1_Missense_Mutation_p.I1710S|NEB_ENST00000409198.1_Missense_Mutation_p.I1710S|NEB_ENST00000397345.3_Missense_Mutation_p.I1710S|NEB_ENST00000604864.1_Missense_Mutation_p.I1710S|NEB_ENST00000427231.2_Missense_Mutation_p.I1710S			P20929	NEBU_HUMAN	nebulin	1710					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CTCACTAAGAATCTCTCCTGC	0.473																																																	0													209.0	205.0	207.0					2																	152521956		2011	4153	6164	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.5129T>G	2.37:g.152521956A>C	ENSP00000172853:p.Ile1710Ser		F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.I1710S	ENST00000172853.10	37	c.5129		2	.	.	.	.	.	.	.	.	.	.	A	21.7	4.193765	0.78902	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.10573	2.89;2.86;2.86;2.95	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.36663	0.0975	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.12656	-1.0539	10	0.72032	D	0.01	.	15.3771	0.74615	1.0:0.0:0.0:0.0	.	1710	P20929	NEBU_HUMAN	S	1710	ENSP00000386259:I1710S;ENSP00000380505:I1710S;ENSP00000416578:I1710S;ENSP00000172853:I1710S	ENSP00000172853:I1710S	I	-	2	0	NEB	152230202	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	5.999000	0.70665	2.367000	0.80283	0.528000	0.53228	ATT	NEB	-	smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.473	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		-	0.00	81	0	A	NM_004543		152521956	-1	tier1	-	no_errors	ENST00000397345	ensembl	human	known	74_37	missense	42.11	44	32	SNP	1.000	C
NECAP1	25977	genome.wustl.edu	37	12	8248680	8248680	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:8248680G>T	ENST00000339754.5	+	8	900	c.822G>T	c.(820-822)caG>caT	p.Q274H		NM_015509.3	NP_056324.2	Q8NC96	NECP1_HUMAN	NECAP endocytosis associated 1	274					endocytosis (GO:0006897)|protein transport (GO:0015031)	clathrin vesicle coat (GO:0030125)|coated pit (GO:0005905)|plasma membrane (GO:0005886)				cervix(1)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				Kidney(36;0.0915)		ACTGGGTCCAGTTCTGAATGG	0.468																																																	0													108.0	98.0	101.0					12																	8248680		2203	4300	6503	SO:0001583	missense	0			AK074923	CCDS8589.1	12p13.31	2012-05-02			ENSG00000089818	ENSG00000089818			24539	protein-coding gene	gene with protein product		611623				14555962, 15494011	Standard	NM_015509		Approved	DKFZP566B183	uc001qtx.2	Q8NC96	OTTHUMG00000168568	ENST00000339754.5:c.822G>T	12.37:g.8248680G>T	ENSP00000341737:p.Gln274His		Q2NL73|Q5XG95|Q6NWY6|Q8N153|Q8NCB0|Q9BU52|Q9Y407	Missense_Mutation	SNP	pfam_NECAP-1	p.Q274H	ENST00000339754.5	37	c.822	CCDS8589.1	12	.	.	.	.	.	.	.	.	.	.	G	17.36	3.370375	0.61624	.	.	ENSG00000089818	ENST00000545179;ENST00000339754;ENST00000540291	T	0.35789	1.29	4.75	3.85	0.44370	.	0.064020	0.64402	D	0.000005	T	0.56601	0.1996	M	0.77616	2.38	0.51233	D	0.999911	D	0.76494	0.999	D	0.69142	0.962	T	0.60530	-0.7245	10	0.87932	D	0	.	10.7073	0.45962	0.0949:0.0:0.9051:0.0	.	274	Q8NC96	NECP1_HUMAN	H	274;274;132	ENSP00000341737:Q274H	ENSP00000341737:Q274H	Q	+	3	2	NECAP1	8139947	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.027000	0.64109	2.608000	0.88229	0.650000	0.86243	CAG	NECAP1	-	NULL	ENSG00000089818		0.468	NECAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAP1	HGNC	protein_coding	OTTHUMT00000400244.1	-	0.00	56	0	G	NM_015509		8248680	+1	tier1	-	no_errors	ENST00000339754	ensembl	human	known	74_37	missense	14.81	23	4	SNP	1.000	T
NFIC	4782	genome.wustl.edu	37	19	3381984	3381984	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:3381984C>T	ENST00000443272.2	+	2	356	c.305C>T	c.(304-306)cCg>cTg	p.P102L	NFIC_ENST00000346156.5_Missense_Mutation_p.P93L|NFIC_ENST00000395111.3_Missense_Mutation_p.P93L|NFIC_ENST00000590282.1_Missense_Mutation_p.P102L|NFIC_ENST00000586919.1_Missense_Mutation_p.P93L|NFIC_ENST00000341919.3_Missense_Mutation_p.P102L|NFIC_ENST00000589123.1_Missense_Mutation_p.P93L	NM_001245002.1	NP_001231931.1	P08651	NFIC_HUMAN	nuclear factor I/C (CCAAT-binding transcription factor)	102					DNA replication (GO:0006260)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)	core promoter proximal region DNA binding (GO:0001159)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		AAGAAGGCGCCGGGCTGCGTG	0.672																																																	0													71.0	78.0	75.0					19																	3381984		2203	4300	6503	SO:0001583	missense	0			X12492	CCDS12107.1, CCDS45914.1, CCDS58640.1, CCDS59330.1, CCDS59331.1	19p13.3	2008-02-05				ENSG00000141905			7786	protein-coding gene	gene with protein product		600729		NFI		3398920, 7590749	Standard	NM_205843		Approved	CTF, NF-I, CTF5	uc010xhi.2	P08651		ENST00000443272.2:c.305C>T	19.37:g.3381984C>T	ENSP00000396843:p.Pro102Leu		A8K1H0|B7Z4U5|B7Z9C3|K7EMU1|P08652|Q14932|Q9UPJ3|Q9UPJ9|Q9UPK0|Q9UPK1	Missense_Mutation	SNP	pfam_CTF/NFI,pfam_CTF/NFI_DNA-bd_N,pfam_MAD_homology1_Dwarfin-type,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,pfscan_CTF/NFI_DNA-bd-dom	p.P102L	ENST00000443272.2	37	c.305	CCDS59330.1	19	.	.	.	.	.	.	.	.	.	.	C	17.96	3.516736	0.64634	.	.	ENSG00000141905	ENST00000443272;ENST00000395111;ENST00000346156;ENST00000341919;ENST00000343825;ENST00000269778	T;T;T	0.75050	-0.9;-0.9;-0.9	3.88	3.88	0.44766	MAD homology 1, Dwarfin-type (2);CTF transcription factor/nuclear factor 1, DNA-binding domain (1);	0.144057	0.45867	D	0.000330	T	0.56396	0.1982	N	0.22421	0.69	0.80722	D	1	P;P;P;P;P	0.42248	0.774;0.574;0.733;0.519;0.519	B;B;B;B;B	0.28784	0.094;0.094;0.057;0.035;0.057	T	0.66810	-0.5829	10	0.72032	D	0.01	.	14.8198	0.70062	0.0:1.0:0.0:0.0	.	102;102;93;102;93	B7Z4U5;P08651;P08651-3;P08651-5;P08651-2	.;NFIC_HUMAN;.;.;.	L	93;93;93;102;102;102	ENSP00000378543:P93L;ENSP00000301935:P93L;ENSP00000342194:P102L	ENSP00000269778:P102L	P	+	2	0	NFIC	3332984	0.886000	0.30341	1.000000	0.80357	0.973000	0.67179	7.515000	0.81761	1.879000	0.54435	0.467000	0.42956	CCG	NFIC	-	pfam_MAD_homology1_Dwarfin-type,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,pfscan_CTF/NFI_DNA-bd-dom	ENSG00000141905		0.672	NFIC-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NFIC	HGNC	protein_coding	OTTHUMT00000452834.1	-	0.00	96	0	C	NM_005597		3381984	+1	tier1	-	no_errors	ENST00000443272	ensembl	human	known	74_37	missense	53.03	31	35	SNP	0.998	T
NLGN4Y	22829	genome.wustl.edu	37	Y	16953045	16953045	+	3'UTR	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrY:16953045C>A	ENST00000476359.1	+	0	2899							Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked						learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			large_intestine(3)|lung(7)|prostate(2)|skin(2)	14						ATTCCAAACACATTGATGGGG	0.498																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS14788.1, CCDS55553.1, CCDS56619.1	Yq11.221	2013-09-20	2004-05-21		ENSG00000165246	ENSG00000165246			15529	protein-coding gene	gene with protein product		400028	"""neuroligin 4, Y linked"""			10231032	Standard	NM_014893		Approved	KIAA0951	uc004ftg.2	Q8NFZ3	OTTHUMG00000036618	ENST00000476359.1:c.*2896C>A	Y.37:g.16953045C>A			F5H6W0|Q14D08|Q7Z3T5|Q8N5B6|Q9Y2F8	Missense_Mutation	SNP	pfam_CarbesteraseB,prints_Neuroligin	p.T842K	ENST00000476359.1	37	c.2525		Y																																																																																			NLGN4Y	-	NULL	ENSG00000165246		0.498	NLGN4Y-004	KNOWN	basic	processed_transcript	NLGN4Y	HGNC	protein_coding	OTTHUMT00000089064.2	-	0.00	61	0	C	NM_014893		16953045	+1	tier1	-	no_errors	ENST00000382868	ensembl	human	known	74_37	missense	18.75	13	3	SNP	1.000	A
NOX4	50507	genome.wustl.edu	37	11	89075351	89075351	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:89075351C>T	ENST00000263317.4	-	14	1466	c.1228G>A	c.(1228-1230)Gat>Aat	p.D410N	NOX4_ENST00000535633.1_Missense_Mutation_p.D386N|NOX4_ENST00000532825.1_Intron|NOX4_ENST00000527626.1_Missense_Mutation_p.D244N|NOX4_ENST00000424319.1_Missense_Mutation_p.D386N|NOX4_ENST00000525196.1_Intron|NOX4_ENST00000413594.2_Missense_Mutation_p.D431N|NOX4_ENST00000531342.1_Intron|NOX4_ENST00000527956.1_Missense_Mutation_p.D386N|NOX4_ENST00000375979.3_Missense_Mutation_p.D103N|NOX4_ENST00000534731.1_Intron|NOX4_ENST00000343727.5_Missense_Mutation_p.D386N|NOX4_ENST00000542487.1_Missense_Mutation_p.D386N|NOX4_ENST00000528341.1_Missense_Mutation_p.D385N			Q9NPH5	NOX4_HUMAN	NADPH oxidase 4	410	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.|Mediates interaction with TLR4.				bone resorption (GO:0045453)|cardiac muscle cell differentiation (GO:0055007)|cell aging (GO:0007569)|cell morphogenesis (GO:0000902)|cellular response to cAMP (GO:0071320)|cellular response to gamma radiation (GO:0071480)|cellular response to glucose stimulus (GO:0071333)|cellular response to transforming growth factor beta stimulus (GO:0071560)|homocysteine metabolic process (GO:0050667)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|oxidation-reduction process (GO:0055114)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of stress fiber assembly (GO:0051496)|reactive oxygen species metabolic process (GO:0072593)|response to hypoxia (GO:0001666)|superoxide anion generation (GO:0042554)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|NADPH oxidase complex (GO:0043020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|modified amino acid binding (GO:0072341)|NAD(P)H oxidase activity (GO:0016174)|nucleotide binding (GO:0000166)|oxygen sensor activity (GO:0019826)|superoxide-generating NADPH oxidase activity (GO:0016175)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(20)|ovary(2)|prostate(3)|skin(2)	44		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				AAAGGACCATCAATATACAGC	0.393																																																	0													66.0	63.0	64.0					11																	89075351		2201	4299	6500	SO:0001583	missense	0			AF254621	CCDS8285.1, CCDS44695.1, CCDS44696.1, CCDS73361.1, CCDS73362.1	11q14.2-q21	2008-02-05			ENSG00000086991	ENSG00000086991			7891	protein-coding gene	gene with protein product		605261					Standard	NM_001143837		Approved	KOX-1, KOX	uc001pct.3	Q9NPH5	OTTHUMG00000167298	ENST00000263317.4:c.1228G>A	11.37:g.89075351C>T	ENSP00000263317:p.Asp410Asn		A8K715|B7Z520|E7EMD7|Q5K3R4|Q5K3R5|Q5K3R6|Q5K3R8|Q7Z7G3|Q86V92	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_Fe3_Rdtase_TM_dom,pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.D431N	ENST00000263317.4	37	c.1291	CCDS8285.1	11	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756740	0.89843	.	.	ENSG00000086991	ENST00000424319;ENST00000535633;ENST00000343727;ENST00000263317;ENST00000527956;ENST00000542487;ENST00000527626;ENST00000528341;ENST00000413594;ENST00000375979	D;D;D;D;D;D;D;D;D;D	0.94723	-3.4;-3.4;-3.4;-3.4;-3.4;-3.4;-3.4;-3.4;-3.4;-3.5	5.18	5.18	0.71444	Riboflavin synthase-like beta-barrel (1);FAD-binding 8 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.96765	0.8944	M	0.68317	2.08	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.87578	0.998;0.997;0.998;0.986	D	0.96430	0.9318	9	.	.	.	-13.7589	18.2829	0.90104	0.0:1.0:0.0:0.0	.	244;385;103;410	E9PR43;E9PPP2;Q9NPH5-4;Q9NPH5	.;.;.;NOX4_HUMAN	N	386;386;386;410;386;386;244;385;431;103	ENSP00000412446:D386N;ENSP00000440172:D386N;ENSP00000344747:D386N;ENSP00000263317:D410N;ENSP00000433797:D386N;ENSP00000439373:D386N;ENSP00000436093:D244N;ENSP00000436970:D385N;ENSP00000405705:D431N;ENSP00000365146:D103N	.	D	-	1	0	NOX4	88714999	1.000000	0.71417	0.990000	0.47175	0.741000	0.42261	7.173000	0.77612	2.403000	0.81681	0.462000	0.41574	GAT	NOX4	-	pfam_FAD-bd_8,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	ENSG00000086991		0.393	NOX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX4	HGNC	protein_coding	OTTHUMT00000394054.1	-	0.00	86	0	C	NM_016931		89075351	-1	tier1	-	no_errors	ENST00000413594	ensembl	human	known	74_37	missense	10.61	59	7	SNP	1.000	T
NPC1L1	29881	genome.wustl.edu	37	7	44555474	44555474	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:44555474G>T	ENST00000289547.4	-	19	3860	c.3805C>A	c.(3805-3807)Ctc>Atc	p.L1269I	NPC1L1_ENST00000381160.3_Missense_Mutation_p.L1242I|NPC1L1_ENST00000546276.1_Missense_Mutation_p.L1196I	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1269					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	AGGAGGTTGAGGCGGAAGAAG	0.602																																																	0													74.0	75.0	75.0					7																	44555474		2203	4300	6503	SO:0001583	missense	0				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3805C>A	7.37:g.44555474G>T	ENSP00000289547:p.Leu1269Ile		A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.L1269I	ENST00000289547.4	37	c.3805	CCDS5491.1	7	.	.	.	.	.	.	.	.	.	.	G	15.94	2.980133	0.53827	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.85258	-1.96;-1.96;-1.96	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000001	D	0.85314	0.5668	N	0.17594	0.5	0.37469	D	0.915535	D;P;D	0.69078	0.974;0.947;0.997	P;P;D	0.65443	0.837;0.837;0.935	D	0.85604	0.1254	10	0.29301	T	0.29	-44.1788	16.8388	0.85963	0.0:0.0:1.0:0.0	.	1196;1242;1269	B7ZLE6;Q17RV5;D3DVK9	.;.;.	I	1269;1242;1196	ENSP00000289547:L1269I;ENSP00000370552:L1242I;ENSP00000438033:L1196I	ENSP00000289547:L1269I	L	-	1	0	NPC1L1	44521999	1.000000	0.71417	1.000000	0.80357	0.304000	0.27724	1.910000	0.39927	2.589000	0.87451	0.561000	0.74099	CTC	NPC1L1	-	pfam_Patched	ENSG00000015520		0.602	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	NPC1L1	HGNC	protein_coding	OTTHUMT00000251256.1	-	0.00	36	0	G	NM_013389		44555474	-1	tier1	-	no_errors	ENST00000289547	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
NPEPL1	79716	genome.wustl.edu	37	20	57282220	57282220	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr20:57282220G>A	ENST00000356091.6	+	7	1152	c.864G>A	c.(862-864)gcG>gcA	p.A288A	NPEPL1_ENST00000525967.1_Silent_p.A260A|NPEPL1_ENST00000525817.1_Silent_p.A240A|STX16-NPEPL1_ENST00000530122.1_3'UTR	NM_024663.3	NP_078939.3	Q8NDH3	PEPL1_HUMAN	aminopeptidase-like 1	288						cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|manganese ion binding (GO:0030145)|metalloexopeptidase activity (GO:0008235)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;2.88e-09)|Colorectal(105;0.109)			GGGGTGCTGCGGCCGTCCTGG	0.672																																																	0													11.0	17.0	15.0					20																	57282220		1938	4056	5994	SO:0001819	synonymous_variant	0			AK021645	CCDS46621.1, CCDS56200.1, CCDS56201.1	20q13.32	2008-07-02			ENSG00000215440	ENSG00000215440			16244	protein-coding gene	gene with protein product						14702039	Standard	NM_001204872		Approved	FLJ11583, bA261P9.2	uc010zzs.1	Q8NDH3	OTTHUMG00000033060	ENST00000356091.6:c.864G>A	20.37:g.57282220G>A			A6NGZ0|B4DMW7|B7ZBN0|E9PN47|G5EA34|Q53G37|Q5W083|Q8TF28|Q8WUI2|Q9H1T6|Q9HAI5	Silent	SNP	pfam_Peptidase_M17_C,prints_Leucine_aapep/pepB	p.A288	ENST00000356091.6	37	c.864	CCDS46621.1	20																																																																																			NPEPL1	-	pfam_Peptidase_M17_C,prints_Leucine_aapep/pepB	ENSG00000215440		0.672	NPEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPEPL1	HGNC	protein_coding	OTTHUMT00000080402.6	-	0.00	185	0	G	NM_024663		57282220	+1	tier1	-	no_errors	ENST00000356091	ensembl	human	known	74_37	silent	18.83	181	42	SNP	0.914	A
POM121C	100101267	genome.wustl.edu	37	7	75045369	75045369	+	IGR	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:75045369C>T	ENST00000257665.5	-	0	5700				NSUN5P1_ENST00000393633.2_RNA			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C						mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						GCTCACTTTCCCTTCCCTGCA	0.647																																																	0													18.0	21.0	20.0					7																	75045369		2202	4293	6495	SO:0001628	intergenic_variant	0				CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238		7.37:g.75045369C>T			O75115|Q9Y2N3|Q9Y4S7	RNA	SNP	-	NULL	ENST00000257665.5	37	NULL		7																																																																																			NSUN5P1	-	-	ENSG00000223705		0.647	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	NSUN5P1	HGNC	protein_coding	OTTHUMT00000343919.2		0.00	83	0	C	NM_001099415		75045369	+1			no_errors	ENST00000393633	ensembl	human	known	74_37	rna	5.56	51	3	SNP	1.000	T
NUP98	4928	genome.wustl.edu	37	11	3720357	3720357	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:3720357T>C	ENST00000324932.7	-	25	4384	c.3964A>G	c.(3964-3966)Aca>Gca	p.T1322A	NUP98_ENST00000359171.4_Missense_Mutation_p.T1322A|NUP98_ENST00000355260.3_Missense_Mutation_p.T1322A|NUP98_ENST00000488828.1_5'Flank	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1339					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		CTTTTGCCTGTGAGGTAGCTG	0.547			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																			Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	0													169.0	168.0	168.0					11																	3720357		2201	4298	6499	SO:0001583	missense	0			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.3964A>G	11.37:g.3720357T>C	ENSP00000316032:p.Thr1322Ala		Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	pfam_Nup96,pfam_Peptidase_S59,superfamily_Peptidase_S59	p.T1322A	ENST00000324932.7	37	c.3964	CCDS7746.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.6|22.6	4.309734|4.309734	0.81247|0.81247	.|.	.|.	ENSG00000110713|ENSG00000110713	ENST00000429801|ENST00000324932;ENST00000359171;ENST00000355260	.|.	.|.	.|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	.|0.049102	.|0.85682	.|D	.|0.000000	T|T	0.66096|0.66096	0.2755|0.2755	L|L	0.52905|0.52905	1.665|1.665	0.36512|0.36512	D|D	0.869662|0.869662	.|D;P;D	.|0.62365	.|0.991;0.949;0.976	.|P;P;P	.|0.59643	.|0.861;0.73;0.741	T|T	0.66040|0.66040	-0.6022|-0.6022	5|9	.|0.14656	.|T	.|0.56	-9.3858|-9.3858	15.3831|15.3831	0.74676|0.74676	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1322;1322;1236	.|P52948-2;P52948-5;P52948-6	.|.;.;.	R|A	274|1322	.|.	.|ENSP00000316032:T1322A	H|T	-|-	2|1	0|0	NUP98|NUP98	3676933|3676933	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.868000|0.868000	0.49771|0.49771	4.364000|4.364000	0.59479|0.59479	2.285000|2.285000	0.76669|0.76669	0.533000|0.533000	0.62120|0.62120	CAC|ACA	NUP98	-	pfam_Nup96	ENSG00000110713		0.547	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP98	HGNC	protein_coding	OTTHUMT00000032766.3	-	0.00	67	0	T	NM_016320		3720357	-1	tier1	-	no_errors	ENST00000324932	ensembl	human	known	74_37	missense	35.09	37	20	SNP	1.000	C
NVL	4931	genome.wustl.edu	37	1	224514159	224514160	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:224514159_224514160insTA	ENST00000281701.6	-	2	323_324	c.64_65insTA	c.(64-66)accfs	p.T22fs	NVL_ENST00000340871.4_Intron|NVL_ENST00000468673.1_5'UTR|NVL_ENST00000361463.3_Intron|NVL_ENST00000482491.1_Intron|NVL_ENST00000391875.2_Intron|NVL_ENST00000469075.1_Frame_Shift_Ins_p.T22fs	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	22						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		TTTGTTACTGGTAAGGTACTAA	0.317																																																	0																																										SO:0001589	frameshift_variant	0			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.63_64dupTA	1.37:g.224514160_224514161dupTA	ENSP00000281701:p.Thr22fs		B4DMC4|B4DP98|Q96EM7	Frame_Shift_Ins	INS	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_AAA-2,pfam_ATPase_dyneun-rel_AAA,pfam_Zeta_toxin_domain,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.T22fs	ENST00000281701.6	37	c.65_64	CCDS1541.1	1																																																																																			NVL	-	NULL	ENSG00000143748		0.317	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NVL	HGNC	protein_coding	OTTHUMT00000091453.2		0.00	55	0	-	NM_002533		224514160	-1	tier1		no_errors	ENST00000281701	ensembl	human	known	74_37	frame_shift_ins	11.84	67	9	INS	0.935:0.900	TA
NXPE1	120400	genome.wustl.edu	37	11	114392979	114392979	+	Missense_Mutation	SNP	C	C	T	rs201047483		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:114392979C>T	ENST00000424269.1	-	5	1354	c.1355G>A	c.(1354-1356)cGc>cAc	p.R452H	NXPE1_ENST00000251921.2_Missense_Mutation_p.R310H|NXPE1_ENST00000536271.1_Missense_Mutation_p.R168H			Q8N323	NXPE1_HUMAN	neurexophilin and PC-esterase domain family, member 1	452						extracellular region (GO:0005576)											GATGGCCCTGCGAATAAAAAT	0.443																																																	0													125.0	116.0	119.0					11																	114392979		2201	4296	6497	SO:0001583	missense	0			BC029049	CCDS8372.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000095110	ENSG00000095110			28527	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member A"""	FAM55A		12477932	Standard	NM_152315		Approved	MGC34290	uc001ppa.3	Q8N323	OTTHUMG00000168284	ENST00000424269.1:c.1355G>A	11.37:g.114392979C>T	ENSP00000411690:p.Arg452His		B0YJ13	Missense_Mutation	SNP	pfam_NXPH/NXPE,superfamily_Ig_E-set	p.R452H	ENST00000424269.1	37	c.1355		11	.	.	.	.	.	.	.	.	.	.	C	12.28	1.891960	0.33442	.	.	ENSG00000095110	ENST00000536271;ENST00000251921;ENST00000424269	T;T;T	0.28255	1.62;1.62;1.62	4.44	1.44	0.22558	.	0.086453	0.46758	N	0.000267	T	0.33235	0.0856	M	0.79614	2.46	0.30055	N	0.811373	P	0.45827	0.867	P	0.45406	0.479	T	0.25047	-1.0143	10	0.30078	T	0.28	.	5.8178	0.18506	0.155:0.6676:0.0:0.1775	.	452	Q8N323	FA55A_HUMAN	H	168;310;452	ENSP00000445200:R168H;ENSP00000251921:R310H;ENSP00000411690:R452H	ENSP00000251921:R310H	R	-	2	0	FAM55A	113898189	0.003000	0.15002	0.006000	0.13384	0.496000	0.33645	0.702000	0.25631	0.181000	0.19994	0.650000	0.86243	CGC	NXPE1	-	NULL	ENSG00000095110		0.443	NXPE1-201	KNOWN	basic	protein_coding	NXPE1	HGNC	protein_coding			0.00	69	0	C	NM_152315		114392979	-1			no_errors	ENST00000424269	ensembl	human	known	74_37	missense	6.00	47	3	SNP	0.955	T
OGFOD3	79701	genome.wustl.edu	37	17	80373480	80373480	+	Missense_Mutation	SNP	C	C	T	rs527862857		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:80373480C>T	ENST00000313056.5	-	2	249	c.98G>A	c.(97-99)cGg>cAg	p.R33Q	Y_RNA_ENST00000364369.1_RNA|HEXDC_ENST00000337014.6_5'Flank|OGFOD3_ENST00000329197.5_Missense_Mutation_p.R33Q	NM_024648.2|NM_175902.4	NP_078924.1|NP_787098.3	Q6PK18	OGFD3_HUMAN	2-oxoglutarate and iron-dependent oxygenase domain containing 3	33						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)										CTGCACCTCCCGCGGGGCTCG	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		16745	0.0		0.001	False		,,,				2504	0.0																0													24.0	27.0	26.0					17																	80373480		2203	4300	6503	SO:0001583	missense	0			BC023602	CCDS11811.1, CCDS11812.1	17q25.3	2012-10-23	2012-10-23	2012-10-23	ENSG00000181396	ENSG00000181396			26174	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 101"""	C17orf101		12477932	Standard	NM_175902		Approved	FLJ22222	uc002keu.2	Q6PK18		ENST00000313056.5:c.98G>A	17.37:g.80373480C>T	ENSP00000320116:p.Arg33Gln		C9JDC8|Q8IZ37|Q9H6J2	Missense_Mutation	SNP	smart_Pro_4_hyd_alph	p.R33Q	ENST00000313056.5	37	c.98	CCDS11811.1	17	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050568	0.36181	.	.	ENSG00000181396	ENST00000313056;ENST00000329197	T;T	0.32988	1.9;1.43	5.0	-1.5	0.08691	.	1.265250	0.05940	N	0.636762	T	0.14485	0.0350	N	0.08118	0	0.09310	N	1	B;B	0.16396	0.005;0.017	B;B	0.12837	0.002;0.008	T	0.30446	-0.9978	10	0.13108	T	0.6	-9.7559	8.758	0.34656	0.0:0.3013:0.0:0.6987	.	33;33	Q6PK18;Q6PK18-2	CQ101_HUMAN;.	Q	33	ENSP00000320116:R33Q;ENSP00000330075:R33Q	ENSP00000320116:R33Q	R	-	2	0	C17orf101	77966769	0.000000	0.05858	0.003000	0.11579	0.044000	0.14063	-0.242000	0.08928	-0.115000	0.11915	0.655000	0.94253	CGG	OGFOD3	-	NULL	ENSG00000181396		0.637	OGFOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGFOD3	HGNC	protein_coding	OTTHUMT00000442895.1		0.00	106	0	C	NM_175902		80373480	-1			no_errors	ENST00000329197	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.001	T
OR51E1	143503	genome.wustl.edu	37	11	4673819	4673819	+	Silent	SNP	T	T	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:4673819T>A	ENST00000530215.1	+	1	104	c.63T>A	c.(61-63)ccT>ccA	p.P21P	OR51E1_ENST00000396952.5_Silent_p.P21P			Q8TCB6	O51E1_HUMAN	olfactory receptor, family 51, subfamily E, member 1	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|skin(1)|stomach(2)	30		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;7.37e-14)|GBM - Glioblastoma multiforme(2;2.85e-05)|BRCA - Breast invasive adenocarcinoma(625;0.00222)|LUSC - Lung squamous cell carcinoma(625;0.19)		TAGGCCTCCCTGGTTTAGAAG	0.488																																																	0													286.0	209.0	235.0					11																	4673819		2201	4298	6499	SO:0001819	synonymous_variant	0			AY775731	CCDS31358.2	11p15.4	2012-08-22	2004-11-03	2004-11-06	ENSG00000180785	ENSG00000180785		"""GPCR / Class A : Olfactory receptors"""	15194	protein-coding gene	gene with protein product		611267	"""olfactory receptor, family 51, subfamily E, member 1 pseudogene"""	OR51E1P, OR52A3P, GPR164			Standard	NM_152430		Approved	GPR136	uc001lzi.4	Q8TCB6	OTTHUMG00000157024	ENST00000530215.1:c.63T>A	11.37:g.4673819T>A			A8KAM6|Q5S4P5|Q66X57|Q6IF93	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P21	ENST00000530215.1	37	c.63		11																																																																																			OR51E1	-	NULL	ENSG00000180785		0.488	OR51E1-002	PUTATIVE	basic|exp_conf	protein_coding	OR51E1	HGNC	protein_coding	OTTHUMT00000385957.1	-	0.00	59	0	T	NM_152430		4673819	+1	tier1	-	no_errors	ENST00000396952	ensembl	human	known	74_37	silent	14.81	46	8	SNP	0.996	A
OR4C3	256144	genome.wustl.edu	37	11	48346874	48346874	+	Nonsense_Mutation	SNP	G	G	T	rs375760019		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:48346874G>T	ENST00000319856.4	+	1	403	c.382G>T	c.(382-384)Gga>Tga	p.G128*		NM_001004702.1	NP_001004702.1	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C, member 3	101						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(18)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	32						TCAGCTCTTTGGAGCTCATTT	0.453																																																	0													268.0	254.0	259.0					11																	48346874		2201	4298	6499	SO:0001587	stop_gained	0			AB065567	CCDS31489.1	11p11.2	2012-08-09				ENSG00000176547		"""GPCR / Class A : Olfactory receptors"""	14697	protein-coding gene	gene with protein product							Standard	NM_001004702		Approved		uc010rhv.2	Q8NH37	OTTHUMG00000166579	ENST00000319856.4:c.382G>T	11.37:g.48346874G>T	ENSP00000321419:p.Gly128*		B2RNF2|Q6IFB3	Nonsense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.G128*	ENST00000319856.4	37	c.382	CCDS31489.1	11	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266009	0.80358	.	.	ENSG00000176547	ENST00000319856	.	.	.	5.78	4.84	0.62591	.	0.785035	0.11111	N	0.598598	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	12.1258	0.53917	0.0:0.0:0.7035:0.2965	.	.	.	.	X	128	.	ENSP00000321419:G128X	G	+	1	0	OR4C3	48303450	0.003000	0.15002	0.963000	0.40424	0.988000	0.76386	0.360000	0.20250	2.782000	0.95742	0.478000	0.44815	GGA	OR4C3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000176547		0.453	OR4C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C3	HGNC	protein_coding	OTTHUMT00000390557.1	-	0.00	108	0	G	NM_001004702		48346874	+1	tier1	-	no_errors	ENST00000319856	ensembl	human	known	74_37	nonsense	20.73	65	17	SNP	0.927	T
OR5AS1	219447	genome.wustl.edu	37	11	55798703	55798703	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:55798703C>G	ENST00000313555.1	+	1	809	c.809C>G	c.(808-810)aCt>aGt	p.T270S		NM_001001921.1	NP_001001921.1	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS, member 1	270						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(7)|large_intestine(7)|liver(1)|lung(22)|ovary(3)|prostate(4)|skin(3)|stomach(1)	48	Esophageal squamous(21;0.00693)					TCCCTAGACACTGATAAGGTG	0.398																																																	0													92.0	80.0	84.0					11																	55798703		2201	4296	6497	SO:0001583	missense	0			AB065543	CCDS31516.1	11q11	2012-08-09			ENSG00000181785	ENSG00000181785		"""GPCR / Class A : Olfactory receptors"""	15261	protein-coding gene	gene with protein product							Standard	NM_001001921		Approved		uc010riw.2	Q8N127	OTTHUMG00000166830	ENST00000313555.1:c.809C>G	11.37:g.55798703C>G	ENSP00000324111:p.Thr270Ser		Q6IFB8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.T270S	ENST00000313555.1	37	c.809	CCDS31516.1	11	.	.	.	.	.	.	.	.	.	.	C	1.197	-0.633735	0.03584	.	.	ENSG00000181785	ENST00000313555	T	0.00054	8.8	5.14	3.25	0.37280	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34362	U	0.004021	T	0.00109	0.0003	L	0.28192	0.835	0.09310	N	1	B	0.24317	0.101	B	0.25506	0.061	T	0.16512	-1.0400	10	0.39692	T	0.17	.	5.4701	0.16666	0.1614:0.6711:0.0:0.1675	.	270	Q8N127	O5AS1_HUMAN	S	270	ENSP00000324111:T270S	ENSP00000324111:T270S	T	+	2	0	OR5AS1	55555279	0.000000	0.05858	0.008000	0.14137	0.034000	0.12701	-0.238000	0.08977	0.550000	0.28991	0.579000	0.79373	ACT	OR5AS1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181785		0.398	OR5AS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AS1	HGNC	protein_coding	OTTHUMT00000391538.1		0.00	57	0	C	NM_001001921		55798703	+1			no_errors	ENST00000313555	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.000	G
OR5T1	390155	genome.wustl.edu	37	11	56043714	56043714	+	Silent	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:56043714T>C	ENST00000313033.2	+	1	686	c.600T>C	c.(598-600)tcT>tcC	p.S200S		NM_001004745.1	NP_001004745.1	Q8NG75	OR5T1_HUMAN	olfactory receptor, family 5, subfamily T, member 1	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S200S(1)		NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(27)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	43	Esophageal squamous(21;0.00448)					TTGCTATTTCTTGTTCTGACA	0.398																																																	1	Substitution - coding silent(1)	lung(1)											236.0	224.0	228.0					11																	56043714		2201	4296	6497	SO:0001819	synonymous_variant	0			AB065962	CCDS31525.1	11q11	2012-08-09		2004-03-10	ENSG00000181698	ENSG00000181698		"""GPCR / Class A : Olfactory receptors"""	14821	protein-coding gene	gene with protein product				OR5T1P			Standard	NM_001004745		Approved		uc001nio.1	Q8NG75	OTTHUMG00000166853	ENST00000313033.2:c.600T>C	11.37:g.56043714T>C			B2RNM9	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S200	ENST00000313033.2	37	c.600	CCDS31525.1	11																																																																																			OR5T1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000181698		0.398	OR5T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T1	HGNC	protein_coding	OTTHUMT00000391600.1	-	0.00	70	0	T	NM_001004745		56043714	+1	tier1	-	no_errors	ENST00000313033	ensembl	human	known	74_37	silent	27.91	31	12	SNP	0.004	C
OR10Q1	219960	genome.wustl.edu	37	11	57996159	57996159	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:57996159C>T	ENST00000316770.2	-	1	231	c.189G>A	c.(187-189)atG>atA	p.M63I		NM_001004471.2	NP_001004471.1	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q, member 1	63						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(26)|ovary(2)	35		Breast(21;0.0589)				GGAAGAAATACATCGGGGTGC	0.522																																																	0													101.0	103.0	103.0					11																	57996159		2201	4295	6496	SO:0001583	missense	0			AB065735	CCDS31547.1	11q12.1	2012-08-09			ENSG00000180475	ENSG00000180475		"""GPCR / Class A : Olfactory receptors"""	15134	protein-coding gene	gene with protein product							Standard	NM_001004471		Approved		uc010rkd.2	Q8NGQ4	OTTHUMG00000167542	ENST00000316770.2:c.189G>A	11.37:g.57996159C>T	ENSP00000314324:p.Met63Ile		Q6IFG4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M63I	ENST00000316770.2	37	c.189	CCDS31547.1	11	.	.	.	.	.	.	.	.	.	.	C	14.62	2.589055	0.46110	.	.	ENSG00000180475	ENST00000316770	T	0.09350	2.99	4.73	4.73	0.59995	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000083	T	0.48114	0.1482	H	0.96805	3.885	0.34865	D	0.743069	D	0.65815	0.995	D	0.75020	0.985	T	0.74153	-0.3757	10	0.72032	D	0.01	.	16.8854	0.86074	0.0:1.0:0.0:0.0	.	63	Q8NGQ4	O10Q1_HUMAN	I	63	ENSP00000314324:M63I	ENSP00000314324:M63I	M	-	3	0	OR10Q1	57752735	1.000000	0.71417	0.976000	0.42696	0.014000	0.08584	4.688000	0.61715	2.430000	0.82344	0.557000	0.71058	ATG	OR10Q1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000180475		0.522	OR10Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10Q1	HGNC	protein_coding	OTTHUMT00000394706.1		0.00	34	0	C	NM_001004471		57996159	-1			no_errors	ENST00000316770	ensembl	human	known	74_37	missense	18.18	18	4	SNP	1.000	T
ORC4	5000	genome.wustl.edu	37	2	148731063	148731063	+	Missense_Mutation	SNP	G	G	T	rs565023604	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:148731063G>T	ENST00000392857.5	-	3	195	c.88C>A	c.(88-90)Cgt>Agt	p.R30S	ORC4_ENST00000542387.1_5'UTR|ORC4_ENST00000264169.2_Missense_Mutation_p.R30S|ORC4_ENST00000536575.1_Intron|ORC4_ENST00000392858.1_Missense_Mutation_p.R30S|ORC4_ENST00000540442.1_5'UTR|ORC4_ENST00000535373.1_Missense_Mutation_p.R30S	NM_001190879.2|NM_001190882.2|NM_002552.4|NM_181741.3	NP_001177808.1|NP_001177811.1|NP_002543.2|NP_859525.1	O43929	ORC4_HUMAN	origin recognition complex, subunit 4	30					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)	ATP binding (GO:0005524)|DNA replication origin binding (GO:0003688)|nucleotide binding (GO:0000166)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	14						GGACTCTGACGACAAAATCTT	0.313																																																	0													94.0	90.0	91.0					2																	148731063		2203	4300	6503	SO:0001583	missense	0			AF022108	CCDS2187.1, CCDS54404.1, CCDS54405.1	2q22-q23	2010-10-12	2010-10-12	2010-10-12	ENSG00000115947	ENSG00000115947		"""ATPases / AAA-type"""	8490	protein-coding gene	gene with protein product		603056	"""origin recognition complex, subunit 4 (yeast homolog)-like"", ""origin recognition complex, subunit 4-like (yeast)"", ""origin recognition complex, subunit 4-like (S. cerevisiae)"", ""origin recognition complex, subunit 4 homolog (S. cerevisiae)"""	ORC4L		9353276, 9691185	Standard	NM_181742		Approved	HsORC4, Orc4p	uc002twk.3	O43929	OTTHUMG00000131849	ENST00000392857.5:c.88C>A	2.37:g.148731063G>T	ENSP00000376597:p.Arg30Ser		B7Z3D0|B7Z5F1|D3DP86|F5H069|Q96C42	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dom_prok,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pirsf_ORC4	p.R30S	ENST00000392857.5	37	c.88	CCDS2187.1	2	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201307	0.58234	.	.	ENSG00000115947	ENST00000264169;ENST00000535373;ENST00000392858;ENST00000392857;ENST00000416719;ENST00000457954;ENST00000440042	T;T;T;T;T;T;T	0.56103	0.48;0.48;0.48;0.48;0.48;0.48;0.48	5.85	4.98	0.66077	.	0.239406	0.49305	D	0.000147	T	0.30448	0.0765	N	0.08118	0	0.80722	D	1	B;B;B	0.15930	0.015;0.009;0.009	B;B;B	0.11329	0.006;0.006;0.006	T	0.12016	-1.0564	10	0.09084	T	0.74	-8.2232	13.9162	0.63899	0.0741:0.0:0.9259:0.0	.	30;30;30	B7Z2M4;A8K7H4;O43929	.;.;ORC4_HUMAN	S	30	ENSP00000264169:R30S;ENSP00000441953:R30S;ENSP00000376598:R30S;ENSP00000376597:R30S;ENSP00000413939:R30S;ENSP00000391484:R30S;ENSP00000403105:R30S	ENSP00000264169:R30S	R	-	1	0	ORC4	148447533	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.680000	0.61656	1.478000	0.48253	0.655000	0.94253	CGT	ORC4	-	superfamily_P-loop_NTPase,pirsf_ORC4	ENSG00000115947		0.313	ORC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC4	HGNC	protein_coding	OTTHUMT00000254797.3		0.00	67	0	G	NM_181742		148731063	-1			no_errors	ENST00000264169	ensembl	human	known	74_37	missense	6.38	44	3	SNP	1.000	T
OTUB1	55611	genome.wustl.edu	37	11	63764925	63764925	+	Silent	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:63764925C>T	ENST00000538426.1	+	7	767	c.723C>T	c.(721-723)ggC>ggT	p.G241G	OTUB1_ENST00000541478.1_Silent_p.G140G|OTUB1_ENST00000535715.1_Intron|OTUB1_ENST00000543004.1_Silent_p.G250G|OTUB1_ENST00000543988.1_Silent_p.G211G|OTUB1_ENST00000428192.2_Silent_p.G241G|OTUB1_ENST00000422031.2_Silent_p.G278G	NM_017670.2	NP_060140.2	Q96FW1	OTUB1_HUMAN	OTU deubiquitinase, ubiquitin aldehyde binding 1	241	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|immune system process (GO:0002376)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein K48-linked deubiquitination (GO:0071108)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	NEDD8-specific protease activity (GO:0019784)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	6						GCGGCGAGGGCGGCACCACCA	0.612																																																	0													115.0	106.0	109.0					11																	63764925		2201	4297	6498	SO:0001819	synonymous_variant	0			AY177200	CCDS8055.1	11q13.1	2014-02-24	2014-02-24			ENSG00000167770		"""OTU domain containing"""	23077	protein-coding gene	gene with protein product		608337	"""OTU domain, ubiquitin aldehyde binding 1"""			12704427, 19383985	Standard	NM_017670		Approved	FLJ20113, FLJ40710	uc001nyf.1	Q96FW1		ENST00000538426.1:c.723C>T	11.37:g.63764925C>T			Q32Q78|Q96II3|Q9NXQ4|Q9P0B8	Silent	SNP	pfam_Peptidase_C65_otubain,pfam_OTU,pirsf_Ubiquitin_thioesterase_Otubain,pfscan_OTU	p.G278	ENST00000538426.1	37	c.834	CCDS8055.1	11																																																																																			OTUB1	-	pfam_Peptidase_C65_otubain,pfam_OTU,pirsf_Ubiquitin_thioesterase_Otubain,pfscan_OTU	ENSG00000167770		0.612	OTUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUB1	HGNC	protein_coding	OTTHUMT00000396277.1	-	0.00	40	0	C	NM_017670		63764925	+1	tier1	-	no_errors	ENST00000422031	ensembl	human	known	74_37	silent	16.00	21	4	SNP	0.998	T
PAH	5053	genome.wustl.edu	37	12	103245493	103245493	+	Missense_Mutation	SNP	G	G	A	rs62642910		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:103245493G>A	ENST00000553106.1	-	8	1356	c.884C>T	c.(883-885)tCa>tTa	p.S295L	PAH_ENST00000307000.2_Missense_Mutation_p.S290L	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	295					catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)	p.S295*(1)		endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	GCTGCGATCTGAAAACAAGGG	0.483																																																	1	Substitution - Nonsense(1)	large_intestine(1)	GRCh37	CM990998	PAH	M	rs62642910						86.0	82.0	83.0					12																	103245493		2203	4300	6503	SO:0001583	missense	0			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.884C>T	12.37:g.103245493G>A	ENSP00000448059:p.Ser295Leu		Q16717|Q8TC14	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Phe-4-hydroxylase_tetra	p.S295L	ENST00000553106.1	37	c.884	CCDS9092.1	12	.	.	.	.	.	.	.	.	.	.	G	21.9	4.222379	0.79464	.	.	ENSG00000171759	ENST00000553106;ENST00000307000	D;D	0.99571	-6.19;-6.19	5.51	5.51	0.81932	Aromatic amino acid hydroxylase, C-terminal (3);	0.113998	0.64402	D	0.000017	D	0.98416	0.9473	N	0.05510	-0.035	0.58432	D	0.999999	P	0.45827	0.867	P	0.49332	0.607	D	0.99585	1.0974	10	0.56958	D	0.05	-10.362	19.7791	0.96410	0.0:0.0:1.0:0.0	.	295	P00439	PH4H_HUMAN	L	295;290	ENSP00000448059:S295L;ENSP00000303500:S290L	ENSP00000303500:S290L	S	-	2	0	PAH	101769623	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.420000	0.97426	2.763000	0.94921	0.650000	0.86243	TCA	PAH	-	pfam_Aromatic-AA_hydroxylase_C,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Phe-4-hydroxylase_tetra	ENSG00000171759		0.483	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAH	HGNC	protein_coding	OTTHUMT00000406692.1		0.00	59	0	G			103245493	-1			no_errors	ENST00000553106	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	A
PAN3	255967	genome.wustl.edu	37	13	28712978	28712979	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	GA	GA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr13:28712978_28712979delGA	ENST00000380958.3	+	1	336_337	c.184_185delGA	c.(184-186)gagfs	p.E63fs	PAN3-AS1_ENST00000563843.1_RNA|PAN3_ENST00000399613.1_5'Flank	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		CTTCTACGGGGAGGAGTGTCAG	0.688																																																	0																																										SO:0001589	frameshift_variant	0			AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.184_185delGA	13.37:g.28712978_28712979delGA	ENSP00000370345:p.Glu63fs			Frame_Shift_Del	DEL	superfamily_Kinase-like_dom,smart_Znf_CCCH,pfscan_Prot_kinase_dom	p.E62fs	ENST00000380958.3	37	c.184_185	CCDS9329.2	13																																																																																			PAN3	-	smart_Znf_CCCH	ENSG00000152520		0.688	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN3	HGNC	protein_coding	OTTHUMT00000044318.4		0.00	81	0	GA	NM_175854		28712979	+1	tier1		no_errors	ENST00000380958	ensembl	human	known	74_37	frame_shift_del	34.62	34	18	DEL	1.000:1.000	-
PBX2P1	5088	genome.wustl.edu	37	3	142896901	142896901	+	RNA	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:142896901G>T	ENST00000560287.1	+	0	1775									pre-B-cell leukemia homeobox 2 pseudogene 1																		GGAGACGCCAGCCCTGCCCAA	0.577																																																	0																																												0					3q24	2014-03-25	2007-01-30	2007-01-30	ENSG00000244171	ENSG00000244171		"""Homeoboxes / TALE class"""	8635	pseudogene	pseudogene			"""pre-B-cell leukemia transcription factor pseudogene 1"""	PBX2, PBXP1		1682799	Standard	NG_002434		Approved				OTTHUMG00000159350		3.37:g.142896901G>T				RNA	SNP	-	NULL	ENST00000560287.1	37	NULL		3																																																																																			PBX2P1	-	-	ENSG00000244171		0.577	PBX2P1-002	KNOWN	basic	processed_transcript	PBX2P1	HGNC	pseudogene	OTTHUMT00000417717.1	-	0.00	122	0	G	NG_002434		142896901	+1	tier1	-	no_errors	ENST00000560287	ensembl	human	known	74_37	rna	27.42	45	17	SNP	0.991	T
PCDH17	27253	genome.wustl.edu	37	13	58208354	58208354	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr13:58208354G>A	ENST00000377918.3	+	1	1700	c.1674G>A	c.(1672-1674)ggG>ggA	p.G558G		NM_001040429.2	NP_001035519.1	O14917	PCD17_HUMAN	protocadherin 17	558	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(30)|liver(2)|lung(54)|ovary(4)|pancreas(2)|prostate(5)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	120		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		AGGACTCGGGGGCGCCCGCGC	0.592																																					Melanoma(72;952 1291 1619 12849 33676)												0													39.0	41.0	40.0					13																	58208354		2203	4300	6503	SO:0001819	synonymous_variant	0			AF029343	CCDS31986.1	13q21.1	2010-01-26			ENSG00000118946	ENSG00000118946		"""Cadherins / Protocadherins : Non-clustered"""	14267	protein-coding gene	gene with protein product		611760				10835267	Standard	NM_001040429		Approved	PCDH68, PCH68	uc001vhq.1	O14917	OTTHUMG00000016992	ENST00000377918.3:c.1674G>A	13.37:g.58208354G>A			A8K1R5|Q5VVW9|Q5VVX0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G558	ENST00000377918.3	37	c.1674	CCDS31986.1	13																																																																																			PCDH17	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000118946		0.592	PCDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDH17	HGNC	protein_coding	OTTHUMT00000045139.1	-	0.00	40	0	G	NM_001040429		58208354	+1	tier1	-	no_errors	ENST00000377918	ensembl	human	known	74_37	silent	40.00	9	6	SNP	0.991	A
PCDHA12	56137	genome.wustl.edu	37	5	140255418	140255418	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:140255418G>A	ENST00000398631.2	+	1	361	c.361G>A	c.(361-363)Gtg>Atg	p.V121M	PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	121	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCATGTGGACGTGGAGGTGAA	0.562																																					Pancreas(113;759 1672 13322 24104 50104)												0													105.0	120.0	115.0					5																	140255418		2203	4300	6503	SO:0001583	missense	0			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.361G>A	5.37:g.140255418G>A	ENSP00000381628:p.Val121Met		O75278|Q2M1N8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V121M	ENST00000398631.2	37	c.361	CCDS47285.1	5	.	.	.	.	.	.	.	.	.	.	G	16.31	3.086942	0.55861	.	.	ENSG00000251664	ENST00000398631	T	0.60548	0.18	5.28	5.28	0.74379	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.82793	0.5114	M	0.93241	3.395	0.38853	D	0.956318	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88218	0.2895	9	0.72032	D	0.01	.	18.502	0.90886	0.0:0.0:1.0:0.0	.	121;121	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	M	121	ENSP00000381628:V121M	ENSP00000381628:V121M	V	+	1	0	PCDHA12	140235602	0.994000	0.37717	1.000000	0.80357	0.380000	0.30137	2.136000	0.42121	2.468000	0.83385	0.591000	0.81541	GTG	PCDHA12	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000251664		0.562	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	-	0.00	133	0	G	NM_018903		140255418	+1	tier1	-	no_errors	ENST00000398631	ensembl	human	known	74_37	missense	8.75	73	7	SNP	1.000	A
PEG3	5178	genome.wustl.edu	37	19	57335020	57335020	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:57335020T>A	ENST00000326441.9	-	5	785	c.422A>T	c.(421-423)gAc>gTc	p.D141V	PEG3_ENST00000594706.1_5'Flank|PEG3_ENST00000598410.1_Missense_Mutation_p.D15V|ZIM2_ENST00000593711.1_Missense_Mutation_p.D15V|PEG3_ENST00000423103.2_Missense_Mutation_p.D141V|ZIM2_ENST00000601070.1_Missense_Mutation_p.D15V|ZIM2_ENST00000599935.1_Missense_Mutation_p.D15V|PEG3_ENST00000593695.1_Missense_Mutation_p.D15V|ZIM2_ENST00000221722.5_Missense_Mutation_p.D15V|ZIM2_ENST00000593931.1_Missense_Mutation_p.D15V|ZIM2_ENST00000391708.3_Missense_Mutation_p.D15V	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	141					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		CATGTCGTCGTCGCTGGTCAC	0.557																																																	0													295.0	215.0	242.0					19																	57335020		2203	4300	6503	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.422A>T	19.37:g.57335020T>A	ENSP00000326581:p.Asp141Val		A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.D141V	ENST00000326441.9	37	c.422	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	T	12.12	1.844081	0.32606	.	.	ENSG00000198300	ENST00000391708;ENST00000221722;ENST00000326441;ENST00000423103;ENST00000292074	T;T;T;T	0.06294	3.32;3.32;4.24;4.24	3.95	3.95	0.45737	Transcription regulator SCAN (1);	0.292616	0.24755	N	0.035873	T	0.08626	0.0214	N	0.24115	0.695	.	.	.	P;P;P;D	0.58268	0.952;0.952;0.952;0.982	P;P;P;P	0.53450	0.601;0.521;0.694;0.726	T	0.10086	-1.0645	9	0.87932	D	0	-20.154	9.4964	0.38991	0.0:0.0:0.0:1.0	.	15;141;74;15	A7E2B8;Q9GZU2;Q96Q96;Q9NZV7	.;PEG3_HUMAN;.;ZIM2_HUMAN	V	15;15;141;141;141	ENSP00000375589:D15V;ENSP00000221722:D15V;ENSP00000326581:D141V;ENSP00000403051:D141V	ENSP00000221722:D15V	D	-	2	0	ZIM2	62026832	0.252000	0.23972	0.184000	0.23157	0.022000	0.10575	2.869000	0.48444	2.023000	0.59567	0.460000	0.39030	GAC	PEG3	-	smart_Tscrpt_reg_SCAN	ENSG00000198300		0.557	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	-	0.00	71	0	T			57335020	-1	tier1	-	no_errors	ENST00000326441	ensembl	human	known	74_37	missense	65.00	14	26	SNP	0.211	A
PFN4	375189	genome.wustl.edu	37	2	24342500	24342500	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:24342500G>T	ENST00000313213.4	-	4	679	c.308C>A	c.(307-309)aCt>aAt	p.T103N	PFN4_ENST00000465360.1_5'UTR	NM_199346.1	NP_955378.1	Q8NHR9	PROF4_HUMAN	profilin family, member 4	103					actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	lipid binding (GO:0008289)			breast(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCAGTGTAAGTTGCTACCAG	0.453																																																	0													136.0	124.0	128.0					2																	24342500		2203	4300	6503	SO:0001583	missense	0			BC029523	CCDS1709.1	2p24.1	2008-02-05			ENSG00000176732	ENSG00000176732			31103	protein-coding gene	gene with protein product							Standard	NM_199346		Approved		uc002rfa.1	Q8NHR9	OTTHUMG00000090816	ENST00000313213.4:c.308C>A	2.37:g.24342500G>T	ENSP00000322170:p.Thr103Asn		Q53TL9	Missense_Mutation	SNP	pfam_Profilin_eukaryotes/bac,superfamily_Profilin_eukaryotes/bac,smart_Profilin_eukaryotes/bac,prints_Profilin_eukaryotes/bac	p.T103N	ENST00000313213.4	37	c.308	CCDS1709.1	2	.	.	.	.	.	.	.	.	.	.	G	19.15	3.772126	0.69992	.	.	ENSG00000176732	ENST00000313213	D	0.86097	-2.07	5.42	5.42	0.78866	.	0.000000	0.64402	D	0.000004	D	0.90126	0.6915	M	0.64997	1.995	0.42298	D	0.992162	D	0.64830	0.994	D	0.65874	0.939	D	0.89287	0.3616	10	0.41790	T	0.15	-6.6912	15.0985	0.72253	0.0:0.0:1.0:0.0	.	103	Q8NHR9	PROF4_HUMAN	N	103	ENSP00000322170:T103N	ENSP00000322170:T103N	T	-	2	0	PFN4	24196004	1.000000	0.71417	0.997000	0.53966	0.728000	0.41692	3.845000	0.55880	2.721000	0.93114	0.650000	0.86243	ACT	PFN4	-	pfam_Profilin_eukaryotes/bac,superfamily_Profilin_eukaryotes/bac,smart_Profilin_eukaryotes/bac,prints_Profilin_eukaryotes/bac	ENSG00000176732		0.453	PFN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFN4	HGNC	protein_coding	OTTHUMT00000207617.2	-	0.00	65	0	G	NM_199346		24342500	-1	tier1	-	no_errors	ENST00000313213	ensembl	human	known	74_37	missense	44.68	26	21	SNP	0.996	T
PHYHIPL	84457	genome.wustl.edu	37	10	61005214	61005214	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr10:61005214G>T	ENST00000373880.4	+	5	1258	c.994G>T	c.(994-996)Gtc>Ttc	p.V332F	PHYHIPL_ENST00000373878.3_Missense_Mutation_p.V306F	NM_032439.3	NP_115815.2	Q96FC7	PHIPL_HUMAN	phytanoyl-CoA 2-hydroxylase interacting protein-like	332						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(3)|skin(1)|urinary_tract(1)	18						CATTTTAGAAGTCATTTACAC	0.438																																																	0													74.0	69.0	71.0					10																	61005214		2203	4300	6503	SO:0001583	missense	0			AL834339	CCDS7254.1, CCDS44405.1	10q21.1	2013-02-11	2006-01-09		ENSG00000165443	ENSG00000165443		"""Fibronectin type III domain containing"""	29378	protein-coding gene	gene with protein product			"""phytanoyl-CoA hydroxylase interacting protein-like"""			11347906	Standard	NM_032439		Approved	KIAA1796, Em:AC025038.1	uc001jkk.4	Q96FC7	OTTHUMG00000018276	ENST00000373880.4:c.994G>T	10.37:g.61005214G>T	ENSP00000362987:p.Val332Phe		B7WP61|Q68DF3|Q6UXY3|Q8N3W3|Q96JM9|Q96NP7	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.V332F	ENST00000373880.4	37	c.994	CCDS7254.1	10	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670589	0.67814	.	.	ENSG00000165443	ENST00000373880;ENST00000373878	T;T	0.49139	0.79;0.79	5.56	4.59	0.56863	.	0.088726	0.47455	D	0.000238	T	0.58595	0.2133	M	0.68317	2.08	0.80722	D	1	D;P	0.54772	0.968;0.947	P;P	0.54210	0.745;0.561	T	0.63060	-0.6721	10	0.72032	D	0.01	-13.0214	12.8229	0.57704	0.0873:0.0:0.9127:0.0	.	306;332	Q96FC7-2;Q96FC7	.;PHIPL_HUMAN	F	332;306	ENSP00000362987:V332F;ENSP00000362985:V306F	ENSP00000362985:V306F	V	+	1	0	PHYHIPL	60675220	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.771000	0.74996	1.196000	0.43129	0.655000	0.94253	GTC	PHYHIPL	-	NULL	ENSG00000165443		0.438	PHYHIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHYHIPL	HGNC	protein_coding	OTTHUMT00000048156.1	-	0.00	24	0	G	NM_032439		61005214	+1	tier1	-	no_errors	ENST00000373880	ensembl	human	known	74_37	missense	19.23	21	5	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178916924	178916924	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:178916924C>T	ENST00000263967.3	+	2	468	c.311C>T	c.(310-312)cCa>cTa	p.P104L		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	104	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.P104L(1)|p.P104R(1)|p.P104_G106>R(1)|p.E103_G106>D(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GTAATTGAACCAGTAGGCAAC	0.353		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	4	Substitution - Missense(2)|Complex - deletion inframe(2)	large_intestine(2)|NS(1)|breast(1)											92.0	88.0	89.0					3																	178916924		1819	4069	5888	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.311C>T	3.37:g.178916924C>T	ENSP00000263967:p.Pro104Leu		Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_dom,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.P104L	ENST00000263967.3	37	c.311	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255170	0.80135	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.73575	-0.76;-0.76	5.52	5.52	0.82312	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	D	0.83843	0.5342	L	0.56769	1.78	0.80722	D	1	D	0.67145	0.996	D	0.67382	0.951	T	0.82456	-0.0448	9	.	.	.	-19.3096	19.4272	0.94746	0.0:1.0:0.0:0.0	.	104	P42336	PK3CA_HUMAN	L	104	ENSP00000263967:P104L;ENSP00000417479:P104L	.	P	+	2	0	PIK3CA	180399618	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.484000	0.81180	2.584000	0.87258	0.555000	0.69702	CCA	PIK3CA	-	pfam_PI3K_adapt-bd_dom,smart_PI3K_adapt-bd_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2		0.00	45	0	C			178916924	+1			no_errors	ENST00000263967	ensembl	human	known	74_37	missense	5.88	32	2	SNP	1.000	T
PIGZ	80235	genome.wustl.edu	37	3	196675122	196675122	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:196675122G>T	ENST00000412723.1	-	3	792	c.646C>A	c.(646-648)Ctt>Att	p.L216I	PIGZ_ENST00000443835.1_3'UTR	NM_025163.2	NP_079439.2	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class Z	216					GPI anchor biosynthetic process (GO:0006506)|mannosylation (GO:0097502)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	alpha-1,2-mannosyltransferase activity (GO:0000026)|mannosyltransferase activity (GO:0000030)	p.L216F(1)		breast(1)|endometrium(1)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	14	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		ATGCCTCCAAGAAGCCAGCTG	0.637																																																	1	Substitution - Missense(1)	lung(1)											59.0	68.0	65.0					3																	196675122		2203	4299	6502	SO:0001583	missense	0			BC018804	CCDS3324.1	3q29	2013-02-26	2006-06-28		ENSG00000119227	ENSG00000119227		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	30596	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 4"", ""dol-P-Man dependent GPI mannosyltransferase"""	611671	"""phosphatidylinositol glycan, class Z"""			15208306	Standard	NM_025163		Approved	FLJ12768, MGC52163, SMP3	uc003fxh.3	Q86VD9	OTTHUMG00000155522	ENST00000412723.1:c.646C>A	3.37:g.196675122G>T	ENSP00000413405:p.Leu216Ile		Q9H9G6	Missense_Mutation	SNP	pfam_GPI_mannosylTrfase	p.L216I	ENST00000412723.1	37	c.646	CCDS3324.1	3	.	.	.	.	.	.	.	.	.	.	G	12.86	2.063888	0.36373	.	.	ENSG00000119227	ENST00000412723	T	0.64085	-0.08	5.13	4.19	0.49359	.	0.145674	0.31963	N	0.006798	T	0.54663	0.1872	M	0.66297	2.02	0.80722	D	1	B	0.33583	0.418	B	0.34873	0.191	T	0.49652	-0.8917	10	0.20519	T	0.43	-17.7197	7.1217	0.25448	0.0:0.2015:0.5176:0.2809	.	216	Q86VD9	PIGZ_HUMAN	I	216	ENSP00000413405:L216I	ENSP00000413405:L216I	L	-	1	0	PIGZ	198159519	0.973000	0.33851	1.000000	0.80357	0.941000	0.58515	0.527000	0.22987	2.567000	0.86603	0.549000	0.68633	CTT	PIGZ	-	pfam_GPI_mannosylTrfase	ENSG00000119227		0.637	PIGZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGZ	HGNC	protein_coding	OTTHUMT00000340486.2		0.00	65	0	G	NM_025163		196675122	-1			no_errors	ENST00000412723	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.989	T
PKHD1L1	93035	genome.wustl.edu	37	8	110477200	110477200	+	Silent	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:110477200T>C	ENST00000378402.5	+	49	8243	c.8139T>C	c.(8137-8139)ctT>ctC	p.L2713L		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2713					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCGGCCATCTTGATGAACTGG	0.468										HNSCC(38;0.096)																																							0													172.0	171.0	171.0					8																	110477200		1893	4113	6006	SO:0001819	synonymous_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8139T>C	8.37:g.110477200T>C			Q567P2|Q9UF27	Silent	SNP	pfam_IPT,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT,smart_PA14,smart_PbH1	p.L2713	ENST00000378402.5	37	c.8139	CCDS47911.1	8																																																																																			PKHD1L1	-	NULL	ENSG00000205038		0.468	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1		0.00	70	0	T	NM_177531		110477200	+1			no_errors	ENST00000378402	ensembl	human	known	74_37	silent	8.00	46	4	SNP	0.997	C
PLIN2	123	genome.wustl.edu	37	9	19123637	19123637	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:19123637C>T	ENST00000276914.2	-	4	414	c.235G>A	c.(235-237)Gcc>Acc	p.A79T	PLIN2_ENST00000380465.3_Missense_Mutation_p.A79T|PLIN2_ENST00000411567.1_Missense_Mutation_p.A79T|PLIN2_ENST00000380464.3_Missense_Mutation_p.A79T	NM_001122.3	NP_001113.2	Q99541	PLIN2_HUMAN	perilipin 2	79					cellular lipid metabolic process (GO:0044255)|lipid storage (GO:0019915)|long-chain fatty acid transport (GO:0015909)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|lipid particle (GO:0005811)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	19						TAGGTATTGGCAACTGCAACT	0.408																																																	0													101.0	84.0	90.0					9																	19123637		2203	4300	6503	SO:0001583	missense	0			X97324	CCDS6490.1	9p22.1	2009-08-12	2009-08-12	2009-08-12	ENSG00000147872	ENSG00000147872		"""Perilipins"""	248	protein-coding gene	gene with protein product	"""adipophilin"""	103195	"""adipose differentiation-related protein"""	ADFP		9003395, 19638644	Standard	NM_001122		Approved	ADRP	uc003zno.3	Q99541	OTTHUMG00000019624	ENST00000276914.2:c.235G>A	9.37:g.19123637C>T	ENSP00000276914:p.Ala79Thr		Q9BSC3	Missense_Mutation	SNP	pfam_Perilipin,pirsf_Perilipin	p.A79T	ENST00000276914.2	37	c.235	CCDS6490.1	9	.	.	.	.	.	.	.	.	.	.	C	26.4	4.734784	0.89482	.	.	ENSG00000147872	ENST00000411567;ENST00000276914;ENST00000434144;ENST00000380465;ENST00000380464	T;T;T;T;T	0.07908	3.15;3.15;3.15;3.15;3.15	5.94	5.94	0.96194	.	0.074770	0.51477	U	0.000087	T	0.39064	0.1064	M	0.89414	3.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.30416	-0.9979	10	0.72032	D	0.01	.	20.3593	0.98849	0.0:1.0:0.0:0.0	.	79;79	E9PG83;Q99541	.;PLIN2_HUMAN	T	79	ENSP00000415270:A79T;ENSP00000276914:A79T;ENSP00000403421:A79T;ENSP00000369832:A79T;ENSP00000369831:A79T	ENSP00000276914:A79T	A	-	1	0	PLIN2	19113637	1.000000	0.71417	0.999000	0.59377	0.504000	0.33889	7.188000	0.77739	2.807000	0.96579	0.591000	0.81541	GCC	PLIN2	-	pfam_Perilipin,pirsf_Perilipin	ENSG00000147872		0.408	PLIN2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	PLIN2	HGNC	protein_coding	OTTHUMT00000051835.1		0.00	51	0	C	NM_001122		19123637	-1			no_errors	ENST00000276914	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	T
PMS2	5395	genome.wustl.edu	37	7	6026831	6026831	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:6026831C>T	ENST00000265849.7	-	11	1670	c.1565G>A	c.(1564-1566)aGc>aAc	p.S522N	PMS2_ENST00000469652.1_Intron|PMS2_ENST00000406569.3_Missense_Mutation_p.S522N|PMS2_ENST00000441476.2_Missense_Mutation_p.S416N|PMS2_ENST00000382321.4_Intron	NM_000535.5	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)	522					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|single base insertion or deletion binding (GO:0032138)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(11)|lung(13)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		CCCTGGGGAGCTGGCCGCATA	0.587			"""Mis, N, F"""			"""colorectal, endometrial, ovarian, medulloblastoma, glioma"""		Direct reversal of damage;Mismatch excision repair (MMR)	Turcot syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																														yes	Rec		"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	7	7p22	5395	PMS2 postmeiotic segregation increased 2 (S. cerevisiae)		E	0													65.0	70.0	68.0					7																	6026831		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III		CCDS5343.1	7p22.1	2014-09-17	2001-11-28		ENSG00000122512	ENSG00000122512			9122	protein-coding gene	gene with protein product		600259	"""postmeiotic segregation increased (S. cerevisiae) 2"""	PMSL2		8072530	Standard	NM_000535		Approved	H_DJ0042M02.9, HNPCC4	uc003spl.3	P54278	OTTHUMG00000023135	ENST00000265849.7:c.1565G>A	7.37:g.6026831C>T	ENSP00000265849:p.Ser522Asn		B2R610|Q52LH6|Q5FBW9|Q5FBX1|Q5FBX2|Q75MR2	Missense_Mutation	SNP	pfam_MutL_C,pfam_DNA_mismatch_repair_C,pfam_HATPase_ATP-bd,superfamily_HATPase_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,smart_MutL_C,tigrfam_DNA_mismatch_repair_N	p.S522N	ENST00000265849.7	37	c.1565	CCDS5343.1	7	.	.	.	.	.	.	.	.	.	.	c	10.36	1.329978	0.24167	.	.	ENSG00000122512	ENST00000265849;ENST00000382322;ENST00000441476;ENST00000406569	T;T;D	0.87887	1.06;1.06;-2.31	5.95	3.18	0.36537	.	1.341090	0.04415	N	0.366639	D	0.82875	0.5132	L	0.42245	1.32	0.09310	N	1	B;B;B	0.18610	0.01;0.009;0.029	B;B;B	0.15870	0.006;0.004;0.014	T	0.62139	-0.6917	10	0.16420	T	0.52	-4.2898	9.6338	0.39795	0.0:0.7024:0.0:0.2976	.	522;522;416	P54278-3;P54278;C9J167	.;PMS2_HUMAN;.	N	522;475;416;522	ENSP00000265849:S522N;ENSP00000392843:S416N;ENSP00000384308:S522N	ENSP00000265849:S522N	S	-	2	0	PMS2	5993357	0.043000	0.20138	0.115000	0.21578	0.015000	0.08874	0.298000	0.19120	0.417000	0.25871	0.650000	0.86243	AGC	PMS2	-	NULL	ENSG00000122512		0.587	PMS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS2	HGNC	protein_coding	OTTHUMT00000207353.3		0.00	79	0	C	NM_000535		6026831	-1			no_errors	ENST00000265849	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.174	T
PPP4R4	57718	genome.wustl.edu	37	14	94725670	94725671	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	AG	AG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr14:94725670_94725671delAG	ENST00000304338.3	+	19	2245_2246	c.2091_2092delAG	c.(2089-2094)caagagfs	p.E698fs		NM_058237.1	NP_478144.1	Q6NUP7	PP4R4_HUMAN	protein phosphatase 4, regulatory subunit 4	698					negative regulation of phosphoprotein phosphatase activity (GO:0032515)|regulation of protein serine/threonine phosphatase activity (GO:0080163)	cytoplasm (GO:0005737)|protein serine/threonine phosphatase complex (GO:0008287)	protein phosphatase regulator activity (GO:0019888)			NS(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(15)|lung(10)|skin(7)|upper_aerodigestive_tract(2)	40						TGTTGGATCAAGAGAAAGAAAG	0.272																																																	0																																										SO:0001589	frameshift_variant	0			AB046842, BC068491	CCDS9921.1, CCDS9922.1	14q32.2	2014-07-18	2008-09-16	2008-09-16	ENSG00000119698	ENSG00000119698		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	23788	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 14"""		"""KIAA1622"""	KIAA1622		18715871	Standard	NM_020958		Approved	PP4R4, CFAP14	uc001ycs.1	Q6NUP7		ENST00000304338.3:c.2091_2092delAG	14.37:g.94725672_94725673delAG	ENSP00000305924:p.Glu698fs		Q9BUF8|Q9HCF0	Frame_Shift_Del	DEL	superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.K699fs	ENST00000304338.3	37	c.2091_2092	CCDS9921.1	14																																																																																			PPP4R4	-	NULL	ENSG00000119698		0.272	PPP4R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R4	HGNC	protein_coding	OTTHUMT00000413056.1		0.00	48	0	AG	NM_058237		94725671	+1	tier1		no_errors	ENST00000304338	ensembl	human	known	74_37	frame_shift_del	5.26	36	2	DEL	1.000:1.000	-
PRDM8	56978	genome.wustl.edu	37	4	81123235	81123235	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:81123235G>A	ENST00000504452.1	+	8	1458	c.619G>A	c.(619-621)Ggc>Agc	p.G207S	PRDM8_ENST00000339711.4_Missense_Mutation_p.G207S|PRDM8_ENST00000415738.2_Missense_Mutation_p.G207S			Q9NQV8	PRDM8_HUMAN	PR domain containing 8	207	Gly-rich.				corpus callosum morphogenesis (GO:0021540)|corticospinal tract morphogenesis (GO:0021957)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(2)	10						gggcggcggcggcggtggcaa	0.652											OREG0016246	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													25.0	32.0	30.0					4																	81123235		2005	4172	6177	SO:0001583	missense	0			AF275815	CCDS43243.1	4q21	2008-08-21				ENSG00000152784			13993	protein-coding gene	gene with protein product							Standard	NM_020226		Approved		uc003hmc.4	Q9NQV8		ENST00000504452.1:c.619G>A	4.37:g.81123235G>A	ENSP00000423985:p.Gly207Ser	1203	A8K7X2|Q6IQ36	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G207S	ENST00000504452.1	37	c.619	CCDS43243.1	4	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462325	0.43736	.	.	ENSG00000152784	ENST00000504452;ENST00000515013;ENST00000339711;ENST00000415738	T;T;T;T	0.64085	-0.08;0.49;-0.08;-0.08	4.08	3.22	0.36961	.	0.000000	0.38897	N	0.001530	T	0.61299	0.2336	L	0.27053	0.805	0.24873	N	0.992276	D	0.89917	1.0	D	0.66497	0.944	T	0.51718	-0.8670	10	0.22706	T	0.39	.	9.5671	0.39405	0.0:0.2144:0.7856:0.0	.	207	Q9NQV8	PRDM8_HUMAN	S	207	ENSP00000423985:G207S;ENSP00000425149:G207S;ENSP00000339764:G207S;ENSP00000406998:G207S	ENSP00000339764:G207S	G	+	1	0	PRDM8	81342259	0.969000	0.33509	0.913000	0.36048	0.142000	0.21351	1.605000	0.36815	0.894000	0.36317	0.313000	0.20887	GGC	PRDM8	-	NULL	ENSG00000152784		0.652	PRDM8-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRDM8	HGNC	protein_coding	OTTHUMT00000362793.1	-	0.00	81	0	G			81123235	+1	tier1	-	no_errors	ENST00000339711	ensembl	human	known	74_37	missense	34.62	34	18	SNP	0.876	A
PREX2	80243	genome.wustl.edu	37	8	68968135	68968135	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:68968135G>A	ENST00000288368.4	+	10	1441	c.1164G>A	c.(1162-1164)atG>atA	p.M388I	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	388					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TTTATAAAATGATGTGCAGAC	0.398																																																	0													103.0	113.0	109.0					8																	68968135		2203	4300	6503	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1164G>A	8.37:g.68968135G>A	ENSP00000288368:p.Met388Ile		B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.M388I	ENST00000288368.4	37	c.1164	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213267	0.58452	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.14022	2.54	5.69	5.69	0.88448	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.113461	0.64402	D	0.000007	T	0.19805	0.0476	L	0.36672	1.1	0.48341	D	0.999633	B;B;B	0.34241	0.202;0.444;0.363	B;B;B	0.42030	0.281;0.103;0.373	T	0.01259	-1.1403	10	0.48119	T	0.1	.	20.181	0.98201	0.0:0.0:1.0:0.0	.	388;388;388	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	I	388	ENSP00000288368:M388I	ENSP00000288368:M388I	M	+	3	0	PREX2	69130689	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.094000	0.64523	2.840000	0.97914	0.655000	0.94253	ATG	PREX2	-	NULL	ENSG00000046889		0.398	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	58	0	G	NM_025170		68968135	+1	tier1	-	no_errors	ENST00000288368	ensembl	human	known	74_37	missense	19.72	57	14	SNP	1.000	A
PREX2	80243	genome.wustl.edu	37	8	69017554	69017554	+	Intron	SNP	T	T	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:69017554T>A	ENST00000288368.4	+	24	2992				PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2						adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CCTGAGGACCTTCCTTCTCAA	0.507																																																	0													99.0	82.0	88.0					8																	69017554		2203	4300	6503	SO:0001627	intron_variant	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2716-2790T>A	8.37:g.69017554T>A			B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	RNA	SNP	-	NULL	ENST00000288368.4	37	NULL	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	T	5.682	0.310491	0.10733	.	.	ENSG00000046889	ENST00000354677	.	.	.	1.81	1.81	0.25067	.	.	.	.	.	T	0.14960	0.0361	.	.	.	0.19300	N	0.999976	P	0.43392	0.805	B	0.24394	0.053	T	0.17501	-1.0367	7	0.87932	D	0	.	5.6759	0.17747	0.0:0.0:0.0:1.0	.	966	Q70Z35-3	.	H	966	.	ENSP00000346707:L966H	L	+	2	0	PREX2	69180108	0.003000	0.15002	0.008000	0.14137	0.023000	0.10783	1.819000	0.39022	1.088000	0.41272	0.377000	0.23210	CTT	PREX2	-	-	ENSG00000046889		0.507	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	-	0.00	36	0	T	NM_025170		69017554	+1	tier1	-	no_errors	ENST00000529398	ensembl	human	known	74_37	rna	17.24	48	10	SNP	0.011	A
PRMT1	3276	genome.wustl.edu	37	19	50180545	50180545	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:50180545C>T	ENST00000391851.4	+	1	137	c.8C>T	c.(7-9)gCa>gTa	p.A3V	PRMT1_ENST00000454376.2_Missense_Mutation_p.A3V|PRMT1_ENST00000532489.1_Intron	NM_198318.4	NP_938074.2	Q99873	ANM1_HUMAN	protein arginine methyltransferase 1	0					cell surface receptor signaling pathway (GO:0007166)|histone H4-R3 methylation (GO:0043985)|histone methylation (GO:0016571)|negative regulation of megakaryocyte differentiation (GO:0045653)|neuron projection development (GO:0031175)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|protein methylation (GO:0006479)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|identical protein binding (GO:0042802)|methyltransferase activity (GO:0008168)|N-methyltransferase activity (GO:0008170)|poly(A) RNA binding (GO:0044822)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(2)	12		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00103)|GBM - Glioblastoma multiforme(134;0.012)		AAGATGGCGGCAGCCGAGGCC	0.687																																																	0													29.0	43.0	39.0					19																	50180545		1977	4176	6153	SO:0001583	missense	0			D66904	CCDS42592.1, CCDS46145.1, CCDS74425.1	19q13	2014-06-12	2006-02-16	2006-02-16	ENSG00000126457	ENSG00000126457	2.1.1.125	"""Protein arginine methyltransferases"""	5187	protein-coding gene	gene with protein product		602950	"""HMT1 (hnRNP methyltransferase, S. cerevisiae)-like 2"", ""HMT1 hnRNP methyltransferase-like 2 (S. cerevisiae)"""	HRMT1L2		9545638	Standard	NM_001207042		Approved	HCP1, ANM1	uc010enf.2	Q99873	OTTHUMG00000167568	ENST00000391851.4:c.8C>T	19.37:g.50180545C>T	ENSP00000375724:p.Ala3Val		B4E3C3|G5E9B6|Q15529|Q2VP93|Q6LEU5|Q8WUW5|Q99872|Q99874|Q9NZ04|Q9NZ05|Q9NZ06	Missense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Arg_MeTrfase,pfam_Methyltransf_11,pfam_Small_mtfrase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.A3V	ENST00000391851.4	37	c.8	CCDS42592.1	19	.	.	.	.	.	.	.	.	.	.	C	19.28	3.796554	0.70567	.	.	ENSG00000126457	ENST00000391851;ENST00000454376	T;T	0.27402	1.75;1.67	4.97	4.97	0.65823	.	.	.	.	.	T	0.38612	0.1047	N	0.19112	0.55	0.34547	D	0.710902	D	0.60575	0.988	D	0.70935	0.971	T	0.46148	-0.9212	9	0.40728	T	0.16	0.0046	13.6009	0.62018	0.0:1.0:0.0:0.0	.	3	G5E9B6	.	V	3	ENSP00000375724:A3V;ENSP00000406162:A3V	ENSP00000375724:A3V	A	+	2	0	PRMT1	54872357	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	3.287000	0.51732	2.575000	0.86900	0.655000	0.94253	GCA	PRMT1	-	NULL	ENSG00000126457		0.687	PRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT1	HGNC	protein_coding	OTTHUMT00000395065.1	-	0.00	205	0	C	NM_001536		50180545	+1	tier1	-	no_errors	ENST00000454376	ensembl	human	known	74_37	missense	5.53	187	11	SNP	1.000	T
PRNP	5621	genome.wustl.edu	37	20	4680395	4680395	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr20:4680395C>T	ENST00000379440.4	+	2	816	c.529C>T	c.(529-531)Cac>Tac	p.H177Y	PRNP_ENST00000430350.2_Missense_Mutation_p.H177Y	NM_000311.3|NM_001080121.1|NM_001080122.1|NM_001080123.1|NM_001271561.1|NM_183079.2	NP_000302.1|NP_001073590.1|NP_001073591.1|NP_001073592.1|NP_001258490.1|NP_898902.1	F7VJQ1	APRIO_HUMAN	prion protein	0						integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)				central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	14						CAACTTTGTGCACGACTGCGT	0.507																																																	0													164.0	133.0	143.0					20																	4680395		2203	4300	6503	SO:0001583	missense	0			M13899	CCDS13080.1	20p13	2014-06-05	2008-07-28		ENSG00000171867	ENSG00000171867		"""CD molecules"""	9449	protein-coding gene	gene with protein product	"""Creutzfeldt-Jakob disease"", ""Gerstmann-Strausler-Scheinker syndrome"", ""fatal familial insomnia"", ""p27-30"""	176640	"""prion protein (p27-30)"""	PRIP, GSS, CJD			Standard	NM_000311		Approved	CD230, PRP, AltPrP	uc002wkw.4	F7VJQ1	OTTHUMG00000031786	ENST00000379440.4:c.529C>T	20.37:g.4680395C>T	ENSP00000368752:p.His177Tyr			Missense_Mutation	SNP	pfam_Prion/Doppel_prot_b-ribbon_dom,pfam_Prion_N_dom,superfamily_Prion/Doppel_prot_b-ribbon_dom,smart_Prion,prints_Prion	p.H177Y	ENST00000379440.4	37	c.529	CCDS13080.1	20	.	.	.	.	.	.	.	.	.	.	C	18.49	3.635442	0.67130	.	.	ENSG00000171867	ENST00000379440;ENST00000430350;ENST00000424424;ENST00000444805;ENST00000457586	D;D;D;D	0.92397	-3.03;-3.03;-3.03;-2.45	5.28	5.28	0.74379	Prion/Doppel protein, beta-ribbon domain (3);	0.665977	0.14689	N	0.304264	D	0.95557	0.8556	M	0.73962	2.25	0.34888	D	0.745285	P;P;D	0.65815	0.71;0.91;0.995	P;P;D	0.68483	0.534;0.826;0.958	D	0.97498	1.0058	10	0.87932	D	0	-16.6843	14.4135	0.67132	0.0:1.0:0.0:0.0	.	177;177;209	B2NI04;P04156;O75942	.;PRIO_HUMAN;.	Y	177;177;177;116;177	ENSP00000368752:H177Y;ENSP00000399376:H177Y;ENSP00000411599:H177Y;ENSP00000415284:H177Y	ENSP00000368752:H177Y	H	+	1	0	PRNP	4628395	0.788000	0.28762	0.998000	0.56505	0.998000	0.95712	1.049000	0.30392	2.480000	0.83734	0.655000	0.94253	CAC	PRNP	-	pfam_Prion/Doppel_prot_b-ribbon_dom,superfamily_Prion/Doppel_prot_b-ribbon_dom,smart_Prion	ENSG00000171867		0.507	PRNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRNP	HGNC	protein_coding	OTTHUMT00000077820.2	-	0.00	54	0	C	NM_000311		4680395	+1	tier1	-	no_errors	ENST00000379440	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.995	T
PRPF8	10594	genome.wustl.edu	37	17	1586912	1586912	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:1586912G>A	ENST00000572621.1	-	2	449	c.184C>T	c.(184-186)Ccc>Tcc	p.P62S	PRPF8_ENST00000304992.6_Missense_Mutation_p.P62S			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	62					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TGTTCTGGGGGCATGTCTTCC	0.507																																																	0													196.0	166.0	176.0					17																	1586912		2203	4300	6503	SO:0001583	missense	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.184C>T	17.37:g.1586912G>A	ENSP00000460348:p.Pro62Ser		O14547|O75965	Missense_Mutation	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_PRO8NT,pfam_Prp8_U5-snRNA-bd,pfam_PROCT,pfam_RRM_spliceosomal_PrP8,pfam_JAB_MPN_dom,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB_MPN_dom	p.P62S	ENST00000572621.1	37	c.184	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	G	32	5.191803	0.94923	.	.	ENSG00000174231	ENST00000304992	T	0.54279	0.58	5.41	5.41	0.78517	Pre-mRNA-processing-splicing factor 8 (2);	0.000000	0.85682	D	0.000000	T	0.78310	0.4263	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81775	-0.0778	10	0.59425	D	0.04	.	19.1993	0.93704	0.0:0.0:1.0:0.0	.	62	Q6P2Q9	PRP8_HUMAN	S	62	ENSP00000304350:P62S	ENSP00000304350:P62S	P	-	1	0	PRPF8	1533662	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	9.185000	0.94900	2.534000	0.85438	0.467000	0.42956	CCC	PRPF8	-	pfam_PRO8NT	ENSG00000174231		0.507	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	-	0.00	90	0	G			1586912	-1	tier1	-	no_errors	ENST00000304992	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
PRR3	80742	genome.wustl.edu	37	6	30531428	30531428	+	3'UTR	DEL	T	T	-	rs563052704	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:30531428delT	ENST00000376560.3	+	0	2182				PRR3_ENST00000376557.3_3'UTR|PRR3_ENST00000498336.1_3'UTR	NM_025263.3	NP_079539.2	P79522	PRR3_HUMAN	proline rich 3								metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			lung(1)|ovary(1)	2						GAGAATGAGGttttttttttt	0.378													|||unknown(HR)	449	0.0896565	0.1483	0.0807	5008	,	,		17388	0.0665		0.0865	False		,,,				2504	0.044																0																																										SO:0001624	3_prime_UTR_variant	0			AK074531	CCDS43440.1, CCDS43441.1	6p21.32	2013-01-18	2004-05-27		ENSG00000204576	ENSG00000204576		"""Zinc fingers, CCCH-type domain containing"""	21149	protein-coding gene	gene with protein product			"""proline-rich polpeptide 3"""				Standard	NM_025263		Approved	CAT56, Em:AB014077.1, Em:AB023052.2	uc003nqi.2	P79522	OTTHUMG00000031037	ENST00000376560.3:c.*1156T>-	6.37:g.30531428delT			A1A4H4|Q5RJB5|Q5STN6	RNA	DEL	-	NULL	ENST00000376560.3	37	NULL	CCDS43440.1	6																																																																																			PRR3	-	-	ENSG00000204576		0.378	PRR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR3	HGNC	protein_coding	OTTHUMT00000076033.2		0.00	34	0	T	NM_025263		30531428	+1	tier1		no_errors	ENST00000481741	ensembl	human	known	74_37	rna	16.13	26	5	DEL	0.005	-
PRRC2C	23215	genome.wustl.edu	37	1	171492410	171492410	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:171492410G>A	ENST00000338920.4	+	8	1115	c.878G>A	c.(877-879)cGc>cAc	p.R293H	PRRC2C_ENST00000476522.1_3'UTR|PRRC2C_ENST00000392078.3_Missense_Mutation_p.R295H|PRRC2C_ENST00000426496.2_Missense_Mutation_p.R293H|PRRC2C_ENST00000367742.3_Missense_Mutation_p.R295H	NM_015172.3	NP_055987.2	Q9Y520	PRC2C_HUMAN	proline-rich coiled-coil 2C	293					hematopoietic progenitor cell differentiation (GO:0002244)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)										GAGCCTGAACGCCCATCCATT	0.443																																																	0													56.0	52.0	54.0					1																	171492410		2203	4300	6503	SO:0001583	missense	0			AL096857	CCDS1296.2	1q24.3	2012-07-18	2010-12-09	2010-12-09	ENSG00000117523	ENSG00000117523			24903	protein-coding gene	gene with protein product			"""BAT2 domain containing 1"", ""HLA-B associated transcript 2-like 2"""	BAT2D1, BAT2L2		10470851, 12443540	Standard	NM_015172		Approved	KIAA1096, XTP2	uc010pmg.2	Q9Y520	OTTHUMG00000034665	ENST00000338920.4:c.878G>A	1.37:g.171492410G>A	ENSP00000343629:p.Arg293His		Q05DM8|Q49A39|Q6PD54|Q9H2N2|Q9HA05|Q9NSM8|Q9NXL3|Q9UF29|Q9UPQ6	Missense_Mutation	SNP	pfam_BAT2_N	p.R295H	ENST00000338920.4	37	c.884	CCDS1296.2	1	.	.	.	.	.	.	.	.	.	.	G	17.25	3.341813	0.61073	.	.	ENSG00000117523	ENST00000392078;ENST00000451306;ENST00000426496;ENST00000367742;ENST00000338920;ENST00000392080;ENST00000483654	T;T;T;T	0.03920	3.77;3.77;3.76;3.76	5.23	5.23	0.72850	.	0.000000	0.43260	U	0.000582	T	0.17066	0.0410	M	0.77486	2.375	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.01048	-1.1469	10	0.72032	D	0.01	.	18.8324	0.92145	0.0:0.0:1.0:0.0	.	293;295	Q9Y520-4;E7EPN9	.;.	H	295;293;293;295;293;49;51	ENSP00000375928:R295H;ENSP00000410219:R293H;ENSP00000356716:R295H;ENSP00000343629:R293H	ENSP00000343629:R293H	R	+	2	0	PRRC2C	169759034	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.110000	0.94302	2.448000	0.82819	0.655000	0.94253	CGC	PRRC2C	-	NULL	ENSG00000117523		0.443	PRRC2C-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRRC2C	HGNC	protein_coding	OTTHUMT00000314826.4	-	0.00	49	0	G	NM_015172		171492410	+1	tier1	-	no_errors	ENST00000392078	ensembl	human	known	74_37	missense	19.57	37	9	SNP	1.000	A
PSORS1C1	170679	genome.wustl.edu	37	6	31106527	31106527	+	Silent	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:31106527T>C	ENST00000259881.9	+	5	427	c.138T>C	c.(136-138)ctT>ctC	p.L46L	PSORS1C2_ENST00000259845.4_Intron|PSORS1C1_ENST00000547221.1_5'UTR|PSORS1C1_ENST00000481450.2_Intron	NM_014068.2	NP_054787.2	Q9UIG5	PS1C1_HUMAN	psoriasis susceptibility 1 candidate 1	46										kidney(1)|ovary(2)|prostate(1)|skin(1)	5						CTGACCGACTTTGCCACATGG	0.562																																																	0													155.0	153.0	153.0					6																	31106527		1511	2709	4220	SO:0001819	synonymous_variant	0			AB031479	CCDS34390.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204540	ENSG00000204540			17202	protein-coding gene	gene with protein product		613525	"""chromosome 6 open reading frame 16"""	C6orf16			Standard	NM_014068		Approved	SEEK1	uc003nsl.2	Q9UIG5	OTTHUMG00000031077	ENST00000259881.9:c.138T>C	6.37:g.31106527T>C			B0V083|Q5ST21|Q86WJ8|Q86WJ9|Q96QC3	Silent	SNP	NULL	p.L46	ENST00000259881.9	37	c.138	CCDS34390.1	6																																																																																			PSORS1C1	-	NULL	ENSG00000204540		0.562	PSORS1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSORS1C1	HGNC	protein_coding	OTTHUMT00000076110.3	-	0.00	79	0	T	NM_014068		31106527	+1	tier1	-	no_errors	ENST00000259881	ensembl	human	known	74_37	silent	6.90	54	4	SNP	0.000	C
PTPN4	5775	genome.wustl.edu	37	2	120714494	120714494	+	Nonsense_Mutation	SNP	C	C	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:120714494C>G	ENST00000263708.2	+	21	2826	c.2055C>G	c.(2053-2055)taC>taG	p.Y685*	PTPN4_ENST00000544261.1_Nonsense_Mutation_p.Y318*	NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	685	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	AAAATAGATACAGAGATATTT	0.259																																																	0													68.0	77.0	74.0					2																	120714494		2203	4298	6501	SO:0001587	stop_gained	0				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.2055C>G	2.37:g.120714494C>G	ENSP00000263708:p.Tyr685*		B2RBV8|Q9UDA7	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,pfam_PDZ,pfam_FERM-adjacent,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin_like	p.Y685*	ENST00000263708.2	37	c.2055	CCDS2129.1	2	.	.	.	.	.	.	.	.	.	.	C	17.34	3.365231	0.61513	.	.	ENSG00000088179	ENST00000263708;ENST00000544261	.	.	.	5.28	4.4	0.53042	.	0.057968	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.7414	0.62849	0.0:0.9255:0.0:0.0745	.	.	.	.	X	685;318	.	ENSP00000263708:Y685X	Y	+	3	2	PTPN4	120430964	1.000000	0.71417	1.000000	0.80357	0.029000	0.11900	4.909000	0.63314	1.208000	0.43306	0.655000	0.94253	TAC	PTPN4	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pirsf_Tyr_Pase_non-rcpt_typ-3/4,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000088179		0.259	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN4	HGNC	protein_coding	OTTHUMT00000254233.2	-	0.00	131	0	C			120714494	+1	tier1	-	no_errors	ENST00000263708	ensembl	human	known	74_37	nonsense	5.00	95	5	SNP	1.000	G
PUM1	9698	genome.wustl.edu	37	1	31438993	31438993	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:31438993G>A	ENST00000257075.5	-	13	2015	c.1922C>T	c.(1921-1923)gCa>gTa	p.A641V	SNORD85_ENST00000363311.1_RNA|PUM1_ENST00000423018.2_Missense_Mutation_p.A497V|PUM1_ENST00000424085.2_Missense_Mutation_p.A399V|PUM1_ENST00000440538.2_Missense_Mutation_p.A615V|PUM1_ENST00000490546.1_Intron|PUM1_ENST00000373742.2_Missense_Mutation_p.A582V|PUM1_ENST00000373741.4_Missense_Mutation_p.A677V|PUM1_ENST00000426105.2_Missense_Mutation_p.A641V|PUM1_ENST00000373747.3_Missense_Mutation_p.A642V	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	641					membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		AGAACTGGATGCCAGGTTGTT	0.557																																																	0													137.0	132.0	134.0					1																	31438993		2203	4300	6503	SO:0001583	missense	0			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.1922C>T	1.37:g.31438993G>A	ENSP00000257075:p.Ala641Val		A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.A641V	ENST00000257075.5	37	c.1922	CCDS338.1	1	.	.	.	.	.	.	.	.	.	.	G	18.87	3.715931	0.68844	.	.	ENSG00000134644	ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742	T;T;T;T;T;T;T;T	0.18810	2.2;2.19;2.45;2.45;2.46;2.44;2.48;2.19	5.95	5.95	0.96441	.	0.047293	0.85682	D	0.000000	T	0.27454	0.0674	L	0.40543	1.245	0.52099	D	0.999949	D;B;P;B;P;P;P;P	0.54772	0.968;0.041;0.944;0.069;0.913;0.856;0.913;0.913	P;B;P;B;B;B;B;B	0.48654	0.585;0.051;0.585;0.109;0.445;0.445;0.445;0.445	T	0.00460	-1.1726	10	0.22109	T	0.4	-7.5831	20.3931	0.98965	0.0:0.0:1.0:0.0	.	582;497;677;615;641;641;642;641	B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5	.;.;.;.;PUM1_HUMAN;.;.;.	V	399;641;642;379;641;615;677;497;582	ENSP00000400141:A399V;ENSP00000257075:A641V;ENSP00000362852:A642V;ENSP00000391723:A641V;ENSP00000401777:A615V;ENSP00000362846:A677V;ENSP00000399440:A497V;ENSP00000362847:A582V	ENSP00000257075:A641V	A	-	2	0	PUM1	31211580	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.175000	0.65021	2.824000	0.97209	0.655000	0.94253	GCA	PUM1	-	NULL	ENSG00000134644		0.557	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PUM1	HGNC	protein_coding	OTTHUMT00000010671.1	-	0.00	122	0	G			31438993	-1	tier1	-	no_errors	ENST00000426105	ensembl	human	known	74_37	missense	22.62	65	19	SNP	1.000	A
RALA	5898	genome.wustl.edu	37	7	39730055	39730055	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:39730055G>T	ENST00000005257.2	+	3	569	c.189G>T	c.(187-189)caG>caT	p.Q63H	RALA_ENST00000468201.1_Intron	NM_005402.3	NP_005393.2	P11233	RALA_HUMAN	v-ral simian leukemia viral oncogene homolog A (ras related)	63					actin cytoskeleton reorganization (GO:0031532)|chemotaxis (GO:0006935)|cytokinesis (GO:0000910)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|membrane raft localization (GO:0051665)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of filopodium assembly (GO:0051491)|Ras protein signal transduction (GO:0007265)|regulation of exocytosis (GO:0017157)|signal transduction (GO:0007165)|viral process (GO:0016032)	cell surface (GO:0009986)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	Edg-2 lysophosphatidic acid receptor binding (GO:0031755)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.Q63Q(1)		NS(1)|central_nervous_system(1)|large_intestine(2)|lung(9)|skin(3)	16						AGGAAGTCCAGATCGATATCT	0.458																																																	1	Substitution - coding silent(1)	skin(1)											96.0	100.0	99.0					7																	39730055		2203	4300	6503	SO:0001583	missense	0				CCDS5460.1	7p22-p15	2014-05-09			ENSG00000006451	ENSG00000006451			9839	protein-coding gene	gene with protein product	"""RAS-like protein A"", ""Ras-related protein Ral-A"", ""Ras family small GTP binding protein RALA"", ""ras related GTP binding protein A"""	179550		RAL		3292391	Standard	NM_005402		Approved		uc003thd.3	P11233	OTTHUMG00000128775	ENST00000005257.2:c.189G>T	7.37:g.39730055G>T	ENSP00000005257:p.Gln63His		A4D1W3	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Q63H	ENST00000005257.2	37	c.189	CCDS5460.1	7	.	.	.	.	.	.	.	.	.	.	G	12.51	1.960976	0.34565	.	.	ENSG00000006451	ENST00000005257;ENST00000436179	T;T	0.76968	-1.06;-1.06	4.76	4.76	0.60689	Small GTP-binding protein domain (1);	0.115588	0.64402	D	0.000006	T	0.64294	0.2585	N	0.17248	0.465	0.80722	D	1	B	0.18741	0.03	B	0.22753	0.041	T	0.64326	-0.6434	10	0.87932	D	0	.	11.8738	0.52536	0.0918:0.0:0.9082:0.0	.	63	P11233	RALA_HUMAN	H	63	ENSP00000005257:Q63H;ENSP00000388975:Q63H	ENSP00000005257:Q63H	Q	+	3	2	RALA	39696580	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	4.357000	0.59436	2.477000	0.83638	0.305000	0.20034	CAG	RALA	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000006451		0.458	RALA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALA	HGNC	protein_coding	OTTHUMT00000250696.2		0.00	51	0	G	NM_005402		39730055	+1			no_errors	ENST00000005257	ensembl	human	known	74_37	missense	5.56	51	3	SNP	1.000	T
RBM6	10180	genome.wustl.edu	37	3	50004793	50004794	+	Intron	INS	-	-	A	rs377257427		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:50004793_50004794insA	ENST00000266022.4	+	3	303				RBM6_ENST00000442092.1_Intron|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000422955.1_Intron|RBM6_ENST00000443081.1_5'UTR|RBM6_ENST00000441115.1_Intron	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6						RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		AGAACTCTGCCAAAAAAAAAAT	0.361																																																	0																																										SO:0001627	intron_variant	0			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.45-109->A	3.37:g.50004803_50004803dupA			O60549|O75524|Q86SS3	RNA	INS	-	NULL	ENST00000266022.4	37	NULL	CCDS2809.1	3																																																																																			RBM6	-	-	ENSG00000004534		0.361	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	HGNC	protein_coding	OTTHUMT00000345528.4		0.00	17	0	-	NM_005777		50004794	+1	tier1		no_errors	ENST00000488807	ensembl	human	putative	74_37	rna	25.00	9	3	INS	1.000:1.000	A
RDX	5962	genome.wustl.edu	37	11	110143263	110143263	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:110143263G>T	ENST00000343115.4	-	3	413	c.94C>A	c.(94-96)Cag>Aag	p.Q32K	RDX_ENST00000544551.1_Silent_p.T19T|RDX_ENST00000405097.1_Missense_Mutation_p.Q32K|RDX_ENST00000528498.1_Missense_Mutation_p.Q32K|RDX_ENST00000528900.1_Intron|RDX_ENST00000530301.1_Missense_Mutation_p.Q32K	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	P35241	RADI_HUMAN	radixin	32	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		TGTAATACCTGGTCAAAAAGT	0.363																																					Esophageal Squamous(55;25 1062 11040 28755 44273)												0													114.0	95.0	101.0					11																	110143263		2201	4298	6499	SO:0001583	missense	0			BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000343115.4:c.94C>A	11.37:g.110143263G>T	ENSP00000342830:p.Gln32Lys		A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	p.Q32K	ENST00000343115.4	37	c.94	CCDS8343.1	11	.	.	.	.	.	.	.	.	.	.	G	21.9	4.214080	0.79352	.	.	ENSG00000137710	ENST00000528498;ENST00000429481;ENST00000405097;ENST00000530301;ENST00000343115;ENST00000532118;ENST00000533991	T;T;T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05;-1.05;-1.05	4.95	4.95	0.65309	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.122924	0.64402	D	0.000020	T	0.82148	0.4974	M	0.72576	2.205	0.80722	D	1	P;P;B	0.43938	0.784;0.822;0.188	P;P;B	0.48952	0.54;0.596;0.131	T	0.79427	-0.1808	10	0.23302	T	0.38	.	18.3697	0.90402	0.0:0.0:1.0:0.0	.	32;32;32	A7YIK0;A7YIJ8;P35241	.;.;RADI_HUMAN	K	32;32;32;32;32;21;21	ENSP00000432112:Q32K;ENSP00000384136:Q32K;ENSP00000436277:Q32K;ENSP00000342830:Q32K;ENSP00000437140:Q21K;ENSP00000432572:Q21K	ENSP00000342830:Q32K	Q	-	1	0	RDX	109648473	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.153000	0.94687	2.570000	0.86706	0.655000	0.94253	CAG	RDX	-	pirsf_ERM,pfam_FERM_N,smart_Band_41_domain,prints_Ez/rad/moesin_like,pfscan_FERM_domain	ENSG00000137710		0.363	RDX-001	KNOWN	basic|CCDS	protein_coding	RDX	HGNC	protein_coding	OTTHUMT00000390535.2	-	0.00	45	0	G	NM_002906		110143263	-1	tier1	-	no_errors	ENST00000530749	ensembl	human	known	74_37	missense	10.00	36	4	SNP	1.000	T
RECQL	5965	genome.wustl.edu	37	12	21636458	21636458	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:21636458T>G	ENST00000444129.2	-	6	1020	c.552A>C	c.(550-552)ttA>ttC	p.L184F	RECQL_ENST00000421138.2_Missense_Mutation_p.L184F	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	184	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						AAATCAGCTTTAACTCGGAGT	0.333								Other identified genes with known or suspected DNA repair function																																									0													115.0	104.0	108.0					12																	21636458		2203	4300	6503	SO:0001583	missense	0			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.552A>C	12.37:g.21636458T>G	ENSP00000416739:p.Leu184Phe		A8K6G2	Missense_Mutation	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_RQC_domain,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.L184F	ENST00000444129.2	37	c.552	CCDS31756.1	12	.	.	.	.	.	.	.	.	.	.	T	12.00	1.807556	0.31961	.	.	ENSG00000004700	ENST00000444129;ENST00000421138;ENST00000396093;ENST00000314748	T;T;T;T	0.15603	2.41;2.41;2.41;2.41	4.67	-0.512	0.11966	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.126802	0.53938	D	0.000046	T	0.17023	0.0409	L	0.46157	1.445	0.38982	D	0.958964	P	0.36065	0.535	P	0.45856	0.495	T	0.08953	-1.0697	10	0.28530	T	0.3	0.033	6.0397	0.19728	0.0:0.3847:0.1409:0.4744	.	184	P46063	RECQ1_HUMAN	F	184	ENSP00000416739:L184F;ENSP00000395449:L184F;ENSP00000379400:L184F;ENSP00000318727:L184F	ENSP00000318727:L184F	L	-	3	2	RECQL	21527725	0.995000	0.38212	0.846000	0.33378	0.984000	0.73092	0.219000	0.17641	0.008000	0.14787	0.460000	0.39030	TTA	RECQL	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000004700		0.333	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL	HGNC	protein_coding	OTTHUMT00000402371.1	-	0.00	78	0	T	NM_002907		21636458	-1	tier1	-	no_errors	ENST00000421138	ensembl	human	known	74_37	missense	13.11	53	8	SNP	0.995	G
REV3L	5980	genome.wustl.edu	37	6	111688631	111688631	+	Silent	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:111688631A>G	ENST00000358835.3	-	15	6814	c.6360T>C	c.(6358-6360)ccT>ccC	p.P2120P	REV3L_ENST00000435970.1_Silent_p.P2042P|REV3L_ENST00000368805.1_Silent_p.P2120P|REV3L_ENST00000368802.3_Silent_p.P2120P			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2120					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		CTGGAGAATCAGGGGAGCTAT	0.443								DNA polymerases (catalytic subunits)																																									0													144.0	141.0	142.0					6																	111688631		2203	4300	6503	SO:0001819	synonymous_variant	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.6360T>C	6.37:g.111688631A>G			O43214|Q5TC33	Silent	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.P2120	ENST00000358835.3	37	c.6360	CCDS5091.2	6																																																																																			REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.443	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	-	0.00	84	0	A	NM_002912		111688631	-1	tier1	-	no_errors	ENST00000358835	ensembl	human	known	74_37	silent	7.14	51	4	SNP	0.997	G
RFXAP	5994	genome.wustl.edu	37	13	37401814	37401814	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr13:37401814T>C	ENST00000255476.2	+	3	877	c.743T>C	c.(742-744)tTa>tCa	p.L248S	RFXAP_ENST00000472888.1_3'UTR	NM_000538.3	NP_000529.1	O00287	RFXAP_HUMAN	regulatory factor X-associated protein	248	C-terminal domain.				positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(1)	4		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;3.5e-07)|Epithelial(112;1.27e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.0069)|BRCA - Breast invasive adenocarcinoma(63;0.0116)|GBM - Glioblastoma multiforme(144;0.0405)		GTGCAATTTTTACAGAAACAG	0.333																																																	0													96.0	91.0	93.0					13																	37401814		2203	4300	6503	SO:0001583	missense	0			Y12812	CCDS9359.1	13q14	2014-09-17			ENSG00000133111	ENSG00000133111			9988	protein-coding gene	gene with protein product		601861				9118943	Standard	NM_000538		Approved		uc001uvu.1	O00287	OTTHUMG00000016738	ENST00000255476.2:c.743T>C	13.37:g.37401814T>C	ENSP00000255476:p.Leu248Ser		B2R9T8|Q5VZM6|Q8TC40	Missense_Mutation	SNP	NULL	p.L248S	ENST00000255476.2	37	c.743	CCDS9359.1	13	.	.	.	.	.	.	.	.	.	.	T	14.15	2.450034	0.43531	.	.	ENSG00000133111	ENST00000255476	.	.	.	5.53	4.31	0.51392	.	0.085566	0.48286	D	0.000192	T	0.71048	0.3294	M	0.61703	1.905	0.58432	D	0.999995	D	0.89917	1.0	D	0.87578	0.998	T	0.72214	-0.4358	9	0.87932	D	0	-4.7647	10.6701	0.45753	0.1435:0.0:0.0:0.8565	.	248	O00287	RFXAP_HUMAN	S	248	.	ENSP00000255476:L248S	L	+	2	0	RFXAP	36299814	1.000000	0.71417	1.000000	0.80357	0.228000	0.25075	6.127000	0.71642	0.868000	0.35678	0.477000	0.44152	TTA	RFXAP	-	NULL	ENSG00000133111		0.333	RFXAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFXAP	HGNC	protein_coding	OTTHUMT00000044521.1	-	0.00	141	0	T	NM_000538		37401814	+1	tier1	-	no_errors	ENST00000255476	ensembl	human	known	74_37	missense	37.14	66	39	SNP	1.000	C
RIMBP2	23504	genome.wustl.edu	37	12	130926745	130926745	+	Silent	SNP	G	G	T	rs377474816		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:130926745G>T	ENST00000261655.4	-	8	1264	c.1101C>A	c.(1099-1101)tcC>tcA	p.S367S	RIMBP2_ENST00000536002.1_Silent_p.S275S|RIMBP2_ENST00000535703.1_Silent_p.S275S	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	367	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)		p.S367S(1)		NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		CGCACTGCACGGAGATGCGGT	0.632																																																	1	Substitution - coding silent(1)	endometrium(1)											147.0	140.0	142.0					12																	130926745		2203	4300	6503	SO:0001819	synonymous_variant	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.1101C>A	12.37:g.130926745G>T			Q96ID2	Silent	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.S367	ENST00000261655.4	37	c.1101	CCDS31925.1	12																																																																																			RIMBP2	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000060709		0.632	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1		0.00	37	0	G	NM_015347		130926745	-1			no_errors	ENST00000261655	ensembl	human	known	74_37	silent	7.14	26	2	SNP	0.854	T
RMDN2	151393	genome.wustl.edu	37	2	38216731	38216731	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:38216731A>C	ENST00000406384.1	+	6	1033	c.839A>C	c.(838-840)aAc>aCc	p.N280T	RMDN2_ENST00000234195.3_Missense_Mutation_p.N458T|RMDN2_ENST00000354545.2_Missense_Mutation_p.N280T|RMDN2_ENST00000407257.1_Missense_Mutation_p.N458T|RMDN2-AS1_ENST00000414365.2_RNA|RMDN2_ENST00000417700.2_Missense_Mutation_p.N135T	NM_001170792.1	NP_001164263.1	Q96LZ7	RMD2_HUMAN	regulator of microtubule dynamics 2	280						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)											GGTTTACAAAACAAAATCAAC	0.313																																																	0													164.0	149.0	154.0					2																	38216731		2203	4300	6503	SO:0001583	missense	0			AK057516	CCDS1792.1, CCDS54351.1, CCDS54352.1	2p22.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000115841	ENSG00000115841			26567	protein-coding gene	gene with protein product		611872	"""family with sequence similarity 82, member A1"""	FAM82A, FAM82A1		12477932	Standard	XM_005264161		Approved	FLJ32954, RMD2	uc002rqn.2	Q96LZ7	OTTHUMG00000128487	ENST00000406384.1:c.839A>C	2.37:g.38216731A>C	ENSP00000386004:p.Asn280Thr		A9UMZ7|A9UN00|Q4ZG33|Q6UXN4|Q8N657|Q8N9A2|Q8NCV6|Q8NHM0	Missense_Mutation	SNP	NULL	p.N458T	ENST00000406384.1	37	c.1373	CCDS54351.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.84|18.84	3.709880|3.709880	0.68730|0.68730	.|.	.|.	ENSG00000115841|ENSG00000115841	ENST00000425641|ENST00000354545;ENST00000406384;ENST00000407257;ENST00000417700;ENST00000234195;ENST00000442857	.|T;T;T;T;T;T	.|0.45668	.|0.89;0.89;0.89;0.89;0.89;0.89	5.8|5.8	4.65|4.65	0.58169|0.58169	.|.	.|0.051452	.|0.85682	.|D	.|0.000000	T|T	0.50137|0.50137	0.1598|0.1598	L|L	0.37630|0.37630	1.12|1.12	0.39932|0.39932	D|D	0.974302|0.974302	.|P;D;D;D	.|0.76494	.|0.947;0.999;0.999;0.999	.|P;D;D;D	.|0.71656	.|0.754;0.974;0.974;0.974	T|T	0.49041|0.49041	-0.8980|-0.8980	5|10	.|0.41790	.|T	.|0.15	-2.2736|-2.2736	9.8636|9.8636	0.41129|0.41129	0.9194:0.0:0.0806:0.0|0.9194:0.0:0.0806:0.0	.|.	.|458;135;280;135	.|Q96LZ7-2;Q96LZ7-4;Q96LZ7;Q96LZ7-3	.|.;.;RMD2_HUMAN;.	N|T	14|280;280;458;135;458;135	.|ENSP00000346549:N280T;ENSP00000386004:N280T;ENSP00000385049:N458T;ENSP00000392977:N135T;ENSP00000234195:N458T;ENSP00000416367:N135T	.|ENSP00000234195:N458T	K|N	+|+	3|2	2|0	FAM82A1|FAM82A1	38070235|38070235	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	3.699000|3.699000	0.54778|0.54778	1.037000|1.037000	0.40024|0.40024	0.528000|0.528000	0.53228|0.53228	AAA|AAC	RMDN2	-	NULL	ENSG00000115841		0.313	RMDN2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RMDN2	HGNC	protein_coding	OTTHUMT00000325577.1	-	0.00	99	0	A	NM_144713		38216731	+1	tier1	-	no_errors	ENST00000234195	ensembl	human	known	74_37	missense	10.00	99	11	SNP	1.000	C
RNF169	254225	genome.wustl.edu	37	11	74500713	74500713	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:74500713A>G	ENST00000299563.4	+	2	558	c.545A>G	c.(544-546)gAa>gGa	p.E182G		NM_001098638.1	NP_001092108.1	Q8NCN4	RN169_HUMAN	ring finger protein 169	182					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of double-strand break repair (GO:2000780)|protein ubiquitination (GO:0016567)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|site of double-strand break (GO:0035861)	K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	15						AAGCCTGGGGAACTTCGTGAG	0.333																																																	0													100.0	93.0	95.0					11																	74500713		1800	4065	5865	SO:0001583	missense	0			AB082522	CCDS41691.1	11q13.4	2008-02-05			ENSG00000166439	ENSG00000166439		"""RING-type (C3HC4) zinc fingers"""	26961	protein-coding gene	gene with protein product						12056414	Standard	NM_001098638		Approved	KIAA1991	uc001ovl.4	Q8NCN4	OTTHUMG00000165516	ENST00000299563.4:c.545A>G	11.37:g.74500713A>G	ENSP00000299563:p.Glu182Gly		Q6N015	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.E182G	ENST00000299563.4	37	c.545	CCDS41691.1	11	.	.	.	.	.	.	.	.	.	.	A	20.3	3.964268	0.74131	.	.	ENSG00000166439	ENST00000299563	T	0.62105	0.05	4.79	4.79	0.61399	.	0.204155	0.32655	N	0.005802	T	0.72787	0.3504	M	0.70595	2.14	0.43099	D	0.994781	D	0.64830	0.994	P	0.59115	0.852	T	0.76860	-0.2803	10	0.87932	D	0	-18.3873	11.0248	0.47739	1.0:0.0:0.0:0.0	.	182	Q8NCN4	RN169_HUMAN	G	182	ENSP00000299563:E182G	ENSP00000299563:E182G	E	+	2	0	RNF169	74178361	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.691000	0.54720	1.898000	0.54952	0.533000	0.62120	GAA	RNF169	-	NULL	ENSG00000166439		0.333	RNF169-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF169	HGNC	protein_coding	OTTHUMT00000384741.1	-	0.00	46	0	A	XM_495886		74500713	+1	tier1	-	no_errors	ENST00000299563	ensembl	human	known	74_37	missense	34.78	30	16	SNP	1.000	G
RNPC3	55599	genome.wustl.edu	37	1	104076467	104076467	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:104076467delA	ENST00000533099.1	+	4	583	c.347delA	c.(346-348)gaafs	p.E116fs	RNPC3_ENST00000524631.1_Frame_Shift_Del_p.E116fs|RNPC3_ENST00000423855.2_Frame_Shift_Del_p.E116fs			Q96LT9	RBM40_HUMAN	RNA-binding region (RNP1, RRM) containing 3	116	Necessary for interaction with PDCD7.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Lung(183;0.111)|Epithelial(280;0.122)|all cancers(265;0.125)|Colorectal(144;0.163)		TCAGGCTCTGAAAAAAAAAAA	0.318																																																	0										85,435,1262		6,1,72,18,398,396	50.0	39.0	43.0			4.6	0.6	1		49	197,914,2651		20,3,154,16,879,809	no	codingComplex	RNPC3	NM_017619.3		26,4,226,34,1277,1205	A1A1,A1A2,A1R,A2A2,A2R,RR		29.5322,29.1807,29.4192			104076467	282,1349,3913	692	1590	2282	SO:0001589	frameshift_variant	0			AB058742, AY099329	CCDS781.1	1p21.1	2013-07-16			ENSG00000185946	ENSG00000185946		"""RNA binding motif (RRM) containing"""	18666	protein-coding gene	gene with protein product	"""U11/U12 snRNP 65K"""					14974681, 15146077	Standard	NM_017619		Approved	KIAA1839, FLJ20008, RBM40, SNRNP65	uc010oun.2	Q96LT9	OTTHUMG00000166613	ENST00000533099.1:c.347delA	1.37:g.104076467delA	ENSP00000432886:p.Glu116fs		A8K1C9|D3DT74|Q5TZ87|Q96FK7|Q96JI8|Q9NSU7|Q9NXX2	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K119fs	ENST00000533099.1	37	c.347	CCDS781.1	1																																																																																			RNPC3	-	NULL	ENSG00000185946		0.318	RNPC3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNPC3	HGNC	protein_coding	OTTHUMT00000390812.1		0.00	35	0	A	NM_017619		104076467	+1	tier1		no_errors	ENST00000423855	ensembl	human	known	74_37	frame_shift_del	17.39	19	4	DEL	0.784	-
RPAP1	26015	genome.wustl.edu	37	15	41829284	41829284	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr15:41829284G>T	ENST00000304330.4	-	2	156	c.40C>A	c.(40-42)Ctg>Atg	p.L14M	RPAP1_ENST00000561603.1_Missense_Mutation_p.L14M	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	14						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		AAGTGCAGCAGGTCCACCTCG	0.602																																																	0													76.0	64.0	68.0					15																	41829284		2203	4300	6503	SO:0001583	missense	0			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.40C>A	15.37:g.41829284G>T	ENSP00000306123:p.Leu14Met		Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Missense_Mutation	SNP	pfam_RNA_pol_II_AP1_C,pfam_RNA_pol_II_AP1_N,superfamily_ARM-type_fold	p.L14M	ENST00000304330.4	37	c.40	CCDS10079.1	15	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663130	0.67700	.	.	ENSG00000103932	ENST00000304330	D	0.83250	-1.7	4.82	2.93	0.34026	.	0.000000	0.64402	D	0.000003	D	0.84257	0.5432	L	0.34521	1.04	0.49582	D	0.999807	D	0.89917	1.0	D	0.91635	0.999	D	0.83512	0.0081	10	0.87932	D	0	-6.3701	8.6368	0.33953	0.2537:0.0:0.7463:0.0	.	14	Q9BWH6	RPAP1_HUMAN	M	14	ENSP00000306123:L14M	ENSP00000306123:L14M	L	-	1	2	RPAP1	39616576	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.549000	0.45803	0.746000	0.32786	0.462000	0.41574	CTG	RPAP1	-	NULL	ENSG00000103932		0.602	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP1	HGNC	protein_coding	OTTHUMT00000252694.2	-	0.00	24	0	G	NM_015540		41829284	-1	tier1	-	no_errors	ENST00000304330	ensembl	human	known	74_37	missense	18.75	13	3	SNP	1.000	T
RPS6KA1	6195	genome.wustl.edu	37	1	26898372	26898372	+	Silent	SNP	C	C	T	rs552205045		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:26898372C>T	ENST00000374168.2	+	19	1939	c.1785C>T	c.(1783-1785)tgC>tgT	p.C595C	RPS6KA1_ENST00000531382.1_Silent_p.C604C|RPS6KA1_ENST00000530003.1_Silent_p.C579C|RPS6KA1_ENST00000526792.1_Silent_p.C503C|RPS6KA1_ENST00000374166.4_Silent_p.C584C|RPS6KA1_ENST00000374162.2_Silent_p.C503C	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	595	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		ATGAAGGCTGCGACATCTGGA	0.632													C|||	1	0.000199681	0.0	0.0	5008	,	,		19490	0.0		0.0	False		,,,				2504	0.001																0													56.0	49.0	52.0					1																	26898372		2203	4300	6503	SO:0001819	synonymous_variant	0			BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.1785C>T	1.37:g.26898372C>T			A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.C604	ENST00000374168.2	37	c.1812	CCDS284.1	1																																																																																			RPS6KA1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000117676		0.632	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA1	HGNC	protein_coding	OTTHUMT00000011431.1		0.00	37	0	C	NM_002953		26898372	+1			no_errors	ENST00000531382	ensembl	human	known	74_37	silent	6.67	27	2	SNP	0.948	T
SCN11A	11280	genome.wustl.edu	37	3	38888876	38888876	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:38888876C>T	ENST00000302328.3	-	26	4883	c.4685G>A	c.(4684-4686)cGa>cAa	p.R1562Q	SCN11A_ENST00000456224.3_Missense_Mutation_p.R1524Q|SCN11A_ENST00000450244.1_Missense_Mutation_p.R1562Q	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1562					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.R1562Q(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTCTTTTGATCGCAGCATGGG	0.453																																																	1	Substitution - Missense(1)	large_intestine(1)											98.0	96.0	97.0					3																	38888876		2203	4300	6503	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.4685G>A	3.37:g.38888876C>T	ENSP00000307599:p.Arg1562Gln		A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.R1562Q	ENST00000302328.3	37	c.4685	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	c	13.16	2.154906	0.38021	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224	D;D;D	0.97430	-4.38;-4.38;-4.38	5.3	-2.15	0.07102	Ion transport (1);	2.067950	0.02264	N	0.067819	D	0.92802	0.7711	N	0.21282	0.65	0.09310	N	1	B	0.16603	0.018	B	0.06405	0.002	D	0.85206	0.1018	10	0.62326	D	0.03	.	6.1028	0.20057	0.1412:0.4819:0.0:0.3769	.	1562	Q9UI33	SCNBA_HUMAN	Q	1562;1562;1524	ENSP00000307599:R1562Q;ENSP00000400945:R1562Q;ENSP00000416757:R1524Q	ENSP00000307599:R1562Q	R	-	2	0	SCN11A	38863880	0.000000	0.05858	0.000000	0.03702	0.805000	0.45488	-0.551000	0.06027	-0.245000	0.09625	0.441000	0.28932	CGA	SCN11A	-	pfam_Ion_trans_dom	ENSG00000168356		0.453	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4		0.00	40	0	C	NM_014139		38888876	-1			no_errors	ENST00000302328	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.000	T
RSRC1	51319	genome.wustl.edu	37	3	158261202	158261202	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:158261202G>T	ENST00000295930.3	+	9	1000	c.838G>T	c.(838-840)Gaa>Taa	p.E280*	RSRC1_ENST00000312179.6_Nonsense_Mutation_p.E222*|RSRC1_ENST00000464171.1_Nonsense_Mutation_p.E222*|RSRC1_ENST00000480820.1_Nonsense_Mutation_p.E280*|RP11-538P18.2_ENST00000475981.1_RNA|RSRC1_ENST00000475278.2_Intron	NM_001271838.1|NM_016625.2	NP_001258767.1|NP_057709.2	Q96IZ7	RSRC1_HUMAN	arginine/serine-rich coiled-coil 1	280					mRNA splicing, via spliceosome (GO:0000398)|nucleocytoplasmic transport (GO:0006913)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)				cervix(1)|endometrium(2)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	18			Lung(72;0.00416)|LUSC - Lung squamous cell carcinoma(72;0.00575)			ACCCAGTACTGAAAAAGAAAT	0.408																																																	0													143.0	131.0	135.0					3																	158261202		2203	4300	6503	SO:0001587	stop_gained	0			AF208853	CCDS3181.1, CCDS63822.1	3q25.32	2009-09-09			ENSG00000174891	ENSG00000174891			24152	protein-coding gene	gene with protein product	"""splicing factor, arginine/serine-rich 21"""	613352				15798186, 19065146	Standard	NM_001271838		Approved	MGC12197, BM-011, SRrp53, SFRS21	uc003fbu.2	Q96IZ7	OTTHUMG00000158758	ENST00000295930.3:c.838G>T	3.37:g.158261202G>T	ENSP00000295930:p.Glu280*		A8K2R9|Q96QK2|Q9NZE5	Nonsense_Mutation	SNP	NULL	p.E280*	ENST00000295930.3	37	c.838	CCDS3181.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.851|8.851	0.944577|0.944577	0.18356|0.18356	.|.	.|.	ENSG00000174891|ENSG00000174891	ENST00000480820;ENST00000295930;ENST00000464171;ENST00000312179|ENST00000482822	.|.	.|.	.|.	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	0.289633|.	0.29218|.	N|.	0.012795|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.07813|.	T|.	0.8|.	.|.	11.7865|11.7865	0.52045|0.52045	0.0815:0.0:0.9185:0.0|0.0815:0.0:0.9185:0.0	.|.	.|.	.|.	.|.	X|L	280;280;222;222|173	.|.	ENSP00000295930:E280X|.	E|X	+|+	1|2	0|2	RSRC1|RSRC1	159743896|159743896	1.000000|1.000000	0.71417|0.71417	0.524000|0.524000	0.27887|0.27887	0.124000|0.124000	0.20399|0.20399	5.308000|5.308000	0.65768|0.65768	2.495000|2.495000	0.84180|0.84180	0.655000|0.655000	0.94253|0.94253	GAA|TGA	RSRC1	-	NULL	ENSG00000174891		0.408	RSRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSRC1	HGNC	protein_coding	OTTHUMT00000352063.2	-	0.00	49	0	G	NM_016625		158261202	+1	tier1	-	no_errors	ENST00000295930	ensembl	human	known	74_37	nonsense	11.76	30	4	SNP	0.944	T
SCUBE1	80274	genome.wustl.edu	37	22	43619183	43619183	+	Missense_Mutation	SNP	C	C	A	rs200093143	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr22:43619183C>A	ENST00000360835.4	-	11	1373	c.1247G>T	c.(1246-1248)cGg>cTg	p.R416L		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	416					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				CAGCTGGGCCCGGGGGGAGGT	0.642																																																	0													78.0	87.0	84.0					22																	43619183		2203	4300	6503	SO:0001583	missense	0				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.1247G>T	22.37:g.43619183C>A	ENSP00000354080:p.Arg416Leu		Q5R336	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB_dom,superfamily_CUB_dom,superfamily_Growth_fac_rcpt_N_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_CUB_dom,pfscan_CUB_dom,pfscan_EG-like_dom	p.R416L	ENST00000360835.4	37	c.1247	CCDS14048.1	22	.	.	.	.	.	.	.	.	.	.	C	9.531	1.110878	0.20714	.	.	ENSG00000159307	ENST00000360835	D	0.85629	-2.01	5.07	-7.66	0.01277	.	0.696518	0.13602	N	0.375752	T	0.78830	0.4345	M	0.66939	2.045	0.09310	N	1	B	0.23591	0.088	B	0.26770	0.073	T	0.65327	-0.6195	10	0.51188	T	0.08	.	9.3824	0.38322	0.0:0.2112:0.1942:0.5946	.	416	Q8IWY4	SCUB1_HUMAN	L	416	ENSP00000354080:R416L	ENSP00000354080:R416L	R	-	2	0	SCUBE1	41949127	0.006000	0.16342	0.004000	0.12327	0.036000	0.12997	-0.253000	0.08794	-1.167000	0.02779	-0.367000	0.07326	CGG	SCUBE1	-	NULL	ENSG00000159307		0.642	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	HGNC	protein_coding	OTTHUMT00000319582.3	-	0.00	75	0	C	NM_173050		43619183	-1	tier1	-	no_errors	ENST00000360835	ensembl	human	known	74_37	missense	32.14	38	18	SNP	0.002	A
SCYL3	57147	genome.wustl.edu	37	1	169823906	169823907	+	Frame_Shift_Ins	INS	-	-	GA	rs146013542		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:169823906_169823907insGA	ENST00000367770.1	-	12	1720_1721	c.1673_1674insTC	c.(1672-1674)tccfs	p.S558fs	SCYL3_ENST00000367772.4_Frame_Shift_Ins_p.S558fs|SCYL3_ENST00000367771.6_Frame_Shift_Ins_p.S504fs			Q8IZE3	PACE1_HUMAN	SCY1-like 3 (S. cerevisiae)	558	Interaction with EZR.				cell migration (GO:0016477)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TAGTGCACTGGGACTTGACATC	0.48																																																	0																																										SO:0001589	frameshift_variant	0			BC014662	CCDS1286.1, CCDS1287.1	1q24.2	2008-02-05			ENSG00000000457	ENSG00000000457			19285	protein-coding gene	gene with protein product	"""ezrin-binding partner PACE-1"""	608192				12651155	Standard	NM_020423		Approved	PACE-1, PACE1	uc001ggs.3	Q8IZE3	OTTHUMG00000035941	ENST00000367770.1:c.1672_1673dupTC	1.37:g.169823907_169823908dupGA	ENSP00000356744:p.Ser558fs		A8K8Z2|Q5THA6|Q5THA8|Q8IZN9|Q96C56|Q9UBK6	Frame_Shift_Ins	INS	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_HEAT_type_2,pfscan_Prot_kinase_dom	p.Q559fs	ENST00000367770.1	37	c.1674_1673	CCDS1287.1	1																																																																																			SCYL3	-	NULL	ENSG00000000457		0.480	SCYL3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SCYL3	HGNC	protein_coding	OTTHUMT00000087550.4		0.00	56	0	-	NM_181093		169823907	-1	tier1		no_errors	ENST00000367770	ensembl	human	known	74_37	frame_shift_ins	12.90	54	8	INS	0.004:0.312	GA
SEMA4D	10507	genome.wustl.edu	37	9	92002317	92002317	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:92002317G>A	ENST00000450295.1	-	12	2090	c.1314C>T	c.(1312-1314)gtC>gtT	p.V438V	SEMA4D_ENST00000422704.2_Silent_p.V438V|SEMA4D_ENST00000420987.1_Silent_p.V438V|SEMA4D_ENST00000343780.4_Silent_p.V438V|SEMA4D_ENST00000356444.2_Silent_p.V438V|SEMA4D_ENST00000339861.4_Silent_p.V438V|SEMA4D_ENST00000455551.2_Silent_p.V438V|SEMA4D_ENST00000438547.2_Silent_p.V438V			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	438	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						TGACAAACATGACATCATAGA	0.512																																																	0													128.0	109.0	115.0					9																	92002317		2203	4300	6503	SO:0001819	synonymous_variant	0			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.1314C>T	9.37:g.92002317G>A			B2RPM6|Q7Z5S4|Q8N8B0	Silent	SNP	pfam_Semap_dom,pfam_Plexin_repeat,pfam_Immunoglobulin,superfamily_Semap_dom,superfamily_Plexin-like_fold,smart_Semap_dom,smart_Plexin-like_fold,smart_Ig_sub,smart_Ig_sub2,pfscan_Semap_dom,pfscan_Ig-like_dom	p.V438	ENST00000450295.1	37	c.1314	CCDS6685.1	9																																																																																			SEMA4D	-	pfam_Semap_dom,superfamily_Semap_dom,smart_Semap_dom,pfscan_Semap_dom	ENSG00000187764		0.512	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA4D	HGNC	protein_coding	OTTHUMT00000342411.1		0.00	67	0	G	NM_006378		92002317	-1			no_errors	ENST00000356444	ensembl	human	known	74_37	silent	6.38	44	3	SNP	0.999	A
SENP3	26168	genome.wustl.edu	37	17	7475198	7475198	+	Intron	SNP	T	T	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:7475198T>A	ENST00000429205.2	+	12	2161				EIF4A1_ENST00000582746.1_5'Flank|SENP3_ENST00000578868.1_3'UTR|EIF4A1_ENST00000577269.1_5'Flank|SNORA48_ENST00000386847.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA|EIF4A1_ENST00000293831.8_5'Flank|EIF4A1_ENST00000380512.5_5'Flank			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3							cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				tatatatatatatatatatat	0.299																																																	0																																										SO:0001627	intron_variant	0			AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.1722+10T>A	17.37:g.7475198T>A			Q66K15|Q86VS7|Q96PS4|Q9Y3W9	RNA	SNP	-	NULL	ENST00000429205.2	37	NULL		17																																																																																			SENP3	-	-	ENSG00000161956		0.299	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	SENP3	HGNC	protein_coding		-	0.00	37	0	T	NM_015670		7475198	+1	tier1	-	no_errors	ENST00000578813	ensembl	human	known	74_37	rna	26.32	14	5	SNP	0.939	A
SEPT1	1731	genome.wustl.edu	37	16	30392561	30392561	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:30392561G>A	ENST00000571393.1	-	7	631	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W	SEPT1_ENST00000321367.3_Missense_Mutation_p.R196W|SEPT1_ENST00000570039.1_5'Flank|SEPT1_ENST00000605106.1_Missense_Mutation_p.R154W			Q8WYJ6	SEPT1_HUMAN	septin 1	149	Septin-type G.			LRP -> SR (in Ref. 1; AAL40393). {ECO:0000305}.	cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			TCTAGGGGCCGGAGCCTGCAC	0.637																																																	0													77.0	76.0	76.0					16																	30392561		2197	4300	6497	SO:0001583	missense	0			AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984	ENST00000571393.1:c.445C>T	16.37:g.30392561G>A	ENSP00000460441:p.Arg149Trp		B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,superfamily_P-loop_NTPase,pirsf_Septin	p.R196W	ENST00000571393.1	37	c.586		16	.	.	.	.	.	.	.	.	.	.	G	16.73	3.204205	0.58234	.	.	ENSG00000180096	ENST00000321367	.	.	.	5.93	4.93	0.64822	.	0.205879	0.34156	N	0.004206	T	0.73473	0.3591	M	0.89095	3.005	0.48135	D	0.999592	P	0.41643	0.758	P	0.45406	0.479	T	0.79087	-0.1947	9	0.87932	D	0	.	14.4622	0.67459	0.0:0.0:0.8213:0.1787	.	149	Q8WYJ6	SEPT1_HUMAN	W	149	.	ENSP00000324511:R149W	R	-	1	2	SEPT1	30300062	0.969000	0.33509	1.000000	0.80357	0.563000	0.35712	1.643000	0.37217	1.342000	0.45619	0.561000	0.74099	CGG	SEPT1	-	pfam_Cell_div_GTP-bd,superfamily_P-loop_NTPase,pirsf_Septin	ENSG00000180096		0.637	SEPT1-201	KNOWN	basic	protein_coding	SEPT1	HGNC	protein_coding		-	0.00	180	0	G	NM_052838		30392561	-1	tier1	-	no_errors	ENST00000321367	ensembl	human	known	74_37	missense	17.89	78	17	SNP	1.000	A
SEPT1	1731	genome.wustl.edu	37	16	30393468	30393470	+	In_Frame_Del	DEL	TGA	TGA	-	rs151280275	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	TGA	TGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:30393468_30393470delTGA	ENST00000571393.1	-	4	311_313	c.125_127delTCA	c.(124-129)atcaac>aac	p.I42del	SEPT1_ENST00000321367.3_In_Frame_Del_p.I89del|SEPT1_ENST00000570039.1_5'Flank|SEPT1_ENST00000605106.1_In_Frame_Del_p.I47del			Q8WYJ6	SEPT1_HUMAN	septin 1	42	Septin-type G.				cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			AAGAGGCTGTTGATGAGGGTGGA	0.626																																																	0																																										SO:0001651	inframe_deletion	0			AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984	ENST00000571393.1:c.125_127delTCA	16.37:g.30393471_30393473delTGA	ENSP00000460441:p.Ile42del		B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	In_Frame_Del	DEL	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,superfamily_P-loop_NTPase,pirsf_Septin	p.I89in_frame_del	ENST00000571393.1	37	c.268_266		16																																																																																			SEPT1	-	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,superfamily_P-loop_NTPase,pirsf_Septin	ENSG00000180096		0.626	SEPT1-201	KNOWN	basic	protein_coding	SEPT1	HGNC	protein_coding			0.00	57	0	TGA	NM_052838		30393470	-1	tier1		no_errors	ENST00000321367	ensembl	human	known	74_37	in_frame_del	16.28	36	7	DEL	1.000:1.000:1.000	-
SETD8	387893	genome.wustl.edu	37	12	123875311	123875311	+	Silent	SNP	C	C	T	rs74356260		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:123875311C>T	ENST00000402868.3	+	3	693	c.267C>T	c.(265-267)gcC>gcT	p.A89A	SETD8_ENST00000478781.2_3'UTR|SETD8_ENST00000330479.4_Silent_p.A89A			Q9NQR1	SETD8_HUMAN	SET domain containing (lysine methyltransferase) 8	130					histone lysine methylation (GO:0034968)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|transcription corepressor activity (GO:0003714)	p.A89A(4)		central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|urinary_tract(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		AACCATTAGCCGGAATCTACA	0.498																																																	4	Substitution - coding silent(4)	prostate(3)|central_nervous_system(1)											105.0	100.0	101.0					12																	123875311		2203	4300	6503	SO:0001819	synonymous_variant	0			AY102937	CCDS9247.1	12q24.31	2011-07-01			ENSG00000183955	ENSG00000183955		"""Chromatin-modifying enzymes / K-methyltransferases"""	29489	protein-coding gene	gene with protein product		607240				15933070, 12086618, 12121615	Standard	NM_020382		Approved	SET8, SET07, PR-Set7, KMT5A	uc001uew.3	Q9NQR1	OTTHUMG00000150477	ENST00000402868.3:c.267C>T	12.37:g.123875311C>T			A8K9D0|Q86W83|Q8TD09	Missense_Mutation	SNP	NULL	p.R49W	ENST00000402868.3	37	c.145	CCDS9247.1	12																																																																																			SETD8	-	NULL	ENSG00000183955		0.498	SETD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD8	HGNC	protein_coding	OTTHUMT00000318263.1	-	0.00	73	0	C	NM_020382		123875311	+1	tier1	rs74356260	no_errors	ENST00000437519	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.079	T
SIPA1L2	57568	genome.wustl.edu	37	1	232581352	232581352	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:232581352G>A	ENST00000366630.1	-	10	3634	c.3276C>T	c.(3274-3276)tgC>tgT	p.C1092C	SIPA1L2_ENST00000308942.4_Silent_p.C166C|SIPA1L2_ENST00000262861.4_Silent_p.C1092C			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1092					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				GCAGCTGTTGGCACGGCAGCC	0.662																																																	0													23.0	30.0	28.0					1																	232581352		2001	4156	6157	SO:0001819	synonymous_variant	0			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.3276C>T	1.37:g.232581352G>A			Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Silent	SNP	pfam_DUF3401,pfam_Rap_GAP_dom,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP_dom	p.C1092	ENST00000366630.1	37	c.3276	CCDS41474.1	1																																																																																			SIPA1L2	-	NULL	ENSG00000116991		0.662	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1		0.00	74	0	G	XM_045839		232581352	-1			no_errors	ENST00000262861	ensembl	human	known	74_37	silent	5.41	70	4	SNP	1.000	A
SLA	6503	genome.wustl.edu	37	8	134052331	134052331	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:134052331T>C	ENST00000338087.5	-	8	1348	c.529A>G	c.(529-531)Aca>Gca	p.T177A	SLA_ENST00000517648.1_Missense_Mutation_p.T150A|TG_ENST00000377869.1_Intron|SLA_ENST00000524345.1_Missense_Mutation_p.T69A|SLA_ENST00000427060.2_Missense_Mutation_p.T217A|TG_ENST00000519543.1_Intron|TG_ENST00000220616.4_Intron|SLA_ENST00000395352.3_Missense_Mutation_p.T194A|TG_ENST00000542445.1_Intron	NM_001045556.2	NP_001039021.1	Q13239	SLAP1_HUMAN	Src-like-adaptor	177					positive regulation of signal transduction (GO:0009967)	endosome (GO:0005768)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(6)|prostate(1)|skin(1)	17	all_epithelial(106;3.51e-21)|Lung NSC(106;4.24e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0279)|Breast(495;0.037)	BRCA - Breast invasive adenocarcinoma(115;0.000701)			GTGCTTTGTGTCAGGCAGGGC	0.632																																																	0													69.0	42.0	51.0					8																	134052331		2191	4278	6469	SO:0001583	missense	0				CCDS6370.1, CCDS47922.1, CCDS47923.1, CCDS64977.1, CCDS64978.1	8q24.22	2013-09-19	2001-11-28		ENSG00000155926	ENSG00000155926		"""SH2 domain containing"""	10902	protein-coding gene	gene with protein product		601099	"""Src-like-adapter"""			8825655, 11179692	Standard	NM_001045556		Approved	SLA1	uc011ljd.2	Q13239	OTTHUMG00000164439	ENST00000338087.5:c.529A>G	8.37:g.134052331T>C	ENSP00000337548:p.Thr177Ala		B7Z4J2|B7Z4L6|Q6FI01|Q9UMQ8	Missense_Mutation	SNP	pfam_SH2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2	p.T217A	ENST00000338087.5	37	c.649	CCDS6370.1	8	.	.	.	.	.	.	.	.	.	.	T	10.67	1.416521	0.25552	.	.	ENSG00000155926	ENST00000338087;ENST00000427060;ENST00000395352;ENST00000524345;ENST00000517648	T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;2.41	5.77	3.43	0.39272	SH2 motif (1);	0.143627	0.64402	N	0.000005	T	0.18383	0.0441	L	0.31120	0.905	0.37592	D	0.920222	B;B;B;B	0.06786	0.001;0.0;0.001;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.0	T	0.11792	-1.0573	10	0.09843	T	0.71	-8.4292	8.8199	0.35018	0.0:0.1452:0.0:0.8548	.	150;177;177;177	B7Z4J2;Q6FI01;Q5TZW1;Q13239	.;.;.;SLAP1_HUMAN	A	177;217;194;69;150	ENSP00000337548:T177A;ENSP00000394049:T217A;ENSP00000378759:T194A;ENSP00000427928:T69A;ENSP00000428559:T150A	ENSP00000337548:T177A	T	-	1	0	SLA	134121513	1.000000	0.71417	0.962000	0.40283	0.813000	0.45954	1.247000	0.32815	0.476000	0.27440	0.528000	0.53228	ACA	SLA	-	NULL	ENSG00000155926		0.632	SLA-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLA	HGNC	protein_coding	OTTHUMT00000378771.1	-	0.00	72	0	T			134052331	-1	tier1	-	no_errors	ENST00000427060	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	C
SLC12A5	57468	genome.wustl.edu	37	20	44663608	44663608	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr20:44663608G>T	ENST00000454036.2	+	2	192	c.143G>T	c.(142-144)aGc>aTc	p.S48I	SLC12A5_ENST00000243964.3_Missense_Mutation_p.S25I|SLC12A5_ENST00000608944.1_5'UTR|SLC12A5_ENST00000372315.1_Missense_Mutation_p.S25I	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	48					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCCAAGGAAAGCAGTCCCTTC	0.552																																																	0													242.0	179.0	201.0					20																	44663608		2203	4300	6503	SO:0001583	missense	0			AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.143G>T	20.37:g.44663608G>T	ENSP00000387694:p.Ser48Ile		A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.S48I	ENST00000454036.2	37	c.143	CCDS46610.1	20	.	.	.	.	.	.	.	.	.	.	G	18.07	3.541381	0.65085	.	.	ENSG00000124140	ENST00000454036;ENST00000372315;ENST00000539566;ENST00000243964	D;T;T;T	0.85013	-1.93;2.02;2.02;2.02	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	D	0.88599	0.6480	M	0.69823	2.125	0.53688	D	0.999972	B;P;P	0.47484	0.043;0.896;0.834	B;P;P	0.54210	0.091;0.745;0.66	D	0.88639	0.3174	10	0.54805	T	0.06	.	12.2374	0.54524	0.0:0.0:0.8299:0.1701	.	48;25;25	Q9H2X9;Q9H2X9-2;A8K143	S12A5_HUMAN;.;.	I	48;25;25;25	ENSP00000387694:S48I;ENSP00000361389:S25I;ENSP00000446091:S25I;ENSP00000243964:S25I	ENSP00000243964:S25I	S	+	2	0	SLC12A5	44097015	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.425000	0.44723	2.679000	0.91253	0.655000	0.94253	AGC	SLC12A5	-	prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	ENSG00000124140		0.552	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	SLC12A5	HGNC	protein_coding	OTTHUMT00000471538.1	-	0.00	73	0	G			44663608	+1	tier1	-	no_errors	ENST00000454036	ensembl	human	known	74_37	missense	10.29	61	7	SNP	1.000	T
SLC12A6	9990	genome.wustl.edu	37	15	34529714	34529714	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr15:34529714G>T	ENST00000354181.3	-	22	3332	c.2840C>A	c.(2839-2841)gCc>gAc	p.A947D	SLC12A6_ENST00000397707.2_Missense_Mutation_p.A932D|SLC12A6_ENST00000560164.1_Missense_Mutation_p.A759D|SLC12A6_ENST00000558589.1_Missense_Mutation_p.A938D|SLC12A6_ENST00000290209.5_Missense_Mutation_p.A896D|SLC12A6_ENST00000451844.2_Missense_Mutation_p.A759D|SLC12A6_ENST00000397702.2_Missense_Mutation_p.A888D|SLC12A6_ENST00000458406.2_Missense_Mutation_p.A888D|SLC12A6_ENST00000560611.1_Missense_Mutation_p.A947D|SLC12A6_ENST00000558667.1_Missense_Mutation_p.A947D			Q9UHW9	S12A6_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 6	947					angiogenesis (GO:0001525)|cellular hypotonic response (GO:0071476)|cellular hypotonic salinity response (GO:0071477)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|rubidium ion transport (GO:0035826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium ion transmembrane transporter activity (GO:0015079)|potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)|rubidium ion transmembrane transporter activity (GO:0035827)	p.A896V(1)		central_nervous_system(5)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|skin(3)	45		all_lung(180;2.78e-08)		all cancers(64;3.43e-17)|GBM - Glioblastoma multiforme(113;2.6e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0301)	Potassium Chloride(DB00761)	TTCTAATTGGGCTACTGTGAA	0.443																																																	1	Substitution - Missense(1)	central_nervous_system(1)											327.0	249.0	275.0					15																	34529714		2201	4298	6499	SO:0001583	missense	0			AF108831	CCDS10036.1, CCDS42010.1, CCDS42011.1, CCDS42012.1, CCDS58352.1	15q13	2014-09-17	2013-07-18		ENSG00000140199	ENSG00000140199		"""Solute carriers"""	10914	protein-coding gene	gene with protein product		604878	"""agenesis of corpus callosum and peripheral neuropathy (Andermann syndrome)"""	KCC3, ACCPN		10187864, 10347194	Standard	NM_133647		Approved		uc001zhw.3	Q9UHW9	OTTHUMG00000129441	ENST00000354181.3:c.2840C>A	15.37:g.34529714G>T	ENSP00000346112:p.Ala947Asp		A0AV76|Q2VI00|Q7Z2E7|Q7Z4G5|Q8TDD4|Q9UFR2|Q9Y642|Q9Y665	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pfam_K/Cl_cotranspt_1/3,prints_KCL_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.A938D	ENST00000354181.3	37	c.2813	CCDS58352.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.111448	0.94339	.	.	ENSG00000140199	ENST00000290209;ENST00000397707;ENST00000354181;ENST00000397702;ENST00000458406;ENST00000451844	D;D;D;D;D	0.91351	-2.83;-2.83;-2.83;-2.83;-2.83	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.96611	0.8894	M	0.93978	3.48	0.80722	D	1	D;D;P;P	0.89917	0.987;1.0;0.899;0.949	P;D;B;D	0.83275	0.73;0.996;0.387;0.939	D	0.97436	1.0018	10	0.87932	D	0	.	17.5108	0.87759	0.0:0.0:1.0:0.0	.	932;947;896;759	Q9UHW9-3;Q9UHW9;A0AV76;B3KXX3	.;S12A6_HUMAN;.;.	D	896;932;938;888;888;759	ENSP00000290209:A896D;ENSP00000380819:A932D;ENSP00000380814:A888D;ENSP00000387725:A888D;ENSP00000390199:A759D	ENSP00000290209:A896D	A	-	2	0	SLC12A6	32317006	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.662000	0.90505	0.563000	0.77884	GCC	SLC12A6	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000140199		0.443	SLC12A6-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	SLC12A6	HGNC	protein_coding	OTTHUMT00000417991.1	-	0.00	96	0	G	NM_005135		34529714	-1	tier1	-	no_errors	ENST00000558589	ensembl	human	known	74_37	missense	6.35	59	4	SNP	1.000	T
SLC13A1	6561	genome.wustl.edu	37	7	122787321	122787321	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:122787321A>T	ENST00000194130.2	-	7	743	c.704T>A	c.(703-705)gTg>gAg	p.V235E	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	235					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TTTACGTGTCACGTGGCCCTT	0.418																																																	0													235.0	180.0	198.0					7																	122787321		2203	4300	6503	SO:0001583	missense	0				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.704T>A	7.37:g.122787321A>T	ENSP00000194130:p.Val235Glu		Q9H5Z0	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.V235E	ENST00000194130.2	37	c.704	CCDS5786.1	7	.	.	.	.	.	.	.	.	.	.	A	13.46	2.243481	0.39697	.	.	ENSG00000081800	ENST00000194130	T	0.03468	3.92	5.0	3.76	0.43208	.	0.219788	0.52532	D	0.000078	T	0.01627	0.0052	N	0.03608	-0.345	0.80722	D	1	B;B	0.14805	0.011;0.011	B;B	0.23852	0.049;0.049	T	0.41088	-0.9528	10	0.02654	T	1	-27.0989	8.857	0.35234	0.8324:0.0:0.0:0.1676	.	235;235	A4D0X1;Q9BZW2	.;S13A1_HUMAN	E	235	ENSP00000194130:V235E	ENSP00000194130:V235E	V	-	2	0	SLC13A1	122574557	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	3.820000	0.55693	1.895000	0.54865	0.460000	0.39030	GTG	SLC13A1	-	pfam_Na/sul_symport	ENSG00000081800		0.418	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	HGNC	protein_coding	OTTHUMT00000347404.1	-	0.00	54	0	A	NM_022444		122787321	-1	tier1	-	no_errors	ENST00000194130	ensembl	human	known	74_37	missense	8.51	43	4	SNP	1.000	T
SLC13A4	26266	genome.wustl.edu	37	7	135376332	135376332	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:135376332G>C	ENST00000354042.4	-	12	1971	c.1282C>G	c.(1282-1284)Cca>Gca	p.P428A	C7orf73_ENST00000422968.1_3'UTR	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	428					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						TTCTTCGCTGGAATGAGGAAG	0.478																																																	0													82.0	76.0	78.0					7																	135376332		2203	4300	6503	SO:0001583	missense	0			AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1282C>G	7.37:g.135376332G>C	ENSP00000297282:p.Pro428Ala		A4D1Q4|Q8N631	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom,pfam_DctM	p.P428A	ENST00000354042.4	37	c.1282	CCDS5840.1	7	.	.	.	.	.	.	.	.	.	.	G	25.9	4.681087	0.88542	.	.	ENSG00000164707	ENST00000354042	T	0.02787	4.16	5.69	5.69	0.88448	.	0.054085	0.85682	D	0.000000	T	0.25606	0.0623	H	0.95504	3.68	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.20974	-1.0259	10	0.87932	D	0	-9.6909	17.2983	0.87175	0.0:0.0:1.0:0.0	.	297;428	Q59HF0;Q9UKG4	.;S13A4_HUMAN	A	428	ENSP00000297282:P428A	ENSP00000297282:P428A	P	-	1	0	SLC13A4	135026872	1.000000	0.71417	0.987000	0.45799	0.656000	0.38851	9.582000	0.98214	2.676000	0.91093	0.655000	0.94253	CCA	SLC13A4	-	pfam_Na/sul_symport	ENSG00000164707		0.478	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A4	HGNC	protein_coding	OTTHUMT00000340558.1	-	0.00	56	0	G	NM_012450		135376332	-1	tier1	-	no_errors	ENST00000354042	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	C
SLC22A2	6582	genome.wustl.edu	37	6	160668305	160668306	+	Frame_Shift_Ins	INS	-	-	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:160668305_160668306insC	ENST00000366953.3	-	5	1125_1126	c.867_868insG	c.(865-870)tggctgfs	p.L290fs	SLC22A2_ENST00000366952.1_Frame_Shift_Ins_p.L269fs|SLC22A2_ENST00000491092.1_5'UTR	NM_003058.3	NP_003049.2	O15244	S22A2_HUMAN	solute carrier family 22 (organic cation transporter), member 2	290					body fluid secretion (GO:0007589)|drug transmembrane transport (GO:0006855)|histamine transport (GO:0051608)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|organic cation transport (GO:0015695)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|steroid binding (GO:0005496)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(16)|prostate(2)|skin(1)	27		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)	Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Chlorphenamine(DB01114)|Choline(DB00122)|Cimetidine(DB00501)|Cisplatin(DB00515)|Cladribine(DB00242)|Cocaine(DB00907)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Desipramine(DB01151)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Famotidine(DB00927)|Flurazepam(DB00690)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Memantine(DB01043)|Metformin(DB00331)|Metoprolol(DB00264)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Oxprenolol(DB01580)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Propranolol(DB00571)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Reserpine(DB00206)|Thiamine(DB00152)|Tubocurarine(DB01199)|Vinblastine(DB00570)|Zidovudine(DB00495)	TGGGAGATCAGCCACCTGGGAG	0.48																																																	0																																										SO:0001589	frameshift_variant	0			X98333	CCDS5276.1	6q25.3	2013-05-22			ENSG00000112499	ENSG00000112499		"""Solute carriers"""	10966	protein-coding gene	gene with protein product		602608				9605850	Standard	NM_003058		Approved	OCT2	uc003qtf.3	O15244	OTTHUMG00000015950	ENST00000366953.3:c.868dupG	6.37:g.160668307_160668307dupC	ENSP00000355920:p.Leu290fs		Q5T7Q6|Q6PIQ8|Q8NG62|Q9NQB9	Frame_Shift_Ins	INS	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.L289fs	ENST00000366953.3	37	c.868_867	CCDS5276.1	6																																																																																			SLC22A2	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000112499		0.480	SLC22A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A2	HGNC	protein_coding	OTTHUMT00000042943.1		0.00	85	0	0	NM_003058		160668306	-1			no_errors	ENST00000366953	ensembl	human	known	74_37	frame_shift_ins	8.14	79	7	INS	1.000:1.000	C
SLC25A10	1468	genome.wustl.edu	37	17	79682740	79682740	+	Missense_Mutation	SNP	G	G	A	rs541892207		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:79682740G>A	ENST00000350690.5	+	4	432	c.346G>A	c.(346-348)Gtg>Atg	p.V116M	SLC25A10_ENST00000331531.5_Missense_Mutation_p.V116M|SLC25A10_ENST00000541223.1_Missense_Mutation_p.V271M|SLC25A10_ENST00000571730.1_Missense_Mutation_p.V271M|SLC25A10_ENST00000545862.1_Missense_Mutation_p.V73M	NM_001270953.1|NM_012140.4	NP_001257882.1|NP_036272.2	Q9UBX3	DIC_HUMAN	solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member 10	116					carbohydrate metabolic process (GO:0005975)|cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid transport (GO:0006835)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|ion transport (GO:0006811)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	dicarboxylic acid transmembrane transporter activity (GO:0005310)			endometrium(1)|lung(9)|ovary(1)|prostate(1)|skin(2)	14	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.23)		BRCA - Breast invasive adenocarcinoma(99;0.0117)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)		Succinic acid(DB00139)	TGGAGGCTTCGTGGGGACGCC	0.662																																																	0													106.0	113.0	111.0					17																	79682740		2203	4300	6503	SO:0001583	missense	0				CCDS11786.1, CCDS59301.1, CCDS74176.1	17q25.3	2013-07-15			ENSG00000183048	ENSG00000183048		"""Solute carriers"""	10980	protein-coding gene	gene with protein product		606794		DIC		9733776, 10072589	Standard	NM_001270953		Approved		uc031rew.1	Q9UBX3	OTTHUMG00000178173	ENST00000350690.5:c.346G>A	17.37:g.79682740G>A	ENSP00000345580:p.Val116Met		Q542Z3|Q96BA1|Q96IP1	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,pfam_Ribosomal_L7/L12_C,superfamily_Mt_carrier_dom,superfamily_Ribosomal_L7/L12_oligo,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.V271M	ENST00000350690.5	37	c.811	CCDS11786.1	17	.	.	.	.	.	.	.	.	.	.	G	15.25	2.777606	0.49786	.	.	ENSG00000183048	ENST00000541223;ENST00000331531;ENST00000350690;ENST00000545862	D;D;D;D	0.81499	-1.5;-1.5;-1.5;-1.5	4.11	4.11	0.48088	Mitochondrial carrier domain (2);	0.248506	0.33515	N	0.004833	D	0.88171	0.6365	M	0.83012	2.62	0.51482	D	0.999926	D;D;D	0.71674	0.996;0.998;0.998	P;D;D	0.66847	0.88;0.911;0.947	D	0.89052	0.3456	10	0.72032	D	0.01	-27.3577	9.8171	0.40860	0.0973:0.0:0.9027:0.0	.	271;116;116	B4DLN1;Q9UBX3-2;Q9UBX3	.;.;DIC_HUMAN	M	271;116;116;73	ENSP00000439565:V271M;ENSP00000328403:V116M;ENSP00000345580:V116M;ENSP00000446242:V73M	ENSP00000328403:V116M	V	+	1	0	SLC25A10	77293145	0.986000	0.35501	0.955000	0.39395	0.371000	0.29859	1.988000	0.40697	1.861000	0.53984	0.313000	0.20887	GTG	SLC25A10	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000183048		0.662	SLC25A10-002	KNOWN	basic|CCDS	protein_coding	SLC25A10	HGNC	protein_coding	OTTHUMT00000440816.1	-	0.00	31	0	G			79682740	+1	tier1	-	no_errors	ENST00000541223	ensembl	human	known	74_37	missense	23.08	10	3	SNP	0.970	A
SLC25A23	79085	genome.wustl.edu	37	19	6456040	6456040	+	Intron	DEL	T	T	-			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:6456040delT	ENST00000301454.4	-	4	590				SLC25A23_ENST00000414491.2_5'Flank|SLC25A23_ENST00000334510.5_Intron	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23						adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						AAGACCGTGGTTTTTGAACGA	0.567																																																	0																																										SO:0001627	intron_variant	0			AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.483+390A>-	19.37:g.6456040delT			B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Frame_Shift_Del	DEL	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.T183fs	ENST00000301454.4	37	c.547	CCDS32882.1	19																																																																																			SLC25A23	-	NULL	ENSG00000125648		0.567	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A23	HGNC	protein_coding	OTTHUMT00000453325.1		0.00	32	0	T	NM_024103		6456040	-1	tier1		no_errors	ENST00000264088	ensembl	human	known	74_37	frame_shift_del	9.52	19	2	DEL	0.003	-
SLC30A10	55532	genome.wustl.edu	37	1	220091782	220091782	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:220091782G>A	ENST00000366926.3	-	3	934	c.773C>T	c.(772-774)aCg>aTg	p.T258M	SLC30A10_ENST00000536446.1_Missense_Mutation_p.T13M|SLC30A10_ENST00000484079.1_5'UTR	NM_018713.2	NP_061183.2	Q6XR72	ZNT10_HUMAN	solute carrier family 30, member 10	258					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	13				GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.209)		TATGATGGCCGTGATGACCAC	0.512																																					Colon(76;360 1614 43677 51136)												0													164.0	144.0	151.0					1																	220091782		2203	4300	6503	SO:0001583	missense	0			AY212919	CCDS31026.1	1q41	2013-05-22			ENSG00000196660	ENSG00000196660		"""Solute carriers"""	25355	protein-coding gene	gene with protein product	"""zinc transporter 8"""	611146				15154973	Standard	NR_046437		Approved	DKFZp547M236, ZnT-10, ZRC1, ZNT8	uc001hlw.3	Q6XR72	OTTHUMG00000037434	ENST00000366926.3:c.773C>T	1.37:g.220091782G>A	ENSP00000355893:p.Thr258Met		Q49AL9|Q9NPW0	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.T258M	ENST00000366926.3	37	c.773	CCDS31026.1	1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.344702	0.82022	.	.	ENSG00000196660	ENST00000366926;ENST00000536446	T;T	0.63580	-0.05;-0.05	6.02	6.02	0.97574	.	0.244211	0.42821	D	0.000642	T	0.80132	0.4567	M	0.79123	2.44	0.80722	D	1	D	0.89917	1.0	D	0.65773	0.938	T	0.78645	-0.2123	9	.	.	.	-20.5412	20.5269	0.99230	0.0:0.0:1.0:0.0	.	258	Q6XR72	ZNT10_HUMAN	M	258;13	ENSP00000355893:T258M;ENSP00000439489:T13M	.	T	-	2	0	SLC30A10	218158405	1.000000	0.71417	0.969000	0.41365	0.981000	0.71138	6.125000	0.71627	2.859000	0.98148	0.591000	0.81541	ACG	SLC30A10	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000196660		0.512	SLC30A10-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A10	HGNC	protein_coding	OTTHUMT00000357709.1		0.00	31	0	G	NM_018713		220091782	-1			no_errors	ENST00000366926	ensembl	human	known	74_37	missense	5.71	33	2	SNP	0.996	A
SLC44A2	57153	genome.wustl.edu	37	19	10747424	10747424	+	Missense_Mutation	SNP	G	G	A	rs571971748	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:10747424G>A	ENST00000335757.5	+	16	1959	c.1583G>A	c.(1582-1584)cGg>cAg	p.R528Q	SLC44A2_ENST00000586078.1_Missense_Mutation_p.R528Q|SLC44A2_ENST00000407327.4_Missense_Mutation_p.R526Q			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	528					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	CTGGATCAGCGGCTGAAAGGT	0.622													G|||	3	0.000599042	0.0023	0.0	5008	,	,		18431	0.0		0.0	False		,,,				2504	0.0																0													95.0	75.0	82.0					19																	10747424		2203	4300	6503	SO:0001583	missense	0			AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.1583G>A	19.37:g.10747424G>A	ENSP00000336888:p.Arg528Gln		B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.R528Q	ENST00000335757.5	37	c.1583	CCDS12245.1	19	.	.	.	.	.	.	.	.	.	.	G	20.2	3.947020	0.73672	.	.	ENSG00000129353	ENST00000407327;ENST00000335757;ENST00000380614	T;T	0.20738	2.05;2.05	5.13	5.13	0.70059	.	0.055850	0.64402	D	0.000001	T	0.13200	0.0320	L	0.31120	0.905	0.45087	D	0.9981	P;P;P	0.37233	0.526;0.588;0.526	B;B;B	0.29862	0.101;0.108;0.101	T	0.06162	-1.0842	10	0.30854	T	0.27	-23.6835	11.0036	0.47620	0.0861:0.0:0.9139:0.0	.	528;528;526	Q8IWA5-2;Q8IWA5;Q8IWA5-3	.;CTL2_HUMAN;.	Q	526;528;528	ENSP00000385135:R526Q;ENSP00000336888:R528Q	ENSP00000336888:R528Q	R	+	2	0	SLC44A2	10608424	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	3.831000	0.55776	2.675000	0.91044	0.655000	0.94253	CGG	SLC44A2	-	pfam_Choline_transptr-like	ENSG00000129353		0.622	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A2	HGNC	protein_coding	OTTHUMT00000452045.1		0.00	36	0	G			10747424	+1			no_errors	ENST00000335757	ensembl	human	known	74_37	missense	7.50	37	3	SNP	1.000	A
SLC5A6	8884	genome.wustl.edu	37	2	27427384	27427384	+	Missense_Mutation	SNP	G	G	T	rs199587675		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:27427384G>T	ENST00000310574.3	-	9	1423	c.950C>A	c.(949-951)gCg>gAg	p.A317E	SLC5A6_ENST00000408041.1_Missense_Mutation_p.A317E|SLC5A6_ENST00000461319.1_5'Flank	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	317					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)	p.A317V(1)		endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	CTGGTAATACGCGAACATGAC	0.597																																																	1	Substitution - Missense(1)	large_intestine(1)											99.0	95.0	96.0					2																	27427384		2203	4300	6503	SO:0001583	missense	0			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.950C>A	2.37:g.27427384G>T	ENSP00000310208:p.Ala317Glu		B2RB85|D6W549|Q969Y5	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.A317E	ENST00000310574.3	37	c.950	CCDS1740.1	2	.	.	.	.	.	.	.	.	.	.	G	15.21	2.765159	0.49574	.	.	ENSG00000138074	ENST00000310574;ENST00000408041	D;D	0.87650	-2.28;-2.28	4.93	2.04	0.26737	.	0.604283	0.16756	N	0.200821	D	0.92469	0.7609	M	0.89478	3.035	0.41268	D	0.98682	D	0.59357	0.985	D	0.65874	0.939	D	0.90510	0.4480	10	0.56958	D	0.05	.	7.2906	0.26364	0.1706:0.1441:0.6852:0.0	.	317	Q9Y289	SC5A6_HUMAN	E	317	ENSP00000310208:A317E;ENSP00000384853:A317E	ENSP00000310208:A317E	A	-	2	0	SLC5A6	27280888	0.999000	0.42202	0.226000	0.23910	0.215000	0.24574	3.539000	0.53604	0.585000	0.29608	0.655000	0.94253	GCG	SLC5A6	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000138074		0.597	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A6	HGNC	protein_coding	OTTHUMT00000214194.1		0.00	38	0	G	NM_021095		27427384	-1			no_errors	ENST00000310574	ensembl	human	known	74_37	missense	6.52	43	3	SNP	0.588	T
SLC6A19	340024	genome.wustl.edu	37	5	1219077	1219077	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:1219077G>A	ENST00000304460.10	+	9	1289	c.1233G>A	c.(1231-1233)ccG>ccA	p.P411P		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	411					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCAAGATGCCGTTGTCCCCAC	0.602																																																	0													399.0	296.0	331.0					5																	1219077		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.1233G>A	5.37:g.1219077G>A			A8K446	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_orphan	p.P411	ENST00000304460.10	37	c.1233	CCDS34130.1	5																																																																																			SLC6A19	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000174358		0.602	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A19	HGNC	protein_coding	OTTHUMT00000365557.1	-	0.00	36	0	G	XM_291120		1219077	+1	tier1	-	no_errors	ENST00000304460	ensembl	human	known	74_37	silent	9.30	38	4	SNP	0.000	A
SLCO3A1	28232	genome.wustl.edu	37	15	92647683	92647683	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr15:92647683G>A	ENST00000318445.6	+	4	1134	c.920G>A	c.(919-921)aGa>aAa	p.R307K	SLCO3A1_ENST00000424469.2_Missense_Mutation_p.R307K|SLCO3A1_ENST00000555549.1_3'UTR	NM_013272.3	NP_037404.2	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family, member 3A1	307					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)|skin(2)	25	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)		Alprostadil(DB00770)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Conjugated Estrogens(DB00286)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Iloprost(DB01088)|Methotrexate(DB00563)	CTCTCCGAAAGAGAATACGAG	0.587																																																	0													81.0	72.0	75.0					15																	92647683		2198	4298	6496	SO:0001583	missense	0			AB031050	CCDS10371.1, CCDS45354.1	15q26	2013-05-22	2003-11-25	2003-11-26	ENSG00000176463	ENSG00000176463		"""Solute carriers"""	10952	protein-coding gene	gene with protein product		612435	"""solute carrier family 21 (organic anion transporter), member 11"""	SLC21A11			Standard	NM_001145044		Approved	OATP-D, OATP3A1	uc002bqx.2	Q9UIG8	OTTHUMG00000149846	ENST00000318445.6:c.920G>A	15.37:g.92647683G>A	ENSP00000320634:p.Arg307Lys		A8K4A7|B3KPY5|B3KUR7|C6G486|Q9BW73|Q9GZV2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.R307K	ENST00000318445.6	37	c.920	CCDS10371.1	15	.	.	.	.	.	.	.	.	.	.	G	7.780	0.709328	0.15239	.	.	ENSG00000176463	ENST00000318445;ENST00000424469;ENST00000556649;ENST00000555549	T;T	0.38401	1.14;1.14	5.31	5.31	0.75309	Major facilitator superfamily domain, general substrate transporter (1);	0.648102	0.16571	N	0.208631	T	0.14270	0.0345	N	0.02129	-0.67	0.37276	D	0.907616	B;B;B	0.19817	0.011;0.039;0.001	B;B;B	0.18871	0.009;0.023;0.02	T	0.11348	-1.0591	10	0.02654	T	1	.	14.5547	0.68091	0.0:0.1462:0.8538:0.0	.	249;307;307	Q9UIG8-3;Q9UIG8-2;Q9UIG8	.;.;SO3A1_HUMAN	K	307;307;100;26	ENSP00000320634:R307K;ENSP00000387846:R307K	ENSP00000320634:R307K	R	+	2	0	SLCO3A1	90448687	1.000000	0.71417	0.990000	0.47175	0.861000	0.49209	1.911000	0.39937	2.456000	0.83038	0.655000	0.94253	AGA	SLCO3A1	-	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	ENSG00000176463		0.587	SLCO3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO3A1	HGNC	protein_coding	OTTHUMT00000313529.1		0.00	64	0	G	NM_013272		92647683	+1			no_errors	ENST00000318445	ensembl	human	known	74_37	missense	10.00	27	3	SNP	0.987	A
SNAP91	9892	genome.wustl.edu	37	6	84366506	84366506	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:84366506C>A	ENST00000439399.2	-	7	941	c.625G>T	c.(625-627)Gct>Tct	p.A209S	SNAP91_ENST00000428679.2_Missense_Mutation_p.A209S|SNAP91_ENST00000437520.1_Missense_Mutation_p.A209S|SNAP91_ENST00000369694.2_Missense_Mutation_p.A209S|SNAP91_ENST00000520213.1_Missense_Mutation_p.A209S|SNAP91_ENST00000520302.1_Missense_Mutation_p.A209S|SNAP91_ENST00000521743.1_Missense_Mutation_p.A209S|SNAP91_ENST00000195649.6_Missense_Mutation_p.A209S|SNAP91_ENST00000521485.1_Missense_Mutation_p.A209S	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	209					clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		TTGTAGCAAGCAAAAAGTTTG	0.358																																																	0													113.0	107.0	109.0					6																	84366506		1883	4110	5993	SO:0001583	missense	0			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.625G>T	6.37:g.84366506C>A	ENSP00000400459:p.Ala209Ser		A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	pfam_ANTH_dom,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.A209S	ENST00000439399.2	37	c.625	CCDS47455.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.274771	0.95459	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000521931	T;T;T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	5.11	5.11	0.69529	ANTH (1);Clathrin adaptor, phosphoinositide-binding, GAT-like (1);	0.000000	0.85682	D	0.000000	T	0.51381	0.1671	M	0.73753	2.245	0.80722	D	1	D;D;D;D	0.61697	0.99;0.976;0.99;0.976	D;D;D;D	0.79784	0.992;0.989;0.993;0.989	T	0.56226	-0.8014	10	0.87932	D	0	-13.5066	18.8994	0.92435	0.0:1.0:0.0:0.0	.	209;209;209;209	O60641-3;E5RI02;O60641;E1P549	.;.;AP180_HUMAN;.	S	209	ENSP00000429776:A209S;ENSP00000358708:A209S;ENSP00000400459:A209S;ENSP00000195649:A209S;ENSP00000412492:A209S;ENSP00000413277:A209S;ENSP00000428511:A209S;ENSP00000428215:A209S;ENSP00000428026:A209S;ENSP00000430071:A209S	ENSP00000195649:A209S	A	-	1	0	SNAP91	84423225	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.776000	0.85560	2.543000	0.85770	0.467000	0.42956	GCT	SNAP91	-	pfam_ANTH_dom	ENSG00000065609		0.358	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SNAP91	HGNC	protein_coding	OTTHUMT00000375296.1	-	0.00	40	0	C			84366506	-1	tier1	-	no_errors	ENST00000369694	ensembl	human	known	74_37	missense	22.22	21	6	SNP	1.000	A
MTCL1	23255	genome.wustl.edu	37	18	8720379	8720379	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr18:8720379C>T	ENST00000306329.11	+	3	1322	c.1322C>T	c.(1321-1323)aCg>aTg	p.T441M	SOGA2_ENST00000517570.1_Missense_Mutation_p.T81M|Y_RNA_ENST00000516510.1_RNA|SOGA2_ENST00000400050.3_Missense_Mutation_p.T81M|SOGA2_ENST00000306285.7_5'UTR|SOGA2_ENST00000359865.3_Missense_Mutation_p.T81M																							GAACTTAAGACGGTGGAGGAA	0.468																																																	0													113.0	99.0	103.0					18																	8720379		2203	4300	6503	SO:0001583	missense	0																														ENST00000306329.11:c.1322C>T	18.37:g.8720379C>T	ENSP00000305027:p.Thr441Met			Missense_Mutation	SNP	pfam_SOGA	p.T81M	ENST00000306329.11	37	c.242		18	.	.	.	.	.	.	.	.	.	.	c	15.83	2.949295	0.53186	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050	T;T;T	0.78481	-1.18;-1.18;-1.18	5.08	3.17	0.36434	.	0.288652	0.25214	N	0.032288	T	0.75576	0.3868	L	0.33485	1.01	0.80722	D	1	D	0.76494	0.999	P	0.62382	0.901	T	0.73588	-0.3935	10	0.46703	T	0.11	-9.4624	4.5547	0.12131	0.1217:0.5003:0.2915:0.0865	.	81	Q9Y4B5-3	.	M	102;81;81;81	ENSP00000429556:T81M;ENSP00000352927:T81M;ENSP00000382924:T81M	ENSP00000305027:T102M	T	+	2	0	CCDC165	8710379	0.845000	0.29573	0.799000	0.32177	0.671000	0.39405	1.274000	0.33132	1.293000	0.44690	-0.127000	0.14921	ACG	SOGA2	-	NULL	ENSG00000168502		0.468	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000444141.1		0.00	50	0	C			8720379	+1			no_errors	ENST00000359865	ensembl	human	known	74_37	missense	10.34	26	3	SNP	0.902	T
SORBS1	10580	genome.wustl.edu	37	10	97081740	97081740	+	Silent	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr10:97081740C>T	ENST00000361941.3	-	29	3704	c.3678G>A	c.(3676-3678)agG>agA	p.R1226R	SORBS1_ENST00000306402.6_Silent_p.R715R|SORBS1_ENST00000354106.3_Silent_p.R938R|SORBS1_ENST00000371241.1_Silent_p.R618R|SORBS1_ENST00000371247.2_Silent_p.R1226R|SORBS1_ENST00000371245.3_Silent_p.R839R|SORBS1_ENST00000371227.4_Silent_p.R1200R|SORBS1_ENST00000371239.1_Silent_p.R745R|SORBS1_ENST00000371246.2_Silent_p.R1085R|SORBS1_ENST00000371249.2_Silent_p.R750R|SORBS1_ENST00000393949.1_Silent_p.R938R|SORBS1_ENST00000347291.4_Silent_p.R780R|SORBS1_ENST00000353505.5_Silent_p.R839R|SORBS1_ENST00000277982.5_Silent_p.R1085R|SORBS1_ENST00000607232.1_Silent_p.R1228R	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AGGTTTGACTCCTGTCGGGGG	0.458																																																	0													113.0	109.0	110.0					10																	97081740		2203	4300	6503	SO:0001819	synonymous_variant	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.3678G>A	10.37:g.97081740C>T				Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain	p.R1228	ENST00000361941.3	37	c.3684	CCDS31255.1	10																																																																																			SORBS1	-	superfamily_SH3_domain	ENSG00000095637		0.458	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1		0.00	80	0	C			97081740	-1			no_errors	ENST00000607232	ensembl	human	known	74_37	silent	5.80	64	4	SNP	1.000	T
SOX1	6656	genome.wustl.edu	37	13	112722081	112722083	+	In_Frame_Del	DEL	GGC	GGC	-			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	GGC	GGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr13:112722081_112722083delGGC	ENST00000330949.1	+	1	169_171	c.109_111delGGC	c.(109-111)ggcdel	p.G43del		NM_005986.2	NP_005977.2	O00570	SOX1_HUMAN	SRY (sex determining region Y)-box 1	43	Poly-Gly.				chromatin organization (GO:0006325)|forebrain neuron development (GO:0021884)|lens morphogenesis in camera-type eye (GO:0002089)|neuron migration (GO:0001764)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron specification (GO:0021521)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(4)	4	all_lung(23;0.000652)|Lung NSC(43;0.017)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	all_cancers(25;0.000331)|Lung NSC(25;0.0496)|all_lung(25;0.0831)|all_epithelial(44;0.0868)|Breast(118;0.231)		OV - Ovarian serous cystadenocarcinoma(48;0.132)		cggaggcgggggcggcggcggcg	0.778																																																	0										38,64,2450		12,0,14,18,28,1204						-3.4	0.0			3	31,94,5427		3,0,25,8,78,2662	no	codingComplex	SOX1	NM_005986.2		15,0,39,26,106,3866	A1A1,A1A2,A1R,A2A2,A2R,RR		2.2514,3.9969,2.8011				69,158,7877				SO:0001651	inframe_deletion	0				CCDS9523.1	13q34	2008-07-18			ENSG00000182968	ENSG00000182968		"""SRY (sex determining region Y)-boxes"""	11189	protein-coding gene	gene with protein product	"""SRY-related HMG-box gene 1"""	602148				9337405	Standard	NM_005986		Approved		uc001vsb.1	O00570	OTTHUMG00000017362	ENST00000330949.1:c.109_111delGGC	13.37:g.112722090_112722092delGGC	ENSP00000330218:p.Gly43del		Q5W0Q1	In_Frame_Del	DEL	pfam_HMG_box_dom,pfam_TF_SOX,superfamily_HMG_box_dom,smart_HMG_box_dom,pfscan_HMG_box_dom	p.G40in_frame_del	ENST00000330949.1	37	c.109_111	CCDS9523.1	13																																																																																			SOX1	-	superfamily_HMG_box_dom	ENSG00000182968		0.778	SOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX1	HGNC	protein_coding	OTTHUMT00000045817.3		0.00	53	0	GGC	NM_005986		112722083	+1	tier1		no_errors	ENST00000330949	ensembl	human	known	74_37	in_frame_del	6.90	27	2	DEL	0.029:0.038:0.034	-
SPATA31A2	642265	genome.wustl.edu	37	9	39888176	39888176	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:39888176A>C	ENST00000456183.2	+	4	1192	c.1163A>C	c.(1162-1164)aAc>aCc	p.N388T		NM_001040065.1	NP_001035154.1	Q5RGS2	S31A2_HUMAN	SPATA31 subfamily A, member 2	388					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ATGGGAGAGAACTCGAAACAG	0.483																																																	0													11.0	10.0	11.0					9																	39888176		1138	2458	3596	SO:0001583	missense	0					9p13.1	2012-10-15	2012-10-12	2012-10-12	ENSG00000204848				32002	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A2"""	FAM75A2		20850414	Standard			Approved	OTTHUMG00000013563	uc004abm.3	Q5RGS2	OTTHUMG00000013563	ENST00000456183.2:c.1163A>C	9.37:g.39888176A>C	ENSP00000406957:p.Asn388Thr			Missense_Mutation	SNP	NULL	p.N388T	ENST00000456183.2	37	c.1163	CCDS43809.1	9	.	.	.	.	.	.	.	.	.	.	A	9.172	1.021391	0.19433	.	.	ENSG00000204848	ENST00000456183	T	0.03860	3.78	1.85	1.85	0.25348	.	0.485309	0.19210	N	0.119956	T	0.02380	0.0073	N	0.14661	0.345	0.09310	N	1	P	0.36874	0.572	B	0.29716	0.106	T	0.46456	-0.9190	10	0.41790	T	0.15	-8.2225	5.8428	0.18643	1.0:0.0:0.0:0.0	.	388	Q5RGS2	F75A2_HUMAN	T	388	ENSP00000406957:N388T	ENSP00000406957:N388T	N	+	2	0	FAM75A2	39878176	0.025000	0.19082	0.001000	0.08648	0.221000	0.24807	0.355000	0.20163	1.147000	0.42369	0.102000	0.15555	AAC	SPATA31A2	-	NULL	ENSG00000204848		0.483	SPATA31A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A2	HGNC	protein_coding	OTTHUMT00000037739.1	-	0.00	218	0	A	NM_001040065		39888176	+1	tier1	-	no_errors	ENST00000456183	ensembl	human	known	74_37	missense	27.78	117	45	SNP	0.001	C
SPATA31D1	389763	genome.wustl.edu	37	9	84607460	84607460	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:84607460G>A	ENST00000344803.2	+	4	2122	c.2075G>A	c.(2074-2076)cGa>cAa	p.R692Q		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	692					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CAACACATTCGAAGGAGGCTC	0.493																																																	0													90.0	85.0	87.0					9																	84607460		1858	4087	5945	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2075G>A	9.37:g.84607460G>A	ENSP00000341988:p.Arg692Gln			Missense_Mutation	SNP	NULL	p.R692Q	ENST00000344803.2	37	c.2075	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	G	10.55	1.380564	0.24944	.	.	ENSG00000214929	ENST00000344803	T	0.06933	3.24	3.51	-7.02	0.01589	.	0.847431	0.09833	N	0.749958	T	0.04003	0.0112	N	0.17764	0.52	0.09310	N	1	B	0.31413	0.322	B	0.30251	0.113	T	0.33650	-0.9860	10	0.20519	T	0.43	-0.6683	7.9563	0.30045	0.6254:0.2293:0.1453:0.0	.	692	Q6ZQQ2	F75D1_HUMAN	Q	692	ENSP00000341988:R692Q	ENSP00000341988:R692Q	R	+	2	0	FAM75D1	83797280	0.224000	0.23674	0.000000	0.03702	0.003000	0.03518	0.179000	0.16840	-2.213000	0.00735	-1.421000	0.01109	CGA	SPATA31D1	-	NULL	ENSG00000214929		0.493	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31D1	HGNC	protein_coding	OTTHUMT00000402325.1	-	0.00	195	0	G	NM_001001670		84607460	+1	tier1	-	no_errors	ENST00000344803	ensembl	human	known	74_37	missense	9.32	107	11	SNP	0.000	A
SPDYE2B	100310812	genome.wustl.edu	37	7	102294074	102294074	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:102294074T>C	ENST00000507450.1	+	3	811	c.337T>C	c.(337-339)Tcc>Ccc	p.S113P	SPDYE2B_ENST00000436228.2_Missense_Mutation_p.S113P|SPDYE2B_ENST00000455020.2_5'Flank|POLR2J2_ENST00000333432.6_Intron|POLR2J2_ENST00000591000.1_Intron|POLR2J2_ENST00000476151.1_Intron	NM_001166339.1	NP_001159811.1	A6NHP3	SPE2B_HUMAN	speedy/RINGO cell cycle regulator family member E2B	113																	GCGAGTGTCATCCATCCTCCC	0.542																																																	0																																										SO:0001583	missense	0				CCDS59507.1	7q22.1	2013-05-08			ENSG00000173678	ENSG00000173678		"""Speedy homologs"""	48334	protein-coding gene	gene with protein product							Standard	NM_001166339		Approved			A6NHP3	OTTHUMG00000158393	ENST00000507450.1:c.337T>C	7.37:g.102294074T>C	ENSP00000424058:p.Ser113Pro		D6RBN0	Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.S113P	ENST00000507450.1	37	c.337	CCDS59507.1	7	.	.	.	.	.	.	.	.	.	.	c	0	-2.811089	0.00074	.	.	ENSG00000173678	ENST00000540965;ENST00000507450;ENST00000436228	.	.	.	.	.	.	.	.	.	.	.	T	0.12732	0.0309	N	0.04959	-0.14	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15350	-1.0440	6	0.27082	T	0.32	.	.	.	.	.	113	A6NHP3	SPE2L_HUMAN	P	113	.	ENSP00000440393:S113P	S	+	1	0	RP11-577H5.4	102081310	0.724000	0.28038	0.002000	0.10522	0.002000	0.02628	-0.913000	0.04042	-1.655000	0.01497	-1.635000	0.00777	TCC	SPDYE2B	-	NULL	ENSG00000173678		0.542	SPDYE2B-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	SPDYE2B	HGNC	protein_coding	OTTHUMT00000350899.3	-	0.00	17	0	T			102294074	+1	tier1	-	no_errors	ENST00000436228	ensembl	human	known	74_37	missense	27.27	8	3	SNP	0.002	C
SPEF1	25876	genome.wustl.edu	37	20	3759184	3759184	+	Missense_Mutation	SNP	G	G	A	rs373691129		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr20:3759184G>A	ENST00000379756.3	-	6	647	c.487C>T	c.(487-489)Cgg>Tgg	p.R163W	SPEF1_ENST00000463490.1_5'UTR	NM_015417.4	NP_056232.2	Q9Y4P9	SPEF1_HUMAN	sperm flagellar 1	163						axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8						GCCGGCGGCCGGTCCCAGCTG	0.677																																																	0													12.0	15.0	14.0					20																	3759184		1870	4109	5979	SO:0001583	missense	0			AL080154	CCDS13063.2	20p13	2013-09-23	2007-08-20	2007-08-20	ENSG00000101222	ENSG00000101222			15874	protein-coding gene	gene with protein product		610674	"""chromosome 20 open reading frame 28"""	C20orf28		15979255	Standard	NM_015417		Approved	DKFZP434I114, SPEF1A	uc002wjj.3	Q9Y4P9	OTTHUMG00000031756	ENST00000379756.3:c.487C>T	20.37:g.3759184G>A	ENSP00000369080:p.Arg163Trp		A5YM71|D3DVY0|Q5JX78	Missense_Mutation	SNP	pfam_DUF1042,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain	p.R163W	ENST00000379756.3	37	c.487	CCDS13063.2	20	.	.	.	.	.	.	.	.	.	.	G	13.64	2.298176	0.40694	.	.	ENSG00000101222	ENST00000379756	.	.	.	4.76	1.5	0.22942	.	0.817828	0.10240	N	0.698549	T	0.10165	0.0249	N	0.14661	0.345	0.09310	N	1	P	0.50617	0.937	B	0.28991	0.097	T	0.17349	-1.0372	9	0.66056	D	0.02	-14.8121	5.5911	0.17301	0.0954:0.0:0.5609:0.3438	.	163	Q9Y4P9	SPEF1_HUMAN	W	163	.	ENSP00000369080:R163W	R	-	1	2	SPEF1	3707184	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.198000	0.17217	0.594000	0.29761	-0.332000	0.08345	CGG	SPEF1	-	NULL	ENSG00000101222		0.677	SPEF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEF1	HGNC	protein_coding	OTTHUMT00000077760.2	-	0.00	59	0	G			3759184	-1	tier1	-	no_errors	ENST00000379756	ensembl	human	known	74_37	missense	8.51	43	4	SNP	0.000	A
SPTAN1	6709	genome.wustl.edu	37	9	131370475	131370475	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:131370475G>T	ENST00000372731.4	+	34	4521	c.4411G>T	c.(4411-4413)Gaa>Taa	p.E1471*	SPTAN1_ENST00000358161.5_Nonsense_Mutation_p.E1471*|SPTAN1_ENST00000372739.3_Nonsense_Mutation_p.E1471*	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	1471					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.E1471K(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						CTTGAATACCGAAGACAAAGG	0.517																																					NSCLC(120;833 1744 2558 35612 37579)												1	Substitution - Missense(1)	large_intestine(1)											162.0	166.0	165.0					9																	131370475		2203	4300	6503	SO:0001587	stop_gained	0			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.4411G>T	9.37:g.131370475G>T	ENSP00000361816:p.Glu1471*		Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF_hand_dom,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.E1471*	ENST00000372731.4	37	c.4411	CCDS6905.1	9	.	.	.	.	.	.	.	.	.	.	G	44	10.727774	0.99457	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	.	.	.	5.54	5.54	0.83059	.	0.048330	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	19.8585	0.96775	0.0:0.0:1.0:0.0	.	.	.	.	X	1471;1471;1471;1451	.	ENSP00000350882:E1471X	E	+	1	0	SPTAN1	130410296	1.000000	0.71417	0.942000	0.38095	0.941000	0.58515	9.420000	0.97426	2.760000	0.94817	0.655000	0.94253	GAA	SPTAN1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000197694		0.517	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	HGNC	protein_coding	OTTHUMT00000054472.1		0.00	44	0	G	NM_003127		131370475	+1			no_errors	ENST00000358161	ensembl	human	known	74_37	nonsense	5.88	32	2	SNP	1.000	T
SPTB	6710	genome.wustl.edu	37	14	65237816	65237816	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr14:65237816A>G	ENST00000389721.5	-	26	5617	c.5585T>C	c.(5584-5586)cTg>cCg	p.L1862P	SPTB_ENST00000389722.3_Missense_Mutation_p.L1862P|SPTB_ENST00000542895.1_Missense_Mutation_p.L1862P|SPTB_ENST00000389720.3_Missense_Mutation_p.L1862P|SPTB_ENST00000556626.1_Missense_Mutation_p.L1862P	NM_000347.5	NP_000338.3	P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	1862					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TGCTGTCTGCAGACGGGTGGC	0.622																																																	0													119.0	113.0	115.0					14																	65237816		2203	4300	6503	SO:0001583	missense	0				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000389721.5:c.5585T>C	14.37:g.65237816A>G	ENSP00000374371:p.Leu1862Pro		Q15510|Q15519	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.L1862P	ENST00000389721.5	37	c.5585	CCDS32100.1	14	.	.	.	.	.	.	.	.	.	.	A	22.5	4.293009	0.80914	.	.	ENSG00000070182	ENST00000389723;ENST00000389722;ENST00000335612;ENST00000553938;ENST00000556626;ENST00000389721;ENST00000542895;ENST00000389720	T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	5.14	5.14	0.70334	.	0.000000	0.64402	D	0.000001	T	0.80763	0.4685	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84277	0.0492	10	0.87932	D	0	.	14.2287	0.65877	1.0:0.0:0.0:0.0	.	646;1862;1866	E7EV95;P11277;Q59FP5	.;SPTB1_HUMAN;.	P	1866;1862;646;527;1862;1862;1862;1862	ENSP00000374372:L1862P;ENSP00000451324:L527P;ENSP00000451752:L1862P;ENSP00000374371:L1862P;ENSP00000443882:L1862P;ENSP00000374370:L1862P	ENSP00000334218:L646P	L	-	2	0	SPTB	64307569	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.307000	0.96226	2.055000	0.61198	0.379000	0.24179	CTG	SPTB	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000070182		0.622	SPTB-004	KNOWN	basic|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414080.1	-	0.00	39	0	A			65237816	-1	tier1	-	no_errors	ENST00000389722	ensembl	human	known	74_37	missense	34.78	15	8	SNP	1.000	G
SRGAP3	9901	genome.wustl.edu	37	3	9100157	9100157	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:9100157C>T	ENST00000383836.3	-	7	1229		c.e7-1		SRGAP3_ENST00000360413.3_Splice_Site|SRGAP3_ENST00000433332.3_Splice_Site	NM_014850.3	NP_055665.1	O43295	SRGP3_HUMAN	SLIT-ROBO Rho GTPase activating protein 3						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)		SRGAP3/RAF1(6)	breast(1)|endometrium(2)|kidney(21)|large_intestine(7)|lung(13)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	54				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		AATCACAGCACTTGGGGAGAG	0.577			T	RAF1	pilocytic astrocytoma																																			Dom	yes		3	3p25.3	9901	SLIT-ROBO Rho GTPase activating protein 3		M	0													68.0	64.0	65.0					3																	9100157		2203	4300	6503	SO:0001630	splice_region_variant	0			AB007871	CCDS2572.1, CCDS33689.1	3p25.3	2011-07-04	2004-11-12	2004-11-12	ENSG00000196220	ENSG00000196220		"""Rho GTPase activating proteins"""	19744	protein-coding gene	gene with protein product		606525	"""SLIT-ROBO Rho GTPase activating protein 2"""	SRGAP2		12195014	Standard	NM_014850		Approved	KIAA0411, MEGAP, WRP, ARHGAP14	uc003brf.2	O43295	OTTHUMG00000090589	ENST00000383836.3:c.802-1G>A	3.37:g.9100157C>T			Q8IX13|Q8IZV8	Splice_Site	SNP	-	e7-1	ENST00000383836.3	37	c.802-1	CCDS2572.1	3	.	.	.	.	.	.	.	.	.	.	C	23.5	4.424679	0.83667	.	.	ENSG00000196220	ENST00000383836;ENST00000360413;ENST00000544908	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1098	0.93312	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SRGAP3	9075157	1.000000	0.71417	0.998000	0.56505	0.868000	0.49771	7.663000	0.83820	2.596000	0.87737	0.650000	0.86243	.	SRGAP3	-	-	ENSG00000196220		0.577	SRGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRGAP3	HGNC	protein_coding	OTTHUMT00000207137.3	-	0.00	46	0	C		Intron	9100157	-1	tier1	-	no_errors	ENST00000383836	ensembl	human	known	74_37	splice_site	25.00	27	9	SNP	1.000	T
STX11	8676	genome.wustl.edu	37	6	144508350	144508350	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:144508350G>A	ENST00000367568.4	+	2	769	c.586G>A	c.(586-588)Gac>Aac	p.D196N		NM_003764.3	NP_003755.2	O75558	STX11_HUMAN	syntaxin 11	196					cytotoxic T cell degranulation (GO:0043316)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|natural killer cell degranulation (GO:0043320)|neutrophil degranulation (GO:0043312)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	SNAP receptor activity (GO:0005484)	p.D196N(1)		breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	12				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)		CTTGCTGGCCGACGTGAAGGG	0.637									Familial Hemophagocytic Lymphohistiocytosis																																								1	Substitution - Missense(1)	lung(1)											42.0	49.0	47.0					6																	144508350		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AF044309	CCDS5205.1	6q24.1	2014-09-17			ENSG00000135604	ENSG00000135604			11429	protein-coding gene	gene with protein product		605014				9553086	Standard	NM_003764		Approved		uc003qks.4	O75558	OTTHUMG00000015739	ENST00000367568.4:c.586G>A	6.37:g.144508350G>A	ENSP00000356540:p.Asp196Asn		E1P598|O75378|O95148|Q5TCL6	Missense_Mutation	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.D196N	ENST00000367568.4	37	c.586	CCDS5205.1	6	.	.	.	.	.	.	.	.	.	.	G	34	5.404984	0.96051	.	.	ENSG00000135604	ENST00000367568	T	0.21734	1.99	5.18	5.18	0.71444	t-SNARE (1);	0.051520	0.85682	D	0.000000	T	0.23451	0.0567	M	0.83774	2.66	0.80722	D	1	P	0.52463	0.953	B	0.41988	0.372	T	0.31475	-0.9942	10	0.72032	D	0.01	-27.99	18.321	0.90238	0.0:0.0:1.0:0.0	.	196	O75558	STX11_HUMAN	N	196	ENSP00000356540:D196N	ENSP00000356540:D196N	D	+	1	0	STX11	144550043	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	9.799000	0.99117	2.413000	0.81919	0.655000	0.94253	GAC	STX11	-	superfamily_t-SNARE	ENSG00000135604		0.637	STX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX11	HGNC	protein_coding	OTTHUMT00000042544.1		0.00	75	0	G			144508350	+1			no_errors	ENST00000367568	ensembl	human	known	74_37	missense	5.66	50	3	SNP	1.000	A
SUSD2	56241	genome.wustl.edu	37	22	24584195	24584195	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr22:24584195C>T	ENST00000358321.3	+	14	2605	c.2344C>T	c.(2344-2346)Cgc>Tgc	p.R782C		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	782					immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						CTCACCAGGACGCAGCTACGC	0.657																																																	0													70.0	68.0	69.0					22																	24584195		2203	4300	6503	SO:0001583	missense	0			AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.2344C>T	22.37:g.24584195C>T	ENSP00000351075:p.Arg782Cys		Q9H5Y6	Missense_Mutation	SNP	pfam_AMOP,pfam_VWF_type-D,pfam_Sushi_SCR_CCP,pfam_Somatomedin_B_dom,superfamily_Sushi_SCR_CCP,superfamily_Ig_E-set,smart_AMOP,smart_VWF_type-D,smart_Sushi_SCR_CCP,pfscan_AMOP,pfscan_Somatomedin_B_dom,pfscan_Sushi_SCR_CCP	p.R782C	ENST00000358321.3	37	c.2344	CCDS13824.1	22	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702885	0.68501	.	.	ENSG00000099994	ENST00000358321	T	0.22336	1.96	4.19	3.13	0.36017	.	0.666050	0.13549	N	0.379607	T	0.28300	0.0699	L	0.46670	1.46	0.09310	N	0.999995	D	0.76494	0.999	P	0.53146	0.719	T	0.06023	-1.0850	10	0.56958	D	0.05	-48.5666	9.2932	0.37800	0.2147:0.7853:0.0:0.0	.	782	Q9UGT4	SUSD2_HUMAN	C	782	ENSP00000351075:R782C	ENSP00000351075:R782C	R	+	1	0	SUSD2	22914195	0.513000	0.26194	0.283000	0.24790	0.274000	0.26718	3.911000	0.56378	1.094000	0.41399	0.555000	0.69702	CGC	SUSD2	-	NULL	ENSG00000099994		0.657	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD2	HGNC	protein_coding	OTTHUMT00000320088.1	-	0.00	38	0	C	NM_019601		24584195	+1	tier1	-	no_errors	ENST00000358321	ensembl	human	known	74_37	missense	26.67	33	12	SNP	0.070	T
SYNJ2	8871	genome.wustl.edu	37	6	158505199	158505199	+	Silent	SNP	G	G	A	rs149771444	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr6:158505199G>A	ENST00000355585.4	+	22	3276	c.3201G>A	c.(3199-3201)acG>acA	p.T1067T	SYNJ2_ENST00000367121.3_Silent_p.T1067T|SYNJ2_ENST00000367112.1_Silent_p.T152T|SYNJ2_ENST00000367122.2_Silent_p.T1067T	NM_001178088.1|NM_003898.3	NP_001171559.1|NP_003889.1	O15056	SYNJ2_HUMAN	synaptojanin 2	1067					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	nucleotide binding (GO:0000166)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(9)|kidney(3)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		AGCATCCAACGTACAAAGGTA	0.552																																																	0								G	,	0,4406		0,0,2203	109.0	113.0	112.0		2490,3201	-3.3	1.0	6	dbSNP_134	112	8,8592	6.4+/-24.3	0,8,4292	no	coding-synonymous,coding-synonymous	SYNJ2	NM_001178088.1,NM_003898.3	,	0,8,6495	AA,AG,GG		0.093,0.0,0.0615	,	830/1260,1067/1497	158505199	8,12998	2203	4300	6503	SO:0001819	synonymous_variant	0			AB002346	CCDS5254.1	6q25.3	2008-05-15			ENSG00000078269	ENSG00000078269			11504	protein-coding gene	gene with protein product		609410					Standard	NM_003898		Approved	INPP5H	uc003qqx.2	O15056	OTTHUMG00000015904	ENST00000355585.4:c.3201G>A	6.37:g.158505199G>A			Q5TA13|Q5TA16|Q5TA19|Q86XK0|Q8IZA8|Q9H226	Silent	SNP	pfam_Syja_N,pfam_DUF1866,pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc,pfscan_RRM_dom,pfscan_Syja_N	p.T1067	ENST00000355585.4	37	c.3201	CCDS5254.1	6																																																																																			SYNJ2	-	NULL	ENSG00000078269		0.552	SYNJ2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNJ2	HGNC	protein_coding	OTTHUMT00000042858.2		0.00	66	0	G			158505199	+1			no_errors	ENST00000355585	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.982	A
SYT15	83849	genome.wustl.edu	37	10	46969283	46969283	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr10:46969283G>T	ENST00000374321.4	-	2	244	c.178C>A	c.(178-180)Ccc>Acc	p.P60T	SYT15_ENST00000374323.4_Intron|SYT15_ENST00000374325.3_Missense_Mutation_p.P60T|SYT15_ENST00000503753.1_Missense_Mutation_p.P60T|RP11-38L15.3_ENST00000506914.1_RNA	NM_031912.4	NP_114118.2	Q9BQS2	SYT15_HUMAN	synaptotagmin XV	60						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(5)|kidney(2)|lung(5)	13						GGCTGGCAGGGCCTGTCCCGC	0.632																																					Ovarian(57;1152 1428 19651 37745)												0													37.0	48.0	44.0					10																	46969283		2152	4261	6413	SO:0001583	missense	0			AJ303363	CCDS73103.1, CCDS73104.1	10q11.1	2013-01-21			ENSG00000204176	ENSG00000204176		"""Synaptotagmins"""	17167	protein-coding gene	gene with protein product		608081				11543631	Standard	NM_031912		Approved	CHR10SYT	uc001jea.3	Q9BQS2	OTTHUMG00000018103	ENST00000374321.4:c.178C>A	10.37:g.46969283G>T	ENSP00000363441:p.Pro60Thr		A5D6W8|Q5VY53|Q5VY55|Q7Z439|Q7Z440	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,pfscan_C2_dom	p.P60T	ENST00000374321.4	37	c.178	CCDS44376.1	10	.	.	.	.	.	.	.	.	.	.	g	3.428	-0.116794	0.06838	.	.	ENSG00000204176	ENST00000416127;ENST00000374325;ENST00000503753;ENST00000374321	T;T;T	0.14022	2.54;2.54;2.78	3.66	0.672	0.17935	.	.	.	.	.	T	0.08223	0.0205	L	0.34521	1.04	0.09310	N	1	B;B	0.24823	0.112;0.095	B;B	0.22386	0.039;0.037	T	0.42172	-0.9467	9	0.16420	T	0.52	.	3.8503	0.08953	0.2345:0.2019:0.5636:0.0	.	60;60	Q9BQS2;Q9BQS2-2	SYT15_HUMAN;.	T	60	ENSP00000363445:P60T;ENSP00000427607:P60T;ENSP00000363441:P60T	ENSP00000363441:P60T	P	-	1	0	SYT15	46389289	0.063000	0.20901	0.001000	0.08648	0.036000	0.12997	0.975000	0.29449	0.031000	0.15407	0.467000	0.42956	CCC	SYT15	-	NULL	ENSG00000204176		0.632	SYT15-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT15	HGNC	protein_coding	OTTHUMT00000367008.1	-	0.00	151	0	G	NM_031912		46969283	-1	tier1	-	no_errors	ENST00000374321	ensembl	human	known	74_37	missense	5.74	114	7	SNP	0.008	T
TBC1D2	55357	genome.wustl.edu	37	9	100961830	100961830	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:100961830G>A	ENST00000375066.5	-	13	2678	c.2587C>T	c.(2587-2589)Cgc>Tgc	p.R863C	TBC1D2_ENST00000342112.5_Missense_Mutation_p.R656C|TBC1D2_ENST00000375064.1_3'UTR|TBC1D2_ENST00000375063.1_Missense_Mutation_p.R414C	NM_018421.3	NP_060891.3	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	874					positive regulation of Rab GTPase activity (GO:0032851)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)	cadherin binding (GO:0045296)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)		TGTTTCATGCGGAAGGGGTTC	0.632																																																	0													135.0	138.0	137.0					9																	100961830		2203	4300	6503	SO:0001583	missense	0			AY026527	CCDS35080.1, CCDS59137.1, CCDS75865.1	9q22.32	2011-11-30			ENSG00000095383	ENSG00000095383			18026	protein-coding gene	gene with protein product	"""prostate antigen recognized and identified by SEREX"""	609871					Standard	NM_018421		Approved	PARIS1, TBC1D2A, Armus	uc011lvb.2	Q9BYX2	OTTHUMG00000020343	ENST00000375066.5:c.2587C>T	9.37:g.100961830G>A	ENSP00000364207:p.Arg863Cys		B3KWD1|B4DQ05|B9A6J7|Q59EU0|Q5TBQ5|Q6IPC7|Q7L1K8|Q8WYT1|Q9H6A2|Q9NSH4	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Pleckstrin_homology,smart_Rab-GTPase-TBC_dom,pfscan_Pleckstrin_homology,pfscan_Rab-GTPase-TBC_dom	p.R863C	ENST00000375066.5	37	c.2587	CCDS35080.1	9	.	.	.	.	.	.	.	.	.	.	G	16.73	3.204836	0.58234	.	.	ENSG00000095383	ENST00000375066;ENST00000342112;ENST00000375063	T;T;T	0.08896	3.04;3.46;3.06	5.51	2.56	0.30785	Rab-GAP/TBC domain (1);	0.423651	0.25774	N	0.028394	T	0.07999	0.0200	N	0.14661	0.345	0.37502	D	0.916797	D;D	0.65815	0.991;0.995	B;P	0.50708	0.446;0.648	T	0.28870	-1.0030	10	0.72032	D	0.01	.	9.4063	0.38464	0.248:0.0:0.752:0.0	.	874;863	Q9BYX2;Q9BYX2-2	TBD2A_HUMAN;.	C	863;656;414	ENSP00000364207:R863C;ENSP00000341567:R656C;ENSP00000364203:R414C	ENSP00000341567:R656C	R	-	1	0	TBC1D2	100001651	1.000000	0.71417	0.043000	0.18650	0.567000	0.35839	5.624000	0.67764	0.244000	0.21351	-0.424000	0.05967	CGC	TBC1D2	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000095383		0.632	TBC1D2-002	KNOWN	basic|CCDS	protein_coding	TBC1D2	HGNC	protein_coding	OTTHUMT00000053367.1		0.00	35	0	G	NM_018421		100961830	-1			no_errors	ENST00000375066	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.745	A
TBC1D29	26083	genome.wustl.edu	37	17	28890301	28890301	+	Missense_Mutation	SNP	G	G	A	rs80145926	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:28890301G>A	ENST00000580161.1	+	6	2808	c.311G>A	c.(310-312)aGc>aAc	p.S104N	TBC1D29_ENST00000579181.1_Missense_Mutation_p.S104N|RP11-218M11.1_ENST00000563063.1_lincRNA|TBC1D29_ENST00000584297.1_3'UTR			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29	104							Rab GTPase activator activity (GO:0005097)	p.S104N(1)		breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				TCAGAGAGCAGCAGAGGCCCC	0.587																																																	1	Substitution - Missense(1)	prostate(1)											48.0	45.0	46.0					17																	28890301		2203	4300	6503	SO:0001583	missense	0			BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.311G>A	17.37:g.28890301G>A	ENSP00000462799:p.Ser104Asn			Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S104N	ENST00000580161.1	37	c.311	CCDS32606.1	17	.	.	.	.	.	.	.	.	.	.	.	9.179	1.023040	0.19433	.	.	ENSG00000197689	ENST00000329040	.	.	.	.	.	.	.	.	.	.	.	T	0.22820	0.0551	N	0.08118	0	0.18873	N	0.999983	B	0.33000	0.393	B	0.42319	0.383	T	0.34850	-0.9812	7	0.72032	D	0.01	.	5.89	0.18904	8.0E-4:0.0:0.9992:0.0	.	104	Q9UFV1	TBC29_HUMAN	N	104	.	ENSP00000330052:S104N	S	+	2	0	TBC1D29	25914427	0.966000	0.33281	0.071000	0.20095	0.071000	0.16799	-0.367000	0.07553	0.107000	0.17824	0.109000	0.15622	AGC	TBC1D29	-	NULL	ENSG00000266733		0.587	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TBC1D29	HGNC	protein_coding	OTTHUMT00000443632.1		0.00	56	0	G	NM_015594		28890301	+1			no_errors	ENST00000579181	ensembl	human	known	74_37	missense	9.68	55	6	SNP	0.904	A
TCERG1L	256536	genome.wustl.edu	37	10	132915087	132915087	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr10:132915087A>G	ENST00000368642.4	-	9	1455	c.1370T>C	c.(1369-1371)tTc>tCc	p.F457S		NM_174937.3	NP_777597.2	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	457	FF 1.									cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	31		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)		CATGTCTCGGAAGTGGGTCAC	0.657																																																	0													70.0	53.0	59.0					10																	132915087		2201	4296	6497	SO:0001583	missense	0			AK096269	CCDS7662.2	10q26.3	2006-04-12			ENSG00000176769	ENSG00000176769			23533	protein-coding gene	gene with protein product							Standard	NM_174937		Approved	FLJ38950	uc001lkp.3	Q5VWI1	OTTHUMG00000019276	ENST00000368642.4:c.1370T>C	10.37:g.132915087A>G	ENSP00000357631:p.Phe457Ser		Q5VWI2|Q86XM8	Missense_Mutation	SNP	pfam_FF_domain,pfam_WW_dom,superfamily_FF_domain,superfamily_WW_dom,smart_WW_dom,smart_FF_domain,pfscan_WW_dom	p.F457S	ENST00000368642.4	37	c.1370	CCDS7662.2	10	.	.	.	.	.	.	.	.	.	.	A	15.91	2.972367	0.53614	.	.	ENSG00000176769	ENST00000368642	T	0.69306	-0.39	4.18	4.18	0.49190	FF domain (4);	0.000000	0.64402	D	0.000001	D	0.84642	0.5517	H	0.94582	3.555	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.87197	0.2238	10	0.87932	D	0	.	9.5279	0.39175	1.0:0.0:0.0:0.0	.	457	Q5VWI1	TCRGL_HUMAN	S	457	ENSP00000357631:F457S	ENSP00000357631:F457S	F	-	2	0	TCERG1L	132805077	1.000000	0.71417	1.000000	0.80357	0.368000	0.29767	4.424000	0.59868	1.753000	0.51906	0.533000	0.62120	TTC	TCERG1L	-	pfam_FF_domain,superfamily_FF_domain,smart_FF_domain	ENSG00000176769		0.657	TCERG1L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCERG1L	HGNC	protein_coding	OTTHUMT00000091619.2	-	0.00	56	0	A	NM_174937		132915087	-1	tier1	-	no_errors	ENST00000368642	ensembl	human	known	74_37	missense	56.41	17	22	SNP	1.000	G
TCF20	6942	genome.wustl.edu	37	22	42610573	42610575	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	AGG	AGG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr22:42610573_42610575delAGG	ENST00000359486.3	-	1	873_875	c.737_739delCCT	c.(736-741)tccttc>ttc	p.S246del	TCF20_ENST00000335626.4_In_Frame_Del_p.S246del	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	246	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						GGTGAAGGGAaggaggaggagga	0.507																																																	0																																										SO:0001651	inframe_deletion	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.737_739delCCT	22.37:g.42610582_42610584delAGG	ENSP00000352463:p.Ser246del		A9JX12|O14528|Q13078|Q4V353|Q9H4M0	In_Frame_Del	DEL	smart_Znf_PHD	p.S246in_frame_del	ENST00000359486.3	37	c.739_737	CCDS14033.1	22																																																																																			TCF20	-	NULL	ENSG00000100207		0.507	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1		0.00	35	0	AGG	NM_181492		42610575	-1	tier1		no_errors	ENST00000359486	ensembl	human	known	74_37	in_frame_del	14.29	18	3	DEL	1.000:1.000:1.000	-
TGM1	7051	genome.wustl.edu	37	14	24727813	24727813	+	Missense_Mutation	SNP	G	G	T	rs398122905		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr14:24727813G>T	ENST00000206765.6	-	8	1349	c.1226C>A	c.(1225-1227)aCa>aAa	p.T409K	TGM1_ENST00000544573.1_Intron	NM_000359.2	NP_000350.1	P22735	TGM1_HUMAN	transglutaminase 1	409					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|organ morphogenesis (GO:0009887)|peptide cross-linking (GO:0018149)	cell-cell adherens junction (GO:0005913)|cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|intrinsic component of membrane (GO:0031224)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)	24				GBM - Glioblastoma multiforme(265;0.0186)	L-Glutamine(DB00130)	GGTAAGGGATGTGTCTGTGTC	0.577																																																	0													204.0	173.0	184.0					14																	24727813		2203	4300	6503	SO:0001583	missense	0			D90287	CCDS9622.1	14q11.2	2013-05-02	2013-05-02		ENSG00000092295	ENSG00000092295	2.3.2.13	"""Transglutaminases"""	11777	protein-coding gene	gene with protein product	"""K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase"""	190195	"""transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)"""	ICR2		11390390	Standard	NM_000359		Approved	TGASE, TGK, LI, LI1	uc001wod.3	P22735	OTTHUMG00000029329	ENST00000206765.6:c.1226C>A	14.37:g.24727813G>T	ENSP00000206765:p.Thr409Lys		B4DWR7|Q197M4	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.T409K	ENST00000206765.6	37	c.1226	CCDS9622.1	14	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710057	0.68730	.	.	ENSG00000092295	ENST00000206765	D	0.87571	-2.27	5.01	5.01	0.66863	Transglutaminase-like (2);	0.173882	0.52532	D	0.000072	T	0.79233	0.4411	N	0.04203	-0.255	0.80722	D	1	P	0.52692	0.955	P	0.51701	0.677	T	0.79850	-0.1629	10	0.36615	T	0.2	-13.2631	11.5248	0.50573	0.0:0.1806:0.8194:0.0	.	409	P22735	TGM1_HUMAN	K	409	ENSP00000206765:T409K	ENSP00000206765:T409K	T	-	2	0	TGM1	23797653	0.048000	0.20356	0.960000	0.40013	0.848000	0.48234	0.341000	0.19909	2.613000	0.88420	0.561000	0.74099	ACA	TGM1	-	pfam_Transglutaminase-like,smart_Transglutaminase-like	ENSG00000092295		0.577	TGM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM1	HGNC	protein_coding	OTTHUMT00000073160.6		0.00	65	0	G	NM_000359		24727813	-1			no_errors	ENST00000206765	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.974	T
THADA	63892	genome.wustl.edu	37	2	43735819	43735819	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:43735819T>A	ENST00000405006.4	-	23	3826	c.3475A>T	c.(3475-3477)Agg>Tgg	p.R1159W	THADA_ENST00000330266.7_Missense_Mutation_p.R869W|THADA_ENST00000415080.2_Missense_Mutation_p.R869W|THADA_ENST00000405975.2_Missense_Mutation_p.R1159W	NM_001083953.1|NM_001271643.1	NP_001077422.1|NP_001258572.1	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1159										breast(1)|endometrium(9)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	66		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GCACTGCGCCTTGTAGCACAG	0.408																																																	0													90.0	87.0	88.0					2																	43735819		1900	4109	6009	SO:0001583	missense	0			AY149629	CCDS46268.1, CCDS62901.1, CCDS62902.1	2p21	2008-02-05			ENSG00000115970	ENSG00000115970			19217	protein-coding gene	gene with protein product		611800				12063398, 11214970	Standard	NM_022065		Approved	FLJ21877, KIAA1767, GITA	uc002rsx.4	Q6YHU6	OTTHUMG00000152398	ENST00000405006.4:c.3475A>T	2.37:g.43735819T>A	ENSP00000385995:p.Arg1159Trp		A8K1V8|B7WNS6|Q3KR04|Q53RC6|Q53TB2|Q6YHU2|Q6ZU38|Q8IY32|Q8TAU8|Q96I88|Q9BZF7|Q9C096|Q9H6U0|Q9H6W7	Missense_Mutation	SNP	pfam_DUF2428_death-receptor-like,superfamily_ARM-type_fold	p.R1159W	ENST00000405006.4	37	c.3475	CCDS46268.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.88|19.88	3.909333|3.909333	0.72868|0.72868	.|.	.|.	ENSG00000115970|ENSG00000115970	ENST00000407351|ENST00000330266;ENST00000405975;ENST00000356975;ENST00000415080;ENST00000405006	.|D;D;D;D	.|0.82526	.|-1.62;-1.62;-1.62;-1.62	4.61|4.61	3.42|3.42	0.39159|0.39159	.|Domain of unknown function DUF2428, death-receptor-like (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91703|0.91703	0.7377|0.7377	M|M	0.91972|0.91972	3.26|3.26	0.50632|0.50632	D|D	0.999881|0.999881	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;1.0;1.0;1.0	D|D	0.91817|0.91817	0.5464|0.5464	5|10	.|0.87932	.|D	.|0	.|.	10.3598|10.3598	0.43987|0.43987	0.0:0.0:0.2084:0.7916|0.0:0.0:0.2084:0.7916	.|.	.|869;1160;869;1159	.|Q6YHU6-2;B6ZDQ0;C9JJB1;Q6YHU6	.|.;.;.;THADA_HUMAN	H|W	472|869;1159;1160;869;1159	.|ENSP00000331105:R869W;ENSP00000386088:R1159W;ENSP00000416048:R869W;ENSP00000385995:R1159W	.|ENSP00000331105:R869W	Q|R	-|-	3|1	2|2	THADA|THADA	43589323|43589323	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.997000|0.997000	0.91878|0.91878	3.682000|3.682000	0.54656|0.54656	0.835000|0.835000	0.34877|0.34877	0.533000|0.533000	0.62120|0.62120	CAA|AGG	THADA	-	pfam_DUF2428_death-receptor-like,superfamily_ARM-type_fold	ENSG00000115970		0.408	THADA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	THADA	HGNC	protein_coding	OTTHUMT00000326070.3	-	0.00	42	0	T	NM_022065		43735819	-1	tier1	-	no_errors	ENST00000405006	ensembl	human	known	74_37	missense	8.16	45	4	SNP	1.000	A
THNSL2	55258	genome.wustl.edu	37	2	88478333	88478333	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:88478333G>A	ENST00000324166.5	+	4	2294	c.603G>A	c.(601-603)ccG>ccA	p.P201P	THNSL2_ENST00000377254.3_Silent_p.P201P|THNSL2_ENST00000402102.1_Silent_p.P201P|THNSL2_ENST00000343544.4_Silent_p.P201P|THNSL2_ENST00000449349.1_Silent_p.P169P|THNSL2_ENST00000358591.2_Silent_p.P201P|THNSL2_ENST00000496844.1_3'UTR	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	201					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						TCGATGAGCCGATCAAGACTG	0.562																																																	0													170.0	154.0	159.0					2																	88478333		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.603G>A	2.37:g.88478333G>A			B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Silent	SNP	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,tigrfam_Thr_synthase_like	p.P201	ENST00000324166.5	37	c.603	CCDS2002.2	2																																																																																			THNSL2	-	pfam_Trp_syn_b_sub_like_PLP_eny_SF,superfamily_Trp_syn_b_sub_like_PLP_eny_SF,tigrfam_Thr_synthase_like	ENSG00000144115		0.562	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THNSL2	HGNC	protein_coding	OTTHUMT00000252662.1		0.00	42	0	G	NM_018271		88478333	+1			no_errors	ENST00000324166	ensembl	human	known	74_37	silent	5.41	35	2	SNP	0.987	A
THUMPD3	25917	genome.wustl.edu	37	3	9426296	9426296	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr3:9426296T>C	ENST00000345094.3	+	10	1782	c.1448T>C	c.(1447-1449)aTa>aCa	p.I483T	SETD5-AS1_ENST00000519043.1_RNA|SETD5-AS1_ENST00000523354.1_RNA|SETD5-AS1_ENST00000520629.1_RNA|THUMPD3_ENST00000452837.2_Missense_Mutation_p.I483T|SETD5-AS1_ENST00000468186.1_RNA|SETD5-AS1_ENST00000521609.1_RNA|THUMPD3_ENST00000515662.2_Missense_Mutation_p.I483T	NM_001114092.1|NM_015453.2	NP_001107564.1|NP_056268.2	Q9BV44	THUM3_HUMAN	THUMP domain containing 3	483						cytoplasm (GO:0005737)|nucleolus (GO:0005730)	methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	19	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.101)		TACGTTCTGATACGTACACCT	0.448																																																	0													395.0	323.0	347.0					3																	9426296		2203	4300	6503	SO:0001583	missense	0			AL117483	CCDS2573.1	3p25.3	2004-06-04			ENSG00000134077	ENSG00000134077			24493	protein-coding gene	gene with protein product						12477932	Standard	NM_015453		Approved	DKFZP434F091	uc003brn.4	Q9BV44	OTTHUMG00000097031	ENST00000345094.3:c.1448T>C	3.37:g.9426296T>C	ENSP00000339532:p.Ile483Thr		Q9H8V6|Q9NVC1|Q9UFS3	Missense_Mutation	SNP	pfam_RNA_methylase_dom,pfam_THUMP,smart_THUMP,pfscan_THUMP	p.I483T	ENST00000345094.3	37	c.1448	CCDS2573.1	3	.	.	.	.	.	.	.	.	.	.	T	7.723	0.697521	0.15106	.	.	ENSG00000134077	ENST00000452837;ENST00000345094;ENST00000515662	T;T;T	0.39997	1.05;1.05;1.05	5.67	1.9	0.25705	.	0.268722	0.47455	D	0.000238	T	0.19167	0.0460	N	0.08118	0	0.25032	N	0.991264	B	0.09022	0.002	B	0.10450	0.005	T	0.12863	-1.0531	10	0.37606	T	0.19	-24.3766	5.2769	0.15655	0.7117:0.0:0.1536:0.1347	.	483	Q9BV44	THUM3_HUMAN	T	483	ENSP00000395893:I483T;ENSP00000339532:I483T;ENSP00000424064:I483T	ENSP00000339532:I483T	I	+	2	0	THUMPD3	9401296	0.999000	0.42202	0.864000	0.33941	0.025000	0.11179	1.060000	0.30530	0.087000	0.17167	-0.406000	0.06334	ATA	THUMPD3	-	NULL	ENSG00000134077		0.448	THUMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THUMPD3	HGNC	protein_coding	OTTHUMT00000214127.1	-	0.00	23	0	T	NM_015453		9426296	+1	tier1	-	no_errors	ENST00000345094	ensembl	human	known	74_37	missense	33.33	12	6	SNP	1.000	C
TIMM17A	10440	genome.wustl.edu	37	1	201932755	201932755	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:201932755G>T	ENST00000367287.4	+	4	238	c.202G>T	c.(202-204)Gtt>Ttt	p.V68F	TIMM17A_ENST00000482943.1_3'UTR	NM_006335.2	NP_006326.1	Q99595	TI17A_HUMAN	translocase of inner mitochondrial membrane 17 homolog A (yeast)	68					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane presequence translocase complex (GO:0005744)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			kidney(1)|lung(3)|stomach(1)	5						TAGCTTTGCAGTTTGGGGAGG	0.363																																																	0													95.0	93.0	94.0					1																	201932755		2203	4300	6503	SO:0001583	missense	0			AF106622	CCDS1417.1	1q32.1	2008-05-23			ENSG00000134375	ENSG00000134375			17315	protein-coding gene	gene with protein product		605057				8893850, 10339406	Standard	NM_006335		Approved	TIM17, TIM17A	uc001gxc.3	Q99595	OTTHUMG00000035806	ENST00000367287.4:c.202G>T	1.37:g.201932755G>T	ENSP00000356256:p.Val68Phe		B2RDM5|Q9BWF5	Missense_Mutation	SNP	pfam_Tim17/Tim22/Tim23/PMP24,tigrfam_Tim17	p.V68F	ENST00000367287.4	37	c.202	CCDS1417.1	1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779298	0.70107	.	.	ENSG00000134375	ENST00000367287	T	0.34072	1.38	5.35	3.44	0.39384	.	0.051515	0.85682	D	0.000000	T	0.67135	0.2861	H	0.94620	3.56	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74945	-0.3491	10	0.87932	D	0	-3.4185	10.5138	0.44876	0.1701:0.0:0.8299:0.0	.	68	Q99595	TI17A_HUMAN	F	68	ENSP00000356256:V68F	ENSP00000356256:V68F	V	+	1	0	TIMM17A	200199378	1.000000	0.71417	0.985000	0.45067	0.739000	0.42172	5.194000	0.65125	1.387000	0.46486	0.655000	0.94253	GTT	TIMM17A	-	pfam_Tim17/Tim22/Tim23/PMP24,tigrfam_Tim17	ENSG00000134375		0.363	TIMM17A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM17A	HGNC	protein_coding	OTTHUMT00000087092.1	-	0.00	71	0	G	NM_006335		201932755	+1	tier1	-	no_errors	ENST00000367287	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.996	T
TLL1	7092	genome.wustl.edu	37	4	166929126	166929126	+	Silent	SNP	T	T	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:166929126T>G	ENST00000061240.2	+	7	1490	c.843T>G	c.(841-843)ccT>ccG	p.P281P	TLL1_ENST00000513213.1_Silent_p.P281P|TLL1_ENST00000507499.1_Silent_p.P281P	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	281	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		AGATGGAGCCTGGAGAAGTAA	0.408																																																	0													117.0	113.0	115.0					4																	166929126		2203	4300	6503	SO:0001819	synonymous_variant	0			AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.843T>G	4.37:g.166929126T>G			B2RMU2|Q96AN3|Q9NQS4	Silent	SNP	pfam_CUB_dom,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd_dom,superfamily_CUB_dom,smart_Peptidase_Metallo,smart_CUB_dom,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB_dom,pfscan_EG-like_dom,prints_Peptidase_M12A	p.P281	ENST00000061240.2	37	c.843	CCDS3811.1	4																																																																																			TLL1	-	pfam_Peptidase_M12A,smart_Peptidase_Metallo,pirsf_BMP_1/tolloid-like	ENSG00000038295		0.408	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL1	HGNC	protein_coding	OTTHUMT00000363821.1	-	0.00	54	0	T			166929126	+1	tier1	-	no_errors	ENST00000061240	ensembl	human	known	74_37	silent	19.57	37	9	SNP	0.996	G
TMTC2	160335	genome.wustl.edu	37	12	83290168	83290168	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:83290168C>G	ENST00000321196.3	+	3	1933	c.1226C>G	c.(1225-1227)aCg>aGg	p.T409R	TMTC2_ENST00000548305.1_Missense_Mutation_p.T409R|TMTC2_ENST00000549919.1_Missense_Mutation_p.T403R	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	409					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)		p.T409R(2)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						GTTCCTGCCACGAACCTGTTT	0.418																																																	2	Substitution - Missense(2)	lung(2)											179.0	181.0	180.0					12																	83290168		2203	4300	6503	SO:0001583	missense	0			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.1226C>G	12.37:g.83290168C>G	ENSP00000322300:p.Thr409Arg		B2RCU7|Q8N2K8	Missense_Mutation	SNP	pfam_TPR_1,pfam_TPR_2,pfam_DUF1736,pfam_TPR-4,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T409R	ENST00000321196.3	37	c.1226	CCDS9025.1	12	.	.	.	.	.	.	.	.	.	.	C	20.3	3.961960	0.74016	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919;ENST00000546590	T;T;T	0.42900	0.96;0.96;0.96	5.86	5.86	0.93980	.	0.045313	0.85682	D	0.000000	T	0.56601	0.1996	M	0.64997	1.995	0.80722	D	1	D;P;D	0.58970	0.971;0.933;0.984	P;P;P	0.55999	0.691;0.71;0.789	T	0.57533	-0.7795	10	0.66056	D	0.02	-14.0083	15.6552	0.77129	0.0:0.8636:0.1364:0.0	.	409;164;409	Q8N394;F8VRQ2;F8VSH2	TMTC2_HUMAN;.;.	R	409;409;403;164	ENSP00000322300:T409R;ENSP00000448292:T409R;ENSP00000447609:T403R	ENSP00000322300:T409R	T	+	2	0	TMTC2	81814299	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	5.696000	0.68287	2.776000	0.95493	0.650000	0.86243	ACG	TMTC2	-	NULL	ENSG00000179104		0.418	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC2	HGNC	protein_coding	OTTHUMT00000405663.1		0.00	66	0	C	NM_152588		83290168	+1			no_errors	ENST00000321196	ensembl	human	known	74_37	missense	5.77	49	3	SNP	1.000	G
TNPO3	23534	genome.wustl.edu	37	7	128645134	128645134	+	Nonsense_Mutation	SNP	A	A	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:128645134A>T	ENST00000265388.5	-	5	775	c.632T>A	c.(631-633)tTg>tAg	p.L211*	TNPO3_ENST00000482320.1_Nonsense_Mutation_p.L145*|TNPO3_ENST00000471166.1_Nonsense_Mutation_p.L211*|TNPO3_ENST00000393245.1_Nonsense_Mutation_p.L211*|TNPO3_ENST00000471234.1_Nonsense_Mutation_p.L211*			Q9Y5L0	TNPO3_HUMAN	transportin 3	211					splicing factor protein import into nucleus (GO:0035048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(3)	22						CAAAACTCCCAAGTTAAACCA	0.348																																					Pancreas(147;583 2585 39696 52331)												0													103.0	98.0	100.0					7																	128645134		2203	4300	6503	SO:0001587	stop_gained	0			AF145029	CCDS5809.1, CCDS55162.1	7q32.2	2014-02-03			ENSG00000064419	ENSG00000064419		"""Importins"""	17103	protein-coding gene	gene with protein product	"""importin 12"""	610032	"""limb girdle muscular dystrophy 1F (autosomal dominant)"""	LGMD1F		10366588, 10713112, 23543484, 23667635	Standard	NM_012470		Approved	TRN-SR, MTR10A, TRN-SR2, IPO12	uc003vol.2	Q9Y5L0	OTTHUMG00000158409	ENST00000265388.5:c.632T>A	7.37:g.128645134A>T	ENSP00000265388:p.Leu211*		A4D1K9|C9IZM0|Q6NUM1|Q96G71|Q96GU9|Q9Y3R2	Nonsense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	p.L211*	ENST00000265388.5	37	c.632	CCDS5809.1	7	.	.	.	.	.	.	.	.	.	.	A	41	8.607986	0.98884	.	.	ENSG00000064419	ENST00000393245;ENST00000265388;ENST00000482320;ENST00000471234;ENST00000471166	.	.	.	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	.	14.14	0.65313	1.0:0.0:0.0:0.0	.	.	.	.	X	211;211;145;211;211	.	ENSP00000265388:L211X	L	-	2	0	TNPO3	128432370	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.980000	0.93460	2.216000	0.71823	0.528000	0.53228	TTG	TNPO3	-	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	ENSG00000064419		0.348	TNPO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNPO3	HGNC	protein_coding	OTTHUMT00000350929.1	-	0.00	59	0	A	NM_012470		128645134	-1	tier1	-	no_errors	ENST00000393245	ensembl	human	known	74_37	nonsense	8.00	46	4	SNP	1.000	T
TONSL	4796	genome.wustl.edu	37	8	145661646	145661646	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:145661646C>T	ENST00000409379.3	-	17	2199	c.2170G>A	c.(2170-2172)Gca>Aca	p.A724T	AC084125.4_ENST00000442850.1_RNA|AC084125.4_ENST00000544423.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	724					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						ATGGCTGGTGCCGCCTGCCCT	0.682																																																	0													11.0	14.0	13.0					8																	145661646		2110	4160	6270	SO:0001583	missense	0				CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.2170G>A	8.37:g.145661646C>T	ENSP00000386239:p.Ala724Thr		B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.A724T	ENST00000409379.3	37	c.2170	CCDS34968.2	8	.	.	.	.	.	.	.	.	.	.	C	9.268	1.045054	0.19748	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.44482	0.92	3.68	2.8	0.32819	.	1.699270	0.03223	N	0.177867	T	0.29749	0.0743	N	0.22421	0.69	0.09310	N	1	B	0.14438	0.01	B	0.13407	0.009	T	0.18461	-1.0336	10	0.13853	T	0.58	-2.1729	7.035	0.24989	0.0:0.8708:0.0:0.1291	.	724	Q96HA7	TONSL_HUMAN	T	724;723	ENSP00000386239:A724T	ENSP00000386239:A724T	A	-	1	0	TONSL	145632454	0.013000	0.17824	0.003000	0.11579	0.180000	0.23129	1.746000	0.38288	0.866000	0.35629	0.462000	0.41574	GCA	TONSL	-	NULL	ENSG00000160949		0.682	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TONSL	HGNC	protein_coding	OTTHUMT00000329668.2	-	0.00	70	0	C	NM_013432		145661646	-1	tier1	-	no_errors	ENST00000409379	ensembl	human	known	74_37	missense	11.36	39	5	SNP	0.039	T
TP53	7157	genome.wustl.edu	37	17	7578526	7578526	+	Missense_Mutation	SNP	C	C	A	rs587781991		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:7578526C>A	ENST00000269305.4	-	5	593	c.404G>T	c.(403-405)tGc>tTc	p.C135F	TP53_ENST00000359597.4_Missense_Mutation_p.C135F|TP53_ENST00000420246.2_Missense_Mutation_p.C135F|TP53_ENST00000455263.2_Missense_Mutation_p.C135F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.C135F|TP53_ENST00000413465.2_Missense_Mutation_p.C135F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	135	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		C -> F (in sporadic cancers; somatic mutation).|C -> G (in sporadic cancers; somatic mutation).|C -> R (in sporadic cancers; somatic mutation).|C -> S (in sporadic cancers; somatic mutation).|C -> T (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|C -> W (in sporadic cancers; somatic mutation).|C -> Y (in sporadic cancers; somatic mutation; decreased E6-mediated binding to E6-AP).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.C135Y(60)|p.C135F(43)|p.C135S(8)|p.0?(8)|p.C42Y(4)|p.C3Y(4)|p.C135fs*9(3)|p.N131fs*27(2)|p.C3F(2)|p.C42F(2)|p.F134_T140>S(1)|p.K132_A138delKMFCQLA(1)|p.S127_Q136del10(1)|p.C135T(1)|p.V73fs*9(1)|p.C135fs*15(1)|p.C135fs*14(1)|p.Y126fs*11(1)|p.C3fs*9(1)|p.C42fs*9(1)|p.C135_A138delCQLA(1)|p.C42S(1)|p.M133fs*13(1)|p.C3S(1)|p.C135_T140delCQLAKT(1)|p.Q136fs*13(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGCCAGTTGGCAAAACATCTT	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	152	Substitution - Missense(126)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(4)|Insertion - Frameshift(3)|Complex - deletion inframe(1)	large_intestine(19)|breast(17)|oesophagus(16)|haematopoietic_and_lymphoid_tissue(13)|urinary_tract(13)|upper_aerodigestive_tract(12)|prostate(11)|lung(9)|ovary(9)|liver(7)|bone(6)|stomach(5)|central_nervous_system(5)|soft_tissue(2)|autonomic_ganglia(2)|eye(1)|kidney(1)|pancreas(1)|skin(1)|NS(1)|pituitary(1)											50.0	50.0	50.0					17																	7578526		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.404G>T	17.37:g.7578526C>A	ENSP00000269305:p.Cys135Phe		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.C135F	ENST00000269305.4	37	c.404	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574878	0.86542	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99797	-6.79;-6.79;-6.79;-6.79;-6.79;-6.79;-6.79;-6.79;-6.79	5.48	5.48	0.80851	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99771	0.9906	M	0.85945	2.785	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.993;1.0;1.0;1.0;1.0	D;D;P;D;D;D;D	0.97110	0.997;1.0;0.904;1.0;1.0;1.0;1.0	D	0.97349	0.9962	10	0.72032	D	0.01	-26.815	17.2272	0.86973	0.0:1.0:0.0:0.0	.	96;135;135;42;135;135;135	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	135;135;135;135;135;135;124;42;3;42;3;135	ENSP00000410739:C135F;ENSP00000352610:C135F;ENSP00000269305:C135F;ENSP00000398846:C135F;ENSP00000391127:C135F;ENSP00000391478:C135F;ENSP00000425104:C3F;ENSP00000423862:C42F;ENSP00000424104:C135F	ENSP00000269305:C135F	C	-	2	0	TP53	7519251	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	7.772000	0.85439	2.733000	0.93635	0.655000	0.94253	TGC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	41	0	C	NM_000546		7578526	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	60.61	13	20	SNP	1.000	A
TPTE	7179	genome.wustl.edu	37	21	10914363	10914363	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr21:10914363C>T	ENST00000361285.4	-	21	1685	c.1356G>A	c.(1354-1356)tcG>tcA	p.S452S	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Splice_Site_p.S434S|TPTE_ENST00000342420.5_Splice_Site_p.S414S	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	452	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTTCTCTTACCGAACATTTTC	0.328																																																	0													66.0	59.0	62.0					21																	10914363		2203	4297	6500	SO:0001630	splice_region_variant	0			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1356+1G>A	21.37:g.10914363C>T			B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Silent	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.S452	ENST00000361285.4	37	c.1356	CCDS13560.2	21																																																																																			TPTE	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_dom,pfscan_Tensin_phosphatase_C2-dom	ENSG00000166157		0.328	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	HGNC	protein_coding	OTTHUMT00000157413.1	-	0.00	148	0	C		Silent	10914363	-1	tier1	-	no_errors	ENST00000361285	ensembl	human	known	74_37	silent	20.00	72	18	SNP	0.768	T
TRHDE	29953	genome.wustl.edu	37	12	72666653	72666653	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:72666653G>A	ENST00000261180.4	+	1	191	c.95G>A	c.(94-96)cGc>cAc	p.R32H	TRHDE-AS1_ENST00000550334.1_RNA|TRHDE-AS1_ENST00000426250.3_RNA|TRHDE-AS1_ENST00000435350.1_RNA	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	32					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						ACCACGGAGCGCCACATCGCC	0.687																																																	0													20.0	14.0	16.0					12																	72666653		2192	4288	6480	SO:0001583	missense	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.95G>A	12.37:g.72666653G>A	ENSP00000261180:p.Arg32His		A5PL19|Q6UWJ4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.R32H	ENST00000261180.4	37	c.95	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	G	20.5	4.008704	0.75046	.	.	ENSG00000072657	ENST00000261180	T	0.01613	4.73	5.21	3.37	0.38596	.	0.140713	0.49305	N	0.000159	T	0.01661	0.0053	N	0.24115	0.695	0.40692	D	0.982401	B	0.15473	0.013	B	0.08055	0.003	T	0.54912	-0.8222	10	0.72032	D	0.01	.	9.8296	0.40932	0.1689:0.0:0.8311:0.0	.	32	Q9UKU6	TRHDE_HUMAN	H	32	ENSP00000261180:R32H	ENSP00000261180:R32H	R	+	2	0	TRHDE	70952920	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	2.879000	0.48522	1.172000	0.42781	0.609000	0.83330	CGC	TRHDE	-	NULL	ENSG00000072657		0.687	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	-	0.00	19	0	G	NM_013381		72666653	+1	tier1	-	no_errors	ENST00000261180	ensembl	human	known	74_37	missense	40.00	6	4	SNP	1.000	A
TRIM33	51592	genome.wustl.edu	37	1	114969885	114969885	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:114969885G>T	ENST00000358465.2	-	8	1417	c.1334C>A	c.(1333-1335)gCa>gAa	p.A445E	TRIM33_ENST00000369543.2_Missense_Mutation_p.A445E|TRIM33_ENST00000450349.2_Missense_Mutation_p.A53E	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	445					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATCACACCGTGCTTTCAAAAT	0.363			T	RET	papillary thyroid																																			Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	0													101.0	102.0	101.0					1																	114969885		2203	4300	6503	SO:0001583	missense	0			AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.1334C>A	1.37:g.114969885G>T	ENSP00000351250:p.Ala445Glu		O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Bromodomain,prints_Bromodomain	p.A445E	ENST00000358465.2	37	c.1334	CCDS872.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.9|26.9	4.783896|4.783896	0.90282|0.90282	.|.	.|.	ENSG00000197323|ENSG00000197323	ENST00000358465;ENST00000369543;ENST00000450349|ENST00000448034	T;T;T|.	0.78816|.	-0.89;-0.79;-1.21|.	4.94|4.94	4.94|4.94	0.65067|0.65067	B-box, C-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.64538|0.64538	0.2607|0.2607	L|L	0.56769|0.56769	1.78|1.78	0.80722|0.80722	D|D	1|1	D;D;D;P|.	0.76494|.	0.997;0.997;0.999;0.903|.	D;D;D;P|.	0.83275|.	0.986;0.986;0.996;0.474|.	T|T	0.63346|0.63346	-0.6658|-0.6658	10|5	0.36615|.	T|.	0.2|.	-11.6513|-11.6513	18.1494|18.1494	0.89669|0.89669	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	53;53;445;445|.	E7EN20;B3KN30;Q9UPN9-2;Q9UPN9|.	.;.;.;TRI33_HUMAN|.	E|N	445;445;53|182	ENSP00000351250:A445E;ENSP00000358556:A445E;ENSP00000412077:A53E|.	ENSP00000351250:A445E|.	A|H	-|-	2|1	0|0	TRIM33|TRIM33	114771408|114771408	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.888000|0.888000	0.51559|0.51559	6.327000|6.327000	0.72910|0.72910	2.298000|2.298000	0.77334|0.77334	0.655000|0.655000	0.94253|0.94253	GCA|CAC	TRIM33	-	smart_Bbox_C	ENSG00000197323		0.363	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM33	HGNC	protein_coding	OTTHUMT00000032854.1	-	0.00	71	0	G	NM_015906		114969885	-1	tier1	-	no_errors	ENST00000358465	ensembl	human	known	74_37	missense	7.27	51	4	SNP	1.000	T
TRPC7	57113	genome.wustl.edu	37	5	135601939	135601939	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:135601939C>A	ENST00000513104.1	-	5	1596	c.1314G>T	c.(1312-1314)tgG>tgT	p.W438C	TRPC7_ENST00000355180.3_Missense_Mutation_p.W377C|TRPC7_ENST00000426057.2_Missense_Mutation_p.W322C	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	438					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GCATTTCTGTCCAGGAGAACT	0.383																																																	0													229.0	217.0	221.0					5																	135601939		1875	4115	5990	SO:0001583	missense	0			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.1314G>T	5.37:g.135601939C>A	ENSP00000426070:p.Trp438Cys		A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC7_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.W438C	ENST00000513104.1	37	c.1314	CCDS47267.2	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.9|20.9	4.067927|4.067927	0.76301|0.76301	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753|ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	.|T;T;T	.|0.79352	.|-1.13;-1.26;-1.21	5.37|5.37	5.37|5.37	0.77165|0.77165	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.87103|0.87103	0.6094|0.6094	M|M	0.79475|0.79475	2.455|2.455	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.64830	.|0.994;0.964;0.972;0.972	.|P;P;P;P	.|0.61003	.|0.865;0.882;0.765;0.664	D|D	0.86229|0.86229	0.1636|0.1636	5|10	.|0.42905	.|T	.|0.14	-0.6983|-0.6983	19.3071|19.3071	0.94167|0.94167	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|322;377;383;438	.|Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.|.;.;.;TRPC7_HUMAN	Y|C	322;377;383|377;322;438;438	.|ENSP00000347312:W377C;ENSP00000441628:W322C;ENSP00000426070:W438C	.|ENSP00000265193:W438C	D|W	-|-	1|3	0|0	TRPC7|TRPC7	135629838|135629838	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.604000|7.604000	0.82830|0.82830	2.793000|2.793000	0.96121|0.96121	0.563000|0.563000	0.77884|0.77884	GAC|TGG	TRPC7	-	tigrfam_TRP_channel	ENSG00000069018		0.383	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	HGNC	protein_coding	OTTHUMT00000366975.1	-	0.00	126	0	C	NM_020389		135601939	-1	tier1	-	no_errors	ENST00000513104	ensembl	human	known	74_37	missense	5.41	70	4	SNP	1.000	A
TTF1	7270	genome.wustl.edu	37	9	135251460	135251460	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:135251460C>T	ENST00000334270.2	-	11	2599	c.2560G>A	c.(2560-2562)Gca>Aca	p.A854T	TTF1_ENST00000461970.1_5'UTR	NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	854					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		TTGGGTGCTGCAGGAGTCTGG	0.418																																																	0													164.0	157.0	159.0					9																	135251460		2203	4300	6503	SO:0001583	missense	0			BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.2560G>A	9.37:g.135251460C>T	ENSP00000333920:p.Ala854Thr		A1L160|Q4VXF3|Q58EY2|Q6P5T5	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.A854T	ENST00000334270.2	37	c.2560	CCDS6948.1	9	.	.	.	.	.	.	.	.	.	.	c	11.07	1.531393	0.27387	.	.	ENSG00000125482	ENST00000334270;ENST00000245588	T	0.10573	2.86	4.97	2.0	0.26442	.	0.597827	0.14729	N	0.301861	T	0.08403	0.0209	L	0.47716	1.5	0.09310	N	1	B	0.30824	0.296	B	0.19946	0.027	T	0.27502	-1.0072	10	0.52906	T	0.07	.	4.9524	0.14021	0.1665:0.6507:0.0:0.1828	.	854	Q15361	TTF1_HUMAN	T	854	ENSP00000333920:A854T	ENSP00000245588:A854T	A	-	1	0	TTF1	134241281	0.001000	0.12720	0.000000	0.03702	0.099000	0.18886	0.125000	0.15749	0.199000	0.20427	-0.258000	0.10820	GCA	TTF1	-	NULL	ENSG00000125482		0.418	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF1	HGNC	protein_coding	OTTHUMT00000054784.2	-	0.00	50	0	C	NM_007344		135251460	-1	tier1	-	no_errors	ENST00000334270	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.000	T
TTF2	8458	genome.wustl.edu	37	1	117633213	117633213	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:117633213G>T	ENST00000369466.4	+	15	2600	c.2556G>T	c.(2554-2556)gaG>gaT	p.E852D		NM_003594.3	NP_003585.3	Q9UNY4	TTF2_HUMAN	transcription termination factor, RNA polymerase II	852					ATP catabolic process (GO:0006200)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|spliceosomal complex (GO:0005681)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(24)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	50	Lung SC(450;0.225)	all_cancers(81;4.23e-06)|all_epithelial(167;3.65e-07)|all_lung(203;2.81e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0553)|Colorectal(144;0.179)|LUSC - Lung squamous cell carcinoma(189;0.19)		AAGATGAAGAGACTGTTTACA	0.368																																																	0													123.0	118.0	120.0					1																	117633213		2203	4300	6503	SO:0001583	missense	0			AF073771	CCDS892.1	1p13.1	2014-02-18			ENSG00000116830	ENSG00000116830			12398	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 6"""	604718				9748214	Standard	NM_003594		Approved	HuF2, ZGRF6	uc001egy.3	Q9UNY4	OTTHUMG00000012030	ENST00000369466.4:c.2556G>T	1.37:g.117633213G>T	ENSP00000358478:p.Glu852Asp		A8K4Q2|O75921|Q5T2K7|Q5VVU8|Q8N6I8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_Znf_GRF,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E852D	ENST00000369466.4	37	c.2556	CCDS892.1	1	.	.	.	.	.	.	.	.	.	.	G	15.53	2.862220	0.51482	.	.	ENSG00000116830	ENST00000369466	T	0.76448	-1.02	5.34	3.33	0.38152	SNF2-related (1);	0.431628	0.17194	N	0.183390	T	0.63212	0.2492	L	0.58583	1.82	0.09310	N	1	P	0.39424	0.673	B	0.43445	0.42	T	0.59172	-0.7504	10	0.72032	D	0.01	-9.0691	6.9295	0.24434	0.2084:0.0:0.7916:0.0	.	852	Q9UNY4	TTF2_HUMAN	D	852	ENSP00000358478:E852D	ENSP00000358478:E852D	E	+	3	2	TTF2	117434736	0.992000	0.36948	0.396000	0.26296	0.996000	0.88848	1.964000	0.40462	1.478000	0.48253	0.655000	0.94253	GAG	TTF2	-	pfam_SNF2_N,superfamily_P-loop_NTPase	ENSG00000116830		0.368	TTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF2	HGNC	protein_coding	OTTHUMT00000033277.3	-	0.00	77	0	G			117633213	+1	tier1	-	no_errors	ENST00000369466	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.165	T
TTN	7273	genome.wustl.edu	37	2	179475827	179475827	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:179475827G>T	ENST00000591111.1	-	220	46330	c.46106C>A	c.(46105-46107)gCa>gAa	p.A15369E	TTN_ENST00000342175.6_Missense_Mutation_p.A8137E|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A14442E|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A8070E|TTN_ENST00000460472.2_Missense_Mutation_p.A7945E|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A17010E|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	15369	Ig-like 97.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.A7945V(1)|p.A14442V(1)|p.A8137V(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCAAGGTGTGCAGAGATGTG	0.433																																																	3	Substitution - Missense(3)	large_intestine(3)											183.0	174.0	177.0					2																	179475827		1912	4134	6046	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.46106C>A	2.37:g.179475827G>T	ENSP00000465570:p.Ala15369Glu		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.A14442E	ENST00000591111.1	37	c.43325		2	.	.	.	.	.	.	.	.	.	.	G	7.776	0.708425	0.15239	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.65	4.76	0.60689	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.52661	0.1748	M	0.73962	2.25	0.28411	N	0.918188	P;P;P;P	0.38335	0.627;0.627;0.627;0.627	B;B;B;B	0.43623	0.172;0.172;0.172;0.425	T	0.55205	-0.8177	9	0.87932	D	0	.	15.517	0.75833	0.0695:0.0:0.9305:0.0	.	7945;8070;8137;15369	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	E	14442;7945;8137;8070;7945	ENSP00000343764:A14442E;ENSP00000434586:A7945E;ENSP00000340554:A8137E;ENSP00000352154:A8070E	ENSP00000340554:A8137E	A	-	2	0	TTN	179184072	1.000000	0.71417	1.000000	0.80357	0.666000	0.39218	3.069000	0.50026	2.824000	0.97209	0.655000	0.94253	GCA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000155657		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	64	0	G	NM_133378		179475827	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	43.18	25	19	SNP	0.967	T
TUBA8	51807	genome.wustl.edu	37	22	18609704	18609704	+	Missense_Mutation	SNP	G	G	T	rs567090235		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr22:18609704G>T	ENST00000330423.3	+	4	1032	c.959G>T	c.(958-960)cGg>cTg	p.R320L	TUBA8_ENST00000316027.6_Missense_Mutation_p.R254L	NM_018943.2	NP_061816.1	Q9NY65	TBA8_HUMAN	tubulin, alpha 8	320					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	14						ATGCTCTACCGGGGCGACGTG	0.562																																																	0													99.0	83.0	88.0					22																	18609704		2203	4300	6503	SO:0001583	missense	0			AJ245922	CCDS13751.1, CCDS54495.1	22q11	2005-06-11			ENSG00000183785	ENSG00000183785		"""Tubulins"""	12410	protein-coding gene	gene with protein product		605742		TUBAL2		10772959, 10591208	Standard	NM_001193414		Approved		uc002znv.2	Q9NY65	OTTHUMG00000150097	ENST00000330423.3:c.959G>T	22.37:g.18609704G>T	ENSP00000333326:p.Arg320Leu		B2RCX2|B3KPW9|B4DWG3|Q2M3N4	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin	p.R320L	ENST00000330423.3	37	c.959	CCDS13751.1	22	.	.	.	.	.	.	.	.	.	.	.	20.4	3.985761	0.74589	.	.	ENSG00000183785	ENST00000316027;ENST00000330423;ENST00000416740	D;D;D	0.84370	-1.84;-1.84;-1.84	5.67	5.67	0.87782	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.96605	0.8892	H	0.99815	4.805	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.998;0.997;0.997	D	0.98212	1.0473	10	0.87932	D	0	.	19.1191	0.93355	0.0:0.0:1.0:0.0	.	254;344;320	B3KPW9;C9J2C0;Q9NY65	.;.;TBA8_HUMAN	L	254;320;344	ENSP00000318575:R254L;ENSP00000333326:R320L;ENSP00000412646:R344L	ENSP00000318575:R254L	R	+	2	0	TUBA8	16989704	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.813000	0.99286	2.837000	0.97791	0.655000	0.94253	CGG	TUBA8	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin	ENSG00000183785		0.562	TUBA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA8	HGNC	protein_coding	OTTHUMT00000316232.3		0.00	60	0	G	NM_018943		18609704	+1			no_errors	ENST00000330423	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	T
UBBP4	23666	genome.wustl.edu	37	17	21731555	21731555	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:21731555C>A	ENST00000578713.1	+	2	634	c.630C>A	c.(628-630)gaC>gaA	p.D210E	UBBP4_ENST00000584755.1_3'UTR|UBBP4_ENST00000583708.1_3'UTR					ubiquitin B pseudogene 4											endometrium(9)|kidney(4)|lung(4)|prostate(3)|urinary_tract(4)	24						CTCTTTCTGACTACAGCATCC	0.527																																																	0																																										SO:0001583	missense	0			X07499		17p11.2	2011-08-10				ENSG00000263563			12467	pseudogene	pseudogene						2834222	Standard	NG_002285		Approved		uc002gyy.3			ENST00000578713.1:c.630C>A	17.37:g.21731555C>A	ENSP00000464265:p.Asp210Glu			Missense_Mutation	SNP	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup,prints_Ubiquitin	p.D210E	ENST00000578713.1	37	c.630		17																																																																																			UBBP4	-	pfam_Ubiquitin_dom,pfam_Rad60/SUMO_like,smart_Ubiquitin_dom,pfscan_Ubiquitin_supergroup	ENSG00000263563		0.527	UBBP4-004	PUTATIVE	basic|appris_principal	protein_coding	UBBP4	HGNC	protein_coding	OTTHUMT00000444589.2	-	0.00	86	0	C			21731555	+1	tier1	-	no_errors	ENST00000578713	ensembl	human	putative	74_37	missense	8.33	55	5	SNP	1.000	A
UBE2U	148581	genome.wustl.edu	37	1	64680522	64680522	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:64680522G>T	ENST00000371076.3	+	5	608	c.364G>T	c.(364-366)Gag>Tag	p.E122*		NM_152489.1	NP_689702.1	Q5VVX9	UBE2U_HUMAN	ubiquitin-conjugating enzyme E2U (putative)	122					protein ubiquitination (GO:0016567)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			large_intestine(3)|lung(2)|skin(1)	6						TCCAGTGCTAGAGAATCCAGT	0.333																																																	0													99.0	102.0	101.0					1																	64680522		2203	4300	6503	SO:0001587	stop_gained	0			BC029895	CCDS627.1	1p31.3	2008-02-05			ENSG00000177414	ENSG00000177414		"""Ubiquitin-conjugating enzymes E2"""	28559	protein-coding gene	gene with protein product						12477932	Standard	NM_152489		Approved	MGC35130	uc001dbn.1	Q5VVX9	OTTHUMG00000009023	ENST00000371076.3:c.364G>T	1.37:g.64680522G>T	ENSP00000360116:p.Glu122*		Q8N1D4	Nonsense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.E122*	ENST00000371076.3	37	c.364	CCDS627.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.111962	0.94339	.	.	ENSG00000177414	ENST00000371077;ENST00000371076	.	.	.	4.49	1.24	0.21308	.	0.578351	0.15316	N	0.268797	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	4.8352	0.13460	0.2235:0.1787:0.5978:0.0	.	.	.	.	X	122	.	ENSP00000360116:E122X	E	+	1	0	UBE2U	64453110	0.984000	0.35163	0.780000	0.31762	0.437000	0.31866	1.463000	0.35277	0.423000	0.26033	0.557000	0.71058	GAG	UBE2U	-	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000177414		0.333	UBE2U-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2U	HGNC	protein_coding	OTTHUMT00000025005.1	-	0.00	111	0	G	NM_152489		64680522	+1	tier1	-	no_errors	ENST00000371076	ensembl	human	known	74_37	nonsense	5.63	67	4	SNP	0.752	T
UNC13B	10497	genome.wustl.edu	37	9	35386232	35386232	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:35386232C>T	ENST00000378495.3	+	23	3011	c.2789C>T	c.(2788-2790)tCc>tTc	p.S930F	UNC13B_ENST00000378496.4_Missense_Mutation_p.S930F|UNC13B_ENST00000396787.1_Missense_Mutation_p.S942F	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	930					apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)	p.S930F(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			TGTTTGAACTCCACATATGAA	0.493																																																	1	Substitution - Missense(1)	urinary_tract(1)											74.0	75.0	75.0					9																	35386232		2203	4300	6503	SO:0001583	missense	0			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.2789C>T	9.37:g.35386232C>T	ENSP00000367756:p.Ser930Phe		Q5VYM8	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.S930F	ENST00000378495.3	37	c.2789	CCDS6579.1	9	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851359	0.91355	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	D;D;D	0.85484	-1.86;-1.79;-1.99	4.76	4.76	0.60689	Calcium-dependent secretion activator (1);	0.100301	0.64402	D	0.000001	D	0.92450	0.7603	M	0.81341	2.54	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.69824	0.93;0.966	D	0.93367	0.6732	10	0.87932	D	0	-14.6683	18.3312	0.90270	0.0:1.0:0.0:0.0	.	930;930	F8W8M9;O14795	.;UN13B_HUMAN	F	942;930;930;517	ENSP00000380006:S942F;ENSP00000367756:S930F;ENSP00000367757:S930F	ENSP00000367756:S930F	S	+	2	0	UNC13B	35376232	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.525000	0.81892	2.627000	0.88993	0.655000	0.94253	TCC	UNC13B	-	pfam_Ca-dep_secretion_activator	ENSG00000198722		0.493	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	HGNC	protein_coding	OTTHUMT00000052296.1		0.00	60	0	C	NM_006377		35386232	+1			no_errors	ENST00000378496	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
UNC5D	137970	genome.wustl.edu	37	8	35631964	35631964	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:35631964C>A	ENST00000404895.2	+	16	2954	c.2626C>A	c.(2626-2628)Cag>Aag	p.Q876K	UNC5D_ENST00000453357.2_Missense_Mutation_p.Q871K|UNC5D_ENST00000287272.2_Missense_Mutation_p.Q807K|UNC5D_ENST00000420357.1_Missense_Mutation_p.Q809K|UNC5D_ENST00000449677.1_Missense_Mutation_p.Q452K|UNC5D_ENST00000416672.1_Missense_Mutation_p.Q881K	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	876	Death.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CAAGGACTGGCAGATGTTAGC	0.468																																																	0													114.0	108.0	110.0					8																	35631964		2203	4300	6503	SO:0001583	missense	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.2626C>A	8.37:g.35631964C>A	ENSP00000385143:p.Gln876Lys		Q8WYP7	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death_domain,pfam_Immunoglobulin,superfamily_DEATH-like_dom,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death_domain,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like_dom	p.Q876K	ENST00000404895.2	37	c.2626	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701082	0.88924	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	D;D;D;D;D;D	0.83075	-1.68;-1.68;-1.68;-1.68;-1.68;-1.68	5.95	5.06	0.68205	Death (2);DEATH-like (2);	0.104627	0.64402	D	0.000002	D	0.87462	0.6183	L	0.56769	1.78	0.58432	D	0.999998	D;P;P	0.57571	0.98;0.792;0.826	P;B;P	0.56474	0.799;0.419;0.554	D	0.88719	0.3228	10	0.72032	D	0.01	-18.0667	16.4549	0.84009	0.1322:0.8678:0.0:0.0	.	452;871;876	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	K	876;809;807;881;871;452	ENSP00000385143:Q876K;ENSP00000392739:Q809K;ENSP00000287272:Q807K;ENSP00000412652:Q881K;ENSP00000394303:Q871K;ENSP00000397211:Q452K	ENSP00000287272:Q807K	Q	+	1	0	UNC5D	35751506	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.916000	0.69981	1.486000	0.48398	0.650000	0.86243	CAG	UNC5D	-	pfam_Death_domain,superfamily_DEATH-like_dom,smart_Death_domain	ENSG00000156687		0.468	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	-	0.00	61	0	C			35631964	+1	tier1	-	no_errors	ENST00000404895	ensembl	human	known	74_37	missense	55.56	20	25	SNP	1.000	A
UNCX	340260	genome.wustl.edu	37	7	1273297	1273297	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:1273297C>T	ENST00000316333.8	+	2	527	c.416C>T	c.(415-417)gCg>gTg	p.A139V		NM_001080461.1	NP_001073930.1	A6NJT0	UNC4_HUMAN	UNC homeobox	139					cartilage condensation (GO:0001502)|common myeloid progenitor cell proliferation (GO:0035726)|dorsal spinal cord development (GO:0021516)|olfactory bulb interneuron differentiation (GO:0021889)|pattern specification process (GO:0007389)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			lung(2)|skin(1)|upper_aerodigestive_tract(1)	4		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		GAGGCGCTGGCGCTGCGCCTA	0.687																																																	0													46.0	49.0	48.0					7																	1273297		2203	4300	6503	SO:0001583	missense	0				CCDS34583.1	7p22.3	2011-06-20			ENSG00000164853	ENSG00000164853		"""Homeoboxes / PRD class"""	33194	protein-coding gene	gene with protein product							Standard	NM_001080461		Approved	Uncx4.1	uc011jvw.2	A6NJT0	OTTHUMG00000152022	ENST00000316333.8:c.416C>T	7.37:g.1273297C>T	ENSP00000314480:p.Ala139Val		A4D221	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.A139V	ENST00000316333.8	37	c.416	CCDS34583.1	7	.	.	.	.	.	.	.	.	.	.	C	16.13	3.035437	0.54896	.	.	ENSG00000164853	ENST00000316333	D	0.98362	-4.89	3.89	2.96	0.34315	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.64402	U	0.000001	D	0.99306	0.9757	H	0.98333	4.205	0.50813	D	0.999891	D	0.89917	1.0	D	0.97110	1.0	D	0.98640	1.0675	10	0.87932	D	0	-23.444	11.7135	0.51639	0.1783:0.8217:0.0:0.0	.	139	A6NJT0	UNC4_HUMAN	V	139	ENSP00000314480:A139V	ENSP00000314480:A139V	A	+	2	0	UNCX	1239823	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.515000	0.81761	0.721000	0.32231	0.478000	0.44815	GCG	UNCX	-	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	ENSG00000164853		0.687	UNCX-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	UNCX	HGNC	protein_coding	OTTHUMT00000324910.2	-	0.00	118	0	C	NM_001080461		1273297	+1	tier1	-	no_errors	ENST00000316333	ensembl	human	known	74_37	missense	6.87	122	9	SNP	1.000	T
VANGL2	57216	genome.wustl.edu	37	1	160394067	160394067	+	Silent	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:160394067G>A	ENST00000368061.2	+	7	1773	c.1299G>A	c.(1297-1299)acG>acA	p.T433T		NM_020335.2	NP_065068.1	Q9ULK5	VANG2_HUMAN	VANGL planar cell polarity protein 2	433					anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|cell migration involved in kidney development (GO:0035787)|cochlea morphogenesis (GO:0090103)|convergent extension involved in axis elongation (GO:0060028)|convergent extension involved in neural plate elongation (GO:0022007)|digestive tract morphogenesis (GO:0048546)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity involved in neural tube closure (GO:0090177)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|glomerulus development (GO:0032835)|hair follicle development (GO:0001942)|heart looping (GO:0001947)|inner ear receptor stereocilium organization (GO:0060122)|kidney morphogenesis (GO:0060993)|lateral sprouting involved in lung morphogenesis (GO:0060490)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in axis elongation (GO:0003402)|planar cell polarity pathway involved in heart morphogenesis (GO:0061346)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|positive regulation of JUN kinase activity (GO:0043507)|post-anal tail morphogenesis (GO:0036342)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of Wnt signaling pathway (GO:0030111)|Rho protein signal transduction (GO:0007266)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell pole (GO:0060187)|cell-cell junction (GO:0005911)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)				biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(1)	37	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ATGACATGACGCCCAAGGTAG	0.547																																																	0													115.0	81.0	93.0					1																	160394067		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033041	CCDS30915.1	1q22-q23	2013-03-05	2013-03-05		ENSG00000162738	ENSG00000162738			15511	protein-coding gene	gene with protein product	"""vang, van gogh-like 2"", ""loop-tail-associated protein"", ""strabismus"""	600533	"""vang (van gogh, Drosophila)-like 2, vang, van gogh-like 2 (Drosophila)"", ""vang-like 2 (van gogh, Drosophila)"""			11431695	Standard	NM_020335		Approved	KIAA1215, LTAP, LPP1, STBM, STB1, STBM1, MGC119403, MGC119404	uc001fwc.2	Q9ULK5	OTTHUMG00000033122	ENST00000368061.2:c.1299G>A	1.37:g.160394067G>A			D3DVE9|Q5T212	Silent	SNP	pfam_Strabismus,pirsf_Strabismus	p.T433	ENST00000368061.2	37	c.1299	CCDS30915.1	1																																																																																			VANGL2	-	pfam_Strabismus,pirsf_Strabismus	ENSG00000162738		0.547	VANGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VANGL2	HGNC	protein_coding	OTTHUMT00000080677.1	-	0.00	57	0	G	NM_020335		160394067	+1	tier1	-	no_errors	ENST00000368061	ensembl	human	known	74_37	silent	23.40	36	11	SNP	0.996	A
USH2A	7399	genome.wustl.edu	37	1	215853681	215853681	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:215853681G>T	ENST00000307340.3	-	62	12490	c.12104C>A	c.(12103-12105)cCa>cAa	p.P4035Q	USH2A_ENST00000366943.2_Missense_Mutation_p.P4035Q	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4035	Fibronectin type-III 25. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.P4035R(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGTTGTGAATGGTTCTAACCC	0.403										HNSCC(13;0.011)																																							1	Substitution - Missense(1)	endometrium(1)											114.0	119.0	118.0					1																	215853681		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12104C>A	1.37:g.215853681G>T	ENSP00000305941:p.Pro4035Gln		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.P4035Q	ENST00000307340.3	37	c.12104	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	16.27	3.076481	0.55753	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.68624	-0.34;-0.34	5.26	5.26	0.73747	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.154271	0.30142	N	0.010308	D	0.86760	0.6010	M	0.93328	3.405	0.58432	D	0.999995	D	0.76494	0.999	D	0.75020	0.985	D	0.90099	0.4183	10	0.72032	D	0.01	.	18.8769	0.92341	0.0:0.0:1.0:0.0	.	4035	O75445	USH2A_HUMAN	Q	4035	ENSP00000305941:P4035Q;ENSP00000355910:P4035Q	ENSP00000305941:P4035Q	P	-	2	0	USH2A	213920304	1.000000	0.71417	0.997000	0.53966	0.032000	0.12392	8.185000	0.89704	2.458000	0.83093	0.655000	0.94253	CCA	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.403	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1		0.00	43	0	G	NM_007123		215853681	-1			no_errors	ENST00000366943	ensembl	human	known	74_37	missense	6.06	31	2	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	215990529	215990529	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:215990529T>C	ENST00000307340.3	-	48	9766	c.9380A>G	c.(9379-9381)cAa>cGa	p.Q3127R	USH2A_ENST00000366943.2_Missense_Mutation_p.Q3127R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3127	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCAATCAATTTGAAGAGATCT	0.368										HNSCC(13;0.011)																																							0													80.0	80.0	80.0					1																	215990529		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9380A>G	1.37:g.215990529T>C	ENSP00000305941:p.Gln3127Arg		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.Q3127R	ENST00000307340.3	37	c.9380	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	T	6.921	0.539684	0.13250	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.52526	0.66;0.66	5.29	2.99	0.34606	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.330624	0.21608	N	0.071827	T	0.32763	0.0840	L	0.31926	0.97	0.31380	N	0.679124	B	0.06786	0.001	B	0.06405	0.002	T	0.28902	-1.0029	10	0.19590	T	0.45	.	9.4303	0.38606	0.0:0.1438:0.0:0.8562	.	3127	O75445	USH2A_HUMAN	R	3127	ENSP00000305941:Q3127R;ENSP00000355910:Q3127R	ENSP00000305941:Q3127R	Q	-	2	0	USH2A	214057152	0.920000	0.31207	0.756000	0.31282	0.825000	0.46686	1.343000	0.33930	0.436000	0.26393	0.459000	0.35465	CAA	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000042781		0.368	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	-	0.00	30	0	T	NM_007123		215990529	-1	tier1	-	no_errors	ENST00000366943	ensembl	human	known	74_37	missense	13.64	19	3	SNP	0.941	C
VAT1	10493	genome.wustl.edu	37	17	41170790	41170790	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:41170790G>T	ENST00000420567.3	-	2	157	c.12C>A	c.(10-12)aaC>aaA	p.N4K	VAT1_ENST00000355653.3_Missense_Mutation_p.N138K|VAT1_ENST00000587173.1_Missense_Mutation_p.N70K			P54219	VMAT1_HUMAN	vesicle amine transport 1	0			T -> P (in dbSNP:rs2270641). {ECO:0000269|PubMed:15489334}.		monoamine transport (GO:0015844)|neurotransmitter transport (GO:0006836)|transmembrane transport (GO:0055085)	clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	drug transmembrane transporter activity (GO:0015238)|monoamine transmembrane transporter activity (GO:0008504)			endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|upper_aerodigestive_tract(1)	9		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.156)	Ephedra(DB01363)|Methamphetamine(DB01577)|Norepinephrine(DB00368)|Reserpine(DB00206)	TCCCTGACCGGTTCAACACCA	0.527																																																	0													100.0	83.0	89.0					17																	41170790		2203	4300	6503	SO:0001583	missense	0			U18009	CCDS11451.1	17q21	2013-08-23	2013-08-23			ENSG00000108828			16919	protein-coding gene	gene with protein product		604631	"""vesicle amine transport protein 1 homolog (T. californica)"""			7774926, 8938427	Standard	NM_006373		Approved	VATI, FLJ20230	uc002icm.1	Q99536		ENST00000420567.3:c.12C>A	17.37:g.41170790G>T	ENSP00000408553:p.Asn4Lys		E9PDJ5|Q9BRE4	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.N138K	ENST00000420567.3	37	c.414		17	.	.	.	.	.	.	.	.	.	.	G	3.591	-0.083610	0.07141	.	.	ENSG00000108828	ENST00000355653;ENST00000542468;ENST00000420567;ENST00000315674	T;T	0.54479	0.57;2.84	5.64	3.51	0.40186	GroES-like (1);	0.485871	0.24717	N	0.036171	T	0.35595	0.0937	N	0.20986	0.625	0.37685	D	0.923617	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.30592	-0.9973	10	0.46703	T	0.11	-0.7291	8.4825	0.33052	0.2083:0.1262:0.6655:0.0	.	70;138	B4DPX4;Q99536	.;VAT1_HUMAN	K	138;45;4;138	ENSP00000347872:N138K;ENSP00000408553:N4K	ENSP00000326121:N138K	N	-	3	2	VAT1	38424316	0.953000	0.32496	0.989000	0.46669	0.877000	0.50540	0.590000	0.23954	1.379000	0.46325	0.561000	0.74099	AAC	VAT1	-	superfamily_GroES-like,smart_PKS_ER	ENSG00000108828		0.527	VAT1-002	PUTATIVE	basic|exp_conf	protein_coding	VAT1	HGNC	protein_coding	OTTHUMT00000453104.1		0.00	41	0	G	NM_006373		41170790	-1			no_errors	ENST00000355653	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.927	T
VCAN	1462	genome.wustl.edu	37	5	82817499	82817499	+	Missense_Mutation	SNP	G	G	T	rs146606609	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:82817499G>T	ENST00000265077.3	+	7	3939	c.3374G>T	c.(3373-3375)cGc>cTc	p.R1125L	VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Missense_Mutation_p.R1125L|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000512590.2_Missense_Mutation_p.R1077L	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1125	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)	p.R1125H(3)		NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CTAACACCACGCATTGGGCCA	0.398																																																	3	Substitution - Missense(3)	large_intestine(2)|endometrium(1)											68.0	62.0	64.0					5																	82817499		2203	4300	6503	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.3374G>T	5.37:g.82817499G>T	ENSP00000265077:p.Arg1125Leu		P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EG-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Sushi_SCR_CCP,smart_Ig_sub,smart_Link,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like_dom,prints_Link	p.R1125L	ENST00000265077.3	37	c.3374	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	G	1.517	-0.547861	0.04024	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	D;D;D	0.85411	-1.87;-1.96;-1.98	5.81	-0.402	0.12404	.	0.982777	0.08328	N	0.962738	T	0.69922	0.3165	N	0.08118	0	0.09310	N	1	B;B	0.15473	0.005;0.013	B;B	0.17098	0.017;0.008	T	0.58696	-0.7591	10	0.72032	D	0.01	.	7.3139	0.26489	0.215:0.3072:0.4777:0.0	.	1125;1125	P13611-3;P13611	.;CSPG2_HUMAN	L	1125;1125;1077	ENSP00000265077:R1125L;ENSP00000342768:R1125L;ENSP00000425959:R1077L	ENSP00000265077:R1125L	R	+	2	0	VCAN	82853255	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.409000	0.07160	-0.095000	0.12351	-1.850000	0.00570	CGC	VCAN	-	NULL	ENSG00000038427		0.398	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3		0.00	45	0	G	NM_004385		82817499	+1			no_errors	ENST00000265077	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.000	T
VCL	7414	genome.wustl.edu	37	10	75877901	75877901	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr10:75877901G>T	ENST00000211998.4	+	22	3473	c.3379G>T	c.(3379-3381)Gtt>Ttt	p.V1127F	RP11-178G16.4_ENST00000598318.1_lincRNA|RP11-178G16.5_ENST00000599110.1_lincRNA|VCL_ENST00000372755.3_Missense_Mutation_p.V1059F|VCL_ENST00000417648.2_Missense_Mutation_p.V320F	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	1127	C-terminal tail.|Facilitates phospholipid membrane insertion. {ECO:0000250}.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					ACTGCGCTGGGTTAGAAAGAC	0.507																																																	0													86.0	77.0	80.0					10																	75877901		2203	4300	6503	SO:0001583	missense	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.3379G>T	10.37:g.75877901G>T	ENSP00000211998:p.Val1127Phe		Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.V1127F	ENST00000211998.4	37	c.3379	CCDS7341.1	10	.	.	.	.	.	.	.	.	.	.	G	20.8	4.049392	0.75846	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000417648;ENST00000436396	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	5.5	5.5	0.81552	.	0.181933	0.47455	D	0.000224	T	0.68787	0.3039	L	0.49126	1.545	0.80722	D	1	D;P;P	0.71674	0.998;0.568;0.588	D;B;B	0.70016	0.967;0.232;0.158	T	0.70037	-0.4982	10	0.66056	D	0.02	.	19.4027	0.94637	0.0:0.0:1.0:0.0	.	320;1059;1127	B4DTM7;P18206-2;P18206	.;.;VINC_HUMAN	F	1059;1127;320;799	ENSP00000361841:V1059F;ENSP00000211998:V1127F;ENSP00000411887:V320F;ENSP00000415489:V799F	ENSP00000211998:V1127F	V	+	1	0	VCL	75547907	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.401000	0.73256	2.576000	0.86940	0.655000	0.94253	GTT	VCL	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000035403		0.507	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding		-	0.00	39	0	G	NM_003373, NM_014000		75877901	+1	tier1	-	no_errors	ENST00000211998	ensembl	human	known	74_37	missense	34.48	19	10	SNP	1.000	T
VPS13B	157680	genome.wustl.edu	37	8	100568859	100568860	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:100568859_100568860insT	ENST00000358544.2	+	31	5113_5114	c.5002_5003insT	c.(5002-5004)cttfs	p.L1668fs	VPS13B_ENST00000357162.2_Frame_Shift_Ins_p.L1643fs|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	1668					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AAATCCAGCCCTTGAGTGGAAT	0.411																																					Colon(161;2205 2542 7338 31318)												0																																										SO:0001589	frameshift_variant	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.5004dupT	8.37:g.100568861_100568861dupT	ENSP00000351346:p.Leu1668fs		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Frame_Shift_Ins	INS	pfam_Autophagy-rel_C	p.E1669fs	ENST00000358544.2	37	c.5002_5003	CCDS6280.1	8																																																																																			VPS13B	-	NULL	ENSG00000132549		0.411	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1		0.00	34	0	-	NM_184042		100568860	+1	tier1		no_errors	ENST00000358544	ensembl	human	known	74_37	frame_shift_ins	16.67	10	2	INS	0.994:0.998	T
WBP4	11193	genome.wustl.edu	37	13	41654921	41654921	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr13:41654921A>G	ENST00000379487.3	+	9	1296	c.896A>G	c.(895-897)gAa>gGa	p.E299G	WBP4_ENST00000542082.1_Missense_Mutation_p.E278G	NM_007187.3	NP_009118.1	O75554	WBP4_HUMAN	WW domain binding protein 4	299					mRNA cis splicing, via spliceosome (GO:0045292)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	nucleic acid binding (GO:0003676)|proline-rich region binding (GO:0070064)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|prostate(1)|skin(1)	12		Lung NSC(96;3.55e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;3.11e-09)|Epithelial(112;3.37e-06)|OV - Ovarian serous cystadenocarcinoma(117;8.3e-05)|GBM - Glioblastoma multiforme(144;0.00102)|BRCA - Breast invasive adenocarcinoma(63;0.07)		GAATGGCAAGAAATTAAACAA	0.338																																																	0													119.0	119.0	119.0					13																	41654921		2203	4299	6502	SO:0001583	missense	0			AF071185	CCDS9375.1	13q13.3	2012-10-17	2012-10-17		ENSG00000120688	ENSG00000120688			12739	protein-coding gene	gene with protein product	"""formin binding protein 21"""	604981				9724750	Standard	NM_007187		Approved	FBP21, MGC117310	uc001uxt.3	O75554	OTTHUMG00000016784	ENST00000379487.3:c.896A>G	13.37:g.41654921A>G	ENSP00000368801:p.Glu299Gly		B7Z4M2|Q32P29	Missense_Mutation	SNP	pfam_WW_dom,pfam_Znf_U1-C,superfamily_WW_dom,smart_Znf_U1,smart_WW_dom,pfscan_WW_dom,pfscan_Znf_C2H2_matrin	p.E299G	ENST00000379487.3	37	c.896	CCDS9375.1	13	.	.	.	.	.	.	.	.	.	.	A	14.17	2.455210	0.43634	.	.	ENSG00000120688	ENST00000379487;ENST00000542082	.	.	.	5.64	3.22	0.36961	.	0.618297	0.17332	N	0.178083	T	0.38957	0.1060	L	0.60455	1.87	0.33090	D	0.537783	P;P	0.48764	0.58;0.915	B;B	0.39904	0.254;0.313	T	0.52563	-0.8559	9	0.37606	T	0.19	-10.4901	6.7648	0.23560	0.7682:0.154:0.0779:0.0	.	278;299	B7Z4M2;O75554	.;WBP4_HUMAN	G	299;278	.	ENSP00000368801:E299G	E	+	2	0	WBP4	40552921	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.957000	0.29215	0.948000	0.37687	-0.466000	0.05196	GAA	WBP4	-	NULL	ENSG00000120688		0.338	WBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP4	HGNC	protein_coding	OTTHUMT00000044655.2	-	0.00	56	0	A	NM_007187		41654921	+1	tier1	-	no_errors	ENST00000379487	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	G
WDR37	22884	genome.wustl.edu	37	10	1170271	1170271	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr10:1170271G>T	ENST00000358220.1	+	12	1361	c.1217G>T	c.(1216-1218)cGc>cTc	p.R406L	WDR37_ENST00000482165.1_3'UTR|WDR37_ENST00000263150.4_Missense_Mutation_p.R406L			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37	406										breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		GCAACTATTCGCACGGACTCT	0.448																																																	0													126.0	113.0	117.0					10																	1170271		2203	4300	6503	SO:0001583	missense	0			AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540	ENST00000358220.1:c.1217G>T	10.37:g.1170271G>T	ENSP00000350954:p.Arg406Leu		A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R406L	ENST00000358220.1	37	c.1217	CCDS7057.1	10	.	.	.	.	.	.	.	.	.	.	G	33	5.285058	0.95517	.	.	ENSG00000047056	ENST00000358220;ENST00000263150	T;T	0.01359	4.98;4.98	5.64	5.64	0.86602	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.11281	0.0275	M	0.86343	2.81	0.80722	D	1	D;D	0.89917	0.979;1.0	P;D	0.68192	0.748;0.956	T	0.00193	-1.1934	10	0.72032	D	0.01	.	19.6953	0.96022	0.0:0.0:1.0:0.0	.	407;406	A8K976;Q9Y2I8	.;WDR37_HUMAN	L	406	ENSP00000350954:R406L;ENSP00000263150:R406L	ENSP00000263150:R406L	R	+	2	0	WDR37	1160271	1.000000	0.71417	0.844000	0.33320	0.869000	0.49853	9.671000	0.98627	2.665000	0.90641	0.591000	0.81541	CGC	WDR37	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom	ENSG00000047056		0.448	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR37	HGNC	protein_coding	OTTHUMT00000046418.1		0.00	83	0	G	NM_014023		1170271	+1			no_errors	ENST00000263150	ensembl	human	known	74_37	missense	6.00	46	3	SNP	1.000	T
WDR45B	56270	genome.wustl.edu	37	17	80606364	80606365	+	5'UTR	INS	-	-	CGTG	rs368655024|rs150551798	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:80606364_80606365insCGTG	ENST00000392325.4	-	0	46_47					NM_019613.3	NP_062559.2	Q5MNZ6	WIPI3_HUMAN	WD repeat domain 45B																		tgtgtgctggacgtgcgtgcgt	0.738																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AF091083	CCDS11815.2	17q25.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000141580	ENSG00000141580		"""WD repeat domain containing"""	25072	protein-coding gene	gene with protein product		609226	"""WDR45-like"""	WDR45L		12477932	Standard	NM_019613		Approved	WIPI3	uc002kfq.3	Q5MNZ6	OTTHUMG00000150146	ENST00000392325.4:c.-149->CACG	17.37:g.80606369_80606372dupCGTG			O95328|Q2MCP6|Q6IBN2	RNA	INS	-	NULL	ENST00000392325.4	37	NULL	CCDS11815.2	17																																																																																			WDR45B	-	-	ENSG00000141580		0.738	WDR45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR45B	HGNC	protein_coding	OTTHUMT00000316536.1		0.00	8	0	-	NM_019613		80606365	-1	tier1		no_errors	ENST00000574828	ensembl	human	known	74_37	rna	62.50	3	5	INS	0.042:0.012	CGTG
WDR54	84058	genome.wustl.edu	37	2	74649471	74649471	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr2:74649471G>T	ENST00000348227.4	+	2	279	c.191G>T	c.(190-192)gGt>gTt	p.G64V	WDR54_ENST00000409791.1_Intron|WDR54_ENST00000461531.1_Intron	NM_032118.2	NP_115494.1	Q9H977	WDR54_HUMAN	WD repeat domain 54	64										breast(1)|large_intestine(1)|lung(6)|upper_aerodigestive_tract(1)	9						GCTAAGGAGGGTGCTGGAGTG	0.592																																																	0													41.0	35.0	37.0					2																	74649471		2203	4300	6503	SO:0001583	missense	0			AK023015	CCDS1940.1	2p13.1	2013-01-09			ENSG00000005448	ENSG00000005448		"""WD repeat domain containing"""	25770	protein-coding gene	gene with protein product						12477932	Standard	NM_032118		Approved	FLJ12953	uc002slb.3	Q9H977	OTTHUMG00000129951	ENST00000348227.4:c.191G>T	2.37:g.74649471G>T	ENSP00000006526:p.Gly64Val		D6W5I3|Q53H85|Q86V45	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G64V	ENST00000348227.4	37	c.191	CCDS1940.1	2	.	.	.	.	.	.	.	.	.	.	G	12.70	2.015801	0.35606	.	.	ENSG00000005448	ENST00000426787;ENST00000348227	.	.	.	5.47	4.59	0.56863	.	0.259259	0.38381	N	0.001714	T	0.52805	0.1757	L	0.44542	1.39	0.58432	D	0.999995	B	0.17465	0.022	B	0.09377	0.004	T	0.46911	-0.9157	9	0.27082	T	0.32	-6.5572	13.3019	0.60330	0.0:0.1704:0.8296:0.0	.	64	Q9H977	WDR54_HUMAN	V	64	.	ENSP00000006526:G64V	G	+	2	0	WDR54	74502979	1.000000	0.71417	0.821000	0.32701	0.709000	0.40893	4.437000	0.59955	1.296000	0.44742	0.511000	0.50034	GGT	WDR54	-	NULL	ENSG00000005448		0.592	WDR54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR54	HGNC	protein_coding	OTTHUMT00000252213.1	-	0.00	40	0	G	NM_032118		74649471	+1	tier1	-	no_errors	ENST00000348227	ensembl	human	known	74_37	missense	39.29	17	11	SNP	0.995	T
WISP1	8840	genome.wustl.edu	37	8	134233036	134233036	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr8:134233036G>A	ENST00000250160.6	+	3	668	c.562G>A	c.(562-564)Gac>Aac	p.D188N	WISP1_ENST00000377863.2_Intron|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000220856.6_Intron|WISP1_ENST00000517423.1_Intron	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	188					cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			ATGTGAGGACGACGCCAAGAG	0.682																																																	0													36.0	34.0	35.0					8																	134233036		2203	4300	6503	SO:0001583	missense	0			AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.562G>A	8.37:g.134233036G>A	ENSP00000250160:p.Asp188Asn		A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Missense_Mutation	SNP	pfam_IGFBP-like,pfam_VWF_C,pfam_Cys_knot,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.D188N	ENST00000250160.6	37	c.562	CCDS6371.1	8	.	.	.	.	.	.	.	.	.	.	G	12.03	1.816913	0.32145	.	.	ENSG00000104415	ENST00000250160	T	0.78481	-1.18	4.46	3.57	0.40892	.	0.803616	0.11878	N	0.520742	T	0.62974	0.2472	N	0.08118	0	0.80722	D	1	D	0.54397	0.966	P	0.44696	0.458	T	0.56980	-0.7889	10	0.24483	T	0.36	-23.6415	13.7492	0.62897	0.0:0.1555:0.8445:0.0	.	188	O95388	WISP1_HUMAN	N	188	ENSP00000250160:D188N	ENSP00000250160:D188N	D	+	1	0	WISP1	134302218	1.000000	0.71417	0.003000	0.11579	0.403000	0.30841	2.483000	0.45233	0.972000	0.38314	0.557000	0.71058	GAC	WISP1	-	pirsf_IGFBP_CNN	ENSG00000104415		0.682	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WISP1	HGNC	protein_coding	OTTHUMT00000378794.2	-	0.00	43	0	G	NM_003882		134233036	+1	tier1	-	no_errors	ENST00000250160	ensembl	human	known	74_37	missense	75.00	24	72	SNP	0.776	A
WNT2B	7482	genome.wustl.edu	37	1	113057570	113057570	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:113057570G>T	ENST00000369684.4	+	2	742	c.257G>T	c.(256-258)tGc>tTc	p.C86F	WNT2B_ENST00000256640.5_5'UTR|RP4-671G15.2_ENST00000608357.1_RNA|WNT2B_ENST00000369686.5_Missense_Mutation_p.C67F|WNT2B_ENST00000478360.1_3'UTR	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	86					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CGGCAGCTGTGCCAGCGTTAC	0.602																																																	0													92.0	83.0	86.0					1																	113057570		2203	4300	6503	SO:0001583	missense	0			AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.257G>T	1.37:g.113057570G>T	ENSP00000358698:p.Cys86Phe		O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt2	p.C86F	ENST00000369684.4	37	c.257	CCDS847.1	1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.870506	0.91587	.	.	ENSG00000134245	ENST00000369686;ENST00000369684	T;T	0.79141	-1.24;-1.24	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	D	0.92685	0.7675	H	0.98295	4.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95400	0.8489	10	0.87932	D	0	.	18.5545	0.91079	0.0:0.0:1.0:0.0	.	86;67	Q93097;Q93097-2	WNT2B_HUMAN;.	F	67;86	ENSP00000358700:C67F;ENSP00000358698:C86F	ENSP00000358698:C86F	C	+	2	0	WNT2B	112859093	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.474000	0.83562	0.561000	0.74099	TGC	WNT2B	-	pfam_Wnt,smart_Wnt	ENSG00000134245		0.602	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT2B	HGNC	protein_coding	OTTHUMT00000030692.1	-	0.00	67	0	G	NM_004185		113057570	+1	tier1	-	no_errors	ENST00000369684	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
WSCD2	9671	genome.wustl.edu	37	12	108589643	108589643	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr12:108589643T>G	ENST00000332082.4	+	3	852	c.34T>G	c.(34-36)Ttc>Gtc	p.F12V	WSCD2_ENST00000549903.1_Missense_Mutation_p.F12V|WSCD2_ENST00000547525.1_Missense_Mutation_p.F12V|WSCD2_ENST00000261400.3_Missense_Mutation_p.F12V			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	12						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						CCAGCGGTACTTCCGCCGGAA	0.587																																																	0													62.0	66.0	65.0					12																	108589643		1980	4160	6140	SO:0001583	missense	0				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.34T>G	12.37:g.108589643T>G	ENSP00000331933:p.Phe12Val		B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	pfam_WSC_carb-bd,superfamily_P-loop_NTPase,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.F12V	ENST00000332082.4	37	c.34	CCDS41828.1	12	.	.	.	.	.	.	.	.	.	.	T	25.1	4.603849	0.87157	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.32988	1.45;1.43;1.45;1.43	5.74	5.74	0.90152	.	0.047717	0.85682	D	0.000000	T	0.31482	0.0798	M	0.66939	2.045	0.80722	D	1	P	0.39809	0.689	B	0.31442	0.13	T	0.18524	-1.0334	10	0.52906	T	0.07	-29.8352	15.1986	0.73116	0.0:0.0:0.0:1.0	.	12	Q2TBF2	WSCD2_HUMAN	V	12	ENSP00000448047:F12V;ENSP00000261400:F12V;ENSP00000331933:F12V;ENSP00000447272:F12V	ENSP00000261400:F12V	F	+	1	0	WSCD2	107113773	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.863000	0.69568	2.183000	0.69458	0.533000	0.62120	TTC	WSCD2	-	NULL	ENSG00000075035		0.587	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	HGNC	protein_coding	OTTHUMT00000405554.1	-	0.00	47	0	T	NM_014653		108589643	+1	tier1	-	no_errors	ENST00000261400	ensembl	human	known	74_37	missense	30.00	14	6	SNP	1.000	G
WT1	7490	genome.wustl.edu	37	11	32421555	32421555	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr11:32421555G>A	ENST00000379079.2	-	6	674	c.401C>T	c.(400-402)aCg>aTg	p.T134M	WT1_ENST00000332351.3_Missense_Mutation_p.T346M|WT1_ENST00000448076.3_Missense_Mutation_p.T346M|WT1_ENST00000530998.1_Missense_Mutation_p.T117M	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	278					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			GAGGATGGGCGTTGTGTGGTT	0.557			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																														yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	0													303.0	252.0	270.0					11																	32421555		2202	4299	6501	SO:0001583	missense	0	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.401C>T	11.37:g.32421555G>A	ENSP00000368370:p.Thr134Met		A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	pfam_Wilms_tumour_N,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2,prints_Wilms_tumour	p.T346M	ENST00000379079.2	37	c.1037	CCDS55751.1	11	.	.	.	.	.	.	.	.	.	.	G	14.05	2.418840	0.42918	.	.	ENSG00000184937	ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076;ENST00000527775	D;D;D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89;-1.89;-1.89	5.98	5.98	0.97165	Wilm&apos (1);s tumour protein, N-terminal (1);	0.255135	0.30593	U	0.009287	D	0.86908	0.6046	L	0.46157	1.445	0.09310	N	1	P;P;P;P;P	0.48694	0.914;0.668;0.616;0.786;0.616	P;P;P;P;P	0.52109	0.493;0.69;0.562;0.627;0.562	T	0.81116	-0.1079	10	0.48119	T	0.1	.	16.6753	0.85277	0.0:0.1293:0.8707:0.0	.	334;278;351;117;134	P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.;WT1_HUMAN;.;.;.	M	134;346;117;329;346;97	ENSP00000368370:T134M;ENSP00000331327:T346M;ENSP00000435307:T117M;ENSP00000415516:T329M;ENSP00000413452:T346M;ENSP00000435351:T97M	ENSP00000331327:T346M	T	-	2	0	WT1	32378131	0.946000	0.32159	0.011000	0.14972	0.059000	0.15707	4.759000	0.62227	2.835000	0.97688	0.650000	0.86243	ACG	WT1	-	pfam_Wilms_tumour_N	ENSG00000184937		0.557	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WT1	HGNC	protein_coding	OTTHUMT00000095434.1	-	0.00	73	0	G	NM_000378		32421555	-1	tier1	-	no_errors	ENST00000332351	ensembl	human	known	74_37	missense	23.53	39	12	SNP	0.151	A
WWC1	23286	genome.wustl.edu	37	5	167881030	167881032	+	In_Frame_Del	DEL	GGA	GGA	-	rs111457550|rs28429769|rs28421695|rs376909223	byFrequency	TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	GGA	GGA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr5:167881030_167881032delGGA	ENST00000265293.4	+	18	3085_3087	c.2583_2585delGGA	c.(2581-2586)gtggag>gtg	p.E865del	WWC1_ENST00000521089.1_In_Frame_Del_p.E865del|WWC1_ENST00000522140.1_3'UTR	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	865	Glu-rich.|Interaction with histone H3.			Missing (in Ref. 6; AAO73817). {ECO:0000305}.	cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		aggaggaggtggaggaggaggag	0.547																																																	0									,,	2323,1941		637,1049,446					,,	-0.6	0.1		dbSNP_132	92	1828,6426		217,1394,2516	no	coding,coding,coding	WWC1	NM_015238.2,NM_001161662.1,NM_001161661.1	,,	854,2443,2962	A1A1,A1R,RR		22.1468,45.5206,33.1602	,,	,,		4151,8367				SO:0001651	inframe_deletion	0			AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.2583_2585delGGA	5.37:g.167881039_167881041delGGA	ENSP00000265293:p.Glu865del		B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	In_Frame_Del	DEL	pfam_WW_dom,superfamily_C2_dom,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom	p.E865in_frame_del	ENST00000265293.4	37	c.2583_2585	CCDS4366.1	5																																																																																			WWC1	-	NULL	ENSG00000113645		0.547	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	HGNC	protein_coding	OTTHUMT00000252791.2		0.00	39	0	GGA	NM_015238		167881032	+1	tier1		no_errors	ENST00000265293	ensembl	human	known	74_37	in_frame_del	10.81	33	4	DEL	0.823:0.847:0.815	-
XAF1	54739	genome.wustl.edu	37	17	6674047	6674047	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr17:6674047C>T	ENST00000361842.3	+	6	832	c.593C>T	c.(592-594)gCt>gTt	p.A198V	XAF1_ENST00000346752.4_Missense_Mutation_p.A179V|XAF1_ENST00000441631.1_Missense_Mutation_p.A198V	NM_017523.3	NP_059993.2	Q6GPH4	XAF1_HUMAN	XIAP associated factor 1	198					apoptotic process (GO:0006915)|cytokine-mediated signaling pathway (GO:0019221)|negative regulation of protein complex assembly (GO:0031333)|response to interferon-beta (GO:0035456)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	6						CCAAGTCAAGCTGCTGAAAAT	0.373																																																	0													85.0	88.0	87.0					17																	6674047		2203	4300	6503	SO:0001583	missense	0			X99699	CCDS11080.1, CCDS11081.1	17p13.2	2010-03-19			ENSG00000132530	ENSG00000132530			30932	protein-coding gene	gene with protein product		606717				12029096, 11175744	Standard	NM_199139		Approved	BIRC4BP, XIAPAF1, HSXIAPAF1	uc002gdn.3	Q6GPH4		ENST00000361842.3:c.593C>T	17.37:g.6674047C>T	ENSP00000354822:p.Ala198Val		A2T931|A2T932|A8K2L1|A8K9Y3|D3DTM6|Q6MZE8|Q8N557|Q99982	Missense_Mutation	SNP	superfamily_TRAF-like,pfscan_Znf_TRAF	p.A198V	ENST00000361842.3	37	c.593	CCDS11080.1	17	.	.	.	.	.	.	.	.	.	.	c	12.76	2.035873	0.35893	.	.	ENSG00000132530	ENST00000361842;ENST00000441631;ENST00000346752;ENST00000431790	T;T;T	0.21031	4.04;2.04;2.03	5.13	0.729	0.18266	.	1.428890	0.04572	N	0.393512	T	0.13884	0.0336	N	0.24115	0.695	0.09310	N	1	B;B;B;B;P	0.35077	0.386;0.386;0.386;0.267;0.483	B;B;B;B;B	0.36766	0.232;0.232;0.124;0.058;0.163	T	0.21965	-1.0230	10	0.30078	T	0.28	-27.735	2.4095	0.04420	0.1581:0.5277:0.1435:0.1707	.	198;96;179;198;138	C9K044;Q6GPH4-6;Q6GPH4-2;Q6GPH4;B3KPW1	.;.;.;XAF1_HUMAN;.	V	198;198;179;96	ENSP00000354822:A198V;ENSP00000413199:A198V;ENSP00000341029:A179V	ENSP00000341029:A179V	A	+	2	0	XAF1	6614771	0.000000	0.05858	0.000000	0.03702	0.098000	0.18820	-0.012000	0.12699	0.087000	0.17167	-0.119000	0.15052	GCT	XAF1	-	NULL	ENSG00000132530		0.373	XAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XAF1	HGNC	protein_coding	OTTHUMT00000439643.5	-	0.00	53	0	C	NM_017523		6674047	+1	tier1	-	no_errors	ENST00000361842	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.000	T
ZAN	7455	genome.wustl.edu	37	7	100377345	100377345	+	RNA	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:100377345C>T	ENST00000348028.3	+	0	6759				ZAN_ENST00000443370.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000538115.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCTCAAGCCCCCACTCTGGAG	0.627																																																	0													11.0	13.0	12.0					7																	100377345		1893	4078	5971			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100377345C>T			A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.P2198S	ENST00000348028.3	37	c.6592		7	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244336	0.79912	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585	T;T;T	0.75589	-0.95;-0.95;-0.95	4.08	3.2	0.36748	Uncharacterised domain, cysteine-rich (2);	0.221864	0.23454	N	0.048005	T	0.64843	0.2635	.	.	.	0.35981	D	0.836044	P;P	0.36330	0.492;0.548	B;B	0.42771	0.276;0.397	T	0.63761	-0.6564	9	0.18710	T	0.47	.	8.0311	0.30465	0.0:0.8894:0.0:0.1106	.	2198;2199	F5H0T8;Q9Y493	.;ZAN_HUMAN	S	2198	ENSP00000445943:P2198S;ENSP00000445091:P2198S;ENSP00000444427:P2198S	ENSP00000445091:P2198S	P	+	1	0	ZAN	100215281	0.000000	0.05858	0.011000	0.14972	0.980000	0.70556	0.448000	0.21726	1.321000	0.45227	0.558000	0.71614	CCA	ZAN	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000146839		0.627	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	-	0.00	75	0	C	NM_003386		100377345	+1	tier1	-	no_errors	ENST00000546292	ensembl	human	known	74_37	missense	17.91	55	12	SNP	0.034	T
ZC3H4	23211	genome.wustl.edu	37	19	47569839	47569839	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:47569839G>A	ENST00000253048.5	-	15	3723	c.3686C>T	c.(3685-3687)cCc>cTc	p.P1229L	ZC3H4_ENST00000594019.1_5'UTR	NM_015168.1	NP_055983.1	Q9UPT8	ZC3H4_HUMAN	zinc finger CCCH-type containing 4	1229							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(13)|ovary(4)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	41		all_cancers(25;3.3e-08)|all_epithelial(76;2.28e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.0889)		OV - Ovarian serous cystadenocarcinoma(262;5.76e-05)|all cancers(93;7.69e-05)|Epithelial(262;0.00354)|GBM - Glioblastoma multiforme(486;0.0372)		GGTGGCAGCGGGGGCTGCAGC	0.706																																																	0													9.0	12.0	11.0					19																	47569839		1568	3381	4949	SO:0001583	missense	0			AB028987	CCDS42582.1	19q13.33	2012-07-05	2007-10-18	2007-10-18		ENSG00000130749		"""Zinc fingers, CCCH-type domain containing"""	17808	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 7"""	C19orf7			Standard	NM_015168		Approved	KIAA1064	uc002pga.4	Q9UPT8		ENST00000253048.5:c.3686C>T	19.37:g.47569839G>A	ENSP00000253048:p.Pro1229Leu		Q9Y420	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.P1229L	ENST00000253048.5	37	c.3686	CCDS42582.1	19	.	.	.	.	.	.	.	.	.	.	G	9.362	1.068331	0.20067	.	.	ENSG00000130749	ENST00000253048	T	0.20069	2.1	5.74	3.57	0.40892	.	1.947900	0.02898	N	0.135036	T	0.42607	0.1210	L	0.50333	1.59	0.20403	N	0.999905	D	0.76494	0.999	D	0.64144	0.922	T	0.16808	-1.0390	10	0.87932	D	0	.	10.5226	0.44929	0.0735:0.1341:0.7924:0.0	.	1229	Q9UPT8	ZC3H4_HUMAN	L	1229	ENSP00000253048:P1229L	ENSP00000253048:P1229L	P	-	2	0	ZC3H4	52261679	0.426000	0.25506	0.002000	0.10522	0.004000	0.04260	1.517000	0.35867	0.742000	0.32697	0.563000	0.77884	CCC	ZC3H4	-	NULL	ENSG00000130749		0.706	ZC3H4-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	ZC3H4	HGNC	protein_coding	OTTHUMT00000466667.1	-	0.00	100	0	G			47569839	-1	tier1	-	no_errors	ENST00000253048	ensembl	human	known	74_37	missense	70.00	18	42	SNP	0.079	A
ZCCHC5	203430	genome.wustl.edu	37	X	77913195	77913195	+	Silent	SNP	A	A	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chrX:77913195A>C	ENST00000321110.1	-	2	1018	c.723T>G	c.(721-723)acT>acG	p.T241T		NM_152694.2	NP_689907.1	Q8N8U3	ZCHC5_HUMAN	zinc finger, CCHC domain containing 5	241							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)|prostate(1)|skin(1)	37						TGAAGGTTAAAGTGTATTGCA	0.502																																																	0													26.0	25.0	25.0					X																	77913195		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096184	CCDS14440.1	Xq13.3	2008-02-05			ENSG00000179300	ENSG00000179300		"""Zinc fingers, CCHC domain containing"""	22997	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_152694		Approved	FLJ38865, Mar3, Mart3, ZHC5	uc004edc.1	Q8N8U3	OTTHUMG00000021892	ENST00000321110.1:c.723T>G	X.37:g.77913195A>C			B2RMZ0|Q5JQE9	Silent	SNP	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.T241	ENST00000321110.1	37	c.723	CCDS14440.1	X																																																																																			ZCCHC5	-	NULL	ENSG00000179300		0.502	ZCCHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC5	HGNC	protein_coding	OTTHUMT00000057319.1	-	0.00	51	0	A	NM_152694		77913195	-1	tier1	-	no_errors	ENST00000321110	ensembl	human	known	74_37	silent	81.63	9	40	SNP	0.001	C
ZCCHC6	79670	genome.wustl.edu	37	9	88959945	88959945	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr9:88959945T>A	ENST00000375963.3	-	5	1116	c.944A>T	c.(943-945)cAg>cTg	p.Q315L	ZCCHC6_ENST00000375948.1_5'Flank|ZCCHC6_ENST00000277141.6_5'UTR|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.Q315L|ZCCHC6_ENST00000375947.1_Missense_Mutation_p.Q148L|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.Q315L	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	315					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						TTCCAGCCTCTGTTCCAAGTT	0.393																																																	0													148.0	133.0	138.0					9																	88959945		2203	4300	6503	SO:0001583	missense	0			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.944A>T	9.37:g.88959945T>A	ENSP00000365130:p.Gln315Leu		Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_U1,smart_Znf_CCHC,pfscan_Znf_CCHC	p.Q315L	ENST00000375963.3	37	c.944	CCDS35057.1	9	.	.	.	.	.	.	.	.	.	.	T	15.66	2.900049	0.52227	.	.	ENSG00000083223	ENST00000375960;ENST00000375961;ENST00000375963;ENST00000427388;ENST00000375947	T;T;T;T	0.36520	1.25;1.25;1.25;1.25	5.12	5.12	0.69794	.	0.380198	0.29273	N	0.012635	T	0.18130	0.0435	N	0.19112	0.55	0.32505	N	0.538271	P;P;P;B	0.43938	0.519;0.708;0.822;0.329	B;B;B;B	0.38264	0.269;0.269;0.194;0.095	T	0.13656	-1.0501	10	0.02654	T	1	0.1783	9.5705	0.39425	0.0:0.0781:0.0:0.9219	.	315;315;315;315	Q5VYS8-5;Q5VYS8-2;Q5VYS8-4;Q5VYS8	.;.;.;TUT7_HUMAN	L	315;315;315;148;148	ENSP00000365127:Q315L;ENSP00000365128:Q315L;ENSP00000365130:Q315L;ENSP00000365114:Q148L	ENSP00000365114:Q148L	Q	-	2	0	ZCCHC6	88149765	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.084000	0.41625	2.150000	0.67090	0.482000	0.46254	CAG	ZCCHC6	-	NULL	ENSG00000083223		0.393	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC6	HGNC	protein_coding	OTTHUMT00000052918.1	-	0.00	92	0	T	NM_024617		88959945	-1	tier1	-	no_errors	ENST00000375963	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	A
ZFP42	132625	genome.wustl.edu	37	4	188924482	188924482	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr4:188924482A>T	ENST00000326866.4	+	4	929	c.521A>T	c.(520-522)aAg>aTg	p.K174M	ZFP42_ENST00000509524.1_Missense_Mutation_p.K174M	NM_174900.3	NP_777560.2	Q96MM3	ZFP42_HUMAN	ZFP42 zinc finger protein	174					female gonad development (GO:0008585)|in utero embryonic development (GO:0001701)|male gonad development (GO:0008584)|meiotic nuclear division (GO:0007126)|regulation of genetic imprinting (GO:2000653)|spermatid development (GO:0007286)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(14;6.2e-52)|all_epithelial(14;7.36e-37)|all_lung(41;2.29e-15)|Lung NSC(41;6.7e-15)|Breast(6;1.53e-05)|Melanoma(20;3.01e-05)|Hepatocellular(41;0.00335)|all_hematologic(60;0.014)|Renal(120;0.0183)|Prostate(90;0.0421)|Colorectal(36;0.227)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;4.21e-06)|GBM - Glioblastoma multiforme(59;8.93e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.157)		TTTGCTAGAAAGAAGCCCCCC	0.468																																																	0													97.0	110.0	106.0					4																	188924482		2203	4300	6503	SO:0001583	missense	0			AK056719	CCDS3849.1	4q35.2	2014-09-04	2012-11-27		ENSG00000179059	ENSG00000179059		"""Zinc fingers, C2H2-type"""	30949	protein-coding gene	gene with protein product		614572	"""zinc finger protein 42 homolog (mouse)"", ""zinc finger protein 42"""			12110702	Standard	NM_174900		Approved	REX1, ZNF754	uc003izh.1	Q96MM3	OTTHUMG00000160235	ENST00000326866.4:c.521A>T	4.37:g.188924482A>T	ENSP00000317686:p.Lys174Met		D3DP65|Q8WXE2	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K174M	ENST00000326866.4	37	c.521	CCDS3849.1	4	.	.	.	.	.	.	.	.	.	.	A	7.168	0.587067	0.13812	.	.	ENSG00000179059	ENST00000326866;ENST00000509524	T;T	0.63744	-0.06;-0.06	4.27	0.326	0.15908	.	0.051145	0.85682	U	0.000000	T	0.36276	0.0961	N	0.21194	0.64	0.20196	N	0.999921	B	0.34103	0.437	B	0.23716	0.048	T	0.14282	-1.0478	10	0.36615	T	0.2	.	5.3096	0.15823	0.4679:0.3591:0.0:0.173	.	174	Q96MM3	ZFP42_HUMAN	M	174	ENSP00000317686:K174M;ENSP00000424662:K174M	ENSP00000317686:K174M	K	+	2	0	ZFP42	189161476	0.000000	0.05858	0.124000	0.21820	0.126000	0.20510	-0.423000	0.07034	0.070000	0.16634	0.533000	0.62120	AAG	ZFP42	-	NULL	ENSG00000179059		0.468	ZFP42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP42	HGNC	protein_coding	OTTHUMT00000359794.1	-	0.00	27	0	A	NM_174900		188924482	+1	tier1	-	no_errors	ENST00000326866	ensembl	human	known	74_37	missense	71.43	6	15	SNP	0.599	T
ZKSCAN1	7586	genome.wustl.edu	37	7	99630966	99630966	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:99630966A>G	ENST00000324306.6	+	6	1072	c.838A>G	c.(838-840)Aag>Gag	p.K280E	ZKSCAN1_ENST00000535170.1_Missense_Mutation_p.K67E|ZKSCAN1_ENST00000426572.1_Missense_Mutation_p.K244E	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	280	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			GTCAACCTCAAAGGCTGAAAC	0.443																																																	0													53.0	55.0	54.0					7																	99630966		2203	4300	6503	SO:0001583	missense	0			X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.838A>G	7.37:g.99630966A>G	ENSP00000323148:p.Lys280Glu		A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.K280E	ENST00000324306.6	37	c.838	CCDS34698.1	7	.	.	.	.	.	.	.	.	.	.	A	13.66	2.304289	0.40795	.	.	ENSG00000106261	ENST00000324306;ENST00000426572;ENST00000535170	T;T;T	0.07327	3.28;3.24;3.2	5.64	5.64	0.86602	Krueppel-associated box (3);	0.000000	0.56097	D	0.000030	T	0.08891	0.0220	L	0.33624	1.015	0.27756	N	0.943982	B	0.26483	0.15	B	0.26094	0.066	T	0.12682	-1.0538	10	0.87932	D	0	.	13.8576	0.63537	1.0:0.0:0.0:0.0	.	280	P17029	ZKSC1_HUMAN	E	280;244;67	ENSP00000323148:K280E;ENSP00000409172:K244E;ENSP00000443508:K67E	ENSP00000323148:K280E	K	+	1	0	ZKSCAN1	99468902	0.001000	0.12720	0.992000	0.48379	0.111000	0.19643	1.325000	0.33724	2.367000	0.80283	0.528000	0.53228	AAG	ZKSCAN1	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000106261		0.443	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN1	HGNC	protein_coding	OTTHUMT00000344550.2	-	0.00	67	0	A	NM_003439		99630966	+1	tier1	-	no_errors	ENST00000324306	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.647	G
ZMYND8	23613	genome.wustl.edu	37	20	45920598	45920598	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr20:45920598T>C	ENST00000311275.7	-	6	795	c.542A>G	c.(541-543)cAg>cGg	p.Q181R	ZMYND8_ENST00000360911.3_Missense_Mutation_p.Q176R|ZMYND8_ENST00000262975.4_Missense_Mutation_p.Q181R|ZMYND8_ENST00000446994.2_Missense_Mutation_p.Q118R|ZMYND8_ENST00000536340.1_Missense_Mutation_p.Q208R|ZMYND8_ENST00000461685.1_Missense_Mutation_p.Q201R|ZMYND8_ENST00000540497.1_Missense_Mutation_p.Q176R|ZMYND8_ENST00000352431.2_Missense_Mutation_p.Q201R|ZMYND8_ENST00000355972.4_Missense_Mutation_p.Q181R|ZMYND8_ENST00000468376.2_5'UTR|ZMYND8_ENST00000396281.4_Missense_Mutation_p.Q181R|ZMYND8_ENST00000372023.3_Missense_Mutation_p.Q176R|ZMYND8_ENST00000471951.2_Missense_Mutation_p.Q201R|ZMYND8_ENST00000458360.2_Missense_Mutation_p.Q176R	NM_001281772.1|NM_001281778.1|NM_001281783.1	NP_001268701.1|NP_001268707.1|NP_001268712.1	Q9ULU4	PKCB1_HUMAN	zinc finger, MYND-type containing 8	181	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	repressing transcription factor binding (GO:0070491)|RNA polymerase II transcription corepressor activity (GO:0001106)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|prostate(3)|skin(2)|urinary_tract(8)	62			Epithelial(1;0.0289)|all cancers(1;0.0962)|OV - Ovarian serous cystadenocarcinoma(1;0.154)			GTCAGGGTGCTGTTCCAATGG	0.443																																																	0													109.0	94.0	99.0					20																	45920598		2203	4300	6503	SO:0001583	missense	0			U48251	CCDS13404.1, CCDS13405.1, CCDS46613.1, CCDS63300.1, CCDS63301.1, CCDS63304.1, CCDS63306.1, CCDS74738.1	20q13.12	2013-01-28	2007-01-29	2007-01-29	ENSG00000101040	ENSG00000101040		"""Zinc fingers, MYND-type"", ""Zinc fingers, PHD-type"""	9397	protein-coding gene	gene with protein product		615713	"""protein kinase C binding protein 1"""	PRKCBP1			Standard	NM_001281769		Approved	RACK7	uc002xtb.1	Q9ULU4	OTTHUMG00000032667	ENST00000311275.7:c.542A>G	20.37:g.45920598T>C	ENSP00000312237:p.Gln181Arg		B3KVL2|B7Z2A8|B7Z3E0|B7Z680|B7ZM62|E1P5U5|F5H0X3|H7C0U2|J3KPU3|Q13517|Q2HXV1|Q2HXV2|Q2HXV3|Q2HXV4|Q2HXV7|Q2HXV8|Q2HXV9|Q2HXW0|Q2HXW1|Q2HXW2|Q4JJ94|Q4JJ95|Q5TH09|Q5TH11|Q6MZM1|Q8WXC5|Q9H1F3|Q9H1F4|Q9H1F5|Q9H1L8|Q9H1L9|Q9H2G5|Q9NYN3|Q9UIX6	Missense_Mutation	SNP	pfam_DUF3544,pfam_Bromodomain,pfam_PWWP_dom,pfam_Znf_PHD-finger,pfam_Znf_MYND,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP_dom,pfscan_PWWP_dom,pfscan_Znf_MYND,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.Q208R	ENST00000311275.7	37	c.623		20	.	.	.	.	.	.	.	.	.	.	T	32	5.180891	0.94846	.	.	ENSG00000101040	ENST00000360911;ENST00000311275;ENST00000458360;ENST00000262975;ENST00000471951;ENST00000352431;ENST00000396281;ENST00000536340;ENST00000355972;ENST00000446994;ENST00000461685;ENST00000372023;ENST00000540497;ENST00000435836	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	5.84	5.84	0.93424	Bromodomain (5);	0.000000	0.85682	D	0.000000	T	0.47432	0.1445	L	0.37800	1.135	0.48087	D	0.999586	P;D;D;D;D;B;D;P;B;D;D;D;D;D;D;D;D	0.69078	0.947;0.964;0.996;0.994;0.997;0.369;0.992;0.935;0.369;0.992;0.994;0.994;0.994;0.982;0.992;0.971;0.971	D;D;D;D;D;B;D;P;B;D;D;D;D;D;D;P;P	0.85130	0.93;0.911;0.997;0.987;0.987;0.421;0.953;0.885;0.268;0.953;0.972;0.993;0.987;0.989;0.979;0.898;0.898	T	0.45440	-0.9261	10	0.66056	D	0.02	-15.3747	16.2169	0.82237	0.0:0.0:0.0:1.0	.	176;208;176;176;175;201;181;176;201;201;181;118;176;176;201;176;181	B7ZM62;F5H0X3;Q2HXV7;Q2HXV3;Q5JV90;Q9ULU4-7;Q9ULU4-9;Q9ULU4-14;Q9ULU4-12;Q9ULU4-13;Q9ULU4;B3KVL2;Q2HXV9;Q2HXV1;Q9ULU4-8;Q2HXV4;B7Z2A8	.;.;.;.;.;.;.;.;.;.;PKCB1_HUMAN;.;.;.;.;.;.	R	176;181;176;181;201;201;181;208;181;118;201;176;176;156	ENSP00000354166:Q176R;ENSP00000312237:Q181R;ENSP00000392964:Q176R;ENSP00000262975:Q181R;ENSP00000420095:Q201R;ENSP00000335537:Q201R;ENSP00000379577:Q181R;ENSP00000439800:Q208R;ENSP00000348246:Q181R;ENSP00000396725:Q118R;ENSP00000418210:Q201R;ENSP00000361093:Q176R;ENSP00000443086:Q176R;ENSP00000413727:Q156R	ENSP00000262975:Q181R	Q	-	2	0	ZMYND8	45354005	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.036000	0.88901	2.223000	0.72356	0.533000	0.62120	CAG	ZMYND8	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain	ENSG00000101040		0.443	ZMYND8-007	KNOWN	basic	protein_coding	ZMYND8	HGNC	protein_coding	OTTHUMT00000079596.2	-	0.00	34	0	T	NM_183047		45920598	-1	tier1	-	no_errors	ENST00000536340	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	C
ZNF177	7730	genome.wustl.edu	37	19	9491694	9491694	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:9491694G>T	ENST00000589262.1	+	6	753	c.687G>T	c.(685-687)gaG>gaT	p.E229D	ZNF177_ENST00000590616.1_Intron|ZNF177_ENST00000541595.2_Intron|ZNF177_ENST00000602738.1_Intron|ZNF177_ENST00000446085.4_3'UTR|ZNF177_ENST00000602856.1_3'UTR|ZNF177_ENST00000434737.2_Missense_Mutation_p.E229D|ZNF177_ENST00000343499.4_Intron	NM_001172651.1	NP_001166122.1	Q13360	ZN177_HUMAN	zinc finger protein 177	229					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(2)|stomach(2)	13						CTACTGGAGAGAAAGGTGATG	0.448																																																	0																																										SO:0001583	missense	0			U37263, BC012012	CCDS12212.1, CCDS54214.1	19p13.2	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	12966	protein-coding gene	gene with protein product		601276					Standard	NM_003451		Approved		uc021uon.1	Q13360		ENST00000589262.1:c.687G>T	19.37:g.9491694G>T	ENSP00000468531:p.Glu229Asp		B4DY57|E9PDG0|I3L0I4|Q96ER2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E229D	ENST00000589262.1	37	c.687	CCDS54214.1	19	.	.	.	.	.	.	.	.	.	.	G	13.97	2.394844	0.42512	.	.	ENSG00000188629	ENST00000434737	T	0.19806	2.12	2.64	1.56	0.23342	.	.	.	.	.	T	0.18383	0.0441	L	0.58354	1.805	.	.	.	P	0.37997	0.614	B	0.31390	0.129	T	0.21930	-1.0231	8	0.66056	D	0.02	.	8.741	0.34558	0.0:0.0:0.7724:0.2276	.	229	B4DY57	.	D	229	ENSP00000415070:E229D	ENSP00000415070:E229D	E	+	3	2	ZNF177	9352694	1.000000	0.71417	0.157000	0.22605	0.036000	0.12997	2.585000	0.46111	0.660000	0.30964	0.563000	0.77884	GAG	ZNF177	-	NULL	ENSG00000188629		0.448	ZNF177-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF177	HGNC	protein_coding	OTTHUMT00000449028.1	-	0.00	48	0	G	NM_003451		9491694	+1	tier1	-	no_errors	ENST00000434737	ensembl	human	known	74_37	missense	71.43	9	25	SNP	1.000	T
ZNF208	7757	genome.wustl.edu	37	19	22154945	22154945	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:22154945T>G	ENST00000397126.4	-	4	3039	c.2891A>C	c.(2890-2892)aAg>aCg	p.K964T	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	964					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				ATGAATTTTCTTATGATAACT	0.338																																																	0													33.0	36.0	35.0					19																	22154945		2067	4214	6281	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2891A>C	19.37:g.22154945T>G	ENSP00000380315:p.Lys964Thr			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K964T	ENST00000397126.4	37	c.2891	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	t	8.503	0.864723	0.17250	.	.	ENSG00000160321	ENST00000397126	T	0.17854	2.25	3.07	0.646	0.17789	.	.	.	.	.	T	0.15955	0.0384	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26710	-1.0095	6	0.54805	T	0.06	.	3.966	0.09431	0.1829:0.1141:0.0:0.7029	.	.	.	.	T	964	ENSP00000380315:K964T	ENSP00000380315:K964T	K	-	2	0	ZNF208	21946785	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.123000	0.10611	-0.282000	0.09128	0.234000	0.17832	AAG	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.338	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	-	0.00	71	0	T	NM_007153		22154945	-1	tier1	-	no_errors	ENST00000397126	ensembl	human	novel	74_37	missense	7.55	49	4	SNP	0.006	G
ZNF431	170959	genome.wustl.edu	37	19	21366433	21366433	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:21366433C>A	ENST00000311048.7	+	5	1471	c.1327C>A	c.(1327-1329)Ctt>Att	p.L443I	ZNF431_ENST00000600692.1_3'UTR|ZNF431_ENST00000594425.1_Intron	NM_133473.2	NP_597730.2	Q8TF32	ZN431_HUMAN	zinc finger protein 431	443					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23						GTCCCCACAACTTACTGCACA	0.383																																																	0													42.0	46.0	44.0					19																	21366433		2193	4292	6485	SO:0001583	missense	0			AB075849	CCDS32979.1	19p12	2013-01-08				ENSG00000196705		"""Zinc fingers, C2H2-type"", ""-"""	20809	protein-coding gene	gene with protein product						11853319	Standard	NM_133473		Approved	KIAA1969	uc002npp.2	Q8TF32		ENST00000311048.7:c.1327C>A	19.37:g.21366433C>A	ENSP00000308578:p.Leu443Ile		A8KAK7|Q8IWC4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L443I	ENST00000311048.7	37	c.1327	CCDS32979.1	19	.	.	.	.	.	.	.	.	.	.	.	7.365	0.625558	0.14257	.	.	ENSG00000196705	ENST00000311048	T	0.53857	0.6	1.04	-0.123	0.13527	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.71409	0.3336	M	0.89095	3.005	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.57242	-0.7845	9	0.87932	D	0	.	6.3996	0.21630	0.0:0.7837:0.0:0.2163	.	443	Q8TF32	ZN431_HUMAN	I	443	ENSP00000308578:L443I	ENSP00000308578:L443I	L	+	1	0	ZNF431	21158273	0.056000	0.20664	0.012000	0.15200	0.011000	0.07611	0.560000	0.23500	0.452000	0.26830	0.455000	0.32223	CTT	ZNF431	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196705		0.383	ZNF431-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF431	HGNC	protein_coding	OTTHUMT00000463943.1		0.00	69	0	C	XM_086098		21366433	+1			no_errors	ENST00000311048	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.002	A
ZNF283	284349	genome.wustl.edu	37	19	44352455	44352455	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:44352455G>T	ENST00000324461.7	+	7	1999	c.1702G>T	c.(1702-1704)Gag>Tag	p.E568*	ZNF283_ENST00000588797.1_Nonsense_Mutation_p.E429*	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	568					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				TCATACCGGTGAGAAACCTTT	0.413																																																	0													66.0	73.0	71.0					19																	44352455		2188	4289	6477	SO:0001587	stop_gained	0			AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		ENST00000324461.7:c.1702G>T	19.37:g.44352455G>T	ENSP00000327314:p.Glu568*		B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E568*	ENST00000324461.7	37	c.1702	CCDS46097.1	19	.	.	.	.	.	.	.	.	.	.	G	39	7.352943	0.98231	.	.	ENSG00000167637	ENST00000324461	.	.	.	2.61	2.61	0.31194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	12.3634	0.55215	0.0:0.0:1.0:0.0	.	.	.	.	X	568	.	ENSP00000327314:E568X	E	+	1	0	ZNF283	49044295	1.000000	0.71417	0.985000	0.45067	0.918000	0.54935	5.388000	0.66249	1.440000	0.47531	0.563000	0.77884	GAG	ZNF283	-	pfscan_Znf_C2H2	ENSG00000167637		0.413	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF283	HGNC	protein_coding	OTTHUMT00000459909.1	-	0.00	85	0	G	NM_181845		44352455	+1	tier1	-	no_errors	ENST00000324461	ensembl	human	known	74_37	nonsense	73.26	22	63	SNP	1.000	T
ZNF500	26048	genome.wustl.edu	37	16	4802882	4802882	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:4802882G>T	ENST00000219478.6	-	6	1237	c.938C>A	c.(937-939)cCa>cAa	p.P313Q	ZNF500_ENST00000591026.1_5'UTR|RP11-127I20.7_ENST00000588099.1_RNA|ZNF500_ENST00000545009.1_Missense_Mutation_p.P313Q			O60304	ZN500_HUMAN	zinc finger protein 500	313					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	21						CCGTCTTCCTGGTGGGGGGCC	0.662																																																	0													43.0	45.0	44.0					16																	4802882		2197	4300	6497	SO:0001583	missense	0			AB011129	CCDS32383.1	16p13.3	2013-01-09				ENSG00000103199		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23716	protein-coding gene	gene with protein product						9628581	Standard	XM_005255243		Approved	ZKSCAN18, KIAA0557, ZSCAN50	uc002cxp.1	O60304		ENST00000219478.6:c.938C>A	16.37:g.4802882G>T	ENSP00000219478:p.Pro313Gln		A8K6X7|B4DNN9|Q0VAL2|Q96CQ8|Q9BTG0	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.P313Q	ENST00000219478.6	37	c.938	CCDS32383.1	16	.	.	.	.	.	.	.	.	.	.	G	13.33	2.204958	0.38905	.	.	ENSG00000103199	ENST00000545009;ENST00000219478	T;T	0.08008	3.22;3.14	3.87	-2.42	0.06542	.	.	.	.	.	T	0.03477	0.0100	N	0.14661	0.345	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.06405	0.002;0.002	T	0.46925	-0.9156	9	0.13108	T	0.6	.	3.0992	0.06320	0.3333:0.0:0.3669:0.2998	.	313;313	B4DNN9;O60304	.;ZN500_HUMAN	Q	313	ENSP00000445714:P313Q;ENSP00000219478:P313Q	ENSP00000219478:P313Q	P	-	2	0	ZNF500	4742883	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.466000	0.02355	-0.447000	0.07138	0.655000	0.94253	CCA	ZNF500	-	NULL	ENSG00000103199		0.662	ZNF500-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF500	HGNC	protein_coding	OTTHUMT00000432461.1		0.00	70	0	G	XM_085507		4802882	-1			no_errors	ENST00000219478	ensembl	human	known	74_37	missense	15.38	22	4	SNP	0.000	T
ZNF521	25925	genome.wustl.edu	37	18	22671957	22671957	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr18:22671957G>T	ENST00000361524.3	-	6	3895	c.3747C>A	c.(3745-3747)ttC>ttA	p.F1249L	ZNF521_ENST00000584787.1_Missense_Mutation_p.F1029L|ZNF521_ENST00000538137.2_Missense_Mutation_p.F1249L	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	1249					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CCATCCCTTCGAAGCTGTGCT	0.498			T	PAX5	ALL																																			Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													132.0	111.0	118.0					18																	22671957		2203	4300	6503	SO:0001583	missense	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.3747C>A	18.37:g.22671957G>T	ENSP00000354794:p.Phe1249Leu		A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F1249L	ENST00000361524.3	37	c.3747	CCDS32806.1	18	.	.	.	.	.	.	.	.	.	.	G	13.90	2.374866	0.42105	.	.	ENSG00000198795	ENST00000361524;ENST00000538137;ENST00000399425	T	0.08720	3.06	5.98	-1.45	0.08828	Zinc finger, C2H2 (1);	0.000000	0.85682	D	0.000000	T	0.05318	0.0141	N	0.17379	0.485	0.43408	D	0.995548	B	0.15930	0.015	B	0.21917	0.037	T	0.33471	-0.9867	10	0.49607	T	0.09	-30.2925	11.4528	0.50162	0.787:0.0:0.213:0.0	.	1249	Q96K83	ZN521_HUMAN	L	1249;1283;1249	ENSP00000354794:F1249L	ENSP00000354794:F1249L	F	-	3	2	ZNF521	20925955	0.998000	0.40836	0.994000	0.49952	0.999000	0.98932	0.697000	0.25556	-0.162000	0.10964	0.655000	0.94253	TTC	ZNF521	-	pfscan_Znf_C2H2	ENSG00000198795		0.498	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	-	0.00	63	0	G	NM_015461		22671957	-1	tier1	-	no_errors	ENST00000361524	ensembl	human	known	74_37	missense	5.19	73	4	SNP	0.998	T
ZNF597	146434	genome.wustl.edu	37	16	3486729	3486729	+	Missense_Mutation	SNP	G	G	A	rs200879821		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr16:3486729G>A	ENST00000301744.4	-	4	1205	c.970C>T	c.(970-972)Cgc>Tgc	p.R324C		NM_152457.1	NP_689670.1	Q96LX8	ZN597_HUMAN	zinc finger protein 597	324					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	13						TCGCTGCAGCGTTCAGAGTCC	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		20647	0.0		0.0	False		,,,				2504	0.001																0								G	CYS/ARG	0,4394		0,0,2197	67.0	63.0	65.0		970	-6.2	0.0	16		65	1,8599	1.2+/-3.3	0,1,4299	yes	missense	ZNF597	NM_152457.1	180	0,1,6496	AA,AG,GG		0.0116,0.0,0.0077	benign	324/425	3486729	1,12993	2197	4300	6497	SO:0001583	missense	0			AK057633	CCDS10505.1	16p13.3	2013-01-08			ENSG00000167981	ENSG00000167981		"""Zinc fingers, C2H2-type"", ""-"""	26573	protein-coding gene	gene with protein product		614685				12477932	Standard	NM_152457		Approved	FLJ33071	uc002cvd.3	Q96LX8	OTTHUMG00000129359	ENST00000301744.4:c.970C>T	16.37:g.3486729G>A	ENSP00000301744:p.Arg324Cys			Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R324C	ENST00000301744.4	37	c.970	CCDS10505.1	16	.	.	.	.	.	.	.	.	.	.	G	12.09	1.832837	0.32421	0.0	1.16E-4	ENSG00000167981	ENST00000301744	T	0.07688	3.17	4.48	-6.18	0.02085	.	2.089840	0.01971	N	0.044066	T	0.06917	0.0176	L	0.47190	1.495	0.09310	N	1	B	0.16802	0.019	B	0.06405	0.002	T	0.38134	-0.9675	10	0.72032	D	0.01	3.9638	0.4697	0.00530	0.2165:0.2025:0.2735:0.3075	.	324	Q96LX8	ZN597_HUMAN	C	324	ENSP00000301744:R324C	ENSP00000301744:R324C	R	-	1	0	ZNF597	3426730	0.000000	0.05858	0.000000	0.03702	0.068000	0.16541	-2.226000	0.01211	-0.927000	0.03766	0.650000	0.86243	CGC	ZNF597	-	NULL	ENSG00000167981		0.493	ZNF597-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF597	HGNC	protein_coding	OTTHUMT00000251511.2		0.00	50	0	G	NM_152457		3486729	-1			no_errors	ENST00000301744	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.000	A
ZNF644	84146	genome.wustl.edu	37	1	91403316	91403316	+	Silent	SNP	T	T	G			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:91403316T>G	ENST00000370440.1	-	4	3631	c.3414A>C	c.(3412-3414)tcA>tcC	p.S1138S	ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000337393.5_Silent_p.S1138S|ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000347275.5_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	1138					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		ATGCAGACACTGACAGAGCTT	0.378																																																	0													162.0	166.0	165.0					1																	91403316		2203	4300	6503	SO:0001819	synonymous_variant	0			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.3414A>C	1.37:g.91403316T>G			A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1138	ENST00000370440.1	37	c.3414	CCDS731.1	1																																																																																			ZNF644	-	NULL	ENSG00000122482		0.378	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	-	0.00	68	0	T	NM_032186		91403316	-1	tier1	-	no_errors	ENST00000337393	ensembl	human	known	74_37	silent	22.73	34	10	SNP	0.999	G
ZNF676	163223	genome.wustl.edu	37	19	22363641	22363641	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:22363641G>T	ENST00000397121.2	-	3	1195	c.878C>A	c.(877-879)tCc>tAc	p.S293Y		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				GAGCTTTGAGGACGAGTTGGA	0.428																																																	0													102.0	106.0	105.0					19																	22363641		2157	4278	6435	SO:0001583	missense	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.878C>A	19.37:g.22363641G>T	ENSP00000380310:p.Ser293Tyr		A8MVX5	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S293Y	ENST00000397121.2	37	c.878	CCDS42539.1	19	.	.	.	.	.	.	.	.	.	.	.	0.006	-2.048865	0.00394	.	.	ENSG00000196109	ENST00000397121	T	0.07908	3.15	0.85	-1.7	0.08159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05868	0.0153	L	0.49350	1.555	0.09310	N	1	B	0.31351	0.32	B	0.26770	0.073	T	0.41502	-0.9505	9	0.17832	T	0.49	.	2.6385	0.04964	0.2433:0.0:0.2682:0.4885	.	293	Q8N7Q3	ZN676_HUMAN	Y	293	ENSP00000380310:S293Y	ENSP00000380310:S293Y	S	-	2	0	ZNF676	22155481	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-2.660000	0.00851	-1.149000	0.02843	-1.152000	0.01820	TCC	ZNF676	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196109		0.428	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	-	0.00	74	0	G	NM_001001411		22363641	-1	tier1	-	no_errors	ENST00000397121	ensembl	human	known	74_37	missense	9.72	65	7	SNP	0.000	T
ZNF676	163223	genome.wustl.edu	37	19	22363653	22363653	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:22363653G>T	ENST00000397121.2	-	3	1183	c.866C>A	c.(865-867)gCt>gAt	p.A289D		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	289					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CGAGTTGGAAGCTTTGCCACA	0.433																																																	0													97.0	102.0	100.0					19																	22363653		2156	4279	6435	SO:0001583	missense	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.866C>A	19.37:g.22363653G>T	ENSP00000380310:p.Ala289Asp		A8MVX5	Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A289D	ENST00000397121.2	37	c.866	CCDS42539.1	19	.	.	.	.	.	.	.	.	.	.	.	2.838	-0.241173	0.05906	.	.	ENSG00000196109	ENST00000397121	T	0.36340	1.26	0.85	-1.7	0.08159	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.43456	0.1248	L	0.39566	1.225	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.36286	-0.9754	9	0.72032	D	0.01	.	4.8352	0.13460	0.2228:0.5497:0.2275:0.0	.	289	Q8N7Q3	ZN676_HUMAN	D	289	ENSP00000380310:A289D	ENSP00000380310:A289D	A	-	2	0	ZNF676	22155493	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-2.147000	0.01293	-1.157000	0.02815	-1.151000	0.01829	GCT	ZNF676	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196109		0.433	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	-	0.00	77	0	G	NM_001001411		22363653	-1	tier1	-	no_errors	ENST00000397121	ensembl	human	known	74_37	missense	12.16	65	9	SNP	0.097	T
ZNF773	374928	genome.wustl.edu	37	19	58016677	58016677	+	Silent	SNP	A	A	G	rs199730365		TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr19:58016677A>G	ENST00000282292.4	+	3	311	c.171A>G	c.(169-171)gcA>gcG	p.A57A	ZNF773_ENST00000599847.1_Silent_p.A57A|ZNF773_ENST00000598770.1_Silent_p.A56A|AC003005.4_ENST00000601674.1_3'UTR|ZNF773_ENST00000593916.1_Silent_p.A56A	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	57	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		TAGGACTTGCATCTTCCAAGA	0.468																																																	0													77.0	75.0	76.0					19																	58016677		2202	4281	6483	SO:0001819	synonymous_variant	0			BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.171A>G	19.37:g.58016677A>G			Q96DL8	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A57	ENST00000282292.4	37	c.171	CCDS33134.1	19																																																																																			ZNF773	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000152439		0.468	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF773	HGNC	protein_coding	OTTHUMT00000466475.1	-	0.00	54	0	A	NM_198542		58016677	+1	tier1	rs199730365	no_errors	ENST00000282292	ensembl	human	known	74_37	silent	14.29	54	9	SNP	0.009	G
ZNF789	285989	genome.wustl.edu	37	7	99081750	99081750	+	Silent	SNP	C	C	A			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr7:99081750C>A	ENST00000331410.5	+	4	519	c.249C>A	c.(247-249)tcC>tcA	p.S83S	ZNF789_ENST00000448667.1_Silent_p.S76S|ZNF789_ENST00000494186.1_3'UTR|ZNF789_ENST00000493485.1_Intron	NM_213603.2	NP_998768.2	Q5FWF6	ZN789_HUMAN	zinc finger protein 789	83					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S83S(1)		endometrium(2)|kidney(2)|large_intestine(4)|lung(2)|ovary(1)	11	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					GGAAGGCTTCCGGTAGTGCTT	0.542																																																	1	Substitution - coding silent(1)	ovary(1)											110.0	105.0	107.0					7																	99081750		2203	4300	6503	SO:0001819	synonymous_variant	0			AK093141	CCDS34693.1, CCDS34694.1	7q22.1	2013-01-08			ENSG00000198556	ENSG00000198556		"""Zinc fingers, C2H2-type"", ""-"""	27801	protein-coding gene	gene with protein product						12477932	Standard	XM_005250281		Approved		uc003uqq.1	Q5FWF6	OTTHUMG00000154601	ENST00000331410.5:c.249C>A	7.37:g.99081750C>A			A4D282|A6NH61|Q6ZMZ9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S83	ENST00000331410.5	37	c.249	CCDS34693.1	7																																																																																			ZNF789	-	NULL	ENSG00000198556		0.542	ZNF789-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF789	HGNC	protein_coding	OTTHUMT00000336266.1		0.00	58	0	C	NM_213603		99081750	+1			no_errors	ENST00000331410	ensembl	human	known	74_37	silent	5.13	37	2	SNP	0.000	A
ZNF831	128611	genome.wustl.edu	37	20	57768421	57768421	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr20:57768421C>T	ENST00000371030.2	+	1	2347	c.2347C>T	c.(2347-2349)Ccc>Tcc	p.P783S		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	783							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.P783A(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					TTGGCCGGACCCCAAGCTGGA	0.657																																																	1	Substitution - Missense(1)	lung(1)											29.0	37.0	34.0					20																	57768421		1888	4098	5986	SO:0001583	missense	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2347C>T	20.37:g.57768421C>T	ENSP00000360069:p.Pro783Ser		Q5TDR4|Q8TCP0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P783S	ENST00000371030.2	37	c.2347	CCDS42894.1	20	.	.	.	.	.	.	.	.	.	.	C	0.595	-0.831569	0.02713	.	.	ENSG00000124203	ENST00000371030	T	0.04015	3.73	3.97	-3.98	0.04082	.	1.446830	0.04338	N	0.353539	T	0.03220	0.0094	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.46005	-0.9222	10	0.18710	T	0.47	-8.0E-4	6.8294	0.23900	0.0:0.3198:0.1281:0.552	.	783	Q5JPB2	ZN831_HUMAN	S	783	ENSP00000360069:P783S	ENSP00000360069:P783S	P	+	1	0	ZNF831	57201816	0.000000	0.05858	0.000000	0.03702	0.059000	0.15707	-0.090000	0.11163	-0.631000	0.05560	-0.271000	0.10264	CCC	ZNF831	-	NULL	ENSG00000124203		0.657	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	-	0.00	146	0	C	NM_178457		57768421	+1	tier1	-	no_errors	ENST00000371030	ensembl	human	novel	74_37	missense	61.25	62	98	SNP	0.000	T
ZSWIM5	57643	genome.wustl.edu	37	1	45484793	45484793	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NH-01A-11D-A37C-09	TCGA-L5-A8NH-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	4eeafbb8-0bb7-43f2-8095-6dcd260ba5f8	ddee75f6-4848-4756-b16c-c467cf1cb918	g.chr1:45484793C>T	ENST00000359600.5	-	14	3096	c.2891G>A	c.(2890-2892)aGc>aAc	p.S964N		NM_020883.1	NP_065934.1	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM-type containing 5	964						extracellular space (GO:0005615)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|liver(1)|lung(13)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					CAGGGCACAGCTCTGTGGATC	0.542											OREG0013450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													73.0	74.0	74.0					1																	45484793		2092	4213	6305	SO:0001583	missense	0			AB040944	CCDS41319.1	1p34.1	2010-06-16			ENSG00000162415	ENSG00000162415		"""Zinc fingers, SWIM-type"""	29299	protein-coding gene	gene with protein product						10819331	Standard	NM_020883		Approved	KIAA1511	uc001cnd.2	Q9P217	OTTHUMG00000008950	ENST00000359600.5:c.2891G>A	1.37:g.45484793C>T	ENSP00000352614:p.Ser964Asn	932	Q5SXQ9	Missense_Mutation	SNP	pfscan_Znf_SWIM	p.S964N	ENST00000359600.5	37	c.2891	CCDS41319.1	1	.	.	.	.	.	.	.	.	.	.	C	1.469	-0.560292	0.03939	.	.	ENSG00000162415	ENST00000359600	T	0.38887	1.11	4.74	3.81	0.43845	.	0.038277	0.85682	D	0.000000	T	0.08846	0.0219	N	0.00446	-1.495	0.36757	D	0.883059	B	0.06786	0.001	B	0.06405	0.002	T	0.40308	-0.9570	10	0.02654	T	1	-17.2249	4.2028	0.10475	0.0:0.6853:0.0:0.3147	.	964	Q9P217	ZSWM5_HUMAN	N	964	ENSP00000352614:S964N	ENSP00000352614:S964N	S	-	2	0	ZSWIM5	45257380	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.171000	0.71926	2.558000	0.86282	0.555000	0.69702	AGC	ZSWIM5	-	NULL	ENSG00000162415		0.542	ZSWIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM5	HGNC	protein_coding	OTTHUMT00000024823.2	-	0.00	42	0	C	XM_046581		45484793	-1	tier1	-	no_errors	ENST00000359600	ensembl	human	known	74_37	missense	10.34	26	3	SNP	1.000	T
