#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCB10	23456	genome.wustl.edu	37	1	229661843	229661843	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:229661843G>T	ENST00000344517.4	-	10	1788	c.1746C>A	c.(1744-1746)tgC>tgA	p.C582*		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	582	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				CAGCAATAGAGCAAGAAAACA	0.403																																																	0													69.0	70.0	70.0					1																	229661843		2203	4300	6503	SO:0001587	stop_gained	0			U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1746C>A	1.37:g.229661843G>T	ENSP00000355637:p.Cys582*		Q13040|Q6P1Q8|Q9H3V0	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.C582*	ENST00000344517.4	37	c.1746	CCDS1580.1	1	.	.	.	.	.	.	.	.	.	.	G	19.63	3.863872	0.71949	.	.	ENSG00000135776	ENST00000344517	.	.	.	4.85	0.742	0.18341	.	0.043207	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-18.6668	10.7046	0.45948	0.3522:0.0:0.6478:0.0	.	.	.	.	X	582	.	ENSP00000355637:C582X	C	-	3	2	ABCB10	227728466	1.000000	0.71417	0.907000	0.35723	0.519000	0.34347	2.263000	0.43293	0.192000	0.20272	0.591000	0.81541	TGC	ABCB10	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000135776		0.403	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB10	HGNC	protein_coding	OTTHUMT00000095240.1	-	0.00	54	0	G	NM_012089		229661843	-1	tier1	-	no_errors	ENST00000344517	ensembl	human	known	74_37	nonsense	7.02	53	4	SNP	1.000	T
ABCC12	94160	genome.wustl.edu	37	16	48121857	48121857	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:48121857G>T	ENST00000311303.3	-	25	3960	c.3615C>A	c.(3613-3615)gtC>gtA	p.V1205V	ABCC12_ENST00000532355.1_5'Flank|ABCC12_ENST00000416054.1_3'UTR|ABCC12_ENST00000448542.1_3'UTR	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	1205	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				CTACAAACAGGACAGGATCCT	0.443																																																	0													98.0	90.0	93.0					16																	48121857		2201	4300	6501	SO:0001819	synonymous_variant	0			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.3615C>A	16.37:g.48121857G>T			Q49AL2|Q8TAF0|Q8TEY2	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,superfamily_ABC1_TM_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.V1205	ENST00000311303.3	37	c.3615	CCDS10730.1	16																																																																																			ABCC12	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000140798		0.443	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	HGNC	protein_coding	OTTHUMT00000256837.1		0.00	25	0	G	NM_033226		48121857	-1			no_errors	ENST00000311303	ensembl	human	known	74_37	silent	8.70	42	4	SNP	1.000	T
ABCG2	9429	genome.wustl.edu	37	4	89034590	89034590	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:89034590G>A	ENST00000237612.3	-	9	1604	c.1059C>T	c.(1057-1059)tcC>tcT	p.S353S	ABCG2_ENST00000515655.1_Silent_p.S353S	NM_004827.2	NP_004818.2	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 2 (Junior blood group)	353					cellular iron ion homeostasis (GO:0006879)|drug export (GO:0046618)|drug transmembrane transport (GO:0006855)|embryonic process involved in female pregnancy (GO:0060136)|heme transport (GO:0015886)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|urate metabolic process (GO:0046415)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)	p.S353S(2)		breast(5)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(13)|lung(10)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Afatinib(DB08916)|Apixaban(DB06605)|Buprenorphine(DB00921)|Cabazitaxel(DB06772)|Carboplatin(DB00958)|Cisplatin(DB00515)|Cladribine(DB00242)|Clofarabine(DB00631)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Diethylstilbestrol(DB00255)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Erlotinib(DB00530)|Estradiol(DB00783)|Estrone(DB00655)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gefitinib(DB00317)|Glyburide(DB01016)|Hesperetin(DB01094)|Hydrocortisone(DB00741)|Imatinib(DB00619)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Methotrexate(DB00563)|Mitoxantrone(DB01204)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Nilotinib(DB04868)|Nitrofurantoin(DB00698)|Novobiocin(DB01051)|Omeprazole(DB00338)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Prazosin(DB00457)|Rabeprazole(DB01129)|Regorafenib(DB08896)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Teniposide(DB00444)|Teriflunomide(DB08880)|Testosterone(DB00624)|Topotecan(DB01030)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vincristine(DB00541)|Vismodegib(DB08828)|Zafirlukast(DB00549)|Zidovudine(DB00495)	TCTCACCCCCGGAAAGTTGAT	0.428																																																	2	Substitution - coding silent(2)	breast(2)											152.0	154.0	153.0					4																	89034590		2203	4300	6503	SO:0001819	synonymous_variant	0			AF103796	CCDS3628.1, CCDS58910.1	4q22.1	2014-08-27	2014-08-27		ENSG00000118777	ENSG00000118777		"""CD molecules"", ""ATP binding cassette transporters / subfamily G"""	74	protein-coding gene	gene with protein product		603756	"""ATP-binding cassette, sub-family G (WHITE), member 2"""			8894702, 9861027	Standard	NM_001257386		Approved	EST157481, MXR, BCRP, ABCP, CD338	uc003hrg.3	Q9UNQ0	OTTHUMG00000130601	ENST00000237612.3:c.1059C>T	4.37:g.89034590G>A			A0A1W3|A8K1T5|O95374|Q4W5I3|Q53ZQ1|Q569L4|Q5YLG4|Q86V64|Q8IX16|Q96LD6|Q96TA8|Q9BY73|Q9NUS0	Silent	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S353	ENST00000237612.3	37	c.1059	CCDS3628.1	4																																																																																			ABCG2	-	NULL	ENSG00000118777		0.428	ABCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCG2	HGNC	protein_coding	OTTHUMT00000253051.1		0.00	45	0	G	NM_004827		89034590	-1			no_errors	ENST00000237612	ensembl	human	known	74_37	silent	9.38	29	3	SNP	0.000	A
ABHD2	11057	genome.wustl.edu	37	15	89738468	89738468	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:89738468G>A	ENST00000352732.5	+	11	1612	c.1092G>A	c.(1090-1092)gaG>gaA	p.E364E	ABHD2_ENST00000355100.3_Silent_p.E364E|ABHD2_ENST00000565973.1_Silent_p.E364E	NM_152924.4	NP_690888.1	P08910	ABHD2_HUMAN	abhydrolase domain containing 2	364					negative regulation of cell migration (GO:0030336)|response to wounding (GO:0009611)	integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|soft_tissue(1)	23	Lung NSC(78;0.0472)|all_lung(78;0.089)					AGAAACGAGAGAACGTCATGT	0.572																																					Colon(11;252 417 24570 33239 41878)												0													138.0	120.0	126.0					15																	89738468		2200	4299	6499	SO:0001819	synonymous_variant	0			X12433	CCDS10348.1	15q26.1	2006-10-06			ENSG00000140526	ENSG00000140526		"""Abhydrolase domain containing"""	18717	protein-coding gene	gene with protein product		612196					Standard	NM_152924		Approved	LABH2	uc002bnk.2	P08910	OTTHUMG00000148684	ENST00000352732.5:c.1092G>A	15.37:g.89738468G>A			Q53G48|Q53GU0|Q5FVD9|Q8TC79	Silent	SNP	pfam_AB_hydrolase_1,pirsf_AB-Hydro_YheT	p.E364	ENST00000352732.5	37	c.1092	CCDS10348.1	15																																																																																			ABHD2	-	pfam_AB_hydrolase_1,pirsf_AB-Hydro_YheT	ENSG00000140526		0.572	ABHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD2	HGNC	protein_coding	OTTHUMT00000309074.2	-	0.00	47	0	G			89738468	+1	tier1	-	no_errors	ENST00000352732	ensembl	human	known	74_37	silent	28.00	54	21	SNP	1.000	A
C1orf146	388649	genome.wustl.edu	37	1	92694545	92694545	+	Intron	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:92694545A>C	ENST00000370375.3	+	2	109				C1orf146_ENST00000370373.2_Intron|ACTBP12_ENST00000594933.1_RNA|AL451010.1_ENST00000581900.1_RNA	NM_001012425.1	NP_001012425.1	Q5VVC0	CA146_HUMAN	chromosome 1 open reading frame 146											breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8		all_lung(203;0.00528)|Lung NSC(277;0.0193)		all cancers(265;0.00846)|Epithelial(280;0.0952)		ATGCAGCAAAAGCTATGCATC	0.438																																																	0																																										SO:0001627	intron_variant	0				CCDS30772.1	1p22.1	2008-02-05			ENSG00000203910	ENSG00000203910			24032	protein-coding gene	gene with protein product						15496913	Standard	NM_001012425		Approved		uc001doq.3	Q5VVC0	OTTHUMG00000010285	ENST00000370375.3:c.-39-2394A>C	1.37:g.92694545A>C			Q5VVC4	RNA	SNP	-	NULL	ENST00000370375.3	37	NULL	CCDS30772.1	1																																																																																			ACTBP12	-	-	ENSG00000233125		0.438	C1orf146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTBP12	HGNC	protein_coding	OTTHUMT00000028364.1	-	0.00	28	0	A	NM_001012425		92694545	-1	tier1	-	no_errors	ENST00000594933	ensembl	human	known	74_37	rna	52.38	10	11	SNP	0.958	C
ACTG1	71	genome.wustl.edu	37	17	79478583	79478583	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr17:79478583A>C	ENST00000575842.1	-	3	859	c.433T>G	c.(433-435)Tct>Gct	p.S145A	RP13-766D20.2_ENST00000430912.1_RNA|ACTG1_ENST00000575087.1_Missense_Mutation_p.S145A|ACTG1_ENST00000331925.2_Missense_Mutation_p.S145A|AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000573283.1_Missense_Mutation_p.S145A			P63261	ACTG_HUMAN	actin, gamma 1	145					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			GTGCGCCCAGAGGCGTAGAGG	0.622																																																	0													72.0	78.0	76.0					17																	79478583		2203	4300	6503	SO:0001583	missense	0				CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.433T>G	17.37:g.79478583A>C	ENSP00000458162:p.Ser145Ala		A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	pfam_Actin-related,smart_Actin-related,prints_Actin-related	p.S145A	ENST00000575842.1	37	c.433	CCDS11782.1	17	.	.	.	.	.	.	.	.	.	.	a	14.07	2.426553	0.43020	.	.	ENSG00000184009	ENST00000331925	D	0.97066	-4.23	4.6	4.6	0.57074	.	0.000000	0.64402	D	0.000001	D	0.98576	0.9524	M	0.82716	2.605	0.49213	D	0.999764	B	0.33413	0.411	D	0.65010	0.931	D	0.99808	1.1039	10	0.87932	D	0	.	13.0151	0.58753	1.0:0.0:0.0:0.0	.	145	P63261	ACTG_HUMAN	A	145	ENSP00000331514:S145A	ENSP00000331514:S145A	S	-	1	0	ACTG1	77093178	1.000000	0.71417	0.865000	0.33974	0.362000	0.29581	8.917000	0.92751	1.724000	0.51502	0.456000	0.33151	TCT	ACTG1	-	pfam_Actin-related,smart_Actin-related,prints_Actin-related	ENSG00000184009		0.622	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ACTG1	HGNC	protein_coding	OTTHUMT00000439935.2	-	0.00	38	0	A	NM_001614		79478583	-1	tier1	-	no_errors	ENST00000331925	ensembl	human	known	74_37	missense	22.09	67	19	SNP	1.000	C
AFG3L2	10939	genome.wustl.edu	37	18	12367358	12367358	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr18:12367358G>A	ENST00000269143.3	-	4	547	c.316C>T	c.(316-318)Cgc>Tgc	p.R106C		NM_006796.2	NP_006787.2	Q9Y4W6	AFG32_HUMAN	AFG3-like AAA ATPase 2	106					axonogenesis (GO:0007409)|cell death (GO:0008219)|cristae formation (GO:0042407)|mitochondrial fusion (GO:0008053)|mitochondrial protein processing (GO:0034982)|muscle fiber development (GO:0048747)|myelination (GO:0042552)|nerve development (GO:0021675)|neuromuscular junction development (GO:0007528)|regulation of multicellular organism growth (GO:0040014)|righting reflex (GO:0060013)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metalloendopeptidase activity (GO:0004222)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)	p.R106C(1)		NS(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(12)|prostate(3)|skin(1)|stomach(3)|urinary_tract(1)	27					Adenosine triphosphate(DB00171)	CCAGAAGAGCGTGTGGTAGCA	0.473																																																	1	Substitution - Missense(1)	endometrium(1)											117.0	109.0	112.0					18																	12367358		2203	4300	6503	SO:0001583	missense	0			Y18314	CCDS11859.1	18p11.21	2014-09-17	2013-10-17		ENSG00000141385	ENSG00000141385		"""ATPases / AAA-type"""	315	protein-coding gene	gene with protein product		604581	"""AFG3 (ATPase family gene 3, yeast)-like 2"", ""spinocerebellar ataxia 28"", ""AFG3 ATPase family gene 3-like 2 (yeast)"", ""AFG3 ATPase family gene 3-like 2 (S. cerevisiae)"", ""AFG3 ATPase family member 3-like 2 (S. cerevisiae)"""	SCA28		10395799, 18769991	Standard	NM_006796		Approved	SPAX5	uc002kqz.2	Q9Y4W6	OTTHUMG00000131695	ENST00000269143.3:c.316C>T	18.37:g.12367358G>A	ENSP00000269143:p.Arg106Cys		Q6P1L0	Missense_Mutation	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,pfam_Pept_M41_FtsH_extracell,superfamily_P-loop_NTPase,smart_AAA+_ATPase,tigrfam_FtsH	p.R106C	ENST00000269143.3	37	c.316	CCDS11859.1	18	.	.	.	.	.	.	.	.	.	.	G	12.39	1.923191	0.33908	.	.	ENSG00000141385	ENST00000269143;ENST00000537174	D	0.93247	-3.19	5.72	1.69	0.24217	Peptidase M41, FtsH (1);	2.831530	0.00710	N	0.000837	D	0.90448	0.7009	L	0.43152	1.355	0.09310	N	1	P	0.41498	0.752	B	0.35688	0.208	T	0.79732	-0.1680	10	0.66056	D	0.02	7.891	9.5003	0.39013	0.0649:0.0:0.5742:0.3609	.	106	Q9Y4W6	AFG32_HUMAN	C	106;121	ENSP00000269143:R106C	ENSP00000269143:R106C	R	-	1	0	AFG3L2	12357358	0.003000	0.15002	0.004000	0.12327	0.516000	0.34256	0.730000	0.26043	0.018000	0.15052	0.655000	0.94253	CGC	AFG3L2	-	NULL	ENSG00000141385		0.473	AFG3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFG3L2	HGNC	protein_coding	OTTHUMT00000254603.2		0.00	39	0	G	NM_006796		12367358	-1			no_errors	ENST00000269143	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.003	A
AGRN	375790	genome.wustl.edu	37	1	957614	957614	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:957614C>T	ENST00000379370.2	+	2	285	c.235C>T	c.(235-237)Ctg>Ttg	p.L79L		NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin	79	NtA. {ECO:0000255|PROSITE- ProRule:PRU00443}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		GGGCAAAGACCTGGTGGCCCG	0.617																																																	0													88.0	98.0	95.0					1																	957614		2203	4300	6503	SO:0001819	synonymous_variant	0			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.235C>T	1.37:g.957614C>T			Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Silent	SNP	pfam_Laminin_G,pfam_Agrin_NtA,pfam_Kazal_dom,pfam_EGF_laminin,pfam_SEA_dom,pfam_EG-like_dom,superfamily_TIMP-like_OB-fold,superfamily_ConA-like_lec_gl_sf,smart_FacI_MAC,smart_Fol_N,smart_Kazal_dom,smart_EG-like_dom,smart_EGF_laminin,smart_SEA_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Agrin_NtA,pfscan_SEA_dom	p.L79	ENST00000379370.2	37	c.235	CCDS30551.1	1																																																																																			AGRN	-	pfam_Agrin_NtA,superfamily_TIMP-like_OB-fold,pfscan_Agrin_NtA	ENSG00000188157		0.617	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGRN	HGNC	protein_coding	OTTHUMT00000097990.2	-	0.00	129	0	C	NM_198576		957614	+1	tier1	-	no_errors	ENST00000379370	ensembl	human	known	74_37	silent	36.61	71	41	SNP	0.098	T
AGTR1	185	genome.wustl.edu	37	3	148459671	148459671	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:148459671C>T	ENST00000497524.1	+	2	1240	c.849C>T	c.(847-849)gcC>gcT	p.A283A	AGTR1_ENST00000404754.2_Silent_p.A283A|AGTR1_ENST00000474935.1_Silent_p.A283A|AGTR1_ENST00000349243.3_Silent_p.A283A|AGTR1_ENST00000402260.1_Silent_p.A283A|AGTR1_ENST00000461609.1_Silent_p.A283A|AGTR1_ENST00000542281.1_Silent_p.A283A|AGTR1_ENST00000418473.2_Silent_p.A283A|AGTR1_ENST00000475347.1_Silent_p.A283A	NM_009585.3	NP_033611.1	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	283					angiotensin-activated signaling pathway (GO:0038166)|calcium-mediated signaling (GO:0019722)|cell chemotaxis (GO:0060326)|G-protein coupled receptor signaling pathway (GO:0007186)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|phospholipase C-activating angiotensin-activated signaling pathway (GO:0086097)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of phospholipase A2 activity (GO:0032430)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|renin-angiotensin regulation of aldosterone production (GO:0002018)|Rho protein signal transduction (GO:0007266)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin type I receptor activity (GO:0001596)|angiotensin type II receptor activity (GO:0004945)|bradykinin receptor binding (GO:0031711)|protein heterodimerization activity (GO:0046982)			breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Azilsartan medoxomil(DB08822)|Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	TGGACACGGCCATGCCTATCA	0.368																																																	0													103.0	96.0	99.0					3																	148459671		2203	4300	6503	SO:0001819	synonymous_variant	0			M87290	CCDS3137.1	3q24	2012-08-08	2002-02-20		ENSG00000144891	ENSG00000144891		"""GPCR / Class A : Angiotensin receptors"""	336	protein-coding gene	gene with protein product		106165	"""angiotensin receptor 1B"""	AGTR1B		1550596	Standard	NM_009585		Approved	AT1, AT2R1, AGTR1A, AT2R1A, HAT1R, AG2S, AT2R1B, AT1B	uc003ewh.4	P30556	OTTHUMG00000159503	ENST00000497524.1:c.849C>T	3.37:g.148459671C>T			Q13725|Q8TBK4	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ATII_AT1_rcpt,prints_ATII_rcpt,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Formyl_pep_rcpt,prints_Brdyknn_rcpt	p.A283	ENST00000497524.1	37	c.849	CCDS3137.1	3																																																																																			AGTR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_ATII_AT1_rcpt,prints_ATII_rcpt,prints_Chemokine_rcpt	ENSG00000144891		0.368	AGTR1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AGTR1	HGNC	protein_coding	OTTHUMT00000355807.1	-	0.00	46	0	C			148459671	+1	tier1	-	no_errors	ENST00000349243	ensembl	human	known	74_37	silent	5.06	75	4	SNP	1.000	T
AHCYL1	10768	genome.wustl.edu	37	1	110557445	110557445	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:110557445G>T	ENST00000369799.5	+	6	1008	c.641G>T	c.(640-642)cGc>cTc	p.R214L	AHCYL1_ENST00000393614.4_Missense_Mutation_p.R167L|AHCYL1_ENST00000475081.1_3'UTR|AHCYL1_ENST00000359172.3_Missense_Mutation_p.R167L	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	214					mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)	p.R214H(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		TGTATTGACCGCTGTGTGAAC	0.438																																																	1	Substitution - Missense(1)	large_intestine(1)											213.0	190.0	198.0					1																	110557445		2203	4300	6503	SO:0001583	missense	0			U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.641G>T	1.37:g.110557445G>T	ENSP00000358814:p.Arg214Leu		B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Missense_Mutation	SNP	pfam_Adenosylhomocysteinase,pfam_Ado_hCys_hydrolase_NAD-bd,pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_IlvN,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	p.R214L	ENST00000369799.5	37	c.641	CCDS818.1	1	.	.	.	.	.	.	.	.	.	.	G	19.86	3.905056	0.72868	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	T;T;T	0.78481	-1.18;-1.18;-1.18	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.71668	0.3367	M	0.70787	2.145	0.80722	D	1	P	0.38767	0.646	B	0.31946	0.138	T	0.77064	-0.2726	10	0.87932	D	0	-9.99	20.8794	0.99867	0.0:0.0:1.0:0.0	.	214	O43865	SAHH2_HUMAN	L	214;167;167	ENSP00000358814:R214L;ENSP00000352092:R167L;ENSP00000377238:R167L	ENSP00000352092:R167L	R	+	2	0	AHCYL1	110358968	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.946000	0.87746	2.941000	0.99782	0.655000	0.94253	CGC	AHCYL1	-	pfam_Adenosylhomocysteinase,pirsf_Adenosylhomocysteinase,tigrfam_Adenosylhomocysteinase	ENSG00000168710		0.438	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHCYL1	HGNC	protein_coding	OTTHUMT00000032243.1		0.00	47	0	G			110557445	+1			no_errors	ENST00000369799	ensembl	human	known	74_37	missense	6.38	42	3	SNP	1.000	T
ALDH1A1	216	genome.wustl.edu	37	9	75567891	75567891	+	Nonsense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:75567891A>C	ENST00000297785.3	-	1	80	c.26T>G	c.(25-27)tTa>tGa	p.L9*	ALDH1A1_ENST00000376939.1_Nonsense_Mutation_p.L9*|ALDH1A1_ENST00000482210.1_5'Flank	NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	9					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	TAGGACAGGTAAGTCTGGCGT	0.413																																																	0													116.0	105.0	109.0					9																	75567891		2203	4299	6502	SO:0001587	stop_gained	0			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.26T>G	9.37:g.75567891A>C	ENSP00000297785:p.Leu9*		O00768|Q5SYR1	Nonsense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH	p.L9*	ENST00000297785.3	37	c.26	CCDS6644.1	9	.	.	.	.	.	.	.	.	.	.	A	36	5.949866	0.97139	.	.	ENSG00000165092	ENST00000297785;ENST00000376939;ENST00000428593;ENST00000419959;ENST00000446946	.	.	.	5.96	5.96	0.96718	.	0.484707	0.18811	N	0.130517	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9988	0.71455	1.0:0.0:0.0:0.0	.	.	.	.	X	9;9;23;9;9	.	ENSP00000297785:L9X	L	-	2	0	ALDH1A1	74757711	0.999000	0.42202	0.933000	0.37362	0.459000	0.32528	5.430000	0.66501	2.279000	0.76181	0.533000	0.62120	TTA	ALDH1A1	-	superfamily_Ald_DH/histidinol_DH	ENSG00000165092		0.413	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A1	HGNC	protein_coding	OTTHUMT00000052679.1	-	0.00	70	0	A			75567891	-1	tier1	-	no_errors	ENST00000297785	ensembl	human	known	74_37	nonsense	22.37	59	17	SNP	0.996	C
ALLC	55821	genome.wustl.edu	37	2	3721693	3721693	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:3721693C>T	ENST00000252505.3	+	3	224	c.62C>T	c.(61-63)gCt>gTt	p.A21V		NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	40					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		GACTTTTTTGCTCCTGCAGAA	0.333										HNSCC(21;0.051)																																							0													30.0	30.0	30.0					2																	3721693		1797	4055	5852	SO:0001583	missense	0			AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.62C>T	2.37:g.3721693C>T	ENSP00000252505:p.Ala21Val		Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	pfam_Allantoicase_dom,superfamily_Galactose-bd-like,tigrfam_Allantoicase	p.A21V	ENST00000252505.3	37	c.62	CCDS46223.1	2	.	.	.	.	.	.	.	.	.	.	C	22.3	4.266908	0.80469	.	.	ENSG00000151360	ENST00000252505	.	.	.	5.49	4.6	0.57074	Allantoicase domain (1);Galactose-binding domain-like (1);	0.051380	0.85682	D	0.000000	D	0.85517	0.5715	H	0.94771	3.58	0.41406	D	0.987705	D	0.71674	0.998	D	0.68621	0.959	D	0.89505	0.3767	9	0.87932	D	0	-14.4494	13.7207	0.62725	0.0:0.8382:0.1618:0.0	.	40	Q8N6M5	ALLC_HUMAN	V	21	.	ENSP00000252505:A21V	A	+	2	0	ALLC	3699568	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.736000	0.47385	1.259000	0.44117	0.655000	0.94253	GCT	ALLC	-	pfam_Allantoicase_dom,superfamily_Galactose-bd-like,tigrfam_Allantoicase	ENSG00000151360		0.333	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALLC	HGNC	protein_coding	OTTHUMT00000322855.1	-	0.00	54	0	C			3721693	+1	tier1	-	no_errors	ENST00000252505	ensembl	human	known	74_37	missense	5.80	64	4	SNP	1.000	T
AMACR	23600	genome.wustl.edu	37	5	34005897	34005897	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:34005897A>T	ENST00000335606.6	-	2	443	c.355T>A	c.(355-357)Tta>Ata	p.L119I	AMACR_ENST00000382068.3_Missense_Mutation_p.L119I|AMACR_ENST00000441713.2_Missense_Mutation_p.L119I|RP11-1084J3.4_ENST00000382079.3_Missense_Mutation_p.V266D|AMACR_ENST00000382072.2_Missense_Mutation_p.L119I|AMACR_ENST00000426255.2_Missense_Mutation_p.L119I|AMACR_ENST00000512079.1_Missense_Mutation_p.L119I|AMACR_ENST00000514195.1_5'UTR|AMACR_ENST00000502637.1_Missense_Mutation_p.L119I|AMACR_ENST00000382085.3_Missense_Mutation_p.L119I	NM_001167595.1|NM_014324.5	NP_001161067.1|NP_055139.4	Q9UHK6	AMACR_HUMAN	alpha-methylacyl-CoA racemase	119					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alpha-methylacyl-CoA racemase activity (GO:0008111)|receptor binding (GO:0005102)			endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|stomach(1)|urinary_tract(1)	19						TGGCCAGCTAACCGGCAGAAG	0.438																																																	0													54.0	56.0	56.0					5																	34005897		2203	4300	6503	SO:0001583	missense	0			AF047020	CCDS3902.1, CCDS3903.1, CCDS54836.1	5p13.2	2012-05-16			ENSG00000242110	ENSG00000242110	5.1.99.4		451	protein-coding gene	gene with protein product		604489				9307041	Standard	NM_014324		Approved	RACE	uc003jij.3	Q9UHK6	OTTHUMG00000090734	ENST00000335606.6:c.355T>A	5.37:g.34005897A>T	ENSP00000334424:p.Leu119Ile		A5YM47|B8Y916|B8Y918|F8W9N1|O43673|Q3KT79|Q96GH1|Q9Y3Q1	Missense_Mutation	SNP	pfam_CoA-Trfase_fam_III,superfamily_CoA-Trfase_III_dom	p.L119I	ENST00000335606.6	37	c.355	CCDS3902.1	5	.	.	.	.	.	.	.	.	.	.	A	11.66	1.705391	0.30232	.	.	ENSG00000242110	ENST00000335606;ENST00000382072;ENST00000382085;ENST00000502637;ENST00000441713	T;T;T;T;T	0.55413	0.52;0.52;0.52;0.52;0.52	5.46	-5.97	0.02227	CoA-transferase family III domain (2);	0.948341	0.08864	N	0.882517	T	0.36303	0.0962	L	0.43152	1.355	0.09310	N	1	B;B;B;B;B;B	0.30236	0.01;0.274;0.01;0.007;0.232;0.007	B;B;B;B;B;B	0.34346	0.038;0.18;0.015;0.026;0.07;0.026	T	0.32052	-0.9921	10	0.22109	T	0.4	0.149	4.0537	0.09806	0.5619:0.1229:0.072:0.2432	.	119;119;119;119;119;119	B3KMU8;Q6VRU4;F8W9N1;D6RB81;Q9UHK6-4;Q9UHK6	.;.;.;.;.;AMACR_HUMAN	I	119	ENSP00000334424:L119I;ENSP00000371504:L119I;ENSP00000371517:L119I;ENSP00000424351:L119I;ENSP00000403800:L119I	ENSP00000334424:L119I	L	-	1	2	AMACR	34041654	0.000000	0.05858	0.000000	0.03702	0.464000	0.32679	0.038000	0.13862	-1.260000	0.02465	-0.290000	0.09829	TTA	AMACR	-	pfam_CoA-Trfase_fam_III,superfamily_CoA-Trfase_III_dom	ENSG00000242110		0.438	AMACR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMACR	HGNC	protein_coding	OTTHUMT00000207467.1	-	0.00	59	0	A	NM_014324		34005897	-1	tier1	-	no_errors	ENST00000335606	ensembl	human	known	74_37	missense	26.37	67	24	SNP	0.000	T
ANK3	288	genome.wustl.edu	37	10	61836146	61836146	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:61836146A>C	ENST00000280772.2	-	37	4684	c.4493T>G	c.(4492-4494)tTt>tGt	p.F1498C	ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron|ANK3_ENST00000355288.2_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1498					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TCTTGTAGAAAAGAATGGCTT	0.428																																																	0													78.0	80.0	79.0					10																	61836146		2203	4300	6503	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.4493T>G	10.37:g.61836146A>C	ENSP00000280772:p.Phe1498Cys		B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like_dom,smart_Ankyrin_rpt,smart_ZU5,smart_Death_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death_domain,pfscan_ZU5,prints_Ankyrin_rpt	p.F1498C	ENST00000280772.2	37	c.4493	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	A	16.78	3.217570	0.58560	.	.	ENSG00000151150	ENST00000280772	T	0.74209	-0.82	5.87	5.87	0.94306	.	0.000000	0.43260	D	0.000581	D	0.84750	0.5541	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.86191	0.1612	10	0.87932	D	0	.	16.2632	0.82562	1.0:0.0:0.0:0.0	.	1498	Q12955	ANK3_HUMAN	C	1498	ENSP00000280772:F1498C	ENSP00000280772:F1498C	F	-	2	0	ANK3	61506152	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.247000	0.74100	0.477000	0.44152	TTT	ANK3	-	NULL	ENSG00000151150		0.428	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	-	0.00	117	0	A	NM_020987		61836146	-1	tier1	-	no_errors	ENST00000280772	ensembl	human	known	74_37	missense	56.74	93	122	SNP	1.000	C
ANKRD20A5P	440482	genome.wustl.edu	37	18	14179251	14179251	+	RNA	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr18:14179251G>T	ENST00000581935.1	+	0	156							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						gggttggatcgcggatttggg	0.597																																																	0																																												0			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14179251G>T			Q4G1B6	RNA	SNP	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481		0.597	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	HGNC	pseudogene	OTTHUMT00000442833.1		0.00	40	0	G			14179251	+1			no_errors	ENST00000581181	ensembl	human	known	74_37	rna	12.00	22	3	SNP	0.058	T
ANKRD20A5P	440482	genome.wustl.edu	37	18	14179258	14179258	+	RNA	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr18:14179258T>G	ENST00000581935.1	+	0	163							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						atcgcggatttggggttggat	0.592																																																	0																																												0			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14179258T>G			Q4G1B6	RNA	SNP	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481		0.592	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	HGNC	pseudogene	OTTHUMT00000442833.1		0.00	43	0	T			14179258	+1			no_errors	ENST00000581181	ensembl	human	known	74_37	rna	11.54	23	3	SNP	0.033	G
ANKRD26	22852	genome.wustl.edu	37	10	27323846	27323846	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:27323846A>C	ENST00000376087.4	-	24	3698	c.3533T>G	c.(3532-3534)cTt>cGt	p.L1178R	ANKRD26_ENST00000436985.2_Missense_Mutation_p.L1194R|ANKRD26_ENST00000376070.3_Missense_Mutation_p.L735R	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1177					glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						CTCAGCTTGAAGTTTTTGCAC	0.358																																																	0													192.0	179.0	183.0					10																	27323846		1874	4102	5976	SO:0001583	missense	0			AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.3533T>G	10.37:g.27323846A>C	ENSP00000365255:p.Leu1178Arg		A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Polyketide_synth_docking,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L1194R	ENST00000376087.4	37	c.3581	CCDS41499.1	10	.	.	.	.	.	.	.	.	.	.	A	8.337	0.827791	0.16749	.	.	ENSG00000107890	ENST00000376070;ENST00000376087;ENST00000436985	T;T;T	0.27890	1.64;1.64;1.64	5.64	3.21	0.36854	.	0.441232	0.18488	N	0.139735	T	0.46600	0.1401	M	0.70595	2.14	0.09310	N	1	D;D;D	0.71674	0.998;0.996;0.988	P;P;P	0.61132	0.884;0.768;0.797	T	0.33675	-0.9859	10	0.87932	D	0	.	7.4542	0.27257	0.7102:0.1482:0.0:0.1416	.	1178;1177;1194	Q9UPS8-3;Q9UPS8;A1L497	.;ANR26_HUMAN;.	R	735;1178;1194	ENSP00000365238:L735R;ENSP00000365255:L1178R;ENSP00000405112:L1194R	ENSP00000365238:L735R	L	-	2	0	ANKRD26	27363852	1.000000	0.71417	0.000000	0.03702	0.123000	0.20343	7.937000	0.87672	0.367000	0.24454	0.482000	0.46254	CTT	ANKRD26	-	NULL	ENSG00000107890		0.358	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	HGNC	protein_coding	OTTHUMT00000047296.1	-	0.00	24	0	A			27323846	-1	tier1	-	no_errors	ENST00000436985	ensembl	human	known	74_37	missense	22.81	44	13	SNP	0.005	C
ANKRD30A	91074	genome.wustl.edu	37	10	37422955	37422955	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:37422955T>G	ENST00000602533.1	+	5	660	c.561T>G	c.(559-561)caT>caG	p.H187Q	RNU6-811P_ENST00000384069.1_RNA|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.H187Q|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.H187Q			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	243					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						CTGCAGAACATTATGCTGTTA	0.378																																																	0													323.0	301.0	308.0					10																	37422955		1897	4116	6013	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.561T>G	10.37:g.37422955T>G	ENSP00000473551:p.His187Gln		Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.H187Q	ENST00000602533.1	37	c.561		10	.	.	.	.	.	.	.	.	.	.	.	9.497	1.102298	0.20632	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.72167	-0.63;-0.55	1.43	0.0244	0.14141	Ankyrin repeat-containing domain (3);	.	.	.	.	T	0.59183	0.2175	L	0.52905	1.665	0.09310	N	1	B	0.23650	0.089	B	0.17722	0.019	T	0.51348	-0.8717	9	0.54805	T	0.06	.	3.3927	0.07295	0.6047:0.0:0.0:0.3953	.	243	Q9BXX3	AN30A_HUMAN	Q	187	ENSP00000354432:H187Q;ENSP00000363792:H187Q	ENSP00000354432:H187Q	H	+	3	2	ANKRD30A	37462961	0.053000	0.20554	0.005000	0.12908	0.024000	0.10985	-0.761000	0.04751	-0.159000	0.11021	0.240000	0.17902	CAT	ANKRD30A	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000148513		0.378	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	-	0.00	103	0	T	NM_052997		37422955	+1	tier1	-	no_errors	ENST00000361713	ensembl	human	known	74_37	missense	24.09	104	33	SNP	0.189	G
ANKRD62	342850	genome.wustl.edu	37	18	12125669	12125669	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr18:12125669A>G	ENST00000587848.2	+	13	2014	c.1849A>G	c.(1849-1851)Aca>Gca	p.T617A	ANKRD62_ENST00000418274.2_3'UTR|ANKRD62_ENST00000314074.8_Missense_Mutation_p.T603A			A6NC57	ANR62_HUMAN	ankyrin repeat domain 62	617										breast(2)|haematopoietic_and_lymphoid_tissue(1)	3						ATTAACAAAAACAATAACCCG	0.333																																																	0																																										SO:0001583	missense	0			BX648696	CCDS67439.1	18p11.21	2014-01-21			ENSG00000181626	ENSG00000181626		"""Ankyrin repeat domain containing"""	35241	protein-coding gene	gene with protein product							Standard	XM_003959949		Approved	DKFZp779B1634	uc031rhk.1	A6NC57	OTTHUMG00000180673	ENST00000587848.2:c.1849A>G	18.37:g.12125669A>G	ENSP00000467740:p.Thr617Ala			Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T603A	ENST00000587848.2	37	c.1807		18	.	.	.	.	.	.	.	.	.	.	.	8.939	0.965333	0.18583	.	.	ENSG00000181626	ENST00000314074;ENST00000418274	T;T	0.23552	1.9;1.9	1.78	1.78	0.24846	.	.	.	.	.	T	0.42223	0.1193	M	0.70595	2.14	0.22292	N	0.999229	D	0.67145	0.996	D	0.63033	0.91	T	0.11036	-1.0604	9	0.46703	T	0.11	.	7.5246	0.27647	1.0:0.0:0.0:0.0	.	617	A6NC57	ANR62_HUMAN	A	603;339	ENSP00000326572:T603A;ENSP00000405628:T339A	ENSP00000326572:T603A	T	+	1	0	ANKRD62	12115669	1.000000	0.71417	0.017000	0.16124	0.127000	0.20565	5.051000	0.64257	1.079000	0.41038	0.155000	0.16302	ACA	ANKRD62	-	NULL	ENSG00000181626		0.333	ANKRD62-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ANKRD62	HGNC	protein_coding	OTTHUMT00000452521.2	-	0.00	72	0	A	XM_001715728		12125669	+1	tier1	-	no_errors	ENST00000314074	ensembl	human	known	74_37	missense	69.57	7	16	SNP	0.660	G
ANO2	57101	genome.wustl.edu	37	12	5674779	5674779	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:5674779G>A	ENST00000356134.5	-	26	2746	c.2675C>T	c.(2674-2676)tCg>tTg	p.S892L	ANO2_ENST00000546188.1_Missense_Mutation_p.S892L|ANO2_ENST00000327087.8_Missense_Mutation_p.S891L	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	896					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.S892L(1)		central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						GTACTGTTTCGAAAACTCATA	0.502																																																	1	Substitution - Missense(1)	skin(1)											45.0	44.0	45.0					12																	5674779		1850	4094	5944	SO:0001583	missense	0			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2675C>T	12.37:g.5674779G>A	ENSP00000348453:p.Ser892Leu		C4N787|Q9H847	Missense_Mutation	SNP	pfam_Anoctamin	p.S892L	ENST00000356134.5	37	c.2675		12	.	.	.	.	.	.	.	.	.	.	G	29.5	5.009850	0.93346	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	T;T;T	0.68765	-0.35;-0.35;-0.35	4.95	4.95	0.65309	.	0.000000	0.85682	D	0.000000	D	0.83857	0.5345	M	0.86651	2.83	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	D	0.86800	0.1991	10	0.62326	D	0.03	.	17.1848	0.86863	0.0:0.0:1.0:0.0	.	891	Q9NQ90-3	.	L	891;892;892;896	ENSP00000314048:S891L;ENSP00000348453:S892L;ENSP00000440981:S892L	ENSP00000314048:S891L	S	-	2	0	ANO2	5545040	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.476000	0.97823	2.309000	0.77851	0.561000	0.74099	TCG	ANO2	-	pfam_Anoctamin	ENSG00000047617		0.502	ANO2-001	KNOWN	basic	protein_coding	ANO2	HGNC	protein_coding	OTTHUMT00000399019.4	-	0.00	55	0	G	NM_020373		5674779	-1	tier1	-	no_errors	ENST00000356134	ensembl	human	known	74_37	missense	28.95	54	22	SNP	1.000	A
AP5M1	55745	genome.wustl.edu	37	14	57741320	57741320	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:57741320G>A	ENST00000261558.3	+	2	839	c.433G>A	c.(433-435)Ggt>Agt	p.G145S	AP5M1_ENST00000431972.2_Missense_Mutation_p.G159S	NM_018229.3	NP_060699.3	Q9H0R1	AP5M1_HUMAN	adaptor-related protein complex 5, mu 1 subunit	145					endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|cytosol (GO:0005829)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)											TCTTTATTCAGGTCAAAAAAA	0.403																																																	0													55.0	59.0	58.0					14																	57741320		2203	4299	6502	SO:0001583	missense	0			AF094583	CCDS9729.1	14q22.2	2012-03-20	2012-03-20	2012-03-20	ENSG00000053770	ENSG00000053770			20192	protein-coding gene	gene with protein product	"""Mu-2 related death-inducing gene"""	614368	"""chromosome 14 open reading frame 108"", ""MU-2/AP1M2 domain containing, death-inducing"""	C14orf108, MUDENG		18395520	Standard	NM_018229		Approved	FLJ10813, MuD, mu5	uc001xcv.3	Q9H0R1	OTTHUMG00000140318	ENST00000261558.3:c.433G>A	14.37:g.57741320G>A	ENSP00000261558:p.Gly145Ser		O95354|Q6ZMD7|Q96DX3|Q9NVC5	Missense_Mutation	SNP	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pfscan_Clathrin_mu_C	p.G145S	ENST00000261558.3	37	c.433	CCDS9729.1	14	.	.	.	.	.	.	.	.	.	.	G	10.33	1.321450	0.23994	.	.	ENSG00000053770	ENST00000261558;ENST00000556995;ENST00000431972	T;T	0.29142	1.59;1.58	5.78	-2.83	0.05769	.	0.322791	0.41001	N	0.000964	T	0.10294	0.0252	N	0.12182	0.205	0.28333	N	0.921698	B;B	0.31193	0.0;0.312	B;B	0.31946	0.0;0.138	T	0.33828	-0.9853	10	0.07482	T	0.82	.	3.6611	0.08238	0.3952:0.0991:0.4053:0.1004	.	145;145	Q9H0R1;Q9H0R1-2	MUDEN_HUMAN;.	S	145;42;159	ENSP00000261558:G145S;ENSP00000390531:G159S	ENSP00000261558:G145S	G	+	1	0	MUDENG	56811073	0.349000	0.24870	0.010000	0.14722	0.879000	0.50718	0.639000	0.24690	-0.486000	0.06744	-0.282000	0.10007	GGT	AP5M1	-	NULL	ENSG00000053770		0.403	AP5M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP5M1	HGNC	protein_coding	OTTHUMT00000276922.1	-	0.00	36	0	G	NM_018229		57741320	+1	tier1	-	no_errors	ENST00000261558	ensembl	human	known	74_37	missense	42.22	26	19	SNP	0.052	A
APBA1	320	genome.wustl.edu	37	9	72091020	72091020	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:72091020A>C	ENST00000265381.4	-	3	1462	c.1240T>G	c.(1240-1242)Tca>Gca	p.S414A	RP11-470P21.2_ENST00000429567.2_RNA	NM_001163.3	NP_001154.2	Q02410	APBA1_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 1	414	LIN-2/CASK binding.|Pro-rich.				axon cargo transport (GO:0008088)|cell adhesion (GO:0007155)|gamma-aminobutyric acid secretion (GO:0014051)|glutamate secretion (GO:0014047)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein complex assembly (GO:0006461)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synaptic vesicle (GO:0008021)	beta-amyloid binding (GO:0001540)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(4)|kidney(2)|large_intestine(12)|lung(13)|prostate(3)|skin(3)	37						GTGCTTGATGACTCTGCACCC	0.522																																																	0													93.0	86.0	89.0					9																	72091020		2203	4300	6503	SO:0001583	missense	0			AF029106	CCDS6630.1	9q13-q21	2008-07-18	2008-07-18		ENSG00000107282	ENSG00000107282			578	protein-coding gene	gene with protein product		602414		MINT1		7678331, 7719031	Standard	NM_001163		Approved	D9S411E, X11	uc004ahh.2	Q02410	OTTHUMG00000019984	ENST00000265381.4:c.1240T>G	9.37:g.72091020A>C	ENSP00000265381:p.Ser414Ala		O14914|O60570|Q5VYR8	Missense_Mutation	SNP	pfam_PTB/PI_dom,pfam_PDZ,superfamily_PDZ,smart_PTB/PI_dom,smart_PDZ,pfscan_PDZ,pfscan_PTB/PI_dom	p.S414A	ENST00000265381.4	37	c.1240	CCDS6630.1	9	.	.	.	.	.	.	.	.	.	.	A	16.06	3.015204	0.54468	.	.	ENSG00000107282	ENST00000265381	T	0.04317	3.65	5.63	5.63	0.86233	.	0.066768	0.64402	D	0.000007	T	0.08846	0.0219	L	0.60455	1.87	0.51482	D	0.999926	P	0.46656	0.882	B	0.43701	0.428	T	0.33445	-0.9868	10	0.25106	T	0.35	.	15.841	0.78845	1.0:0.0:0.0:0.0	.	414	Q02410	APBA1_HUMAN	A	414	ENSP00000265381:S414A	ENSP00000265381:S414A	S	-	1	0	APBA1	71280840	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	7.060000	0.76692	2.146000	0.66826	0.459000	0.35465	TCA	APBA1	-	NULL	ENSG00000107282		0.522	APBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA1	HGNC	protein_coding	OTTHUMT00000052589.2	-	0.00	46	0	A	NM_001163		72091020	-1	tier1	-	no_errors	ENST00000265381	ensembl	human	known	74_37	missense	28.81	42	17	SNP	1.000	C
APOBEC1	339	genome.wustl.edu	37	12	7805406	7805406	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:7805406C>T	ENST00000229304.4	-	3	90	c.70G>A	c.(70-72)Gac>Aac	p.D24N		NM_001644.3	NP_001635.2	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1	24					cellular response to insulin stimulus (GO:0032869)|cytidine deamination (GO:0009972)|cytidine to uridine editing (GO:0016554)|defense response to virus (GO:0051607)|DNA demethylation (GO:0080111)|gene expression (GO:0010467)|lipid metabolic process (GO:0006629)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein transport (GO:0042953)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|mRNA stabilization (GO:0048255)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to osmotic stress (GO:0006970)|response to zinc ion (GO:0010043)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	AU-rich element binding (GO:0017091)|cytidine deaminase activity (GO:0004126)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			kidney(2)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|stomach(1)	17						TAGAAGACGTCAAACTCCCAG	0.478																																					Pancreas(135;929 1826 4531 10527 41012)												0													47.0	48.0	48.0					12																	7805406		2199	4297	6496	SO:0001583	missense	0			U72891	CCDS8579.1	12p13.1	2007-02-01			ENSG00000111701	ENSG00000111701		"""Apolipoprotein B mRNA editing enzymes"""	604	protein-coding gene	gene with protein product		600130					Standard	XM_005253355		Approved	BEDP, CDAR1, APOBEC-1, HEPR	uc001qtb.3	P41238	OTTHUMG00000141288	ENST00000229304.4:c.70G>A	12.37:g.7805406C>T	ENSP00000229304:p.Asp24Asn		Q9UE64|Q9UM71	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.D24N	ENST00000229304.4	37	c.70	CCDS8579.1	12	.	.	.	.	.	.	.	.	.	.	C	7.808	0.715099	0.15306	.	.	ENSG00000111701	ENST00000229304	T	0.62105	0.05	4.48	1.46	0.22682	APOBEC-like, N-terminal (1);	0.353786	0.24262	N	0.040077	T	0.35307	0.0927	N	0.14661	0.345	0.19575	N	0.999963	B	0.25007	0.116	B	0.24541	0.054	T	0.08472	-1.0720	10	0.25106	T	0.35	-3.2997	2.6725	0.05071	0.1931:0.5154:0.1872:0.1042	.	24	P41238	ABEC1_HUMAN	N	24	ENSP00000229304:D24N	ENSP00000229304:D24N	D	-	1	0	APOBEC1	7696673	0.048000	0.20356	0.473000	0.27253	0.005000	0.04900	0.131000	0.15870	0.406000	0.25560	-0.475000	0.04921	GAC	APOBEC1	-	pfam_APOBEC_N	ENSG00000111701		0.478	APOBEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC1	HGNC	protein_coding	OTTHUMT00000280523.1	-	0.00	37	0	C	NM_001644		7805406	-1	tier1	-	no_errors	ENST00000229304	ensembl	human	known	74_37	missense	21.84	67	19	SNP	0.385	T
APOBR	55911	genome.wustl.edu	37	16	28509621	28509621	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:28509621A>T	ENST00000431282.1	+	4	3158	c.3148A>T	c.(3148-3150)Agg>Tgg	p.R1050W	CLN3_ENST00000567160.1_5'Flank|APOBR_ENST00000328423.5_Intron|CLN3_ENST00000569430.1_5'Flank|APOBR_ENST00000564831.1_Missense_Mutation_p.R1059W			Q0VD83	APOBR_HUMAN	apolipoprotein B receptor	1050					cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	chylomicron (GO:0042627)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|prostate(1)|skin(2)|stomach(1)	29						AAGCCCTCTGAGGCATGATGG	0.687																																																	0													15.0	19.0	18.0					16																	28509621		1943	4144	6087	SO:0001583	missense	0			AK025123	CCDS58442.1	16p11.2	2011-02-14			ENSG00000184730	ENSG00000184730			24087	protein-coding gene	gene with protein product	"""apolipoprotein B48 receptor"", ""apolipoprotein B100 receptor"""	605220				10852956	Standard	NM_018690		Approved	APOB48R, APOB100R	uc002dqb.2	Q0VD83		ENST00000431282.1:c.3148A>T	16.37:g.28509621A>T	ENSP00000416094:p.Arg1050Trp		H3BU97|Q0VD81|Q8NC15|Q9NPJ9	Missense_Mutation	SNP	NULL	p.R1059W	ENST00000431282.1	37	c.3175		16	.	.	.	.	.	.	.	.	.	.	A	15.19	2.758593	0.49468	.	.	ENSG00000184730	ENST00000431282	T	0.61510	0.1	4.84	0.977	0.19733	.	.	.	.	.	T	0.55909	0.1950	L	0.27053	0.805	0.09310	N	1	D;D	0.71674	0.998;0.996	D;D	0.67103	0.949;0.925	T	0.41698	-0.9494	8	.	.	.	-4.6226	4.8502	0.13533	0.5222:0.3757:0.102:0.0	.	1050;1050	Q0VD83;Q9NS13	APOBR_HUMAN;.	W	1050	ENSP00000416094:R1050W	.	R	+	1	2	APOBR	28417122	0.006000	0.16342	0.007000	0.13788	0.404000	0.30871	0.603000	0.24149	0.196000	0.20367	0.375000	0.23000	AGG	APOBR	-	NULL	ENSG00000184730		0.687	APOBR-202	KNOWN	basic|appris_candidate	protein_coding	APOBR	HGNC	protein_coding			0.00	62	0	A	NM_182804		28509621	+1			no_errors	ENST00000564831	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.001	T
AQR	9716	genome.wustl.edu	37	15	35159753	35159753	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:35159753C>T	ENST00000156471.5	-	32	4051	c.3826G>A	c.(3826-3828)Gta>Ata	p.V1276I		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	1276					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		CTGGTTCGTACCAGAGAAAGA	0.348																																																	0													104.0	100.0	101.0					15																	35159753		1833	4080	5913	SO:0001583	missense	0			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.3826G>A	15.37:g.35159753C>T	ENSP00000156471:p.Val1276Ile		A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	superfamily_P-loop_NTPase	p.V1276I	ENST00000156471.5	37	c.3826	CCDS42013.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.494536	0.96339	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.96651	-4.08	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.98896	0.9626	H	0.97962	4.115	0.80722	D	1	D	0.57571	0.98	P	0.61328	0.887	D	0.98997	1.0810	10	0.87932	D	0	-21.3252	20.5827	0.99408	0.0:1.0:0.0:0.0	.	1276	O60306	AQR_HUMAN	I	1276	ENSP00000156471:V1276I	ENSP00000156471:V1276I	V	-	1	0	AQR	32947045	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.538000	0.82048	2.941000	0.99782	0.655000	0.94253	GTA	AQR	-	superfamily_P-loop_NTPase	ENSG00000021776		0.348	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQR	HGNC	protein_coding	OTTHUMT00000417526.2	-	0.00	64	0	C	NM_014691		35159753	-1	tier1	-	no_errors	ENST00000156471	ensembl	human	known	74_37	missense	18.10	95	21	SNP	1.000	T
AR	367	genome.wustl.edu	37	X	66765161	66765161	+	Missense_Mutation	SNP	A	A	T	rs200185441		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:66765161A>T	ENST00000374690.3	+	1	697	c.173A>T	c.(172-174)cAg>cTg	p.Q58L	AR_ENST00000504326.1_Missense_Mutation_p.Q58L|AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.Q58L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	58	Gln-rich.|Modulating.|Poly-Gln.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q58L(2)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTGCTGCTgcagcagcagcag	0.667									Androgen Insensitivity Syndrome																																								2	Substitution - Missense(2)	lung(1)|endometrium(1)	GRCh37	CM033749	AR	M	rs5902610						8.0	11.0	10.0					X																	66765161		2116	4153	6269	SO:0001583	missense	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.173A>T	X.37:g.66765161A>T	ENSP00000363822:p.Gln58Leu		A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt	p.Q58L	ENST00000374690.3	37	c.173	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	a	11.20	1.568808	0.28003	.	.	ENSG00000169083	ENST00000374690;ENST00000504326;ENST00000396044;ENST00000538891	T;T;T	0.69040	-0.37;-0.37;-0.37	.	.	.	.	0.157519	0.30235	N	0.010084	T	0.46541	0.1398	N	0.19112	0.55	0.09310	N	0.999999	B;B	0.34313	0.448;0.448	B;B	0.36534	0.227;0.227	T	0.39800	-0.9596	8	0.62326	D	0.03	.	.	.	.	.	58;58	E7EVX6;D3YPQ2	.;.	L	58	ENSP00000363822:Q58L;ENSP00000421155:Q58L;ENSP00000379359:Q58L	ENSP00000363822:Q58L	Q	+	2	0	AR	66681886	0.997000	0.39634	0.872000	0.34217	0.495000	0.33615	1.386000	0.34419	0.000000	0.14550	0.000000	0.15137	CAG	AR	-	pfam_Andrgn_rcpt	ENSG00000169083		0.667	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1		0.00	27	0	A	NM_000044		66765161	+1			no_errors	ENST00000374690	ensembl	human	known	74_37	missense	10.00	27	3	SNP	0.920	T
ASTN1	460	genome.wustl.edu	37	1	177030253	177030253	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:177030253C>T	ENST00000367654.3	-	2	643	c.432G>A	c.(430-432)tcG>tcA	p.S144S	ASTN1_ENST00000361833.2_Silent_p.S144S|ASTN1_ENST00000367657.3_Silent_p.S144S|ASTN1_ENST00000281881.3_5'UTR|ASTN1_ENST00000424564.2_Silent_p.S144S	NM_004319.1	NP_004310.1	O14525	ASTN1_HUMAN	astrotactin 1	144					locomotory behavior (GO:0007626)|neuron cell-cell adhesion (GO:0007158)|neuron migration (GO:0001764)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)				NS(4)|breast(5)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(23)|liver(1)|lung(81)|ovary(6)|prostate(5)|skin(10)|urinary_tract(3)	153						CCTCTTCTGCCGACTCATGTT	0.502																																																	0													229.0	213.0	218.0					1																	177030253		2203	4300	6503	SO:0001819	synonymous_variant	0			AB006627	CCDS1319.1, CCDS44280.1, CCDS65732.1	1q25.2	2008-02-05	2006-08-24	2006-08-24	ENSG00000152092	ENSG00000152092			773	protein-coding gene	gene with protein product		600904	"""astrotactin"""	ASTN		9070947	Standard	NM_001286164		Approved		uc001glc.3	O14525	OTTHUMG00000035041	ENST00000367654.3:c.432G>A	1.37:g.177030253C>T			A5PL12|B4DHI9|E9PFR8|O60799|Q5W0V7|Q5W0V8	Silent	SNP	superfamily_Fibronectin_type3,smart_EG-like_dom,smart_MACPF,pfscan_Fibronectin_type3	p.S144	ENST00000367654.3	37	c.432		1																																																																																			ASTN1	-	NULL	ENSG00000152092		0.502	ASTN1-201	KNOWN	basic	protein_coding	ASTN1	HGNC	protein_coding		-	0.00	57	0	C	NM_004319		177030253	-1	tier1	-	no_errors	ENST00000367654	ensembl	human	known	74_37	silent	76.39	17	55	SNP	0.002	T
ASXL3	80816	genome.wustl.edu	37	18	31319460	31319460	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr18:31319460T>G	ENST00000269197.5	+	11	2092	c.2092T>G	c.(2092-2094)Tta>Gta	p.L698V		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	698	Ser-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						TATGTCCAACTTACCATTAAC	0.368																																																	0													191.0	186.0	187.0					18																	31319460		1924	4132	6056	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2092T>G	18.37:g.31319460T>G	ENSP00000269197:p.Leu698Val		Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.L698V	ENST00000269197.5	37	c.2092	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	T	13.70	2.316398	0.40996	.	.	ENSG00000141431	ENST00000269197	T	0.18657	2.2	5.91	3.46	0.39613	.	0.606836	0.15625	N	0.252708	T	0.34250	0.0891	M	0.63843	1.955	0.25942	N	0.982857	D	0.76494	0.999	P	0.61070	0.883	T	0.13926	-1.0491	10	0.20046	T	0.44	.	8.7972	0.34887	0.0:0.206:0.0:0.794	.	698	Q9C0F0	ASXL3_HUMAN	V	698	ENSP00000269197:L698V	ENSP00000269197:L698V	L	+	1	2	ASXL3	29573458	0.997000	0.39634	0.589000	0.28718	0.841000	0.47740	1.517000	0.35867	0.461000	0.27071	0.377000	0.23210	TTA	ASXL3	-	NULL	ENSG00000141431		0.368	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	-	0.00	56	0	T			31319460	+1	tier1	-	no_errors	ENST00000269197	ensembl	human	known	74_37	missense	83.33	4	20	SNP	0.878	G
ATP6V1A	523	genome.wustl.edu	37	3	113517250	113517250	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:113517250A>T	ENST00000273398.3	+	12	1559	c.1451A>T	c.(1450-1452)cAg>cTg	p.Q484L	ATP6V1A_ENST00000538620.1_Missense_Mutation_p.Q451L	NM_001690.3	NP_001681.2	P38606	VATA_HUMAN	ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A	484					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)	ATP binding (GO:0005524)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34					Alendronate(DB00630)|Etidronic acid(DB01077)|Tiludronate(DB01133)	GAAATTCTGCAGGAAGAAGAA	0.438																																																	0													101.0	99.0	100.0					3																	113517250		2203	4300	6503	SO:0001583	missense	0			L09235	CCDS2976.1	3q13.31	2010-04-21	2002-08-29	2003-04-25	ENSG00000114573	ENSG00000114573	3.6.3.14	"""ATPases / V-type"""	851	protein-coding gene	gene with protein product		607027	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), alpha polypeptide, 70kD, isoform 1"""	VPP2, ATP6A1, ATP6V1A1		8463241	Standard	NM_001690		Approved	Vma1, VA68	uc003eao.3	P38606	OTTHUMG00000159295	ENST00000273398.3:c.1451A>T	3.37:g.113517250A>T	ENSP00000273398:p.Gln484Leu		B2RBR8|B7Z1R5|D3DN75|Q53YD9|Q96DY6|Q9UHY3	Missense_Mutation	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1_a/bsu_N,superfamily_P-loop_NTPase,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1_a/bsu_N,tigrfam_ATPase_V1-cplx_asu	p.Q484L	ENST00000273398.3	37	c.1451	CCDS2976.1	3	.	.	.	.	.	.	.	.	.	.	A	28.4	4.919452	0.92249	.	.	ENSG00000114573	ENST00000545842;ENST00000273398;ENST00000538620	T;T	0.78924	-1.22;-1.22	4.92	4.92	0.64577	ATPase, F1/V1/A1 complex, alpha/beta subunit, C-terminal (2);ATPase, F1 complex beta subunit/V1 complex, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.89181	0.6642	M	0.93420	3.415	0.80722	D	1	D	0.55800	0.973	P	0.58013	0.831	D	0.91950	0.5570	10	0.66056	D	0.02	-10.6285	14.8467	0.70264	1.0:0.0:0.0:0.0	.	484	P38606	VATA_HUMAN	L	201;484;451	ENSP00000273398:Q484L;ENSP00000439874:Q451L	ENSP00000273398:Q484L	Q	+	2	0	ATP6V1A	114999940	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.886000	0.92447	1.979000	0.57680	0.454000	0.30748	CAG	ATP6V1A	-	pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,tigrfam_ATPase_V1-cplx_asu	ENSG00000114573		0.438	ATP6V1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1A	HGNC	protein_coding	OTTHUMT00000354457.1	-	0.00	45	0	A	NM_001690		113517250	+1	tier1	-	no_errors	ENST00000273398	ensembl	human	known	74_37	missense	5.71	66	4	SNP	1.000	T
B9D1	27077	genome.wustl.edu	37	17	19251097	19251097	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr17:19251097C>T	ENST00000261499.4	-	4	484	c.341G>A	c.(340-342)cGg>cAg	p.R114Q	B9D1_ENST00000395615.1_Splice_Site_p.R114Q|B9D1_ENST00000461069.2_Splice_Site_p.R114Q|B9D1_ENST00000575403.1_Splice_Site_p.G90S|B9D1_ENST00000477478.2_Splice_Site_p.G90S|B9D1_ENST00000268841.6_Splice_Site_p.R114Q|B9D1_ENST00000395616.3_Splice_Site_p.R114Q	NM_015681.3	NP_056496.1	Q9UPM9	B9D1_HUMAN	B9 protein domain 1	114	B9. {ECO:0000255|PROSITE- ProRule:PRU00713}.				camera-type eye development (GO:0043010)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|in utero embryonic development (GO:0001701)|neuroepithelial cell differentiation (GO:0060563)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)|vasculature development (GO:0001944)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)	hedgehog receptor activity (GO:0008158)			large_intestine(3)|urinary_tract(1)	4	all_cancers(12;2.04e-05)|all_epithelial(12;0.000806)|Hepatocellular(7;0.00345)|Breast(13;0.143)					GAGGACCTACCGGCCAGGTGA	0.587																																																	0													81.0	55.0	64.0					17																	19251097		2203	4300	6503	SO:0001630	splice_region_variant	0			BC002944	CCDS11205.1, CCDS58528.1	17p11.2	2014-09-17			ENSG00000108641	ENSG00000108641			24123	protein-coding gene	gene with protein product	"""endothelial precursor protein B9"""	614144				21493627	Standard	NM_015681		Approved	B9, EPPB9, MKS9	uc010vyr.2	Q9UPM9	OTTHUMG00000059586	ENST00000261499.4:c.341+1G>A	17.37:g.19251097C>T			Q9BU22	Missense_Mutation	SNP	pfam_B9_dom	p.R114Q	ENST00000261499.4	37	c.341	CCDS11205.1	17	.	.	.	.	.	.	.	.	.	.	C	16.00	2.998423	0.54147	.	.	ENSG00000108641	ENST00000395615;ENST00000261499;ENST00000395616;ENST00000268841;ENST00000440841	T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4	5.43	5.43	0.79202	.	0.222293	0.45867	D	0.000324	T	0.50667	0.1629	L	0.29908	0.895	0.47819	D	0.999524	B	0.24823	0.112	B	0.18561	0.022	T	0.45673	-0.9245	9	.	.	.	.	10.2721	0.43489	0.0:0.9094:0.0:0.0906	.	114	Q9UPM9	B9D1_HUMAN	Q	114;114;114;114;105	ENSP00000378977:R114Q;ENSP00000261499:R114Q;ENSP00000378978:R114Q;ENSP00000268841:R114Q;ENSP00000410835:R105Q	.	R	-	2	0	B9D1	19191690	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.943000	0.56621	2.536000	0.85505	0.561000	0.74099	CGG	B9D1	-	pfam_B9_dom	ENSG00000108641		0.587	B9D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B9D1	HGNC	protein_coding	OTTHUMT00000132494.1	-	0.00	47	0	C	NM_015681	Missense_Mutation	19251097	-1	tier1	-	no_errors	ENST00000261499	ensembl	human	known	74_37	missense	7.69	48	4	SNP	1.000	T
BAGE2	85319	genome.wustl.edu	37	21	11049551	11049551	+	RNA	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr21:11049551A>G	ENST00000470054.1	-	0	557							Q86Y30	BAGE2_HUMAN	B melanoma antigen family, member 2							extracellular region (GO:0005576)								Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		GCTGACCACAAGTAGTACAAA	0.448																																																	0													95.0	60.0	71.0					21																	11049551		692	1580	2272			0			AF218570		21p	2009-03-13			ENSG00000187172	ENSG00000187172			15723	protein-coding gene	gene with protein product	"""cancer/testis antigen family 2, member 2"""					12461691	Standard	NM_182482		Approved	CT2.2		Q86Y30	OTTHUMG00000074128		21.37:g.11049551A>G			A8K925|Q08ER0	RNA	SNP	-	NULL	ENST00000470054.1	37	NULL		21																																																																																			BAGE2	-	-	ENSG00000187172		0.448	BAGE2-001	KNOWN	basic	processed_transcript	BAGE2	HGNC	pseudogene	OTTHUMT00000157417.3		0.00	83	0	A	NM_182482		11049551	-1			no_errors	ENST00000470054	ensembl	human	known	74_37	rna	9.62	94	10	SNP	1.000	G
BAI3	577	genome.wustl.edu	37	6	69665964	69665964	+	Missense_Mutation	SNP	C	C	A	rs200369422		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:69665964C>A	ENST00000370598.1	+	7	2065	c.1244C>A	c.(1243-1245)aCg>aAg	p.T415K		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	415	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TGCTCAGTAACGTGCTCGAAT	0.537																																																	0													100.0	88.0	92.0					6																	69665964		2203	4300	6503	SO:0001583	missense	0			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1244C>A	6.37:g.69665964C>A	ENSP00000359630:p.Thr415Lys		B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.T415K	ENST00000370598.1	37	c.1244	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	C	21.4	4.150182	0.78001	.	.	ENSG00000135298	ENST00000370598	T	0.70869	-0.52	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.83533	0.5275	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	D	0.84679	0.0716	10	0.72032	D	0.01	.	19.8472	0.96713	0.0:1.0:0.0:0.0	.	415	O60242	BAI3_HUMAN	K	415	ENSP00000359630:T415K	ENSP00000359630:T415K	T	+	2	0	BAI3	69722685	1.000000	0.71417	0.754000	0.31244	0.171000	0.22731	7.818000	0.86416	2.701000	0.92244	0.591000	0.81541	ACG	BAI3	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000135298		0.537	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	-	0.00	27	0	C			69665964	+1	tier1	-	no_errors	ENST00000370598	ensembl	human	known	74_37	missense	86.67	4	26	SNP	1.000	A
BAIAP2	10458	genome.wustl.edu	37	17	79059483	79059483	+	Silent	SNP	G	G	A	rs140205618	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr17:79059483G>A	ENST00000321300.6	+	5	402	c.309G>A	c.(307-309)acG>acA	p.T103T	BAIAP2_ENST00000575712.1_Silent_p.T103T|BAIAP2_ENST00000392411.3_Silent_p.T25T|BAIAP2_ENST00000435091.3_Silent_p.T103T|BAIAP2_ENST00000321280.7_Silent_p.T103T|BAIAP2_ENST00000575245.1_Silent_p.T136T|BAIAP2_ENST00000573894.1_3'UTR|BAIAP2_ENST00000428708.2_Silent_p.T103T	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2	103	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			AGCTGCTTACGCAGCTGGAGC	0.597																																																	0								A	,,,	2,4404	4.2+/-10.8	0,2,2201	86.0	75.0	79.0		309,309,309,309	-8.6	0.0	17	dbSNP_134	79	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	BAIAP2	NM_001144888.1,NM_006340.2,NM_017450.2,NM_017451.2	,,,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	,,,	103/535,103/521,103/522,103/553	79059483	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	0			AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.309G>A	17.37:g.79059483G>A			O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Silent	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.T103	ENST00000321300.6	37	c.309	CCDS11775.1	17																																																																																			BAIAP2	-	pfam_IRSp53/MIM_homology_IMD	ENSG00000175866		0.597	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	BAIAP2	HGNC	protein_coding	OTTHUMT00000438553.1		0.00	22	0	G			79059483	+1			no_errors	ENST00000321300	ensembl	human	known	74_37	silent	10.53	34	4	SNP	0.007	A
BAZ1B	9031	genome.wustl.edu	37	7	72892291	72892291	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:72892291G>T	ENST00000339594.4	-	7	1838	c.1500C>A	c.(1498-1500)tcC>tcA	p.S500S	BAZ1B_ENST00000404251.1_Silent_p.S500S	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	500	Lys-rich.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				GAGCTGTTTTGGAGATAACAC	0.453																																					Esophageal Squamous(112;1167 1561 21085 43672 48228)												0													105.0	106.0	106.0					7																	72892291		2203	4300	6503	SO:0001819	synonymous_variant	0			AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.1500C>A	7.37:g.72892291G>T			B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Silent	SNP	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.S500	ENST00000339594.4	37	c.1500	CCDS5549.1	7																																																																																			BAZ1B	-	superfamily_ARM-type_fold	ENSG00000009954		0.453	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1B	HGNC	protein_coding	OTTHUMT00000252123.4		0.00	23	0	G	NM_032408		72892291	-1			no_errors	ENST00000339594	ensembl	human	known	74_37	silent	10.71	25	3	SNP	1.000	T
BCAS3	54828	genome.wustl.edu	37	17	59465981	59465981	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr17:59465981delA	ENST00000589222.1	+	25	2730	c.2662delA	c.(2662-2664)aaafs	p.K890fs	BCAS3_ENST00000585744.1_Intron|BCAS3_ENST00000585812.1_Intron|BCAS3_ENST00000407086.3_Intron|RP11-332H18.5_ENST00000585765.1_RNA|BCAS3_ENST00000408905.3_Intron|BCAS3_ENST00000390652.5_Intron|BCAS3_ENST00000588874.1_Intron|BCAS3_ENST00000588462.1_Intron					breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			TTCAAAAGGGAAAAAAAAAGG	0.443																																																	0													6.0	5.0	5.0					17																	59465981		836	1922	2758	SO:0001589	frameshift_variant	0			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000589222.1:c.2662delA	17.37:g.59465981delA	ENSP00000466078:p.Lys890fs			Frame_Shift_Del	DEL	pfam_BCAS3,pfam_WD40_repeat	p.G891fs	ENST00000589222.1	37	c.2662		17																																																																																			BCAS3	-	NULL	ENSG00000141376		0.443	BCAS3-004	KNOWN	basic	protein_coding	BCAS3	HGNC	protein_coding	OTTHUMT00000449571.1		0.00	54	0	A	NM_017679		59465981	+1	tier1		no_errors	ENST00000589222	ensembl	human	known	74_37	frame_shift_del	22.08	60	17	DEL	1.000	-
BCL6	604	genome.wustl.edu	37	3	187447231	187447231	+	Missense_Mutation	SNP	G	G	A	rs377059215		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:187447231G>A	ENST00000406870.2	-	5	1328	c.962C>T	c.(961-963)gCa>gTa	p.A321V	RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000450123.2_Missense_Mutation_p.A321V|RP11-211G3.3_ENST00000437407.1_Intron|BCL6_ENST00000232014.4_Missense_Mutation_p.A321V	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	321					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		GTTCAGGGGTGCATTGGGGGG	0.577			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																			Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	0								G	VAL/ALA,VAL/ALA,VAL/ALA	0,4406		0,0,2203	86.0	101.0	96.0		962,962,962	5.5	1.0	3		96	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense	BCL6	NM_001130845.1,NM_001134738.1,NM_001706.4	64,64,64	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	321/707,321/651,321/707	187447231	1,13005	2203	4300	6503	SO:0001583	missense	0				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.962C>T	3.37:g.187447231G>A	ENSP00000384371:p.Ala321Val		A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.A321V	ENST00000406870.2	37	c.962	CCDS3289.1	3	.	.	.	.	.	.	.	.	.	.	G	14.78	2.638326	0.47153	0.0	1.16E-4	ENSG00000113916	ENST00000406870;ENST00000232014;ENST00000450123	T;T;T	0.08193	3.12;3.12;3.13	5.48	5.48	0.80851	.	0.097709	0.64402	D	0.000001	T	0.07188	0.0182	N	0.22421	0.69	0.37546	D	0.918492	B;P	0.35745	0.437;0.518	B;B	0.27380	0.037;0.079	T	0.30851	-0.9964	10	0.51188	T	0.08	.	18.7147	0.91671	0.0:0.0:1.0:0.0	.	321;321	B8PSA7;P41182	.;BCL6_HUMAN	V	321	ENSP00000384371:A321V;ENSP00000232014:A321V;ENSP00000413122:A321V	ENSP00000232014:A321V	A	-	2	0	BCL6	188929925	1.000000	0.71417	0.978000	0.43139	0.977000	0.68977	7.051000	0.76627	2.747000	0.94245	0.462000	0.41574	GCA	BCL6	-	NULL	ENSG00000113916		0.577	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6	HGNC	protein_coding	OTTHUMT00000344202.1		0.00	35	0	G	NM_138931		187447231	-1			no_errors	ENST00000232014	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.989	A
BCR	613	genome.wustl.edu	37	22	23523281	23523281	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr22:23523281T>A	ENST00000305877.8	+	1	885	c.134T>A	c.(133-135)cTg>cAg	p.L45Q	BCR_ENST00000359540.3_Missense_Mutation_p.L45Q|BCR_ENST00000398512.5_Missense_Mutation_p.L45Q	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	45	Kinase.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	ATTCGGCGCCTGGAGCAGGAG	0.642			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0													20.0	22.0	21.0					22																	23523281		2196	4292	6488	SO:0001583	missense	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.134T>A	22.37:g.23523281T>A	ENSP00000303507:p.Leu45Gln		P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Bcr-Abl_oncoprot_oligo,pfam_DH-domain,pfam_C2_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_Bcr-Abl_oncoprot_oligo,superfamily_C2_dom,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_dom,smart_RhoGAP_dom,pfscan_C2_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.L45Q	ENST00000305877.8	37	c.134	CCDS13806.1	22	.	.	.	.	.	.	.	.	.	.	T	23.5	4.424042	0.83667	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000398512;ENST00000290956;ENST00000292697;ENST00000420248	T;T;T	0.66638	0.35;0.35;-0.22	3.84	3.84	0.44239	Bcr-Abl oncoprotein oligomerisation (2);	0.000000	0.53938	U	0.000054	T	0.72787	0.3504	L	0.36672	1.1	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.997;0.998	T	0.75628	-0.3252	10	0.87932	D	0	.	12.1306	0.53940	0.0:0.0:0.0:1.0	.	45;45	P11274-2;P11274	.;BCR_HUMAN	Q	45	ENSP00000303507:L45Q;ENSP00000352535:L45Q;ENSP00000381524:L45Q	ENSP00000290956:L45Q	L	+	2	0	BCR	21853281	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.475000	0.73582	1.527000	0.49086	0.254000	0.18369	CTG	BCR	-	pfam_Bcr-Abl_oncoprot_oligo,superfamily_Bcr-Abl_oncoprot_oligo	ENSG00000186716		0.642	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1		0.00	50	0	T	NM_004327		23523281	+1			no_errors	ENST00000305877	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	A
BEND2	139105	genome.wustl.edu	37	X	18220001	18220001	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:18220001T>C	ENST00000380033.4	-	6	1099	c.967A>G	c.(967-969)Act>Gct	p.T323A	BEND2_ENST00000380030.3_Intron	NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	323										NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						CCCATTAAAGTTGGATAATTC	0.378																																																	0													246.0	199.0	215.0					X																	18220001		2203	4300	6503	SO:0001583	missense	0			AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.967A>G	X.37:g.18220001T>C	ENSP00000369372:p.Thr323Ala		E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	pfam_BEN_domain	p.T323A	ENST00000380033.4	37	c.967	CCDS14184.1	X	.	.	.	.	.	.	.	.	.	.	-	10.10	1.258431	0.23051	.	.	ENSG00000177324	ENST00000380033	T	0.25912	1.77	2.96	-1.21	0.09524	.	.	.	.	.	T	0.10078	0.0247	N	0.11560	0.145	0.09310	N	1	P	0.51791	0.948	B	0.43783	0.431	T	0.10870	-1.0611	9	0.07175	T	0.84	.	3.8705	0.09035	0.0:0.1425:0.4513:0.4062	.	323	Q8NDZ0	BEND2_HUMAN	A	323	ENSP00000369372:T323A	ENSP00000369372:T323A	T	-	1	0	BEND2	18129922	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-3.266000	0.00534	-0.337000	0.08426	0.336000	0.21669	ACT	BEND2	-	NULL	ENSG00000177324		0.378	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND2	HGNC	protein_coding	OTTHUMT00000055940.1	-	0.00	48	0	T	NM_153346		18220001	-1	tier1	-	no_errors	ENST00000380033	ensembl	human	known	74_37	missense	55.00	27	33	SNP	0.000	C
BMP5	653	genome.wustl.edu	37	6	55739327	55739327	+	Silent	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:55739327T>G	ENST00000370830.3	-	1	1035	c.337A>C	c.(337-339)Aga>Cga	p.R113R	BMP5_ENST00000446683.2_Silent_p.R113R	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	113					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			TATCCCTTTCTTGCCCCTCTG	0.522																																																	0													135.0	117.0	123.0					6																	55739327		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.337A>C	6.37:g.55739327T>G			B4E0Y4|Q9H547|Q9NTM5	Silent	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.R113	ENST00000370830.3	37	c.337	CCDS4958.1	6																																																																																			BMP5	-	pfam_TGF-b_N	ENSG00000112175		0.522	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP5	HGNC	protein_coding	OTTHUMT00000041000.1	-	0.00	64	0	T			55739327	-1	tier1	-	no_errors	ENST00000370830	ensembl	human	known	74_37	silent	32.56	29	14	SNP	0.881	G
BTBD11	121551	genome.wustl.edu	37	12	108029076	108029076	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:108029076C>T	ENST00000280758.5	+	12	3174	c.2646C>T	c.(2644-2646)agC>agT	p.S882S	BTBD11_ENST00000357167.4_Silent_p.S419S|BTBD11_ENST00000490090.2_Silent_p.S882S|BTBD11_ENST00000420571.2_Silent_p.S763S|BTBD11_ENST00000494235.2_5'UTR	NM_001018072.1	NP_001018082.1	A6QL63	BTBDB_HUMAN	BTB (POZ) domain containing 11	882						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(18)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						AAGTGATCAGCCAGCAGCTGT	0.562																																																	0													144.0	130.0	134.0					12																	108029076		2203	4300	6503	SO:0001819	synonymous_variant	0			AK091276	CCDS31893.1, CCDS41827.1	12q24.11	2013-10-02			ENSG00000151136	ENSG00000151136		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	23844	protein-coding gene	gene with protein product							Standard	XM_005268645		Approved	FLJ33957, ABTB2B	uc001tmk.1	A6QL63	OTTHUMG00000150413	ENST00000280758.5:c.2646C>T	12.37:g.108029076C>T			A4FU41|B3KXG3|C9J019|C9JK80|E9PHS4|Q3ZTQ4|Q52M89|Q6ZV99|Q8N245	Silent	SNP	pfam_Ankyrin_rpt,pfam_BTB_POZ,superfamily_BTB/POZ_fold,superfamily_Ankyrin_rpt-contain_dom,superfamily_Histone-fold,smart_Ankyrin_rpt,smart_BTB/POZ-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_BTB/POZ-like	p.S882	ENST00000280758.5	37	c.2646	CCDS31893.1	12																																																																																			BTBD11	-	NULL	ENSG00000151136		0.562	BTBD11-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTBD11	HGNC	protein_coding	OTTHUMT00000318003.1	-	0.00	34	0	C	NM_152322		108029076	+1	tier1	-	no_errors	ENST00000280758	ensembl	human	known	74_37	silent	7.84	47	4	SNP	1.000	T
BTN2A1	11120	genome.wustl.edu	37	6	26463595	26463595	+	Frame_Shift_Del	DEL	T	T	-			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:26463595delT	ENST00000312541.5	+	4	802	c.554delT	c.(553-555)gttfs	p.V185fs	BTN2A1_ENST00000429381.1_Frame_Shift_Del_p.V185fs|BTN2A1_ENST00000469185.1_Frame_Shift_Del_p.V185fs|BTN2A1_ENST00000541522.1_Frame_Shift_Del_p.V124fs	NM_007049.3|NM_078476.2	NP_008980.1|NP_510961.1	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1	185					lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(3)	27						TACGGTGGGGTTGCGCCTGCC	0.587																																																	0													92.0	83.0	86.0					6																	26463595		2203	4300	6503	SO:0001589	frameshift_variant	0			U90543	CCDS4613.1, CCDS47390.1, CCDS56404.1, CCDS56405.1	6p22.1	2014-01-14			ENSG00000112763	ENSG00000112763		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1136	protein-coding gene	gene with protein product		613590				9382921, 9149941	Standard	NM_007049		Approved	BT2.1, BTF1, BTN2.1	uc003nib.2	Q7KYR7	OTTHUMG00000014457	ENST00000312541.5:c.554delT	6.37:g.26463595delT	ENSP00000312158:p.Val185fs		B4DLP9|E9PGR4|O00475|P78408|Q59EN4|Q7KYQ7|Q7Z386|Q96AV7|Q9NU62	Frame_Shift_Del	DEL	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl_sf,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like_dom	p.A186fs	ENST00000312541.5	37	c.554	CCDS4613.1	6																																																																																			BTN2A1	-	pfam_CD80_C2-set	ENSG00000112763		0.587	BTN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN2A1	HGNC	protein_coding	OTTHUMT00000040122.2		0.00	68	0	T	NM_007049		26463595	+1	tier1		no_errors	ENST00000312541	ensembl	human	known	74_37	frame_shift_del	36.84	48	28	DEL	0.000	-
BZRAP1	9256	genome.wustl.edu	37	17	56405068	56405068	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr17:56405068C>T	ENST00000343736.4	-	1	377	c.214G>A	c.(214-216)Gtg>Atg	p.V72M	BZRAP1-AS1_ENST00000579527.1_RNA|BZRAP1-AS1_ENST00000578334.1_RNA|BZRAP1_ENST00000268893.6_Missense_Mutation_p.V72M|BZRAP1-AS1_ENST00000580515.1_RNA|BZRAP1-AS1_ENST00000580633.1_RNA|BZRAP1_ENST00000355701.3_Missense_Mutation_p.V72M			O95153	RIMB1_HUMAN	benzodiazepine receptor (peripheral) associated protein 1	72						cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	benzodiazepine receptor binding (GO:0030156)			cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GTTCCCCCCACGGGCCTGGAG	0.627																																																	0													61.0	56.0	57.0					17																	56405068		2203	4300	6503	SO:0001583	missense	0			AB014512	CCDS11605.1, CCDS45742.1	17q22-q23	2014-01-09	2014-01-09						16831	protein-coding gene	gene with protein product		610764				9734811, 9915832	Standard	NM_004758		Approved	PRAX-1, KIAA0612, RIM-BP1, RIMBP1	uc002ivx.5	O95153		ENST00000343736.4:c.214G>A	17.37:g.56405068C>T	ENSP00000345824:p.Val72Met		O75111|Q8N5W3	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain	p.V72M	ENST00000343736.4	37	c.214	CCDS11605.1	17	.	.	.	.	.	.	.	.	.	.	C	9.529	1.110332	0.20714	.	.	ENSG00000005379	ENST00000355701;ENST00000343736;ENST00000268893	T;T;T	0.05382	3.51;3.51;3.45	4.97	-9.14	0.00701	.	2.108670	0.01990	N	0.045441	T	0.06645	0.0170	L	0.44542	1.39	0.09310	N	1	B;B;B	0.18610	0.007;0.029;0.017	B;B;B	0.16722	0.003;0.016;0.004	T	0.15435	-1.0437	10	0.46703	T	0.11	.	10.8599	0.46821	0.0:0.3671:0.0881:0.5448	.	72;72;72	B7ZVZ7;O95153-2;O95153	.;.;RIMB1_HUMAN	M	72	ENSP00000347929:V72M;ENSP00000345824:V72M;ENSP00000268893:V72M	ENSP00000268893:V72M	V	-	1	0	BZRAP1	53760067	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.720000	0.01871	-2.321000	0.00641	-1.587000	0.00848	GTG	BZRAP1	-	NULL	ENSG00000005379		0.627	BZRAP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	BZRAP1	HGNC	protein_coding	OTTHUMT00000443980.1	-	0.00	75	0	C	NM_004758		56405068	-1	tier1	-	no_errors	ENST00000355701	ensembl	human	known	74_37	missense	17.31	86	18	SNP	0.000	T
BZW2	28969	genome.wustl.edu	37	7	16722452	16722452	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:16722452T>A	ENST00000433922.2	+	5	565	c.387T>A	c.(385-387)ttT>ttA	p.F129L	BZW2_ENST00000405202.1_Missense_Mutation_p.F53L|BZW2_ENST00000432311.1_3'UTR|BZW2_ENST00000258761.3_Missense_Mutation_p.F129L|BZW2_ENST00000452975.2_Missense_Mutation_p.F129L	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2	129					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		AGAAGGCATTTGAAGATGAAA	0.313																																																	0													47.0	50.0	49.0					7																	16722452		2202	4298	6500	SO:0001583	missense	0			AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.387T>A	7.37:g.16722452T>A	ENSP00000397249:p.Phe129Leu		A4D123|Q3B779|Q96JW5|Q9H3F7	Missense_Mutation	SNP	pfam_W2_domain,superfamily_ARM-type_fold,smart_W2_domain	p.F129L	ENST00000433922.2	37	c.387	CCDS5362.1	7	.	.	.	.	.	.	.	.	.	.	T	10.01	1.234675	0.22626	.	.	ENSG00000136261	ENST00000415365;ENST00000258761;ENST00000433922;ENST00000452975;ENST00000405202;ENST00000446596;ENST00000438834;ENST00000430000	T;T;T;T;T;T;T;T	0.58797	0.31;0.31;0.31;0.31;0.31;0.31;0.31;0.31	5.62	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.39655	0.1086	L	0.31120	0.905	0.54753	D	0.999988	B;B;B	0.14012	0.001;0.009;0.001	B;B;B	0.15484	0.001;0.013;0.001	T	0.22452	-1.0216	10	0.02654	T	1	-11.5867	11.4004	0.49866	0.0:0.0707:0.0:0.9293	.	129;129;129	E7ETZ4;Q96JW5;Q9Y6E2	.;.;BZW2_HUMAN	L	129;129;129;129;53;129;129;129	ENSP00000403481:F129L;ENSP00000258761:F129L;ENSP00000397249:F129L;ENSP00000411715:F129L;ENSP00000385577:F53L;ENSP00000412750:F129L;ENSP00000415924:F129L;ENSP00000416531:F129L	ENSP00000258761:F129L	F	+	3	2	BZW2	16688977	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.602000	0.46257	0.972000	0.38314	0.528000	0.53228	TTT	BZW2	-	NULL	ENSG00000136261		0.313	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BZW2	HGNC	protein_coding	OTTHUMT00000253256.2	-	0.00	56	0	T	NM_014038		16722452	+1	tier1	-	no_errors	ENST00000258761	ensembl	human	known	74_37	missense	29.70	71	30	SNP	1.000	A
C11orf49	79096	genome.wustl.edu	37	11	47178706	47178706	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:47178706A>T	ENST00000278460.7	+	6	643	c.584A>T	c.(583-585)gAg>gTg	p.E195V	C11orf49_ENST00000536126.1_Missense_Mutation_p.E98V|C11orf49_ENST00000527268.1_3'UTR|C11orf49_ENST00000378618.2_Missense_Mutation_p.E195V|C11orf49_ENST00000395460.2_Missense_Mutation_p.E195V|C11orf49_ENST00000378615.3_Missense_Mutation_p.E195V|C11orf49_ENST00000543718.1_Missense_Mutation_p.E111V	NM_001003677.1|NM_024113.3	NP_001003677.1|NP_077018.1	Q9H6J7	CK049_HUMAN	chromosome 11 open reading frame 49	195						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(1)	11						GGCACGCTGGAGGGCGTGGAG	0.652																																																	0													56.0	52.0	53.0					11																	47178706		2201	4298	6499	SO:0001583	missense	0			AL136575	CCDS7925.1, CCDS31479.1, CCDS31480.1, CCDS41641.1	11p11.2	2006-02-02			ENSG00000149179	ENSG00000149179			28720	protein-coding gene	gene with protein product							Standard	NM_001003677		Approved	FLJ22210, MGC4707	uc001ndr.4	Q9H6J7	OTTHUMG00000166725	ENST00000278460.7:c.584A>T	11.37:g.47178706A>T	ENSP00000278460:p.Glu195Val		D3DQQ8|E9PAX7|Q7L077|Q96CS8|Q9BQH4|Q9BUW5	Missense_Mutation	SNP	NULL	p.E195V	ENST00000278460.7	37	c.584	CCDS7925.1	11	.	.	.	.	.	.	.	.	.	.	A	23.5	4.418709	0.83559	.	.	ENSG00000149179	ENST00000536126;ENST00000278460;ENST00000378618;ENST00000395460;ENST00000378615;ENST00000543718;ENST00000526827	T;T;T;T;T;T;T	0.19394	2.15;2.15;2.15;2.15;2.15;2.15;2.15	5.2	5.2	0.72013	.	0.206597	0.49916	D	0.000130	T	0.34106	0.0886	M	0.63843	1.955	0.45502	D	0.998469	D;D;P;B;P	0.53885	0.963;0.963;0.874;0.226;0.693	P;P;P;B;B	0.50754	0.649;0.649;0.466;0.246;0.431	T	0.12319	-1.0552	10	0.72032	D	0.01	-11.4594	15.2382	0.73447	1.0:0.0:0.0:0.0	.	111;111;195;195;195	F5H6E0;B4DEG1;E9PAX7;Q9H6J7-2;Q9H6J7	.;.;.;.;CK049_HUMAN	V	98;195;195;195;195;111;121	ENSP00000438207:E98V;ENSP00000278460:E195V;ENSP00000367881:E195V;ENSP00000378844:E195V;ENSP00000367878:E195V;ENSP00000437689:E111V;ENSP00000433707:E121V	ENSP00000278460:E195V	E	+	2	0	C11orf49	47135282	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	8.209000	0.89751	2.194000	0.70268	0.533000	0.62120	GAG	C11orf49	-	NULL	ENSG00000149179		0.652	C11orf49-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf49	HGNC	protein_coding	OTTHUMT00000391218.1	-	0.00	69	0	A	NM_024113		47178706	+1	tier1	-	no_errors	ENST00000378615	ensembl	human	known	74_37	missense	53.52	33	38	SNP	1.000	T
CCDC184	387856	genome.wustl.edu	37	12	48577990	48577990	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:48577990G>A	ENST00000316554.3	+	1	625	c.85G>A	c.(85-87)Ggg>Agg	p.G29R		NM_001013635.3	NP_001013657.3	Q52MB2	CC184_HUMAN		29						cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)	4						GCCGGCAGTGGGGGACGTGAT	0.637																																																	0													49.0	59.0	56.0					12																	48577990		2203	4300	6503	SO:0001583	missense	0																														ENST00000316554.3:c.85G>A	12.37:g.48577990G>A	ENSP00000320849:p.Gly29Arg		Q96MK5|Q96N39	Missense_Mutation	SNP	NULL	p.G29R	ENST00000316554.3	37	c.85	CCDS31785.1	12	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081883	0.36758	.	.	ENSG00000177875	ENST00000316554	T	0.61627	0.09	4.97	4.97	0.65823	.	0.000000	0.52532	D	0.000068	T	0.53948	0.1828	N	0.08118	0	0.36663	D	0.878076	P	0.48998	0.918	P	0.59825	0.864	T	0.66830	-0.5824	10	0.87932	D	0	-25.7111	13.5964	0.61994	0.0:0.0:1.0:0.0	.	29	Q52MB2	CL068_HUMAN	R	29	ENSP00000320849:G29R	ENSP00000320849:G29R	G	+	1	0	C12orf68	46864257	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	4.341000	0.59335	2.568000	0.86640	0.650000	0.86243	GGG	C12orf68	-	NULL	ENSG00000177875		0.637	C12orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf68	HGNC	protein_coding	OTTHUMT00000406514.1	-	0.00	67	0	G			48577990	+1	tier1	-	no_errors	ENST00000316554	ensembl	human	known	74_37	missense	29.00	71	29	SNP	1.000	A
CIART	148523	genome.wustl.edu	37	1	150255816	150255816	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:150255816G>A	ENST00000290363.5	+	1	588	c.139G>A	c.(139-141)Gac>Aac	p.D47N	C1orf51_ENST00000469255.1_3'UTR|C1orf51_ENST00000369094.1_Intron|C1orf51_ENST00000369095.1_Missense_Mutation_p.D47N	NM_144697.2	NP_653298.1	Q8N365	CIART_HUMAN		47					circadian regulation of gene expression (GO:0032922)|locomotor rhythm (GO:0045475)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|E-box binding (GO:0070888)			endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCCCAGGCCAGACACTGTTGG	0.597																																																	0													108.0	111.0	110.0					1																	150255816		2203	4300	6503	SO:0001583	missense	0																														ENST00000290363.5:c.139G>A	1.37:g.150255816G>A	ENSP00000290363:p.Asp47Asn		B2RD43|D3DV01|Q8N795|Q96MG6	Missense_Mutation	SNP	NULL	p.D47N	ENST00000290363.5	37	c.139	CCDS949.1	1	.	.	.	.	.	.	.	.	.	.	G	14.35	2.510431	0.44660	.	.	ENSG00000159208	ENST00000369095;ENST00000290363	.	.	.	4.7	3.79	0.43588	.	0.621203	0.16946	N	0.193116	T	0.27697	0.0681	L	0.51422	1.61	0.31053	N	0.71497	B	0.14438	0.01	B	0.15052	0.012	T	0.22138	-1.0225	9	0.62326	D	0.03	3.2911	8.6867	0.34243	0.1026:0.0:0.8974:0.0	.	47	Q8N365	CA051_HUMAN	N	47	.	ENSP00000290363:D47N	D	+	1	0	C1orf51	148522440	0.106000	0.21978	0.984000	0.44739	0.945000	0.59286	1.826000	0.39092	1.205000	0.43262	-0.140000	0.14226	GAC	C1orf51	-	NULL	ENSG00000159208		0.597	C1orf51-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1orf51	HGNC	protein_coding	OTTHUMT00000035058.1	-	0.00	43	0	G			150255816	+1	tier1	-	no_errors	ENST00000290363	ensembl	human	known	74_37	missense	50.00	34	34	SNP	0.986	A
C3orf67	200844	genome.wustl.edu	37	3	58856003	58856003	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:58856003G>A	ENST00000482387.1	-	4	469	c.373C>T	c.(373-375)Cgg>Tgg	p.R125W	RP11-147N17.1_ENST00000493123.1_RNA|RP11-147N17.1_ENST00000492031.1_RNA|RP11-147N17.1_ENST00000463703.1_RNA|C3orf67_ENST00000295966.7_Missense_Mutation_p.R125W|C3orf67_ENST00000472469.1_Missense_Mutation_p.R45W|RP11-147N17.1_ENST00000482372.1_RNA			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67	125										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		TTACTGTTCCGTGTAATACTT	0.378																																																	0													226.0	185.0	199.0					3																	58856003		2203	4300	6503	SO:0001583	missense	0			AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.373C>T	3.37:g.58856003G>A	ENSP00000417122:p.Arg125Trp		B9EKV6|Q6ZV69	Missense_Mutation	SNP	NULL	p.R125W	ENST00000482387.1	37	c.373		3	.	.	.	.	.	.	.	.	.	.	G	11.05	1.525033	0.27299	.	.	ENSG00000163689	ENST00000295966;ENST00000482387;ENST00000472469	T;T;T	0.51325	0.71;0.71;0.71	5.98	0.81	0.18732	.	0.469271	0.20788	N	0.085667	T	0.32882	0.0844	L	0.51422	1.61	0.09310	N	0.999998	B;B	0.34255	0.445;0.054	B;B	0.25140	0.058;0.017	T	0.21245	-1.0251	10	0.59425	D	0.04	-6.3094	5.7781	0.18292	0.19:0.0:0.2587:0.5512	.	45;125	C9J3M8;Q6ZVT6-2	.;.	W	125;125;45	ENSP00000295966:R125W;ENSP00000417122:R125W;ENSP00000417271:R45W	ENSP00000295966:R125W	R	-	1	2	C3orf67	58831043	0.000000	0.05858	0.002000	0.10522	0.058000	0.15608	0.463000	0.21972	0.394000	0.25230	-0.293000	0.09583	CGG	C3orf67	-	NULL	ENSG00000163689		0.378	C3orf67-003	KNOWN	basic	protein_coding	C3orf67	HGNC	protein_coding	OTTHUMT00000353803.1	-	0.00	84	0	G	NM_198463		58856003	-1	tier1	-	no_errors	ENST00000482387	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.000	A
C3orf52	79669	genome.wustl.edu	37	3	111831885	111831885	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:111831885T>G	ENST00000264848.5	+	5	601	c.542T>G	c.(541-543)aTg>aGg	p.M181R	C3orf52_ENST00000431717.2_Intron|C3orf52_ENST00000467942.2_3'UTR|C3orf52_ENST00000430855.1_Intron|MIR567_ENST00000385205.1_RNA	NM_024616.2	NP_078892	Q5BVD1	TTMP_HUMAN	chromosome 3 open reading frame 52	181						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						ATGAAGTATATGATGAGTGAG	0.423																																																	0													135.0	127.0	130.0					3																	111831885		1977	4171	6148	SO:0001583	missense	0			AY830714	CCDS46887.1, CCDS54620.1	3q13.2	2006-01-30			ENSG00000114529	ENSG00000114529			26255	protein-coding gene	gene with protein product	"""TPA induced trans-membrane protein"""	611956				15737651	Standard	NM_024616		Approved	FLJ23186, TTMP	uc011bhs.2	Q5BVD1	OTTHUMG00000159230	ENST00000264848.5:c.542T>G	3.37:g.111831885T>G	ENSP00000264848:p.Met181Arg		B4DNV2|B4E0Z2|Q96AJ4|Q9H5Q1	Missense_Mutation	SNP	NULL	p.M181R	ENST00000264848.5	37	c.542	CCDS46887.1	3	.	.	.	.	.	.	.	.	.	.	T	21.3	4.128565	0.77549	.	.	ENSG00000114529	ENST00000264848	T	0.23754	1.89	5.83	5.83	0.93111	.	0.161726	0.53938	D	0.000045	T	0.33614	0.0869	M	0.64997	1.995	0.80722	D	1	D	0.53151	0.958	P	0.51229	0.663	T	0.11665	-1.0578	10	0.10377	T	0.69	.	12.6059	0.56523	0.0:0.0:0.0:1.0	.	181	Q5BVD1	TTMP_HUMAN	R	181	ENSP00000264848:M181R	ENSP00000264848:M181R	M	+	2	0	C3orf52	113314575	0.998000	0.40836	0.986000	0.45419	0.947000	0.59692	0.536000	0.23129	2.224000	0.72417	0.528000	0.53228	ATG	C3orf52	-	NULL	ENSG00000114529		0.423	C3orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf52	HGNC	protein_coding	OTTHUMT00000353961.1	-	0.00	42	0	T	NM_024616		111831885	+1	tier1	-	no_errors	ENST00000264848	ensembl	human	known	74_37	missense	23.29	56	17	SNP	0.994	G
C9orf131	138724	genome.wustl.edu	37	9	35043395	35043395	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:35043395G>T	ENST00000312292.5	+	2	816	c.769G>T	c.(769-771)Gcc>Tcc	p.A257S	C9orf131_ENST00000421362.2_Missense_Mutation_p.A209S|C9orf131_ENST00000354479.5_Missense_Mutation_p.A184S|FLJ00273_ENST00000595331.1_5'Flank	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	257										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			TACCCATGGGGCCCATACTAT	0.517																																																	0													143.0	133.0	136.0					9																	35043395		2203	4300	6503	SO:0001583	missense	0			BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.769G>T	9.37:g.35043395G>T	ENSP00000308279:p.Ala257Ser		A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	NULL	p.A257S	ENST00000312292.5	37	c.769	CCDS6572.2	9	.	.	.	.	.	.	.	.	.	.	G	17.21	3.332846	0.60853	.	.	ENSG00000174038	ENST00000421362;ENST00000354479;ENST00000312292;ENST00000378745	T;T;T;T	0.35789	2.24;2.23;2.25;1.29	4.95	2.88	0.33553	.	1.016850	0.07898	N	0.972111	T	0.40297	0.1111	L	0.55481	1.735	0.09310	N	1	P;P;P	0.50819	0.939;0.939;0.939	B;P;P	0.48627	0.445;0.584;0.584	T	0.28744	-1.0034	10	0.72032	D	0.01	-0.2094	5.6979	0.17865	0.2601:0.0:0.7399:0.0	.	257;184;209	Q5VYM1;A6NLE6;E9PB26	CI131_HUMAN;.;.	S	209;184;257;222	ENSP00000393683:A209S;ENSP00000346472:A184S;ENSP00000308279:A257S;ENSP00000368019:A222S	ENSP00000308279:A257S	A	+	1	0	C9orf131	35033395	0.001000	0.12720	0.019000	0.16419	0.136000	0.21042	0.300000	0.19156	1.246000	0.43901	0.650000	0.86243	GCC	C9orf131	-	NULL	ENSG00000174038		0.517	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf131	HGNC	protein_coding	OTTHUMT00000052283.5		0.00	28	0	G	NM_203299		35043395	+1			no_errors	ENST00000312292	ensembl	human	known	74_37	missense	5.63	67	4	SNP	0.004	T
CACNB2	783	genome.wustl.edu	37	10	18827127	18827127	+	Silent	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:18827127T>C	ENST00000324631.7	+	13	1381	c.1321T>C	c.(1321-1323)Ttg>Ctg	p.L441L	CACNB2_ENST00000377315.4_Silent_p.L393L|CACNB2_ENST00000282343.8_Silent_p.L413L|CACNB2_ENST00000377319.3_Silent_p.L348L|CACNB2_ENST00000352115.6_Silent_p.L417L|CACNB2_ENST00000377331.2_Silent_p.L389L|RP11-499P20.2_ENST00000425669.1_RNA|CACNB2_ENST00000396576.2_Silent_p.L386L|CACNB2_ENST00000377329.4_Silent_p.L387L|CACNB2_ENST00000377328.1_Silent_p.L191L	NM_201593.2|NM_201596.2	NP_963887.2|NP_963890.2	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2 subunit	441					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|neuromuscular junction development (GO:0007528)|positive regulation of calcium ion transport (GO:0051928)|synaptic transmission (GO:0007268)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|voltage-gated calcium channel complex (GO:0005891)	calcium channel activity (GO:0005262)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|stomach(2)	31					Amlodipine(DB00381)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	CGATGTGATCTTGGATGAGAA	0.577																																																	0													165.0	145.0	152.0					10																	18827127		2203	4300	6503	SO:0001819	synonymous_variant	0			U95019	CCDS7125.1, CCDS7126.1, CCDS7127.1, CCDS7128.1, CCDS7129.1, CCDS41493.1, CCDS41494.1	10p12	2014-09-17			ENSG00000165995	ENSG00000165995		"""Calcium channel subunits"""	1402	protein-coding gene	gene with protein product		600003		MYSB, CACNLB2		9254841, 8494331	Standard	NM_201596		Approved		uc001ipr.2	Q08289	OTTHUMG00000017764	ENST00000324631.7:c.1321T>C	10.37:g.18827127T>C			A6PVM5|A6PVM7|A6PVM8|O00304|Q5QJ99|Q5QJA0|Q5VVG9|Q5VVH0|Q5VWV6|Q6TME1|Q6TME2|Q6TME3|Q8WX81|Q96NZ3|Q96NZ4|Q96NZ5|Q9BWU2|Q9HD32|Q9Y340|Q9Y341	Silent	SNP	pfam_GK/Ca_channel_bsu,pfam_VDCC_L_bsu,superfamily_P-loop_NTPase,superfamily_SH3_domain,smart_SH3_domain,smart_GK/Ca_channel_bsu,pfscan_SH3_domain,prints_VDCC_L_bsu,prints_VDCC_L_b2su	p.L441	ENST00000324631.7	37	c.1321	CCDS7125.1	10																																																																																			CACNB2	-	pfam_GK/Ca_channel_bsu,superfamily_P-loop_NTPase,smart_GK/Ca_channel_bsu	ENSG00000165995		0.577	CACNB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CACNB2	HGNC	protein_coding	OTTHUMT00000047072.2	-	0.00	69	0	T	NM_000724		18827127	+1	tier1	-	no_errors	ENST00000324631	ensembl	human	known	74_37	silent	22.43	83	24	SNP	0.993	C
SOHLH2	54937	genome.wustl.edu	37	13	36764128	36764128	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr13:36764128T>G	ENST00000379881.3	-	6	684	c.596A>C	c.(595-597)aAc>aCc	p.N199T	SOHLH2_ENST00000317764.6_Missense_Mutation_p.N199T|SOHLH2_ENST00000554962.1_Missense_Mutation_p.N276T|CCDC169-SOHLH2_ENST00000511166.1_Missense_Mutation_p.N276T	NM_017826.2	NP_060296.2	Q9NX45	SOLH2_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 2	199					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;4.63e-08)|Epithelial(112;2.67e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00272)|BRCA - Breast invasive adenocarcinoma(63;0.00685)|GBM - Glioblastoma multiforme(144;0.0273)		GATCTTTTTGTTTTTCTCGAA	0.318																																																	0													109.0	109.0	109.0					13																	36764128		2203	4300	6503	SO:0001583	missense	0			AK000456	CCDS9355.1, CCDS61309.1	13q13.3	2013-05-21			ENSG00000120669	ENSG00000120669		"""Basic helix-loop-helix proteins"""	26026	protein-coding gene	gene with protein product	"""spermatogenesis associated 28"""					12477932	Standard	NM_017826		Approved	FLJ20449, TEB1, bHLHe81, SPATA28		Q9NX45	OTTHUMG00000016728	ENST00000379881.3:c.596A>C	13.37:g.36764128T>G	ENSP00000369210:p.Asn199Thr		B4DX90|Q5EGC3|Q8TC74|Q96QX4	Missense_Mutation	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.N276T	ENST00000379881.3	37	c.827	CCDS9355.1	13	.	.	.	.	.	.	.	.	.	.	T	11.57	1.676784	0.29783	.	.	ENSG00000120669;ENSG00000120669;ENSG00000120669;ENSG00000250709	ENST00000379881;ENST00000554962;ENST00000317764;ENST00000511166	D;D;T;D	0.97404	-4.37;-4.37;0.81;-4.37	5.1	-1.5	0.08691	Helix-loop-helix DNA-binding (2);	0.593152	0.16970	N	0.192141	D	0.90978	0.7163	N	0.14661	0.345	0.23215	N	0.998103	B;B	0.17038	0.02;0.02	B;B	0.19946	0.027;0.027	T	0.83158	-0.0100	10	0.49607	T	0.09	-3.2993	9.016	0.36170	0.0:0.4204:0.0:0.5796	.	276;199	B4DX90;Q9NX45	.;SOLH2_HUMAN	T	199;276;199;276	ENSP00000369210:N199T;ENSP00000451542:N276T;ENSP00000326838:N199T;ENSP00000421868:N276T	ENSP00000421868:N276T	N	-	2	0	CCDC169-SOHLH2;SOHLH2	35662128	0.000000	0.05858	0.600000	0.28864	0.639000	0.38242	-2.500000	0.00967	-0.270000	0.09285	-0.321000	0.08615	AAC	CCDC169-SOHLH2	-	superfamily_bHLH_dom,pfscan_bHLH_dom	ENSG00000250709		0.318	SOHLH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC169-SOHLH2	HGNC	protein_coding	OTTHUMT00000044477.2	-	0.00	26	0	T	NM_017826		36764128	-1	tier1	-	no_errors	ENST00000511166	ensembl	human	known	74_37	missense	18.42	31	7	SNP	0.954	G
CCDC180	100499483	genome.wustl.edu	37	9	100124039	100124039	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:100124039G>T	ENST00000357054.1	+	38	4495	c.3560G>T	c.(3559-3561)aGt>aTt	p.S1187I	RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Missense_Mutation_p.S1216I|MIR1302-8_ENST00000408342.1_RNA|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000529487.1_Missense_Mutation_p.S1216I			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1187						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GAGGAAGACAGTGACATCCTG	0.617																																																	0													87.0	71.0	76.0					9																	100124039		2203	4300	6503	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.3560G>T	9.37:g.100124039G>T	ENSP00000349562:p.Ser1187Ile		Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.S1216I	ENST00000357054.1	37	c.3647		9	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344839	0.41498	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000529487	T;T;T	0.09911	2.97;2.93;2.93	5.37	4.46	0.54185	.	0.274253	0.32473	N	0.006046	T	0.26195	0.0639	M	0.67953	2.075	0.80722	D	1	D;P	0.76494	0.999;0.944	D;P	0.74023	0.982;0.629	T	0.00170	-1.1961	10	0.37606	T	0.19	-12.2413	9.3345	0.38043	0.096:0.0:0.904:0.0	.	1355;1187	B7ZMG3;Q9P1Z9	.;CI174_HUMAN	I	1187;1216;1216	ENSP00000349562:S1187I;ENSP00000364348:S1216I;ENSP00000434727:S1216I	ENSP00000349562:S1187I	S	+	2	0	C9orf174	99163860	1.000000	0.71417	0.972000	0.41901	0.014000	0.08584	2.839000	0.48207	2.687000	0.91594	0.655000	0.94253	AGT	CCDC180	-	NULL	ENSG00000197816		0.617	CCDC180-201	KNOWN	basic	protein_coding	CCDC180	HGNC	protein_coding		-	0.00	35	0	G	NM_020893		100124039	+1	tier1	-	no_errors	ENST00000375202	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.903	T
CCDC39	339829	genome.wustl.edu	37	3	180361933	180361933	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:180361933A>C	ENST00000442201.2	-	12	1759	c.1640T>G	c.(1639-1641)cTt>cGt	p.L547R	CCDC39_ENST00000273654.4_Missense_Mutation_p.L631R	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	547					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.L631R(1)|p.L547R(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GGCTTTATCAAGTTCTTTCTC	0.308																																																	2	Substitution - Missense(2)	large_intestine(2)											160.0	145.0	150.0					3																	180361933		1488	3303	4791	SO:0001583	missense	0			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1640T>G	3.37:g.180361933A>C	ENSP00000405708:p.Leu547Arg		B4E2H1	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.L547R	ENST00000442201.2	37	c.1640	CCDS46964.1	3	.	.	.	.	.	.	.	.	.	.	A	13.98	2.398410	0.42512	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.22945	1.93;1.93	5.56	5.56	0.83823	.	0.162313	0.41396	D	0.000899	T	0.44222	0.1283	L	0.59436	1.845	0.42547	D	0.993096	D	0.71674	0.998	P	0.60541	0.876	T	0.36768	-0.9734	10	0.56958	D	0.05	-5.8948	15.0019	0.71479	1.0:0.0:0.0:0.0	.	547	Q9UFE4	CCD39_HUMAN	R	631;547	ENSP00000273654:L631R;ENSP00000405708:L547R	ENSP00000273654:L631R	L	-	2	0	CCDC39	181844627	0.999000	0.42202	0.926000	0.36857	0.128000	0.20619	5.752000	0.68728	2.240000	0.73641	0.533000	0.62120	CTT	CCDC39	-	NULL	ENSG00000145075		0.308	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC39	HGNC	protein_coding	OTTHUMT00000349783.3	-	0.00	46	0	A	XM_291028		180361933	-1	tier1	-	no_errors	ENST00000442201	ensembl	human	known	74_37	missense	23.89	86	27	SNP	0.978	C
CCT8	10694	genome.wustl.edu	37	21	30445906	30445906	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr21:30445906C>T	ENST00000286788.4	-	1	212	c.6G>A	c.(4-6)gcG>gcA	p.A2A	CCT8_ENST00000542732.1_5'Flank|CCT8_ENST00000540844.1_5'UTR|CCT8_ENST00000470450.1_5'UTR	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	2					'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						GAACGTGAAGCGCCATGGCCA	0.632																																																	0													82.0	73.0	76.0					21																	30445906		2203	4300	6503	SO:0001819	synonymous_variant	0			Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.6G>A	21.37:g.30445906C>T			A6NN54|B4DEM7|B4DQH4|Q4VBP8	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,tigrfam_Chap_CCT_theta	p.A2	ENST00000286788.4	37	c.6	CCDS33528.1	21																																																																																			CCT8	-	NULL	ENSG00000156261		0.632	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8	HGNC	protein_coding	OTTHUMT00000171822.1		0.00	46	0	C			30445906	-1			no_errors	ENST00000286788	ensembl	human	known	74_37	silent	12.90	27	4	SNP	1.000	T
CD1E	913	genome.wustl.edu	37	1	158325192	158325192	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:158325192T>G	ENST00000368167.3	+	3	697	c.458T>G	c.(457-459)aTt>aGt	p.I153S	CD1E_ENST00000434258.1_Missense_Mutation_p.I151S|CD1E_ENST00000444681.2_Missense_Mutation_p.I54S|CD1E_ENST00000368157.1_Intron|CD1E_ENST00000368163.3_Missense_Mutation_p.I153S|CD1E_ENST00000368161.3_Missense_Mutation_p.I153S|CD1E_ENST00000368154.1_Intron|CD1E_ENST00000368164.3_Intron|CD1E_ENST00000452291.2_Intron|CD1E_ENST00000368165.3_Intron|CD1E_ENST00000368160.3_Missense_Mutation_p.I153S|CD1E_ENST00000368166.3_Intron|CD1E_ENST00000368155.3_Intron|CD1E_ENST00000368156.1_Intron	NM_030893.3	NP_112155.2	P15812	CD1E_HUMAN	CD1e molecule	153					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(27)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|urinary_tract(1)	49	all_hematologic(112;0.0378)					TTCCAAGGAATTTCCTGGGAG	0.453																																																	0													95.0	93.0	94.0					1																	158325192		1837	4098	5935	SO:0001583	missense	0			AJ289111	CCDS41417.1, CCDS41418.1, CCDS41419.1, CCDS41420.1, CCDS41421.1, CCDS41422.1, CCDS53387.1, CCDS53388.1, CCDS53389.1, CCDS53390.1, CCDS53384.1, CCDS53385.1, CCDS53386.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158488	ENSG00000158488		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1638	protein-coding gene	gene with protein product		188411	"""CD1E antigen, e polypeptide"", ""CD1e antigen"""			10948205	Standard	NM_001042585		Approved		uc001fse.3	P15812	OTTHUMG00000017515	ENST00000368167.3:c.458T>G	1.37:g.158325192T>G	ENSP00000357149:p.Ile153Ser		B4DZV3|E7EP01|Q5TDJ9|Q5TDK3|Q5TDK4|Q5TDK5|Q5TDK6|Q5TDK8|Q5TDL1|Q712E4|Q712E5|Q712E6|Q712E7|Q712E8|Q712E9|Q712F0|Q712F1|Q712F2|Q712F3|Q712F4|Q712F5|Q96TD0|Q96TD1|Q9UMM1|Q9Y5M3	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom	p.I153S	ENST00000368167.3	37	c.458	CCDS41417.1	1	.	.	.	.	.	.	.	.	.	.	T	4.057	0.008394	0.07912	.	.	ENSG00000158488	ENST00000434258;ENST00000444681;ENST00000368167;ENST00000368163;ENST00000368160;ENST00000368161	T;T;T;T;T;T	0.05649	3.41;3.41;3.41;3.41;3.41;3.41	4.53	-0.224	0.13115	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	1.142540	0.06570	N	0.748431	T	0.00496	0.0016	N	0.00841	-1.15	0.19575	N	0.999961	B;B;B;B;B;B;B	0.14438	0.006;0.006;0.0;0.001;0.001;0.01;0.009	B;B;B;B;B;B;B	0.09377	0.001;0.001;0.001;0.001;0.0;0.001;0.004	T	0.46247	-0.9205	10	0.17832	T	0.49	-0.158	3.0575	0.06189	0.4599:0.0:0.336:0.2041	.	54;151;54;153;153;153;153	B4E042;E7ET31;E7EP01;P15812-2;P15812;P15812-3;P15812-4	.;.;.;.;CD1E_HUMAN;.;.	S	151;54;153;153;153;153	ENSP00000401957:I151S;ENSP00000402906:I54S;ENSP00000357149:I153S;ENSP00000357145:I153S;ENSP00000357142:I153S;ENSP00000357143:I153S	ENSP00000357142:I153S	I	+	2	0	CD1E	156591816	0.000000	0.05858	0.433000	0.26760	0.765000	0.43378	-0.294000	0.08309	-0.105000	0.12132	-0.445000	0.05633	ATT	CD1E	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000158488		0.453	CD1E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD1E	HGNC	protein_coding	OTTHUMT00000046353.3	-	0.00	44	0	T	NM_030893		158325192	+1	tier1	-	no_errors	ENST00000368167	ensembl	human	known	74_37	missense	25.68	55	19	SNP	0.468	G
CD79A	973	genome.wustl.edu	37	19	42383164	42383164	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:42383164G>A	ENST00000221972.3	+	2	369	c.184G>A	c.(184-186)Gcc>Acc	p.A62T	CD79A_ENST00000444740.2_Missense_Mutation_p.A62T	NM_001783.3|NM_021601.3	NP_001774.1|NP_067612.1	P11912	CD79A_HUMAN	CD79a molecule, immunoglobulin-associated alpha	62	Ig-like C2-type.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)	B cell receptor complex (GO:0019815)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			large_intestine(3)|lung(3)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	11						CAGCAACAACGCCAACGTCAC	0.612			"""O, S"""		DLBCL																																			Dom	yes		19	19q13.2	973	"""CD79a molecule, immunoglobulin-associated alpha"""		L	0													104.0	82.0	90.0					19																	42383164		2203	4300	6503	SO:0001583	missense	0			M80462	CCDS12589.1, CCDS46088.1	19q13.2	2014-09-17	2006-03-28					"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1698	protein-coding gene	gene with protein product		112205	"""CD79A antigen (immunoglobulin-associated alpha)"""	IGA		1538135	Standard	NM_001783		Approved	MB-1	uc002orv.3	P11912		ENST00000221972.3:c.184G>A	19.37:g.42383164G>A	ENSP00000221972:p.Ala62Thr		A0N775|Q53FB8	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Phos_immunorcpt_sig_ITAM,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Phos_immunorcpt_sig_ITAM,pfscan_Phos_immunorcpt_sig_ITAM,pfscan_Ig-like_dom	p.A62T	ENST00000221972.3	37	c.184	CCDS12589.1	19	.	.	.	.	.	.	.	.	.	.	G	7.885	0.731114	0.15507	.	.	ENSG00000105369	ENST00000221972;ENST00000444740	T	0.80214	-1.35	5.06	-10.1	0.00402	Immunoglobulin V-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.40932	0.1137	N	0.00621	-1.32	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.04013	0.001;0.0	T	0.44742	-0.9308	9	0.17369	T	0.5	-1.9842	5.6097	0.17398	0.2995:0.1068:0.4726:0.1211	.	62;62	P11912;A0N775	CD79A_HUMAN;.	T	62	ENSP00000221972:A62T	ENSP00000221972:A62T	A	+	1	0	CD79A	47075004	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.979000	0.00321	-2.734000	0.00382	-0.910000	0.02820	GCC	CD79A	-	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000105369		0.612	CD79A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD79A	HGNC	protein_coding	OTTHUMT00000463058.1	-	0.00	57	0	G			42383164	+1	tier1	-	no_errors	ENST00000221972	ensembl	human	known	74_37	missense	38.78	30	19	SNP	0.000	A
CD33	945	genome.wustl.edu	37	19	51729310	51729310	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:51729310G>T	ENST00000262262.4	+	3	691	c.670G>T	c.(670-672)Gag>Tag	p.E224*	CD33_ENST00000421133.2_Nonsense_Mutation_p.E97*|CD33_ENST00000436584.2_Nonsense_Mutation_p.E97*|CD33_ENST00000391796.3_Nonsense_Mutation_p.E224*	NM_001772.3	NP_001763.3	P20138	CD33_HUMAN	CD33 molecule	224	Ig-like C2-type.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(15)|skin(1)|stomach(1)	24		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000224)|OV - Ovarian serous cystadenocarcinoma(262;0.00468)	Gemtuzumab ozogamicin(DB00056)	TGTGACTACGGAGAGAACCAT	0.602																																																	0													45.0	42.0	43.0					19																	51729310		2203	4300	6503	SO:0001587	stop_gained	0			M23197	CCDS33084.1, CCDS46157.1, CCDS54299.1	19q13.3	2013-01-29	2006-03-28		ENSG00000105383	ENSG00000105383		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1659	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 3"""	159590	"""CD33 antigen (gp67)"""			3139766, 9465907	Standard	NM_001772		Approved	SIGLEC3, SIGLEC-3, p67, FLJ00391	uc002pwa.2	P20138		ENST00000262262.4:c.670G>T	19.37:g.51729310G>T	ENSP00000262262:p.Glu224*		B4E3P8|C9JEN7|F8WAL2|Q8TD24	Nonsense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like_dom	p.E224*	ENST00000262262.4	37	c.670	CCDS33084.1	19	.	.	.	.	.	.	.	.	.	.	.	17.55	3.418003	0.62622	.	.	ENSG00000105383	ENST00000436584;ENST00000262262;ENST00000421133;ENST00000391796	.	.	.	3.08	0.727	0.18254	.	0.234953	0.21503	U	0.073490	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	4.2898	0.10872	0.1409:0.2366:0.6225:0.0	.	.	.	.	X	97;224;97;224	.	ENSP00000262262:E224X	E	+	1	0	CD33	56421122	0.003000	0.15002	0.002000	0.10522	0.001000	0.01503	1.096000	0.30976	0.132000	0.18615	-0.379000	0.06801	GAG	CD33	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000105383		0.602	CD33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD33	HGNC	protein_coding	OTTHUMT00000464199.2	-	0.00	35	0	G	NM_001772		51729310	+1	tier1	-	no_errors	ENST00000262262	ensembl	human	known	74_37	nonsense	8.00	46	4	SNP	0.007	T
CD93	22918	genome.wustl.edu	37	20	23065077	23065077	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr20:23065077A>G	ENST00000246006.4	-	1	1900	c.1753T>C	c.(1753-1755)Tac>Cac	p.Y585H		NM_012072.3	NP_036204.2	Q9NPY3	C1QR1_HUMAN	CD93 molecule	585					macrophage activation (GO:0042116)|phagocytosis (GO:0006909)|single organismal cell-cell adhesion (GO:0016337)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|complement component C1q binding (GO:0001849)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					CCTAGGATGTAGAATAAAAGC	0.607																																																	0													154.0	147.0	149.0					20																	23065077		2203	4300	6503	SO:0001583	missense	0			U94333	CCDS13149.1	20p11.21	2009-01-29	2006-03-28	2006-02-22	ENSG00000125810	ENSG00000125810		"""CD molecules"""	15855	protein-coding gene	gene with protein product		120577	"""matrix-remodelling associated 4"", ""complement component 1, q subcomponent, receptor 1"", ""CD93 antigen"""	MXRA4, C1QR1		9047234, 10648005	Standard	NM_012072		Approved	C1qRP, C1qR(P), dJ737E23.1, CDw93, ECSM3	uc002wsv.3	Q9NPY3	OTTHUMG00000032058	ENST00000246006.4:c.1753T>C	20.37:g.23065077A>G	ENSP00000246006:p.Tyr585His		O00274	Missense_Mutation	SNP	pirsf_CD93/CD141,pfam_EGF-like_Ca-bd_dom,pfam_EG-like_dom,pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_MFS_dom_general_subst_transpt,smart_C-type_lectin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_C-type_lectin	p.Y585H	ENST00000246006.4	37	c.1753	CCDS13149.1	20	.	.	.	.	.	.	.	.	.	.	A	25.6	4.650575	0.87958	.	.	ENSG00000125810	ENST00000246006	T	0.81163	-1.46	5.84	5.84	0.93424	.	0.117859	0.38492	N	0.001667	D	0.88328	0.6407	M	0.71581	2.175	0.34252	D	0.678874	D	0.71674	0.998	D	0.65573	0.936	D	0.92796	0.6252	10	0.87932	D	0	-35.4767	15.4659	0.75400	1.0:0.0:0.0:0.0	.	585	Q9NPY3	C1QR1_HUMAN	H	585	ENSP00000246006:Y585H	ENSP00000246006:Y585H	Y	-	1	0	CD93	23013077	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	4.056000	0.57448	2.242000	0.73789	0.529000	0.55759	TAC	CD93	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000125810		0.607	CD93-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD93	HGNC	protein_coding	OTTHUMT00000078312.2		0.00	58	0	A	NM_012072		23065077	-1			no_errors	ENST00000246006	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.996	G
CD99L2	83692	genome.wustl.edu	37	X	149963744	149963744	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:149963744G>A	ENST00000370377.3	-	6	482	c.365C>T	c.(364-366)gCt>gTt	p.A122V	CD99L2_ENST00000355149.3_Missense_Mutation_p.A50V|CD99L2_ENST00000466436.1_Missense_Mutation_p.A73V|CD99L2_ENST00000346693.4_5'UTR|CD99L2_ENST00000437787.2_Intron	NM_001242614.1|NM_031462.3	NP_001229543.1|NP_113650.2	Q8TCZ2	C99L2_HUMAN	CD99 molecule-like 2	122					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					CAGGGCATCAGCCAAGTCAAA	0.463																																																	0													138.0	138.0	138.0					X																	149963744		2203	4300	6503	SO:0001583	missense	0			BC030536	CCDS14697.1, CCDS14698.1, CCDS35427.1, CCDS55527.1, CCDS76044.1	Xq28	2007-12-04	2006-03-28	2003-02-14	ENSG00000102181	ENSG00000102181			18237	protein-coding gene	gene with protein product		300846	"""MIC2 like 1"", ""CD99 antigen-like 2"""	MIC2L1			Standard	NM_001184808		Approved	CD99B	uc004fek.3	Q8TCZ2	OTTHUMG00000024247	ENST00000370377.3:c.365C>T	X.37:g.149963744G>A	ENSP00000359403:p.Ala122Val		A8K2D5|A8K5R0|B3KWG2|B4DDL7|E7EMK5|E9PD27|Q8TAW2|Q8TCZ0|Q8TCZ1|Q9BQG9	Missense_Mutation	SNP	pfam_CD99L2	p.A122V	ENST00000370377.3	37	c.365	CCDS35427.1	X	.	.	.	.	.	.	.	.	.	.	G	12.16	1.854379	0.32791	.	.	ENSG00000102181	ENST00000370377;ENST00000438086;ENST00000355149;ENST00000466436;ENST00000418547	T;T;T;T	0.24538	1.85;1.85;1.85;1.85	3.67	0.546	0.17196	.	0.809938	0.11205	N	0.588333	T	0.31482	0.0798	M	0.68952	2.095	0.47778	D	0.999511	P;P;B	0.48162	0.906;0.557;0.245	P;B;B	0.46543	0.52;0.215;0.138	T	0.17961	-1.0352	9	.	.	.	-7.2847	9.7007	0.40184	0.0:0.0:0.4573:0.5427	.	50;73;122	Q8TCZ2-3;Q8TCZ2-2;Q8TCZ2	.;.;C99L2_HUMAN	V	122;126;50;73;85	ENSP00000359403:A122V;ENSP00000347275:A50V;ENSP00000417697:A73V;ENSP00000391821:A85V	.	A	-	2	0	CD99L2	149714402	0.932000	0.31603	0.417000	0.26559	0.936000	0.57629	0.661000	0.25023	-0.008000	0.14320	0.513000	0.50165	GCT	CD99L2	-	pfam_CD99L2	ENSG00000102181		0.463	CD99L2-001	KNOWN	basic|CCDS	protein_coding	CD99L2	HGNC	protein_coding	OTTHUMT00000061199.1	-	0.00	42	0	G	NM_031462		149963744	-1	tier1	-	no_errors	ENST00000370377	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.831	A
CDC42BPG	55561	genome.wustl.edu	37	11	64603053	64603053	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:64603053G>A	ENST00000342711.5	-	15	1798	c.1799C>T	c.(1798-1800)cCt>cTt	p.P600L		NM_017525.2	NP_059995.2			CDC42 binding protein kinase gamma (DMPK-like)											central_nervous_system(1)|lung(3)	4						CCCACCCTCAGGGGGTCCCAT	0.672																																																	0													50.0	58.0	55.0					11																	64603053		2197	4292	6489	SO:0001583	missense	0			AY648038	CCDS31601.1	11q13	2013-01-10			ENSG00000171219	ENSG00000171219		"""Pleckstrin homology (PH) domain containing"""	29829	protein-coding gene	gene with protein product		613991				9341881, 15194684	Standard	NM_017525		Approved	HSMDPKIN, MRCKgamma, DMPK2, kappa-200	uc001obs.4	Q6DT37	OTTHUMG00000045365	ENST00000342711.5:c.1799C>T	11.37:g.64603053G>A	ENSP00000345133:p.Pro600Leu			Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pfscan_CRIB_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.P600L	ENST00000342711.5	37	c.1799	CCDS31601.1	11	.	.	.	.	.	.	.	.	.	.	G	8.446	0.852049	0.17034	.	.	ENSG00000171219	ENST00000342711	T	0.20881	2.04	4.11	2.13	0.27403	.	0.446179	0.18672	N	0.134405	T	0.11537	0.0281	L	0.34521	1.04	0.09310	N	1	B	0.32245	0.361	B	0.28139	0.086	T	0.24657	-1.0154	10	0.12430	T	0.62	.	6.235	0.20758	0.1126:0.1939:0.6935:0.0	.	600	Q6DT37	MRCKG_HUMAN	L	600	ENSP00000345133:P600L	ENSP00000345133:P600L	P	-	2	0	CDC42BPG	64359629	0.678000	0.27586	0.013000	0.15412	0.032000	0.12392	2.146000	0.42216	0.824000	0.34613	0.462000	0.41574	CCT	CDC42BPG	-	NULL	ENSG00000171219		0.672	CDC42BPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPG	HGNC	protein_coding	OTTHUMT00000105352.4	-	0.00	9	0	G	XM_290516		64603053	-1	tier1	-	no_errors	ENST00000342711	ensembl	human	known	74_37	missense	22.22	14	4	SNP	0.004	A
CDH22	64405	genome.wustl.edu	37	20	44845598	44845598	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr20:44845598G>A	ENST00000372262.3	-	4	1105	c.705C>T	c.(703-705)cgC>cgT	p.R235R	CDH22_ENST00000537909.1_Silent_p.R235R|CDH22_ENST00000474438.1_5'UTR	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	235	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				CCTGGCTCTCGCGGTCAAGGT	0.657																																																	0													102.0	80.0	87.0					20																	44845598		2203	4300	6503	SO:0001819	synonymous_variant	0			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.705C>T	20.37:g.44845598G>A			B9EGK7|O43205	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,superfamily_MFS_dom_general_subst_transpt,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R235	ENST00000372262.3	37	c.705	CCDS13395.1	20																																																																																			CDH22	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000149654		0.657	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH22	HGNC	protein_coding	OTTHUMT00000080491.1	-	0.00	36	0	G	NM_021248		44845598	-1	tier1	-	no_errors	ENST00000372262	ensembl	human	known	74_37	silent	27.27	32	12	SNP	0.011	A
CDH9	1007	genome.wustl.edu	37	5	26881552	26881552	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:26881552A>C	ENST00000231021.4	-	12	2235	c.2063T>G	c.(2062-2064)cTt>cGt	p.L688R		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	688					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ATCCCGTCTAAGTTTACTGTC	0.408																																					Melanoma(8;187 585 15745 40864 52829)												0													192.0	184.0	187.0					5																	26881552		2203	4300	6503	SO:0001583	missense	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.2063T>G	5.37:g.26881552A>C	ENSP00000231021:p.Leu688Arg		Q3B7I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L688R	ENST00000231021.4	37	c.2063	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	A	12.73	2.024784	0.35701	.	.	ENSG00000113100	ENST00000231021	T	0.76839	-1.05	4.96	3.76	0.43208	Cadherin, cytoplasmic domain (1);	0.334872	0.32357	N	0.006216	T	0.75317	0.3833	L	0.42632	1.34	0.40977	D	0.984746	B;B	0.28783	0.222;0.003	B;B	0.42593	0.392;0.05	T	0.68739	-0.5329	9	.	.	.	.	10.9095	0.47099	0.842:0.1579:0.0:0.0	.	281;688	B4DFP0;Q9ULB4	.;CADH9_HUMAN	R	688	ENSP00000231021:L688R	.	L	-	2	0	CDH9	26917309	1.000000	0.71417	0.953000	0.39169	0.966000	0.64601	5.823000	0.69272	0.800000	0.34041	0.455000	0.32223	CTT	CDH9	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000113100		0.408	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	-	0.00	34	0	A	NM_016279		26881552	-1	tier1	-	no_errors	ENST00000231021	ensembl	human	known	74_37	missense	38.10	39	24	SNP	0.998	C
CDH9	1007	genome.wustl.edu	37	5	26886180	26886180	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:26886180C>T	ENST00000231021.4	-	10	1697	c.1525G>A	c.(1525-1527)Gtc>Atc	p.V509I		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	509	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ATGACACTGACAGTCTGAATC	0.338																																					Melanoma(8;187 585 15745 40864 52829)												0													64.0	72.0	69.0					5																	26886180		2202	4293	6495	SO:0001583	missense	0			AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.1525G>A	5.37:g.26886180C>T	ENSP00000231021:p.Val509Ile		Q3B7I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V509I	ENST00000231021.4	37	c.1525	CCDS3893.1	5	.	.	.	.	.	.	.	.	.	.	C	3.029	-0.200132	0.06219	.	.	ENSG00000113100	ENST00000231021	T	0.56611	0.45	5.76	0.176	0.15049	Cadherin (4);Cadherin-like (1);	0.548775	0.19944	N	0.102586	T	0.21307	0.0513	N	0.02011	-0.69	0.32368	N	0.55619	B;B	0.02656	0.0;0.0	B;B	0.11329	0.006;0.003	T	0.25847	-1.0120	9	.	.	.	.	9.9781	0.41797	0.0:0.5299:0.0:0.4701	.	102;509	B4DFP0;Q9ULB4	.;CADH9_HUMAN	I	509	ENSP00000231021:V509I	.	V	-	1	0	CDH9	26921937	0.009000	0.17119	0.938000	0.37757	0.990000	0.78478	0.138000	0.16016	0.084000	0.17077	0.467000	0.42956	GTC	CDH9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000113100		0.338	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH9	HGNC	protein_coding	OTTHUMT00000207352.1	-	0.00	59	0	C	NM_016279		26886180	-1	tier1	-	no_errors	ENST00000231021	ensembl	human	known	74_37	missense	20.00	72	18	SNP	0.843	T
CDH6	1004	genome.wustl.edu	37	5	31323178	31323178	+	Silent	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:31323178C>G	ENST00000265071.2	+	12	2401	c.2136C>G	c.(2134-2136)gtC>gtG	p.V712V		NM_004932.3	NP_004923.1	P55285	CADH6_HUMAN	cadherin 6, type 2, K-cadherin (fetal kidney)	712					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(42)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						ACACCGATGTCAGAGATTTCA	0.527																																																	0													61.0	62.0	61.0					5																	31323178		2203	4300	6503	SO:0001819	synonymous_variant	0			D31784	CCDS3894.1	5p13.3	2010-01-26			ENSG00000113361	ENSG00000113361		"""Cadherins / Major cadherins"""	1765	protein-coding gene	gene with protein product	"""K-Cadherin"""	603007				7743525, 10191097	Standard	NM_004932		Approved		uc003jhe.2	P55285	OTTHUMG00000090673	ENST00000265071.2:c.2136C>G	5.37:g.31323178C>G			A8K5H5|Q9BWS0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V712	ENST00000265071.2	37	c.2136	CCDS3894.1	5																																																																																			CDH6	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000113361		0.527	CDH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH6	HGNC	protein_coding	OTTHUMT00000207355.2	-	0.00	50	0	C	NM_004932		31323178	+1	tier1	-	no_errors	ENST00000265071	ensembl	human	known	74_37	silent	20.75	41	11	SNP	1.000	G
CEMP1	752014	genome.wustl.edu	37	16	2580765	2580765	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:2580765G>T	ENST00000567119.1	-	1	644	c.310C>A	c.(310-312)Ctc>Atc	p.L104I	AMDHD2_ENST00000302956.4_3'UTR|AMDHD2_ENST00000565570.1_3'UTR|MIR3178_ENST00000581887.1_RNA|CEMP1_ENST00000565480.1_Intron|CEMP1_ENST00000382350.1_Missense_Mutation_p.L104I|AMDHD2_ENST00000413459.3_3'UTR	NM_001048212.3	NP_001041677.1	Q6PRD7	CEMP1_HUMAN	cementum protein 1	104						cytoplasm (GO:0005737)				lung(1)|skin(1)	2						GCCTGAGGGAGGGCCTGGGGC	0.642																																																	0													32.0	37.0	35.0					16																	2580765		1969	4146	6115	SO:0001583	missense	0			AY584596	CCDS42108.1	16p13.3	2006-09-22							32553	protein-coding gene	gene with protein product	"""cementum protein-23"""	611113				16263347	Standard	NM_001048212		Approved	CP-23	uc002cqr.3	Q6PRD7		ENST00000567119.1:c.310C>A	16.37:g.2580765G>T	ENSP00000457380:p.Leu104Ile		B2RUY1	Missense_Mutation	SNP	NULL	p.L104I	ENST00000567119.1	37	c.310	CCDS42108.1	16	.	.	.	.	.	.	.	.	.	.	G	3.449	-0.112490	0.06881	.	.	ENSG00000205923	ENST00000382350	T	0.56103	0.48	1.71	-3.43	0.04810	.	.	.	.	.	T	0.26085	0.0636	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.10497	-1.0627	9	0.87932	D	0	.	3.5219	0.07745	0.3255:0.0:0.4636:0.2109	.	104	Q6PRD7	CEMP1_HUMAN	I	104	ENSP00000371787:L104I	ENSP00000371787:L104I	L	-	1	0	CEMP1	2520766	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.528000	0.00945	-1.563000	0.01680	-0.291000	0.09656	CTC	CEMP1	-	NULL	ENSG00000205923		0.642	CEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEMP1	HGNC	protein_coding	OTTHUMT00000435686.1	-	0.00	38	0	G	NM_001048212		2580765	-1	tier1	-	no_errors	ENST00000382350	ensembl	human	known	74_37	missense	7.69	48	4	SNP	0.000	T
CENPW	387103	genome.wustl.edu	37	6	126667400	126667400	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:126667400G>T	ENST00000368328.4	+	2	276	c.176G>T	c.(175-177)aGg>aTg	p.R59M	CENPW_ENST00000368326.1_Nonsense_Mutation_p.G46*|CENPW_ENST00000368325.1_Missense_Mutation_p.R74M			Q5EE01	CENPW_HUMAN	centromere protein W	59					CENP-A containing nucleosome assembly (GO:0034080)|chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|kinetochore (GO:0000776)|nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(2)|large_intestine(1)|lung(3)	6						GAAGAGTCCAGGACAAACGCT	0.378																																																	0													121.0	116.0	118.0					6																	126667400		2203	4300	6503	SO:0001583	missense	0			BC039556	CCDS34529.1, CCDS69196.1, CCDS75516.1	6q22.32	2013-11-05	2010-04-16	2010-04-16	ENSG00000203760	ENSG00000203760			21488	protein-coding gene	gene with protein product	"""cancer-upregulated gene 2"""	611264	"""chromosome 6 open reading frame 173"""	C6orf173		17610844, 19070575	Standard	NM_001286524		Approved	CUG2	uc003qao.3	Q5EE01	OTTHUMG00000015518	ENST00000368328.4:c.176G>T	6.37:g.126667400G>T	ENSP00000357311:p.Arg59Met		A6NIR0|A6NJC2	Nonsense_Mutation	SNP	NULL	p.G46*	ENST00000368328.4	37	c.136	CCDS34529.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.311511|5.311511	0.95655|0.95655	.|.	.|.	ENSG00000203760|ENSG00000203760	ENST00000368326|ENST00000368325;ENST00000368328	.|T	.|0.22134	.|1.97	5.74|5.74	4.85|4.85	0.62838|0.62838	.|Histone-fold (1);	.|0.000000	.|0.45361	.|D	.|0.000366	.|T	.|0.09642	.|0.0237	.|.	.|.	.|.	0.33039|0.33039	D|D	0.531243|0.531243	.|P	.|0.46912	.|0.886	.|B	.|0.38562	.|0.276	.|T	.|0.04870	.|-1.0921	.|9	0.87932|0.87932	D|D	0|0	-0.1391|-0.1391	11.909|11.909	0.52729|0.52729	0.0:0.0:0.8258:0.1741|0.0:0.0:0.8258:0.1741	.|.	.|59	.|Q5EE01	.|CENPW_HUMAN	X|M	46|74;59	.|ENSP00000357311:R59M	ENSP00000357309:G46X|ENSP00000357308:R74M	G|R	+|+	1|2	0|0	CENPW|CENPW	126709093|126709093	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	5.775000|5.775000	0.68915|0.68915	1.375000|1.375000	0.46248|0.46248	0.655000|0.655000	0.94253|0.94253	GGA|AGG	CENPW	-	NULL	ENSG00000203760		0.378	CENPW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPW	HGNC	protein_coding	OTTHUMT00000042104.1		0.00	70	0	G			126667400	+1			no_errors	ENST00000368326	ensembl	human	known	74_37	nonsense	5.77	49	3	SNP	1.000	T
CEP250	11190	genome.wustl.edu	37	20	34084481	34084481	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr20:34084481G>T	ENST00000397527.1	+	25	3963	c.3243G>T	c.(3241-3243)gaG>gaT	p.E1081D	CEP250_ENST00000342580.4_Missense_Mutation_p.E1025D	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1081	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			GACAACAAGAGCTGAGTGCCC	0.517																																																	0													70.0	65.0	67.0					20																	34084481		2203	4300	6503	SO:0001583	missense	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.3243G>T	20.37:g.34084481G>T	ENSP00000380661:p.Glu1081Asp		E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	superfamily_Prefoldin	p.E1081D	ENST00000397527.1	37	c.3243	CCDS13255.1	20	.	.	.	.	.	.	.	.	.	.	G	23.5	4.426928	0.83667	.	.	ENSG00000126001	ENST00000397527;ENST00000342580	T;T	0.21031	2.23;2.03	4.81	4.81	0.61882	.	0.208625	0.33534	N	0.004808	T	0.24624	0.0597	L	0.36672	1.1	0.32323	N	0.562159	D	0.53312	0.959	P	0.49140	0.601	T	0.12837	-1.0532	10	0.42905	T	0.14	.	14.7151	0.69262	0.0:0.0:1.0:0.0	.	1081	Q9BV73	CP250_HUMAN	D	1081;1025	ENSP00000380661:E1081D;ENSP00000341541:E1025D	ENSP00000341541:E1025D	E	+	3	2	CEP250	33547895	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	2.828000	0.48120	2.502000	0.84385	0.650000	0.86243	GAG	CEP250	-	NULL	ENSG00000126001		0.517	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	-	0.00	51	0	G	NM_007186		34084481	+1	tier1	-	no_errors	ENST00000397527	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
CGN	57530	genome.wustl.edu	37	1	151509274	151509274	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:151509274C>T	ENST00000271636.7	+	20	3508	c.3375C>T	c.(3373-3375)gaC>gaT	p.D1125D		NM_020770.2	NP_065821.1	Q9P2M7	CING_HUMAN	cingulin	1119					transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|myosin complex (GO:0016459)|tight junction (GO:0005923)	actin binding (GO:0003779)|motor activity (GO:0003774)			NS(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(14)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGCGACTGGACGGCCTGAGGA	0.552																																																	0													145.0	144.0	145.0					1																	151509274		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037740	CCDS999.1	1q21	2008-02-05			ENSG00000143375	ENSG00000143375			17429	protein-coding gene	gene with protein product		609473				11042084, 12529927	Standard	NM_020770		Approved	KIAA1319	uc009wmw.3	Q9P2M7	OTTHUMG00000012497	ENST00000271636.7:c.3375C>T	1.37:g.151509274C>T			A6H8L3|A7MD22|Q5T386|Q9NR25	Silent	SNP	pfam_Myosin_tail	p.D1125	ENST00000271636.7	37	c.3375	CCDS999.1	1																																																																																			CGN	-	pfam_Myosin_tail	ENSG00000143375		0.552	CGN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CGN	HGNC	protein_coding	OTTHUMT00000034900.3	-	0.00	50	0	C	NM_020770		151509274	+1	tier1	-	no_errors	ENST00000271636	ensembl	human	known	74_37	silent	5.43	87	5	SNP	0.033	T
CFH	3075	genome.wustl.edu	37	1	196659363	196659363	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:196659363C>T	ENST00000359637.2	+	8	1200	c.1138C>T	c.(1138-1140)Cgt>Tgt	p.R380C	CFH_ENST00000439155.2_Missense_Mutation_p.R444C|CFH_ENST00000367429.4_Missense_Mutation_p.R444C			P08603	CFAH_HUMAN	complement factor H	444	Sushi 6. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						CAGATGCATCCGTGTCAGTAA	0.423																																																	0													107.0	88.0	95.0					1																	196659363		2203	4300	6503	SO:0001583	missense	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.1138C>T	1.37:g.196659363C>T	ENSP00000352658:p.Arg380Cys		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R444C	ENST00000359637.2	37	c.1330		1	.	.	.	.	.	.	.	.	.	.	.	10.91	1.483643	0.26598	.	.	ENSG00000000971	ENST00000367429;ENST00000439155;ENST00000391986;ENST00000359637	T;T;T	0.74526	0.73;-0.85;-0.85	4.52	3.6	0.41247	Complement control module (1);Sushi/SCR/CCP (1);	.	.	.	.	D	0.85767	0.5773	M	0.89095	3.005	0.09310	N	1	D;D;D;D	0.89917	0.997;1.0;0.999;0.999	P;D;P;D	0.65987	0.73;0.94;0.693;0.911	T	0.75673	-0.3236	9	0.37606	T	0.19	.	10.7957	0.46459	0.0:0.809:0.191:0.0	.	380;444;444;444	Q5TFM2;P08603-2;P08603;F8WDX4	.;.;CFAH_HUMAN;.	C	444;444;444;380	ENSP00000356399:R444C;ENSP00000402656:R444C;ENSP00000352658:R380C	ENSP00000352658:R380C	R	+	1	0	CFH	194925986	0.000000	0.05858	0.006000	0.13384	0.018000	0.09664	0.502000	0.22594	1.493000	0.48517	0.655000	0.94253	CGT	CFH	-	superfamily_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.423	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000087502.1	-	0.00	49	0	C	NM_000186		196659363	+1	tier1	-	no_errors	ENST00000367429	ensembl	human	known	74_37	missense	68.12	22	47	SNP	0.007	T
CHMP1B	57132	genome.wustl.edu	37	18	11851577	11851577	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr18:11851577delA	ENST00000526991.2	+	1	183	c.67delA	c.(67-69)aaafs	p.K24fs	RP11-78A19.3_ENST00000586474.1_RNA|GNAL_ENST00000535121.1_Intron|GNAL_ENST00000269162.5_Intron|GNAL_ENST00000334049.6_Intron|GNAL_ENST00000423027.3_Intron	NM_020412.4	NP_065145.2	Q7LBR1	CHM1B_HUMAN	charged multivesicular body protein 1B	24					cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|protein transport (GO:0015031)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein domain specific binding (GO:0019904)			endometrium(1)|lung(1)|urinary_tract(1)	3						TAGGAGTGCCAAAAAATGCGA	0.502																																																	0													31.0	30.0	30.0					18																	11851577		1902	4114	6016	SO:0001589	frameshift_variant	0			AF306520	CCDS54180.1	18p11.21	2011-09-21	2011-09-21		ENSG00000255112	ENSG00000255112		"""Charged multivesicular body proteins"""	24287	protein-coding gene	gene with protein product		606486	"""chromatin modifying protein 1B"""			15537668	Standard	NM_020412		Approved	CHMP1.5, C18orf2, Vps46B	uc002kqe.3	Q7LBR1	OTTHUMG00000165820	ENST00000526991.2:c.67delA	18.37:g.11851577delA	ENSP00000432279:p.Lys24fs		Q96E89|Q9HD41	Frame_Shift_Del	DEL	pfam_Snf7	p.K24fs	ENST00000526991.2	37	c.67	CCDS54180.1	18																																																																																			CHMP1B	-	pfam_Snf7	ENSG00000255112		0.502	CHMP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHMP1B	HGNC	protein_coding	OTTHUMT00000386375.2		0.00	49	0	A	NM_020412		11851577	+1	tier1		no_errors	ENST00000526991	ensembl	human	known	74_37	frame_shift_del	8.33	22	2	DEL	1.000	-
CHRD	8646	genome.wustl.edu	37	3	184103918	184103918	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:184103918G>T	ENST00000204604.1	+	15	2149	c.1903G>T	c.(1903-1905)Ggt>Tgt	p.G635C	CHRD_ENST00000545352.1_Missense_Mutation_p.G265C|EIF2B5_ENST00000444495.1_Intron|CHRD_ENST00000450923.1_Missense_Mutation_p.G635C|CHRD_ENST00000348986.3_Missense_Mutation_p.G595C	NM_003741.2	NP_003732.2	Q9H2X0	CHRD_HUMAN	chordin	635	CHRD 4. {ECO:0000255|PROSITE- ProRule:PRU00230}.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning (GO:0021919)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|gastrulation with mouth forming second (GO:0001702)|mesoderm formation (GO:0001707)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell migration (GO:0030336)|negative regulation of osteoblast differentiation (GO:0045668)|osteoblast differentiation (GO:0001649)|positive regulation of cell adhesion (GO:0045785)|positive regulation of mesenchymal cell proliferation (GO:0002053)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)	cytokine binding (GO:0019955)|heparin binding (GO:0008201)			NS(1)|biliary_tract(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(23)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	48	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CACCACCAAGGGTAGCCCCAG	0.647																																																	0													70.0	72.0	71.0					3																	184103918		2203	4300	6503	SO:0001583	missense	0			AF076612	CCDS3266.1	3q27	2008-07-18			ENSG00000090539	ENSG00000090539			1949	protein-coding gene	gene with protein product		603475				9782094, 11472837	Standard	NM_003741		Approved		uc003fov.3	Q9H2X0	OTTHUMG00000141267	ENST00000204604.1:c.1903G>T	3.37:g.184103918G>T	ENSP00000204604:p.Gly635Cys		O95254|Q2M1I8|Q6UW83|Q9H2D3|Q9H2W8|Q9H2W9|Q9P0Z2|Q9P0Z3|Q9P0Z4|Q9P0Z5	Missense_Mutation	SNP	pfam_CHRD,pfam_VWF_C,smart_VWF_C,smart_CHRD,pirsf_Chordin,pfscan_CHRD,pfscan_VWF_C	p.G635C	ENST00000204604.1	37	c.1903	CCDS3266.1	3	.	.	.	.	.	.	.	.	.	.	G	13.57	2.278023	0.40294	.	.	ENSG00000090539	ENST00000204604;ENST00000450923;ENST00000348986;ENST00000545352;ENST00000342610	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	4.68	1.8	0.24995	CHRD (3);	0.301525	0.34507	N	0.003914	T	0.44307	0.1287	L	0.38175	1.15	0.27506	N	0.951821	P;D;P;D	0.63046	0.947;0.99;0.909;0.992	P;P;P;P	0.62813	0.84;0.789;0.799;0.907	T	0.21211	-1.0252	10	0.54805	T	0.06	-6.624	5.4538	0.16580	0.2705:0.149:0.5805:0.0	.	265;595;635;635	B7Z6F4;Q9H2X0-5;E7ESX1;Q9H2X0	.;.;.;CHRD_HUMAN	C	635;635;595;265;348	ENSP00000204604:G635C;ENSP00000408972:G635C;ENSP00000334036:G595C;ENSP00000442948:G265C	ENSP00000204604:G635C	G	+	1	0	CHRD	185586612	0.999000	0.42202	0.958000	0.39756	0.515000	0.34225	1.111000	0.31159	0.508000	0.28173	0.655000	0.94253	GGT	CHRD	-	pfam_CHRD,smart_CHRD,pirsf_Chordin,pfscan_CHRD	ENSG00000090539		0.647	CHRD-001	KNOWN	basic|CCDS	protein_coding	CHRD	HGNC	protein_coding	OTTHUMT00000280432.1		0.00	17	0	G	NM_003741		184103918	+1			no_errors	ENST00000204604	ensembl	human	known	74_37	missense	11.11	16	2	SNP	0.793	T
CHRNA10	57053	genome.wustl.edu	37	11	3690541	3690541	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:3690541G>T	ENST00000250699.2	-	3	318	c.247C>A	c.(247-249)Cgg>Agg	p.R83R	CHRNA10_ENST00000534359.1_5'UTR|CHRNA10_ENST00000493827.2_5'UTR	NM_020402.2	NP_065135.2	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10 (neuronal)	83					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell proliferation (GO:0042127)|synaptic transmission, cholinergic (GO:0007271)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perikaryon (GO:0043204)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)|receptor binding (GO:0005102)	p.R83W(1)		breast(1)|endometrium(2)|lung(3)|ovary(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Galantamine(DB00674)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Succinylcholine(DB00202)|Trimethaphan(DB01116)	CACTCCTGCCGTATCCACAGA	0.567																																					Melanoma(153;17 1869 2949 7120 36888)												1	Substitution - Missense(1)	lung(1)											134.0	103.0	113.0					11																	3690541		2201	4298	6499	SO:0001819	synonymous_variant	0			AF199235	CCDS7745.1	11p15.5	2012-02-11	2012-02-07		ENSG00000129749	ENSG00000129749		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	13800	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 10 (neuronal)"""	606372	"""cholinergic receptor, nicotinic, alpha polypeptide 10"""				Standard	NM_020402		Approved		uc001lyf.3	Q9GZZ6	OTTHUMG00000011844	ENST00000250699.2:c.247C>A	11.37:g.3690541G>T				Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R83	ENST00000250699.2	37	c.247	CCDS7745.1	11																																																																																			CHRNA10	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel	ENSG00000129749		0.567	CHRNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA10	HGNC	protein_coding	OTTHUMT00000032763.2		0.00	33	0	G			3690541	-1			no_errors	ENST00000250699	ensembl	human	known	74_37	silent	5.88	32	2	SNP	1.000	T
CLDN17	26285	genome.wustl.edu	37	21	31538725	31538725	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr21:31538725A>C	ENST00000286808.3	-	1	246	c.211T>G	c.(211-213)Ttg>Gtg	p.L71V		NM_012131.2	NP_036263.1	P56750	CLD17_HUMAN	claudin 17	71					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(2)|large_intestine(6)|lung(9)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	23						GGGAGAGCCAACAAGGAGCTA	0.547																																																	0													77.0	84.0	82.0					21																	31538725		2203	4300	6503	SO:0001583	missense	0			AJ250712	CCDS13586.1	21q22.1	2008-07-31			ENSG00000156282	ENSG00000156282		"""Claudins"""	2038	protein-coding gene	gene with protein product						12736707	Standard	NM_012131		Approved	MGC126552, MGC126554	uc011acv.2	P56750	OTTHUMG00000081873	ENST00000286808.3:c.211T>G	21.37:g.31538725A>C	ENSP00000286808:p.Leu71Val		Q3MJB5|Q6UY37	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin14,prints_Claudin8	p.L71V	ENST00000286808.3	37	c.211	CCDS13586.1	21	.	.	.	.	.	.	.	.	.	.	A	13.17	2.157697	0.38119	.	.	ENSG00000156282	ENST00000286808	D	0.89552	-2.53	5.22	-6.09	0.02145	.	0.151830	0.44902	D	0.000408	D	0.94994	0.8380	H	0.95780	3.72	0.41232	D	0.986589	D	0.89917	1.0	D	0.97110	1.0	D	0.94368	0.7593	10	0.87932	D	0	.	16.177	0.81858	0.4019:0.0:0.5981:0.0	.	71	P56750	CLD17_HUMAN	V	71	ENSP00000286808:L71V	ENSP00000286808:L71V	L	-	1	2	CLDN17	30460596	0.001000	0.12720	0.049000	0.19019	0.094000	0.18550	-0.088000	0.11198	-1.272000	0.02427	-0.256000	0.11100	TTG	CLDN17	-	pfam_PMP22/EMP/MP20/Claudin	ENSG00000156282		0.547	CLDN17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN17	HGNC	protein_coding	OTTHUMT00000182261.1	-	0.00	38	0	A	NM_012131		31538725	-1	tier1	-	no_errors	ENST00000286808	ensembl	human	known	74_37	missense	39.47	23	15	SNP	0.538	C
CLEC12A	160364	genome.wustl.edu	37	12	10133243	10133243	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:10133243A>C	ENST00000304361.4	+	4	624	c.442A>C	c.(442-444)Agt>Cgt	p.S148R	CLEC12A_ENST00000350667.4_Missense_Mutation_p.S115R|CLEC12A_ENST00000355690.4_Missense_Mutation_p.S158R|CLEC12A_ENST00000434319.2_Missense_Mutation_p.S148R	NM_138337.5|NM_201623.3	NP_612210.4|NP_963917.2	Q5QGZ9	CL12A_HUMAN	C-type lectin domain family 12, member A	148	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	16						TTATTTCCTAAGTGATGATGT	0.413																																					Melanoma(197;1487 2125 16611 22221 34855)												0													155.0	144.0	148.0					12																	10133243		2203	4300	6503	SO:0001583	missense	0			AY498550	CCDS8608.1, CCDS8609.1, CCDS55803.1, CCDS73442.1	12p13.31	2010-08-17			ENSG00000172322	ENSG00000172322		"""C-type lectin domain containing"""	31713	protein-coding gene	gene with protein product		612088					Standard	NM_201623		Approved	CLL-1, MICL	uc001qwq.3	Q5QGZ9		ENST00000304361.4:c.442A>C	12.37:g.10133243A>C	ENSP00000302804:p.Ser148Arg		B2RA16|Q6P4H1|Q6RH77|Q6RH78|Q8TDQ6	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.S158R	ENST00000304361.4	37	c.472	CCDS8608.1	12	.	.	.	.	.	.	.	.	.	.	A	3.686	-0.064589	0.07273	.	.	ENSG00000172322	ENST00000355690;ENST00000396507;ENST00000304361;ENST00000434319;ENST00000350667;ENST00000396506	T;T;T;T;T	0.20738	2.05;2.05;2.05;2.05;2.05	5.4	-10.8	0.00216	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	.	.	.	.	T	0.17365	0.0417	M	0.84683	2.71	0.09310	N	1	B;B;B	0.19817	0.031;0.006;0.039	B;B;B	0.14578	0.008;0.005;0.011	T	0.24905	-1.0147	9	0.25106	T	0.35	.	0.4967	0.00573	0.2899:0.2605:0.2539:0.1958	.	115;148;158	Q5QGZ9-4;Q5QGZ9;Q5QGZ9-1	.;CL12A_HUMAN;.	R	158;148;148;148;115;21	ENSP00000347916:S158R;ENSP00000379764:S148R;ENSP00000302804:S148R;ENSP00000405244:S148R;ENSP00000345448:S115R	ENSP00000302804:S148R	S	+	1	0	CLEC12A	10024510	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.833000	0.00742	-4.636000	0.00038	-1.690000	0.00728	AGT	CLEC12A	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000172322		0.413	CLEC12A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLEC12A	HGNC	protein_coding	OTTHUMT00000399545.1	-	0.00	64	0	A	NM_138337		10133243	+1	tier1	-	no_errors	ENST00000355690	ensembl	human	known	74_37	missense	23.68	87	27	SNP	0.000	C
CLEC7A	64581	genome.wustl.edu	37	12	10282624	10282624	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:10282624A>C	ENST00000304084.8	-	1	212	c.58T>G	c.(58-60)Ttc>Gtc	p.F20V	CLEC7A_ENST00000533022.1_Missense_Mutation_p.F20V|CLEC7A_ENST00000353231.5_Missense_Mutation_p.F20V|CLEC7A_ENST00000310002.4_Missense_Mutation_p.F20V|CLEC7A_ENST00000298523.5_Missense_Mutation_p.F20V|CLEC7A_ENST00000525605.1_Missense_Mutation_p.F20V|CLEC7A_ENST00000396484.2_Missense_Mutation_p.F20V	NM_197947.2	NP_922938.1	Q9BXN2	CLC7A_HUMAN	C-type lectin domain family 7, member A	20					carbohydrate mediated signaling (GO:0009756)|cell recognition (GO:0008037)|defense response to protozoan (GO:0042832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|MHC protein binding (GO:0042287)|signaling pattern recognition receptor activity (GO:0008329)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						TGAGAGTCGAAGTGTAATTGA	0.358																																																	0													128.0	119.0	122.0					12																	10282624		2203	4300	6503	SO:0001583	missense	0			AY009090	CCDS8613.1, CCDS8614.1, CCDS8617.1, CCDS41753.1, CCDS41754.1, CCDS53744.1	12p13.2-p12.3	2014-09-17		2005-02-09	ENSG00000172243	ENSG00000172243		"""C-type lectin domain containing"""	14558	protein-coding gene	gene with protein product		606264	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12"""	CLECSF12			Standard	XM_005253468		Approved	dectin-1, hDectin-1	uc001qxg.2	Q9BXN2	OTTHUMG00000133597	ENST00000304084.8:c.58T>G	12.37:g.10282624A>C	ENSP00000302569:p.Phe20Val		B2R861|B7Z494|B7Z5A9|B7Z5B9|Q6IPS7|Q96D32|Q96DR9|Q96LD3|Q96PA4|Q96PA5|Q96PA6|Q96PA7|Q96PA8|Q9H1K3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.F20V	ENST00000304084.8	37	c.58	CCDS41753.1	12	.	.	.	.	.	.	.	.	.	.	A	13.52	2.262096	0.39995	.	.	ENSG00000172243	ENST00000353231;ENST00000298523;ENST00000396484;ENST00000304084;ENST00000533022;ENST00000310002;ENST00000525605	T;T;T;T;T	0.07800	4.97;3.4;4.82;3.16;3.16	4.24	4.24	0.50183	.	0.000000	0.49916	D	0.000136	T	0.22003	0.0530	L	0.60904	1.88	0.33585	D	0.600331	D;D;D;D;D;D;D;D	0.89917	1.0;0.996;1.0;1.0;1.0;0.996;0.999;0.999	D;D;D;D;D;D;D;D	0.87578	0.996;0.986;0.997;0.996;0.998;0.986;0.995;0.994	T	0.13818	-1.0495	10	0.52906	T	0.07	.	10.0187	0.42029	1.0:0.0:0.0:0.0	.	20;20;20;20;20;20;20;20	Q96D32;Q9BXN2-6;Q9BXN2-4;Q9BXN2-5;Q9BXN2-3;Q9BXN2-7;Q9BXN2;Q9BXN2-2	.;.;.;.;.;.;CLC7A_HUMAN;.	V	20	ENSP00000266456:F20V;ENSP00000298523:F20V;ENSP00000379743:F20V;ENSP00000302569:F20V;ENSP00000431461:F20V	ENSP00000298523:F20V	F	-	1	0	CLEC7A	10173891	0.996000	0.38824	0.898000	0.35279	0.148000	0.21650	3.464000	0.53057	2.130000	0.65690	0.477000	0.44152	TTC	CLEC7A	-	NULL	ENSG00000172243		0.358	CLEC7A-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC7A	HGNC	protein_coding	OTTHUMT00000390772.1	-	0.00	31	0	A	NM_197954		10282624	-1	tier1	-	no_errors	ENST00000304084	ensembl	human	known	74_37	missense	30.77	27	12	SNP	0.933	C
CNGB3	54714	genome.wustl.edu	37	8	87755746	87755746	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:87755746G>T	ENST00000320005.5	-	1	157	c.110C>A	c.(109-111)tCt>tAt	p.S37Y	CNGB3_ENST00000519777.1_5'UTR|RP11-386D6.1_ENST00000519041.1_RNA	NM_019098.4	NP_061971.3	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	37					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(2)|endometrium(4)|kidney(6)|large_intestine(15)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	80						GGTTTGCTGAGACTGATTACT	0.408																																																	0													327.0	273.0	291.0					8																	87755746		2203	4300	6503	SO:0001583	missense	0			AF228520	CCDS6244.1	8q21.3	2013-01-23	2003-06-25		ENSG00000170289	ENSG00000170289		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2153	protein-coding gene	gene with protein product		605080	"""achromatopsia (rod monochromacy) 3"", ""achromatopsia (rod monochromacy) 1"""	ACHM3, ACHM1, RMCH		10888875, 10958649, 16382102	Standard	NM_019098		Approved		uc003ydx.3	Q9NQW8	OTTHUMG00000163738	ENST00000320005.5:c.110C>A	8.37:g.87755746G>T	ENSP00000316605:p.Ser37Tyr		C9JA51|Q9NRE9	Missense_Mutation	SNP	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.S37Y	ENST00000320005.5	37	c.110	CCDS6244.1	8	.	.	.	.	.	.	.	.	.	.	G	9.379	1.072432	0.20147	.	.	ENSG00000170289	ENST00000320005	T	0.31769	1.48	5.96	4.12	0.48240	.	0.885835	0.09375	N	0.810778	T	0.31513	0.0799	L	0.34521	1.04	0.09310	N	1	B	0.31790	0.34	B	0.37091	0.241	T	0.35126	-0.9801	10	0.54805	T	0.06	.	13.9796	0.64297	0.0:0.2891:0.7109:0.0	.	37	Q9NQW8	CNGB3_HUMAN	Y	37	ENSP00000316605:S37Y	ENSP00000316605:S37Y	S	-	2	0	CNGB3	87824862	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.717000	0.25851	0.799000	0.34018	-0.182000	0.12963	TCT	CNGB3	-	NULL	ENSG00000170289		0.408	CNGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNGB3	HGNC	protein_coding	OTTHUMT00000375107.1	-	0.00	73	0	G	NM_019098		87755746	-1	tier1	-	no_errors	ENST00000320005	ensembl	human	known	74_37	missense	5.75	82	5	SNP	0.002	T
CNNM2	54805	genome.wustl.edu	37	10	104814209	104814209	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:104814209G>A	ENST00000369878.4	+	3	2077	c.1889G>A	c.(1888-1890)cGt>cAt	p.R630H	CNNM2_ENST00000433628.2_Missense_Mutation_p.R630H	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	630					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GCCATGCACCGTTTCCTAGCA	0.512											OREG0020489	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													71.0	70.0	71.0					10																	104814209		2019	4189	6208	SO:0001583	missense	0			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1889G>A	10.37:g.104814209G>A	ENSP00000358894:p.Arg630His	1384	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	pfam_DUF21,superfamily_cNMP-bd-like	p.R630H	ENST00000369878.4	37	c.1889	CCDS44474.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.5|29.5	5.011713|5.011713	0.93346|0.93346	.|.	.|.	ENSG00000148842|ENSG00000148842	ENST00000457502;ENST00000433628|ENST00000369878;ENST00000345419	.|T	.|0.75154	.|-0.91	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|.	.|.	.|.	.|.	.|D	.|0.88108	.|0.6348	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.989	.|D;P	.|0.72982	.|0.979;0.762	.|D	.|0.88018	.|0.2767	.|8	.|.	.|.	.|.	.|-27.8347	19.967|19.967	0.97274|0.97274	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|630;630	.|Q9H8M5-2;Q9H8M5	.|.;CNNM2_HUMAN	.|H	-1|630	.|ENSP00000358894:R630H	.|.	.|R	+|+	.|2	.|0	CNNM2|CNNM2	104804199|104804199	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.864000|9.864000	0.99589|0.99589	2.714000|2.714000	0.92807|0.92807	0.655000|0.655000	0.94253|0.94253	.|CGT	CNNM2	-	superfamily_cNMP-bd-like	ENSG00000148842		0.512	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	-	0.00	37	0	G	NM_017649		104814209	+1	tier1	-	no_errors	ENST00000369878	ensembl	human	known	74_37	missense	22.22	42	12	SNP	1.000	A
CNPY3	10695	genome.wustl.edu	37	6	42897358	42897360	+	In_Frame_Del	DEL	TGC	TGC	-	rs570105218	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:42897358_42897360delTGC	ENST00000372836.4	+	1	421_423	c.50_52delTGC	c.(49-54)ttgctg>ttg	p.17_18LL>L	CNPY3_ENST00000394142.3_In_Frame_Del_p.17_18LL>L	NM_006586.3	NP_006577.2	Q9BT09	CNPY3_HUMAN	canopy FGF signaling regulator 3	17					innate immune response (GO:0045087)|toll-like receptor signaling pathway (GO:0002224)	endoplasmic reticulum lumen (GO:0005788)		p.L25delL(1)		central_nervous_system(1)|endometrium(1)|lung(3)|ovary(1)	6	Colorectal(47;0.196)		all cancers(41;0.000954)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|OV - Ovarian serous cystadenocarcinoma(102;0.0218)|Kidney(15;0.0388)			CTTCTTCCCTtgctgctgctgct	0.695																																																	1	Deletion - In frame(1)	central_nervous_system(1)																																								SO:0001651	inframe_deletion	0			U80744	CCDS4875.1	6p21.1	2013-09-19	2013-07-23	2007-10-22	ENSG00000137161	ENSG00000137161		"""Trinucleotide (CAG) repeat containing"""	11968	protein-coding gene	gene with protein product		610774	"""trinucleotide repeat containing 5"", ""canopy 3 homolog (zebrafish)"""	TNRC5		9225980	Standard	NM_006586		Approved	CAG4A	uc003ota.4	Q9BT09	OTTHUMG00000014708	ENST00000372836.4:c.50_52delTGC	6.37:g.42897367_42897369delTGC	ENSP00000361926:p.Leu25del		O15412|Q0P6I2|Q8NF54|Q8WTU8|Q9P0F2	In_Frame_Del	DEL	pfam_DUF3456	p.L21in_frame_del	ENST00000372836.4	37	c.50_52	CCDS4875.1	6																																																																																			CNPY3	-	NULL	ENSG00000137161		0.695	CNPY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNPY3	HGNC	protein_coding	OTTHUMT00000040564.1		0.00	21	0	TGC	NM_006586		42897360	+1	tier1		no_errors	ENST00000372836	ensembl	human	known	74_37	in_frame_del	18.75	13	3	DEL	0.122:0.131:0.153	-
CNTLN	54875	genome.wustl.edu	37	9	17457656	17457656	+	Silent	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:17457656A>G	ENST00000380647.3	+	19	3333	c.3249A>G	c.(3247-3249)tcA>tcG	p.S1083S	CNTLN_ENST00000425824.1_Silent_p.S1083S|CNTLN_ENST00000262360.5_Silent_p.S1083S			Q9NXG0	CNTLN_HUMAN	centlein, centrosomal protein	1083					centriole-centriole cohesion (GO:0010457)|protein localization to organelle (GO:0033365)	centriole (GO:0005814)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	phosphorelay sensor kinase activity (GO:0000155)|protein binding, bridging (GO:0030674)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(6)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	53				GBM - Glioblastoma multiforme(50;6.14e-10)		AAGTTACATCACTTAGTCCTT	0.323																																																	0													74.0	72.0	72.0					9																	17457656		1821	4085	5906	SO:0001819	synonymous_variant	0			AK000283	CCDS43789.1, CCDS47953.1	9p22.2-p22.1	2008-11-11	2008-02-08	2008-02-08	ENSG00000044459	ENSG00000044459			23432	protein-coding gene	gene with protein product		611870	"""chromosome 9 open reading frame 101"", ""chromosome 9 open reading frame 39"""	C9orf101, C9orf39		18086554	Standard	XM_005251492		Approved	FLJ20276, bA340N12.1, OTTHUMG00000019597	uc003zmy.3	Q9NXG0	OTTHUMG00000019599	ENST00000380647.3:c.3249A>G	9.37:g.17457656A>G			A5Z2X6|Q5VYJ0|Q8N1G9|Q9HAJ5	Silent	SNP	superfamily_Prefoldin	p.S1083	ENST00000380647.3	37	c.3249	CCDS43789.1	9																																																																																			CNTLN	-	NULL	ENSG00000044459		0.323	CNTLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTLN	HGNC	protein_coding	OTTHUMT00000051793.3	-	0.00	151	0	A	NM_017738		17457656	+1	tier1	-	no_errors	ENST00000380647	ensembl	human	known	74_37	silent	40.74	80	55	SNP	0.938	G
COG1	9382	genome.wustl.edu	37	17	71189440	71189440	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr17:71189440G>A	ENST00000299886.4	+	1	312	c.232G>A	c.(232-234)Gac>Aac	p.D78N	RP11-143K11.5_ENST00000580671.1_RNA	NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	78					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			GGGGCTAGTGGACGCCGTGAA	0.751																																																	0													17.0	18.0	18.0					17																	71189440		2181	4277	6458	SO:0001583	missense	0				CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.232G>A	17.37:g.71189440G>A	ENSP00000299886:p.Asp78Asn		Q9NPV9|Q9P2G6	Missense_Mutation	SNP	NULL	p.D78N	ENST00000299886.4	37	c.232	CCDS11692.1	17	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002036	0.35320	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	T;T	0.23754	1.89;1.9	3.89	3.89	0.44902	.	0.357482	0.28921	N	0.013708	T	0.22003	0.0530	L	0.33245	0.995	0.34944	D	0.750618	P;B;P	0.36392	0.551;0.404;0.551	B;B;B	0.39027	0.173;0.288;0.173	T	0.21177	-1.0253	10	0.15952	T	0.53	-22.1124	16.3989	0.83632	0.0:0.0:1.0:0.0	.	78;78;78	E9PBL8;Q8WTW3;Q4G0L8	.;COG1_HUMAN;.	N	78	ENSP00000400111:D78N;ENSP00000299886:D78N	ENSP00000299886:D78N	D	+	1	0	COG1	68701035	1.000000	0.71417	1.000000	0.80357	0.165000	0.22458	2.344000	0.44010	2.158000	0.67659	0.484000	0.47621	GAC	COG1	-	NULL	ENSG00000166685		0.751	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG1	HGNC	protein_coding	OTTHUMT00000441638.1	-	0.00	16	0	G			71189440	+1	tier1	-	no_errors	ENST00000299886	ensembl	human	known	74_37	missense	35.00	13	7	SNP	1.000	A
COL6A5	256076	genome.wustl.edu	37	3	130119948	130119948	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:130119948A>C	ENST00000432398.2	+	11	4559	c.4065A>C	c.(4063-4065)aaA>aaC	p.K1355N	COL6A5_ENST00000265379.6_Missense_Mutation_p.K1355N	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	1355	Nonhelical region.|VWFA 7. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						AATTTGGAAAAAGATTCGATT	0.393																																																	0													164.0	141.0	148.0					3																	130119948		692	1591	2283	SO:0001583	missense	0			AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.4065A>C	3.37:g.130119948A>C	ENSP00000390895:p.Lys1355Asn		A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.K1355N	ENST00000432398.2	37	c.4065		3	.	.	.	.	.	.	.	.	.	.	A	12.53	1.964897	0.34659	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	D;D	0.90324	-2.56;-2.65	5.41	2.93	0.34026	.	.	.	.	.	D	0.92977	0.7765	M	0.61703	1.905	0.23765	N	0.9969	D	0.69078	0.997	D	0.69307	0.963	D	0.84284	0.0496	9	0.48119	T	0.1	.	8.759	0.34663	0.8324:0.0:0.1676:0.0	.	1355	A8TX70-2	.	N	1355	ENSP00000390895:K1355N;ENSP00000265379:K1355N	ENSP00000265379:K1355N	K	+	3	2	COL6A5	131602638	1.000000	0.71417	1.000000	0.80357	0.466000	0.32739	2.056000	0.41355	0.328000	0.23435	0.459000	0.35465	AAA	COL6A5	-	NULL	ENSG00000172752		0.393	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	COL6A5	HGNC	protein_coding		-	0.00	69	0	A	NM_153264		130119948	+1	tier1	-	no_errors	ENST00000265379	ensembl	human	known	74_37	missense	53.73	62	72	SNP	1.000	C
COX15	1355	genome.wustl.edu	37	10	101473230	101473230	+	IGR	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:101473230C>A	ENST00000016171.5	-	0	2356				COX15_ENST00000497381.1_5'Flank|CUTC_ENST00000493385.1_Intron|COX15_ENST00000370483.5_Missense_Mutation_p.V370F			Q7KZN9	COX15_HUMAN	cytochrome c oxidase assembly homolog 15 (yeast)						cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|oxidation-reduction process (GO:0055114)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Colorectal(252;0.234)		Epithelial(162;3.08e-10)|all cancers(201;2.43e-08)		ttgaataagacagggccctat	0.363																																																	0													64.0	61.0	62.0					10																	101473230		2203	4300	6503	SO:0001628	intergenic_variant	0			AF044323	CCDS7481.1, CCDS7482.1	10q24	2014-09-17	2012-10-15		ENSG00000014919	ENSG00000014919		"""Mitochondrial respiratory chain complex assembly factors"""	2263	protein-coding gene	gene with protein product		603646	"""COX15 (yeast) homolog, cytochrome c oxidase assembly protein"", ""COX15 homolog, cytochrome c oxidase assembly protein (yeast)"""			9878253	Standard	NM_078470		Approved		uc001kqb.4	Q7KZN9	OTTHUMG00000018893		10.37:g.101473230C>A			A8K6I9|O60556|O75878|Q5TD00|Q5TD01|Q7Z3Q3|Q9NTN0	Missense_Mutation	SNP	pfam_HemeA_syn,superfamily_Trypsin-like_Pept_dom	p.V370F	ENST00000016171.5	37	c.1108	CCDS7482.1	10	.	.	.	.	.	.	.	.	.	.	C	9.906	1.208178	0.22205	.	.	ENSG00000014919	ENST00000370483	.	.	.	1.84	-0.163	0.13363	.	.	.	.	.	T	0.17066	0.0410	.	.	.	0.09310	N	0.999999	P	0.47484	0.896	B	0.34346	0.18	T	0.15435	-1.0437	7	0.72032	D	0.01	.	4.3746	0.11263	0.0:0.6365:0.0:0.3635	.	370	Q7KZN9-2	.	F	370	.	ENSP00000359514:V370F	V	-	1	0	COX15	101463220	0.000000	0.05858	0.025000	0.17156	0.415000	0.31203	-1.238000	0.02919	-0.053000	0.13289	0.561000	0.74099	GTC	COX15	-	NULL	ENSG00000014919		0.363	COX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX15	HGNC	protein_coding	OTTHUMT00000049818.1		0.00	27	0	C	NP_510870		101473230	-1			no_errors	ENST00000370483	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.035	A
CPSF1	29894	genome.wustl.edu	37	8	145618985	145618985	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:145618985G>A	ENST00000349769.3	-	36	4136	c.4042C>T	c.(4042-4044)Ctg>Ttg	p.L1348L	MIR939_ENST00000401314.1_RNA|CPSF1_ENST00000531727.1_5'UTR	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	1348					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			ATGGGCAGCAGCAGCCCGATG	0.682																																					NSCLC(133;1088 1848 27708 34777 35269)												0													22.0	28.0	26.0					8																	145618985		2185	4292	6477	SO:0001819	synonymous_variant	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.4042C>T	8.37:g.145618985G>A			Q96AF0	Silent	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.L1348	ENST00000349769.3	37	c.4042	CCDS34966.1	8																																																																																			CPSF1	-	pfam_Cleavage/polyA-sp_fac_asu_C	ENSG00000071894		0.682	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	-	0.00	58	0	G	NM_013291		145618985	-1	tier1	-	no_errors	ENST00000349769	ensembl	human	known	74_37	silent	8.33	44	4	SNP	0.999	A
CPT1B	1375	genome.wustl.edu	37	22	51011955	51011955	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr22:51011955C>T	ENST00000360719.2	-	10	1297	c.1160G>A	c.(1159-1161)gGa>gAa	p.G387E	CPT1B_ENST00000312108.7_Missense_Mutation_p.G387E|CPT1B_ENST00000434492.2_Missense_Mutation_p.G184E|CPT1B_ENST00000395650.2_Missense_Mutation_p.G387E|CPT1B_ENST00000405237.3_Missense_Mutation_p.G387E|CPT1B_ENST00000440709.1_Intron|CPT1B_ENST00000457250.1_Missense_Mutation_p.G353E|CHKB-CPT1B_ENST00000453634.1_3'UTR	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	387					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		ATACCTTCCTCCTGCAGTGAG	0.637																																					Esophageal Squamous(170;988 1933 25577 30295 48163)												0													61.0	61.0	61.0					22																	51011955		2203	4300	6503	SO:0001583	missense	0			U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.1160G>A	22.37:g.51011955C>T	ENSP00000353945:p.Gly387Glu		B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.G387E	ENST00000360719.2	37	c.1160	CCDS14098.1	22	.	.	.	.	.	.	.	.	.	.	C	17.49	3.401524	0.62288	.	.	ENSG00000205560	ENST00000405237;ENST00000312108;ENST00000360719;ENST00000457250;ENST00000434492;ENST00000395650	D;D;D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22;-2.22;-2.22	5.09	5.09	0.68999	.	0.051175	0.85682	D	0.000000	D	0.88934	0.6572	L	0.33710	1.025	0.80722	D	1	B;D;P	0.54397	0.155;0.966;0.934	B;P;P	0.62491	0.13;0.903;0.848	D	0.89078	0.3474	10	0.51188	T	0.08	-16.6101	16.0896	0.81084	0.0:1.0:0.0:0.0	.	353;184;387	B7Z4U4;A2RRE8;Q92523	.;.;CPT1B_HUMAN	E	387;387;387;353;184;387	ENSP00000385486:G387E;ENSP00000312189:G387E;ENSP00000353945:G387E;ENSP00000409342:G353E;ENSP00000410966:G184E;ENSP00000379011:G387E	ENSP00000312189:G387E	G	-	2	0	CPT1B	49358821	1.000000	0.71417	0.453000	0.27007	0.876000	0.50452	7.162000	0.77515	2.662000	0.90505	0.555000	0.69702	GGA	CPT1B	-	pfam_Carn_acyl_trans	ENSG00000205560		0.637	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT1B	HGNC	protein_coding	OTTHUMT00000317264.5	-	0.00	51	0	C	NM_152246		51011955	-1	tier1	-	no_errors	ENST00000312108	ensembl	human	known	74_37	missense	40.00	21	14	SNP	1.000	T
CRYAA	1409	genome.wustl.edu	37	21	44589332	44589332	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr21:44589332G>A	ENST00000291554.2	+	1	215	c.123G>A	c.(121-123)tcG>tcA	p.S41S	CRYAA_ENST00000482775.1_3'UTR|CRYAA_ENST00000398133.1_5'Flank|CRYAA_ENST00000398132.1_5'Flank	NM_000394.2	NP_000385.1	P02489	CRYAA_HUMAN	crystallin, alpha A	41					negative regulation of apoptotic process (GO:0043066)|negative regulation of intracellular transport (GO:0032387)|protein homooligomerization (GO:0051260)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural constituent of eye lens (GO:0005212)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	11						CCTTCCTGTCGTCCACCATCA	0.632																																																	0													162.0	152.0	156.0					21																	44589332		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS13695.1	21q22.3	2011-09-05			ENSG00000160202	ENSG00000160202		"""Heat shock proteins / HSPB"""	2388	protein-coding gene	gene with protein product		123580		CRYA1			Standard	XM_005261093		Approved	HSPB4	uc002zdd.1	P02489	OTTHUMG00000086842	ENST00000291554.2:c.123G>A	21.37:g.44589332G>A			Q53X53	Silent	SNP	pfam_a-crystallin/Hsp20_dom,pfam_Alpha-crystallin_N,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP	p.S41	ENST00000291554.2	37	c.123	CCDS13695.1	21																																																																																			CRYAA	-	pfam_Alpha-crystallin_N	ENSG00000160202		0.632	CRYAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYAA	HGNC	protein_coding	OTTHUMT00000195562.1	-	0.00	42	0	G			44589332	+1	tier1	-	no_errors	ENST00000291554	ensembl	human	known	74_37	silent	61.11	7	11	SNP	0.995	A
CSMD2	114784	genome.wustl.edu	37	1	34052206	34052206	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:34052206G>A	ENST00000373381.4	-	46	7125	c.6949C>T	c.(6949-6951)Cgc>Tgc	p.R2317C		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2319	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R2319C(1)		NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CATCTGTAGCGTACGATGTCA	0.478																																																	1	Substitution - Missense(1)	lung(1)											95.0	86.0	89.0					1																	34052206		2203	4300	6503	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.6949C>T	1.37:g.34052206G>A	ENSP00000362479:p.Arg2317Cys		B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.R2317C	ENST00000373381.4	37	c.6949		1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.190656	0.78789	.	.	ENSG00000121904	ENST00000373381	T	0.66815	-0.23	5.84	4.86	0.63082	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.82453	0.5040	M	0.89095	3.005	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.982	D	0.84509	0.0621	10	0.66056	D	0.02	.	11.2181	0.48838	0.0:0.0:0.6513:0.3487	.	2319;2317	Q7Z408;E7EUA6	CSMD2_HUMAN;.	C	2317	ENSP00000362479:R2317C	ENSP00000241312:R2319C	R	-	1	0	CSMD2	33824793	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	5.594000	0.67557	2.764000	0.94973	0.655000	0.94253	CGC	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.478	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		-	0.00	77	0	G	NM_052896		34052206	-1	tier1	-	no_errors	ENST00000373381	ensembl	human	known	74_37	missense	46.03	34	29	SNP	0.992	A
CSPG4	1464	genome.wustl.edu	37	15	75979740	75979740	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:75979740C>T	ENST00000308508.5	-	3	3758	c.3666G>A	c.(3664-3666)acG>acA	p.T1222T		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1222	Gly/Ser-rich (glycosaminoglycan attachment domain).|Interaction with COL5A1. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GGGTGGCATCCGTGTGCACTG	0.622																																																	0													58.0	57.0	58.0					15																	75979740		2196	4294	6490	SO:0001819	synonymous_variant	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.3666G>A	15.37:g.75979740C>T			D3DW77|Q92675	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	p.T1222	ENST00000308508.5	37	c.3666	CCDS10284.1	15																																																																																			CSPG4	-	NULL	ENSG00000173546		0.622	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	-	0.00	91	0	C	NM_001897		75979740	-1	tier1	-	no_errors	ENST00000308508	ensembl	human	known	74_37	silent	24.56	129	42	SNP	0.000	T
CSRP2BP	57325	genome.wustl.edu	37	20	18123370	18123370	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr20:18123370G>T	ENST00000435364.3	+	1	407	c.66G>T	c.(64-66)tcG>tcT	p.S22S	CSRP2BP_ENST00000489634.2_5'Flank|PET117_ENST00000432901.3_3'UTR|CSRP2BP_ENST00000377681.3_Silent_p.S22S	NM_020536.4	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	22					chromatin organization (GO:0006325)|G2/M transition of mitotic cell cycle (GO:0000086)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|LIM domain binding (GO:0030274)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|stomach(1)	34						CGAGAACATCGACCTCAGAAG	0.542																																																	0													141.0	104.0	116.0					20																	18123370		2203	4300	6503	SO:0001819	synonymous_variant	0			AF252257	CCDS13133.1	20p11.23	2012-06-06			ENSG00000149474	ENSG00000149474			15904	protein-coding gene	gene with protein product	"""cysteine rich protein 2 binding protein"", ""ATAC component 2 homolog (Drosophila)"""					9286703, 10924333, 19103755	Standard	NR_028402		Approved	CRP2BP, dJ717M23.1, PRO1194, ATAC2, KAT14	uc021wbb.1	Q9H8E8	OTTHUMG00000031962	ENST00000435364.3:c.66G>T	20.37:g.18123370G>T			A2A2I5|Q96GW6|Q96IH3|Q9HBF0|Q9UIY5	Silent	SNP	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.S22	ENST00000435364.3	37	c.66	CCDS13133.1	20																																																																																			CSRP2BP	-	NULL	ENSG00000149474		0.542	CSRP2BP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSRP2BP	HGNC	protein_coding	OTTHUMT00000078152.5		0.00	29	0	G	NM_020536		18123370	+1			no_errors	ENST00000435364	ensembl	human	known	74_37	silent	7.69	36	3	SNP	0.098	T
CUL5	8065	genome.wustl.edu	37	11	107920757	107920758	+	Frame_Shift_Ins	INS	-	-	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:107920757_107920758insA	ENST00000393094.2	+	4	991_992	c.375_376insA	c.(376-378)aaafs	p.K126fs		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	126					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		AGGGCAGCAATAAAAAATCAAA	0.322																																																	0																																										SO:0001589	frameshift_variant	0			X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.381dupA	11.37:g.107920763_107920763dupA	ENSP00000376808:p.Lys126fs		A8K960|O14766|Q9BZC6	Frame_Shift_Ins	INS	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.S127fs	ENST00000393094.2	37	c.375_376	CCDS31668.1	11																																																																																			CUL5	-	pfam_Cullin_N,superfamily_Cullin_repeat-like_dom	ENSG00000166266		0.322	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL5	HGNC	protein_coding	OTTHUMT00000389429.1		0.00	71	0	-			107920758	+1	tier1		no_errors	ENST00000393094	ensembl	human	known	74_37	frame_shift_ins	17.80	97	21	INS	1.000:1.000	A
CXorf56	63932	genome.wustl.edu	37	X	118678377	118678377	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:118678377T>G	ENST00000371594.4	-	4	440	c.362A>C	c.(361-363)aAg>aCg	p.K121T	CXorf56_ENST00000536133.1_Missense_Mutation_p.K107T|CXorf56_ENST00000320339.4_Missense_Mutation_p.K72T|CXorf56_ENST00000469448.1_5'Flank	NM_022101.3	NP_071384.1	Q9H5V9	CX056_HUMAN	chromosome X open reading frame 56	121										cervix(1)|endometrium(2)|lung(7)	10						CTGGCCAAACTTGACTACTGC	0.443																																																	0													122.0	102.0	109.0					X																	118678377		2203	4300	6503	SO:0001583	missense	0			AK026618	CCDS55484.1, CCDS55485.1	Xq24	2008-02-05			ENSG00000018610	ENSG00000018610			26239	protein-coding gene	gene with protein product						12477932	Standard	NM_022101		Approved	FLJ22965	uc004erk.2	Q9H5V9	OTTHUMG00000022276	ENST00000371594.4:c.362A>C	X.37:g.118678377T>G	ENSP00000360652:p.Lys121Thr		A8MPX7|B4DQN2|D3DWH9|F5GWL7|O43351	Missense_Mutation	SNP	NULL	p.K121T	ENST00000371594.4	37	c.362	CCDS14579.1	X	.	.	.	.	.	.	.	.	.	.	T	17.37	3.372073	0.61624	.	.	ENSG00000018610	ENST00000486230;ENST00000320339;ENST00000371594;ENST00000536133;ENST00000476164	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.24547	0.0595	N	0.25647	0.755	0.58432	D	0.999993	P;P	0.50443	0.935;0.935	B;B	0.44108	0.441;0.441	T	0.02015	-1.1229	10	0.33141	T	0.24	-19.0176	12.736	0.57225	0.0:0.0:0.0:1.0	.	107;121	F5GWL7;Q9H5V9	.;CX056_HUMAN	T	121;72;121;107;121	ENSP00000420787:K121T;ENSP00000320345:K72T;ENSP00000360652:K121T;ENSP00000441786:K107T;ENSP00000420635:K121T	ENSP00000320345:K72T	K	-	2	0	CXorf56	118562405	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.286000	0.78671	1.596000	0.50062	0.441000	0.28932	AAG	CXorf56	-	NULL	ENSG00000018610		0.443	CXorf56-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf56	HGNC	protein_coding		-	0.00	29	0	T	NM_022101		118678377	-1	tier1	-	no_errors	ENST00000371594	ensembl	human	known	74_37	missense	28.00	36	14	SNP	1.000	G
CYFIP2	26999	genome.wustl.edu	37	5	156810274	156810274	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:156810274G>T	ENST00000521420.1	+	27	3127	c.3036G>T	c.(3034-3036)gaG>gaT	p.E1012D	CYFIP2_ENST00000377576.3_Splice_Site_p.E1038D|CTB-47B11.3_ENST00000520658.1_RNA|CYFIP2_ENST00000522463.1_Splice_Site_p.E842D|CYFIP2_ENST00000541131.1_Splice_Site_p.E963D|CYFIP2_ENST00000318218.6_Splice_Site_p.E1063D|CYFIP2_ENST00000442283.2_3'UTR|CTB-47B11.3_ENST00000508443.1_RNA|CYFIP2_ENST00000435847.2_Splice_Site_p.E737D|CYFIP2_ENST00000347377.6_Splice_Site_p.E1038D					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTTTTGCAGAGGGGGAGCGCC	0.572																																																	0													28.0	30.0	29.0					5																	156810274		1897	4101	5998	SO:0001630	splice_region_variant	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.3035-1G>T	5.37:g.156810274G>T				Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.E1063D	ENST00000521420.1	37	c.3189		5	.	.	.	.	.	.	.	.	.	.	G	19.45	3.830724	0.71258	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7;1.7;1.7	5.12	-0.747	0.11091	.	0.000000	0.85682	D	0.000000	T	0.39253	0.1071	L	0.52905	1.665	0.80722	D	1	B;B;B;B;B;B	0.34181	0.005;0.011;0.017;0.005;0.016;0.44	B;B;B;B;B;P	0.58928	0.012;0.029;0.032;0.016;0.012;0.848	T	0.17107	-1.0380	10	0.25106	T	0.35	.	9.2153	0.37344	0.6465:0.0:0.3535:0.0	.	902;842;1012;1038;1038;1063	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	D	1063;842;1012;1038;1038;963;737	ENSP00000325817:E1063D;ENSP00000428009:E842D;ENSP00000430904:E1012D;ENSP00000313567:E1038D;ENSP00000366799:E1038D;ENSP00000444645:E963D;ENSP00000403793:E737D	ENSP00000325817:E1063D	E	+	3	2	CYFIP2	156742852	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	2.687000	0.46976	-0.062000	0.13088	-0.251000	0.11542	GAG	CYFIP2	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000055163		0.572	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1		0.00	74	0	G	NM_001037332	Missense_Mutation	156810274	+1			no_errors	ENST00000318218	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
CYP4Z1	199974	genome.wustl.edu	37	1	47581139	47581140	+	Intron	INS	-	-	A	rs543056245|rs376649524|rs555056962	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:47581139_47581140insA	ENST00000334194.3	+	10	1204				CYP4A22-AS1_ENST00000444042.2_lincRNA|CYP4Z1_ENST00000471598.1_3'UTR	NM_178134.2	NP_835235.1	Q86W10	CP4Z1_HUMAN	cytochrome P450, family 4, subfamily Z, polypeptide 1							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			cervix(1)|large_intestine(4)|lung(4)|skin(1)|stomach(1)	11						aaGTAAAAGAGAAAAAAAAAAA	0.322																																																	0																																										SO:0001627	intron_variant	0			AY262056	CCDS545.1	1p33	2008-02-05			ENSG00000186160	ENSG00000186160		"""Cytochrome P450s"""	20583	protein-coding gene	gene with protein product						15059886	Standard	NM_178134		Approved	CYP4A20	uc001cqu.1	Q86W10	OTTHUMG00000008019	ENST00000334194.3:c.1202-61->A	1.37:g.47581150_47581150dupA			Q5VVE4	RNA	INS	-	NULL	ENST00000334194.3	37	NULL	CCDS545.1	1																																																																																			CYP4Z1	-	-	ENSG00000186160		0.322	CYP4Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4Z1	HGNC	protein_coding	OTTHUMT00000022020.1		0.00	20	0	-	NM_178134		47581140	+1	tier1		no_errors	ENST00000471598	ensembl	human	known	74_37	rna	13.04	20	3	INS	0.010:0.010	A
CYP7B1	9420	genome.wustl.edu	37	8	65537027	65537027	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:65537027T>A	ENST00000310193.3	-	2	365	c.192A>T	c.(190-192)aaA>aaT	p.K64N		NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	64					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TTAAGGGGTCTTTTCGTAAGT	0.383																																																	0													139.0	136.0	137.0					8																	65537027		2203	4300	6503	SO:0001583	missense	0			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.192A>T	8.37:g.65537027T>A	ENSP00000310721:p.Lys64Asn		B2RN07|Q9UNF5	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	p.K64N	ENST00000310193.3	37	c.192	CCDS6180.1	8	.	.	.	.	.	.	.	.	.	.	T	13.80	2.345159	0.41498	.	.	ENSG00000172817	ENST00000310193	T	0.68765	-0.35	5.63	-1.12	0.09808	.	0.211223	0.50627	D	0.000118	T	0.60779	0.2295	M	0.69823	2.125	0.33912	D	0.639802	B	0.27068	0.167	B	0.33690	0.168	T	0.60052	-0.7338	10	0.56958	D	0.05	-24.619	5.8037	0.18428	0.1222:0.3587:0.0:0.5191	.	64	O75881	CP7B1_HUMAN	N	64	ENSP00000310721:K64N	ENSP00000310721:K64N	K	-	3	2	CYP7B1	65699581	0.998000	0.40836	0.005000	0.12908	0.004000	0.04260	0.793000	0.26944	-0.105000	0.12132	0.482000	0.46254	AAA	CYP7B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000172817		0.383	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7B1	HGNC	protein_coding	OTTHUMT00000378550.1	-	0.00	74	0	T			65537027	-1	tier1	-	no_errors	ENST00000310193	ensembl	human	known	74_37	missense	32.04	70	33	SNP	0.907	A
DCAF8L2	347442	genome.wustl.edu	37	X	27766867	27766867	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:27766867G>T	ENST00000451261.2	+	5	2254	c.1855G>T	c.(1855-1857)Gag>Tag	p.E619*		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	619										central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						AGAGACATCTGAGGAGGAGGT	0.502																																																	0													28.0	21.0	23.0					X																	27766867		692	1591	2283	SO:0001587	stop_gained	0				CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.1855G>T	X.37:g.27766867G>T	ENSP00000462745:p.Glu619*		B2RXH9|J3KT06	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E619*	ENST00000451261.2	37	c.1855	CCDS59162.1	X																																																																																			DCAF8L2	-	NULL	ENSG00000189186		0.502	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L2	HGNC	protein_coding	OTTHUMT00000056143.4	-	0.00	26	0	G	XM_293354		27766867	+1	tier1	-	no_errors	ENST00000451261	ensembl	human	known	74_37	nonsense	36.00	16	9	SNP	0.772	T
DDX60	55601	genome.wustl.edu	37	4	169157430	169157430	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:169157430A>T	ENST00000393743.3	-	33	4797	c.4506T>A	c.(4504-4506)gaT>gaA	p.D1502E		NM_017631.5	NP_060101.3	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1502					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(4)|urinary_tract(4)	63		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		CGAAGTGTGCATCTTGGAACT	0.318																																																	0													93.0	90.0	91.0					4																	169157430		2201	4297	6498	SO:0001583	missense	0			AK001649	CCDS34097.1	4q32.3	2010-02-17			ENSG00000137628	ENSG00000137628			25942	protein-coding gene	gene with protein product		613974				12477932	Standard	NM_017631		Approved	FLJ20035	uc003irp.3	Q8IY21	OTTHUMG00000161350	ENST00000393743.3:c.4506T>A	4.37:g.169157430A>T	ENSP00000377344:p.Asp1502Glu		Q6PK35|Q9NVE3	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D1502E	ENST00000393743.3	37	c.4506	CCDS34097.1	4	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.546986	0.00926	.	.	ENSG00000137628	ENST00000393743	T	0.15372	2.43	4.65	-7.91	0.01165	.	0.872830	0.09999	N	0.728708	T	0.03348	0.0097	N	0.02960	-0.455	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.31971	-0.9924	10	0.02654	T	1	.	1.6383	0.02747	0.1359:0.196:0.2082:0.4599	.	1502	Q8IY21	DDX60_HUMAN	E	1502	ENSP00000377344:D1502E	ENSP00000377344:D1502E	D	-	3	2	DDX60	169394005	0.000000	0.05858	0.000000	0.03702	0.254000	0.26022	-2.077000	0.01371	-1.724000	0.01373	0.455000	0.32223	GAT	DDX60	-	NULL	ENSG00000137628		0.318	DDX60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX60	HGNC	protein_coding	OTTHUMT00000364622.1	-	0.00	53	0	A	NM_017631		169157430	-1	tier1	-	no_errors	ENST00000393743	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.000	T
DENND2A	27147	genome.wustl.edu	37	7	140269504	140269504	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:140269504C>T	ENST00000275884.6	-	6	1898	c.1481G>A	c.(1480-1482)cGg>cAg	p.R494Q	DENND2A_ENST00000537639.1_Missense_Mutation_p.R494Q|DENND2A_ENST00000496613.1_Missense_Mutation_p.R494Q|DENND2A_ENST00000492720.1_Missense_Mutation_p.R494Q			Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	494					positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(22)|ovary(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49	Melanoma(164;0.00956)					CTTTCCTCTCCGGACCTCATA	0.567																																																	0													137.0	138.0	137.0					7																	140269504		1950	4161	6111	SO:0001583	missense	0			AB033103	CCDS43659.1	7q34	2012-10-03	2005-08-17	2005-08-17	ENSG00000146966	ENSG00000146966		"""DENN/MADD domain containing"""	22212	protein-coding gene	gene with protein product			"""KIAA1277"""	KIAA1277			Standard	NM_015689		Approved	FAM31D	uc010lnj.3	Q9ULE3	OTTHUMG00000157411	ENST00000275884.6:c.1481G>A	7.37:g.140269504C>T	ENSP00000275884:p.Arg494Gln		C9JUI3|Q1RMD5|Q86XY0	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.R494Q	ENST00000275884.6	37	c.1481	CCDS43659.1	7	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677300	0.88445	.	.	ENSG00000146966	ENST00000275884;ENST00000537639;ENST00000496613;ENST00000492720	T;T;T;T	0.12672	3.37;3.37;3.37;2.66	4.74	4.74	0.60224	.	0.081588	0.50627	N	0.000106	T	0.32285	0.0824	L	0.46157	1.445	0.54753	D	0.999986	D;P	0.89917	1.0;0.906	D;B	0.79108	0.992;0.259	T	0.05632	-1.0873	10	0.72032	D	0.01	-19.0906	17.7358	0.88392	0.0:1.0:0.0:0.0	.	494;494	Q9ULE3-2;Q9ULE3	.;DEN2A_HUMAN	Q	494	ENSP00000275884:R494Q;ENSP00000442245:R494Q;ENSP00000419654:R494Q;ENSP00000419464:R494Q	ENSP00000275884:R494Q	R	-	2	0	DENND2A	139915973	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.424000	0.66464	2.184000	0.69523	0.462000	0.41574	CGG	DENND2A	-	NULL	ENSG00000146966		0.567	DENND2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND2A	HGNC	protein_coding	OTTHUMT00000348742.1	-	0.00	56	0	C	NM_015689		140269504	-1	tier1	-	no_errors	ENST00000275884	ensembl	human	known	74_37	missense	29.27	58	24	SNP	1.000	T
DGKG	1608	genome.wustl.edu	37	3	185986619	185986619	+	Missense_Mutation	SNP	C	C	T	rs574769788		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:185986619C>T	ENST00000265022.3	-	12	1626	c.1087G>A	c.(1087-1089)Gcg>Acg	p.A363T	DGKG_ENST00000382164.4_Intron|DGKG_ENST00000544847.1_Intron|DGKG_ENST00000344484.4_Missense_Mutation_p.A363T	NM_001080744.1|NM_001080745.1|NM_001346.2	NP_001074213.1|NP_001074214.1|NP_001337.2	P49619	DGKG_HUMAN	diacylglycerol kinase, gamma 90kDa	363					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|neuron development (GO:0048666)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	42	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	CAGTGCCGCGCGGTGACACTC	0.607													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19500	0.0		0.0	False		,,,				2504	0.0																0													77.0	59.0	65.0					3																	185986619		2203	4300	6503	SO:0001583	missense	0			AF020945	CCDS3274.1, CCDS43181.1, CCDS43182.1	3q27-q28	2013-01-10	2002-08-29		ENSG00000058866	ENSG00000058866	2.7.1.107	"""EF-hand domain containing"""	2853	protein-coding gene	gene with protein product		601854	"""diacylglycerol kinase, gamma (90kD)"""	DAGK3		8034597	Standard	NM_001080744		Approved		uc003fqa.3	P49619	OTTHUMG00000156617	ENST00000265022.3:c.1087G>A	3.37:g.185986619C>T	ENSP00000265022:p.Ala363Thr		B2RAH4|Q2M1H4|Q5FWG1	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_EF_hand_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_EF_hand_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.A363T	ENST00000265022.3	37	c.1087	CCDS3274.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.123312	0.94429	.	.	ENSG00000058866	ENST00000265022;ENST00000344484;ENST00000437018	D;D;D	0.84800	-1.9;-1.9;-1.9	5.16	4.24	0.50183	Protein kinase C-like, phorbol ester/diacylglycerol binding (3);	0.064498	0.64402	D	0.000013	D	0.83866	0.5347	L	0.45352	1.415	0.80722	D	1	D;D	0.61697	0.973;0.99	P;P	0.48704	0.587;0.565	D	0.86261	0.1655	10	0.87932	D	0	.	14.6577	0.68847	0.1452:0.8548:0.0:0.0	.	363;363	P49619-2;P49619	.;DGKG_HUMAN	T	363;363;114	ENSP00000265022:A363T;ENSP00000339777:A363T;ENSP00000395526:A114T	ENSP00000265022:A363T	A	-	1	0	DGKG	187469313	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.645000	0.67909	2.590000	0.87494	0.563000	0.77884	GCG	DGKG	-	smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000058866		0.607	DGKG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKG	HGNC	protein_coding	OTTHUMT00000344800.3		0.00	35	0	C			185986619	-1			no_errors	ENST00000265022	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
DIS3L2	129563	genome.wustl.edu	37	2	233198653	233198653	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:233198653G>T	ENST00000409307.1	+	16	2114	c.2114G>T	c.(2113-2115)cGc>cTc	p.R705L	DIS3L2_ENST00000325385.7_Missense_Mutation_p.R705L|DIS3L2_ENST00000273009.6_Intron					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		CCCATCCGCCGCTTTGCCGAC	0.677																																																	0													48.0	54.0	52.0					2																	233198653		2156	4253	6409	SO:0001583	missense	0			BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.2114G>T	2.37:g.233198653G>T	ENSP00000386799:p.Arg705Leu			Missense_Mutation	SNP	NULL	p.R705L	ENST00000409307.1	37	c.2114	CCDS42834.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	28.7|28.7	4.945432|4.945432	0.92593|0.92593	.|.	.|.	ENSG00000144535|ENSG00000144535	ENST00000434477|ENST00000325385;ENST00000409307;ENST00000424049	.|T;T;T	.|0.72835	.|-0.69;-0.69;-0.69	4.3|4.3	4.3|4.3	0.51218|0.51218	.|Ribonuclease II/R, conserved site (1);Ribonuclease II/R (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.91240|0.91240	0.7239|0.7239	H|H	0.99415|0.99415	4.555|4.555	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.97110	.|1.0	D|D	0.95403|0.95403	0.8491|0.8491	5|10	.|0.87932	.|D	.|0	-22.9109|-22.9109	16.8176|16.8176	0.85738|0.85738	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|705	.|Q8IYB7	.|DI3L2_HUMAN	S|L	1|705;705;340	.|ENSP00000315569:R705L;ENSP00000386799:R705L;ENSP00000415419:R340L	.|ENSP00000315569:R705L	A|R	+|+	1|2	0|0	DIS3L2|DIS3L2	232906897|232906897	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.995000|0.995000	0.86356|0.86356	9.248000|9.248000	0.95456|0.95456	2.130000|2.130000	0.65690|0.65690	0.645000|0.645000	0.84053|0.84053	GCT|CGC	DIS3L2	-	NULL	ENSG00000144535		0.677	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3L2	HGNC	protein_coding	OTTHUMT00000330988.1		0.00	50	0	G	NM_152383		233198653	+1			no_errors	ENST00000325385	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	T
DLGAP5	9787	genome.wustl.edu	37	14	55646413	55646413	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:55646413G>A	ENST00000247191.2	-	7	924	c.708C>T	c.(706-708)aaC>aaT	p.N236N	DLGAP5_ENST00000395425.2_Silent_p.N236N	NM_014750.4	NP_055565.3	Q15398	DLGP5_HUMAN	discs, large (Drosophila) homolog-associated protein 5	236					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|dephosphorylation (GO:0016311)|mitotic chromosome movement towards spindle pole (GO:0007079)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|spindle pole centrosome (GO:0031616)	phosphoprotein phosphatase activity (GO:0004721)			biliary_tract(1)|breast(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	44						CTTCTGGTTCGTTTTCTAAAA	0.323																																																	0													90.0	82.0	85.0					14																	55646413		2202	4299	6501	SO:0001819	synonymous_variant	0			D13633	CCDS9723.1, CCDS53897.1	14q22.3	2008-05-30	2008-05-30	2008-05-30	ENSG00000126787	ENSG00000126787			16864	protein-coding gene	gene with protein product			"""discs, large homolog 7 (Drosophila)"""	DLG7		7584026, 7584028	Standard	NM_014750		Approved	KIAA0008, DLG1, HURP	uc001xbs.3	Q15398	OTTHUMG00000140310	ENST00000247191.2:c.708C>T	14.37:g.55646413G>A			A8MTM6|B4DRM8|Q86T11|Q8NG58	Silent	SNP	pfam_GKAP	p.N236	ENST00000247191.2	37	c.708	CCDS9723.1	14																																																																																			DLGAP5	-	NULL	ENSG00000126787		0.323	DLGAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP5	HGNC	protein_coding	OTTHUMT00000276908.2		0.00	54	0	G	NM_014750		55646413	-1			no_errors	ENST00000247191	ensembl	human	known	74_37	silent	5.00	57	3	SNP	0.957	A
DNAH11	8701	genome.wustl.edu	37	7	21784185	21784185	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:21784185A>G	ENST00000409508.3	+	50	8315	c.8284A>G	c.(8284-8286)Aga>Gga	p.R2762G	DNAH11_ENST00000328843.6_Missense_Mutation_p.R2769G	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2769					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GTTTCAGAGAAGAATGCTGGA	0.368									Kartagener syndrome																																								0													95.0	92.0	93.0					7																	21784185		1856	4106	5962	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8284A>G	7.37:g.21784185A>G	ENSP00000475939:p.Arg2762Gly		Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,smart_AAA+_ATPase	p.R2769G	ENST00000409508.3	37	c.8305		7	.	.	.	.	.	.	.	.	.	.	A	14.14	2.447895	0.43429	.	.	ENSG00000105877	ENST00000328843	T	0.22743	1.94	5.91	5.91	0.95273	.	0.226724	0.43260	D	0.000595	T	0.18215	0.0437	.	.	.	0.19945	N	0.999942	B	0.13594	0.008	B	0.11329	0.006	T	0.11842	-1.0571	9	0.30854	T	0.27	.	16.3483	0.83171	1.0:0.0:0.0:0.0	.	2769	Q96DT5	DYH11_HUMAN	G	2769	ENSP00000330671:R2769G	ENSP00000330671:R2769G	R	+	1	2	DNAH11	21750710	0.771000	0.28555	0.717000	0.30585	0.953000	0.61014	1.165000	0.31822	2.254000	0.74563	0.533000	0.62120	AGA	DNAH11	-	superfamily_P-loop_NTPase	ENSG00000105877		0.368	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	-	0.00	51	0	A	NM_003777		21784185	+1	tier1	-	no_errors	ENST00000328843	ensembl	human	known	74_37	missense	19.28	67	16	SNP	0.972	G
DNAH3	55567	genome.wustl.edu	37	16	20996637	20996637	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:20996637A>G	ENST00000261383.3	-	48	7426	c.7427T>C	c.(7426-7428)aTc>aCc	p.I2476T	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2476	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CTGCAGTATGATCTTCTTAAG	0.498																																																	0													104.0	80.0	88.0					16																	20996637		2201	4300	6501	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.7427T>C	16.37:g.20996637A>G	ENSP00000261383:p.Ile2476Thr		O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_AAA+_ATPase	p.I2476T	ENST00000261383.3	37	c.7427	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	A	15.19	2.760524	0.49468	.	.	ENSG00000158486	ENST00000261383	T	0.43294	0.95	5.52	5.52	0.82312	Dynein heavy chain, P-loop containing D4 domain (1);	0.157296	0.42821	D	0.000650	T	0.51143	0.1657	M	0.68952	2.095	0.80722	D	1	P	0.44344	0.833	P	0.46685	0.524	T	0.56649	-0.7944	10	0.72032	D	0.01	.	15.6564	0.77140	1.0:0.0:0.0:0.0	.	2476	Q8TD57	DYH3_HUMAN	T	2476	ENSP00000261383:I2476T	ENSP00000261383:I2476T	I	-	2	0	DNAH3	20904138	1.000000	0.71417	1.000000	0.80357	0.455000	0.32408	6.148000	0.71788	2.100000	0.63781	0.533000	0.62120	ATC	DNAH3	-	superfamily_P-loop_NTPase	ENSG00000158486		0.498	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	-	0.00	22	0	A	NM_017539		20996637	-1	tier1	-	no_errors	ENST00000261383	ensembl	human	known	74_37	missense	36.36	28	16	SNP	1.000	G
DOCK2	1794	genome.wustl.edu	37	5	169108824	169108824	+	Silent	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:169108824T>C	ENST00000256935.8	+	7	627	c.547T>C	c.(547-549)Ttg>Ctg	p.L183L		NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	183					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGTCATCAGCTTGTTCCATGC	0.398																																																	0													151.0	142.0	145.0					5																	169108824		2203	4300	6503	SO:0001819	synonymous_variant	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.547T>C	5.37:g.169108824T>C			Q2M3I0|Q96AK7	Silent	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c-like_dom,superfamily_ARM-type_fold,superfamily_Ferritin-like_SF,smart_SH3_domain,pfscan_SH3_domain	p.L183	ENST00000256935.8	37	c.547	CCDS4371.1	5																																																																																			DOCK2	-	NULL	ENSG00000134516		0.398	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	-	0.00	62	0	T	NM_004946		169108824	+1	tier1	-	no_errors	ENST00000256935	ensembl	human	known	74_37	silent	26.25	59	21	SNP	1.000	C
DSCAML1	57453	genome.wustl.edu	37	11	117387276	117387276	+	Silent	SNP	G	G	A	rs575618156		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:117387276G>A	ENST00000321322.6	-	8	1870	c.1869C>T	c.(1867-1869)gaC>gaT	p.D623D	DSCAML1_ENST00000527706.1_Silent_p.D353D	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	563	Ig-like C2-type 7.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		CCTTCTGCACGTCAGTCAGCT	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		20363	0.0		0.0	False		,,,				2504	0.001																0													118.0	90.0	100.0					11																	117387276		2201	4296	6497	SO:0001819	synonymous_variant	0				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.1869C>T	11.37:g.117387276G>A			Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.D623	ENST00000321322.6	37	c.1869	CCDS8384.1	11																																																																																			DSCAML1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000177103		0.577	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	-	0.00	35	0	G	NM_020693		117387276	-1	tier1	-	no_errors	ENST00000321322	ensembl	human	known	74_37	silent	59.65	23	34	SNP	0.497	A
DSE	29940	genome.wustl.edu	37	6	116757008	116757008	+	Silent	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:116757008T>G	ENST00000331677.3	+	7	1821	c.1377T>G	c.(1375-1377)acT>acG	p.T459T	DSE_ENST00000359564.2_Silent_p.T459T|DSE_ENST00000452085.3_Silent_p.T459T|DSE_ENST00000537543.1_Silent_p.T478T			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	459					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		ACTCATTTACTTTTGCTCCCA	0.393																																																	0													67.0	59.0	61.0					6																	116757008		2203	4300	6503	SO:0001819	synonymous_variant	0			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.1377T>G	6.37:g.116757008T>G			Q5R3K6	Silent	SNP	superfamily_Chondroitin_lyas	p.T478	ENST00000331677.3	37	c.1434	CCDS5107.1	6																																																																																			DSE	-	NULL	ENSG00000111817		0.393	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DSE	HGNC	protein_coding	OTTHUMT00000041940.2	-	0.00	30	0	T	NM_013352		116757008	+1	tier1	-	no_errors	ENST00000537543	ensembl	human	known	74_37	silent	87.18	5	34	SNP	0.962	G
DSEL	92126	genome.wustl.edu	37	18	65180368	65180368	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr18:65180368T>C	ENST00000310045.7	-	2	2981	c.1508A>G	c.(1507-1509)aAg>aGg	p.K503R	CTD-2541J13.2_ENST00000583493.1_RNA|CTD-2541J13.2_ENST00000581951.1_RNA	NM_032160.2	NP_115536.1	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	493					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	isomerase activity (GO:0016853)|sulfotransferase activity (GO:0008146)			NS(3)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(25)|lung(23)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	74		Esophageal squamous(42;0.129)				GTGGCTCAACTTGGGTCCATA	0.463																																																	0													99.0	91.0	94.0					18																	65180368		2203	4300	6503	SO:0001583	missense	0			AF480435	CCDS11995.1	18q22.1	2007-01-29	2007-01-29	2007-01-29	ENSG00000171451	ENSG00000171451			18144	protein-coding gene	gene with protein product		611125	"""chromosome 18 open reading frame 4"""	C18orf4		16505484	Standard	NM_032160		Approved	NCAG1, FLJ11477	uc002lke.1	Q8IZU8	OTTHUMG00000132804	ENST00000310045.7:c.1508A>G	18.37:g.65180368T>C	ENSP00000310565:p.Lys503Arg		Q17RH1|Q6P5Z3	Missense_Mutation	SNP	pfam_Sulfotransferase_dom,superfamily_P-loop_NTPase,superfamily_Chondroitin_lyas	p.K503R	ENST00000310045.7	37	c.1508	CCDS11995.1	18	.	.	.	.	.	.	.	.	.	.	T	20.2	3.949189	0.73787	.	.	ENSG00000171451	ENST00000310045;ENST00000397964	T	0.26957	1.7	5.46	5.46	0.80206	.	0.000000	0.85682	U	0.000000	T	0.53222	0.1783	M	0.80183	2.485	0.51012	D	0.999906	D	0.76494	0.999	D	0.80764	0.994	T	0.56715	-0.7933	10	0.49607	T	0.09	-15.6172	15.2042	0.73165	0.0:0.0:0.0:1.0	.	493	Q8IZU8	DSEL_HUMAN	R	503;493	ENSP00000310565:K503R	ENSP00000310565:K503R	K	-	2	0	DSEL	63331348	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.849000	0.86908	2.083000	0.62718	0.460000	0.39030	AAG	DSEL	-	NULL	ENSG00000171451		0.463	DSEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSEL	HGNC	protein_coding	OTTHUMT00000256221.1	-	0.00	68	0	T	NM_032160		65180368	-1	tier1	-	no_errors	ENST00000310045	ensembl	human	known	74_37	missense	77.14	8	27	SNP	1.000	C
EGFLAM	133584	genome.wustl.edu	37	5	38407099	38407099	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:38407099A>C	ENST00000354891.3	+	8	1344	c.998A>C	c.(997-999)aAg>aCg	p.K333T	EGFLAM_ENST00000397202.2_Intron|EGFLAM_ENST00000336740.6_Missense_Mutation_p.K99T|EGFLAM_ENST00000322350.5_Missense_Mutation_p.K333T	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	333					extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					AGAAAGGGGAAGAATGGTGTG	0.532																																					Colon(62;485 1295 3347 17454)												0													143.0	135.0	138.0					5																	38407099		2203	4300	6503	SO:0001583	missense	0			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.998A>C	5.37:g.38407099A>C	ENSP00000346964:p.Lys333Thr		A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.K333T	ENST00000354891.3	37	c.998	CCDS56363.1	5	.	.	.	.	.	.	.	.	.	.	A	5.347	0.249291	0.10130	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000339580	T;T;T	0.79653	0.82;0.65;-1.29	5.91	2.08	0.27032	.	0.521087	0.23444	N	0.048113	T	0.70430	0.3223	L	0.57536	1.79	0.09310	N	0.999994	B;B;B	0.09022	0.0;0.001;0.002	B;B;B	0.06405	0.001;0.001;0.002	T	0.51236	-0.8731	10	0.11485	T	0.65	-3.7249	6.8762	0.24149	0.2163:0.6556:0.1282:0.0	.	99;333;333	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	T	333;333;99;99	ENSP00000346964:K333T;ENSP00000313084:K333T;ENSP00000337607:K99T	ENSP00000313084:K333T	K	+	2	0	EGFLAM	38442856	0.438000	0.25602	0.025000	0.17156	0.006000	0.05464	2.227000	0.42972	0.412000	0.25729	0.533000	0.62120	AAG	EGFLAM	-	NULL	ENSG00000164318		0.532	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	HGNC	protein_coding	OTTHUMT00000367323.1	-	0.00	48	0	A	NM_152403		38407099	+1	tier1	-	no_errors	ENST00000354891	ensembl	human	known	74_37	missense	21.88	49	14	SNP	0.065	C
EDIL3	10085	genome.wustl.edu	37	5	83433072	83433072	+	Silent	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:83433072T>C	ENST00000296591.5	-	5	874	c.456A>G	c.(454-456)agA>agG	p.R152R	EDIL3_ENST00000380138.3_Silent_p.R142R	NM_005711.3	NP_005702.3	O43854	EDIL3_HUMAN	EGF-like repeats and discoidin I-like domains 3	152	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|prostate(5)|skin(3)	31		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)		ATTGACAATTTCTTCCCATAA	0.388																																																	0													158.0	136.0	143.0					5																	83433072		2203	4300	6503	SO:0001819	synonymous_variant	0			U70312	CCDS4062.1, CCDS64195.1	5q14	2008-02-05			ENSG00000164176	ENSG00000164176			3173	protein-coding gene	gene with protein product		606018				9420328	Standard	NM_005711		Approved	DEL1	uc003kio.1	O43854	OTTHUMG00000119047	ENST00000296591.5:c.456A>G	5.37:g.83433072T>C			B2R763|O43855|Q5D094|Q8N610	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_EG-like_dom,pfam_EGF_extracell,superfamily_Galactose-bd-like,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,smart_Coagulation_fac_5/8-C_type_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.R152	ENST00000296591.5	37	c.456	CCDS4062.1	5																																																																																			EDIL3	-	pfam_EGF_extracell,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000164176		0.388	EDIL3-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EDIL3	HGNC	protein_coding	OTTHUMT00000239258.1	-	0.00	40	0	T	NM_005711		83433072	-1	tier1	-	no_errors	ENST00000296591	ensembl	human	known	74_37	silent	30.43	32	14	SNP	0.977	C
EHD3	30845	genome.wustl.edu	37	2	31489489	31489489	+	Silent	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:31489489A>G	ENST00000322054.5	+	6	1812	c.1527A>G	c.(1525-1527)aaA>aaG	p.K509K	EHD3_ENST00000541626.1_3'UTR	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	509	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EH. {ECO:0000255|PROSITE- ProRule:PRU00077}.				blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					ACCTCATCAAAGTCAAGCTGG	0.602																																																	0													92.0	86.0	88.0					2																	31489489		2203	4300	6503	SO:0001819	synonymous_variant	0			AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.1527A>G	2.37:g.31489489A>G			B4DFR5|D6W574|Q8N514|Q9NZB3	Silent	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	p.K509	ENST00000322054.5	37	c.1527	CCDS1774.1	2																																																																																			EHD3	-	smart_EPS15_homology,pfscan_EF_hand_dom,pfscan_EPS15_homology	ENSG00000013016		0.602	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD3	HGNC	protein_coding	OTTHUMT00000216810.1	-	0.00	78	0	A	NM_014600		31489489	+1	tier1	-	no_errors	ENST00000322054	ensembl	human	known	74_37	silent	28.57	50	20	SNP	0.992	G
ELMO1	9844	genome.wustl.edu	37	7	37251031	37251031	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:37251031T>C	ENST00000310758.4	-	13	1693	c.1046A>G	c.(1045-1047)aAg>aGg	p.K349R	ELMO1_ENST00000442504.1_Missense_Mutation_p.K349R|ELMO1_ENST00000448602.1_Missense_Mutation_p.K349R	NM_001206480.1|NM_014800.10	NP_001193409.1|NP_055615.8	Q92556	ELMO1_HUMAN	engulfment and cell motility 1	349	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|phagocytosis, engulfment (GO:0006911)|Rac protein signal transduction (GO:0016601)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(28)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	58						GTACATGGACTTGCGTTTCTC	0.493																																																	0													185.0	132.0	150.0					7																	37251031		2203	4300	6503	SO:0001583	missense	0			AF398885	CCDS5449.1, CCDS5450.1	7p14.1	2012-07-10	2006-01-20		ENSG00000155849	ENSG00000155849		"""Engulfment and cell motility proteins"""	16286	protein-coding gene	gene with protein product		606420	"""engulfment and cell motility 1 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_001039459		Approved	KIAA0281, CED12, ELMO-1, CED-12	uc003tfk.2	Q92556	OTTHUMG00000023701	ENST00000310758.4:c.1046A>G	7.37:g.37251031T>C	ENSP00000312185:p.Lys349Arg		A4D1X6|Q29R79|Q6ZTJ0|Q96PB0|Q9H0I1	Missense_Mutation	SNP	pfam_DUF3361,pfam_Engulfment_cell_motility_ELMO,superfamily_ARM-type_fold	p.K349R	ENST00000310758.4	37	c.1046	CCDS5449.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.57|10.57	1.387418|1.387418	0.25031|0.25031	.|.	.|.	ENSG00000155849|ENSG00000155849	ENST00000310758;ENST00000361912;ENST00000442504;ENST00000448602;ENST00000424212|ENST00000433246	T;T;T;T|.	0.32753|.	2.42;2.42;2.42;1.44|.	4.9|4.9	4.9|4.9	0.64082|0.64082	Engulfment/cell motility, ELMO (2);|.	0.054466|.	0.64402|.	D|.	0.000001|.	T|T	0.52025|0.52025	0.1709|0.1709	N|N	0.24115|0.24115	0.695|0.695	0.80722|0.80722	D|D	1|1	B|.	0.27264|.	0.173|.	B|.	0.32533|.	0.147|.	T|T	0.48896|0.48896	-0.8994|-0.8994	10|5	0.02654|.	T|.	1|.	.|.	15.2288|15.2288	0.73372|0.73372	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	349|.	Q92556|.	ELMO1_HUMAN|.	R|G	349;253;349;349;90|129	ENSP00000312185:K349R;ENSP00000406952:K349R;ENSP00000394458:K349R;ENSP00000395933:K90R|.	ENSP00000312185:K349R|.	K|S	-|-	2|1	0|0	ELMO1|ELMO1	37217556|37217556	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.907000|0.907000	0.53573|0.53573	7.997000|7.997000	0.88414|0.88414	2.142000|2.142000	0.66516|0.66516	0.402000|0.402000	0.26972|0.26972	AAG|AGT	ELMO1	-	pfam_Engulfment_cell_motility_ELMO	ENSG00000155849		0.493	ELMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMO1	HGNC	protein_coding	OTTHUMT00000219830.4	-	0.00	101	0	T	NM_130442		37251031	-1	tier1	-	no_errors	ENST00000310758	ensembl	human	known	74_37	missense	18.98	111	26	SNP	1.000	C
ENO2	2026	genome.wustl.edu	37	12	7031523	7031523	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:7031523C>G	ENST00000535366.1	+	10	1819	c.1193C>G	c.(1192-1194)cCg>cGg	p.P398R	ENO2_ENST00000229277.1_Missense_Mutation_p.P398R|ENO2_ENST00000541477.1_Missense_Mutation_p.P398R|ENO2_ENST00000544774.1_Missense_Mutation_p.P355R|ATN1_ENST00000356654.4_5'Flank|ENO2_ENST00000545045.2_Missense_Mutation_p.P279R|ENO2_ENST00000538763.1_Missense_Mutation_p.P355R|ENO2_ENST00000534977.1_3'UTR			P09104	ENOG_HUMAN	enolase 2 (gamma, neuronal)	398					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|perikaryon (GO:0043204)|phosphopyruvate hydratase complex (GO:0000015)|photoreceptor inner segment (GO:0001917)|plasma membrane (GO:0005886)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			endometrium(3)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						ACTGGTGCCCCGTGCCGTTCT	0.552																																																	0													91.0	82.0	85.0					12																	7031523		2203	4300	6503	SO:0001583	missense	0			M22349	CCDS8570.1	12p13	2012-10-02				ENSG00000111674	4.2.1.11		3353	protein-coding gene	gene with protein product		131360					Standard	NM_001975		Approved		uc001qru.1	P09104		ENST00000535366.1:c.1193C>G	12.37:g.7031523C>G	ENSP00000437402:p.Pro398Arg		B7Z2X9|Q96J33	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N,pfam_MeAsp_NH4-lyase_C,pirsf_Enolase,prints_Enolase,tigrfam_Enolase	p.P398R	ENST00000535366.1	37	c.1193	CCDS8570.1	12	.	.	.	.	.	.	.	.	.	.	C	23.4	4.406163	0.83230	.	.	ENSG00000111674	ENST00000541477;ENST00000229277;ENST00000538763;ENST00000544774;ENST00000535366;ENST00000545045	T;T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2;2.2	4.22	4.22	0.49857	Enolase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.67107	0.2858	H	0.99507	4.6	0.80722	D	1	D;D	0.76494	0.994;0.999	D;D	0.83275	0.987;0.996	D	0.83903	0.0291	10	0.87932	D	0	-8.7412	17.1386	0.86747	0.0:1.0:0.0:0.0	.	355;398	B7Z2X9;P09104	.;ENOG_HUMAN	R	398;398;355;355;398;279	ENSP00000438873:P398R;ENSP00000229277:P398R;ENSP00000441490:P355R;ENSP00000446195:P355R;ENSP00000437402:P398R;ENSP00000438062:P279R	ENSP00000229277:P398R	P	+	2	0	ENO2	6901784	1.000000	0.71417	0.976000	0.42696	0.957000	0.61999	7.651000	0.83577	2.361000	0.80049	0.455000	0.32223	CCG	ENO2	-	pfam_Enolase_C,pirsf_Enolase,tigrfam_Enolase	ENSG00000111674		0.552	ENO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENO2	HGNC	protein_coding	OTTHUMT00000401786.1		0.00	32	0	C			7031523	+1			no_errors	ENST00000229277	ensembl	human	known	74_37	missense	5.71	33	2	SNP	1.000	G
BCRP7	100133163	genome.wustl.edu	37	22	18844968	18844968	+	3'UTR	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr22:18844968G>T	ENST00000412938.1	+	0	3218																											TCTGGAAAGAGCACGGAAATG	0.577																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000412938.1:c.*3215G>T	22.37:g.18844968G>T				RNA	SNP	-	NULL	ENST00000412938.1	37	NULL		22																																																																																			AC008132.13	-	-	ENSG00000161103		0.577	AC008132.13-002	KNOWN	basic	processed_transcript	ENSG00000161103	Clone_based_vega_gene	protein_coding	OTTHUMT00000471615.1	-	0.00	19	0	G			18844968	+1	tier1	-	no_errors	ENST00000412938	ensembl	human	known	74_37	rna	52.63	8	10	SNP	0.008	T
RP11-159F24.2	0	genome.wustl.edu	37	5	43348817	43348817	+	RNA	DEL	A	A	-	rs553054916	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:43348817delA	ENST00000511991.1	+	0	431																											CCAAACTCTTAAAAAAAAAAA	0.338														4	0.000798722	0.0023	0.0014	5008	,	,		18773	0.0		0.0	False		,,,				2504	0.0																0																																												0																															5.37:g.43348817delA				RNA	DEL	-	NULL	ENST00000511991.1	37	NULL		5																																																																																			RP11-159F24.2	-	-	ENSG00000188850		0.338	RP11-159F24.2-001	KNOWN	basic	processed_transcript	ENSG00000188850	Clone_based_vega_gene	pseudogene	OTTHUMT00000367972.1		0.00	18	0	A			43348817	+1	tier1		no_errors	ENST00000511991	ensembl	human	known	74_37	rna	28.00	18	7	DEL	0.000	-
Unknown	0	genome.wustl.edu	37	GL000205.1	117785	117785	+	IGR	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrGL000205.1:117785C>A								None (None upstream) : None (None downstream)																							AAGGCCTTTGCAGGATGGGAT	0.567																																																	0																																										SO:0001628	intergenic_variant	0																															GL000205.1.37:g.117785C>A				Missense_Mutation	SNP	pfam_D-isomer_2_OHA_DH_cat_dom	p.A139E		37	c.416		GL000205.1																																																																																			AC011841.1	-	NULL	ENSG00000212884	0	0.567					ENSG00000212884	Clone_based_ensembl_gene			-	0.00	60	0	C			117785	+1	tier1	-	no_errors	ENST00000391571	ensembl	human	known	74_37	missense	17.02	39	8	SNP	NULL	A
GOLGA8T	653075	genome.wustl.edu	37	15	30437139	30437139	+	Intron	SNP	G	G	A	rs570423259	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:30437139G>A	ENST00000569052.1	+	17	1466				AC120045.2_ENST00000408858.1_RNA|RN7SL469P_ENST00000491512.2_RNA					golgin A8 family, member T																		GGGCCCCAGCGTCTGAGCCCT	0.637													G|||	8	0.00159744	0.0008	0.0	5008	,	,		10478	0.004		0.0	False		,,,				2504	0.0031																0																																										SO:0001627	intron_variant	0					15q13.2	2013-01-17			ENSG00000261247	ENSG00000261247			44410	other	unknown							Standard	NR_033933		Approved		uc021sha.1		OTTHUMG00000175638	ENST00000569052.1:c.1467-23G>A	15.37:g.30437139G>A				RNA	SNP	-	NULL	ENST00000569052.1	37	NULL		15																																																																																			AC120045.2	-	-	ENSG00000221785		0.637	GOLGA8T-001	NOVEL	basic|appris_principal	protein_coding	ENSG00000221785	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000430690.1	-	0.00	66	0	G	NR_033933		30437139	+1	tier1	-	no_errors	ENST00000408858	ensembl	human	novel	74_37	rna	25.29	65	22	SNP	0.002	A
MYADM	91663	genome.wustl.edu	37	19	54379104	54379104	+	3'UTR	DEL	A	A	-	rs75209913|rs369211393		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:54379104delA	ENST00000391769.2	+	0	2601				MYADM_ENST00000391770.4_3'UTR|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000391771.1_3'UTR|MYADM_ENST00000336967.3_3'UTR	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker						establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		actccatctcaaaaaaaaaaa	0.498																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.*1352A>-	19.37:g.54379104delA			B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	RNA	DEL	-	NULL	ENST00000391769.2	37	NULL	CCDS12866.1	19																																																																																			AC008440.5	-	-	ENSG00000232220		0.498	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000232220	Clone_based_vega_gene	protein_coding	OTTHUMT00000134337.1		0.00	33	0	A	NM_138373		54379104	-1	tier1		no_errors	ENST00000413496	ensembl	human	known	74_37	rna	20.00	16	4	DEL	0.000	-
RP11-423O2.5	0	genome.wustl.edu	37	1	142803429	142803429	+	lincRNA	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:142803429A>C	ENST00000423385.1	-	0	1536																											catcctctcaagtagtttgga	0.343																																																	0																																												0																															1.37:g.142803429A>C				RNA	SNP	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			RP11-423O2.5	-	-	ENSG00000234978		0.343	RP11-423O2.5-001	KNOWN	basic	lincRNA	ENSG00000234978	Clone_based_vega_gene	lincRNA	OTTHUMT00000193203.1	-	0.00	138	0	A			142803429	-1	tier1	-	no_errors	ENST00000423385	ensembl	human	known	74_37	rna	11.68	121	16	SNP	0.007	C
NARS2	79731	genome.wustl.edu	37	11	78154810	78154811	+	Intron	INS	-	-	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:78154810_78154811insA	ENST00000281038.5	-	12	1540				NARS2_ENST00000528850.1_Intron|RP11-452H21.1_ENST00000534168.1_RNA	NM_001243251.1|NM_024678.5	NP_001230180.1|NP_078954.4	Q96I59	SYNM_HUMAN	asparaginyl-tRNA synthetase 2, mitochondrial (putative)						asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)	27	all_cancers(14;2.63e-17)|all_epithelial(13;1.85e-19)				L-Asparagine(DB00174)	GCAACCTAAGGAAAAAAAAAAA	0.396																																																	0																																										SO:0001627	intron_variant	0			BC007800	CCDS8261.1, CCDS58164.1	11q14.1	2011-07-01	2007-02-23		ENSG00000137513	ENSG00000137513	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	26274	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 2, mitochondrial (putative)"""	612803				15779907	Standard	NM_024678		Approved	FLJ23441, SLM5	uc001ozi.3	Q96I59	OTTHUMG00000166702	ENST00000281038.5:c.1165-6->T	11.37:g.78154821_78154821dupA			G3V178	RNA	INS	-	NULL	ENST00000281038.5	37	NULL	CCDS8261.1	11																																																																																			RP11-452H21.1	-	-	ENSG00000254420		0.396	NARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000254420	Clone_based_vega_gene	protein_coding	OTTHUMT00000391138.2		0.00	17	0	-	NM_024678		78154811	+1	tier1		no_errors	ENST00000534168	ensembl	human	known	74_37	rna	13.64	19	3	INS	0.247:0.000	A
CAPN1	823	genome.wustl.edu	37	11	64948499	64948499	+	5'Flank	DEL	G	G	-			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:64948499delG	ENST00000527323.1	+	0	0				CAPN1_ENST00000524773.1_5'Flank|AP003068.23_ENST00000526623.1_Frame_Shift_Del_p.Q167fs|CAPN1_ENST00000279247.6_5'Flank|CAPN1_ENST00000533820.1_5'Flank|CAPN1_ENST00000533129.1_5'Flank			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit						extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		GCCCTCTCCTGGGTAAGGTGA	0.642																																																	0																																										SO:0001631	upstream_gene_variant	0			X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614		11.37:g.64948499delG	Exception_encountered		Q2TTR0|Q6DHV4	Frame_Shift_Del	DEL	NULL	p.Q167fs	ENST00000527323.1	37	c.499	CCDS44644.1	11																																																																																			AP003068.23	-	NULL	ENSG00000254614		0.642	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000254614	Clone_based_vega_gene	protein_coding	OTTHUMT00000385325.1		0.00	25	0	G			64948499	-1	tier1		no_errors	ENST00000526623	ensembl	human	putative	74_37	frame_shift_del	58.33	15	21	DEL	0.114	-
RP11-652G5.1	0	genome.wustl.edu	37	16	32616253	32616253	+	RNA	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:32616253A>C	ENST00000562976.1	+	0	272																											GGCACAGGAAACTTCTTCTGA	0.418																																																	0																																												0																															16.37:g.32616253A>C				RNA	SNP	-	NULL	ENST00000562976.1	37	NULL		16																																																																																			RP11-652G5.1	-	-	ENSG00000259966		0.418	RP11-652G5.1-002	KNOWN	basic	processed_transcript	ENSG00000259966	Clone_based_vega_gene	pseudogene	OTTHUMT00000432347.1	-	0.00	114	0	A			32616253	+1	tier1	-	no_errors	ENST00000562976	ensembl	human	known	74_37	rna	24.35	87	28	SNP	0.000	C
WASH6P	653440	genome.wustl.edu	37	X	155251726	155251726	+	RNA	SNP	G	G	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:155251726G>C	ENST00000461007.1	+	0	734				AJ271736.10_ENST00000285718.7_RNA			Q9NQA3	WASH6_HUMAN	WAS protein family homolog 6 pseudogene						Arp2/3 complex-mediated actin nucleation (GO:0034314)|endosomal transport (GO:0016197)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|recycling endosome (GO:0055037)|WASH complex (GO:0071203)	alpha-tubulin binding (GO:0043014)										CCATCTTCACGGGCGCCCAGG	0.662																																																	0																																												0			AI042587		Xq28 and Yq12	2014-08-28	2008-01-16	2008-01-16	ENSG00000182484	ENSG00000182484		"""Pseudoautosomal regions / PAR2"", ""WAS protein homologs"""	31685	pseudogene	pseudogene			"""family with sequence similarity 39, member A"", ""chromosomes X and Y open reading frame 1"""	FAM39A, CXYorf1		10655549, 12566406, 18159949	Standard	NG_008380		Approved			Q9NQA3	OTTHUMG00000022677		X.37:g.155251726G>C			A6NGF1|Q8N305	RNA	SNP	-	NULL	ENST00000461007.1	37	NULL		X																																																																																			AJ271736.10	-	-	ENSG00000270726		0.662	WASH6P-016	KNOWN	basic	processed_transcript	ENSG00000270726	Clone_based_vega_gene	pseudogene	OTTHUMT00000058840.1	-	0.00	22	0	G	NG_008380		155251726	+1	tier1	-	no_errors	ENST00000285718	ensembl	human	known	74_37	rna	36.84	12	7	SNP	0.993	C
TTN	7273	genome.wustl.edu	37	2	179442292	179442293	+	Intron	INS	-	-	A	rs148238009	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:179442292_179442293insA	ENST00000591111.1	-	273	64126				TTN-AS1_ENST00000590932.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586831.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAATTTGCTTTAAAAAAAAAAG	0.351																																																	0																																										SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63901+35->T	2.37:g.179442302_179442302dupA			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	RNA	INS	-	NULL	ENST00000591111.1	37	NULL		2																																																																																			RP11-171I2.5	-	-	ENSG00000271011		0.351	TTN-019	PUTATIVE	basic	protein_coding	ENSG00000271011	Clone_based_vega_gene	protein_coding	OTTHUMT00000460310.1		0.00	19	0	-	NM_133378		179442293	+1	tier1		no_errors	ENST00000604215	ensembl	human	known	74_37	rna	27.50	29	11	INS	0.663:0.038	A
LRIF1	55791	genome.wustl.edu	37	1	111506228	111506228	+	Intron	SNP	G	G	A	rs551011128	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:111506228G>A	ENST00000369763.4	-	1	459				RP11-96K19.5_ENST00000609118.1_RNA|LRIF1_ENST00000485275.2_Intron	NM_018372.3	NP_060842.3	Q5T3J3	LRIF1_HUMAN	ligand dependent nuclear receptor interacting factor 1						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)				endometrium(2)|kidney(2)|large_intestine(7)|lung(12)|ovary(2)|skin(1)|urinary_tract(2)	28						GGGAGGATTCGAAACCGGTAC	0.562											OREG0013667	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													48.0	43.0	45.0					1																	111506228		2203	4300	6503	SO:0001627	intron_variant	0			AY190122	CCDS30800.1, CCDS41366.1	1p13.3	2011-04-15	2011-04-15	2011-04-15	ENSG00000121931	ENSG00000121931			30299	protein-coding gene	gene with protein product	"""receptor interacting factor 1"""	615354	"""chromosome 1 open reading frame 103"""	C1orf103		17455211	Standard	NM_018372		Approved	RIF1, FLJ11269	uc001eaa.3	Q5T3J3	OTTHUMG00000011913	ENST00000369763.4:c.68+14C>T	1.37:g.111506228G>A		1435	Q86XS4|Q8N3B6|Q96HT4|Q9NUM5|Q9NV32	RNA	SNP	-	NULL	ENST00000369763.4	37	NULL	CCDS30800.1	1																																																																																			RP11-96K19.5	-	-	ENSG00000273010		0.562	LRIF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000273010	Clone_based_vega_gene	protein_coding	OTTHUMT00000032932.2	-	0.00	100	0	G	NM_018372		111506228	+1	tier1	-	no_errors	ENST00000609118	ensembl	human	known	74_37	rna	41.30	54	38	SNP	0.002	A
EPHA1	2041	genome.wustl.edu	37	7	143095515	143095515	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:143095515G>A	ENST00000275815.3	-	7	1449	c.1363C>T	c.(1363-1365)Ctg>Ttg	p.L455L		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	455	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				TTCTTCACCAGTCTCAGAGAC	0.542																																																	0													52.0	55.0	54.0					7																	143095515		2203	4300	6503	SO:0001819	synonymous_variant	0			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.1363C>T	7.37:g.143095515G>A			A1L3V3|B5A966|B5A967|Q15405	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,superfamily_SAM/pointed,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.L455	ENST00000275815.3	37	c.1363	CCDS5884.1	7																																																																																			EPHA1	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146904		0.542	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA1	HGNC	protein_coding	OTTHUMT00000342154.1	-	0.00	52	0	G			143095515	-1	tier1	-	no_errors	ENST00000275815	ensembl	human	known	74_37	silent	58.82	28	40	SNP	1.000	A
EPHA3	2042	genome.wustl.edu	37	3	89259074	89259074	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:89259074T>A	ENST00000336596.2	+	3	443	c.218T>A	c.(217-219)gTc>gAc	p.V73D	EPHA3_ENST00000494014.1_Missense_Mutation_p.V73D|EPHA3_ENST00000452448.2_Missense_Mutation_p.V73D	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	73	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		GTGTGCAATGTCATGGACCAC	0.468										TSP Lung(6;0.00050)																																							0													73.0	70.0	71.0					3																	89259074		2203	4300	6503	SO:0001583	missense	0			M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.218T>A	3.37:g.89259074T>A	ENSP00000337451:p.Val73Asp		Q9H2V3|Q9H2V4	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_2,pfam_SAM_type1,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom	p.V73D	ENST00000336596.2	37	c.218	CCDS2922.1	3	.	.	.	.	.	.	.	.	.	.	T	21.6	4.178585	0.78564	.	.	ENSG00000044524	ENST00000336596;ENST00000452448;ENST00000494014	T;T;T	0.04551	3.6;3.6;3.6	5.34	5.34	0.76211	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000001	T	0.26919	0.0659	M	0.89353	3.025	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.97110	0.995;1.0	T	0.06789	-1.0807	9	.	.	.	.	15.3238	0.74144	0.0:0.0:0.0:1.0	.	73;73	P29320;P29320-2	EPHA3_HUMAN;.	D	73	ENSP00000337451:V73D;ENSP00000399926:V73D;ENSP00000419190:V73D	.	V	+	2	0	EPHA3	89341764	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.040000	0.89188	2.020000	0.59435	0.460000	0.39030	GTC	EPHA3	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000044524		0.468	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA3	HGNC	protein_coding	OTTHUMT00000352995.1	-	0.00	59	0	T	NM_005233		89259074	+1	tier1	-	no_errors	ENST00000336596	ensembl	human	known	74_37	missense	34.62	17	9	SNP	1.000	A
EPHA6	285220	genome.wustl.edu	37	3	97466312	97466312	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:97466312C>T	ENST00000389672.5	+	17	3212	c.3174C>T	c.(3172-3174)gtC>gtT	p.V1058V		NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	964						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CTTTGTTTGTCACAGTTGGTG	0.393																																																	0													97.0	88.0	91.0					3																	97466312		1846	4104	5950	SO:0001819	synonymous_variant	0			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.3174C>T	3.37:g.97466312C>T			D6RAL5	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt_N_dom,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V1058	ENST00000389672.5	37	c.3174	CCDS46876.1	3																																																																																			EPHA6	-	pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	ENSG00000080224		0.393	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	EPHA6	HGNC	protein_coding	OTTHUMT00000353845.3	-	0.00	98	0	C	NM_001080448		97466312	+1	tier1	-	no_errors	ENST00000389672	ensembl	human	known	74_37	silent	47.65	89	81	SNP	0.989	T
EPOR	2057	genome.wustl.edu	37	19	11491847	11491847	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:11491847G>A	ENST00000222139.6	-	5	728	c.624C>T	c.(622-624)agC>agT	p.S208S	EPOR_ENST00000592375.2_Silent_p.S208S	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	208	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	CCCGCAGGTTGCTCAGCACAC	0.687											OREG0025255	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													4.0	5.0	4.0					19																	11491847		2021	4006	6027	SO:0001819	synonymous_variant	0			M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.624C>T	19.37:g.11491847G>A		672	B2RCG4|Q15443|Q2M205	Silent	SNP	pirsf_Erythropoietin_rcpt,pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S208	ENST00000222139.6	37	c.624	CCDS12260.1	19																																																																																			EPOR	-	pirsf_Erythropoietin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000187266		0.687	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPOR	HGNC	protein_coding	OTTHUMT00000458791.1	-	0.00	37	0	G			11491847	-1	tier1	-	no_errors	ENST00000222139	ensembl	human	known	74_37	silent	10.53	34	4	SNP	1.000	A
ERBB2IP	55914	genome.wustl.edu	37	5	65349460	65349460	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:65349460A>G	ENST00000284037.5	+	21	2703	c.2314A>G	c.(2314-2316)Act>Gct	p.T772A	ERBB2IP_ENST00000380943.2_Missense_Mutation_p.T772A|ERBB2IP_ENST00000506030.1_Missense_Mutation_p.T772A|ERBB2IP_ENST00000380935.1_Missense_Mutation_p.T772A|ERBB2IP_ENST00000508515.1_Missense_Mutation_p.T772A|ERBB2IP_ENST00000380938.2_Missense_Mutation_p.T772A|ERBB2IP_ENST00000380936.1_Missense_Mutation_p.T772A|ERBB2IP_ENST00000416865.2_Intron|ERBB2IP_ENST00000511297.1_Missense_Mutation_p.T768A|ERBB2IP_ENST00000380939.2_Missense_Mutation_p.T772A	NM_001253697.1	NP_001240626.1	Q96RT1	LAP2_HUMAN	erbb2 interacting protein	772					basal protein localization (GO:0045175)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell growth (GO:0016049)|epidermal growth factor receptor signaling pathway (GO:0007173)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|signal transduction (GO:0007165)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|hemidesmosome (GO:0030056)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ErbB-2 class receptor binding (GO:0005176)|integrin binding (GO:0005178)|structural constituent of cytoskeleton (GO:0005200)			breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(3)|skin(2)	36		Lung NSC(167;9.45e-06)|Prostate(74;0.0139)|Ovarian(174;0.0547)|Breast(144;0.093)|Colorectal(97;0.234)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0767)|Lung(70;0.00191)		TAAACTTATAACTAATGATAC	0.323																																																	0													43.0	46.0	45.0					5																	65349460		2202	4296	6498	SO:0001583	missense	0				CCDS3990.1, CCDS34172.1, CCDS58951.1, CCDS58952.1, CCDS58953.1, CCDS58954.1	5p14.3-q12.3	2008-07-18	2001-11-29		ENSG00000112851	ENSG00000112851			15842	protein-coding gene	gene with protein product	"""densin-180-like protein"", ""ERBB2-interacting protein"""	606944	"""erbb2-interacting protein"""			10574462, 10878805	Standard	NM_001253697		Approved	ERBIN, LAP2	uc011cqx.2	Q96RT1	OTTHUMG00000097808	ENST00000284037.5:c.2314A>G	5.37:g.65349460A>G	ENSP00000284037:p.Thr772Ala		A0AVR1|B4E3F1|B7ZLV9|E7EQW9|E9PCR8|Q1RMD0|Q86W38|Q9NR18|Q9NW48|Q9ULJ5	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_PDZ,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.T772A	ENST00000284037.5	37	c.2314	CCDS58953.1	5	.	.	.	.	.	.	.	.	.	.	A	9.028	0.986651	0.18889	.	.	ENSG00000112851	ENST00000284037;ENST00000380943;ENST00000380939;ENST00000380936;ENST00000380935;ENST00000380938;ENST00000511297;ENST00000506030;ENST00000508515	T;T;T;T;T;T;T;T;T	0.38240	1.35;1.35;1.35;1.54;1.15;1.42;1.35;1.38;1.15	5.56	5.56	0.83823	.	0.498508	0.22495	N	0.059303	T	0.24547	0.0595	L	0.29908	0.895	0.09310	N	1	B;B;B;B;B;B;B	0.21147	0.052;0.031;0.031;0.024;0.009;0.023;0.042	B;B;B;B;B;B;B	0.24006	0.047;0.021;0.021;0.021;0.01;0.047;0.05	T	0.12785	-1.0534	10	0.29301	T	0.29	.	6.1912	0.20526	0.7818:0.0:0.075:0.1432	.	772;772;772;768;772;772;772	Q96RT1-4;E9PCR8;B7ZLV9;E7EQW9;Q96RT1;Q96RT1-7;Q96RT1-2	.;.;.;.;LAP2_HUMAN;.;.	A	772;772;772;772;772;772;768;772;772	ENSP00000284037:T772A;ENSP00000370330:T772A;ENSP00000370326:T772A;ENSP00000370323:T772A;ENSP00000370322:T772A;ENSP00000370325:T772A;ENSP00000422766:T768A;ENSP00000426632:T772A;ENSP00000422015:T772A	ENSP00000284037:T772A	T	+	1	0	ERBB2IP	65385216	0.393000	0.25237	0.964000	0.40570	0.883000	0.51084	2.324000	0.43831	2.108000	0.64289	0.383000	0.25322	ACT	ERBB2IP	-	NULL	ENSG00000112851		0.323	ERBB2IP-002	KNOWN	basic|CCDS	protein_coding	ERBB2IP	HGNC	protein_coding	OTTHUMT00000215070.1	-	0.00	51	0	A	NM_018695		65349460	+1	tier1	-	no_errors	ENST00000284037	ensembl	human	known	74_37	missense	33.73	55	28	SNP	0.030	G
ESRP2	80004	genome.wustl.edu	37	16	68265592	68265592	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:68265592C>T	ENST00000565858.1	-	11	1421	c.1335G>A	c.(1333-1335)ttG>ttA	p.L445L	ESRP2_ENST00000473183.2_Silent_p.L435L|RP11-96D1.11_ENST00000571197.1_RNA	NM_024939.2	NP_079215.2	Q9H6T0	ESRP2_HUMAN	epithelial splicing regulatory protein 2	445					mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)	16						CATAGCGGTTCAAGACCTAGT	0.622																																																	0													75.0	71.0	72.0					16																	68265592		2198	4299	6497	SO:0001819	synonymous_variant	0			AK025571	CCDS10863.1	16q22.1	2013-02-12	2009-03-10	2009-03-10	ENSG00000103067	ENSG00000103067		"""RNA binding motif (RRM) containing"""	26152	protein-coding gene	gene with protein product		612960	"""RNA binding motif protein 35B"""	RBM35B		12477932	Standard	NM_024939		Approved	FLJ21918	uc002evq.1	Q9H6T0	OTTHUMG00000137557	ENST00000565858.1:c.1335G>A	16.37:g.68265592C>T			Q8N6H8|Q8WZ15|Q9H6I4	Silent	SNP	superfamily_RNaseH-like_dom,smart_RRM_dom	p.L445	ENST00000565858.1	37	c.1335		16																																																																																			ESRP2	-	NULL	ENSG00000103067		0.622	ESRP2-004	KNOWN	basic|appris_candidate_longest	protein_coding	ESRP2	HGNC	protein_coding	OTTHUMT00000433083.1		0.00	32	0	C	NM_024939		68265592	-1			no_errors	ENST00000565858	ensembl	human	known	74_37	silent	5.26	36	2	SNP	1.000	T
EVI5	7813	genome.wustl.edu	37	1	93091470	93091470	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:93091470C>A	ENST00000370331.1	-	13	1510	c.1501G>T	c.(1501-1503)Gag>Tag	p.E501*	EVI5_ENST00000491940.1_5'UTR|EVI5_ENST00000540033.1_Nonsense_Mutation_p.E501*|EVI5_ENST00000543509.1_Nonsense_Mutation_p.E512*	NM_005665.4	NP_005656.4	O60447	EVI5_HUMAN	ecotropic viral integration site 5	501	Dimerization.|Interaction with AURKB and INCENP.|Targeting to the centrosomes.				cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|retrograde transport, endosome to Golgi (GO:0042147)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|skin(1)	38		all_lung(203;0.00146)|Lung NSC(277;0.00565)|all_neural(321;0.185)|Melanoma(281;0.193)|Glioma(108;0.203)		Epithelial(280;8.09e-25)|OV - Ovarian serous cystadenocarcinoma(397;1.27e-22)|all cancers(265;1.74e-21)|GBM - Glioblastoma multiforme(16;0.00233)|BRCA - Breast invasive adenocarcinoma(282;0.211)		ATATTATTCTCATCAGGAAGG	0.353																																																	0													86.0	81.0	83.0					1																	93091470		2203	4299	6502	SO:0001587	stop_gained	0			AF008915	CCDS30774.1	1p22	2013-07-09			ENSG00000067208	ENSG00000067208			3501	protein-coding gene	gene with protein product	"""neuroblastoma stage 4S gene"""	602942				9618176	Standard	XM_005271180		Approved	NB4S	uc001dox.3	O60447	OTTHUMG00000010895	ENST00000370331.1:c.1501G>T	1.37:g.93091470C>A	ENSP00000359356:p.Glu501*		A6NKX8|B9A6J0|Q9H1Y9	Nonsense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E512*	ENST00000370331.1	37	c.1534	CCDS30774.1	1	.	.	.	.	.	.	.	.	.	.	C	38	6.843840	0.97881	.	.	ENSG00000067208	ENST00000370331;ENST00000540033;ENST00000543509;ENST00000338689	.	.	.	5.76	5.76	0.90799	.	0.055428	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-17.4458	19.9596	0.97236	0.0:1.0:0.0:0.0	.	.	.	.	X	501;501;512;200	.	ENSP00000345500:E200X	E	-	1	0	EVI5	92864058	1.000000	0.71417	1.000000	0.80357	0.861000	0.49209	7.487000	0.81328	2.723000	0.93209	0.585000	0.79938	GAG	EVI5	-	NULL	ENSG00000067208		0.353	EVI5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVI5	HGNC	protein_coding	OTTHUMT00000030047.1	-	0.00	32	0	C	NM_005665		93091470	-1	tier1	-	no_errors	ENST00000543509	ensembl	human	known	74_37	nonsense	48.89	23	22	SNP	1.000	A
FAM131B	9715	genome.wustl.edu	37	7	143056068	143056068	+	Frame_Shift_Del	DEL	C	C	-	rs535469846	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:143056068delC	ENST00000409408.1	-	4	1942	c.234delG	c.(232-234)gggfs	p.G78fs	FAM131B_ENST00000409222.3_Frame_Shift_Del_p.G78fs|FAM131B_ENST00000409346.1_Frame_Shift_Del_p.G78fs|FAM131B_ENST00000409578.1_Frame_Shift_Del_p.G94fs|FAM131B_ENST00000443739.2_Frame_Shift_Del_p.G106fs			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	78										breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					CCCGGCCTTGCCCCATGGCTG	0.572																																																	0													81.0	61.0	68.0					7																	143056068		2203	4300	6503	SO:0001589	frameshift_variant	0			BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.234delG	7.37:g.143056068delC	ENSP00000387017:p.Gly78fs		A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Frame_Shift_Del	DEL	NULL	p.Q107fs	ENST00000409408.1	37	c.318	CCDS5882.1	7																																																																																			FAM131B	-	NULL	ENSG00000159784		0.572	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	FAM131B	HGNC	protein_coding	OTTHUMT00000328057.1		0.00	48	0	C	NM_014690		143056068	-1	tier1		no_errors	ENST00000443739	ensembl	human	known	74_37	frame_shift_del	27.27	48	18	DEL	0.683	-
AC026369.1	0	genome.wustl.edu	37	12	148762	148762	+	IGR	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:148762T>A	ENST00000594563.1	+	0	129				FAM138D_ENST00000320165.5_lincRNA																							ggtgggaggatcgcttgaggc	0.463																																																	0																																										SO:0001628	intergenic_variant	0																															12.37:g.148762T>A				RNA	SNP	-	NULL	ENST00000594563.1	37	NULL		12																																																																																			FAM138D	-	-	ENSG00000206114		0.463	AC026369.1-201	NOVEL	basic|appris_principal	protein_coding	FAM138D	HGNC	protein_coding		-	0.00	81	0	T			148762	-1	tier1	-	no_errors	ENST00000320165	ensembl	human	known	74_37	rna	14.49	118	20	SNP	0.017	A
FAM13C	220965	genome.wustl.edu	37	10	61112095	61112095	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:61112095A>G	ENST00000373868.2	-	3	346	c.259T>C	c.(259-261)Ttc>Ctc	p.F87L	FAM13C_ENST00000277705.6_Missense_Mutation_p.F87L|FAM13C_ENST00000373867.3_Missense_Mutation_p.F4L|FAM13C_ENST00000442566.3_Missense_Mutation_p.F87L|FAM13C_ENST00000419214.2_Missense_Mutation_p.F87L|FAM13C_ENST00000422313.2_Missense_Mutation_p.F87L|FAM13C_ENST00000468840.2_Missense_Mutation_p.F4L|FAM13C_ENST00000435852.2_Missense_Mutation_p.F87L	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	87										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						CTGGACTTGAAGTTGCCCATG	0.587																																																	0													84.0	82.0	83.0					10																	61112095		2203	4300	6503	SO:0001583	missense	0			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.259T>C	10.37:g.61112095A>G	ENSP00000362975:p.Phe87Leu		B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	NULL	p.F87L	ENST00000373868.2	37	c.259	CCDS7255.1	10	.	.	.	.	.	.	.	.	.	.	A	25.5	4.646574	0.87958	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313;ENST00000512919;ENST00000503444	T;T;T;T;T;T	0.62639	0.01;0.01;0.01;0.01;0.01;0.01	5.8	5.8	0.92144	.	0.089188	0.50627	D	0.000116	T	0.54647	0.1871	L	0.42245	1.32	0.34432	D	0.698671	B;B;B;B;B	0.20052	0.002;0.009;0.011;0.041;0.001	B;B;B;B;B	0.20184	0.006;0.013;0.009;0.028;0.004	T	0.61292	-0.7092	10	0.32370	T	0.25	.	13.5716	0.61849	1.0:0.0:0.0:0.0	.	87;4;87;87;87	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	L	4;87;87;87;87;4;87;87;4;4	ENSP00000362975:F87L;ENSP00000395661:F87L;ENSP00000277705:F87L;ENSP00000391993:F87L;ENSP00000392302:F87L;ENSP00000400241:F87L	ENSP00000277705:F87L	F	-	1	0	FAM13C	60782101	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.979000	0.63806	2.227000	0.72691	0.456000	0.33151	TTC	FAM13C	-	NULL	ENSG00000148541		0.587	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM13C	HGNC	protein_coding	OTTHUMT00000048162.2	-	0.00	49	0	A			61112095	-1	tier1	-	no_errors	ENST00000373868	ensembl	human	known	74_37	missense	16.88	64	13	SNP	1.000	G
FAM205B	389715	genome.wustl.edu	37	9	34834584	34834584	+	RNA	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:34834584T>C	ENST00000455647.2	-	0	1809							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B																		TGAGATGGACTTCCCTGTCTG	0.582																																																	0																																												0					9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34834584T>C			Q6ZRJ7	RNA	SNP	-	NULL	ENST00000455647.2	37	NULL		9	.	.	.	.	.	.	.	.	.	.	T	11.51	1.659394	0.29515	.	.	ENSG00000257198	ENST00000455647	.	.	.	4.41	1.86	0.25419	.	0.253700	0.27797	N	0.017801	T	0.23451	0.0567	.	.	.	0.09310	N	1	B	0.15473	0.013	B	0.16289	0.015	T	0.08638	-1.0712	8	0.34782	T	0.22	.	3.1967	0.06635	0.2214:0.1137:0.0:0.6648	.	302	Q63HN1	F205B_HUMAN	R	302	.	ENSP00000398718:K302R	K	-	2	0	AL589645.1	34824584	0.001000	0.12720	0.001000	0.08648	0.012000	0.07955	0.616000	0.24344	0.745000	0.32763	0.454000	0.30748	AAG	FAM205B	-	-	ENSG00000257198		0.582	FAM205B-001	KNOWN	basic	processed_transcript	FAM205B	HGNC	pseudogene	OTTHUMT00000052246.5	-	0.00	81	0	T	NR_024481		34834584	-1	tier1	-	no_errors	ENST00000455647	ensembl	human	known	74_37	rna	25.97	57	20	SNP	0.000	C
FAM60A	58516	genome.wustl.edu	37	12	31448177	31448178	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:31448177_31448178insT	ENST00000337682.4	-	3	586_587	c.218_219insA	c.(217-219)aacfs	p.N73fs	FAM60A_ENST00000542983.1_5'UTR|FAM60A_ENST00000539409.1_Intron|FAM60A_ENST00000454658.2_Frame_Shift_Ins_p.N73fs|FAM60A_ENST00000395766.1_5'UTR	NM_001135812.1	NP_001129284.1	Q9NP50	FA60A_HUMAN	family with sequence similarity 60, member A	73					negative regulation of cell migration (GO:0030336)	Sin3 complex (GO:0016580)				large_intestine(1)|lung(2)	3	all_cancers(9;5.22e-13)|all_epithelial(9;4e-13)|all_lung(12;1.2e-11)|Lung NSC(12;2.17e-09)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0207)|Lung SC(12;0.0592)|Esophageal squamous(101;0.162)					CATGATTCCAGTTTTTTTTTGA	0.356																																																	0																																										SO:0001589	frameshift_variant	0			AF212220	CCDS8723.1	12p11.21	2012-11-30	2005-04-07	2005-04-07	ENSG00000139146	ENSG00000139146			30702	protein-coding gene	gene with protein product		615027	"""chromosome 12 open reading frame 14"""	C12orf14		11042152, 22984288, 22865885	Standard	NM_021238		Approved	TERA	uc001rke.3	Q9NP50	OTTHUMG00000168586	ENST00000337682.4:c.219dupA	12.37:g.31448186_31448186dupT	ENSP00000337477:p.Asn73fs		D3DUV8|Q9BSZ8	Frame_Shift_Ins	INS	NULL	p.N73fs	ENST00000337682.4	37	c.219_218	CCDS8723.1	12																																																																																			FAM60A	-	NULL	ENSG00000139146		0.356	FAM60A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM60A	HGNC	protein_coding	OTTHUMT00000400347.1		0.00	51	0	-	NM_021238		31448178	-1	tier1		no_errors	ENST00000337682	ensembl	human	known	74_37	frame_shift_ins	9.09	30	3	INS	1.000:1.000	T
FAM98C	147965	genome.wustl.edu	37	19	38899502	38899504	+	In_Frame_Del	DEL	AAG	AAG	-	rs372349446		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	AAG	AAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:38899502_38899504delAAG	ENST00000252530.5	+	8	1049_1051	c.1030_1032delAAG	c.(1030-1032)aagdel	p.K349del	FAM98C_ENST00000588262.1_3'UTR|FAM98C_ENST00000343358.7_In_Frame_Del_p.K267del	NM_174905.3	NP_777565.3	Q17RN3	FA98C_HUMAN	family with sequence similarity 98, member C	349										endometrium(2)|large_intestine(3)|lung(6)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(60;3.95e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTGGGGTCGCAAGAAGAAGAAGA	0.606																																																	0										414,186,2888		21,2,370,1,182,1168						-2.6	0.1		dbSNP_134	37	186,506,7042		7,0,172,3,500,3185	no	codingComplex	FAM98C	NM_174905.3		28,2,542,4,682,4353	A1A1,A1A2,A1R,A2A2,A2R,RR		8.9475,17.2018,11.5131				600,692,9930				SO:0001651	inframe_deletion	0				CCDS42562.1	19q13.2	2008-02-05				ENSG00000130244			27119	protein-coding gene	gene with protein product						12477932	Standard	NM_174905		Approved	FLJ44669	uc002oin.1	Q17RN3		ENST00000252530.5:c.1030_1032delAAG	19.37:g.38899511_38899513delAAG	ENSP00000252530:p.Lys349del		A6NMW3|Q66K45	In_Frame_Del	DEL	pfam_Uncharacterised_FAM98	p.K347in_frame_del	ENST00000252530.5	37	c.1030_1032	CCDS42562.1	19																																																																																			FAM98C	-	NULL	ENSG00000130244		0.606	FAM98C-001	KNOWN	basic|CCDS	protein_coding	FAM98C	HGNC	protein_coding	OTTHUMT00000459222.1		0.00	60	0	AAG	NM_174905		38899504	+1	tier1		no_errors	ENST00000252530	ensembl	human	known	74_37	in_frame_del	13.11	53	8	DEL	0.830:0.873:0.987	-
FANCC	2176	genome.wustl.edu	37	9	97869549	97869549	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:97869549G>T	ENST00000289081.3	-	14	1586	c.1332C>A	c.(1330-1332)gtC>gtA	p.V444V	FANCC_ENST00000375305.1_Silent_p.V444V	NM_000136.2	NP_000127.2	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	444					DNA repair (GO:0006281)|germ cell development (GO:0007281)|myeloid cell homeostasis (GO:0002262)|nucleotide-excision repair (GO:0006289)|protein complex assembly (GO:0006461)|removal of superoxide radicals (GO:0019430)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				kidney(1)|skin(1)|upper_aerodigestive_tract(1)	3		Acute lymphoblastic leukemia(62;0.138)				CCTTCACCTGGACCTGGGCAA	0.542			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia C	9	9q22.3	2176	"""Fanconi anemia, complementation group C"""		L	0													56.0	51.0	53.0					9																	97869549		2203	4300	6503	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC006303	CCDS35071.1, CCDS75861.1	9q22.3	2014-09-17			ENSG00000158169	ENSG00000158169		"""Fanconi anemia, complementation groups"""	3584	protein-coding gene	gene with protein product		613899		FACC		1303234	Standard	NM_001243743		Approved	FAC, FA3	uc004avh.3	Q00597	OTTHUMG00000020279	ENST00000289081.3:c.1332C>A	9.37:g.97869549G>T			B1ALR8	Silent	SNP	pfam_Fanconi,pirsf_Fanconi,prints_Fanconi	p.V444	ENST00000289081.3	37	c.1332	CCDS35071.1	9																																																																																			FANCC	-	pfam_Fanconi,pirsf_Fanconi	ENSG00000158169		0.542	FANCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCC	HGNC	protein_coding	OTTHUMT00000053219.1	-	0.00	29	0	G	NM_000136		97869549	-1	tier1	-	no_errors	ENST00000289081	ensembl	human	known	74_37	silent	7.27	51	4	SNP	0.199	T
FAT2	2196	genome.wustl.edu	37	5	150924030	150924030	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:150924030A>C	ENST00000261800.5	-	9	6670	c.6658T>G	c.(6658-6660)Ttc>Gtc	p.F2220V		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2220	Cadherin 19. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCAGTCTTGAAGTCAGTGGTG	0.517																																																	0													126.0	123.0	124.0					5																	150924030		2203	4300	6503	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.6658T>G	5.37:g.150924030A>C	ENSP00000261800:p.Phe2220Val		O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.F2220V	ENST00000261800.5	37	c.6658	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	A	17.83	3.485541	0.63962	.	.	ENSG00000086570	ENST00000261800	T	0.50277	0.75	5.48	4.32	0.51571	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000006	T	0.58061	0.2096	L	0.45470	1.425	0.58432	D	0.999996	D	0.89917	1.0	D	0.87578	0.998	T	0.52193	-0.8608	10	0.26408	T	0.33	.	11.1428	0.48413	0.9276:0.0:0.0724:0.0	.	2220	Q9NYQ8	FAT2_HUMAN	V	2220	ENSP00000261800:F2220V	ENSP00000261800:F2220V	F	-	1	0	FAT2	150904223	1.000000	0.71417	0.996000	0.52242	0.879000	0.50718	9.252000	0.95491	0.913000	0.36797	0.459000	0.35465	TTC	FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.517	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	-	0.00	46	0	A	NM_001447		150924030	-1	tier1	-	no_errors	ENST00000261800	ensembl	human	known	74_37	missense	25.58	64	22	SNP	1.000	C
FAT3	120114	genome.wustl.edu	37	11	92577768	92577768	+	Silent	SNP	G	G	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:92577768G>C	ENST00000298047.6	+	18	11252	c.11235G>C	c.(11233-11235)ggG>ggC	p.G3745G	FAT3_ENST00000533797.1_Silent_p.G80G|FAT3_ENST00000409404.2_Silent_p.G3745G|FAT3_ENST00000525166.1_Silent_p.G3595G			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3745					homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACTGCTCAGGGCTGGACTGTC	0.532										TCGA Ovarian(4;0.039)																																							0													94.0	94.0	94.0					11																	92577768		2129	4244	6373	SO:0001819	synonymous_variant	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11235G>C	11.37:g.92577768G>C			B5MDB0|Q96AU6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.G3745	ENST00000298047.6	37	c.11235		11																																																																																			FAT3	-	NULL	ENSG00000165323		0.532	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		-	0.00	27	0	G	NM_001008781		92577768	+1	tier1	-	no_errors	ENST00000298047	ensembl	human	known	74_37	silent	36.67	18	11	SNP	0.875	C
FCGBP	8857	genome.wustl.edu	37	19	40433477	40433477	+	Missense_Mutation	SNP	A	A	T	rs377296494		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:40433477A>T	ENST00000221347.6	-	2	799	c.792T>A	c.(790-792)gaT>gaA	p.D264E		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	264	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CGAAGGCCAAATCATAGCGAG	0.577																																																	0													58.0	51.0	53.0					19																	40433477		2203	4300	6503	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.792T>A	19.37:g.40433477A>T	ENSP00000221347:p.Asp264Glu		O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.D264E	ENST00000221347.6	37	c.792	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	A	7.114	0.576604	0.13686	.	.	ENSG00000090920	ENST00000221347	T	0.21734	1.99	4.33	1.1	0.20463	.	0.000000	0.64402	D	0.000005	T	0.36908	0.0984	M	0.64170	1.965	0.09310	N	0.999998	D	0.76494	0.999	D	0.76071	0.987	T	0.08953	-1.0697	10	0.66056	D	0.02	.	7.8775	0.29603	0.6434:0.0:0.3566:0.0	.	264	Q9Y6R7	FCGBP_HUMAN	E	264	ENSP00000221347:D264E	ENSP00000221347:D264E	D	-	3	2	FCGBP	45125317	0.042000	0.20092	0.033000	0.17914	0.018000	0.09664	0.267000	0.18552	0.105000	0.17753	-0.290000	0.09829	GAT	FCGBP	-	NULL	ENSG00000090920		0.577	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1		0.00	18	0	A	NM_003890		40433477	-1			no_errors	ENST00000221347	ensembl	human	known	74_37	missense	5.56	34	2	SNP	0.227	T
FCAR	2204	genome.wustl.edu	37	19	55386812	55386812	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:55386812G>T	ENST00000355524.3	+	2	71	c.61G>T	c.(61-63)Gca>Tca	p.A21S	FCAR_ENST00000359272.4_Intron|FCAR_ENST00000391726.3_Intron|FCAR_ENST00000391723.3_Intron|FCAR_ENST00000391725.3_Missense_Mutation_p.A21S|FCAR_ENST00000482092.2_3'UTR|FCAR_ENST00000345937.4_Missense_Mutation_p.A21S|FCAR_ENST00000353758.4_Intron|FCAR_ENST00000391724.3_Intron|FCAR_ENST00000469767.1_Missense_Mutation_p.A21S	NM_002000.2	NP_001991.1	P24071	FCAR_HUMAN	Fc fragment of IgA, receptor for	21					immune response (GO:0006955)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|skin(2)	24				GBM - Glioblastoma multiforme(193;0.0443)		GAGGATTCAGGCACAGGAAGG	0.448																																																	0													157.0	158.0	157.0					19																	55386812		2203	4300	6503	SO:0001583	missense	0			X54150	CCDS12907.1, CCDS12908.1, CCDS12909.1, CCDS12910.1, CCDS42622.1, CCDS42623.1, CCDS42624.1, CCDS42625.1, CCDS46180.1	19q13.42	2013-01-29			ENSG00000186431	ENSG00000186431		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3608	protein-coding gene	gene with protein product		147045				1577457	Standard	NM_133269		Approved	CD89	uc002qhr.1	P24071	OTTHUMG00000065936	ENST00000355524.3:c.61G>T	19.37:g.55386812G>T	ENSP00000347714:p.Ala21Ser		Q13603|Q13604|Q15727|Q15728|Q1AJL7|Q1AJL8|Q1AJL9|Q53X38|Q53X39|Q92587|Q92588|Q92590|Q92592|Q92593|Q9UEK0	Missense_Mutation	SNP	smart_Ig_sub	p.A21S	ENST00000355524.3	37	c.61	CCDS12907.1	19	.	.	.	.	.	.	.	.	.	.	G	9.359	1.067464	0.20067	.	.	ENSG00000186431	ENST00000433231;ENST00000355524;ENST00000391725;ENST00000345937	T;T;T	0.01313	6.81;6.69;5.02	2.96	0.744	0.18353	.	.	.	.	.	T	0.05318	0.0141	M	0.69823	2.125	0.09310	N	1	D;B;B;D	0.76494	0.999;0.135;0.404;0.997	D;B;B;D	0.69479	0.964;0.084;0.172;0.922	T	0.31110	-0.9955	9	0.72032	D	0.01	.	5.0583	0.14544	0.2988:0.0:0.7012:0.0	.	21;21;21;21	Q53X39;P24071-3;P24071;P24071-4	.;.;FCAR_HUMAN;.	S	21	ENSP00000347714:A21S;ENSP00000375605:A21S;ENSP00000338257:A21S	ENSP00000338257:A21S	A	+	1	0	FCAR	60078624	0.000000	0.05858	0.001000	0.08648	0.990000	0.78478	0.073000	0.14640	0.124000	0.18369	0.455000	0.32223	GCA	FCAR	-	NULL	ENSG00000186431		0.448	FCAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCAR	HGNC	protein_coding	OTTHUMT00000141243.1	-	0.00	31	0	G	NM_002000		55386812	+1	tier1	-	no_errors	ENST00000355524	ensembl	human	known	74_37	missense	10.26	35	4	SNP	0.013	T
FEM1C	56929	genome.wustl.edu	37	5	114878803	114878803	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:114878803C>T	ENST00000274457.3	-	2	949	c.388G>A	c.(388-390)Gaa>Aaa	p.E130K		NM_020177.2	NP_064562.1	Q96JP0	FEM1C_HUMAN	fem-1 homolog c (C. elegans)	130					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				breast(5)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	18		all_cancers(142;0.000575)|all_epithelial(76;9.98e-06)|Prostate(80;0.00955)|Ovarian(225;0.0443)|all_lung(232;0.132)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;2.5e-07)|Epithelial(69;2.66e-07)|all cancers(49;1.39e-05)		TTCACTATTTCCAAATGGCCA	0.423																																																	0													117.0	115.0	116.0					5																	114878803		2202	4300	6502	SO:0001583	missense	0				CCDS4118.1	5q22	2013-01-10	2006-11-08		ENSG00000145780	ENSG00000145780		"""Ankyrin repeat domain containing"""	16933	protein-coding gene	gene with protein product		608767				14527725, 11733146	Standard	NM_020177		Approved	KIAA1785, EUROIMAGE686608, EUROIMAGE783647, FEM1A	uc003krb.1	Q96JP0	OTTHUMG00000128895	ENST00000274457.3:c.388G>A	5.37:g.114878803C>T	ENSP00000274457:p.Glu130Lys		B2RE47|Q8N3V8|Q9H704|Q9NPL6|Q9NPL9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E130K	ENST00000274457.3	37	c.388	CCDS4118.1	5	.	.	.	.	.	.	.	.	.	.	C	25.9	4.684990	0.88639	.	.	ENSG00000145780	ENST00000274457	T	0.68903	-0.36	5.51	5.51	0.81932	Ankyrin repeat-containing domain (4);	0.053179	0.85682	D	0.000000	T	0.66781	0.2824	L	0.51914	1.62	0.80722	D	1	B	0.19200	0.034	B	0.27715	0.082	T	0.63967	-0.6517	10	0.62326	D	0.03	-22.896	19.4166	0.94703	0.0:1.0:0.0:0.0	.	130	Q96JP0	FEM1C_HUMAN	K	130	ENSP00000274457:E130K	ENSP00000274457:E130K	E	-	1	0	FEM1C	114906702	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.814000	0.86154	2.588000	0.87417	0.585000	0.79938	GAA	FEM1C	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000145780		0.423	FEM1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FEM1C	HGNC	protein_coding	OTTHUMT00000250857.3	-	0.00	69	0	C	NM_020177		114878803	-1	tier1	-	no_errors	ENST00000274457	ensembl	human	known	74_37	missense	29.73	52	22	SNP	1.000	T
LINC01446	401337	genome.wustl.edu	37	7	53833835	53833835	+	lincRNA	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:53833835T>C	ENST00000380970.2	-	0	602					NR_038371.1																						TAGTAGCAACTTCAATGCTCA	0.363																																																	0																																												0																															7.37:g.53833835T>C				RNA	SNP	-	NULL	ENST00000380970.2	37	NULL		7																																																																																			GS1-179L18.1	-	-	ENSG00000205628		0.363	GS1-179L18.1-001	KNOWN	basic	lincRNA	FLJ45974	Clone_based_vega_gene	lincRNA	OTTHUMT00000342819.1	-	0.00	50	0	T			53833835	-1	tier1	-	no_errors	ENST00000380970	ensembl	human	known	74_37	rna	32.20	40	19	SNP	0.002	C
MACROD1	28992	genome.wustl.edu	37	11	63884398	63884398	+	Intron	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:63884398G>T	ENST00000255681.6	-	3	584				RP11-21A7A.3_ENST00000543817.1_RNA|FLRT1_ENST00000246841.3_Missense_Mutation_p.G220V	NM_014067.3	NP_054786.2	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1						cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(1)|large_intestine(3)|lung(6)|skin(1)	11						GCCTTCAAGGGCCTCAACAGC	0.652																																																	0													38.0	34.0	35.0					11																	63884398		2201	4297	6498	SO:0001627	intron_variant	0			AF202922	CCDS8056.1	11q13.1	2007-07-24	2007-06-11		ENSG00000133315	ENSG00000133315			29598	protein-coding gene	gene with protein product		610400				15691879	Standard	NM_014067		Approved	LRP16	uc001nyh.3	Q9BQ69	OTTHUMG00000167843	ENST00000255681.6:c.517+34312C>A	11.37:g.63884398G>T			Q9UH96	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.G220V	ENST00000255681.6	37	c.659	CCDS8056.1	11	.	.	.	.	.	.	.	.	.	.	G	16.28	3.079845	0.55753	.	.	ENSG00000126500	ENST00000246841	T	0.60672	0.17	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.79429	0.4444	M	0.84846	2.72	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.81854	-0.0741	10	0.62326	D	0.03	-37.5847	18.2988	0.90157	0.0:0.0:1.0:0.0	.	192	Q9NZU1	FLRT1_HUMAN	V	220	ENSP00000246841:G220V	ENSP00000246841:G220V	G	+	2	0	FLRT1	63640974	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	2.823000	0.48081	2.615000	0.88500	0.555000	0.69702	GGC	FLRT1	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000126500		0.652	MACROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT1	HGNC	protein_coding	OTTHUMT00000396570.1		0.00	73	0	G	NM_014067		63884398	+1			no_errors	ENST00000246841	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	T
FLRT2	23768	genome.wustl.edu	37	14	86088246	86088246	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:86088246G>T	ENST00000330753.4	+	2	1155	c.388G>T	c.(388-390)Gcc>Tcc	p.A130S	FLRT2_ENST00000554746.1_Missense_Mutation_p.A130S	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	130					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		GGCTGCTCTTGCCCAGCTCTT	0.507																																																	0													72.0	74.0	73.0					14																	86088246		2203	4300	6503	SO:0001583	missense	0			AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.388G>T	14.37:g.86088246G>T	ENSP00000332879:p.Ala130Ser		A0AV84|B7ZLP3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.A130S	ENST00000330753.4	37	c.388	CCDS9877.1	14	.	.	.	.	.	.	.	.	.	.	G	13.03	2.116633	0.37339	.	.	ENSG00000185070	ENST00000330753;ENST00000554746	T;T	0.56275	0.47;0.47	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.46483	0.1395	N	0.25144	0.715	0.80722	D	1	D	0.55605	0.972	P	0.48488	0.579	T	0.27297	-1.0078	10	0.08599	T	0.76	-24.7084	19.9036	0.96999	0.0:0.0:1.0:0.0	.	130	O43155	FLRT2_HUMAN	S	130	ENSP00000332879:A130S;ENSP00000451050:A130S	ENSP00000332879:A130S	A	+	1	0	FLRT2	85157999	1.000000	0.71417	0.962000	0.40283	0.987000	0.75469	8.061000	0.89467	2.706000	0.92434	0.655000	0.94253	GCC	FLRT2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000185070		0.507	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT2	HGNC	protein_coding	OTTHUMT00000413193.1	-	0.00	19	0	G			86088246	+1	tier1	-	no_errors	ENST00000330753	ensembl	human	known	74_37	missense	41.18	10	7	SNP	1.000	T
FNBP1L	54874	genome.wustl.edu	37	1	93988967	93988967	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:93988967A>C	ENST00000271234.7	+	4	412	c.261A>C	c.(259-261)gaA>gaC	p.E87D	FNBP1L_ENST00000370256.4_Missense_Mutation_p.E87D|FNBP1L_ENST00000260506.8_Missense_Mutation_p.E87D|FNBP1L_ENST00000370253.2_Missense_Mutation_p.E87D|FNBP1L_ENST00000604705.1_Missense_Mutation_p.E87D	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	87	F-BAR domain. {ECO:0000250}.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		GACAGCGAGAAGTTGTAGCAG	0.353																																																	0													100.0	96.0	97.0					1																	93988967		1931	4162	6093	SO:0001583	missense	0				CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.261A>C	1.37:g.93988967A>C	ENSP00000271234:p.Glu87Asp		J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Missense_Mutation	SNP	pfam_FCH_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_HR1_rho-bd,smart_FCH_dom,smart_SH3_domain,pfscan_FCH_dom,pfscan_SH3_domain	p.E87D	ENST00000271234.7	37	c.261	CCDS53343.1	1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.109407	0.77096	.	.	ENSG00000137942	ENST00000370256;ENST00000271234;ENST00000260506;ENST00000370253	T;T;T;T	0.19105	2.17;2.17;2.17;2.17	5.95	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.24431	0.0592	M	0.68317	2.08	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.75020	0.985;0.924	T	0.12116	-1.0560	10	0.23302	T	0.38	-41.6721	6.8249	0.23876	0.806:0.0:0.194:0.0	.	87;87	Q5T0N5-4;Q5T0N5-3	.;.	D	87	ENSP00000359278:E87D;ENSP00000271234:E87D;ENSP00000260506:E87D;ENSP00000359275:E87D	ENSP00000260506:E87D	E	+	3	2	FNBP1L	93761555	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.599000	0.61076	1.145000	0.42336	0.402000	0.26972	GAA	FNBP1L	-	pfam_FCH_dom,smart_FCH_dom	ENSG00000137942		0.353	FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	FNBP1L	HGNC	protein_coding		-	0.00	51	0	A	NM_017737		93988967	+1	tier1	-	no_errors	ENST00000271234	ensembl	human	known	74_37	missense	42.31	30	22	SNP	1.000	C
FOLR1	2348	genome.wustl.edu	37	11	71907014	71907014	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:71907014C>T	ENST00000393679.1	+	5	1003	c.567C>T	c.(565-567)tgC>tgT	p.C189C	FOLR1_ENST00000312293.4_Silent_p.C189C|RP11-807H22.7_ENST00000378140.3_RNA|FOLR1_ENST00000393681.2_Silent_p.C189C|FOLR1_ENST00000393676.3_Silent_p.C189C			P15328	FOLR1_HUMAN	folate receptor 1 (adult)	189					cell death (GO:0008219)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|receptor-mediated endocytosis (GO:0006898)	anchored component of external side of plasma membrane (GO:0031362)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|receptor activity (GO:0004872)			cervix(2)|endometrium(1)|large_intestine(7)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	14					Methotrexate(DB00563)	CTGTTCTGTGCAATGAAATCT	0.552																																																	0													101.0	95.0	97.0					11																	71907014		2200	4293	6493	SO:0001819	synonymous_variant	0			J05013	CCDS8211.1	11q13.3-q14.1	2010-04-09			ENSG00000110195	ENSG00000110195			3791	protein-coding gene	gene with protein product		136430		FOLR		1717147	Standard	NM_000802		Approved		uc001osa.2	P15328		ENST00000393679.1:c.567C>T	11.37:g.71907014C>T			Q53EW2|Q6FGT8|Q6LC90|Q9UCT2	Silent	SNP	pfam_Folate_rcpt-like	p.C189	ENST00000393679.1	37	c.567	CCDS8211.1	11																																																																																			FOLR1	-	pfam_Folate_rcpt-like	ENSG00000110195		0.552	FOLR1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FOLR1	HGNC	protein_coding	OTTHUMT00000396773.1	-	0.00	46	0	C	NM_016725		71907014	+1	tier1	-	no_errors	ENST00000312293	ensembl	human	known	74_37	silent	7.14	65	5	SNP	0.995	T
FOXG1	2290	genome.wustl.edu	37	14	29237869	29237869	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:29237869A>C	ENST00000313071.4	+	1	1583	c.1384A>C	c.(1384-1386)Agt>Cgt	p.S462R	FOXG1_ENST00000382535.3_Missense_Mutation_p.S462R	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	462					aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CTCTTTGCCAAGTTTTACGAC	0.557																																																	0													84.0	83.0	83.0					14																	29237869		2203	4300	6503	SO:0001583	missense	0				CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.1384A>C	14.37:g.29237869A>C	ENSP00000339004:p.Ser462Arg		A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S462R	ENST00000313071.4	37	c.1384	CCDS9636.1	14	.	.	.	.	.	.	.	.	.	.	A	11.24	1.580652	0.28180	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.93488	-3.23;-3.23	4.14	4.14	0.48551	.	0.118050	0.53938	U	0.000046	D	0.85243	0.5652	N	0.14661	0.345	0.39860	D	0.973363	P	0.44578	0.838	B	0.39299	0.296	D	0.86489	0.1796	10	0.66056	D	0.02	.	9.0165	0.36173	0.911:0.0:0.089:0.0	.	462	P55316	FOXG1_HUMAN	R	462	ENSP00000371975:S462R;ENSP00000339004:S462R	ENSP00000339004:S462R	S	+	1	0	FOXG1	28307620	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.591000	0.67536	1.633000	0.50488	0.402000	0.26972	AGT	FOXG1	-	NULL	ENSG00000176165		0.557	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXG1	HGNC	protein_coding	OTTHUMT00000276559.3	-	0.00	78	0	A			29237869	+1	tier1	-	no_errors	ENST00000313071	ensembl	human	known	74_37	missense	33.33	46	23	SNP	1.000	C
FOXA1	3169	genome.wustl.edu	37	14	38060617	38060617	+	Missense_Mutation	SNP	C	C	T	rs141004703		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:38060617C>T	ENST00000250448.2	-	2	1433	c.1372G>A	c.(1372-1374)Gcg>Acg	p.A458T	FOXA1_ENST00000540786.1_Missense_Mutation_p.A425T|FOXA1_ENST00000545425.2_5'UTR	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	458					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		TGGTAGTACGCCGGCTCCAGG	0.612																																																	0													56.0	62.0	60.0					14																	38060617		2203	4300	6503	SO:0001583	missense	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.1372G>A	14.37:g.38060617C>T	ENSP00000250448:p.Ala458Thr		B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A458T	ENST00000250448.2	37	c.1372	CCDS9665.1	14	.	.	.	.	.	.	.	.	.	.	C	10.62	1.402162	0.25291	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	T;T	0.39787	1.06;1.06	4.13	3.15	0.36227	Forkhead box protein, C-terminal (1);	0.253443	0.26514	N	0.023954	T	0.14270	0.0345	N	0.02202	-0.64	0.32755	N	0.505879	B	0.10296	0.003	B	0.08055	0.003	T	0.13548	-1.0505	10	0.18710	T	0.47	.	4.6339	0.12514	0.2947:0.5883:0.0:0.117	.	458	P55317	FOXA1_HUMAN	T	458;425	ENSP00000250448:A458T;ENSP00000440178:A425T	ENSP00000250448:A458T	A	-	1	0	FOXA1	37130368	0.944000	0.32072	1.000000	0.80357	0.985000	0.73830	2.061000	0.41403	2.128000	0.65567	0.400000	0.26472	GCG	FOXA1	-	pfam_Forkhead_box_C	ENSG00000129514		0.612	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	-	0.00	47	0	C			38060617	-1	tier1	-	no_errors	ENST00000250448	ensembl	human	known	74_37	missense	43.48	13	10	SNP	0.996	T
FOXK1	221937	genome.wustl.edu	37	7	4801842	4801842	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:4801842C>T	ENST00000328914.4	+	9	1949	c.1949C>T	c.(1948-1950)gCg>gTg	p.A650V	FOXK1_ENST00000446823.1_Missense_Mutation_p.A487V	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		CAGCTCCTTGCGACCCAAGCG	0.642																																																	0													43.0	28.0	33.0					7																	4801842		2144	4202	6346	SO:0001583	missense	0			BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.1949C>T	7.37:g.4801842C>T	ENSP00000328720:p.Ala650Val			Missense_Mutation	SNP	pfam_TF_fork_head,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_TF_fork_head,pfscan_FHA_dom,pfscan_TF_fork_head,prints_TF_fork_head	p.A650V	ENST00000328914.4	37	c.1949	CCDS34591.1	7	.	.	.	.	.	.	.	.	.	.	c	22.6	4.308002	0.81247	.	.	ENSG00000164916	ENST00000446823;ENST00000450194;ENST00000328914;ENST00000545598	D;D	0.97186	-3.91;-4.28	4.82	4.82	0.62117	.	0.198339	0.42682	D	0.000672	D	0.97766	0.9267	L	0.58810	1.83	0.54753	D	0.999986	D;D	0.89917	1.0;1.0	D;D	0.85130	0.986;0.997	D	0.98050	1.0387	10	0.51188	T	0.08	.	15.0709	0.72037	0.0:1.0:0.0:0.0	.	650;487	P85037;P85037-2	FOXK1_HUMAN;.	V	487;406;650;533	ENSP00000394442:A487V;ENSP00000328720:A650V	ENSP00000328720:A650V	A	+	2	0	FOXK1	4768368	1.000000	0.71417	0.988000	0.46212	0.613000	0.37349	5.279000	0.65597	2.232000	0.73038	0.556000	0.70494	GCG	FOXK1	-	NULL	ENSG00000164916		0.642	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXK1	HGNC	protein_coding	OTTHUMT00000323729.2		0.00	55	0	C			4801842	+1			no_errors	ENST00000328914	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
FOXP2	93986	genome.wustl.edu	37	7	114270000	114270000	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:114270000G>A	ENST00000393494.2	+	5	816	c.537G>A	c.(535-537)caG>caA	p.Q179Q	FOXP2_ENST00000350908.4_Silent_p.Q179Q|FOXP2_ENST00000393500.3_Silent_p.Q104Q|FOXP2_ENST00000360232.4_Silent_p.Q179Q|FOXP2_ENST00000393489.3_Silent_p.Q87Q|FOXP2_ENST00000378237.3_Silent_p.Q179Q|FOXP2_ENST00000390668.3_Silent_p.Q203Q|FOXP2_ENST00000408937.3_Silent_p.Q204Q|FOXP2_ENST00000403559.4_Silent_p.Q196Q|FOXP2_ENST00000393491.3_Silent_p.Q87Q|FOXP2_ENST00000393498.2_Silent_p.Q159Q|AC020606.1_ENST00000580664.1_RNA			O15409	FOXP2_HUMAN	forkhead box P2	179	Gln-rich.				camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q204Q(1)		breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						agcaacaacagcagcagcagc	0.498																																																	1	Substitution - coding silent(1)	lung(1)											41.0	38.0	39.0					7																	114270000		2199	4282	6481	SO:0001819	synonymous_variant	0			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.537G>A	7.37:g.114270000G>A			A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.Q204	ENST00000393494.2	37	c.612	CCDS5760.1	7																																																																																			FOXP2	-	NULL	ENSG00000128573		0.498	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	FOXP2	HGNC	protein_coding	OTTHUMT00000317366.1		0.00	28	0	G	NM_014491		114270000	+1			no_errors	ENST00000408937	ensembl	human	known	74_37	silent	5.71	33	2	SNP	1.000	A
FREM1	158326	genome.wustl.edu	37	9	14848682	14848682	+	Silent	SNP	G	G	C	rs373428758		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:14848682G>C	ENST00000380880.3	-	7	2025	c.1242C>G	c.(1240-1242)ccC>ccG	p.P414P	RNU6-1260P_ENST00000362944.1_RNA|FREM1_ENST00000422223.2_Silent_p.P414P|FREM1_ENST00000380881.4_Silent_p.P415P			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	414					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		AGGATACACGGGGGGCATTTG	0.428																																																	0													132.0	119.0	123.0					9																	14848682		1907	4133	6040	SO:0001819	synonymous_variant	0			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.1242C>G	9.37:g.14848682G>C			B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Silent	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.P415	ENST00000380880.3	37	c.1245	CCDS47952.1	9																																																																																			FREM1	-	NULL	ENSG00000164946		0.428	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	-	0.00	80	0	G	NM_144966		14848682	-1	tier1	-	no_errors	ENST00000380881	ensembl	human	known	74_37	silent	42.03	40	29	SNP	0.004	C
FREM2	341640	genome.wustl.edu	37	13	39425912	39425912	+	Missense_Mutation	SNP	C	C	T	rs375661157		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr13:39425912C>T	ENST00000280481.7	+	11	7048	c.6832C>T	c.(6832-6834)Cgc>Tgc	p.R2278C		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	2278	Calx-beta 5.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TCCAGTGATTCGCCAAGGAGA	0.453																																																	0								C	CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	69.0	70.0	70.0		6832	5.6	1.0	13		70	0,8600		0,0,4300	no	missense	FREM2	NM_207361.4	180	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	2278/3170	39425912	1,13005	2203	4300	6503	SO:0001583	missense	0			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.6832C>T	13.37:g.39425912C>T	ENSP00000280481:p.Arg2278Cys		Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.R2278C	ENST00000280481.7	37	c.6832	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	C	21.7	4.182222	0.78677	2.27E-4	0.0	ENSG00000150893	ENST00000280481	T	0.43688	0.94	5.62	5.62	0.85841	Na-Ca exchanger/integrin-beta4 (2);	0.000000	0.85682	D	0.000000	T	0.73783	0.3631	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.79685	-0.1700	10	0.87932	D	0	.	19.655	0.95832	0.0:1.0:0.0:0.0	.	2278;2278	Q5SZK8-2;Q5SZK8	.;FREM2_HUMAN	C	2278	ENSP00000280481:R2278C	ENSP00000280481:R2278C	R	+	1	0	FREM2	38323912	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	4.761000	0.62243	2.650000	0.89964	0.650000	0.86243	CGC	FREM2	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000150893		0.453	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2		0.00	48	0	C	NM_207361		39425912	+1			no_errors	ENST00000280481	ensembl	human	known	74_37	missense	5.26	36	2	SNP	1.000	T
G2E3	55632	genome.wustl.edu	37	14	31058655	31058655	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:31058655G>T	ENST00000206595.6	+	4	356	c.202G>T	c.(202-204)Gat>Tat	p.D68Y	G2E3_ENST00000553504.1_Missense_Mutation_p.D98Y|G2E3_ENST00000544007.1_3'UTR|G2E3_ENST00000438909.2_Missense_Mutation_p.D22Y	NM_017769.3	NP_060239.2	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin protein ligase	68					apoptotic process (GO:0006915)|blastocyst development (GO:0001824)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|protein polyubiquitination (GO:0000209)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						TCTAATAGAAGATATCAGGAA	0.299																																																	0													109.0	119.0	116.0					14																	31058655		2203	4295	6498	SO:0001583	missense	0			AK000340	CCDS9638.1	14q12	2013-01-28	2010-09-17	2009-02-03	ENSG00000092140	ENSG00000092140		"""Zinc fingers, PHD-type"""	20338	protein-coding gene	gene with protein product	"""PHD finger protein 7B"""	611299	"""KIAA1333"""	KIAA1333		18511420, 17239372	Standard	NM_017769		Approved	FLJ20333, PHF7B	uc001wqk.2	Q7L622	OTTHUMG00000140204	ENST00000206595.6:c.202G>T	14.37:g.31058655G>T	ENSP00000206595:p.Asp68Tyr		Q9BVR2|Q9H9E9|Q9NXC0|Q9P2L3	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_HECT,pfscan_HECT	p.D68Y	ENST00000206595.6	37	c.202	CCDS9638.1	14	.	.	.	.	.	.	.	.	.	.	G	25.1	4.604455	0.87157	.	.	ENSG00000092140	ENST00000206595;ENST00000550944;ENST00000438909;ENST00000553504;ENST00000554714;ENST00000547532;ENST00000555429	T;T;T;T;T;T;D	0.93763	-0.61;-0.61;-0.61;-0.61;-0.61;-0.61;-3.28	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.97139	0.9065	M	0.85859	2.78	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.97487	1.0051	10	0.87932	D	0	-17.0659	19.2705	0.94008	0.0:0.0:1.0:0.0	.	22;68	B4DIF9;Q7L622	.;G2E3_HUMAN	Y	68;68;22;98;68;68;68	ENSP00000206595:D68Y;ENSP00000448745:D68Y;ENSP00000391068:D22Y;ENSP00000451653:D98Y;ENSP00000451147:D68Y;ENSP00000446615:D68Y;ENSP00000452275:D68Y	ENSP00000206595:D68Y	D	+	1	0	G2E3	30128406	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.927000	0.87577	2.642000	0.89623	0.591000	0.81541	GAT	G2E3	-	superfamily_Znf_FYVE_PHD	ENSG00000092140		0.299	G2E3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G2E3	HGNC	protein_coding	OTTHUMT00000276613.2		0.00	39	0	G	NM_017769		31058655	+1			no_errors	ENST00000206595	ensembl	human	known	74_37	missense	5.56	34	2	SNP	1.000	T
FSCB	84075	genome.wustl.edu	37	14	44975154	44975154	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:44975154A>G	ENST00000340446.4	-	1	1328	c.1037T>C	c.(1036-1038)cTt>cCt	p.L346P	RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	346	Pro-rich.					sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		TTCAGCCAGAAGCTCTACAGA	0.502																																																	0													71.0	82.0	78.0					14																	44975154		2203	4300	6503	SO:0001583	missense	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.1037T>C	14.37:g.44975154A>G	ENSP00000344579:p.Leu346Pro		Q5H9U7|Q86YI2|Q9H0J3	Missense_Mutation	SNP	NULL	p.L346P	ENST00000340446.4	37	c.1037	CCDS9679.1	14	.	.	.	.	.	.	.	.	.	.	A	1.187	-0.636306	0.03557	.	.	ENSG00000189139	ENST00000340446;ENST00000537803	T	0.10382	2.88	1.8	-0.24	0.13047	.	.	.	.	.	T	0.04272	0.0118	N	0.04508	-0.205	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43940	-0.9360	9	0.27082	T	0.32	4.9995	5.871	0.18802	0.3225:0.0:0.6775:0.0	.	346	Q5H9T9	FSCB_HUMAN	P	346	ENSP00000344579:L346P	ENSP00000344579:L346P	L	-	2	0	FSCB	44044904	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.821000	0.04452	-0.054000	0.13266	-0.495000	0.04643	CTT	FSCB	-	NULL	ENSG00000189139		0.502	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1	-	0.00	67	0	A	NM_032135		44975154	-1	tier1	-	no_errors	ENST00000340446	ensembl	human	known	74_37	missense	31.03	40	18	SNP	0.009	G
GABRA2	2555	genome.wustl.edu	37	4	46252427	46252427	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:46252427G>C	ENST00000510861.1	-	10	1427	c.1254C>G	c.(1252-1254)gaC>gaG	p.D418E	GABRA2_ENST00000356504.1_Missense_Mutation_p.D418E|GABRA2_ENST00000507069.1_Missense_Mutation_p.D478E|GABRA2_ENST00000514090.1_Missense_Mutation_p.D418E|GABRA2_ENST00000540012.1_Missense_Mutation_p.D423E|GABRA2_ENST00000381620.4_Missense_Mutation_p.D418E			P47869	GBRA2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 2	418					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|neurotransmitter transport (GO:0006836)|regulation of neurotransmitter levels (GO:0001505)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of synaptic vesicle membrane (GO:0030285)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	56					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zolpidem(DB00425)|Zopiclone(DB01198)	TGGACATTCTGTCAATTTTGC	0.403																																																	0													177.0	179.0	178.0					4																	46252427		2203	4299	6502	SO:0001583	missense	0				CCDS3471.1	4p12	2012-06-22			ENSG00000151834	ENSG00000151834		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4076	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 2"""	137140					Standard	NM_000807		Approved		uc010igc.2	P47869	OTTHUMG00000044266	ENST00000510861.1:c.1254C>G	4.37:g.46252427G>C	ENSP00000421828:p.Asp418Glu		A8K0U7|B7Z1H8|Q59G14	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa2_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.D423E	ENST00000510861.1	37	c.1269	CCDS3471.1	4	.	.	.	.	.	.	.	.	.	.	G	17.65	3.440947	0.63067	.	.	ENSG00000151834	ENST00000510861;ENST00000514090;ENST00000381620;ENST00000356504;ENST00000540012;ENST00000507069	D;D;D;D;D;D	0.98381	-4.9;-4.9;-4.9;-4.9;-4.9;-4.9	5.96	1.33	0.21861	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.98667	0.9553	M	0.84511	2.7	0.48511	D	0.999667	D;D	0.89917	0.999;1.0	D;D	0.91635	0.997;0.999	D	0.98505	1.0616	10	0.87932	D	0	.	10.166	0.42879	0.3221:0.0:0.6779:0.0	.	423;418	B7Z1H8;P47869	.;GBRA2_HUMAN	E	418;418;418;418;423;478	ENSP00000421828:D418E;ENSP00000421300:D418E;ENSP00000371033:D418E;ENSP00000348897:D418E;ENSP00000444409:D423E;ENSP00000427603:D478E	ENSP00000348897:D418E	D	-	3	2	GABRA2	45947184	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	3.016000	0.49607	0.141000	0.18875	0.655000	0.94253	GAC	GABRA2	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,tigrfam_Neur_channel	ENSG00000151834		0.403	GABRA2-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	GABRA2	HGNC	protein_coding	OTTHUMT00000360848.2	-	0.00	72	0	G			46252427	-1	tier1	-	no_errors	ENST00000540012	ensembl	human	known	74_37	missense	44.64	31	25	SNP	1.000	C
GCNT4	51301	genome.wustl.edu	37	5	74325642	74325642	+	Missense_Mutation	SNP	G	G	A	rs149074938		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:74325642G>A	ENST00000322348.4	-	1	1082	c.221C>T	c.(220-222)tCg>tTg	p.S74L		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	74					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		ATAGATACCCGAACAGTTAAC	0.403																																																	0								G	LEU/SER	2,4404		0,2,2201	138.0	130.0	133.0		221	5.1	0.9	5	dbSNP_134	133	0,8600		0,0,4300	no	missense	GCNT4	NM_016591.2	145	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	possibly-damaging	74/454	74325642	2,13004	2203	4300	6503	SO:0001583	missense	0			AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.221C>T	5.37:g.74325642G>A	ENSP00000317027:p.Ser74Leu			Missense_Mutation	SNP	pfam_Glyco_trans_14	p.S74L	ENST00000322348.4	37	c.221	CCDS4026.1	5	.	.	.	.	.	.	.	.	.	.	.	16.96	3.267309	0.59540	4.54E-4	0.0	ENSG00000176928	ENST00000322348	T	0.45668	0.89	5.95	5.09	0.68999	.	0.203305	0.43110	D	0.000615	T	0.41259	0.1151	M	0.65975	2.015	0.36279	D	0.855673	D	0.58970	0.984	B	0.38264	0.269	T	0.58923	-0.7550	10	0.52906	T	0.07	-10.8927	15.2664	0.73666	0.067:0.0:0.933:0.0	.	74	Q9P109	GCNT4_HUMAN	L	74	ENSP00000317027:S74L	ENSP00000317027:S74L	S	-	2	0	GCNT4	74361398	1.000000	0.71417	0.885000	0.34714	0.973000	0.67179	4.697000	0.61782	1.524000	0.49035	0.655000	0.94253	TCG	GCNT4	-	NULL	ENSG00000176928		0.403	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT4	HGNC	protein_coding	OTTHUMT00000254040.1	-	0.00	32	0	G	NM_016591		74325642	-1	tier1	rs149074938	no_errors	ENST00000322348	ensembl	human	known	74_37	missense	23.40	36	11	SNP	0.997	A
GDF6	392255	genome.wustl.edu	37	8	97172823	97172823	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:97172823G>A	ENST00000287020.5	-	1	197	c.98C>T	c.(97-99)tCg>tTg	p.S33L		NM_001001557.2	NP_001001557.1	Q6KF10	GDF6_HUMAN	growth differentiation factor 6	33	Poly-Ser.				activin receptor signaling pathway (GO:0032924)|apoptotic process (GO:0006915)|BMP signaling pathway (GO:0030509)|growth (GO:0040007)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal cell apoptotic process (GO:1990009)	extracellular space (GO:0005615)				breast(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	27	Breast(36;2.67e-05)					CTCGGCGGACGACGAGGAGGA	0.642																																																	0													50.0	58.0	55.0					8																	97172823		2203	4300	6503	SO:0001583	missense	0				CCDS34926.1	8q22.1	2014-01-29			ENSG00000156466	ENSG00000156466			4221	protein-coding gene	gene with protein product		601147	"""segmentation syndrome 1"""	SGM1		10022976, 18425797	Standard	NM_001001557		Approved	BMP13, KFS, KFS1	uc003yhp.3	Q6KF10	OTTHUMG00000164710	ENST00000287020.5:c.98C>T	8.37:g.97172823G>A	ENSP00000287020:p.Ser33Leu		Q6PI58	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C	p.S33L	ENST00000287020.5	37	c.98	CCDS34926.1	8	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481863	0.63849	.	.	ENSG00000156466	ENST00000287020;ENST00000454970;ENST00000435084	D	0.82255	-1.59	4.25	4.25	0.50352	.	3.878570	0.01150	N	0.006384	T	0.72755	0.3500	N	0.14661	0.345	0.28664	N	0.905989	B	0.32731	0.382	B	0.21917	0.037	T	0.61362	-0.7078	10	0.25106	T	0.35	.	13.5368	0.61652	0.0:0.0:1.0:0.0	.	33	Q6KF10	GDF6_HUMAN	L	33	ENSP00000287020:S33L	ENSP00000287020:S33L	S	-	2	0	GDF6	97241999	0.476000	0.25901	0.589000	0.28718	0.834000	0.47266	4.208000	0.58486	1.893000	0.54813	0.514000	0.50259	TCG	GDF6	-	NULL	ENSG00000156466		0.642	GDF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF6	HGNC	protein_coding	OTTHUMT00000379862.2	-	0.00	110	0	G	NM_001001557		97172823	-1	tier1	-	no_errors	ENST00000287020	ensembl	human	known	74_37	missense	26.11	116	41	SNP	0.998	A
GJA10	84694	genome.wustl.edu	37	6	90604691	90604691	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:90604691A>C	ENST00000369352.1	+	1	504	c.504A>C	c.(502-504)gaA>gaC	p.E168D		NM_032602.1	NP_115991.1	P57773	CXA9_HUMAN	gap junction protein, alpha 10, 62kDa	168					cell communication (GO:0007154)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|skin(3)|urinary_tract(1)	37		all_cancers(76;5.71e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.0915)		CTGTGCTGGAAGTAGGATTCA	0.458																																																	0													142.0	137.0	139.0					6																	90604691		2203	4300	6503	SO:0001583	missense	0			AF296766	CCDS5025.1	6q15-q16	2008-02-05			ENSG00000135355	ENSG00000135355		"""Ion channels / Gap junction proteins (connexins)"""	16995	protein-coding gene	gene with protein product	"""connexin 62"""	611924					Standard	NM_032602		Approved	CX62	uc011eaa.2	Q969M2	OTTHUMG00000015210	ENST00000369352.1:c.504A>C	6.37:g.90604691A>C	ENSP00000358358:p.Glu168Asp		B2R722|B3KVQ2|Q5TA63|Q96KG0	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.E168D	ENST00000369352.1	37	c.504	CCDS5025.1	6	.	.	.	.	.	.	.	.	.	.	A	19.81	3.895786	0.72639	.	.	ENSG00000135355	ENST00000369352	D	0.97553	-4.43	4.91	3.71	0.42584	Gap junction protein, cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.97356	0.9135	M	0.72894	2.215	0.45528	D	0.998484	D	0.89917	1.0	D	0.91635	0.999	D	0.97530	1.0079	10	0.87932	D	0	.	10.8337	0.46675	0.9248:0.0:0.0752:0.0	.	168	Q969M2	CXA10_HUMAN	D	168	ENSP00000358358:E168D	ENSP00000358358:E168D	E	+	3	2	GJA10	90661412	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.036000	0.49767	0.867000	0.35654	0.460000	0.39030	GAA	GJA10	-	pfam_Connexin_CCC,prints_Connexin	ENSG00000135355		0.458	GJA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJA10	HGNC	protein_coding	OTTHUMT00000041505.1	-	0.00	55	0	A	NM_032602		90604691	+1	tier1	-	no_errors	ENST00000369352	ensembl	human	known	74_37	missense	40.48	25	17	SNP	1.000	C
GLYATL2	219970	genome.wustl.edu	37	11	58602155	58602155	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:58602155A>G	ENST00000287275.1	-	6	1022	c.632T>C	c.(631-633)cTt>cCt	p.L211P	GLYATL2_ENST00000532258.1_Missense_Mutation_p.L211P|GLYATL2_ENST00000533636.1_5'Flank	NM_145016.3	NP_659453.3	Q8WU03	GLYL2_HUMAN	glycine-N-acyltransferase-like 2	211						endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)			breast(1)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	23		Breast(21;0.0044)|all_epithelial(135;0.0216)			Glycine(DB00145)	CCAAGAGACAAGCTGGCCCTC	0.458																																																	0													71.0	74.0	73.0					11																	58602155		2136	4264	6400	SO:0001583	missense	0			AF426250	CCDS41649.1	11q12.1	2008-02-05				ENSG00000156689			24178	protein-coding gene	gene with protein product		614762				12477932	Standard	NM_145016		Approved	BXMAS2-10, MGC24009	uc001nnd.4	Q8WU03		ENST00000287275.1:c.632T>C	11.37:g.58602155A>G	ENSP00000287275:p.Leu211Pro		A5LGC7|Q86WC3|Q96AT2	Missense_Mutation	SNP	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	p.L211P	ENST00000287275.1	37	c.632	CCDS41649.1	11	.	.	.	.	.	.	.	.	.	.	A	0.013	-1.623132	0.00820	.	.	ENSG00000156689	ENST00000287275;ENST00000532258	T;T	0.20069	2.1;2.1	4.34	2.41	0.29592	Acyl-CoA N-acyltransferase (2);Glycine N-acyltransferase, C-terminal (1);	0.085587	0.47455	N	0.000222	T	0.05364	0.0142	N	0.00864	-1.135	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.33777	-0.9855	10	0.27785	T	0.31	.	4.956	0.14041	0.1167:0.0:0.6778:0.2056	.	211	Q8WU03	GLYL2_HUMAN	P	211	ENSP00000287275:L211P;ENSP00000434277:L211P	ENSP00000287275:L211P	L	-	2	0	GLYATL2	58358731	0.049000	0.20398	0.002000	0.10522	0.080000	0.17528	0.546000	0.23284	0.273000	0.22049	-0.516000	0.04426	CTT	GLYATL2	-	pfam_Glycine_N-acyltransferase_C,pfam_FR47,superfamily_Acyl_CoA_acyltransferase	ENSG00000156689		0.458	GLYATL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL2	HGNC	protein_coding	OTTHUMT00000394599.1	-	0.00	52	0	A	NM_145016		58602155	-1	tier1	-	no_errors	ENST00000287275	ensembl	human	known	74_37	missense	25.00	45	15	SNP	0.011	G
GLB1L3	112937	genome.wustl.edu	37	11	134147682	134147682	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:134147682T>C	ENST00000431683.2	+	3	238	c.238T>C	c.(238-240)Ttc>Ctc	p.F80L	GLB1L3_ENST00000389887.5_Missense_Mutation_p.F80L	NM_001080407.2	NP_001073876.2	Q8NCI6	GLBL3_HUMAN	galactosidase, beta 1-like 3	80					carbohydrate metabolic process (GO:0005975)		beta-galactosidase activity (GO:0004565)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)	13	all_hematologic(175;0.127)	all_cancers(12;5.52e-23)|all_epithelial(12;2.15e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|all_neural(223;0.0182)|Medulloblastoma(222;0.0208)|Esophageal squamous(93;0.0559)		Epithelial(10;1.3e-11)|all cancers(11;2.07e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000873)|Lung(977;0.222)		TAAGCCCCACTTCACACTGGA	0.582																																																	0													42.0	48.0	46.0					11																	134147682		2201	4296	6497	SO:0001583	missense	0				CCDS44780.1	11q25	2008-11-06	2008-01-29		ENSG00000166105	ENSG00000166105			25147	protein-coding gene	gene with protein product						12477932	Standard	NM_001080407		Approved	FLJ90231	uc009zdf.3	Q8NCI6	OTTHUMG00000133524	ENST00000431683.2:c.238T>C	11.37:g.134147682T>C	ENSP00000396615:p.Phe80Leu		A6NEM0|A6NN15|Q6P3S3|Q96FF8	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.F80L	ENST00000431683.2	37	c.238	CCDS44780.1	11	.	.	.	.	.	.	.	.	.	.	T	22.1	4.238683	0.79800	.	.	ENSG00000166105	ENST00000389887;ENST00000431683	D;D	0.97430	-4.38;-4.38	5.06	5.06	0.68205	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	.	.	.	.	D	0.97779	0.9271	M	0.63428	1.95	0.58432	D	0.999991	D;D	0.89917	1.0;0.998	D;D	0.83275	0.993;0.996	D	0.98210	1.0472	9	0.72032	D	0.01	.	12.7469	0.57285	0.0:0.0:0.0:1.0	.	80;80	Q8NCI6-4;Q8NCI6	.;GLBL3_HUMAN	L	80	ENSP00000374537:F80L;ENSP00000396615:F80L	ENSP00000374537:F80L	F	+	1	0	GLB1L3	133652892	1.000000	0.71417	0.967000	0.41034	0.185000	0.23345	6.943000	0.75934	2.265000	0.75225	0.477000	0.44152	TTC	GLB1L3	-	pfam_Glycoside_Hdrlase_35,superfamily_Glycoside_hydrolase_SF	ENSG00000166105		0.582	GLB1L3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	GLB1L3	HGNC	protein_coding	OTTHUMT00000393625.1	-	0.00	57	0	T	NM_138416		134147682	+1	tier1	-	no_errors	ENST00000431683	ensembl	human	known	74_37	missense	55.07	31	38	SNP	1.000	C
GOLGA6L7P	728310	genome.wustl.edu	37	15	29091084	29091084	+	RNA	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:29091084T>A	ENST00000569815.1	-	0	348					NR_047567.1				golgin A6 family-like 7, pseudogene																		TGTTGGTGGCTTGCCTTATTT	0.512																																																	0																																												0			AK302238		15q13.1	2012-10-05	2011-04-15	2010-04-20	ENSG00000261649	ENSG00000261649			37442	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 6-like 7 (pseudogene)"""	GOLGA6L7			Standard	NR_047567		Approved		uc010uar.2		OTTHUMG00000176345		15.37:g.29091084T>A				RNA	SNP	-	NULL	ENST00000569815.1	37	NULL		15																																																																																			GOLGA6L7P	-	-	ENSG00000261649		0.512	GOLGA6L7P-002	PUTATIVE	basic	processed_transcript	GOLGA6L7P	HGNC	pseudogene	OTTHUMT00000431796.1	-	0.00	206	0	T	XR_078490		29091084	-1	tier1	-	no_errors	ENST00000569815	ensembl	human	putative	74_37	rna	17.60	206	44	SNP	0.001	A
GRIA2	2891	genome.wustl.edu	37	4	158284035	158284035	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:158284035G>T	ENST00000264426.9	+	15	2770	c.2491G>T	c.(2491-2493)Gct>Tct	p.A831S	GRIA2_ENST00000507898.1_Missense_Mutation_p.A784S|GRIA2_ENST00000393815.2_Missense_Mutation_p.A784S|AC079233.1_ENST00000578227.1_RNA|GRIA2_ENST00000296526.7_Missense_Mutation_p.A831S|GRIA2_ENST00000449365.1_Missense_Mutation_p.A784S	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	831					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.A831T(2)		NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AATGCTGGTGGCTTTGATTGA	0.468																																																	2	Substitution - Missense(2)	lung(2)											150.0	135.0	140.0					4																	158284035		2203	4300	6503	SO:0001583	missense	0				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.2491G>T	4.37:g.158284035G>T	ENSP00000264426:p.Ala831Ser		A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A831S	ENST00000264426.9	37	c.2491	CCDS43274.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.306178|4.306178	0.81247|0.81247	.|.	.|.	ENSG00000120251|ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365|ENST00000510854	T;T;T;T;T|.	0.15603|.	2.41;2.41;2.46;2.45;2.41|.	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.83857|0.83857	0.5345|0.5345	M|M	0.84948|0.84948	2.725|2.725	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;0.999;0.994|.	D;D;D|.	0.85130|.	0.994;0.997;0.97|.	D|D	0.83604|0.83604	0.0130|0.0130	10|5	0.87932|.	D|.	0|.	.|.	20.6721|20.6721	0.99693|0.99693	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	831;831;784|.	P42262;P42262-2;A8MT92|.	GRIA2_HUMAN;.;.|.	S|V	784;784;831;831;784|161	ENSP00000426845:A784S;ENSP00000377403:A784S;ENSP00000296526:A831S;ENSP00000264426:A831S;ENSP00000389837:A784S|.	ENSP00000264426:A831S|.	A|G	+|+	1|2	0|0	GRIA2|GRIA2	158503485|158503485	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.869000|9.869000	0.99810|0.99810	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	GCT|GGC	GRIA2	-	prints_NMDA_rcpt	ENSG00000120251		0.468	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA2	HGNC	protein_coding	OTTHUMT00000258367.2	-	0.00	96	0	G			158284035	+1	tier1	-	no_errors	ENST00000264426	ensembl	human	known	74_37	missense	25.97	57	20	SNP	1.000	T
GRID2IP	392862	genome.wustl.edu	37	7	6548686	6548686	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:6548686C>T	ENST00000457091.2	-	12	2029	c.2030G>A	c.(2029-2031)cGc>cAc	p.R677H	GRID2IP_ENST00000452113.1_Missense_Mutation_p.R486H|GRID2IP_ENST00000435185.1_Missense_Mutation_p.R493H	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	677					long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						GTCAGTATCGCGGCTTCGCAC	0.692																																																	0													7.0	8.0	7.0					7																	6548686		686	1584	2270	SO:0001583	missense	0				CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.2030G>A	7.37:g.6548686C>T	ENSP00000397351:p.Arg677His			Missense_Mutation	SNP	pfam_FH2_Formin,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_FH2_Formin,pfscan_PDZ	p.R677H	ENST00000457091.2	37	c.2030	CCDS47537.1	7	.	.	.	.	.	.	.	.	.	.	C	14.00	2.405410	0.42715	.	.	ENSG00000215045	ENST00000452113;ENST00000435185;ENST00000457091	T;T;T	0.43294	0.95;0.95;0.96	4.32	1.49	0.22878	.	0.426594	0.22703	U	0.056674	T	0.30978	0.0782	L	0.52573	1.65	0.37147	D	0.901967	P	0.38420	0.63	B	0.32211	0.142	T	0.22173	-1.0224	10	0.87932	D	0	.	7.7657	0.28978	0.0:0.7112:0.0:0.2888	.	677	A4D2P6	GRD2I_HUMAN	H	486;493;677	ENSP00000397887:R486H;ENSP00000408364:R493H;ENSP00000397351:R677H	ENSP00000408364:R493H	R	-	2	0	GRID2IP	6515211	0.885000	0.30320	0.057000	0.19452	0.836000	0.47400	1.769000	0.38522	0.087000	0.17167	0.467000	0.42956	CGC	GRID2IP	-	NULL	ENSG00000215045		0.692	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	GRID2IP	HGNC	protein_coding	OTTHUMT00000340534.1	-	0.00	34	0	C	XM_294249		6548686	-1	tier1	-	no_errors	ENST00000457091	ensembl	human	putative	74_37	missense	23.94	54	17	SNP	0.922	T
GUCY1B2	2974	genome.wustl.edu	37	13	51578449	51578449	+	RNA	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr13:51578449C>T	ENST00000493639.2	-	0	2509					NR_003923.2		O75343	GCYB2_HUMAN	guanylate cyclase 1, soluble, beta 2 (pseudogene)						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|metal ion binding (GO:0046872)										TAGCTCATGACGGCAGCAGTT	0.532																																																	0																																												0			AF038499		13q14.3	2012-04-19	2012-04-19		ENSG00000123201	ENSG00000123201	4.6.1.2		4686	pseudogene	pseudogene		603695	"""guanylate cyclase 1, soluble, beta 2"""			9889008, 10449911	Standard	NR_003923		Approved	GC-SB2	uc010tgo.2	O75343	OTTHUMG00000016940		13.37:g.51578449C>T			Q9NZ64	RNA	SNP	-	NULL	ENST00000493639.2	37	NULL		13																																																																																			GUCY1B2	-	-	ENSG00000123201		0.532	GUCY1B2-001	KNOWN	basic	processed_transcript	GUCY1B2	HGNC	pseudogene	OTTHUMT00000045014.3		0.00	38	0	C			51578449	-1			no_errors	ENST00000485590	ensembl	human	known	74_37	rna	7.84	47	4	SNP	0.000	T
HAND1	9421	genome.wustl.edu	37	5	153857302	153857302	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:153857302G>A	ENST00000231121.2	-	1	522	c.267C>T	c.(265-267)ggC>ggT	p.G89G		NM_004821.2	NP_004812.1	O96004	HAND1_HUMAN	heart and neural crest derivatives expressed 1	89					angiogenesis (GO:0001525)|blastocyst development (GO:0001824)|cardiac left ventricle formation (GO:0003218)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cartilage morphogenesis (GO:0060536)|embryonic heart tube development (GO:0035050)|embryonic heart tube formation (GO:0003144)|heart development (GO:0007507)|heart looping (GO:0001947)|mesenchyme development (GO:0060485)|mesoderm formation (GO:0001707)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)|trophoblast giant cell differentiation (GO:0060707)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)	6	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			CAAGACGGCCGCCAAGCGCCT	0.721																																																	0													15.0	17.0	16.0					5																	153857302		2200	4286	6486	SO:0001819	synonymous_variant	0			AF061756	CCDS4327.1	5q33	2013-05-21			ENSG00000113196	ENSG00000113196		"""Basic helix-loop-helix proteins"""	4807	protein-coding gene	gene with protein product		602406				9337404, 9931445	Standard	NM_004821		Approved	eHand, Thing1, Hxt, bHLHa27	uc003lvn.3	O96004	OTTHUMG00000130193	ENST00000231121.2:c.267C>T	5.37:g.153857302G>A				Silent	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.G89	ENST00000231121.2	37	c.267	CCDS4327.1	5																																																																																			HAND1	-	NULL	ENSG00000113196		0.721	HAND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAND1	HGNC	protein_coding	OTTHUMT00000252511.1	-	0.00	16	0	G	NM_004821		153857302	-1	tier1	-	no_errors	ENST00000231121	ensembl	human	known	74_37	silent	33.33	8	4	SNP	0.569	A
HBP1	26959	genome.wustl.edu	37	7	106827032	106827032	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:106827032A>T	ENST00000222574.4	+	6	857	c.671A>T	c.(670-672)cAt>cTt	p.H224L	HBP1_ENST00000485846.1_Missense_Mutation_p.H224L|HBP1_ENST00000461963.1_3'UTR|HBP1_ENST00000468410.1_Missense_Mutation_p.H224L	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	224	AXH. {ECO:0000255|PROSITE- ProRule:PRU00496}.				cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						CTGTGCTTTCATAAGGGAAGC	0.398																																																	0													142.0	137.0	139.0					7																	106827032		2203	4300	6503	SO:0001583	missense	0			BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.671A>T	7.37:g.106827032A>T	ENSP00000222574:p.His224Leu		B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,pfam_HMG_box_dom,superfamily_Ataxin-1_HBP1,superfamily_HMG_box_dom,smart_Ataxin_AXH_dom,smart_HMG_box_dom,pfscan_Ataxin-1_HBP1,pfscan_HMG_box_dom	p.H224L	ENST00000222574.4	37	c.671	CCDS5741.1	7	.	.	.	.	.	.	.	.	.	.	A	28.1	4.889353	0.91889	.	.	ENSG00000105856	ENST00000468410;ENST00000222574;ENST00000485846;ENST00000498408	D;D;D	0.99070	-5.39;-5.39;-5.39	5.95	5.95	0.96441	Ataxin, AXH domain (1);Ataxin-1/HBP1 module (AXH) (3);	0.000000	0.85682	D	0.000000	D	0.98595	0.9530	M	0.63428	1.95	0.80722	D	1	P;P;P	0.49559	0.827;0.908;0.925	P;P;P	0.50617	0.448;0.514;0.646	D	0.99640	1.0988	10	0.87932	D	0	-10.1551	16.4323	0.83853	1.0:0.0:0.0:0.0	.	234;224;224	B4DJ36;O60381-3;O60381	.;.;HBP1_HUMAN	L	224;224;224;216	ENSP00000420500:H224L;ENSP00000222574:H224L;ENSP00000418738:H224L	ENSP00000222574:H224L	H	+	2	0	HBP1	106614268	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.272000	0.89885	2.281000	0.76405	0.528000	0.53228	CAT	HBP1	-	pfam_Ataxin-1_HBP1,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	ENSG00000105856		0.398	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBP1	HGNC	protein_coding	OTTHUMT00000349297.1	-	0.00	83	0	A	NM_012257		106827032	+1	tier1	-	no_errors	ENST00000222574	ensembl	human	known	74_37	missense	37.63	58	35	SNP	1.000	T
HERC1	8925	genome.wustl.edu	37	15	63991149	63991149	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:63991149G>A	ENST00000443617.2	-	26	4770	c.4683C>T	c.(4681-4683)cgC>cgT	p.R1561R	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	1561					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						TATGTTTCAGGCGAGCCCAAG	0.393																																																	0													168.0	162.0	164.0					15																	63991149		1884	4111	5995	SO:0001819	synonymous_variant	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.4683C>T	15.37:g.63991149G>A			Q8IW65	Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.R1561	ENST00000443617.2	37	c.4683	CCDS45277.1	15																																																																																			HERC1	-	NULL	ENSG00000103657		0.393	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	-	0.00	34	0	G	NM_003922		63991149	-1	tier1	-	no_errors	ENST00000443617	ensembl	human	known	74_37	silent	11.36	39	5	SNP	1.000	A
HERC1	8925	genome.wustl.edu	37	15	64027049	64027049	+	Splice_Site	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:64027049C>G	ENST00000443617.2	-	13	2608		c.e13-1			NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1						cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CAATTACCACCTAATATCAAA	0.368																																																	0													64.0	57.0	59.0					15																	64027049		1844	4095	5939	SO:0001630	splice_region_variant	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.2521-1G>C	15.37:g.64027049C>G			Q8IW65	Splice_Site	SNP	-	e12-1	ENST00000443617.2	37	c.2521-1	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	C	24.9	4.581632	0.86748	.	.	ENSG00000103657	ENST00000443617	.	.	.	5.59	5.59	0.84812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5833	0.95478	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HERC1	61814102	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.818000	0.86416	2.612000	0.88384	0.655000	0.94253	.	HERC1	-	-	ENSG00000103657		0.368	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	-	0.00	26	0	C	NM_003922	Intron	64027049	-1	tier1	-	no_errors	ENST00000443617	ensembl	human	known	74_37	splice_site	43.59	22	17	SNP	1.000	G
HLA-C	3107	genome.wustl.edu	37	6	31238055	31238056	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:31238055_31238056CC>AA	ENST00000376228.5	-	4	840_841	c.826_827GG>TT	c.(826-828)GGa>TTa	p.G276L	HLA-C_ENST00000383329.3_Missense_Mutation_p.G276L	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	276	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CTGCTCTTGTCCAGAAGGCACC	0.609																																																	0																																										SO:0001583	missense	0			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.826_827delinsAA	6.37:g.31238055_31238056delinsAA	ENSP00000365402:p.Gly276Leu		O02864|O02958|Q29643|Q9MY30	Missense_Mutation|Nonsense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.G276V|p.G276*	ENST00000376228.5	37	c.827|c.826	CCDS34393.1	6																																																																																			HLA-C	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000204525		0.609	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-C	HGNC	protein_coding	OTTHUMT00000076281.3	-	0.00	32|31	0	C	NM_002117		31238055|31238056	-1	tier1	-	no_errors	ENST00000383329	ensembl	human	known	74_37	missense|nonsense	81.82	4	18	SNP	0.811|0.856	A
HLA-C	3107	genome.wustl.edu	37	6	31238853	31238853	+	Missense_Mutation	SNP	C	C	T	rs17849598		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:31238853C>T	ENST00000376228.5	-	3	630	c.616G>A	c.(616-618)Gca>Aca	p.A206T	HLA-C_ENST00000383329.3_Missense_Mutation_p.A206T	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	206	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CTGGTACCTGCGCGCTGCAGC	0.647																																																	0													47.0	42.0	44.0					6																	31238853		2202	4300	6502	SO:0001583	missense	0			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.616G>A	6.37:g.31238853C>T	ENSP00000365402:p.Ala206Thr		O02864|O02958|Q29643|Q9MY30	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.A206T	ENST00000376228.5	37	c.616	CCDS34393.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	9.192|9.192	1.026185|1.026185	0.19512|0.19512	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307|ENST00000415537	T;T|T	0.00695|0.00235	5.84;5.83|8.48	2.55|2.55	-4.93|-4.93	0.03066|0.03066	MHC class I-like antigen recognition (1);|.	0.959209|.	0.08469|.	N|.	0.941313|.	T|T	0.00039|0.00039	0.0001|0.0001	N|N	0.25060|0.25060	0.705|0.705	0.21290|0.21290	N|N	0.999739|0.999739	B;B;B;B|.	0.21905|.	0.062;0.002;0.008;0.004|.	B;B;B;B|.	0.18263|.	0.021;0.005;0.005;0.007|.	T|T	0.18555|0.18555	-1.0333|-1.0333	10|7	0.30078|0.87932	T|D	0.28|0	.|.	6.1502|6.1502	0.20308|0.20308	0.1486:0.2084:0.0:0.643|0.1486:0.2084:0.0:0.643	rs17849598;rs17850340|rs17849598;rs17850340	206;206;206;206|.	A2AEA4;A6H578;A2AEA2;P10321|.	.;.;.;1C07_HUMAN|.	T|H	206;206;206;243|205	ENSP00000365402:A206T;ENSP00000372819:A206T|ENSP00000400410:R205H	ENSP00000365402:A206T|ENSP00000400410:R205H	A|R	-|-	1|2	0|0	HLA-C|HLA-C	31346832|31346832	0.000000|0.000000	0.05858|0.05858	0.261000|0.261000	0.24466|0.24466	0.005000|0.005000	0.04900|0.04900	-0.679000|-0.679000	0.05203|0.05203	-1.431000|-1.431000	0.01982|0.01982	-0.704000|-0.704000	0.03662|0.03662	GCA|CGC	HLA-C	-	NULL	ENSG00000204525		0.647	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-C	HGNC	protein_coding	OTTHUMT00000076281.3		0.00	42	0	C	NM_002117		31238853	-1			no_errors	ENST00000383329	ensembl	human	known	74_37	missense	10.53	34	4	SNP	0.589	T
HLA-B	3106	genome.wustl.edu	37	6	31323162	31323163	+	Missense_Mutation	DNP	CC	CC	AA	rs151341358		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:31323162_31323163CC>AA	ENST00000412585.2	-	4	854_855	c.826_827GG>TT	c.(826-828)GGa>TTa	p.G276L		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	276	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)			endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						CTGCTCTTCTCCAGAAGGCACC	0.574									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																																								0																																										SO:0001583	missense	0	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.826_827delinsAA	6.37:g.31323162_31323163delinsAA	ENSP00000399168:p.Gly276Leu		Q29764	Missense_Mutation|Nonsense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.G276V|p.G276*	ENST00000412585.2	37	c.827|c.826	CCDS34394.1	6																																																																																			HLA-B	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000234745		0.574	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4		0.00	59	0	C	NM_005514		31323162|31323163	-1			no_errors	ENST00000412585	ensembl	human	known	74_37	missense|nonsense	17.86	46	10	SNP	0.998|1.000	A
HLA-DRB5	3127	genome.wustl.edu	37	6	32489822	32489822	+	Missense_Mutation	SNP	C	C	T	rs115417906	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:32489822C>T	ENST00000374975.3	-	2	292	c.230G>A	c.(229-231)cGg>cAg	p.R77Q		NM_002125.3	NP_002116.2			major histocompatibility complex, class II, DR beta 5											NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|pancreas(1)|prostate(1)|stomach(2)	10						CGTCACCGCCCGGTACTCCCC	0.617																																																	0													38.0	35.0	36.0					6																	32489822		2160	4212	6372	SO:0001583	missense	0				CCDS4751.1	6p21.3	2013-01-11			ENSG00000198502	ENSG00000198502		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4953	protein-coding gene	gene with protein product		604776					Standard	NM_002125		Approved		uc003obj.3	Q30154	OTTHUMG00000031027	ENST00000374975.3:c.230G>A	6.37:g.32489822C>T	ENSP00000364114:p.Arg77Gln			Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.R77Q	ENST00000374975.3	37	c.230	CCDS4751.1	6	302	0.1382783882783883	31	0.06300813008130081	57	0.1574585635359116	83	0.1451048951048951	131	0.17282321899736147	.	15.37	2.814317	0.50527	.	.	ENSG00000198502	ENST00000374975	T	0.00356	7.9	4.72	-2.23	0.06930	MHC class II, alpha/beta chain, N-terminal (1);MHC class II, beta chain, N-terminal (3);MHC classes I/II-like antigen recognition protein (1);	1.326340	0.05441	N	0.547586	T	0.00144	0.0004	M	0.84585	2.705	0.09310	N	1	B;B	0.32918	0.094;0.39	B;B	0.20184	0.016;0.028	T	0.19386	-1.0307	10	0.66056	D	0.02	.	9.4942	0.38978	0.6955:0.1936:0.1109:0.0	.	4;77	Q29973;Q30154	.;DRB5_HUMAN	Q	77	ENSP00000364114:R77Q	ENSP00000364114:R77Q	R	-	2	0	HLA-DRB5	32597800	0.000000	0.05858	0.000000	0.03702	0.943000	0.58893	-0.525000	0.06214	-0.241000	0.09681	0.430000	0.28490	CGG	HLA-DRB5	-	pfam_MHC_II_b_N,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N	ENSG00000198502		0.617	HLA-DRB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB5	HGNC	protein_coding	OTTHUMT00000076022.2		0.00	31	0	C	NM_002125		32489822	-1			no_errors	ENST00000374975	ensembl	human	known	74_37	missense	27.27	8	3	SNP	0.000	T
HLA-DQB2	3120	genome.wustl.edu	37	6	32726627	32726627	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:32726627G>A	ENST00000437316.2	-	3	709	c.646C>T	c.(646-648)Cgg>Tgg	p.R216W	HLA-DQB2_ENST00000435145.2_Splice_Site_p.R216W|HLA-DQB2_ENST00000411527.1_Splice_Site_p.R216*			P05538	DQB2_HUMAN	major histocompatibility complex, class II, DQ beta 2	220	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|B cell affinity maturation (GO:0002344)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of alpha-beta T cell activation (GO:0046635)|positive regulation of antigen processing and presentation (GO:0002579)|positive regulation of T-helper 1 type immune response (GO:0002827)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|early endosome (GO:0005769)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)|toxic substance binding (GO:0015643)			endometrium(1)|kidney(1)|lung(1)|prostate(2)	5						TTCCCCTTACGCCACTCCACG	0.562																																																	0																																										SO:0001630	splice_region_variant	0			M83890	CCDS56419.1	6p21.3	2013-01-11			ENSG00000232629	ENSG00000232629		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4945	protein-coding gene	gene with protein product		615161		HLA-DXB		2564844	Standard	NM_001198858		Approved		uc003oby.4	P05538	OTTHUMG00000031125	ENST00000437316.2:c.646+1C>T	6.37:g.32726627G>A			A6NIA5|Q29826|Q29870|Q29871|Q29872|Q29873|Q5SR06	Nonsense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,pfam_CD80_C2-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like_dom	p.R216*	ENST00000437316.2	37	c.646		6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.53|18.53	3.643653|3.643653	0.67244|0.67244	.|.	.|.	ENSG00000232629|ENSG00000232629	ENST00000437316;ENST00000435145|ENST00000411527	T;T|.	0.00619|.	6.18;6.18|.	3.29|3.29	-1.96|-1.96	0.07525|0.07525	.|.	0.882556|0.882556	0.09553|0.09553	U|U	0.786645|0.786645	T|.	0.35008|.	0.0917|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.69654|.	0.965|.	T|.	0.49123|.	-0.8972|.	8|.	.|.	.|.	.|.	.|.	7.1887|7.1887	0.25814|0.25814	0.0:0.1506:0.2404:0.609|0.0:0.1506:0.2404:0.609	.|.	216|.	A2ADX3|.	.|.	W|X	216|216	ENSP00000396330:R216W;ENSP00000410512:R216W|.	.|.	R|R	-|-	1|1	2|2	HLA-DQB2|HLA-DQB2	32834605|32834605	0.707000|0.707000	0.27866|0.27866	0.997000|0.997000	0.53966|0.53966	0.887000|0.887000	0.51463|0.51463	-0.319000|-0.319000	0.08039|0.08039	-0.159000|-0.159000	0.11021|0.11021	0.491000|0.491000	0.48974|0.48974	CGG|CGA	HLA-DQB2	-	NULL	ENSG00000232629		0.562	HLA-DQB2-003	KNOWN	basic|appris_principal	protein_coding	HLA-DQB2	HGNC	protein_coding	OTTHUMT00000076216.2	-	0.00	65	0	G		Missense_Mutation	32726627	-1	tier1	-	no_errors	ENST00000411527	ensembl	human	known	74_37	nonsense	42.31	30	22	SNP	0.989	A
HEY2	23493	genome.wustl.edu	37	6	126080933	126080933	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:126080933A>C	ENST00000368364.3	+	5	1196	c.999A>C	c.(997-999)gaA>gaC	p.E333D	HEY2_ENST00000368365.1_Missense_Mutation_p.E287D	NM_012259.2	NP_036391.1	Q9UBP5	HEY2_HUMAN	hes-related family bHLH transcription factor with YRPW motif 2	333					anterior/posterior axis specification (GO:0009948)|arterial endothelial cell differentiation (GO:0060842)|ascending aorta morphogenesis (GO:0035910)|atrial septum morphogenesis (GO:0060413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate commitment (GO:0045165)|cochlea development (GO:0090102)|coronary vasculature morphogenesis (GO:0060977)|dorsal aorta morphogenesis (GO:0035912)|endocardial cushion to mesenchymal transition involved in heart valve formation (GO:0003199)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|mesenchymal cell development (GO:0014031)|muscular septum morphogenesis (GO:0003150)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cardiac vascular smooth muscle cell differentiation (GO:2000723)|negative regulation of gene expression (GO:0010629)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by transcription factor localization (GO:0010621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000820)|negative regulation of transcription initiation from RNA polymerase II promoter (GO:0060633)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of heart rate (GO:0010460)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein-DNA complex assembly (GO:0065004)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|regulation of auditory receptor cell differentiation (GO:0045607)|regulation of vasculogenesis (GO:2001212)|smooth muscle cell differentiation (GO:0051145)|tricuspid valve formation (GO:0003195)|tricuspid valve morphogenesis (GO:0003186)|umbilical cord morphogenesis (GO:0036304)|vascular smooth muscle cell development (GO:0097084)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	histone deacetylase binding (GO:0042826)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|large_intestine(7)|lung(5)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.0608)|GBM - Glioblastoma multiforme(226;0.0361)|all cancers(137;0.193)		GGGGGACAGAAGTTGGAGCTT	0.478																																																	0													33.0	40.0	38.0					6																	126080933		2203	4300	6503	SO:0001583	missense	0			AJ249545	CCDS5131.1	6q	2013-10-17	2013-10-17		ENSG00000135547	ENSG00000135547		"""Basic helix-loop-helix proteins"""	4881	protein-coding gene	gene with protein product		604674	"""hairy/enhancer-of-split related with YRPW motif 2"""			10415358	Standard	NM_012259		Approved	bHLHb32, HERP1, HESR2	uc003qad.3	Q9UBP5	OTTHUMG00000015512	ENST00000368364.3:c.999A>C	6.37:g.126080933A>C	ENSP00000357348:p.Glu333Asp			Missense_Mutation	SNP	pfam_bHLH_dom,pfam_Orange,superfamily_bHLH_dom,smart_bHLH_dom,smart_Orange_subgr,pfscan_Orange,pfscan_bHLH_dom,prints_Antifreeze_1	p.E333D	ENST00000368364.3	37	c.999	CCDS5131.1	6	.	.	.	.	.	.	.	.	.	.	A	17.15	3.317293	0.60524	.	.	ENSG00000135547	ENST00000368365;ENST00000368364	T;T	0.74947	-0.79;-0.89	5.43	3.06	0.35304	.	0.062472	0.64402	D	0.000008	T	0.51753	0.1693	L	0.54323	1.7	0.41360	D	0.987424	P	0.37525	0.598	B	0.34038	0.174	T	0.54906	-0.8223	10	0.72032	D	0.01	-15.0884	9.0759	0.36522	0.7229:0.0:0.2771:0.0	.	333	Q9UBP5	HEY2_HUMAN	D	287;333	ENSP00000357349:E287D;ENSP00000357348:E333D	ENSP00000357348:E333D	E	+	3	2	HEY2	126122626	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.194000	0.51005	0.377000	0.24735	0.459000	0.35465	GAA	HEY2	-	NULL	ENSG00000135547		0.478	HEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEY2	HGNC	protein_coding	OTTHUMT00000042077.1	-	0.00	46	0	A			126080933	+1	tier1	-	no_errors	ENST00000368364	ensembl	human	known	74_37	missense	46.34	22	19	SNP	1.000	C
HMCN1	83872	genome.wustl.edu	37	1	185962449	185962449	+	Intron	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:185962449T>C	ENST00000271588.4	+	23	3734				HMCN1_ENST00000367492.2_Intron|HMCN1_ENST00000485744.1_3'UTR	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1						response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATGGTGAGTCTTGAAATGAGA	0.388																																																	0													71.0	70.0	71.0					1																	185962449		2203	4299	6502	SO:0001627	intron_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.3505+8T>C	1.37:g.185962449T>C			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	RNA	SNP	-	NULL	ENST00000271588.4	37	NULL	CCDS30956.1	1																																																																																			HMCN1	-	-	ENSG00000143341		0.388	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	87	0	T	NM_031935		185962449	+1	tier1	-	no_errors	ENST00000485744	ensembl	human	known	74_37	rna	38.02	75	46	SNP	0.062	C
HMCN1	83872	genome.wustl.edu	37	1	185962471	185962471	+	Intron	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:185962471C>T	ENST00000271588.4	+	23	3734				HMCN1_ENST00000367492.2_Intron|HMCN1_ENST00000485744.1_3'UTR	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1						response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CATATGACAACCCTGTGGACT	0.353																																																	0													57.0	56.0	57.0					1																	185962471		2203	4299	6502	SO:0001627	intron_variant	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.3505+30C>T	1.37:g.185962471C>T			A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	RNA	SNP	-	NULL	ENST00000271588.4	37	NULL	CCDS30956.1	1																																																																																			HMCN1	-	-	ENSG00000143341		0.353	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	-	0.00	79	0	C	NM_031935		185962471	+1	tier1	-	no_errors	ENST00000485744	ensembl	human	known	74_37	rna	66.07	38	74	SNP	0.000	T
HMGB1P5	10354	genome.wustl.edu	37	3	22424366	22424366	+	RNA	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:22424366G>T	ENST00000451497.1	+	0	931									high mobility group box 1 pseudogene 5																		CTGTTTTGTTGACATTCTGAA	0.333																																																	0																																												0			AF076677		3p24	2011-09-21	2011-04-05	2010-10-15	ENSG00000132967	ENSG00000132967		"""High mobility group / HMG-box pseudogenes"""	4997	pseudogene	pseudogene			"""high-mobility group (nonhistone chromosomal) protein 1-like 5"", ""high-mobility group (nonhistone chromosomal) protein 1-like 5 pseudogene"", ""high-mobility group box 1-like 5 pseudogene"", ""high-mobility group box 1-like 15"", ""high-mobility group box 1 pseudogene 2"", ""high-mobility group box 1-like 5"", ""high-mobility group box 1 pseudogene 5"""	HMG1L5, HMGB1L15, HMGB1P2, HMGB1L5		9925949	Standard	NG_000897		Approved				OTTHUMG00000155591		3.37:g.22424366G>T				RNA	SNP	-	NULL	ENST00000451497.1	37	NULL		3																																																																																			HMGB1P5	-	-	ENSG00000132967		0.333	HMGB1P5-002	KNOWN	basic	processed_transcript	HMGB1P5	HGNC	pseudogene	OTTHUMT00000340803.1		0.00	33	0	G	NG_000897		22424366	+1			no_errors	ENST00000451497	ensembl	human	known	74_37	rna	15.00	17	3	SNP	1.000	T
HSDL1	83693	genome.wustl.edu	37	16	84163988	84163988	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:84163988C>T	ENST00000219439.4	-	4	445	c.269G>A	c.(268-270)cGa>cAa	p.R90Q	HSDL1_ENST00000434463.3_Missense_Mutation_p.R90Q	NM_001146051.1|NM_031463.4	NP_001139523.1|NP_113651.4	Q3SXM5	HSDL1_HUMAN	hydroxysteroid dehydrogenase like 1	90						mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7						ATTGAGACCTCGGCTTGCTAA	0.443																																																	0													105.0	109.0	108.0					16																	84163988		2200	4300	6500	SO:0001583	missense	0			AF237684	CCDS10942.1, CCDS54046.1	16q24	2011-09-20			ENSG00000103160	ENSG00000103160		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	16475	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 3"""					12153137, 19027726	Standard	NM_031463		Approved	SDR12C3	uc002fhk.2	Q3SXM5	OTTHUMG00000137635	ENST00000219439.4:c.269G>A	16.37:g.84163988C>T	ENSP00000219439:p.Arg90Gln		B4DSL2|D3DUL4|Q3SXM4|Q8NC98|Q9BY22	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.R90Q	ENST00000219439.4	37	c.269	CCDS10942.1	16	.	.	.	.	.	.	.	.	.	.	C	11.96	1.794118	0.31777	.	.	ENSG00000103160	ENST00000434463;ENST00000219439	T;D	0.87887	1.35;-2.31	5.36	2.96	0.34315	NAD(P)-binding domain (1);	0.370128	0.34025	N	0.004337	T	0.78855	0.4349	L	0.33710	1.025	0.29304	N	0.868498	B;B	0.26195	0.144;0.069	B;B	0.26202	0.041;0.067	T	0.70306	-0.4908	10	0.33141	T	0.24	-7.4612	9.7145	0.40265	0.0:0.8002:0.0:0.1998	.	90;90	B4DSL2;Q3SXM5	.;HSDL1_HUMAN	Q	90	ENSP00000407437:R90Q;ENSP00000219439:R90Q	ENSP00000219439:R90Q	R	-	2	0	HSDL1	82721489	0.035000	0.19736	0.800000	0.32199	0.035000	0.12851	0.353000	0.20130	1.050000	0.40346	0.655000	0.94253	CGA	HSDL1	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR	ENSG00000103160		0.443	HSDL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSDL1	HGNC	protein_coding	OTTHUMT00000269076.3	-	0.00	54	0	C	NM_031463		84163988	-1	tier1	-	no_errors	ENST00000219439	ensembl	human	known	74_37	missense	29.27	58	24	SNP	0.944	T
HSPB3	8988	genome.wustl.edu	37	5	53751848	53751848	+	Missense_Mutation	SNP	G	G	A	rs148535965	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:53751848G>A	ENST00000302005.1	+	1	404	c.229G>A	c.(229-231)Gtg>Atg	p.V77M		NM_006308.2	NP_006299.1	Q12988	HSPB3_HUMAN	heat shock 27kDa protein 3	77					cell death (GO:0008219)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|large_intestine(4)|prostate(3)	8		Lung NSC(810;0.00104)				CCTGCTGGACGTGGTCCAGTT	0.547													G|||	5	0.000998403	0.0038	0.0	5008	,	,		20261	0.0		0.0	False		,,,				2504	0.0																0								G	MET/VAL	2,4404	4.2+/-10.8	0,2,2201	97.0	88.0	91.0		229	5.7	1.0	5	dbSNP_134	91	1,8599	1.2+/-3.3	0,1,4299	no	missense	HSPB3	NM_006308.2	21	0,3,6500	AA,AG,GG		0.0116,0.0454,0.0231	probably-damaging	77/151	53751848	3,13003	2203	4300	6503	SO:0001583	missense	0			Y17782	CCDS3961.1	5q11.2	2011-09-02	2002-08-29		ENSG00000169271	ENSG00000169271		"""Heat shock proteins / HSPB"""	5248	protein-coding gene	gene with protein product		604624	"""heat shock 27kD protein 3"""			8972725, 9858786	Standard	NM_006308		Approved	HSPL27	uc003jph.2	Q12988	OTTHUMG00000096995	ENST00000302005.1:c.229G>A	5.37:g.53751848G>A	ENSP00000303394:p.Val77Met			Missense_Mutation	SNP	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP	p.V77M	ENST00000302005.1	37	c.229	CCDS3961.1	5	.	.	.	.	.	.	.	.	.	.	G	24.3	4.520918	0.85495	4.54E-4	1.16E-4	ENSG00000169271	ENST00000302005	D	0.94232	-3.38	5.67	5.67	0.87782	Heat shock protein Hsp20 (2);HSP20-like chaperone (1);	0.000000	0.64402	D	0.000001	D	0.97062	0.9040	M	0.83953	2.67	0.54753	D	0.999984	D	0.89917	1.0	D	0.97110	1.0	D	0.97294	0.9926	10	0.87932	D	0	-1.7026	19.7612	0.96319	0.0:0.0:1.0:0.0	.	77	Q12988	HSPB3_HUMAN	M	77	ENSP00000303394:V77M	ENSP00000303394:V77M	V	+	1	0	HSPB3	53787605	1.000000	0.71417	0.988000	0.46212	0.758000	0.43043	7.692000	0.84203	2.646000	0.89796	0.655000	0.94253	GTG	HSPB3	-	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom,prints_Alpha-crystallin/HSP	ENSG00000169271		0.547	HSPB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPB3	HGNC	protein_coding	OTTHUMT00000214074.2	-	0.00	30	0	G			53751848	+1	tier1	rs148535965	no_errors	ENST00000302005	ensembl	human	known	74_37	missense	58.97	16	23	SNP	1.000	A
HTT	3064	genome.wustl.edu	37	4	3231719	3231719	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:3231719G>A	ENST00000355072.5	+	60	8360	c.8215G>A	c.(8215-8217)Gct>Act	p.A2739T	HTT_ENST00000513806.1_3'UTR	NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	2739					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		CGAGATCCTCGCTCAGTACCT	0.577																																																	0													90.0	93.0	92.0					4																	3231719		2152	4264	6416	SO:0001583	missense	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.8215G>A	4.37:g.3231719G>A	ENSP00000347184:p.Ala2739Thr		Q9UQB7	Missense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.A2739T	ENST00000355072.5	37	c.8215	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	G	8.013	0.757926	0.15846	.	.	ENSG00000197386	ENST00000355072	T	0.69175	-0.38	4.82	-9.64	0.00541	.	0.596334	0.16149	N	0.227371	T	0.29652	0.0740	N	0.04508	-0.205	0.09310	N	1	B	0.26318	0.146	B	0.16289	0.015	T	0.27606	-1.0069	10	0.09843	T	0.71	.	10.9952	0.47571	0.5094:0.304:0.1866:0.0	.	2739	P42858	HD_HUMAN	T	2739	ENSP00000347184:A2739T	ENSP00000347184:A2739T	A	+	1	0	HTT	3201517	0.000000	0.05858	0.000000	0.03702	0.751000	0.42716	-0.447000	0.06828	-2.607000	0.00447	-0.136000	0.14681	GCT	HTT	-	NULL	ENSG00000197386		0.577	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	-	0.00	33	0	G	NM_002111		3231719	+1	tier1	-	no_errors	ENST00000355072	ensembl	human	known	74_37	missense	48.00	13	12	SNP	0.000	A
HUWE1	10075	genome.wustl.edu	37	X	53661227	53661227	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:53661227G>T	ENST00000342160.3	-	7	985	c.528C>A	c.(526-528)ggC>ggA	p.G176G	HUWE1_ENST00000218328.8_Silent_p.G176G|HUWE1_ENST00000262854.6_Silent_p.G176G			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	176					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CAAGTCCAAAGCCATTCTCCT	0.463																																																	0													244.0	185.0	205.0					X																	53661227		2203	4300	6503	SO:0001819	synonymous_variant	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.528C>A	X.37:g.53661227G>T			O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/Ts_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.G176	ENST00000342160.3	37	c.528	CCDS35301.1	X																																																																																			HUWE1	-	pfam_E3_Ub_ligase_DUF908,superfamily_ARM-type_fold	ENSG00000086758		0.463	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	-	0.00	32	0	G	XM_497119		53661227	-1	tier1	-	no_errors	ENST00000262854	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.996	T
IDO1	3620	genome.wustl.edu	37	8	39785408	39785408	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:39785408T>G	ENST00000518237.1	+	10	1555	c.916T>G	c.(916-918)Ttc>Gtc	p.F306V	IDO1_ENST00000522495.1_Missense_Mutation_p.F306V|RP11-44K6.3_ENST00000517623.1_RNA	NM_002164.5	NP_002155.1	P14902	I23O1_HUMAN	indoleamine 2,3-dioxygenase 1	306					cellular nitrogen compound metabolic process (GO:0034641)|cytokine production involved in inflammatory response (GO:0002534)|female pregnancy (GO:0007565)|kynurenic acid biosynthetic process (GO:0034276)|multicellular organismal response to stress (GO:0033555)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chronic inflammatory response (GO:0002678)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of type 2 immune response (GO:0002830)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|swimming behavior (GO:0036269)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytosol (GO:0005829)|smooth muscle contractile fiber (GO:0030485)|stereocilium bundle (GO:0032421)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(2)	12					L-Tryptophan(DB00150)|Melatonin(DB01065)	TCACAGGAACTTCCTGTGCTC	0.483																																																	0													44.0	42.0	43.0					8																	39785408		1963	4170	6133	SO:0001583	missense	0			M34455	CCDS47847.1	8p12-p11	2009-01-07	2009-01-07	2009-01-07		ENSG00000131203	1.13.11.52		6059	protein-coding gene	gene with protein product		147435	"""indoleamine-pyrrole 2,3 dioxygenase"""	IDO, INDO		2109605, 8404046	Standard	NM_002164		Approved		uc003xnm.3	P14902		ENST00000518237.1:c.916T>G	8.37:g.39785408T>G	ENSP00000430950:p.Phe306Val		Q540B4	Missense_Mutation	SNP	pfam_Indolamine_dOase	p.F306V	ENST00000518237.1	37	c.916	CCDS47847.1	8	.	.	.	.	.	.	.	.	.	.	T	17.23	3.336499	0.60963	.	.	ENSG00000131203	ENST00000522495;ENST00000518237	T;T	0.58940	0.3;0.3	5.37	5.37	0.77165	.	0.072612	0.56097	D	0.000036	T	0.81264	0.4786	H	0.94734	3.575	0.24003	N	0.996209	D	0.89917	1.0	D	0.97110	1.0	T	0.76963	-0.2764	9	.	.	.	-22.7821	11.6914	0.51519	0.0:0.0:0.0:1.0	.	306	P14902	I23O1_HUMAN	V	306	ENSP00000430505:F306V;ENSP00000430950:F306V	.	F	+	1	0	IDO1	39904565	0.996000	0.38824	0.054000	0.19295	0.038000	0.13279	2.885000	0.48570	2.254000	0.74563	0.460000	0.39030	TTC	IDO1	-	pfam_Indolamine_dOase	ENSG00000131203		0.483	IDO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDO1	HGNC	protein_coding	OTTHUMT00000376987.1	-	0.00	64	0	T	NM_002164		39785408	+1	tier1	-	no_errors	ENST00000518237	ensembl	human	known	74_37	missense	22.83	71	21	SNP	0.256	G
IFIT3	3437	genome.wustl.edu	37	10	91098633	91098633	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:91098633T>C	ENST00000371818.4	+	2	401	c.221T>C	c.(220-222)tTa>tCa	p.L74S	LIPA_ENST00000371837.1_Intron|IFIT3_ENST00000371811.4_Missense_Mutation_p.L74S|LIPA_ENST00000487618.1_Intron	NM_001549.4	NP_001540.2	O14879	IFIT3_HUMAN	interferon-induced protein with tetratricopeptide repeats 3	74					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)|urinary_tract(1)	15						CTGGAATGCTTACGGCAAGCT	0.433																																																	0													101.0	99.0	100.0					10																	91098633		2203	4300	6503	SO:0001583	missense	0			U52513	CCDS7402.1, CCDS31241.1	10q23.31	2014-05-22	2004-07-16	2004-07-16	ENSG00000119917	ENSG00000119917		"""Tetratricopeptide (TTC) repeat domain containing"""	5411	protein-coding gene	gene with protein product		604650	"""interferon-induced protein with tetratricopeptide repeats 4"""	IFIT4		9828129, 9391139	Standard	NM_001031683		Approved	ISG60, RIG-G, CIG-49, IFI60, GARG-49, IRG2	uc001kgg.3	O14879	OTTHUMG00000018708	ENST00000371818.4:c.221T>C	10.37:g.91098633T>C	ENSP00000360883:p.Leu74Ser		Q99634|Q9BSK7	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L74S	ENST00000371818.4	37	c.221	CCDS7402.1	10	.	.	.	.	.	.	.	.	.	.	T	15.23	2.770617	0.49680	.	.	ENSG00000119917	ENST00000371818;ENST00000371811	T;T	0.78481	-1.18;-1.18	4.58	4.58	0.56647	Tetratricopeptide-like helical (1);	0.071088	0.53938	D	0.000042	D	0.89846	0.6833	M	0.91717	3.235	0.32126	N	0.587418	D	0.89917	1.0	D	0.97110	1.0	D	0.92186	0.5755	10	0.87932	D	0	-5.0702	14.1511	0.65384	0.0:0.0:0.0:1.0	.	74	O14879	IFIT3_HUMAN	S	74	ENSP00000360883:L74S;ENSP00000360876:L74S	ENSP00000360876:L74S	L	+	2	0	IFIT3	91088613	0.716000	0.27956	0.441000	0.26858	0.362000	0.29581	5.570000	0.67398	2.286000	0.76751	0.454000	0.30748	TTA	IFIT3	-	smart_TPR_repeat	ENSG00000119917		0.433	IFIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT3	HGNC	protein_coding	OTTHUMT00000049294.1	-	0.00	27	0	T	NM_001549		91098633	+1	tier1	-	no_errors	ENST00000371811	ensembl	human	known	74_37	missense	23.53	39	12	SNP	0.452	C
TRIM59	286827	genome.wustl.edu	37	3	160156367	160156368	+	Frame_Shift_Ins	INS	-	-	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:160156367_160156368insT	ENST00000309784.4	-	3	789_790	c.604_605insA	c.(604-606)agtfs	p.S202fs	TRIM59_ENST00000543469.1_Frame_Shift_Ins_p.S202fs|RP11-432B6.3_ENST00000483754.1_Frame_Shift_Ins_p.S202fs	NM_173084.2	NP_775107.1	Q8IWR1	TRI59_HUMAN	tripartite motif containing 59	202					innate immune response (GO:0045087)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral entry into host cell (GO:0046597)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S202fs*3(1)		breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|urinary_tract(3)	15			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CGTTAGGAAACTTTTTTTTTTC	0.342																																																	1	Deletion - Frameshift(1)	ovary(1)																																								SO:0001589	frameshift_variant	0			AY159379	CCDS3190.1	3q26	2013-01-09	2011-01-25		ENSG00000213186	ENSG00000213186		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	30834	protein-coding gene	gene with protein product			"""tripartite motif-containing 57"", ""tripartite motif-containing 59"""	TRIM57		12095697	Standard	NM_173084		Approved	TSBF1, Mrf1, RNF104	uc003fdm.3	Q8IWR1	OTTHUMG00000159034	ENST00000309784.4:c.605dupA	3.37:g.160156377_160156377dupT	ENSP00000311219:p.Ser202fs		A8K5G9|D3DNL9	Frame_Shift_Ins	INS	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_WD40_repeat_dom,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_B-box,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S202fs	ENST00000309784.4	37	c.605_604	CCDS3190.1	3																																																																																			RP11-432B6.3	-	NULL	ENSG00000248710		0.342	TRIM59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT80	Clone_based_vega_gene	protein_coding	OTTHUMT00000352963.1		0.00	15	0	-	NM_173084		160156368	-1	tier1		no_errors	ENST00000483754	ensembl	human	known	74_37	frame_shift_ins	15.62	27	5	INS	0.000:0.000	T
IL6R	3570	genome.wustl.edu	37	1	154401896	154401896	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:154401896G>T	ENST00000368485.3	+	2	747	c.310G>T	c.(310-312)Ggg>Tgg	p.G104W	IL6R_ENST00000344086.4_Missense_Mutation_p.G104W	NM_000565.3	NP_000556.1	P08887	IL6RA_HUMAN	interleukin 6 receptor	104	Ig-like C2-type.				acute-phase response (GO:0006953)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|endocrine pancreas development (GO:0031018)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatic immune response (GO:0002384)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of interleukin-8 production (GO:0032717)|neutrophil mediated immunity (GO:0002446)|positive regulation of activation of Janus kinase activity (GO:0010536)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|response to cytokine (GO:0034097)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)|plasma membrane (GO:0005886)	ciliary neurotrophic factor binding (GO:0070119)|cytokine receptor activity (GO:0004896)|enzyme binding (GO:0019899)|interleukin-6 binding (GO:0019981)|protein homodimerization activity (GO:0042803)		IL6R/ATP8B2(2)	breast(2)|large_intestine(1)|ovary(3)	6	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)		Tocilizumab(DB06273)	CCGCCCAGCTGGGACTGTGCA	0.597																																																	0													41.0	47.0	45.0					1																	154401896		2203	4300	6503	SO:0001583	missense	0			X12830	CCDS1067.1, CCDS1068.1, CCDS72927.1	1q21	2013-01-11			ENSG00000160712	ENSG00000160712		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6019	protein-coding gene	gene with protein product		147880					Standard	NM_000565		Approved	CD126	uc001fez.2	P08887	OTTHUMG00000036073	ENST00000368485.3:c.310G>T	1.37:g.154401896G>T	ENSP00000357470:p.Gly104Trp		A8KAE8|B2R6V4|Q16202|Q53EQ7|Q5FWG2|Q5VZ23	Missense_Mutation	SNP	pfam_IL-6_rcpt_alpha-bd,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.G104W	ENST00000368485.3	37	c.310	CCDS1067.1	1	.	.	.	.	.	.	.	.	.	.	G	15.74	2.923874	0.52653	.	.	ENSG00000160712	ENST00000368485;ENST00000344086;ENST00000512471	T;T;T	0.20738	2.18;2.05;2.34	5.05	4.06	0.47325	Immunoglobulin-like fold (1);	0.615587	0.16908	N	0.194584	T	0.23965	0.0580	M	0.62723	1.935	0.09310	N	0.999999	D;D	0.89917	1.0;1.0	D;P	0.68039	0.955;0.902	T	0.03981	-1.0987	10	0.37606	T	0.19	-30.7994	7.5648	0.27872	0.1165:0.0:0.8835:0.0	.	104;104	P08887-2;P08887	.;IL6RA_HUMAN	W	104	ENSP00000357470:G104W;ENSP00000340589:G104W;ENSP00000423184:G104W	ENSP00000340589:G104W	G	+	1	0	IL6R	152668520	0.830000	0.29337	0.117000	0.21633	0.061000	0.15899	2.192000	0.42649	2.620000	0.88729	0.561000	0.74099	GGG	IL6R	-	smart_Ig_sub	ENSG00000160712		0.597	IL6R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL6R	HGNC	protein_coding	OTTHUMT00000087911.1	-	0.00	54	0	G	NM_000565		154401896	+1	tier1	-	no_errors	ENST00000368485	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.084	T
IRGC	56269	genome.wustl.edu	37	19	44222750	44222750	+	Nonsense_Mutation	SNP	G	G	T	rs552383567		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:44222750G>T	ENST00000244314.5	+	2	239	c.40G>T	c.(40-42)Gaa>Taa	p.E14*		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	14						membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				TGGGGAGGAGGAAAACACCAT	0.627																																					Colon(189;350 2037 11447 13433 38914)												0													76.0	79.0	78.0					19																	44222750		2203	4300	6503	SO:0001587	stop_gained	0			BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.40G>T	19.37:g.44222750G>T	ENSP00000244314:p.Glu14*		Q05BR8	Nonsense_Mutation	SNP	pfam_Interferon-induced_GTPase,superfamily_P-loop_NTPase	p.E14*	ENST00000244314.5	37	c.40	CCDS12629.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.667251	0.96745	.	.	ENSG00000124449	ENST00000244314	.	.	.	5.39	5.39	0.77823	.	0.436171	0.19877	N	0.104064	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	16.6944	0.85330	0.0:0.0:1.0:0.0	.	.	.	.	X	14	.	ENSP00000244314:E14X	E	+	1	0	IRGC	48914590	0.986000	0.35501	1.000000	0.80357	0.754000	0.42855	2.723000	0.47277	2.540000	0.85666	0.549000	0.68633	GAA	IRGC	-	NULL	ENSG00000124449		0.627	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRGC	HGNC	protein_coding	OTTHUMT00000336191.1		0.00	30	0	G	NM_019612		44222750	+1			no_errors	ENST00000244314	ensembl	human	known	74_37	nonsense	7.55	49	4	SNP	1.000	T
IRX1	79192	genome.wustl.edu	37	5	3599410	3599410	+	Silent	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:3599410T>C	ENST00000302006.3	+	2	400	c.348T>C	c.(346-348)gcT>gcC	p.A116A	CTD-2012M11.3_ENST00000559410.1_RNA	NM_024337.3	NP_077313.3	P78414	IRX1_HUMAN	iroquois homeobox 1	116					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			biliary_tract(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|pancreas(1)|prostate(5)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						CGGCGCCGGCTTATTACCCCT	0.657																																																	0													41.0	46.0	44.0					5																	3599410		2203	4299	6502	SO:0001819	synonymous_variant	0			U90307	CCDS34132.1	5p15.33	2011-12-16	2007-07-13		ENSG00000170549	ENSG00000170549		"""Homeoboxes / TALE class"""	14358	protein-coding gene	gene with protein product		606197					Standard	NM_024337		Approved	IRX-5	uc003jde.3	P78414	OTTHUMG00000161632	ENST00000302006.3:c.348T>C	5.37:g.3599410T>C			Q7Z2F8|Q8N312	Silent	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,smart_Iroquois_homeo,pfscan_Homeobox_dom	p.A116	ENST00000302006.3	37	c.348	CCDS34132.1	5																																																																																			IRX1	-	superfamily_Homeodomain-like	ENSG00000170549		0.657	IRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX1	HGNC	protein_coding	OTTHUMT00000365546.1	-	0.00	42	0	T	NM_024337		3599410	+1	tier1	-	no_errors	ENST00000302006	ensembl	human	known	74_37	silent	15.94	58	11	SNP	1.000	C
ITK	3702	genome.wustl.edu	37	5	156641262	156641262	+	Missense_Mutation	SNP	A	A	T	rs201959697		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:156641262A>T	ENST00000422843.3	+	4	538	c.386A>T	c.(385-387)aAg>aTg	p.K129M	CTB-4E7.1_ENST00000519375.1_RNA	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	129					activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	ATGGATGGGAAGTGGAGGTGC	0.438			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)			Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	0													135.0	126.0	129.0					5																	156641262		2203	4300	6503	SO:0001583	missense	0			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.386A>T	5.37:g.156641262A>T	ENSP00000398655:p.Lys129Met		B2R752|Q32ML7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.K129M	ENST00000422843.3	37	c.386	CCDS4336.1	5	.	.	.	.	.	.	.	.	.	.	A	18.94	3.730462	0.69074	.	.	ENSG00000113263	ENST00000521769;ENST00000422843	D;D	0.94497	-3.44;-3.44	5.49	3.7	0.42460	Pleckstrin homology-type (1);Zinc finger, Btk motif (3);	0.148670	0.64402	D	0.000009	D	0.94245	0.8152	L	0.43598	1.365	0.36488	D	0.868277	D	0.60575	0.988	P	0.59171	0.853	D	0.94268	0.7508	10	0.51188	T	0.08	.	10.4666	0.44611	0.1623:0.0:0.8377:0.0	.	129	Q08881	ITK_HUMAN	M	4;129	ENSP00000430327:K4M;ENSP00000398655:K129M	ENSP00000398655:K129M	K	+	2	0	ITK	156573840	0.999000	0.42202	0.996000	0.52242	0.981000	0.71138	1.423000	0.34837	0.670000	0.31165	-0.242000	0.12053	AAG	ITK	-	pfam_Znf_Btk_motif,smart_Znf_Btk_motif,pfscan_Znf_Btk_motif	ENSG00000113263		0.438	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	HGNC	protein_coding	OTTHUMT00000252569.2	-	0.00	65	0	A			156641262	+1	tier1	-	no_errors	ENST00000422843	ensembl	human	known	74_37	missense	29.79	33	14	SNP	1.000	T
KCND3	3752	genome.wustl.edu	37	1	112525093	112525093	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:112525093G>A	ENST00000315987.2	-	2	735	c.256C>T	c.(256-258)Cgg>Tgg	p.R86W	KCND3_ENST00000302127.4_Missense_Mutation_p.R86W|KCND3_ENST00000369697.1_Missense_Mutation_p.R86W	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	86					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TCGGGGTCCCGGTCGAAGAAG	0.627																																																	0													123.0	111.0	115.0					1																	112525093		2203	4300	6503	SO:0001583	missense	0			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.256C>T	1.37:g.112525093G>A	ENSP00000319591:p.Arg86Trp		O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Shal-type,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.3,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	p.R86W	ENST00000315987.2	37	c.256	CCDS843.1	1	.	.	.	.	.	.	.	.	.	.	G	20.6	4.022184	0.75275	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.90324	-2.65;-2.65;-2.65	5.74	5.74	0.90152	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.97964	0.9330	H	0.99758	4.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99517	1.0957	10	0.87932	D	0	.	19.5181	0.95174	0.0:0.0:1.0:0.0	.	86;86	Q14D71;Q9UK17	.;KCND3_HUMAN	W	86	ENSP00000358711:R86W;ENSP00000319591:R86W;ENSP00000306923:R86W	ENSP00000306923:R86W	R	-	1	2	KCND3	112326616	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.639000	0.74314	2.717000	0.92951	0.655000	0.94253	CGG	KCND3	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	ENSG00000171385		0.627	KCND3-001	KNOWN	basic|CCDS	protein_coding	KCND3	HGNC	protein_coding	OTTHUMT00000033144.1	-	0.00	37	0	G	NM_172198		112525093	-1	tier1	-	no_errors	ENST00000315987	ensembl	human	known	74_37	missense	22.86	27	8	SNP	1.000	A
ITPKB	3707	genome.wustl.edu	37	1	226827315	226827315	+	Silent	SNP	C	C	A	rs116826768	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:226827315C>A	ENST00000272117.3	-	5	2495	c.2496G>T	c.(2494-2496)acG>acT	p.T832T	ITPKB_ENST00000429204.1_Silent_p.T832T			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	832					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				CCTGCTCCCTCGTTTTGGTCT	0.572																																					Colon(84;110 1851 5306 33547)												0													189.0	170.0	177.0					1																	226827315		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2496G>T	1.37:g.226827315C>A			Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Silent	SNP	pfam_IPK	p.T832	ENST00000272117.3	37	c.2496	CCDS1555.1	1																																																																																			ITPKB	-	pfam_IPK	ENSG00000143772		0.572	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	-	0.00	51	0	C	NM_002221		226827315	-1	tier1	-	no_errors	ENST00000272117	ensembl	human	known	74_37	silent	7.84	47	4	SNP	0.609	A
KCNH6	81033	genome.wustl.edu	37	17	61601570	61601570	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr17:61601570C>T	ENST00000583023.1	+	2	158	c.147C>T	c.(145-147)tgC>tgT	p.C49C	KCNH6_ENST00000456941.2_Silent_p.C49C|KCNH6_ENST00000314672.5_Silent_p.C49C|KCNH6_ENST00000581784.1_Silent_p.C49C|KCNH6_ENST00000580652.1_Silent_p.C49C	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	49	PAS.				potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	ACGGCTTCTGCGAACTCTTCG	0.592																																																	0													198.0	179.0	186.0					17																	61601570		2203	4300	6503	SO:0001819	synonymous_variant	0			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.147C>T	17.37:g.61601570C>T			Q9BRD7	Silent	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_2pore_dom_K_chnl_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,superfamily_PAS,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_ELK,prints_2pore_dom_K_chnl,pfscan_cNMP-bd_dom	p.C49	ENST00000583023.1	37	c.147	CCDS11638.1	17																																																																																			KCNH6	-	pfam_PAS_fold,superfamily_PAS	ENSG00000173826		0.592	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH6	HGNC	protein_coding	OTTHUMT00000443853.1	-	0.00	42	0	C	NM_030779		61601570	+1	tier1	-	no_errors	ENST00000583023	ensembl	human	known	74_37	silent	18.84	56	13	SNP	0.851	T
KCNQ3	3786	genome.wustl.edu	37	8	133198348	133198348	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:133198348A>T	ENST00000388996.4	-	2	887	c.467T>A	c.(466-468)cTt>cAt	p.L156H	KCNQ3_ENST00000519445.1_Missense_Mutation_p.L156H|KCNQ3_ENST00000521134.1_Missense_Mutation_p.L36H	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	156					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	CAGTAACAGAAGCCAGTCTCC	0.507																																																	0													109.0	95.0	100.0					8																	133198348		2203	4300	6503	SO:0001583	missense	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.467T>A	8.37:g.133198348A>T	ENSP00000373648:p.Leu156His		A2VCT8|B4DJY4|E7EQ89	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_2pore_dom_K_chnl_dom,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.L156H	ENST00000388996.4	37	c.467	CCDS34943.1	8	.	.	.	.	.	.	.	.	.	.	A	22.8	4.331420	0.81690	.	.	ENSG00000184156	ENST00000388996;ENST00000521134;ENST00000519445;ENST00000542679;ENST00000423790	D;D;D	0.98296	-4.85;-4.85;-4.85	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.98267	0.9426	L	0.42245	1.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.99862	1.1084	10	0.87932	D	0	-15.7477	15.2013	0.73139	1.0:0.0:0.0:0.0	.	156;156	E7ET42;O43525	.;KCNQ3_HUMAN	H	156;36;156;145;35	ENSP00000373648:L156H;ENSP00000429799:L36H;ENSP00000428790:L156H	ENSP00000373648:L156H	L	-	2	0	KCNQ3	133267530	1.000000	0.71417	0.962000	0.40283	0.849000	0.48306	8.651000	0.91078	2.190000	0.69967	0.455000	0.32223	CTT	KCNQ3	-	NULL	ENSG00000184156		0.507	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	-	0.00	79	0	A	NM_004519		133198348	-1	tier1	-	no_errors	ENST00000388996	ensembl	human	known	74_37	missense	26.53	72	26	SNP	0.999	T
KCTD3	51133	genome.wustl.edu	37	1	215794365	215794365	+	3'UTR	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:215794365C>A	ENST00000259154.4	+	0	3147				KCTD3_ENST00000495537.1_3'UTR	NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3						protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		TTAAGTGAATCACATAATTGT	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.*405C>A	1.37:g.215794365C>A			A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	RNA	SNP	-	NULL	ENST00000259154.4	37	NULL	CCDS1515.1	1																																																																																			KCTD3	-	-	ENSG00000136636		0.368	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD3	HGNC	protein_coding	OTTHUMT00000089871.2	-	0.00	47	0	C	NM_016121		215794365	+1	tier1	-	no_errors	ENST00000495537	ensembl	human	known	74_37	rna	50.00	20	20	SNP	0.002	A
KIAA0355	9710	genome.wustl.edu	37	19	34818396	34818396	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:34818396G>T	ENST00000299505.6	+	4	1649	c.776G>T	c.(775-777)tGt>tTt	p.C259F		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	259										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					CAACTCTTTTGTTCTCAAAGT	0.388																																																	0													110.0	120.0	117.0					19																	34818396		2203	4300	6503	SO:0001583	missense	0				CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.776G>T	19.37:g.34818396G>T	ENSP00000299505:p.Cys259Phe		Q2M3W4	Missense_Mutation	SNP	NULL	p.C259F	ENST00000299505.6	37	c.776	CCDS12436.1	19	.	.	.	.	.	.	.	.	.	.	G	23.8	4.464106	0.84425	.	.	ENSG00000166398	ENST00000299505	.	.	.	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.68063	0.2960	L	0.29908	0.895	0.80722	D	1	D	0.69078	0.997	D	0.80764	0.994	T	0.71414	-0.4600	9	0.87932	D	0	-24.0394	19.3067	0.94165	0.0:0.0:1.0:0.0	.	259	O15063	K0355_HUMAN	F	259	.	ENSP00000299505:C259F	C	+	2	0	KIAA0355	39510236	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.400000	0.97290	2.580000	0.87095	0.544000	0.68410	TGT	KIAA0355	-	NULL	ENSG00000166398		0.388	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0355	HGNC	protein_coding	OTTHUMT00000451678.4	-	0.00	48	0	G	NM_014686		34818396	+1	tier1	-	no_errors	ENST00000299505	ensembl	human	known	74_37	missense	5.56	68	4	SNP	1.000	T
KIAA1244	57221	genome.wustl.edu	37	6	138655319	138655319	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:138655319G>A	ENST00000251691.4	+	33	5502	c.5336G>A	c.(5335-5337)aGg>aAg	p.R1779K		NM_020340.4	NP_065073.3			KIAA1244									p.R1708K(1)		NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GACTCTTATAGGACTGCCAGG	0.562																																																	1	Substitution - Missense(1)	kidney(1)											33.0	35.0	35.0					6																	138655319		2203	4300	6503	SO:0001583	missense	0			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.5336G>A	6.37:g.138655319G>A	ENSP00000251691:p.Arg1779Lys			Missense_Mutation	SNP	pfam_DUF1981_Sec7_assoc,superfamily_ARM-type_fold,superfamily_Sec7_dom,smart_Sec7_dom	p.R1779K	ENST00000251691.4	37	c.5336	CCDS5189.2	6	.	.	.	.	.	.	.	.	.	.	G	20.2	3.945719	0.73672	.	.	ENSG00000112379	ENST00000251691	T	0.17528	2.27	5.02	5.02	0.67125	.	0.264686	0.41712	D	0.000829	T	0.13841	0.0335	N	0.22421	0.69	0.50171	D	0.999855	D	0.64830	0.994	D	0.70716	0.97	T	0.01819	-1.1267	10	0.05959	T	0.93	-25.6408	18.3435	0.90313	0.0:0.0:1.0:0.0	.	1779	Q5TH69	BIG3_HUMAN	K	1779	ENSP00000251691:R1779K	ENSP00000251691:R1779K	R	+	2	0	KIAA1244	138697012	1.000000	0.71417	0.994000	0.49952	0.937000	0.57800	7.925000	0.87563	2.341000	0.79615	0.411000	0.27672	AGG	KIAA1244	-	NULL	ENSG00000112379		0.562	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1244	HGNC	protein_coding	OTTHUMT00000042425.4		0.00	22	0	G	NM_020340		138655319	+1			no_errors	ENST00000251691	ensembl	human	known	74_37	missense	7.14	26	2	SNP	1.000	A
KIAA1328	57536	genome.wustl.edu	37	18	34414279	34414279	+	Intron	SNP	G	G	A	rs529687956	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr18:34414279G>A	ENST00000280020.5	+	2	80				KIAA1328_ENST00000592521.1_Intron|KIAA1328_ENST00000591619.1_Missense_Mutation_p.V15I|KIAA1328_ENST00000543923.1_Intron|KIAA1328_ENST00000435985.2_Intron	NM_020776.1	NP_065827.1	Q86T90	K1328_HUMAN	KIAA1328											central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	14				COAD - Colon adenocarcinoma(74;0.195)		GTTCTCCTGCGTAGTTTCTGA	0.338													G|||	2	0.000399361	0.0008	0.0	5008	,	,		16025	0.0		0.0	False		,,,				2504	0.001																0													116.0	102.0	106.0					18																	34414279		1825	4082	5907	SO:0001627	intron_variant	0			AB037749	CCDS45855.1	18q12.2	2011-12-12			ENSG00000150477	ENSG00000150477			29248	protein-coding gene	gene with protein product						10718198	Standard	XM_005258317		Approved		uc002kzz.3	Q86T90		ENST00000280020.5:c.59-4G>A	18.37:g.34414279G>A			Q05DL0|Q49AG6|Q9P2L8	Missense_Mutation	SNP	NULL	p.V15I	ENST00000280020.5	37	c.43	CCDS45855.1	18																																																																																			KIAA1328	-	NULL	ENSG00000150477		0.338	KIAA1328-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1328	HGNC	protein_coding	OTTHUMT00000440455.1	-	0.00	46	0	G	NM_020776		34414279	+1	tier1	-	no_errors	ENST00000591619	ensembl	human	known	74_37	missense	67.74	10	21	SNP	0.042	A
KIAA1551	55196	genome.wustl.edu	37	12	32134669	32134669	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:32134669G>T	ENST00000312561.4	+	4	1194	c.780G>T	c.(778-780)caG>caT	p.Q260H	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	260																	CATCAAGGCAGACCTCAGCTG	0.393																																																	0													80.0	81.0	80.0					12																	32134669		2203	4300	6503	SO:0001583	missense	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.780G>T	12.37:g.32134669G>T	ENSP00000310338:p.Gln260His		B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.Q260H	ENST00000312561.4	37	c.780	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	G	12.99	2.102788	0.37145	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.06608	3.95;3.28	5.68	-0.624	0.11552	.	0.868861	0.09850	N	0.747664	T	0.03477	0.0100	N	0.16656	0.425	0.09310	N	1	B	0.27700	0.186	B	0.25759	0.063	T	0.47649	-0.9101	9	.	.	.	.	5.1603	0.15058	0.3573:0.0:0.5133:0.1294	.	260	Q9HCM1	CL035_HUMAN	H	260	ENSP00000310338:Q260H;ENSP00000370442:Q260H	.	Q	+	3	2	C12orf35	32025936	0.009000	0.17119	0.000000	0.03702	0.010000	0.07245	-0.248000	0.08854	-0.145000	0.11294	0.650000	0.86243	CAG	KIAA1551	-	NULL	ENSG00000174718		0.393	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	-	0.00	22	0	G	NM_018169		32134669	+1	tier1	-	no_errors	ENST00000312561	ensembl	human	known	74_37	missense	28.57	25	10	SNP	0.000	T
KIAA1551	55196	genome.wustl.edu	37	12	32135390	32135390	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:32135390G>C	ENST00000312561.4	+	4	1915	c.1501G>C	c.(1501-1503)Gat>Cat	p.D501H	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	501																	TAACCAAGTTGATTCTGTTTT	0.383																																																	0													78.0	80.0	79.0					12																	32135390		2203	4300	6503	SO:0001583	missense	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.1501G>C	12.37:g.32135390G>C	ENSP00000310338:p.Asp501His		B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.D501H	ENST00000312561.4	37	c.1501	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	G	10.72	1.428596	0.25726	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.06449	3.94;3.3	4.7	-1.17	0.09648	.	1.340870	0.05227	N	0.509654	T	0.03564	0.0102	N	0.08118	0	0.09310	N	1	B	0.29805	0.257	B	0.29598	0.104	T	0.46205	-0.9208	9	.	.	.	.	7.9503	0.30010	0.4793:0.0:0.5207:0.0	.	501	Q9HCM1	CL035_HUMAN	H	501	ENSP00000310338:D501H;ENSP00000370442:D501H	.	D	+	1	0	C12orf35	32026657	0.050000	0.20438	0.000000	0.03702	0.062000	0.15995	1.672000	0.37523	-0.161000	0.10983	-0.670000	0.03821	GAT	KIAA1551	-	NULL	ENSG00000174718		0.383	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	-	0.00	35	0	G	NM_018169		32135390	+1	tier1	-	no_errors	ENST00000312561	ensembl	human	known	74_37	missense	45.00	44	36	SNP	0.000	C
KIAA1551	55196	genome.wustl.edu	37	12	32135420	32135420	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:32135420G>T	ENST00000312561.4	+	4	1945	c.1531G>T	c.(1531-1533)Gaa>Taa	p.E511*	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	511																	TGTCTATTCTGAAAAGCGGCC	0.388																																																	0													60.0	61.0	61.0					12																	32135420		2203	4300	6503	SO:0001587	stop_gained	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.1531G>T	12.37:g.32135420G>T	ENSP00000310338:p.Glu511*		B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Nonsense_Mutation	SNP	NULL	p.E511*	ENST00000312561.4	37	c.1531	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	G	38	6.771860	0.97825	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	.	.	.	4.54	3.63	0.41609	.	0.840369	0.09685	N	0.769166	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6919	0.45875	0.0:0.1936:0.8064:0.0	.	.	.	.	X	511	.	.	E	+	1	0	C12orf35	32026687	0.034000	0.19679	0.002000	0.10522	0.009000	0.06853	2.190000	0.42630	0.862000	0.35528	0.563000	0.77884	GAA	KIAA1551	-	NULL	ENSG00000174718		0.388	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	-	0.00	29	0	G	NM_018169		32135420	+1	tier1	-	no_errors	ENST00000312561	ensembl	human	known	74_37	nonsense	34.15	54	28	SNP	0.002	T
KIAA1551	55196	genome.wustl.edu	37	12	32135882	32135882	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:32135882G>A	ENST00000312561.4	+	4	2407	c.1993G>A	c.(1993-1995)Gac>Aac	p.D665N	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	665																	TGCTAAAAGTGACAGTAGCTG	0.428																																																	0													71.0	66.0	68.0					12																	32135882		2203	4299	6502	SO:0001583	missense	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.1993G>A	12.37:g.32135882G>A	ENSP00000310338:p.Asp665Asn		B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.D665N	ENST00000312561.4	37	c.1993	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	G	13.68	2.309967	0.40895	.	.	ENSG00000174718	ENST00000312561;ENST00000381054	T;T	0.14640	3.67;2.49	4.96	3.12	0.35913	.	1.041540	0.07572	N	0.918764	T	0.12220	0.0297	L	0.43152	1.355	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.33523	-0.9865	9	.	.	.	.	5.4949	0.16797	0.3358:0.0:0.6642:0.0	.	665	Q9HCM1	CL035_HUMAN	N	665	ENSP00000310338:D665N;ENSP00000370442:D665N	.	D	+	1	0	C12orf35	32027149	0.011000	0.17503	0.004000	0.12327	0.016000	0.09150	1.938000	0.40203	1.093000	0.41377	-0.253000	0.11424	GAC	KIAA1551	-	NULL	ENSG00000174718		0.428	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	-	0.00	33	0	G	NM_018169		32135882	+1	tier1	-	no_errors	ENST00000312561	ensembl	human	known	74_37	missense	44.79	53	43	SNP	0.001	A
KIF17	57576	genome.wustl.edu	37	1	21016693	21016693	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:21016693G>T	ENST00000247986.2	-	7	1679	c.1369C>A	c.(1369-1371)Cgg>Agg	p.R457R	KIF17_ENST00000400463.3_Silent_p.R457R|KIF17_ENST00000490034.1_5'UTR|KIF17_ENST00000375044.1_Silent_p.R357R			Q9P2E2	KIF17_HUMAN	kinesin family member 17	457					ATP catabolic process (GO:0006200)|cell projection organization (GO:0030030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|neurogenesis (GO:0022008)|protein complex localization (GO:0031503)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|endometrium(3)|kidney(3)|large_intestine(9)|liver(1)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		GTCTCCTTCCGCAGGTTCTCC	0.602																																																	0													50.0	43.0	45.0					1																	21016693		2203	4300	6503	SO:0001819	synonymous_variant	0			AB037826	CCDS213.1, CCDS44079.1, CCDS72722.1	1p36.13	2012-08-01			ENSG00000117245	ENSG00000117245		"""Kinesins"""	19167	protein-coding gene	gene with protein product	"""kinesin-like protein KIF17"", ""KIF3-related motor protein"", ""KIF17 variant protein"""	605037				10846156	Standard	XR_241202		Approved	KIAA1405, KIF3X, KIF17B, OSM-3, KLP-2	uc001bdr.4	Q9P2E2	OTTHUMG00000002863	ENST00000247986.2:c.1369C>A	1.37:g.21016693G>T			A2A3Q7|A2A3Q8|O95077|Q53YS6|Q5VWA9|Q6GSA8|Q8N411	Silent	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R457	ENST00000247986.2	37	c.1369	CCDS213.1	1																																																																																			KIF17	-	NULL	ENSG00000117245		0.602	KIF17-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF17	HGNC	protein_coding	OTTHUMT00000276995.1		0.00	39	0	G	NM_020816		21016693	-1			no_errors	ENST00000247986	ensembl	human	known	74_37	silent	5.56	34	2	SNP	1.000	T
KIF26A	26153	genome.wustl.edu	37	14	104641616	104641616	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:104641616C>T	ENST00000423312.2	+	12	2491	c.2491C>T	c.(2491-2493)Cga>Tga	p.R831*	KIF26A_ENST00000315264.7_Nonsense_Mutation_p.R692*	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	831					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		CAAGGGTCCCCGAGACGCAGA	0.682																																																	0													15.0	18.0	17.0					14																	104641616		2032	4172	6204	SO:0001587	stop_gained	0			AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2491C>T	14.37:g.104641616C>T	ENSP00000388241:p.Arg831*		Q8TAZ7|Q96GK3|Q9UFL3	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.R831*	ENST00000423312.2	37	c.2491	CCDS45171.1	14	.	.	.	.	.	.	.	.	.	.	C	39	7.897937	0.98551	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	.	.	.	3.28	0.109	0.14578	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	0.3276	0.00313	0.2525:0.2846:0.2513:0.2115	.	.	.	.	X	831;692	.	ENSP00000325452:R692X	R	+	1	2	KIF26A	103711369	0.000000	0.05858	0.040000	0.18447	0.425000	0.31504	0.046000	0.14035	0.168000	0.19655	0.462000	0.41574	CGA	KIF26A	-	NULL	ENSG00000066735		0.682	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	-	0.00	31	0	C			104641616	+1	tier1	-	no_errors	ENST00000423312	ensembl	human	known	74_37	nonsense	41.67	13	10	SNP	0.287	T
KLHDC4	54758	genome.wustl.edu	37	16	87741508	87741508	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:87741508C>T	ENST00000270583.5	-	0	1796				KLHDC4_ENST00000347925.5_3'UTR|KLHDC4_ENST00000353170.5_3'UTR|KLHDC4_ENST00000566349.1_5'UTR|FLJ00104_ENST00000446344.1_5'Flank	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4											breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		CGGCCCAGTGCCGCGTCAGAG	0.572																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.*175G>A	16.37:g.87741508C>T			D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	RNA	SNP	-	NULL	ENST00000270583.5	37	NULL	CCDS10963.1	16																																																																																			KLHDC4	-	-	ENSG00000104731		0.572	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLHDC4	HGNC	protein_coding	OTTHUMT00000269109.2	-	0.00	56	0	C	NM_017566		87741508	-1	tier1	-	no_errors	ENST00000316853	ensembl	human	known	74_37	rna	6.67	56	4	SNP	0.000	T
KRT77	374454	genome.wustl.edu	37	12	53088453	53088453	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:53088453G>T	ENST00000341809.3	-	5	1065	c.1037C>A	c.(1036-1038)gCa>gAa	p.A346E	KRT77_ENST00000537195.1_Missense_Mutation_p.A113E|RP11-641A6.3_ENST00000547533.1_RNA	NM_175078.2	NP_778253.2	Q7Z794	K2C1B_HUMAN	keratin 77	346	Coil 2.|Rod.					cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(2)|endometrium(2)|large_intestine(3)|lung(11)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	25						GCTCCTCTGTGCAATCAGTTC	0.552																																																	0													122.0	85.0	98.0					12																	53088453		2203	4300	6503	SO:0001583	missense	0			BK000975	CCDS8837.1	12q13.13	2013-06-25	2006-07-17	2006-07-17	ENSG00000189182	ENSG00000189182		"""-"", ""Intermediate filaments type II, keratins (basic)"""	20411	protein-coding gene	gene with protein product		611158	"""keratin 1B"""	KRT1B		11683385, 16831889	Standard	NM_175078		Approved		uc001saw.3	Q7Z794	OTTHUMG00000169450	ENST00000341809.3:c.1037C>A	12.37:g.53088453G>T	ENSP00000342710:p.Ala346Glu		Q7RTS8	Missense_Mutation	SNP	pfam_IF,superfamily_Prefoldin,prints_Keratin_II	p.A346E	ENST00000341809.3	37	c.1037	CCDS8837.1	12	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994965	0.54041	.	.	ENSG00000189182	ENST00000341809;ENST00000537195	T;T	0.79845	-1.31;-1.31	4.94	3.07	0.35406	Filament (1);	.	.	.	.	D	0.93281	0.7859	H	0.98754	4.32	0.27759	N	0.943901	D	0.71674	0.998	D	0.72625	0.978	D	0.86615	0.1875	9	0.87932	D	0	.	11.6708	0.51399	0.1566:0.0:0.8434:0.0	.	346	Q7Z794	K2C1B_HUMAN	E	346;113	ENSP00000342710:A346E;ENSP00000440803:A113E	ENSP00000342710:A346E	A	-	2	0	KRT77	51374720	0.998000	0.40836	0.030000	0.17652	0.237000	0.25408	6.421000	0.73353	1.222000	0.43521	0.555000	0.69702	GCA	KRT77	-	pfam_IF,superfamily_Prefoldin	ENSG00000189182		0.552	KRT77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT77	HGNC	protein_coding	OTTHUMT00000404111.1	-	0.00	37	0	G	NM_175078		53088453	-1	tier1	-	no_errors	ENST00000341809	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.697	T
LAMA3	3909	genome.wustl.edu	37	18	21519301	21519301	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr18:21519301C>G	ENST00000313654.9	+	68	9218	c.8977C>G	c.(8977-8979)Ccc>Gcc	p.P2993A	LAMA3_ENST00000269217.6_Missense_Mutation_p.P1384A|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000587184.1_Missense_Mutation_p.P1328A|LAMA3_ENST00000399516.3_Missense_Mutation_p.P2937A	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	2993	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					TGGGGACATTCCCACCAGCCA	0.557																																																	0													158.0	158.0	158.0					18																	21519301		2203	4300	6503	SO:0001583	missense	0			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.8977C>G	18.37:g.21519301C>G	ENSP00000324532:p.Pro2993Ala		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Growth_fac_rcpt_N_dom,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.P2993A	ENST00000313654.9	37	c.8977	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	C	19.96	3.923804	0.73213	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.63255	-0.03;-0.03;-0.03	5.41	4.53	0.55603	Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	T	0.67239	0.2872	L	0.39326	1.205	0.49051	D	0.999745	D;D;D;D	0.76494	0.999;0.962;0.965;0.982	D;P;P;P	0.80764	0.994;0.534;0.556;0.772	T	0.62435	-0.6855	9	0.07482	T	0.82	.	13.9589	0.64166	0.0:0.8467:0.1533:0.0	.	1328;1384;2937;2993	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	A	2993;2937;1384	ENSP00000324532:P2993A;ENSP00000382432:P2937A;ENSP00000269217:P1384A	ENSP00000269217:P1384A	P	+	1	0	LAMA3	19773299	0.997000	0.39634	1.000000	0.80357	0.974000	0.67602	2.086000	0.41643	1.276000	0.44395	0.561000	0.74099	CCC	LAMA3	-	pfscan_Laminin_G	ENSG00000053747		0.557	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	-	0.00	29	0	C	NM_000227, NM_198129		21519301	+1	tier1	-	no_errors	ENST00000313654	ensembl	human	known	74_37	missense	32.26	21	10	SNP	1.000	G
LAMA3	3909	genome.wustl.edu	37	18	21519331	21519331	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr18:21519331C>A	ENST00000313654.9	+	68	9248	c.9007C>A	c.(9007-9009)Cag>Aag	p.Q3003K	LAMA3_ENST00000269217.6_Missense_Mutation_p.Q1394K|LAMA3_ENST00000588770.1_3'UTR|LAMA3_ENST00000587184.1_Missense_Mutation_p.Q1338K|LAMA3_ENST00000399516.3_Missense_Mutation_p.Q2947K	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3	3003	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					CAAGCTTCCTCAGGAGCTGCT	0.542																																																	0													144.0	145.0	145.0					18																	21519331		2203	4300	6503	SO:0001583	missense	0			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.9007C>A	18.37:g.21519331C>A	ENSP00000324532:p.Gln3003Lys		B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_G,pfam_Laminin_I,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Growth_fac_rcpt_N_dom,superfamily_Galactose-bd-like,superfamily_STAT_TF_coiled-coil,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.Q3003K	ENST00000313654.9	37	c.9007	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	C	10.43	1.347324	0.24426	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	T;T;T	0.62498	0.02;0.02;0.02	5.41	4.49	0.54785	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	.	.	.	.	T	0.45816	0.1361	L	0.39397	1.21	0.26637	N	0.972351	B;B;B;B	0.30406	0.278;0.278;0.03;0.03	B;B;B;B	0.24974	0.057;0.057;0.012;0.012	T	0.36237	-0.9756	9	0.06099	T	0.92	.	9.7621	0.40539	0.1438:0.6989:0.1572:0.0	.	1338;1394;2947;3003	Q6VU69;B0YJ33;Q6VU67;Q16787	.;.;.;LAMA3_HUMAN	K	3003;2947;1394	ENSP00000324532:Q3003K;ENSP00000382432:Q2947K;ENSP00000269217:Q1394K	ENSP00000269217:Q1394K	Q	+	1	0	LAMA3	19773329	0.903000	0.30736	0.997000	0.53966	0.929000	0.56500	1.350000	0.34010	2.543000	0.85770	0.561000	0.74099	CAG	LAMA3	-	superfamily_ConA-like_lec_gl_sf,pfscan_Laminin_G	ENSG00000053747		0.542	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	-	0.00	28	0	C	NM_000227, NM_198129		21519331	+1	tier1	-	no_errors	ENST00000313654	ensembl	human	known	74_37	missense	28.12	23	9	SNP	0.813	A
LINC00474	58483	genome.wustl.edu	37	9	118666897	118666897	+	lincRNA	SNP	G	G	T	rs138534774		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:118666897G>T	ENST00000374014.3	-	0	209					NR_024032.1		Q9P2X8	CI027_HUMAN	long intergenic non-protein coding RNA 474																		AGTACAGGTTGCTTGTGAATC	0.398																																																	0																																												0			AB021923		9q31.3	2012-10-12	2011-08-31	2011-08-31	ENSG00000204148	ENSG00000204148		"""Long non-coding RNAs"""	23367	non-coding RNA	RNA, long non-coding			"""chromosome 9 open reading frame 27"""	C9orf27			Standard	NR_024032		Approved	EST-YD1	uc004bjm.3	Q9P2X8	OTTHUMG00000020551		9.37:g.118666897G>T			Q08EI2	RNA	SNP	-	NULL	ENST00000374014.3	37	NULL		9																																																																																			LINC00474	-	-	ENSG00000204148		0.398	LINC00474-001	KNOWN	basic	lincRNA	LINC00474	HGNC	lincRNA	OTTHUMT00000053795.3	-	0.00	69	0	G	NM_021208		118666897	-1	tier1	-	no_errors	ENST00000374014	ensembl	human	known	74_37	rna	38.61	62	39	SNP	0.003	T
LMO7	4008	genome.wustl.edu	37	13	76381620	76381620	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr13:76381620T>A	ENST00000321797.8	+	8	1223	c.502T>A	c.(502-504)Ttt>Att	p.F168I	LMO7_ENST00000377534.3_Missense_Mutation_p.F453I|LMO7_ENST00000341547.4_Intron|LMO7_ENST00000357063.3_Missense_Mutation_p.F453I|LMO7_ENST00000465261.2_Missense_Mutation_p.F168I|RP11-29G8.3_ENST00000563635.1_RNA|LMO7_ENST00000526202.1_Intron			Q8WWI1	LMO7_HUMAN	LIM domain 7	453	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(20)|lung(15)|ovary(2)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		CATCAGTCAGTTTTTACTGCT	0.428																																																	0													81.0	69.0	73.0					13																	76381620		1568	3582	5150	SO:0001583	missense	0			AF092557	CCDS9454.1, CCDS53876.1	13q22.2	2008-02-05	2004-06-15		ENSG00000136153	ENSG00000136153			6646	protein-coding gene	gene with protein product	"""F-box only protein 20"""	604362	"""LIM domain only 7"""	FBXO20		9826547, 10531035	Standard	NM_005358		Approved	FBX20, KIAA0858	uc021rkq.1	Q8WWI1	OTTHUMG00000017093	ENST00000321797.8:c.502T>A	13.37:g.76381620T>A	ENSP00000317802:p.Phe168Ile		E9PLH4|O15462|O95346|Q5TBK6|Q9UKC1|Q9UQM5|Q9Y6A7	Missense_Mutation	SNP	pfam_CH-domain,pfam_PDZ,superfamily_CH-domain,superfamily_PDZ,smart_CH-domain,smart_PDZ,pfscan_CH-domain,pfscan_PDZ,prints_SM22_calponin	p.F453I	ENST00000321797.8	37	c.1357		13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.1|22.1	4.243147|4.243147	0.79912|0.79912	.|.	.|.	ENSG00000136153|ENSG00000136153	ENST00000357063;ENST00000377534;ENST00000321797;ENST00000465261;ENST00000526528|ENST00000447038	T;T;T;T;T|.	0.53640|.	0.61;0.61;0.61;0.61;1.56|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.055575|.	0.64402|.	D|.	0.000001|.	T|T	0.72179|0.72179	0.3428|0.3428	M|M	0.64997|0.64997	1.995|1.995	0.41359|0.41359	D|D	0.987415|0.987415	D;D|.	0.63880|.	0.993;0.993|.	P;P|.	0.61328|.	0.851;0.887|.	T|T	0.71817|0.71817	-0.4478|-0.4478	10|5	0.87932|.	D|.	0|.	-21.6871|-21.6871	16.0034|16.0034	0.80327|0.80327	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	453;168|.	Q8WWI1;E9PLH4|.	LMO7_HUMAN;.|.	I|D	453;453;168;168;74|76	ENSP00000349571:F453I;ENSP00000366757:F453I;ENSP00000317802:F168I;ENSP00000433352:F168I;ENSP00000434201:F74I|.	ENSP00000317802:F168I|.	F|V	+|+	1|2	0|0	LMO7|LMO7	75279621|75279621	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	4.194000|4.194000	0.58393|0.58393	2.179000|2.179000	0.69175|0.69175	0.533000|0.533000	0.62120|0.62120	TTT|GTT	LMO7	-	NULL	ENSG00000136153		0.428	LMO7-005	PUTATIVE	alternative_5_UTR|not_organism_supported|basic|exp_conf	protein_coding	LMO7	HGNC	protein_coding	OTTHUMT00000045301.3	-	0.00	34	0	T	NM_005358		76381620	+1	tier1	-	no_errors	ENST00000357063	ensembl	human	known	74_37	missense	60.66	24	37	SNP	1.000	A
LOC101927905	101927905	genome.wustl.edu	37	12	8388086	8388086	+	lincRNA	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:8388086C>T	ENST00000304751.9	+	0	76				FAM86FP_ENST00000427893.2_RNA																							CCTGTGAGGCCGGCACCACTG	0.632																																																	0																																												0																															12.37:g.8388086C>T				RNA	SNP	-	NULL	ENST00000304751.9	37	NULL		12																																																																																			RP11-266K4.9	-	-	ENSG00000215241		0.632	RP11-266K4.9-001	KNOWN	basic	lincRNA	LOC101927905	Clone_based_vega_gene	lincRNA	OTTHUMT00000400464.1	-	0.00	229	0	C			8388086	+1	tier1	-	no_errors	ENST00000304751	ensembl	human	known	74_37	rna	61.24	69	109	SNP	0.982	T
LOC100190940	100190940	genome.wustl.edu	37	12	130520953	130520953	+	lincRNA	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:130520953T>C	ENST00000567788.1	-	0	1748				RP11-474D1.4_ENST00000561864.1_lincRNA																							TAAGAAATTCTTAggctgggt	0.478																																																	0																																												0																															12.37:g.130520953T>C				RNA	SNP	-	NULL	ENST00000567788.1	37	NULL		12																																																																																			RP11-474D1.3	-	-	ENSG00000214039		0.478	RP11-474D1.3-001	KNOWN	basic	lincRNA	LOC100190940	Clone_based_vega_gene	lincRNA	OTTHUMT00000399498.1		0.00	28	0	T			130520953	-1			no_errors	ENST00000291374	ensembl	human	known	74_37	rna	9.09	30	3	SNP	0.052	C
LOC100240735	100240735	genome.wustl.edu	37	9	44869945	44869945	+	Silent	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:44869945T>C	ENST00000377548.2	+	3	323	c.81T>C	c.(79-81)tcT>tcC	p.S27S	RP11-160N1.10_ENST00000448436.2_Silent_p.S27S																							GCTCGAGCTCTCAGCCACCAG	0.567																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000377548.2:c.81T>C	9.37:g.44869945T>C				Silent	SNP	NULL	p.S27	ENST00000377548.2	37	c.81		9																																																																																			RP11-160N1.10	-	NULL	ENSG00000204814		0.567	RP11-160N1.10-002	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	LOC101928102	Clone_based_vega_gene	protein_coding	OTTHUMT00000192591.2	-	0.00	462	0	T			44869945	+1	tier1	-	no_errors	ENST00000448436	ensembl	human	putative	74_37	silent	30.65	371	164	SNP	0.010	C
LOC90768	90768	genome.wustl.edu	37	4	183064315	183064315	+	RNA	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:183064315A>G	ENST00000315302.2	-	0	747				RP11-402C9.1_ENST00000505389.1_RNA|AC108142.1_ENST00000505873.1_RNA|AC108142.1_ENST00000509012.1_RNA|AC108142.1_ENST00000513752.1_RNA|AC108142.1_ENST00000508968.1_RNA|AC108142.1_ENST00000511052.1_RNA	NR_027107.1																						TGGAGAGGAAAGAAGAGTAGT	0.587																																																	0																																												0																															4.37:g.183064315A>G				RNA	SNP	-	NULL	ENST00000315302.2	37	NULL		4																																																																																			AC108142.1	-	-	ENSG00000177822		0.587	AC108142.1-001	KNOWN	basic	antisense	LOC101928703	Clone_based_vega_gene	antisense	OTTHUMT00000257786.2	-	0.00	53	0	A			183064315	-1	tier1	-	no_errors	ENST00000315302	ensembl	human	known	74_37	rna	23.53	26	8	SNP	0.000	G
LRFN1	57622	genome.wustl.edu	37	19	39804743	39804743	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:39804743C>T	ENST00000248668.4	-	1	1233	c.1234G>A	c.(1234-1236)Gcc>Acc	p.A412T	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	412						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CCCGGCGTGGCGATGTCAGAG	0.711																																																	0													16.0	20.0	19.0					19																	39804743		2051	4174	6225	SO:0001583	missense	0			BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.1234G>A	19.37:g.39804743C>T	ENSP00000248668:p.Ala412Thr		Q8TBS9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.A412T	ENST00000248668.4	37	c.1234	CCDS46071.1	19	.	.	.	.	.	.	.	.	.	.	C	8.525	0.869591	0.17322	.	.	ENSG00000128011	ENST00000248668	T	0.60920	0.15	4.53	4.53	0.55603	.	0.000000	0.44483	D	0.000443	T	0.26122	0.0637	N	0.03608	-0.345	0.37153	D	0.902246	B	0.24317	0.101	B	0.19391	0.025	T	0.33007	-0.9885	10	0.02654	T	1	.	8.3951	0.32553	0.0:0.895:0.0:0.105	.	412	Q9P244	LRFN1_HUMAN	T	412	ENSP00000248668:A412T	ENSP00000248668:A412T	A	-	1	0	LRFN1	44496583	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	1.240000	0.32731	2.352000	0.79861	0.655000	0.94253	GCC	LRFN1	-	NULL	ENSG00000128011		0.711	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN1	HGNC	protein_coding	OTTHUMT00000463835.1	-	0.00	41	0	C	NM_020862		39804743	-1	tier1	-	no_errors	ENST00000248668	ensembl	human	known	74_37	missense	19.61	40	10	SNP	1.000	T
LRIT2	340745	genome.wustl.edu	37	10	85981684	85981684	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:85981684T>C	ENST00000372113.4	-	3	1650	c.1645A>G	c.(1645-1647)Aac>Gac	p.N549D	LRIT2_ENST00000538192.1_Missense_Mutation_p.N559D	NM_001017924.2	NP_001017924.1	A6NDA9	LRIT2_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 2	549						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|prostate(6)|urinary_tract(1)	32						GTTCAGCTGTTGTCTTCCGTT	0.527																																																	0													149.0	116.0	127.0					10																	85981684		2203	4300	6503	SO:0001583	missense	0				CCDS31234.1, CCDS60581.1	10q23.2	2013-01-11	2007-06-19	2007-06-19	ENSG00000204033	ENSG00000204033		"""Immunoglobulin superfamily / I-set domain containing"""	23443	protein-coding gene	gene with protein product			"""leucine rich repeat containing 22"""	LRRC22			Standard	NM_001017924		Approved	AC022389.4	uc001kcy.3	A6NDA9	OTTHUMG00000018633	ENST00000372113.4:c.1645A>G	10.37:g.85981684T>C	ENSP00000361185:p.Asn549Asp		B7ZME6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.N559D	ENST00000372113.4	37	c.1675	CCDS31234.1	10	.	.	.	.	.	.	.	.	.	.	T	8.423	0.846942	0.17034	.	.	ENSG00000204033	ENST00000372113;ENST00000538192	T;T	0.16743	2.32;2.32	3.83	-1.96	0.07525	.	3.793180	0.03767	U	0.259129	T	0.07413	0.0187	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.24693	-1.0153	10	0.28530	T	0.3	.	0.967	0.01407	0.156:0.291:0.1604:0.3925	.	559;549	B7ZME6;A6NDA9	.;LRIT2_HUMAN	D	549;559	ENSP00000361185:N549D;ENSP00000438264:N559D	ENSP00000361185:N549D	N	-	1	0	LRIT2	85971664	0.981000	0.34729	0.000000	0.03702	0.008000	0.06430	1.549000	0.36212	-0.478000	0.06823	-0.250000	0.11733	AAC	LRIT2	-	NULL	ENSG00000204033		0.527	LRIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT2	HGNC	protein_coding	OTTHUMT00000049110.4	-	0.00	46	0	T	XM_291697		85981684	-1	tier1	-	no_errors	ENST00000538192	ensembl	human	known	74_37	missense	6.56	57	4	SNP	0.000	C
LRRC43	254050	genome.wustl.edu	37	12	122674687	122674687	+	Missense_Mutation	SNP	G	G	T	rs188524855	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:122674687G>T	ENST00000339777.4	+	5	701	c.673G>T	c.(673-675)Gtc>Ttc	p.V225F	LRRC43_ENST00000425921.1_Missense_Mutation_p.V40F	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	225										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		GCCCAACCTCGTCTCCCTGGA	0.652																																																	0													113.0	124.0	120.0					12																	122674687		2146	4240	6386	SO:0001583	missense	0			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.673G>T	12.37:g.122674687G>T	ENSP00000344233:p.Val225Phe		Q6ZVT9	Missense_Mutation	SNP	NULL	p.V225F	ENST00000339777.4	37	c.673	CCDS45001.1	12	.	.	.	.	.	.	.	.	.	.	G	10.06	1.246149	0.22796	.	.	ENSG00000158113	ENST00000537729;ENST00000339777;ENST00000289014;ENST00000425921	T;T;T	0.24538	1.85;1.85;1.85	4.95	2.13	0.27403	.	0.151580	0.43416	D	0.000570	T	0.28134	0.0694	M	0.85197	2.74	0.37326	D	0.909762	P	0.39116	0.66	B	0.30401	0.115	T	0.28964	-1.0027	10	0.54805	T	0.06	-35.5951	10.0815	0.42393	0.2235:0.0:0.7765:0.0	.	225	Q8N309	LRC43_HUMAN	F	40;225;96;40	ENSP00000438751:V40F;ENSP00000344233:V225F;ENSP00000416628:V40F	ENSP00000289014:V96F	V	+	1	0	LRRC43	121240640	0.763000	0.28462	0.260000	0.24451	0.126000	0.20510	0.940000	0.28992	0.163000	0.19507	-0.215000	0.12644	GTC	LRRC43	-	NULL	ENSG00000158113		0.652	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC43	HGNC	protein_coding	OTTHUMT00000401589.1	-	0.00	61	0	G	NM_152759		122674687	+1	tier1	-	no_errors	ENST00000339777	ensembl	human	known	74_37	missense	30.34	62	27	SNP	0.947	T
LRRC8B	23507	genome.wustl.edu	37	1	90049626	90049626	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:90049626T>C	ENST00000330947.2	+	5	1777	c.1417T>C	c.(1417-1419)Tca>Cca	p.S473P	LRRC8B_ENST00000439853.1_Missense_Mutation_p.S473P|RP5-1007M22.2_ENST00000443562.1_RNA|LRRC8B_ENST00000358200.4_Missense_Mutation_p.S473P	NM_001134476.1	NP_001127948.1	Q6P9F7	LRC8B_HUMAN	leucine rich repeat containing 8 family, member B	473					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	26		all_lung(203;0.17)		all cancers(265;0.00515)|Epithelial(280;0.0241)		TGTGTACCATTCATCTCTGGT	0.488																																																	0													53.0	52.0	52.0					1																	90049626		2203	4300	6503	SO:0001583	missense	0			AF385436	CCDS724.1	1p22.2	2008-02-05			ENSG00000197147	ENSG00000197147			30692	protein-coding gene	gene with protein product	"""T cell activation leucine repeat rich protein"""	612888				9039502	Standard	NM_015350		Approved	TA-LRRP, KIAA0231	uc001dni.3	Q6P9F7	OTTHUMG00000010129	ENST00000330947.2:c.1417T>C	1.37:g.90049626T>C	ENSP00000332674:p.Ser473Pro		D3DT28|Q6UY21|Q8N106|Q92627	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S473P	ENST00000330947.2	37	c.1417	CCDS724.1	1	.	.	.	.	.	.	.	.	.	.	T	11.55	1.672666	0.29693	.	.	ENSG00000197147	ENST00000330947;ENST00000358200;ENST00000439853	T;T;T	0.00976	5.48;5.48;5.48	5.3	5.3	0.74995	.	0.000000	0.64402	D	0.000003	T	0.00998	0.0033	L	0.53249	1.67	0.41089	D	0.985588	D	0.61080	0.989	P	0.47573	0.55	T	0.76493	-0.2939	9	.	.	.	.	15.5492	0.76133	0.0:0.0:0.0:1.0	.	473	Q6P9F7	LRC8B_HUMAN	P	473	ENSP00000332674:S473P;ENSP00000350933:S473P;ENSP00000400704:S473P	.	S	+	1	0	LRRC8B	89822214	0.998000	0.40836	0.541000	0.28102	0.147000	0.21601	3.875000	0.56108	2.122000	0.65172	0.533000	0.62120	TCA	LRRC8B	-	NULL	ENSG00000197147		0.488	LRRC8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8B	HGNC	protein_coding	OTTHUMT00000028008.1	-	0.00	35	0	T	NM_015350		90049626	+1	tier1	-	no_errors	ENST00000330947	ensembl	human	known	74_37	missense	15.00	17	3	SNP	0.882	C
LRRK2	120892	genome.wustl.edu	37	12	40681184	40681184	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:40681184C>T	ENST00000298910.7	+	20	2590	c.2532C>T	c.(2530-2532)atC>atT	p.I844I	LRRK2_ENST00000343742.2_Silent_p.I844I	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	844					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GAATGGTGATCAGATATCAGA	0.363																																																	0													99.0	93.0	95.0					12																	40681184		2203	4299	6502	SO:0001819	synonymous_variant	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2532C>T	12.37:g.40681184C>T			A6NJU2|Q6ZS50|Q8NCX9	Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.I844	ENST00000298910.7	37	c.2532	CCDS31774.1	12																																																																																			LRRK2	-	NULL	ENSG00000188906		0.363	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	23	0	C	XM_058513		40681184	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	silent	21.88	50	14	SNP	0.991	T
LRRK2	120892	genome.wustl.edu	37	12	40681261	40681261	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:40681261C>G	ENST00000298910.7	+	20	2667	c.2609C>G	c.(2608-2610)tCt>tGt	p.S870C	LRRK2_ENST00000343742.2_Missense_Mutation_p.S870C	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	870					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GATGTGCTGTCTAAATTTGAT	0.378																																																	0													124.0	120.0	121.0					12																	40681261		2203	4300	6503	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2609C>G	12.37:g.40681261C>G	ENSP00000298910:p.Ser870Cys		A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_P-loop_NTPase,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,tigrfam_Small_GTP-bd_dom	p.S870C	ENST00000298910.7	37	c.2609	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	C	5.541	0.284668	0.10513	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.72835	2.15;-0.69	5.5	1.52	0.23074	.	0.367330	0.27856	N	0.017574	T	0.47581	0.1453	N	0.08118	0	0.09310	N	1	B;B	0.25719	0.102;0.132	B;B	0.27262	0.078;0.012	T	0.41448	-0.9508	10	0.56958	D	0.05	.	8.1946	0.31389	0.6178:0.2558:0.0:0.1264	.	870;870	E9PC85;Q5S007	.;LRRK2_HUMAN	C	870	ENSP00000341930:S870C;ENSP00000298910:S870C	ENSP00000298910:S870C	S	+	2	0	LRRK2	38967528	0.996000	0.38824	0.001000	0.08648	0.129000	0.20672	0.999000	0.29757	0.013000	0.14918	-0.714000	0.03626	TCT	LRRK2	-	NULL	ENSG00000188906		0.378	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	-	0.00	40	0	C	XM_058513		40681261	+1	tier1	-	no_errors	ENST00000298910	ensembl	human	known	74_37	missense	16.22	62	12	SNP	0.061	G
LYG1	129530	genome.wustl.edu	37	2	99900948	99900948	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:99900948C>T	ENST00000409448.1	-	8	809	c.493G>A	c.(493-495)Gct>Act	p.A165T	LYG1_ENST00000308528.4_Missense_Mutation_p.A165T			Q8N1E2	LYG1_HUMAN	lysozyme G-like 1	165					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						ACATAGCCAGCACCCCCACTG	0.493																																																	0													104.0	87.0	93.0					2																	99900948		2203	4300	6503	SO:0001583	missense	0			BC029126	CCDS2043.1	2q11.2	2008-02-05			ENSG00000144214	ENSG00000144214			27014	protein-coding gene	gene with protein product						12574869	Standard	NM_174898		Approved	SALW1939	uc002szy.3	Q8N1E2	OTTHUMG00000130639	ENST00000409448.1:c.493G>A	2.37:g.99900948C>T	ENSP00000386923:p.Ala165Thr		Q53RV9	Missense_Mutation	SNP	superfamily_Lysozyme-like_dom,pirsf_Glyco_hydro_23,prints_Glyco_hydro_23	p.A165T	ENST00000409448.1	37	c.493	CCDS2043.1	2	.	.	.	.	.	.	.	.	.	.	C	8.931	0.963471	0.18583	.	.	ENSG00000144214	ENST00000308528;ENST00000409448	.	.	.	4.54	-5.71	0.02413	Lysozyme-like domain (1);	1.157730	0.06458	N	0.728976	T	0.23766	0.0575	N	0.14661	0.345	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.30357	-0.9981	8	.	.	.	-1.0149	13.5144	0.61533	0.0:0.2746:0.6415:0.0839	.	165	Q8N1E2	LYG1_HUMAN	T	165	.	.	A	-	1	0	LYG1	99267380	0.000000	0.05858	0.001000	0.08648	0.960000	0.62799	-2.424000	0.01029	-0.573000	0.05998	0.561000	0.74099	GCT	LYG1	-	superfamily_Lysozyme-like_dom,pirsf_Glyco_hydro_23,prints_Glyco_hydro_23	ENSG00000144214		0.493	LYG1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LYG1	HGNC	protein_coding	OTTHUMT00000330315.1		0.00	47	0	C	NM_174898		99900948	-1			no_errors	ENST00000308528	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.000	T
MACF1	23499	genome.wustl.edu	37	1	39812766	39812766	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:39812766C>G	ENST00000372915.3	+	40	10801	c.10714C>G	c.(10714-10716)Ctg>Gtg	p.L3572V	MACF1_ENST00000564288.1_Missense_Mutation_p.L3567V|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000567887.1_Missense_Mutation_p.L3604V|MACF1_ENST00000289893.4_Missense_Mutation_p.L2007V|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000476350.1_Intron|MACF1_ENST00000545844.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3572					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCGACAGATGCTGAGGCTTCT	0.498																																																	0													101.0	99.0	100.0					1																	39812766		2203	4300	6503	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.10714C>G	1.37:g.39812766C>G	ENSP00000362006:p.Leu3572Val		B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_RNaseH-like_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.L3604V	ENST00000372915.3	37	c.10810		1	.	.	.	.	.	.	.	.	.	.	C	15.11	2.735396	0.49045	.	.	ENSG00000127603	ENST00000372915;ENST00000289893	T;T	0.34667	1.35;1.35	5.75	5.75	0.90469	.	0.545520	0.15443	N	0.262109	T	0.46386	0.1390	M	0.72894	2.215	0.80722	D	1	B	0.29988	0.264	B	0.34590	0.186	T	0.33445	-0.9868	10	0.30078	T	0.28	.	19.9525	0.97208	0.0:1.0:0.0:0.0	.	3572	Q9UPN3	MACF1_HUMAN	V	3572;2007	ENSP00000362006:L3572V;ENSP00000289893:L2007V	ENSP00000289893:L2007V	L	+	1	2	MACF1	39585353	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.313000	0.65798	2.719000	0.93026	0.655000	0.94253	CTG	MACF1	-	superfamily_RNaseH-like_dom,smart_Spectrin/alpha-actinin	ENSG00000127603		0.498	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	-	0.00	21	0	C	NM_033044		39812766	+1	tier1	-	no_errors	ENST00000567887	ensembl	human	putative	74_37	missense	35.71	18	10	SNP	1.000	G
MAGEB4	4115	genome.wustl.edu	37	X	30261075	30261075	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:30261075A>G	ENST00000378982.2	+	1	1019	c.823A>G	c.(823-825)Aga>Gga	p.R275G	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	275	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						GTGGGGTCCAAGAGCTCATGC	0.488																																																	0													70.0	69.0	69.0					X																	30261075		2202	4300	6502	SO:0001583	missense	0				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.823A>G	X.37:g.30261075A>G	ENSP00000368266:p.Arg275Gly		B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.R275G	ENST00000378982.2	37	c.823	CCDS14221.1	X	.	.	.	.	.	.	.	.	.	.	A	10.52	1.372272	0.24857	.	.	ENSG00000120289	ENST00000378982	T	0.22743	1.94	3.31	-1.72	0.08107	.	0.000000	0.64402	U	0.000001	T	0.31199	0.0789	H	0.94462	3.54	0.09310	N	1	B	0.28783	0.222	B	0.37943	0.261	T	0.47222	-0.9134	10	0.87932	D	0	.	0.3109	0.00287	0.3763:0.1931:0.13:0.3007	.	275	O15481	MAGB4_HUMAN	G	275	ENSP00000368266:R275G	ENSP00000368266:R275G	R	+	1	2	MAGEB4	30170996	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.112000	0.10791	-0.402000	0.07633	0.486000	0.48141	AGA	MAGEB4	-	pfam_MAGE,pfscan_MAGE	ENSG00000120289		0.488	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB4	HGNC	protein_coding	OTTHUMT00000056159.1	-	0.00	47	0	A	NM_002367		30261075	+1	tier1	-	no_errors	ENST00000378982	ensembl	human	known	74_37	missense	31.34	46	21	SNP	0.000	G
MAGEE1	57692	genome.wustl.edu	37	X	75649975	75649975	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:75649975T>C	ENST00000361470.2	+	1	1930	c.1652T>C	c.(1651-1653)cTt>cCt	p.L551P		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	551	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						TTGAGAGAACTTGACCCTGAG	0.478																																																	0													36.0	33.0	34.0					X																	75649975		2203	4300	6503	SO:0001583	missense	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.1652T>C	X.37:g.75649975T>C	ENSP00000354912:p.Leu551Pro		Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.L551P	ENST00000361470.2	37	c.1652	CCDS14433.1	X	.	.	.	.	.	.	.	.	.	.	T	6.098	0.386409	0.11524	.	.	ENSG00000198934	ENST00000361470	T	0.06849	3.25	2.34	2.34	0.29019	.	.	.	.	.	T	0.15132	0.0365	L	0.48642	1.525	0.19775	N	0.999955	P	0.36086	0.536	P	0.51324	0.666	T	0.20371	-1.0277	9	0.87932	D	0	.	5.8226	0.18536	0.0:0.0:0.0:1.0	.	551	Q9HCI5	MAGE1_HUMAN	P	551	ENSP00000354912:L551P	ENSP00000354912:L551P	L	+	2	0	MAGEE1	75566379	0.985000	0.35326	0.002000	0.10522	0.007000	0.05969	2.127000	0.42035	1.161000	0.42604	0.481000	0.45027	CTT	MAGEE1	-	pfam_MAGE,pfscan_MAGE	ENSG00000198934		0.478	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	-	0.00	17	0	T	NM_020932		75649975	+1	tier1	-	no_errors	ENST00000361470	ensembl	human	known	74_37	missense	58.54	17	24	SNP	0.002	C
MAP1A	4130	genome.wustl.edu	37	15	43817807	43817807	+	Missense_Mutation	SNP	T	T	A	rs148851436	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:43817807T>A	ENST00000300231.5	+	4	4586	c.4136T>A	c.(4135-4137)gTg>gAg	p.V1379E	MAP1A_ENST00000399453.1_Missense_Mutation_p.V1379E|MAP1A_ENST00000382031.1_Missense_Mutation_p.V1617E			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1379					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CACAAGGAGGTGGTAGAGCCG	0.458																																																	0													100.0	96.0	97.0					15																	43817807		1909	4130	6039	SO:0001583	missense	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.4136T>A	15.37:g.43817807T>A	ENSP00000300231:p.Val1379Glu		O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.V1379E	ENST00000300231.5	37	c.4136	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	T	8.616	0.890335	0.17613	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.20069	4.42;2.1;2.1	3.65	-4.95	0.03048	.	.	.	.	.	T	0.13457	0.0326	M	0.63428	1.95	0.09310	N	1	B	0.26195	0.144	B	0.24269	0.052	T	0.45906	-0.9229	9	0.02654	T	1	-0.0211	4.4366	0.11554	0.1412:0.5253:0.1432:0.1903	.	1379	P78559	MAP1A_HUMAN	E	1617;1379;1379	ENSP00000371462:V1617E;ENSP00000382380:V1379E;ENSP00000300231:V1379E	ENSP00000300231:V1379E	V	+	2	0	MAP1A	41605099	0.000000	0.05858	0.000000	0.03702	0.210000	0.24377	0.013000	0.13310	-1.089000	0.03073	0.460000	0.39030	GTG	MAP1A	-	NULL	ENSG00000166963		0.458	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5		0.00	25	0	T	NM_002373		43817807	+1			no_errors	ENST00000399453	ensembl	human	known	74_37	missense	7.55	47	4	SNP	0.000	A
MAN2C1	4123	genome.wustl.edu	37	15	75660485	75660485	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:75660485C>T	ENST00000267978.5	-	2	202	c.156G>A	c.(154-156)gaG>gaA	p.E52E	RP11-817O13.8_ENST00000563278.1_lincRNA|MAN2C1_ENST00000563539.1_5'UTR|MAN2C1_ENST00000569482.1_Silent_p.E52E|MAN2C1_ENST00000563622.1_Silent_p.E52E|MAN2C1_ENST00000565683.1_Silent_p.E52E	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	52					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						AGGGAAGTCTCTCCGGCGTCA	0.701																																																	0													10.0	13.0	12.0					15																	75660485		2167	4259	6426	SO:0001819	synonymous_variant	0			AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.156G>A	15.37:g.75660485C>T			H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Silent	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.E52	ENST00000267978.5	37	c.156	CCDS32298.1	15																																																																																			MAN2C1	-	NULL	ENSG00000140400		0.701	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2C1	HGNC	protein_coding	OTTHUMT00000419965.1	-	0.00	21	0	C			75660485	-1	tier1	-	no_errors	ENST00000267978	ensembl	human	known	74_37	silent	27.27	16	6	SNP	0.184	T
MAP4K2	5871	genome.wustl.edu	37	11	64564335	64564335	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:64564335C>A	ENST00000294066.2	-	21	1529	c.1438G>T	c.(1438-1440)Ggc>Tgc	p.G480C	MAP4K2_ENST00000377350.3_Missense_Mutation_p.G472C	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	480					activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						AGGGGGCAGCCATTGAAGACC	0.657																																																	0													41.0	44.0	43.0					11																	64564335		2201	4297	6498	SO:0001583	missense	0			BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.1438G>T	11.37:g.64564335C>A	ENSP00000294066:p.Gly480Cys		Q86VU3	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_dom	p.G480C	ENST00000294066.2	37	c.1438	CCDS8082.1	11	.	.	.	.	.	.	.	.	.	.	C	22.0	4.226511	0.79576	.	.	ENSG00000168067	ENST00000294066;ENST00000377350	T;T	0.76968	-1.03;-1.06	4.51	4.51	0.55191	.	0.000000	0.85682	D	0.000000	D	0.86297	0.5899	M	0.69823	2.125	0.54753	D	0.999983	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.87774	0.2607	10	0.87932	D	0	.	13.1403	0.59430	0.0:1.0:0.0:0.0	.	472;480	Q86VU3;Q12851	.;M4K2_HUMAN	C	480;472	ENSP00000294066:G480C;ENSP00000366567:G472C	ENSP00000294066:G480C	G	-	1	0	MAP4K2	64320911	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	6.614000	0.74197	2.247000	0.74100	0.558000	0.71614	GGC	MAP4K2	-	NULL	ENSG00000168067		0.657	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP4K2	HGNC	protein_coding	OTTHUMT00000105239.1	-	0.00	47	0	C	NM_004579		64564335	-1	tier1	-	no_errors	ENST00000294066	ensembl	human	known	74_37	missense	53.75	37	43	SNP	1.000	A
MCM7	4176	genome.wustl.edu	37	7	99697343	99697343	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:99697343A>G	ENST00000303887.5	-	3	790	c.145T>C	c.(145-147)Tat>Cat	p.Y49H	MCM7_ENST00000354230.3_5'UTR|AP4M1_ENST00000422582.1_5'Flank|MCM7_ENST00000343023.6_Missense_Mutation_p.Y49H|AP4M1_ENST00000429084.1_5'Flank|AP4M1_ENST00000421755.1_5'Flank|AP4M1_ENST00000359593.4_5'Flank	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	49					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGGTCCACATACAGAGCCACC	0.542																																																	0													96.0	88.0	91.0					7																	99697343		2203	4300	6503	SO:0001583	missense	0				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.145T>C	7.37:g.99697343A>G	ENSP00000307288:p.Tyr49His		A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold,superfamily_P-loop_NTPase,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM7,prints_MCM_4	p.Y49H	ENST00000303887.5	37	c.145	CCDS5683.1	7	.	.	.	.	.	.	.	.	.	.	A	7.065	0.567168	0.13560	.	.	ENSG00000166508	ENST00000343023;ENST00000303887	T;T	0.12255	2.7;2.7	4.5	3.32	0.38043	Nucleic acid-binding, OB-fold-like (1);	0.141249	0.49305	D	0.000144	T	0.10852	0.0265	L	0.42632	1.34	0.80722	D	1	B	0.09022	0.002	B	0.09377	0.004	T	0.13019	-1.0525	10	0.16896	T	0.51	3.6473	9.328	0.38005	0.8186:0.1814:0.0:0.0	.	49	P33993	MCM7_HUMAN	H	49	ENSP00000344006:Y49H;ENSP00000307288:Y49H	ENSP00000307288:Y49H	Y	-	1	0	MCM7	99535279	0.998000	0.40836	0.306000	0.25113	0.293000	0.27360	2.977000	0.49297	0.723000	0.32274	0.455000	0.32223	TAT	MCM7	-	superfamily_NA-bd_OB-fold	ENSG00000166508		0.542	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM7	HGNC	protein_coding	OTTHUMT00000336534.3	-	0.00	68	0	A			99697343	-1	tier1	-	no_errors	ENST00000303887	ensembl	human	known	74_37	missense	5.41	70	4	SNP	0.742	G
MDGA2	161357	genome.wustl.edu	37	14	47343308	47343308	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:47343308T>C	ENST00000399232.2	-	13	2690	c.2326A>G	c.(2326-2328)Aga>Gga	p.R776G	MDGA2_ENST00000357362.3_Missense_Mutation_p.R547G|MDGA2_ENST00000439988.3_Missense_Mutation_p.R845G|MDGA2_ENST00000399222.3_5'UTR|MDGA2_ENST00000426342.1_Missense_Mutation_p.R547G	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	776	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TTTGTATTTCTTGTTGCTGTA	0.368																																																	0													170.0	162.0	165.0					14																	47343308		1843	4098	5941	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2326A>G	14.37:g.47343308T>C	ENSP00000382178:p.Arg776Gly		F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.R845G	ENST00000399232.2	37	c.2533		14	.	.	.	.	.	.	.	.	.	.	T	19.40	3.819730	0.71028	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.02067	4.47;4.47;4.47;4.47	5.37	4.15	0.48705	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.50627	U	0.000107	T	0.05364	0.0142	N	0.25647	0.755	0.80722	D	1	B;D	0.56521	0.178;0.976	B;D	0.65140	0.084;0.932	T	0.46925	-0.9156	10	0.72032	D	0.01	.	11.0016	0.47609	0.0:0.0:0.156:0.844	rs35704871	547;776	F6W3S7;Q7Z553	.;MDGA2_HUMAN	G	776;547;845;547	ENSP00000400011:R776G;ENSP00000405456:R547G;ENSP00000382178:R845G;ENSP00000349925:R547G	ENSP00000349925:R547G	R	-	1	2	MDGA2	46413058	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.251000	0.51453	2.024000	0.59613	0.383000	0.25322	AGA	MDGA2	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom	ENSG00000272781		0.368	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	-	0.00	63	0	T	NM_182830		47343308	-1	tier1	-	no_errors	ENST00000439988	ensembl	human	known	74_37	missense	43.40	30	23	SNP	1.000	C
MEI1	150365	genome.wustl.edu	37	22	42159250	42159250	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr22:42159250delC	ENST00000401548.3	+	19	2233	c.2193delC	c.(2191-2193)cgcfs	p.R731fs	MEI1_ENST00000540833.1_Frame_Shift_Del_p.R471fs|MEI1_ENST00000540880.1_Frame_Shift_Del_p.R49fs|MEI1_ENST00000300398.4_5'UTR|MEI1_ENST00000400107.1_Frame_Shift_Del_p.R99fs	NM_152513.3	NP_689726.3			meiosis inhibitor 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						AGGGCGAGCGCCCCCCACTGG	0.537											OREG0026596	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													93.0	91.0	91.0					22																	42159250		1935	4150	6085	SO:0001589	frameshift_variant	0			AK092934	CCDS46718.1	22q13.2	2013-10-11			ENSG00000167077	ENSG00000167077			28613	protein-coding gene	gene with protein product	"""spermatogenesis associated 38"""	608797				16683055	Standard	XM_006724154		Approved	MGC40042, SPATA38	uc003baz.1	Q5TIA1	OTTHUMG00000030083	ENST00000401548.3:c.2193delC	22.37:g.42159250delC	ENSP00000384115:p.Arg731fs	906		Frame_Shift_Del	DEL	superfamily_ARM-type_fold	p.P733fs	ENST00000401548.3	37	c.2193	CCDS46718.1	22																																																																																			MEI1	-	superfamily_ARM-type_fold	ENSG00000167077		0.537	MEI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MEI1	HGNC	protein_coding	OTTHUMT00000074937.3		0.00	26	0	C	NM_152513		42159250	+1	tier1		no_errors	ENST00000401548	ensembl	human	known	74_37	frame_shift_del	6.25	30	2	DEL	0.047	-
MGAT3	4248	genome.wustl.edu	37	22	39883741	39883741	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr22:39883741C>T	ENST00000341184.6	+	2	604	c.389C>T	c.(388-390)cCg>cTg	p.P130L		NM_001098270.1|NM_002409.4	NP_001091740.1|NP_002400.3	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase	130					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0003830)			endometrium(4)|kidney(1)|large_intestine(5)|lung(12)|prostate(1)|skin(1)	24	Melanoma(58;0.04)					AGGCCGCCCCCGGGACGGCCG	0.731																																																	0													4.0	6.0	5.0					22																	39883741		2027	3970	5997	SO:0001583	missense	0			D13789	CCDS13994.2	22q13.1	2013-02-25			ENSG00000128268	ENSG00000128268	2.4.1.144	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7046	protein-coding gene	gene with protein product		604621				8370666	Standard	NM_002409		Approved	GNT-III	uc010gxy.3	Q09327	OTTHUMG00000030185	ENST00000341184.6:c.389C>T	22.37:g.39883741C>T	ENSP00000345270:p.Pro130Leu		A6NGD0|Q14CK5|Q6IC49|Q9UH32	Missense_Mutation	SNP	pfam_Glyco_trans_17	p.P130L	ENST00000341184.6	37	c.389	CCDS13994.2	22	.	.	.	.	.	.	.	.	.	.	C	2.549	-0.304486	0.05495	.	.	ENSG00000128268	ENST00000341184;ENST00000429402	.	.	.	5.03	4.02	0.46733	.	0.735064	0.12457	N	0.467228	T	0.26521	0.0648	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15896	-1.0421	9	0.24483	T	0.36	.	11.5413	0.50667	0.0:0.8498:0.0:0.1502	.	130	Q09327	MGAT3_HUMAN	L	130	.	ENSP00000345270:P130L	P	+	2	0	MGAT3	38213687	0.983000	0.35010	0.001000	0.08648	0.086000	0.17979	-1.024000	0.03603	1.126000	0.42016	0.467000	0.42956	CCG	MGAT3	-	NULL	ENSG00000128268		0.731	MGAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT3	HGNC	protein_coding	OTTHUMT00000075039.2	-	0.00	33	0	C	NM_002409		39883741	+1	tier1	-	no_errors	ENST00000341184	ensembl	human	known	74_37	missense	34.48	19	10	SNP	0.000	T
SH3RF3	344558	genome.wustl.edu	37	2	109757978	109757978	+	Intron	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:109757978C>T	ENST00000309415.6	+	1	573				MIR4265_ENST00000582152.1_RNA	NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3								zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						CCCACAGCTGCAGAGATCACC	0.567																																																	0																																										SO:0001627	intron_variant	0			AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.573+11409C>T	2.37:g.109757978C>T			A0SDZ7|A8MPR1|Q8NDU1	RNA	SNP	-	NULL	ENST00000309415.6	37	NULL		2																																																																																			MIR4265	-	-	ENSG00000264934		0.567	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	MIR4265	HGNC	protein_coding		-	0.00	31	0	C	NM_001099289		109757978	-1	tier1	-	no_errors	ENST00000582152	ensembl	human	known	74_37	rna	6.45	58	4	SNP	0.000	T
MKRN3	7681	genome.wustl.edu	37	15	23811324	23811324	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:23811324T>G	ENST00000314520.3	+	1	871	c.395T>G	c.(394-396)gTt>gGt	p.V132G	MKRN3_ENST00000568252.1_Intron|RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000564592.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	132					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GAGGGTGGCGTTTCGCCGCCT	0.627																																																	0													43.0	46.0	45.0					15																	23811324		2203	4300	6503	SO:0001583	missense	0			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.395T>G	15.37:g.23811324T>G	ENSP00000313881:p.Val132Gly			Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.V132G	ENST00000314520.3	37	c.395	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	T	7.278	0.608526	0.14002	.	.	ENSG00000179455	ENST00000314520	T	0.32023	1.47	3.47	-6.93	0.01638	.	0.883403	0.09686	N	0.769066	T	0.07908	0.0198	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19160	-1.0314	10	0.33141	T	0.24	.	0.5758	0.00703	0.297:0.3117:0.15:0.2413	.	132	Q13064	MKRN3_HUMAN	G	132	ENSP00000313881:V132G	ENSP00000313881:V132G	V	+	2	0	MKRN3	21362417	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.009000	0.12765	-1.871000	0.01138	-1.293000	0.01348	GTT	MKRN3	-	NULL	ENSG00000179455		0.627	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	HGNC	protein_coding	OTTHUMT00000251225.1	-	0.00	31	0	T	NM_005664		23811324	+1	tier1	-	no_errors	ENST00000314520	ensembl	human	known	74_37	missense	29.82	40	17	SNP	0.000	G
MROH2B	133558	genome.wustl.edu	37	5	41017990	41017990	+	Missense_Mutation	SNP	G	G	A	rs199545321		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:41017990G>A	ENST00000399564.4	-	28	3296	c.2846C>T	c.(2845-2847)gCg>gTg	p.A949V	MROH2B_ENST00000506092.2_Missense_Mutation_p.A504V	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	949																	GCTAGCAGCCGCCTGACGGAT	0.473																																																	0								G	VAL/ALA	0,3814		0,0,1907	37.0	37.0	37.0		2846	4.0	0.9	5		37	3,8247		0,3,4122	yes	missense	HEATR7B2	NM_173489.4	64	0,3,6029	AA,AG,GG		0.0364,0.0,0.0249	probably-damaging	949/1586	41017990	3,12061	1907	4125	6032	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.2846C>T	5.37:g.41017990G>A	ENSP00000382476:p.Ala949Val		Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A949V	ENST00000399564.4	37	c.2846	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	G	14.87	2.663889	0.47572	0.0	3.64E-4	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.65732	3.37;-0.17	5.86	4.04	0.47022	Armadillo-like helical (1);Armadillo-type fold (1);	0.247191	0.29087	N	0.013182	T	0.49541	0.1563	L	0.61218	1.895	0.24042	N	0.996079	P	0.50443	0.935	B	0.36766	0.232	T	0.45071	-0.9286	10	0.18276	T	0.48	.	8.1093	0.30905	0.0:0.2209:0.6247:0.1544	.	949	Q7Z745	HTRB2_HUMAN	V	504;654;949	ENSP00000441504:A504V;ENSP00000382476:A949V	ENSP00000296803:A654V	A	-	2	0	HEATR7B2	41053747	0.989000	0.36119	0.903000	0.35520	0.293000	0.27360	2.996000	0.49449	1.464000	0.47987	0.591000	0.81541	GCG	MROH2B	-	superfamily_ARM-type_fold	ENSG00000171495		0.473	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MROH2B	HGNC	protein_coding	OTTHUMT00000367558.2	-	0.00	60	0	G	NM_173489		41017990	-1	tier1	rs199545321	no_errors	ENST00000399564	ensembl	human	known	74_37	missense	17.91	55	12	SNP	0.614	A
MSANTD4	84437	genome.wustl.edu	37	11	105880425	105880425	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:105880425T>C	ENST00000301919.4	-	3	2290	c.875A>G	c.(874-876)gAc>gGc	p.D292G	MSANTD4_ENST00000529805.1_5'UTR	NM_032424.1	NP_115800.1	Q8NCY6	MSD4_HUMAN	Myb/SANT-like DNA-binding domain containing 4 with coiled-coils	292						nucleus (GO:0005634)											TGTTTCTATGTCCTGTGGTTG	0.393																																																	0													168.0	154.0	159.0					11																	105880425		2201	4299	6500	SO:0001583	missense	0			AB058729	CCDS31663.1	11q22	2012-03-13	2012-03-13	2012-03-13	ENSG00000170903	ENSG00000170903			29383	protein-coding gene	gene with protein product			"""KIAA1826"""	KIAA1826			Standard	XM_005271697		Approved		uc001piz.3	Q8NCY6	OTTHUMG00000166240	ENST00000301919.4:c.875A>G	11.37:g.105880425T>C	ENSP00000304713:p.Asp292Gly		Q96JK1|Q96JZ3|Q9H2N4	Missense_Mutation	SNP	NULL	p.D292G	ENST00000301919.4	37	c.875	CCDS31663.1	11	.	.	.	.	.	.	.	.	.	.	T	18.20	3.571480	0.65765	.	.	ENSG00000170903	ENST00000301919	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.65417	0.2689	L	0.29908	0.895	0.58432	D	0.99999	D	0.57571	0.98	D	0.68192	0.956	T	0.69371	-0.5163	9	0.72032	D	0.01	-20.9965	15.3857	0.74699	0.0:0.0:0.0:1.0	.	292	Q8NCY6	K1826_HUMAN	G	292	.	ENSP00000304713:D292G	D	-	2	0	KIAA1826	105385635	1.000000	0.71417	0.999000	0.59377	0.613000	0.37349	7.008000	0.76341	2.091000	0.63221	0.402000	0.26972	GAC	MSANTD4	-	NULL	ENSG00000170903		0.393	MSANTD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSANTD4	HGNC	protein_coding	OTTHUMT00000388619.1	-	0.00	34	0	T	NM_032424		105880425	-1	tier1	-	no_errors	ENST00000301919	ensembl	human	known	74_37	missense	67.27	18	37	SNP	1.000	C
MST1L	11223	genome.wustl.edu	37	1	17084127	17084127	+	RNA	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:17084127A>T	ENST00000455405.2	-	0	585							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										GCAAGGCCACATTTAGGACTG	0.587																																																	0																																												0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17084127A>T			B7WPB1|Q13209	RNA	SNP	-	NULL	ENST00000455405.2	37	NULL		1	.	.	.	.	.	.	.	.	.	.	.	0.347	-0.947299	0.02304	.	.	ENSG00000186715	ENST00000334998;ENST00000442552	.	.	.	.	.	.	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.317905	0.22365	N	0.061032	T	0.34832	0.0911	.	.	.	.	.	.	B;D	0.67145	0.423;0.996	B;D	0.70227	0.159;0.968	T	0.50767	-0.8789	6	0.02654	T	1	.	2.1378	0.03767	0.3266:0.3447:0.3287:0.0	.	598;624	Q2TV78-2;Q2TV78	.;MSTP9_HUMAN	K	598;624	.	ENSP00000439273:N598K	N	-	3	2	MST1P9	16956714	0.984000	0.35163	0.481000	0.27354	0.000000	0.00434	-0.108000	0.10857	-0.406000	0.07588	0.000000	0.15137	AAT	MST1L	-	-	ENSG00000186715		0.587	MST1L-002	KNOWN	basic	processed_transcript	MST1L	HGNC	pseudogene	OTTHUMT00000400328.1	-	0.00	243	0	A	NM_001271733		17084127	-1	tier1	-	no_errors	ENST00000455405	ensembl	human	known	74_37	rna	5.88	192	12	SNP	0.996	T
MT-CO1	4512	genome.wustl.edu	37	M	6898	6898	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrM:6898T>C	ENST00000361624.2	+	1	995	c.995T>C	c.(994-996)aTg>aCg	p.M332T	MT-TQ_ENST00000387372.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TD_ENST00000387419.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	332					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CGGAAGCAATATGAAATGATC	0.478																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.995T>C	M.37:g.6898T>C	ENSP00000354499:p.Met332Thr		Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.M332T	ENST00000361624.2	37	c.995		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom	ENSG00000198804		0.478	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		-	0.00	97	0	T	YP_003024028		6898	+1	tier1	-	no_errors	ENST00000361624	ensembl	human	known	74_37	missense	18.18	9	2	SNP	NULL	C
MT-ND5	4540	genome.wustl.edu	37	M	12358	12358	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrM:12358A>G	ENST00000361567.2	+	1	22	c.22A>G	c.(22-24)Acc>Gcc	p.T8A	MT-TE_ENST00000387459.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	0					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ACACTACTATAACCACCCTAA	0.403																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.22A>G	M.37:g.12358A>G	ENSP00000354813:p.Thr8Ala		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.T8A	ENST00000361567.2	37	c.22		MT																																																																																			MT-ND5	-	tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.403	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	71	0	A	YP_003024036		12358	+1	tier1	rs201027657	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	18.18	9	2	SNP	NULL	G
MT-ND5	4540	genome.wustl.edu	37	M	13044	13044	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrM:13044C>T	ENST00000361567.2	+	1	708	c.708C>T	c.(706-708)gcC>gcT	p.A236A	MT-TE_ENST00000387459.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	236			A -> T (in MELAS/LS; due to mitochondrial complex I deficiency). {ECO:0000269|PubMed:15767514, ECO:0000269|PubMed:17400793}.		cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CTCCCCTCAGCCATAGAAGGC	0.537																																																	0																																										SO:0001819	synonymous_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.708C>T	M.37:g.13044C>T			Q34773|Q8WCY3	Silent	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.A236	ENST00000361567.2	37	c.708		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.537	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	56	0	C	YP_003024036		13044	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	silent	14.29	12	2	SNP	NULL	T
MT-ND5	4540	genome.wustl.edu	37	M	13178	13178	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrM:13178G>T	ENST00000361567.2	+	1	842	c.842G>T	c.(841-843)gGc>gTc	p.G281V	MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	281					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ACTATGCTTAGGCGCTATCAC	0.448																																																	0																																										SO:0001583	missense	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.842G>T	M.37:g.13178G>T	ENSP00000354813:p.Gly281Val		Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.G281V	ENST00000361567.2	37	c.842		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5	ENSG00000198786		0.448	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		-	0.00	73	0	G	YP_003024036		13178	+1	tier1	-	no_errors	ENST00000361567	ensembl	human	known	74_37	missense	14.29	12	2	SNP	NULL	T
MT1DP	326343	genome.wustl.edu	37	16	56677643	56677643	+	RNA	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:56677643C>A	ENST00000463480.2	+	0	27							A1L3X4	MT1DP_HUMAN	metallothionein 1D, pseudogene								metal ion binding (GO:0046872)										CCGAATGGACCTCAGCTGCTC	0.567																																																	0																																												0			AF348999		16q13	2011-04-15	2011-04-15		ENSG00000205361	ENSG00000205361		"""Metallothioneins"""	7396	pseudogene	pseudogene						6089206, 6327055, 3785191	Standard	NR_027781		Approved	MTM	uc010vhf.2	A1L3X4	OTTHUMG00000158354		16.37:g.56677643C>A			Q86YX1	RNA	SNP	-	NULL	ENST00000463480.2	37	NULL		16																																																																																			MT1DP	-	-	ENSG00000205361		0.567	MT1DP-002	KNOWN	basic	processed_transcript	MT1DP	HGNC	pseudogene	OTTHUMT00000350774.2	-	0.00	40	0	C			56677643	+1	tier1	-	no_errors	ENST00000463480	ensembl	human	known	74_37	rna	6.67	70	5	SNP	0.850	A
MTERF3	51001	genome.wustl.edu	37	8	97270593	97270593	+	Missense_Mutation	SNP	A	A	C	rs200509858		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:97270593A>C	ENST00000287025.3	-	2	424	c.326T>G	c.(325-327)tTt>tGt	p.F109C	MTERFD1_ENST00000522822.1_5'Flank|MTERFD1_ENST00000523821.1_Missense_Mutation_p.F109C|MTERFD1_ENST00000524341.1_5'Flank	NM_015942.3	NP_057026.3	Q96E29	MTEF3_HUMAN		109					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)	transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	24	Breast(36;5.16e-05)					ACCTTCTAGAAACAGCTCAGA	0.408																																																	0													43.0	41.0	42.0					8																	97270593		2203	4300	6503	SO:0001583	missense	0																														ENST00000287025.3:c.326T>G	8.37:g.97270593A>C	ENSP00000287025:p.Phe109Cys		B3KMG6|G3V130|Q9Y301	Missense_Mutation	SNP	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel	p.F109C	ENST00000287025.3	37	c.326	CCDS6270.1	8	.	.	.	.	.	.	.	.	.	.	A	10.09	1.253939	0.22965	.	.	ENSG00000156469	ENST00000523821;ENST00000287025	T	0.32272	1.46	5.81	4.0	0.46444	.	0.683043	0.14868	N	0.293696	T	0.19805	0.0476	N	0.24115	0.695	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.17410	-1.0370	10	0.38643	T	0.18	-6.2336	7.6322	0.28247	0.0895:0.165:0.7455:0.0	.	109;109	E5RIK9;Q96E29	.;MTER1_HUMAN	C	109	ENSP00000287025:F109C	ENSP00000287025:F109C	F	-	2	0	MTERFD1	97339769	0.001000	0.12720	0.013000	0.15412	0.880000	0.50808	1.059000	0.30517	0.768000	0.33290	-0.242000	0.12053	TTT	MTERFD1	-	NULL	ENSG00000156469		0.408	MTERFD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MTERFD1	HGNC	protein_coding	OTTHUMT00000379876.1	-	0.00	33	0	A			97270593	-1	tier1	-	no_errors	ENST00000287025	ensembl	human	known	74_37	missense	35.71	36	20	SNP	0.003	C
MTUS2	23281	genome.wustl.edu	37	13	29601027	29601027	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr13:29601027A>C	ENST00000431530.3	+	1	2280	c.2222A>C	c.(2221-2223)aAg>aCg	p.K741T		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	731	Mediates interaction with MAPRE1.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)	p.K741T(1)		NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						ATGAGTGAAAAGTTTTTGCAG	0.403																																																	1	Substitution - Missense(1)	stomach(1)											53.0	54.0	54.0					13																	29601027		1859	4090	5949	SO:0001583	missense	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2222A>C	13.37:g.29601027A>C	ENSP00000392057:p.Lys741Thr		A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Missense_Mutation	SNP	NULL	p.K741T	ENST00000431530.3	37	c.2222	CCDS45022.1	13	.	.	.	.	.	.	.	.	.	.	a	18.91	3.723039	0.68959	.	.	ENSG00000132938	ENST00000431530	T	0.19806	2.12	6.17	4.97	0.65823	.	0.094048	0.45867	N	0.000324	T	0.36276	0.0961	M	0.62723	1.935	0.80722	D	1	D	0.65815	0.995	P	0.56474	0.799	T	0.06373	-1.0830	9	.	.	.	.	12.809	0.57629	0.8634:0.1366:0.0:0.0	.	731	Q5JR59	MTUS2_HUMAN	T	741	ENSP00000392057:K741T	.	K	+	2	0	MTUS2	28499027	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.302000	0.72788	1.119000	0.41883	0.533000	0.62120	AAG	MTUS2	-	NULL	ENSG00000132938		0.403	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3		0.00	19	0	A	XM_166270		29601027	+1			no_errors	ENST00000431530	ensembl	human	known	74_37	missense	38.46	8	5	SNP	1.000	C
MUC16	94025	genome.wustl.edu	37	19	9083725	9083725	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:9083725A>G	ENST00000397910.4	-	1	8293	c.8090T>C	c.(8089-8091)cTg>cCg	p.L2697P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2697	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTTAAGAACCAGTGCATCACC	0.488																																																	0													112.0	105.0	107.0					19																	9083725		1944	4137	6081	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.8090T>C	19.37:g.9083725A>G	ENSP00000381008:p.Leu2697Pro		Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_SEA_dom	p.L2697P	ENST00000397910.4	37	c.8090	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	a	6.939	0.542931	0.13250	.	.	ENSG00000181143	ENST00000397910	T	0.03272	3.99	0.235	0.235	0.15431	.	.	.	.	.	T	0.05273	0.0140	N	0.08118	0	.	.	.	D	0.62365	0.991	D	0.68039	0.955	T	0.41466	-0.9507	7	0.87932	D	0	.	.	.	.	.	2697	B5ME49	.	P	2697	ENSP00000381008:L2697P	ENSP00000381008:L2697P	L	-	2	0	MUC16	8944725	0.382000	0.25148	0.690000	0.30148	0.694000	0.40290	0.349000	0.20055	0.263000	0.21812	0.260000	0.18958	CTG	MUC16	-	NULL	ENSG00000181143		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	-	0.00	40	0	A	NM_024690		9083725	-1	tier1	-	no_errors	ENST00000397910	ensembl	human	known	74_37	missense	33.33	24	12	SNP	0.776	G
MYH11	4629	genome.wustl.edu	37	16	15839072	15839072	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:15839072G>A	ENST00000300036.5	-	20	2543	c.2434C>T	c.(2434-2436)Cag>Tag	p.Q812*	MYH11_ENST00000576790.2_Nonsense_Mutation_p.Q812*|MYH11_ENST00000396324.3_Nonsense_Mutation_p.Q819*|MYH11_ENST00000452625.2_Nonsense_Mutation_p.Q819*	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	812	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						GCGGTCAGCTGCTGCTGCCTC	0.607			T	CBFB	AML																																			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													61.0	57.0	58.0					16																	15839072		2197	4300	6497	SO:0001587	stop_gained	0			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.2434C>T	16.37:g.15839072G>A	ENSP00000300036:p.Gln812*		D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Nonsense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.Q819*	ENST00000300036.5	37	c.2455	CCDS10565.1	16	.	.	.	.	.	.	.	.	.	.	G	41	8.543727	0.98857	.	.	ENSG00000133392	ENST00000300036;ENST00000338282;ENST00000396320;ENST00000396324;ENST00000452625	.	.	.	4.33	4.33	0.51752	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	16.2042	0.82108	0.0:0.0:1.0:0.0	.	.	.	.	X	812;812;819;819;819	.	ENSP00000300036:Q812X	Q	-	1	0	MYH11	15746573	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.803000	0.99136	2.112000	0.64535	0.549000	0.68633	CAG	MYH11	-	superfamily_P-loop_NTPase,pfscan_IQ_motif_EF-hand-BS	ENSG00000133392		0.607	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2		0.00	66	0	G	NM_001040113		15839072	-1			no_errors	ENST00000396324	ensembl	human	known	74_37	nonsense	5.41	70	4	SNP	1.000	A
MYO1B	4430	genome.wustl.edu	37	2	192279381	192279381	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:192279381G>A	ENST00000392318.3	+	29	3392	c.3145G>A	c.(3145-3147)Gtc>Atc	p.V1049I	MYO1B_ENST00000339514.4_Missense_Mutation_p.V991I|MYO1B_ENST00000304164.4_Missense_Mutation_p.V1049I|MYO1B_ENST00000439065.2_Missense_Mutation_p.V294I|MYO1B_ENST00000392316.1_Missense_Mutation_p.V1020I	NM_001130158.1	NP_001123630.1	O43795	MYO1B_HUMAN	myosin IB	1049	Myosin tail. {ECO:0000255}.				actin filament bundle assembly (GO:0051017)|actin filament organization (GO:0007015)|actin filament-based movement (GO:0030048)|metabolic process (GO:0008152)|post-Golgi vesicle-mediated transport (GO:0006892)	actin filament (GO:0005884)|brush border (GO:0005903)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.V991I(1)		NS(1)|central_nervous_system(6)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(19)|ovary(1)	55			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)			CTTCTTCGCCGTCCACCTCAA	0.408																																																	1	Substitution - Missense(1)	central_nervous_system(1)											62.0	56.0	58.0					2																	192279381		2203	4300	6503	SO:0001583	missense	0			L29138	CCDS2311.1, CCDS46477.1	2q12-q34	2011-09-27			ENSG00000128641	ENSG00000128641		"""Myosins / Myosin superfamily : Class I"""	7596	protein-coding gene	gene with protein product		606537				8022818, 8449985	Standard	NM_012223		Approved	myr1	uc010fsg.2	O43795	OTTHUMG00000132718	ENST00000392318.3:c.3145G>A	2.37:g.192279381G>A	ENSP00000376132:p.Val1049Ile		O43794|Q7Z6L5	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.V1049I	ENST00000392318.3	37	c.3145	CCDS46477.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.765|4.765	0.142193|0.142193	0.09083|0.09083	.|.	.|.	ENSG00000128641|ENSG00000128641	ENST00000427152|ENST00000339514;ENST00000392318;ENST00000304164;ENST00000392316;ENST00000439065	.|T;T;T;T;T	.|0.28255	.|1.62;1.62;1.62;1.62;1.62	5.25|5.25	-1.35|-1.35	0.09114|0.09114	.|Myosin tail 2 (1);	.|0.475325	.|0.21831	.|N	.|0.068475	T|T	0.09774|0.09774	0.0240|0.0240	N|N	0.02751|0.02751	-0.505|-0.505	0.09310|0.09310	N|N	0.999994|0.999994	.|B;B;B	.|0.30179	.|0.271;0.0;0.0	.|B;B;B	.|0.24394	.|0.053;0.004;0.002	T|T	0.33979|0.33979	-0.9847|-0.9847	5|10	.|0.19147	.|T	.|0.46	.|.	9.462|9.462	0.38789|0.38789	0.4778:0.0:0.5222:0.0|0.4778:0.0:0.5222:0.0	.|.	.|294;1049;991	.|E7EPB4;O43795;O43795-2	.|.;MYO1B_HUMAN;.	H|I	127|991;1049;1049;1020;294	.|ENSP00000341903:V991I;ENSP00000376132:V1049I;ENSP00000306382:V1049I;ENSP00000376130:V1020I;ENSP00000391442:V294I	.|ENSP00000306382:V1049I	R|V	+|+	2|1	0|0	MYO1B|MYO1B	191987626|191987626	0.672000|0.672000	0.27530|0.27530	0.010000|0.010000	0.14722|0.14722	0.651000|0.651000	0.38670|0.38670	0.951000|0.951000	0.29135|0.29135	-0.360000|-0.360000	0.08138|0.08138	-0.229000|-0.229000	0.12294|0.12294	CGT|GTC	MYO1B	-	pfam_Myosin_tail_2	ENSG00000128641		0.408	MYO1B-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1B	HGNC	protein_coding	OTTHUMT00000334774.1		0.00	39	0	G	NM_012223		192279381	+1			no_errors	ENST00000304164	ensembl	human	known	74_37	missense	6.67	28	2	SNP	0.047	A
NBPF14	25832	genome.wustl.edu	37	1	148024806	148024806	+	Missense_Mutation	SNP	G	G	A	rs587659915	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:148024806G>A	ENST00000369219.1	-	2	207	c.191C>T	c.(190-192)cCg>cTg	p.P64L				Q5TI25	NBPFE_HUMAN	neuroblastoma breakpoint family, member 14	64						cytoplasm (GO:0005737)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(1)|lung(23)|ovary(2)|pancreas(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	42	all_hematologic(923;0.032)					CGGCTCATCCGGAGTGAGGAG	0.592													-|||	4	0.000798722	0.0	0.0014	5008	,	,		25471	0.001		0.0	False		,,,				2504	0.002																0													10.0	17.0	15.0					1																	148024806		526	1885	2411	SO:0001583	missense	0			AK092351		1q21.1	2013-01-17			ENSG00000122497			"""neuroblastoma breakpoint family"""	25232	protein-coding gene	gene with protein product		614003				8619474, 9110174, 16079250	Standard	NM_015383		Approved	DJ328E19.C1.1	uc021owp.2	Q5TI25	OTTHUMG00000013900	ENST00000369219.1:c.191C>T	1.37:g.148024806G>A	ENSP00000358221:p.Pro64Leu		Q5TI23|Q8IX76|Q9UJI9	Missense_Mutation	SNP	pfam_NBPF_dom	p.P64L	ENST00000369219.1	37	c.191		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	0.263|0.263	-0.998262|-0.998262	0.02145|0.02145	.|.	.|.	ENSG00000122497|ENSG00000122497	ENST00000369219|ENST00000310701;ENST00000444640;ENST00000431121;ENST00000436356;ENST00000448574;ENST00000458135;ENST00000392972;ENST00000426874	T|.	0.03801|.	3.8|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.17662|0.17662	0.0424|0.0424	L|L	0.54323|0.54323	1.7|1.7	0.09310|0.09310	N|N	1|1	B;P|.	0.41008|.	0.003;0.735|.	B;B|.	0.28385|.	0.001;0.089|.	T|T	0.33266|0.33266	-0.9875|-0.9875	8|4	0.56958|.	D|.	0.05|.	.|.	4.7408|4.7408	0.13012|0.13012	1.0E-4:0.0:0.6494:0.3505|1.0E-4:0.0:0.6494:0.3505	.|.	64;329|.	Q5TI25;Q5VTG7|.	NBPFE_HUMAN;.|.	L|W	64|70;75;75;75;75;75;75;75	ENSP00000358221:P64L|.	ENSP00000358221:P64L|.	P|R	-|-	2|1	0|2	NBPF14|NBPF14	146491430|146491430	0.002000|0.002000	0.14202|0.14202	0.010000|0.010000	0.14722|0.14722	0.331000|0.331000	0.28603|0.28603	-0.386000|-0.386000	0.07370|0.07370	-0.921000|-0.921000	0.03794|0.03794	0.064000|0.064000	0.15345|0.15345	CCG|CGG	NBPF14	-	NULL	ENSG00000122497		0.592	NBPF14-201	KNOWN	basic|appris_principal	protein_coding	NBPF14	HGNC	protein_coding		-	0.00	56	0	G	NM_015383		148024806	-1	tier1	-	no_errors	ENST00000369219	ensembl	human	known	74_37	missense	38.46	40	25	SNP	0.011	A
NCAPD3	23310	genome.wustl.edu	37	11	134062627	134062627	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:134062627A>G	ENST00000534548.2	-	16	2066	c.2002T>C	c.(2002-2004)Tgg>Cgg	p.W668R		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	668					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		AGAAGCGCCCAGGCGAGGACC	0.542																																																	0													109.0	102.0	104.0					11																	134062627		2201	4297	6498	SO:0001583	missense	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.2002T>C	11.37:g.134062627A>G	ENSP00000433681:p.Trp668Arg		A6NFS2|Q4KMQ9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pirsf_NCAPD3	p.W668R	ENST00000534548.2	37	c.2002	CCDS31723.1	11	.	.	.	.	.	.	.	.	.	.	A	16.39	3.111278	0.56398	.	.	ENSG00000151503	ENST00000534548	T	0.63255	-0.03	5.88	5.88	0.94601	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.79862	0.4519	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81355	-0.0970	10	0.54805	T	0.06	-14.3761	16.2762	0.82644	1.0:0.0:0.0:0.0	.	668	P42695	CNDD3_HUMAN	R	668	ENSP00000433681:W668R	ENSP00000431612:W668R	W	-	1	0	NCAPD3	133567837	1.000000	0.71417	0.908000	0.35775	0.043000	0.13939	8.912000	0.92726	2.243000	0.73865	0.482000	0.46254	TGG	NCAPD3	-	superfamily_ARM-type_fold,pirsf_NCAPD3	ENSG00000151503		0.542	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2	-	0.00	56	0	A	NM_015261		134062627	-1	tier1	-	no_errors	ENST00000534548	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.998	G
NCOA1	8648	genome.wustl.edu	37	2	24952369	24952369	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:24952369G>A	ENST00000406961.1	+	17	3538		c.e17-1		NCOA1_ENST00000407230.1_Splice_Site|NCOA1_ENST00000348332.3_Splice_Site|NCOA1_ENST00000405141.1_Splice_Site|NCOA1_ENST00000288599.5_Splice_Site|NCOA1_ENST00000395856.3_Splice_Site|NCOA1_ENST00000538539.1_Splice_Site			Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1						androgen receptor signaling pathway (GO:0030521)|cellular lipid metabolic process (GO:0044255)|cellular response to hormone stimulus (GO:0032870)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|estrous cycle phase (GO:0060206)|hippocampus development (GO:0021766)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|labyrinthine layer morphogenesis (GO:0060713)|lactation (GO:0007595)|male gonad development (GO:0008584)|male mating behavior (GO:0060179)|ovulation cycle (GO:0042698)|positive regulation of apoptotic process (GO:0043065)|positive regulation of female receptivity (GO:0045925)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter by galactose (GO:0000435)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular response to drug (GO:2001038)|response to estradiol (GO:0032355)|response to progesterone (GO:0032570)|response to retinoic acid (GO:0032526)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription coactivator activity (GO:0001105)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)		PAX3/NCOA1(8)	breast(3)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(26)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	53	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTTTCTAACAGGGGGGTGGAT	0.373			T	PAX3	alveolar rhadomyosarcoma																																			Dom	yes		2	2p23	8648	nuclear receptor coactivator 1		M	0													72.0	72.0	72.0					2																	24952369		2203	4300	6503	SO:0001630	splice_region_variant	0			U40396	CCDS1712.1, CCDS1713.1, CCDS42660.1	2p23	2011-07-01			ENSG00000084676	ENSG00000084676		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7668	protein-coding gene	gene with protein product		602691				7481822, 9575154	Standard	XM_005264625		Approved	SRC1, F-SRC-1, NCoA-1, KAT13A, RIP160, bHLHe74	uc002rfk.3	Q15788	OTTHUMG00000125523	ENST00000406961.1:c.2887-1G>A	2.37:g.24952369G>A			O00150|O43792|O43793|Q13071|Q13420|Q2T9G5|Q53SX3|Q6GVI5|Q7KYV3	Splice_Site	SNP	-	e13-1	ENST00000406961.1	37	c.2887-1	CCDS1712.1	2	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769325	0.69992	.	.	ENSG00000084676	ENST00000406961;ENST00000405141;ENST00000407230;ENST00000538539;ENST00000348332;ENST00000288599;ENST00000395856	.	.	.	4.98	4.1	0.47936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4512	0.61172	0.0764:0.0:0.9236:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NCOA1	24805873	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.393000	0.79851	1.485000	0.48380	0.585000	0.79938	.	NCOA1	-	-	ENSG00000084676		0.373	NCOA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA1	HGNC	protein_coding	OTTHUMT00000246852.3	-	0.00	37	0	G	NM_147223	Intron	24952369	+1	tier1	-	no_errors	ENST00000348332	ensembl	human	known	74_37	splice_site	7.55	49	4	SNP	1.000	A
NCK2	8440	genome.wustl.edu	37	2	106471692	106471692	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:106471692G>T	ENST00000233154.4	+	3	615	c.173G>T	c.(172-174)cGg>cTg	p.R58L	AC009505.2_ENST00000598281.1_RNA|AC009505.2_ENST00000427050.2_RNA|NCK2_ENST00000522586.1_Missense_Mutation_p.R58L|NCK2_ENST00000393349.2_Missense_Mutation_p.R58L|NCK2_ENST00000451463.2_Missense_Mutation_p.R58L|AC009505.2_ENST00000596418.1_RNA	NM_003581.4	NP_003572.2	O43639	NCK2_HUMAN	NCK adaptor protein 2	58	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|lamellipodium assembly (GO:0030032)|negative regulation of cell proliferation (GO:0008285)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of translation (GO:0006417)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|lung(3)|ovary(1)	5						TACGTGGAGCGGAAGAACAGC	0.572																																																	0													85.0	68.0	74.0					2																	106471692		2203	4300	6503	SO:0001583	missense	0			AF043119	CCDS33266.1	2q12	2013-02-14			ENSG00000071051	ENSG00000071051		"""SH2 domain containing"""	7665	protein-coding gene	gene with protein product		604930				9737977, 16752908	Standard	NM_001004720		Approved	NCKbeta	uc002tdi.3	O43639	OTTHUMG00000153116	ENST00000233154.4:c.173G>T	2.37:g.106471692G>T	ENSP00000233154:p.Arg58Leu		D3DVK1|Q9BWN9|Q9UIC3	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_SH2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pirsf_Cytoplasmic_NCK,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.R58L	ENST00000233154.4	37	c.173	CCDS33266.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.766805	0.96914	.	.	ENSG00000071051	ENST00000233154;ENST00000451463;ENST00000393348;ENST00000522586;ENST00000425756;ENST00000393349	T;T;T;T;T;T	0.44083	0.93;1.72;0.93;1.72;0.93;0.93	5.84	5.84	0.93424	Src homology-3 domain (2);	0.000000	0.85682	D	0.000000	T	0.56124	0.1964	L	0.33137	0.985	0.80722	D	1	D;D	0.69078	0.982;0.997	P;D	0.69307	0.852;0.963	T	0.54820	-0.8236	10	0.56958	D	0.05	.	20.1381	0.98040	0.0:0.0:1.0:0.0	.	58;58	E7ERP6;O43639	.;NCK2_HUMAN	L	58	ENSP00000233154:R58L;ENSP00000410428:R58L;ENSP00000377017:R58L;ENSP00000431109:R58L;ENSP00000408040:R58L;ENSP00000377018:R58L	ENSP00000233154:R58L	R	+	2	0	NCK2	105838124	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.433000	0.97501	2.763000	0.94921	0.650000	0.86243	CGG	NCK2	-	smart_SH3_domain,pirsf_Cytoplasmic_NCK,pfscan_SH3_domain	ENSG00000071051		0.572	NCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCK2	HGNC	protein_coding	OTTHUMT00000329634.1		0.00	81	0	G	NM_003581		106471692	+1			no_errors	ENST00000233154	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
NCOA5	57727	genome.wustl.edu	37	20	44692181	44692181	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr20:44692181T>C	ENST00000290231.6	-	7	1132	c.968A>G	c.(967-969)cAg>cGg	p.Q323R		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	323					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				CTCTCTTTCCTGCAGGATGGC	0.577																																																	0													63.0	57.0	59.0					20																	44692181		2203	4300	6503	SO:0001583	missense	0				CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.968A>G	20.37:g.44692181T>C	ENSP00000290231:p.Gln323Arg		B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Missense_Mutation	SNP	superfamily_Anticodon-bd	p.Q323R	ENST00000290231.6	37	c.968	CCDS13392.1	20	.	.	.	.	.	.	.	.	.	.	T	1.950	-0.441462	0.04604	.	.	ENSG00000124160	ENST00000290231	T	0.40756	1.02	5.41	5.41	0.78517	.	0.049993	0.85682	D	0.000000	T	0.20901	0.0503	N	0.05280	-0.08	0.33422	D	0.579945	B	0.19817	0.039	B	0.21546	0.035	T	0.17319	-1.0373	10	0.06625	T	0.88	-13.1846	13.3214	0.60434	0.0:0.0:0.0:1.0	.	323	Q9HCD5	NCOA5_HUMAN	R	323	ENSP00000290231:Q323R	ENSP00000290231:Q323R	Q	-	2	0	NCOA5	44125588	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	3.651000	0.54431	2.272000	0.75746	0.459000	0.35465	CAG	NCOA5	-	NULL	ENSG00000124160		0.577	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA5	HGNC	protein_coding	OTTHUMT00000079559.1		0.00	43	0	T	NM_020967		44692181	-1			no_errors	ENST00000290231	ensembl	human	known	74_37	missense	6.90	54	4	SNP	1.000	C
NCR1	9437	genome.wustl.edu	37	19	55420679	55420679	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:55420679G>T	ENST00000291890.4	+	4	469	c.431G>T	c.(430-432)tGc>tTc	p.C144F	NCR1_ENST00000594765.1_Missense_Mutation_p.C144F|NCR1_ENST00000350790.5_Missense_Mutation_p.C49F|NCR1_ENST00000447255.1_Missense_Mutation_p.C144F|NCR1_ENST00000598576.1_Missense_Mutation_p.C132F|NCR1_ENST00000357397.5_Missense_Mutation_p.C37F|NCR1_ENST00000338835.5_Missense_Mutation_p.C144F	NM_004829.5	NP_004820.2	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	144	Ig-like 2.				cellular defense response (GO:0006968)|intracellular signal transduction (GO:0035556)|natural killer cell activation (GO:0030101)|regulation of natural killer cell mediated cytotoxicity (GO:0042269)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|SWI/SNF complex (GO:0016514)	receptor signaling protein activity (GO:0005057)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)	18				GBM - Glioblastoma multiforme(193;0.0449)		ACCTTCTACTGCCGTCTAGAC	0.562																																																	0													111.0	87.0	95.0					19																	55420679		2203	4300	6503	SO:0001583	missense	0			AJ001383	CCDS12911.1, CCDS46181.1, CCDS46182.1, CCDS56103.1	19q13.42	2013-09-20	2002-11-13	2002-11-15	ENSG00000189430	ENSG00000189430		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6731	protein-coding gene	gene with protein product		604530	"""lymphocyte antigen 94 (mouse) homolog (activating NK-receptor; NK-p46)"""	LY94		9730896	Standard	NM_001145457		Approved	NK-p46, NKP46, CD335	uc002qib.2	O76036	OTTHUMG00000183212	ENST00000291890.4:c.431G>T	19.37:g.55420679G>T	ENSP00000291890:p.Cys144Phe		B0V3L2|B0V3L3|B0V3L4|B0V3L5|B8JL03|O76016|O76017|O76018	Missense_Mutation	SNP	smart_Ig_sub	p.C144F	ENST00000291890.4	37	c.431	CCDS12911.1	19	.	.	.	.	.	.	.	.	.	.	G	14.89	2.669549	0.47677	.	.	ENSG00000189430	ENST00000291890;ENST00000447255;ENST00000338835;ENST00000350790;ENST00000357397	T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41	3.53	3.53	0.40419	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000011	T	0.64918	0.2642	H	0.95917	3.74	0.20307	N	0.999919	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	T	0.61466	-0.7057	10	0.87932	D	0	.	10.8815	0.46942	0.0:0.0:1.0:0.0	.	37;49;144;49;144;144	O76036-5;B0V3L4;B0V3L5;B0V3L2;O76036-6;O76036	.;.;.;.;.;NCTR1_HUMAN	F	144;144;144;49;37	ENSP00000291890:C144F;ENSP00000404434:C144F;ENSP00000339515:C144F;ENSP00000344358:C49F;ENSP00000349972:C37F	ENSP00000291890:C144F	C	+	2	0	NCR1	60112491	0.486000	0.25980	0.145000	0.22337	0.056000	0.15407	3.290000	0.51755	2.284000	0.76573	0.591000	0.81541	TGC	NCR1	-	smart_Ig_sub	ENSG00000189430		0.562	NCR1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCR1	HGNC	protein_coding	OTTHUMT00000465680.1	-	0.00	39	0	G			55420679	+1	tier1	-	no_errors	ENST00000291890	ensembl	human	known	74_37	missense	7.27	51	4	SNP	0.150	T
NECAB1	64168	genome.wustl.edu	37	8	91804183	91804183	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:91804183C>G	ENST00000417640.2	+	1	406	c.69C>G	c.(67-69)caC>caG	p.H23Q	TMEM64_ENST00000519519.1_5'Flank|NECAB1_ENST00000521954.1_3'UTR	NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1	23						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			CTGCTCTGCACCTGTCCAAGG	0.602																																																	0													40.0	49.0	46.0					8																	91804183		1975	3974	5949	SO:0001583	missense	0			AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009	ENST00000417640.2:c.69C>G	8.37:g.91804183C>G	ENSP00000387380:p.His23Gln		Q6NUS7|Q96AZ7|Q9HBW8	Missense_Mutation	SNP	pfam_Antibiotic_mOase,superfamily_Dimeric_a/b-barrel,smart_EF_hand_dom,pfscan_EF_hand_dom	p.H23Q	ENST00000417640.2	37	c.69	CCDS47889.1	8	.	.	.	.	.	.	.	.	.	.	C	4.887	0.164767	0.09287	.	.	ENSG00000123119	ENST00000417640	T	0.15718	2.4	4.52	1.59	0.23543	.	0.524289	0.20148	N	0.098231	T	0.05044	0.0135	N	0.02539	-0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32428	-0.9907	10	0.13470	T	0.59	-7.7382	5.2598	0.15567	0.198:0.172:0.63:0.0	.	23	Q8N987	NECA1_HUMAN	Q	23	ENSP00000387380:H23Q	ENSP00000387380:H23Q	H	+	3	2	NECAB1	91873359	0.997000	0.39634	0.994000	0.49952	0.974000	0.67602	0.969000	0.29370	0.490000	0.27771	-0.226000	0.12346	CAC	NECAB1	-	NULL	ENSG00000123119		0.602	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAB1	HGNC	protein_coding	OTTHUMT00000376728.1	-	0.00	44	0	C	NM_022351		91804183	+1	tier1	-	no_errors	ENST00000417640	ensembl	human	known	74_37	missense	38.24	42	26	SNP	0.996	G
NEUROD1	4760	genome.wustl.edu	37	2	182543449	182543449	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:182543449T>C	ENST00000295108.3	-	2	596	c.139A>G	c.(139-141)Aac>Gac	p.N47D	CERKL_ENST00000479558.1_Intron|NEUROD1_ENST00000496876.1_Intron	NM_002500.4	NP_002491.2	Q13562	NDF1_HUMAN	neuronal differentiation 1	47					amacrine cell differentiation (GO:0035881)|anterior/posterior pattern specification (GO:0009952)|cellular response to glucose stimulus (GO:0071333)|cerebellum development (GO:0021549)|dentate gyrus development (GO:0021542)|embryonic organ morphogenesis (GO:0048562)|endocrine pancreas development (GO:0031018)|enteroendocrine cell differentiation (GO:0035883)|glucose homeostasis (GO:0042593)|inner ear development (GO:0048839)|insulin secretion (GO:0030073)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurogenesis (GO:0022008)|nitric oxide mediated signal transduction (GO:0007263)|nucleocytoplasmic transport (GO:0006913)|pancreatic A cell fate commitment (GO:0003326)|pancreatic PP cell fate commitment (GO:0003329)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell differentiation (GO:0045597)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle arrest (GO:0071156)|regulation of insulin secretion (GO:0050796)|regulation of intestinal epithelial structure maintenance (GO:0060730)|response to drug (GO:0042493)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|protein heterodimerization activity (GO:0046982)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			OV - Ovarian serous cystadenocarcinoma(117;0.088)			TCCTCTGCGTTCATGGTTTCG	0.567																																																	0													128.0	99.0	109.0					2																	182543449		2203	4300	6503	SO:0001583	missense	0			U50823	CCDS2283.1	2q32	2013-05-21	2012-02-22		ENSG00000162992	ENSG00000162992		"""Basic helix-loop-helix proteins"""	7762	protein-coding gene	gene with protein product	"""beta-cell E-box transactivator 2"", ""neurogenic helix-loop-helix protein NEUROD"""	601724	"""neurogenic differentiation 1"""	NEUROD		7754368, 8786144	Standard	NM_002500		Approved	BETA2, BHF-1, NeuroD, bHLHa3, MODY6	uc002uof.4	Q13562	OTTHUMG00000132583	ENST00000295108.3:c.139A>G	2.37:g.182543449T>C	ENSP00000295108:p.Asn47Asp		B2R9I8|F1T0E1|O00343|Q13340|Q5U095|Q96TH0|Q99455|Q9UEC8	Missense_Mutation	SNP	pfam_Neurogenic_DUF,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pirsf_TF_bHLH_NeuroD,pfscan_bHLH_dom	p.N47D	ENST00000295108.3	37	c.139	CCDS2283.1	2	.	.	.	.	.	.	.	.	.	.	T	10.17	1.275961	0.23307	.	.	ENSG00000162992	ENST00000295108	D	0.94828	-3.53	5.9	2.13	0.27403	.	0.831640	0.10814	N	0.631310	D	0.87334	0.6151	N	0.22421	0.69	0.34916	D	0.747998	B	0.15141	0.012	B	0.06405	0.002	T	0.79313	-0.1855	10	0.17369	T	0.5	.	6.605	0.22720	0.0:0.0778:0.2985:0.6237	.	47	Q13562	NDF1_HUMAN	D	47	ENSP00000295108:N47D	ENSP00000295108:N47D	N	-	1	0	NEUROD1	182251694	1.000000	0.71417	0.987000	0.45799	0.927000	0.56198	1.252000	0.32874	0.436000	0.26393	0.528000	0.53228	AAC	NEUROD1	-	pirsf_TF_bHLH_NeuroD	ENSG00000162992		0.567	NEUROD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD1	HGNC	protein_coding	OTTHUMT00000255792.2	-	0.00	42	0	T	NM_002500		182543449	-1	tier1	-	no_errors	ENST00000295108	ensembl	human	known	74_37	missense	7.55	49	4	SNP	0.996	C
NHSL1	57224	genome.wustl.edu	37	6	138753531	138753531	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:138753531G>T	ENST00000427025.2	-	5	2591	c.1963C>A	c.(1963-1965)Cgg>Agg	p.R655R	NHSL1_ENST00000343505.5_Silent_p.R651R|MIR3145_ENST00000580727.1_RNA	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	655								p.R655W(1)|p.R651W(1)		breast(2)|endometrium(4)|kidney(1)	7						TAATTGGACCGGTCCCCTTGG	0.502																																																	2	Substitution - Missense(2)	endometrium(2)											199.0	172.0	181.0					6																	138753531		692	1591	2283	SO:0001819	synonymous_variant	0			AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.1963C>A	6.37:g.138753531G>T			Q3ZCS5|Q5SYE8|Q9P2J0	Silent	SNP	NULL	p.R655	ENST00000427025.2	37	c.1963	CCDS55063.1	6																																																																																			NHSL1	-	NULL	ENSG00000135540		0.502	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	NHSL1	HGNC	protein_coding	OTTHUMT00000043700.2		0.00	32	0	G	XM_050421		138753531	-1			no_errors	ENST00000427025	ensembl	human	known	74_37	silent	8.70	21	2	SNP	0.008	T
NID2	22795	genome.wustl.edu	37	14	52481849	52481849	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:52481849C>T	ENST00000216286.5	-	15	3172	c.3173G>A	c.(3172-3174)aGc>aAc	p.S1058N	NID2_ENST00000541773.1_Missense_Mutation_p.S957N	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	1058	Thyroglobulin type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00500}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GCAGAAGTCGCTCTTTCCGTG	0.657																																																	0													52.0	44.0	47.0					14																	52481849		2203	4300	6503	SO:0001583	missense	0			AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.3173G>A	14.37:g.52481849C>T	ENSP00000216286:p.Ser1058Asn		A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd_dom,superfamily_GFP,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd_dom,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.S1058N	ENST00000216286.5	37	c.3173	CCDS9706.1	14	.	.	.	.	.	.	.	.	.	.	C	26.6	4.749510	0.89753	.	.	ENSG00000087303	ENST00000216286;ENST00000316204;ENST00000541773;ENST00000395707	T;T	0.63096	-0.02;-0.02	5.67	5.67	0.87782	Thyroglobulin type-1 (6);	0.078574	0.85682	D	0.000000	T	0.73806	0.3634	L	0.52364	1.645	0.40385	D	0.979482	D;D;D;D	0.76494	0.994;0.975;0.998;0.999	D;P;D;D	0.74674	0.948;0.778;0.984;0.984	T	0.67011	-0.5778	10	0.16896	T	0.51	.	19.3726	0.94495	0.0:1.0:0.0:0.0	.	652;957;1060;1058	E7EPP3;Q14112-2;Q5CZI2;Q14112	.;.;.;NID2_HUMAN	N	1058;652;957;1060	ENSP00000216286:S1058N;ENSP00000443730:S957N	ENSP00000216286:S1058N	S	-	2	0	NID2	51551599	1.000000	0.71417	1.000000	0.80357	0.796000	0.44982	3.139000	0.50577	2.680000	0.91292	0.655000	0.94253	AGC	NID2	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pfscan_Thyroglobulin_1	ENSG00000087303		0.657	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID2	HGNC	protein_coding	OTTHUMT00000276888.1	-	0.00	52	0	C			52481849	-1	tier1	-	no_errors	ENST00000216286	ensembl	human	known	74_37	missense	35.14	24	13	SNP	1.000	T
NLRC4	58484	genome.wustl.edu	37	2	32475733	32475733	+	Silent	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:32475733A>G	ENST00000404025.2	-	5	1688	c.1200T>C	c.(1198-1200)ggT>ggC	p.G400G	NLRC4_ENST00000342905.6_Intron|NLRC4_ENST00000360906.5_Silent_p.G400G|NLRC4_ENST00000402280.1_Silent_p.G400G			Q9NPP4	NLRC4_HUMAN	NLR family, CARD domain containing 4	400	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.|Winged-helix domain (WHD). {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of innate immune response (GO:0002218)|defense response to bacterium (GO:0042742)|detection of bacterium (GO:0016045)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta secretion (GO:0050702)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of apoptotic process (GO:0043065)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein homooligomerization (GO:0051260)|pyroptosis (GO:0070269)	cytosol (GO:0005829)|intracellular (GO:0005622)|IPAF inflammasome complex (GO:0072557)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(1)|ovary(3)|skin(2)|stomach(2)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GGGAGAACACACCCTCCAGAG	0.468																																																	0													68.0	71.0	70.0					2																	32475733		2203	4300	6503	SO:0001819	synonymous_variant	0			AF376061	CCDS33174.1	2p22-p21	2008-08-27	2006-12-08	2006-12-08	ENSG00000091106	ENSG00000091106		"""Nucleotide-binding domain and leucine rich repeat containing"""	16412	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 4"", ""NOD-like receptor C4"""	606831	"""caspase recruitment domain family, member 12"""	CARD12		11374873	Standard	NM_021209		Approved	CLAN1, ipaf, CLANA, CLANB, CLANC, CLAND, CLR2.1, CLAN	uc021vfq.1	Q9NPP4	OTTHUMG00000152107	ENST00000404025.2:c.1200T>C	2.37:g.32475733A>G			A8K9F8|B2RBQ3|B3KTF0|D6W580|Q96J81|Q96J82|Q96J83	Silent	SNP	pfam_CARD,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,pfscan_NACHT_NTPase,pfscan_CARD	p.G400	ENST00000404025.2	37	c.1200	CCDS33174.1	2																																																																																			NLRC4	-	NULL	ENSG00000091106		0.468	NLRC4-001	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	NLRC4	HGNC	protein_coding	OTTHUMT00000325222.2	-	0.00	62	0	A	NM_021209		32475733	-1	tier1	-	no_errors	ENST00000360906	ensembl	human	known	74_37	silent	28.77	52	21	SNP	0.963	G
NLRP3	114548	genome.wustl.edu	37	1	247587770	247587770	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:247587770C>T	ENST00000336119.3	+	3	1771	c.1025C>T	c.(1024-1026)cCc>cTc	p.P342L	NLRP3_ENST00000391827.2_Missense_Mutation_p.P342L|NLRP3_ENST00000366497.2_Missense_Mutation_p.P342L|NLRP3_ENST00000391828.3_Missense_Mutation_p.P342L|NLRP3_ENST00000366496.2_Missense_Mutation_p.P342L|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000348069.2_Missense_Mutation_p.P342L	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	342	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AAGCTGCTTCCCGAGGCCTCT	0.592																																																	0													58.0	61.0	60.0					1																	247587770		2203	4300	6503	SO:0001583	missense	0			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.1025C>T	1.37:g.247587770C>T	ENSP00000337383:p.Pro342Leu		B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like_dom,superfamily_P-loop_NTPase,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.P342L	ENST00000336119.3	37	c.1025	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	C	15.75	2.924701	0.52653	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.81415	-1.49;-1.49;-1.49;-1.49;-1.49;-1.49	3.84	3.84	0.44239	NACHT nucleoside triphosphatase (1);	0.000000	0.51477	D	0.000095	D	0.88916	0.6567	M	0.83692	2.655	0.80722	D	1	P;D;D;D;D	0.89917	0.857;1.0;0.997;1.0;1.0	P;D;D;D;D	0.97110	0.686;0.995;0.95;0.999;1.0	D	0.89618	0.3846	10	0.66056	D	0.02	.	11.5521	0.50726	0.0:1.0:0.0:0.0	.	342;342;342;342;342	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	L	342	ENSP00000375704:P342L;ENSP00000355453:P342L;ENSP00000337383:P342L;ENSP00000294752:P342L;ENSP00000355452:P342L;ENSP00000375703:P342L	ENSP00000337383:P342L	P	+	2	0	NLRP3	245654393	0.834000	0.29399	0.196000	0.23383	0.447000	0.32167	2.414000	0.44627	2.436000	0.82500	0.563000	0.77884	CCC	NLRP3	-	superfamily_P-loop_NTPase,pfscan_NACHT_NTPase	ENSG00000162711		0.592	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	HGNC	protein_coding	OTTHUMT00000097740.1	-	0.00	17	0	C	NM_004895		247587770	+1	tier1	-	no_errors	ENST00000336119	ensembl	human	known	74_37	missense	35.00	13	7	SNP	0.993	T
NOB1	28987	genome.wustl.edu	37	16	69783468	69783468	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:69783468G>T	ENST00000268802.5	-	4	422	c.393C>A	c.(391-393)ccC>ccA	p.P131P		NM_014062.1	NP_054781.1	Q9ULX3	NOB1_HUMAN	NIN1/RPN12 binding protein 1 homolog (S. cerevisiae)	131					visual perception (GO:0007601)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						TTACCTTGTAGGGCAGATGGA	0.398																																																	0													94.0	86.0	89.0					16																	69783468		2198	4300	6498	SO:0001819	synonymous_variant	0			AB026125	CCDS10884.1	16q22.1	2008-02-05	2006-04-20	2006-04-20	ENSG00000141101	ENSG00000141101			29540	protein-coding gene	gene with protein product	"""nin one binding protein"""	613586	"""PSMD8 binding protein 1"""	PSMD8BP1		16172919	Standard	NM_014062		Approved	NOB1P, ART-4, MST158	uc002exs.4	Q9ULX3	OTTHUMG00000137576	ENST00000268802.5:c.393C>A	16.37:g.69783468G>T			Q7L6B7|Q7M4M4|Q7Z4B5|Q9NWB0	Silent	SNP	pfam_NOB1_Zn-bd,smart_PIN_dom,pirsf_D-site_20S_pre-rRNA_nuclease	p.P131	ENST00000268802.5	37	c.393	CCDS10884.1	16																																																																																			NOB1	-	pirsf_D-site_20S_pre-rRNA_nuclease	ENSG00000141101		0.398	NOB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOB1	HGNC	protein_coding	OTTHUMT00000268958.2	-	0.00	64	0	G	NM_014062		69783468	-1	tier1	-	no_errors	ENST00000268802	ensembl	human	known	74_37	silent	6.45	57	4	SNP	0.998	T
NONO	4841	genome.wustl.edu	37	X	70518236	70518236	+	Intron	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:70518236C>A	ENST00000276079.8	+	10	1336				NONO_ENST00000535149.1_Intron|NONO_ENST00000373856.3_Intron|NONO_ENST00000373841.1_Intron|NONO_ENST00000490044.1_Intron	NM_007363.4	NP_031389.3	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding						circadian rhythm (GO:0007623)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mRNA processing (GO:0006397)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)		NONO/TFE3(2)	endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	19	Renal(35;0.156)					ACTCTATCTACTTCCCTTAGT	0.453			T	TFE3	papillary renal cancer																																			Dom	yes		X	Xq13.1	4841	"""non-POU domain containing, octamer-binding"""		E	0																																										SO:0001627	intron_variant	0			L14599	CCDS14410.1, CCDS55445.1	Xq13.1	2014-06-13	2002-01-14		ENSG00000147140	ENSG00000147140		"""RNA binding motif (RRM) containing"""	7871	protein-coding gene	gene with protein product	"""Nuclear RNA-binding protein, 54-kD"", ""non-Pou domain-containing octamer (ATGCAAAT) binding protein"", ""protein phosphatase 1, regulatory subunit 114"""	300084	"""non-POU-domain-containing, octamer-binding"""			8371983, 9360842	Standard	NM_007363		Approved	NRB54, NMT55, P54NRB, P54, PPP1R114	uc004dzp.3	Q15233	OTTHUMG00000021798	ENST00000276079.8:c.1132-83C>A	X.37:g.70518236C>A			B7Z4C2|D3DVV4|F5GYZ3|O00201|P30807|Q12786|Q9BQC5	RNA	SNP	-	NULL	ENST00000276079.8	37	NULL	CCDS14410.1	X																																																																																			NONO	-	-	ENSG00000147140		0.453	NONO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NONO	HGNC	protein_coding	OTTHUMT00000057138.1		0.00	25	0	C	NM_007363		70518236	+1			no_errors	ENST00000473525	ensembl	human	known	74_37	rna	5.45	52	3	SNP	0.000	A
NOTCH4	4855	genome.wustl.edu	37	6	32171621	32171621	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:32171621G>T	ENST00000375023.3	-	20	3295	c.3157C>A	c.(3157-3159)Caa>Aaa	p.Q1053K		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	1053	EGF-like 27. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						AAGCAGGGTTGGCTGTGGCAG	0.557																																																	0													67.0	38.0	48.0					6																	32171621		1507	2702	4209	SO:0001583	missense	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.3157C>A	6.37:g.32171621G>T	ENSP00000364163:p.Gln1053Lys		B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	pirsf_Notch,pfam_EG-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd_dom,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_4,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.Q1053K	ENST00000375023.3	37	c.3157	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	G	10.49	1.365284	0.24684	.	.	ENSG00000204301	ENST00000375023	D	0.87412	-2.25	4.94	4.94	0.65067	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.176870	0.27236	N	0.020295	T	0.65606	0.2707	N	0.25890	0.77	0.80722	D	1	P	0.35107	0.484	B	0.32149	0.141	T	0.69997	-0.4993	10	0.06625	T	0.88	.	15.7021	0.77549	0.0:0.0:1.0:0.0	.	1053	Q99466	NOTC4_HUMAN	K	1053	ENSP00000364163:Q1053K	ENSP00000364163:Q1053K	Q	-	1	0	NOTCH4	32279599	0.056000	0.20664	1.000000	0.80357	0.993000	0.82548	1.350000	0.34010	2.571000	0.86741	0.561000	0.74099	CAA	NOTCH4	-	pirsf_Notch,smart_EGF-like_Ca-bd_dom,smart_EG-like_dom,pfscan_EG-like_dom	ENSG00000204301		0.557	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	-	0.00	60	0	G			32171621	-1	tier1	-	no_errors	ENST00000375023	ensembl	human	known	74_37	missense	6.06	62	4	SNP	0.940	T
NPIPB5	100132247	genome.wustl.edu	37	16	22545272	22545272	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:22545272C>T	ENST00000517539.1	+	8	1043	c.968C>T	c.(967-969)cCt>cTt	p.P323L	NPIPB5_ENST00000424340.1_Missense_Mutation_p.P323L|NPIPB5_ENST00000415654.1_3'UTR			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	323	Pro-rich.					integral component of membrane (GO:0016021)											CTCAAGACACCTCCTGAGTGT	0.567																																																	0													1.0	1.0	1.0					16																	22545272		3	3	6	SO:0001583	missense	0				CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.968C>T	16.37:g.22545272C>T	ENSP00000430633:p.Pro323Leu		B4DK13	Missense_Mutation	SNP	NULL	p.P323L	ENST00000517539.1	37	c.968	CCDS45443.1	16	.	.	.	.	.	.	.	.	.	.	.	9.816	1.184495	0.21870	.	.	ENSG00000243716	ENST00000415833;ENST00000424340;ENST00000342168;ENST00000446615;ENST00000503072;ENST00000517539;ENST00000528249;ENST00000344223	T;T;T;T	0.24908	1.83;1.92;1.92;1.83	.	.	.	.	.	.	.	.	T	0.23370	0.0565	L	0.46157	1.445	0.25829	N	0.984194	B;P	0.35124	0.068;0.485	B;B	0.40066	0.093;0.318	T	0.25222	-1.0138	7	0.51188	T	0.08	.	.	.	.	.	323;323	F5GWX0;A8MRT5	.;K220L_HUMAN	L	323;323;323;323;201;323;323;304	ENSP00000445388:P323L;ENSP00000440703:P323L;ENSP00000430633:P323L;ENSP00000431553:P323L	ENSP00000441680:P323L	P	+	2	0	RP11-368J21.2	22452773	0.916000	0.31088	0.155000	0.22561	0.155000	0.21991	0.882000	0.28186	-0.000000	0.14550	0.000000	0.15137	CCT	NPIPB5	-	NULL	ENSG00000243716		0.567	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NPIPB5	HGNC	protein_coding	OTTHUMT00000374343.2	-	0.00	17	0	C	NM_001135865		22545272	+1	tier1	-	no_errors	ENST00000424340	ensembl	human	known	74_37	missense	29.41	12	5	SNP	0.985	T
NPR2	4882	genome.wustl.edu	37	9	35809417	35809417	+	Missense_Mutation	SNP	G	G	A	rs146546770		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:35809417G>A	ENST00000342694.2	+	22	3374	c.3119G>A	c.(3118-3120)cGg>cAg	p.R1040Q	SPAG8_ENST00000340291.2_Silent_p.S452S|SPAG8_ENST00000479751.1_5'Flank|AL133410.1_ENST00000582432.1_RNA	NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	1040					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	TTAGGAGAGCGGAAAGGACCT	0.517																																																	0								G	GLN/ARG,	2,4404	4.2+/-10.8	0,2,2201	263.0	256.0	258.0		3119,1356	-2.9	0.5	9	dbSNP_134	258	0,8600		0,0,4300	no	missense,coding-synonymous	NPR2,SPAG8	NM_003995.3,NM_172312.1	43,	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign,	1040/1048,452/502	35809417	2,13004	2203	4300	6503	SO:0001583	missense	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.3119G>A	9.37:g.35809417G>A	ENSP00000341083:p.Arg1040Gln		B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,superfamily_Peripla_BP_I,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_dom,pfscan_A/G_cyclase	p.R1040Q	ENST00000342694.2	37	c.3119	CCDS6590.1	9	.	.	.	.	.	.	.	.	.	.	G	12.11	1.838632	0.32513	4.54E-4	0.0	ENSG00000159899	ENST00000342694	T	0.80909	-1.43	5.86	-2.89	0.05665	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.451712	0.16037	N	0.232583	T	0.64136	0.2571	.	.	.	0.43555	D	0.995864	B	0.17852	0.024	B	0.12837	0.008	T	0.41431	-0.9509	9	0.15066	T	0.55	1.0E-4	12.0758	0.53643	0.4923:0.0:0.5077:0.0	.	1040	P20594	ANPRB_HUMAN	Q	1040	ENSP00000341083:R1040Q	ENSP00000341083:R1040Q	R	+	2	0	NPR2	35799417	0.998000	0.40836	0.507000	0.27676	0.982000	0.71751	1.230000	0.32612	-0.973000	0.03555	-0.122000	0.15005	CGG	NPR2	-	NULL	ENSG00000159899		0.517	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR2	HGNC	protein_coding	OTTHUMT00000052345.1	-	0.00	56	0	G			35809417	+1	tier1	rs146546770	no_errors	ENST00000342694	ensembl	human	known	74_37	missense	9.09	80	8	SNP	0.711	A
NPR3	4883	genome.wustl.edu	37	5	32711945	32711945	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:32711945C>T	ENST00000265074.8	+	1	406	c.63C>T	c.(61-63)gcC>gcT	p.A21A	NPR3_ENST00000415685.2_Intron|NPR3_ENST00000434067.2_Intron|NPR3_ENST00000415167.2_Silent_p.A21A	NM_000908.3|NM_001204375.1	NP_000899.1|NP_001191304.1	P17342	ANPRC_HUMAN	natriuretic peptide receptor 3	21					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of smooth muscle cell proliferation (GO:0048662)|osteoclast proliferation (GO:0002158)|pancreatic juice secretion (GO:0030157)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of urine volume (GO:0035810)|regulation of blood pressure (GO:0008217)|regulation of osteoblast proliferation (GO:0033688)|skeletal system development (GO:0001501)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	G-protein coupled peptide receptor activity (GO:0008528)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24					Nesiritide(DB04899)	CGTTGCTGGCcggcggcaccg	0.716																																																	0													3.0	3.0	3.0					5																	32711945		1379	2828	4207	SO:0001819	synonymous_variant	0				CCDS47196.1, CCDS56356.1, CCDS56357.1	5p13.3	2014-03-03	2014-03-03		ENSG00000113389	ENSG00000113389			7945	protein-coding gene	gene with protein product	"""guanylate cyclase C"""	108962	"""chromosome 5 open reading frame 23"", ""atrionatriuretic peptide receptor C"", ""natriuretic peptide receptor C/guanylate cyclase C (atrionatriuretic peptide receptor C)"", ""natriuretic peptide receptor C"""	NPRC, ANPRC, C5orf23		2162522, 1979052	Standard	NM_000908		Approved	GUCY2B, FLJ14054	uc003jhv.3	P17342	OTTHUMG00000150316	ENST00000265074.8:c.63C>T	5.37:g.32711945C>T			A2RRD1|B4DT84|E7EPG9	Silent	SNP	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I,prints_Ntpep_rcpt	p.A21	ENST00000265074.8	37	c.63	CCDS56357.1	5																																																																																			NPR3	-	NULL	ENSG00000113389		0.716	NPR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NPR3	HGNC	protein_coding	OTTHUMT00000317550.3	-	0.00	47	0	C	NM_000908		32711945	+1	tier1	-	no_errors	ENST00000265074	ensembl	human	known	74_37	silent	32.73	37	18	SNP	0.005	T
NR3C2	4306	genome.wustl.edu	37	4	149356787	149356787	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:149356787G>A	ENST00000358102.3	-	2	1588	c.1226C>T	c.(1225-1227)tCa>tTa	p.S409L	NR3C2_ENST00000355292.3_Missense_Mutation_p.S409L|NR3C2_ENST00000511528.1_Missense_Mutation_p.S409L|NR3C2_ENST00000344721.4_Missense_Mutation_p.S409L|NR3C2_ENST00000512865.1_Missense_Mutation_p.S409L	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	409	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	TCCTAGACATGAGCTGCTAAA	0.398																																					Melanoma(27;428 957 40335 51025 51111)												0													87.0	91.0	89.0					4																	149356787		2203	4300	6503	SO:0001583	missense	0			M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.1226C>T	4.37:g.149356787G>A	ENSP00000350815:p.Ser409Leu		B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.S409L	ENST00000358102.3	37	c.1226	CCDS3772.1	4	.	.	.	.	.	.	.	.	.	.	G	12.81	2.050855	0.36181	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000544252;ENST00000342437;ENST00000511528	D;D;D;D;D;D	0.90069	-2.6;-2.61;-2.6;-2.2;-2.2;-2.61	5.16	5.16	0.70880	.	0.163089	0.53938	D	0.000042	T	0.80059	0.4554	N	0.14661	0.345	0.42336	D	0.992311	B;B	0.32350	0.172;0.366	B;B	0.27500	0.035;0.08	T	0.77579	-0.2535	9	.	.	.	.	19.009	0.92865	0.0:0.0:1.0:0.0	.	409;409	B0ZBF5;B0ZBF6	.;.	L	409	ENSP00000341390:S409L;ENSP00000347441:S409L;ENSP00000350815:S409L;ENSP00000423510:S409L;ENSP00000343907:S409L;ENSP00000421481:S409L	.	S	-	2	0	NR3C2	149576237	1.000000	0.71417	0.984000	0.44739	0.989000	0.77384	6.842000	0.75379	2.564000	0.86499	0.655000	0.94253	TCA	NR3C2	-	NULL	ENSG00000151623		0.398	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NR3C2	HGNC	protein_coding	OTTHUMT00000364986.1		0.00	42	0	G			149356787	-1			no_errors	ENST00000355292	ensembl	human	known	74_37	missense	5.13	37	2	SNP	0.997	A
NRG3	10718	genome.wustl.edu	37	10	84745032	84745032	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:84745032C>T	ENST00000404547.1	+	10	1834	c.1834C>T	c.(1834-1836)Caa>Taa	p.Q612*	NRG3_ENST00000404576.2_Nonsense_Mutation_p.Q392*|NRG3_ENST00000372142.2_Nonsense_Mutation_p.Q391*|NRG3_ENST00000537893.1_Nonsense_Mutation_p.Q238*|NRG3_ENST00000556918.1_Nonsense_Mutation_p.Q418*|NRG3_ENST00000545131.1_Nonsense_Mutation_p.Q238*|NRG3_ENST00000372141.2_Nonsense_Mutation_p.Q588*			P56975	NRG3_HUMAN	neuregulin 3	612					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		AACCTGCCTGCAAATGCCAGG	0.453																																																	0													99.0	101.0	100.0					10																	84745032		2203	4300	6503	SO:0001587	stop_gained	0			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1834C>T	10.37:g.84745032C>T	ENSP00000384796:p.Gln612*		A4D7U1|Q0PEH2|Q5VYH3	Nonsense_Mutation	SNP	pfscan_EG-like_dom	p.Q612*	ENST00000404547.1	37	c.1834	CCDS31233.1	10	.	.	.	.	.	.	.	.	.	.	C	19.63	3.864301	0.71949	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287;ENST00000372142;ENST00000404576;ENST00000556918;ENST00000545131;ENST00000537893	.	.	.	5.95	5.95	0.96441	.	0.080584	0.53938	D	0.000058	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-32.0197	17.8962	0.88888	0.0:1.0:0.0:0.0	.	.	.	.	X	588;612;587;391;392;418;238;238	.	ENSP00000361214:Q588X	Q	+	1	0	NRG3	84735012	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.274000	0.65569	2.827000	0.97445	0.650000	0.86243	CAA	NRG3	-	NULL	ENSG00000185737		0.453	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	HGNC	protein_coding	OTTHUMT00000412262.1		0.00	20	0	C	XM_166086		84745032	+1			no_errors	ENST00000404547	ensembl	human	known	74_37	nonsense	8.00	46	4	SNP	1.000	T
NTSR1	4923	genome.wustl.edu	37	20	61386239	61386239	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr20:61386239G>A	ENST00000370501.3	+	2	1287		c.e2+1			NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)						adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)	p.?(2)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			CGCGTCCTACGTACGTAACCT	0.662																																					GBM(37;400 780 6403 19663 35669)												2	Unknown(2)	lung(1)|endometrium(1)											29.0	24.0	25.0					20																	61386239		2195	4294	6489	SO:0001630	splice_region_variant	0				CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.916+1G>A	20.37:g.61386239G>A			Q9H4H1|Q9H4T5	Splice_Site	SNP	-	e2+1	ENST00000370501.3	37	c.916+1	CCDS13502.1	20	.	.	.	.	.	.	.	.	.	.	g	12.83	2.056539	0.36277	.	.	ENSG00000101188	ENST00000370501	.	.	.	4.01	4.01	0.46588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4738	0.84125	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NTSR1	60856684	1.000000	0.71417	0.936000	0.37596	0.107000	0.19398	8.163000	0.89659	1.940000	0.56252	0.306000	0.20318	.	NTSR1	-	-	ENSG00000101188		0.662	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTSR1	HGNC	protein_coding	OTTHUMT00000080061.1	-	0.00	14	0	G		Intron	61386239	+1	tier1	-	no_errors	ENST00000370501	ensembl	human	known	74_37	splice_site	26.09	17	6	SNP	1.000	A
NUP153	9972	genome.wustl.edu	37	6	17675873	17675873	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:17675873C>T	ENST00000262077.2	-	3	462	c.463G>A	c.(463-465)Gca>Aca	p.A155T	NUP153_ENST00000537253.1_Missense_Mutation_p.A155T	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	155					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			ATTGGGAATGCCGAGGATGTA	0.423																																																	0													102.0	96.0	98.0					6																	17675873		2203	4300	6503	SO:0001583	missense	0			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.463G>A	6.37:g.17675873C>T	ENSP00000262077:p.Ala155Thr		B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	pfam_Nucleoporin_Nup153,pfam_Znf_RanBP2,pfam_Retro-transposon_transp_CS,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.A155T	ENST00000262077.2	37	c.463	CCDS4541.1	6	.	.	.	.	.	.	.	.	.	.	C	15.10	2.733578	0.48939	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	T;T	0.36520	1.25;1.25	5.26	5.26	0.73747	Nucleoporin, Nup153-like (1);	0.000000	0.52532	D	0.000073	T	0.12475	0.0303	L	0.38838	1.175	0.44771	D	0.997776	P;B;B	0.41450	0.75;0.3;0.134	B;B;B	0.33690	0.168;0.096;0.077	T	0.05084	-1.0907	10	0.38643	T	0.18	-10.6876	7.6855	0.28538	0.0:0.8204:0.0:0.1796	.	155;177;155	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	T	155;177;155	ENSP00000262077:A155T;ENSP00000444029:A155T	ENSP00000262077:A155T	A	-	1	0	NUP153	17783852	0.759000	0.28416	0.832000	0.32986	0.711000	0.40976	1.452000	0.35156	2.462000	0.83206	0.650000	0.86243	GCA	NUP153	-	pfam_Nucleoporin_Nup153	ENSG00000124789		0.423	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP153	HGNC	protein_coding	OTTHUMT00000039953.1	-	0.00	55	0	C			17675873	-1	tier1	-	no_errors	ENST00000537253	ensembl	human	known	74_37	missense	8.16	45	4	SNP	0.985	T
NXF4	55999	genome.wustl.edu	37	X	101823513	101823513	+	RNA	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:101823513T>C	ENST00000360035.2	+	0	3266					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						GGGATGAAACTTGAGCAGTCT	0.507																																																	0																																												0			AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101823513T>C				RNA	SNP	-	NULL	ENST00000360035.2	37	NULL		X																																																																																			NXF4	-	-	ENSG00000196970		0.507	NXF4-001	KNOWN	basic	processed_transcript	NXF4	HGNC	pseudogene	OTTHUMT00000095720.1	-	0.00	22	0	T			101823513	+1	tier1	-	no_errors	ENST00000360035	ensembl	human	known	74_37	rna	33.33	14	7	SNP	0.853	C
OCA2	4948	genome.wustl.edu	37	15	28096615	28096615	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:28096615C>T	ENST00000354638.3	-	22	2406	c.2251G>A	c.(2251-2253)Gtg>Atg	p.V751M	OCA2_ENST00000353809.5_Missense_Mutation_p.V727M	NM_000275.2	NP_000266.2	Q04671	P_HUMAN	oculocutaneous albinism II	751					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|spermatid development (GO:0007286)|tyrosine transport (GO:0015828)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome membrane (GO:0033162)	L-tyrosine transmembrane transporter activity (GO:0005302)|transporter activity (GO:0005215)	p.V751M(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(48)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		TTCAGGAGCACGGGAATCTGT	0.572									Oculocutaneous Albinism																																								1	Substitution - Missense(1)	endometrium(1)											58.0	44.0	49.0					15																	28096615		2199	4300	6499	SO:0001583	missense	0	Familial Cancer Database			CCDS10020.1, CCDS73701.1	15q12	2013-01-08	2008-01-30		ENSG00000104044	ENSG00000104044			8101	protein-coding gene	gene with protein product	"""melanocyte-specific transporter protein"""	611409	"""oculocutaneous albinism II (pink-eye dilution (murine) homolog)"", ""eye color 3 (brown)"", ""eye color 2 (central brown)"", ""oculocutaneous albinism II (pink-eye dilution homolog, mouse)"""	D15S12, P, EYCL3, EYCL2			Standard	NM_000275		Approved	BEY2, EYCL, BEY, BEY1	uc001zbh.4	Q04671	OTTHUMG00000128871	ENST00000354638.3:c.2251G>A	15.37:g.28096615C>T	ENSP00000346659:p.Val751Met		Q15211|Q15212|Q96EN1|Q9UMI5	Missense_Mutation	SNP	pfam_Cit_transptr-like_dom,pfam_Na/sul_symport,pfam_Arsenical_pump_ArsB,tigrfam_Arsenical_pump_ArsB	p.V751M	ENST00000354638.3	37	c.2251	CCDS10020.1	15	.	.	.	.	.	.	.	.	.	.	C	23.3	4.403974	0.83230	.	.	ENSG00000104044	ENST00000354638;ENST00000353809	T;T	0.80824	-1.42;-1.42	4.64	4.64	0.57946	.	0.134244	0.49916	D	0.000140	D	0.86289	0.5897	L	0.51914	1.62	0.80722	D	1	D;P	0.76494	0.999;0.878	D;P	0.70487	0.969;0.68	D	0.87726	0.2576	10	0.72032	D	0.01	-23.4963	15.3872	0.74711	0.0:1.0:0.0:0.0	.	727;751	Q04671-2;Q04671	.;P_HUMAN	M	751;727	ENSP00000346659:V751M;ENSP00000261276:V727M	ENSP00000261276:V727M	V	-	1	0	OCA2	25770210	1.000000	0.71417	0.955000	0.39395	0.948000	0.59901	6.255000	0.72466	2.282000	0.76494	0.650000	0.86243	GTG	OCA2	-	pfam_Cit_transptr-like_dom,pfam_Na/sul_symport,pfam_Arsenical_pump_ArsB,tigrfam_Arsenical_pump_ArsB	ENSG00000104044		0.572	OCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCA2	HGNC	protein_coding	OTTHUMT00000250823.1		0.00	36	0	C	NM_000275		28096615	-1			no_errors	ENST00000354638	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.999	T
OR10G6	79490	genome.wustl.edu	37	11	123865724	123865724	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:123865724A>C	ENST00000307002.3	-	1	144	c.145T>G	c.(145-147)Ttc>Gtc	p.F49V				Q8NH81	O10G6_HUMAN	olfactory receptor, family 10, subfamily G, member 6	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)										AAAGCTAAGAAGAGTGGCGCT	0.507																																																	0																																										SO:0001583	missense	0			AB065508		11q24.1	2013-03-28	2004-03-04	2004-03-05	ENSG00000198674	ENSG00000198674		"""GPCR / Class A : Olfactory receptors"""	14836	other	unknown			"""olfactory receptor, family 10, subfamily G, member 6 pseudogene"""	OR10G6P			Standard	NG_002255		Approved	OR10G6Q		Q8NH81	OTTHUMG00000165964	ENST00000307002.3:c.145T>G	11.37:g.123865724A>C	ENSP00000477445:p.Phe49Val			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F49V	ENST00000307002.3	37	c.145		11																																																																																			OR10G6	-	prints_GPCR_Rhodpsn	ENSG00000198674		0.507	OR10G6-001	KNOWN	basic|appris_principal	protein_coding	OR10G6	HGNC	protein_coding	OTTHUMT00000387266.2	-	0.00	45	0	A	NG_002255		123865724	-1	tier1	-	no_errors	ENST00000307002	ensembl	human	known	74_37	missense	39.58	29	19	SNP	0.979	C
OR13C2	392376	genome.wustl.edu	37	9	107367226	107367226	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:107367226A>C	ENST00000542196.1	-	1	725	c.683T>G	c.(682-684)aTt>aGt	p.I228S		NM_001004481.1	NP_001004481.1	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C, member 2	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	22						GGAAGAGCTAATTTTGAAGAT	0.403																																																	0													101.0	98.0	99.0					9																	107367226		2201	4300	6501	SO:0001583	missense	0				CCDS35092.1	9q31.1	2012-10-03			ENSG00000257019	ENSG00000276119		"""GPCR / Class A : Olfactory receptors"""	14701	protein-coding gene	gene with protein product							Standard	NM_001004481		Approved		uc011lvq.2	Q8NGS9	OTTHUMG00000020415	ENST00000542196.1:c.683T>G	9.37:g.107367226A>C	ENSP00000438815:p.Ile228Ser		B9EGV8|Q6IF54	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I228S	ENST00000542196.1	37	c.683	CCDS35092.1	9	.	.	.	.	.	.	.	.	.	.	A	8.257	0.810242	0.16537	.	.	ENSG00000257019	ENST00000542196	T	0.00277	8.34	3.41	3.41	0.39046	GPCR, rhodopsin-like superfamily (1);	0.201133	0.24145	U	0.041127	T	0.00637	0.0021	M	0.88450	2.955	0.09310	N	1	P	0.44344	0.833	P	0.59171	0.853	T	0.08597	-1.0714	10	0.87932	D	0	.	9.8502	0.41053	1.0:0.0:0.0:0.0	.	228	Q8NGS9	O13C2_HUMAN	S	228	ENSP00000438815:I228S	ENSP00000438815:I228S	I	-	2	0	OR13C2	106407047	0.442000	0.25633	0.005000	0.12908	0.022000	0.10575	2.024000	0.41049	1.422000	0.47177	0.260000	0.18958	ATT	OR13C2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000257019		0.403	OR13C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C2	HGNC	protein_coding	OTTHUMT00000053489.2	-	0.00	39	0	A	NM_001004481		107367226	-1	tier1	-	no_errors	ENST00000542196	ensembl	human	known	74_37	missense	32.26	63	30	SNP	0.002	C
OR13C9	286362	genome.wustl.edu	37	9	107379691	107379691	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:107379691T>A	ENST00000259362.1	-	1	794	c.795A>T	c.(793-795)aaA>aaT	p.K265N		NM_001001956.1	NP_001001956.1	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C, member 9	265						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(6)|lung(9)|prostate(1)|skin(4)	22						TAAGTGTCTCTTTAGACTTGG	0.413																																																	0													145.0	135.0	138.0					9																	107379691		2203	4300	6503	SO:0001583	missense	0				CCDS35093.1	9q31.1	2013-09-24			ENSG00000136839	ENSG00000136839		"""GPCR / Class A : Olfactory receptors"""	15104	protein-coding gene	gene with protein product							Standard	NM_001001956		Approved		uc011lvr.2	Q8NGT0	OTTHUMG00000020416	ENST00000259362.1:c.795A>T	9.37:g.107379691T>A	ENSP00000259362:p.Lys265Asn		Q6IFL2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.K265N	ENST00000259362.1	37	c.795	CCDS35093.1	9	.	.	.	.	.	.	.	.	.	.	T	8.777	0.927404	0.18056	.	.	ENSG00000136839	ENST00000259362	T	0.00107	8.72	4.46	3.31	0.37934	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000100	T	0.00210	0.0006	N	0.25245	0.725	0.09310	N	1	D	0.59767	0.986	P	0.62491	0.903	T	0.56032	-0.8046	10	0.44086	T	0.13	.	7.9348	0.29923	0.0:0.1858:0.0:0.8142	.	265	Q8NGT0	O13C9_HUMAN	N	265	ENSP00000259362:K265N	ENSP00000259362:K265N	K	-	3	2	OR13C9	106419512	0.782000	0.28689	0.905000	0.35620	0.255000	0.26057	1.086000	0.30853	0.230000	0.21059	-1.171000	0.01739	AAA	OR13C9	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000136839		0.413	OR13C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C9	HGNC	protein_coding	OTTHUMT00000053490.1	-	0.00	71	0	T			107379691	-1	tier1	-	no_errors	ENST00000259362	ensembl	human	known	74_37	missense	26.67	66	24	SNP	0.001	A
OR2A7	401427	genome.wustl.edu	37	7	143955883	143955883	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:143955883A>C	ENST00000493325.1	-	1	932	c.839T>G	c.(838-840)tTt>tGt	p.F280C	OR2A1-AS1_ENST00000498397.1_RNA|OR2A1-AS1_ENST00000463561.1_RNA|RP4-545C24.1_ENST00000460955.1_RNA|OR2A1-AS1_ENST00000476560.1_RNA|OR2A1-AS1_ENST00000489488.1_RNA|ARHGEF35_ENST00000543357.1_Intron|OR2A1-AS1_ENST00000461843.1_RNA|OR2A1-AS1_ENST00000478806.1_RNA|OR2A1-AS1_ENST00000487102.1_RNA	NM_001005328.1	NP_001005328.1	Q96R45	OR2A7_HUMAN	olfactory receptor, family 2, subfamily A, member 7	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)	6	Melanoma(164;0.14)					CATGGGATTAAAGAGGCTGTG	0.428																																																	0													47.0	52.0	50.0					7																	143955883		2202	4279	6481	SO:0001583	missense	0				CCDS55177.1	7q35	2013-09-20			ENSG00000243896	ENSG00000243896		"""GPCR / Class A : Olfactory receptors"""	8234	protein-coding gene	gene with protein product							Standard	NM_001005328		Approved	HSDJ0798C17	uc011kuc.2	Q96R45	OTTHUMG00000158002	ENST00000493325.1:c.839T>G	7.37:g.143955883A>C	ENSP00000420502:p.Phe280Cys		B2RN57|Q6IFP4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	p.F280C	ENST00000493325.1	37	c.839	CCDS55177.1	7	.	.	.	.	.	.	.	.	.	.	a	11.54	1.670150	0.29693	.	.	ENSG00000243896	ENST00000493325	T	0.00169	8.63	3.17	3.17	0.36434	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00440	0.0014	M	0.63843	1.955	0.30488	N	0.771627	D	0.89917	1.0	D	0.77004	0.989	T	0.52215	-0.8605	9	0.87932	D	0	.	10.0247	0.42063	1.0:0.0:0.0:0.0	.	280	Q96R45	OR2A7_HUMAN	C	280	ENSP00000420502:F280C	ENSP00000420502:F280C	F	-	2	0	OR2A7	143586816	0.752000	0.28338	0.996000	0.52242	0.126000	0.20510	6.524000	0.73791	1.676000	0.50930	0.416000	0.27883	TTT	OR2A7	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Melcrt_ACTH_rcpt	ENSG00000243896		0.428	OR2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2A7	HGNC	protein_coding	OTTHUMT00000349979.1	-	0.00	50	0	A			143955883	-1	tier1	-	no_errors	ENST00000493325	ensembl	human	known	74_37	missense	25.37	50	17	SNP	0.851	C
OR4K14	122740	genome.wustl.edu	37	14	20483046	20483046	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:20483046A>C	ENST00000305045.2	-	1	306	c.307T>G	c.(307-309)Ttc>Gtc	p.F103V		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TGCAAGAAGAAGATTTGAGCC	0.468																																																	0													105.0	100.0	101.0					14																	20483046		2203	4300	6503	SO:0001583	missense	0				CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.307T>G	14.37:g.20483046A>C	ENSP00000305011:p.Phe103Val		Q6IEU1|Q96R71	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F103V	ENST00000305045.2	37	c.307	CCDS32027.1	14	.	.	.	.	.	.	.	.	.	.	.	19.68	3.873136	0.72180	.	.	ENSG00000169484	ENST00000305045	T	0.00402	7.56	4.04	4.04	0.47022	GPCR, rhodopsin-like superfamily (1);	0.153873	0.30252	N	0.010053	T	0.01489	0.0048	M	0.92970	3.365	0.30276	N	0.791811	D	0.76494	0.999	D	0.68621	0.959	T	0.01566	-1.1323	10	0.72032	D	0.01	.	12.097	0.53761	1.0:0.0:0.0:0.0	.	103	Q8NGD5	OR4KE_HUMAN	V	103	ENSP00000305011:F103V	ENSP00000305011:F103V	F	-	1	0	OR4K14	19552886	0.124000	0.22315	0.999000	0.59377	0.985000	0.73830	4.156000	0.58138	1.695000	0.51148	0.413000	0.27773	TTC	OR4K14	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	ENSG00000169484		0.468	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K14	HGNC	protein_coding	OTTHUMT00000410343.1	-	0.00	40	0	A			20483046	-1	tier1	-	no_errors	ENST00000305045	ensembl	human	known	74_37	missense	42.11	22	16	SNP	1.000	C
OR51B2	79345	genome.wustl.edu	37	11	5345083	5345083	+	Silent	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:5345083T>G	ENST00000328813.2	-	1	499	c.445A>C	c.(445-447)Agg>Cgg	p.R149R	HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron	NM_033180.4	NP_149420.4	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B, member 2	149						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|biliary_tract(1)|central_nervous_system(1)|large_intestine(6)|lung(21)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACAAAACCCCTTAGAAACACT	0.398																																																	0													109.0	105.0	107.0					11																	5345083		2201	4297	6498	SO:0001819	synonymous_variant	0			AF399503	CCDS31377.1	11p15.4	2012-08-09			ENSG00000184881	ENSG00000184881		"""GPCR / Class A : Olfactory receptors"""	14703	protein-coding gene	gene with protein product				OR51B1P			Standard	NM_033180		Approved		uc001mao.1	Q9Y5P1	OTTHUMG00000066682	ENST00000328813.2:c.445A>C	11.37:g.5345083T>G			Q96RD4	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R149	ENST00000328813.2	37	c.445	CCDS31377.1	11																																																																																			OR51B2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000184881		0.398	OR51B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51B2	HGNC	protein_coding	OTTHUMT00000142983.1	-	0.00	45	0	T	NM_033180		5345083	-1	tier1	-	no_errors	ENST00000328813	ensembl	human	known	74_37	silent	34.62	17	9	SNP	0.836	G
OR56B1	387748	genome.wustl.edu	37	11	5758323	5758323	+	Missense_Mutation	SNP	G	G	T	rs375273446		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:5758323G>T	ENST00000317121.3	+	1	643	c.577G>T	c.(577-579)Gtc>Ttc	p.V193F	TRIM5_ENST00000380027.1_Intron	NM_001005180.2	NP_001005180.1	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B, member 1	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		TAACCTTGGGGTCACAAGCCT	0.478																																																	0													89.0	79.0	83.0					11																	5758323		2201	4297	6498	SO:0001583	missense	0			BK004386	CCDS31395.1	11p15.4	2012-08-09		2004-03-10	ENSG00000181023	ENSG00000181023		"""GPCR / Class A : Olfactory receptors"""	15245	protein-coding gene	gene with protein product				OR56B1P			Standard	NM_001005180		Approved		uc001mbt.2	Q8NGI3	OTTHUMG00000066891	ENST00000317121.3:c.577G>T	11.37:g.5758323G>T	ENSP00000322939:p.Val193Phe		B2RNY6|B3KV42|Q6IF76	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.V193F	ENST00000317121.3	37	c.577	CCDS31395.1	11	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632820	0.67015	.	.	ENSG00000181023	ENST00000317121	T	0.00237	8.47	5.91	5.91	0.95273	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40144	U	0.001166	T	0.00724	0.0024	M	0.91090	3.175	0.32870	D	0.509119	D	0.67145	0.996	D	0.74348	0.983	T	0.33240	-0.9876	10	0.87932	D	0	-11.2005	13.3832	0.60780	0.0:0.1577:0.8423:0.0	.	193	Q8NGI3	O56B1_HUMAN	F	193	ENSP00000322939:V193F	ENSP00000322939:V193F	V	+	1	0	OR56B1	5714899	0.131000	0.22433	0.995000	0.50966	0.996000	0.88848	0.441000	0.21611	2.801000	0.96364	0.655000	0.94253	GTC	OR56B1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181023		0.478	OR56B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56B1	HGNC	protein_coding	OTTHUMT00000143354.1		0.00	17	0	G	NM_001005180		5758323	+1			no_errors	ENST00000317121	ensembl	human	known	74_37	missense	14.29	18	3	SNP	0.775	T
OR5D13	390142	genome.wustl.edu	37	11	55541046	55541046	+	Missense_Mutation	SNP	T	T	G	rs112091941	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:55541046T>G	ENST00000361760.1	+	1	133	c.133T>G	c.(133-135)Ttg>Gtg	p.L45V		NM_001001967.1	NP_001001967.1	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D, member 13	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(1)|lung(20)|ovary(1)|pancreas(2)|skin(2)|stomach(1)|urinary_tract(1)	40		all_epithelial(135;0.196)				AGTGGGGAACTTGGGCATGAT	0.398																																																	0													162.0	151.0	155.0					11																	55541046		2200	4296	6496	SO:0001583	missense	0			BK004394	CCDS31507.1	11q11	2012-08-09			ENSG00000198877	ENSG00000198877		"""GPCR / Class A : Olfactory receptors"""	15280	protein-coding gene	gene with protein product							Standard	NM_001001967		Approved		uc010ril.2	Q8NGL4	OTTHUMG00000166807	ENST00000361760.1:c.133T>G	11.37:g.55541046T>G	ENSP00000354800:p.Leu45Val		Q6IF68|Q6IFC9	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L45V	ENST00000361760.1	37	c.133	CCDS31507.1	11	.	.	.	.	.	.	.	.	.	.	T	3.763	-0.049291	0.07407	.	.	ENSG00000198877	ENST00000361760	T	0.00428	7.44	3.52	-7.05	0.01573	GPCR, rhodopsin-like superfamily (1);	0.000000	0.27464	U	0.019251	T	0.00356	0.0011	M	0.64170	1.965	0.09310	N	1	B	0.27679	0.185	B	0.29942	0.109	T	0.39860	-0.9593	10	0.42905	T	0.14	-6.8477	11.2759	0.49165	0.0969:0.6551:0.0978:0.1502	.	45	Q8NGL4	OR5DD_HUMAN	V	45	ENSP00000354800:L45V	ENSP00000354800:L45V	L	+	1	2	OR5D13	55297622	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-10.618000	0.00005	-3.857000	0.00098	-1.484000	0.00983	TTG	OR5D13	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000198877		0.398	OR5D13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D13	HGNC	protein_coding	OTTHUMT00000391511.1	-	0.00	47	0	T	NM_001001967		55541046	+1	tier1	-	no_errors	ENST00000361760	ensembl	human	known	74_37	missense	27.27	40	15	SNP	0.000	G
OR5L2	26338	genome.wustl.edu	37	11	55594728	55594728	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:55594728T>G	ENST00000378397.1	+	1	34	c.34T>G	c.(34-36)Ttc>Gtc	p.F12V		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	12						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				TGTGGCTGAGTTCATTCTCCT	0.428										HNSCC(27;0.073)																																							0													206.0	194.0	198.0					11																	55594728		2200	4294	6494	SO:0001583	missense	0			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.34T>G	11.37:g.55594728T>G	ENSP00000367650:p.Phe12Val		Q6IF66|Q96RB2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F12V	ENST00000378397.1	37	c.34	CCDS31511.1	11	.	.	.	.	.	.	.	.	.	.	.	17.56	3.421111	0.62622	.	.	ENSG00000205030	ENST00000378397	T	0.04551	3.6	5.31	5.31	0.75309	.	0.000000	0.51477	D	0.000094	T	0.22975	0.0555	M	0.81341	2.54	0.38337	D	0.943978	D	0.89917	1.0	D	0.87578	0.998	T	0.03008	-1.1083	10	0.87932	D	0	-68.4133	14.5472	0.68041	0.0:0.0:0.0:1.0	.	12	Q8NGL0	OR5L2_HUMAN	V	12	ENSP00000367650:F12V	ENSP00000367650:F12V	F	+	1	0	OR5L2	55351304	0.996000	0.38824	0.939000	0.37840	0.565000	0.35776	2.911000	0.48774	2.173000	0.68751	0.509000	0.49947	TTC	OR5L2	-	NULL	ENSG00000205030		0.428	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L2	HGNC	protein_coding	OTTHUMT00000391516.1	-	0.00	45	0	T	NM_001004739		55594728	+1	tier1	-	no_errors	ENST00000378397	ensembl	human	known	74_37	missense	39.68	38	25	SNP	0.960	G
OR5D16	390144	genome.wustl.edu	37	11	55606285	55606285	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:55606285T>C	ENST00000378396.1	+	1	58	c.58T>C	c.(58-60)Tca>Cca	p.S20P		NM_001005496.1	NP_001005496.1	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D, member 16	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(4)|lung(26)|ovary(5)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_epithelial(135;0.208)				CTTGGGCTTCTCAGATTACCT	0.413																																																	0													102.0	93.0	96.0					11																	55606285		2201	4296	6497	SO:0001583	missense	0			AB065783	CCDS31512.1	11q11	2012-08-09			ENSG00000205029	ENSG00000205029		"""GPCR / Class A : Olfactory receptors"""	15283	protein-coding gene	gene with protein product							Standard	NM_001005496		Approved		uc010rio.2	Q8NGK9	OTTHUMG00000154233	ENST00000378396.1:c.58T>C	11.37:g.55606285T>C	ENSP00000367649:p.Ser20Pro		Q6IF65|Q96RB4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S20P	ENST00000378396.1	37	c.58	CCDS31512.1	11	.	.	.	.	.	.	.	.	.	.	.	13.79	2.341466	0.41498	.	.	ENSG00000205029	ENST00000378396	T	0.00441	7.41	4.15	1.48	0.22813	.	.	.	.	.	T	0.00468	0.0015	L	0.49699	1.58	0.26901	N	0.967109	P	0.36465	0.554	P	0.46049	0.502	T	0.42616	-0.9441	9	0.66056	D	0.02	-9.3149	6.1863	0.20500	0.1594:0.0:0.1656:0.675	.	20	Q8NGK9	OR5DG_HUMAN	P	20	ENSP00000367649:S20P	ENSP00000367649:S20P	S	+	1	0	OR5D16	55362861	0.000000	0.05858	0.734000	0.30879	0.895000	0.52256	-0.493000	0.06459	0.581000	0.29539	0.433000	0.28618	TCA	OR5D16	-	NULL	ENSG00000205029		0.413	OR5D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D16	HGNC	protein_coding	OTTHUMT00000334506.1	-	0.00	60	0	T	NM_001005496		55606285	+1	tier1	-	no_errors	ENST00000378396	ensembl	human	known	74_37	missense	31.15	42	19	SNP	0.998	C
OR8H3	390152	genome.wustl.edu	37	11	55890618	55890618	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:55890618T>C	ENST00000313472.3	+	1	770	c.770T>C	c.(769-771)tTt>tCt	p.F257S		NM_001005201.1	NP_001005201.1	Q8N146	OR8H3_HUMAN	olfactory receptor, family 8, subfamily H, member 3	257						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(30)|ovary(2)|prostate(1)|skin(3)|stomach(1)	42	Esophageal squamous(21;0.00693)					ACTATGATTTTTACTTACTTA	0.383																																																	0													103.0	102.0	102.0					11																	55890618		2201	4296	6497	SO:0001583	missense	0			AB065840	CCDS31519.1	11q11	2012-08-09			ENSG00000181761	ENSG00000181761		"""GPCR / Class A : Olfactory receptors"""	15309	protein-coding gene	gene with protein product							Standard	NM_001005201		Approved		uc001nii.1	Q8N146	OTTHUMG00000166833	ENST00000313472.3:c.770T>C	11.37:g.55890618T>C	ENSP00000323928:p.Phe257Ser		Q6IFB7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F257S	ENST00000313472.3	37	c.770	CCDS31519.1	11	.	.	.	.	.	.	.	.	.	.	T	11.43	1.635342	0.29068	.	.	ENSG00000181761	ENST00000313472	T	0.00274	8.35	3.62	3.62	0.41486	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000046	T	0.00328	0.0010	M	0.64170	1.965	0.23693	N	0.99709	P	0.44195	0.828	P	0.48524	0.58	T	0.45323	-0.9269	10	0.59425	D	0.04	.	10.0954	0.42471	0.0:0.0:0.1682:0.8318	.	257	Q8N146	OR8H3_HUMAN	S	257	ENSP00000323928:F257S	ENSP00000323928:F257S	F	+	2	0	OR8H3	55647194	0.004000	0.15560	0.849000	0.33467	0.123000	0.20343	0.809000	0.27168	1.415000	0.47037	0.145000	0.16022	TTT	OR8H3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	ENSG00000181761		0.383	OR8H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8H3	HGNC	protein_coding	OTTHUMT00000391541.1	-	0.00	33	0	T	NM_001005201		55890618	+1	tier1	-	no_errors	ENST00000313472	ensembl	human	known	74_37	missense	25.00	45	15	SNP	0.482	C
ORC3	23595	genome.wustl.edu	37	6	88372833	88372833	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:88372833G>A	ENST00000392844.3	+	17	1852	c.1804G>A	c.(1804-1806)Gca>Aca	p.A602T	ORC3_ENST00000546266.1_Missense_Mutation_p.A459T|ORC3_ENST00000257789.4_Missense_Mutation_p.A603T	NM_012381.3|NM_181837.2	NP_036513.2|NP_862820.1	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3	602					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|neural precursor cell proliferation (GO:0061351)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|origin recognition complex (GO:0000808)	DNA replication origin binding (GO:0003688)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	28						CCTCCATACTGCACTCAACAA	0.443																																																	0													90.0	77.0	81.0					6																	88372833		2203	4300	6503	SO:0001583	missense	0			AF093535	CCDS5012.1, CCDS43486.1, CCDS56440.1	6q	2010-10-12	2010-10-12	2010-10-12	ENSG00000135336	ENSG00000135336			8489	protein-coding gene	gene with protein product		604972	"""origin recognition complex, subunit 3 (yeast homolog)-like"", ""origin recognition complex, subunit 3-like (yeast)"", ""origin recognition complex, subunit 3 honolog (yeast)"""	ORC3L		9829972, 10402192	Standard	NM_181837		Approved	IMAGE50150, LATHEO	uc003pmg.3	Q9UBD5	OTTHUMG00000015179	ENST00000392844.3:c.1804G>A	6.37:g.88372833G>A	ENSP00000376586:p.Ala602Thr		A2A2T5|B4E025|Q13565|Q53GY6|Q5T159|Q6IUY7|Q86TN5|Q9UG44|Q9UNT6	Missense_Mutation	SNP	pfam_ORC3	p.A603T	ENST00000392844.3	37	c.1807	CCDS43486.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.675344	0.96764	.	.	ENSG00000135336	ENST00000392844;ENST00000257789;ENST00000546266	T;T;T	0.18016	2.59;2.59;2.24	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.44582	0.1300	M	0.89601	3.045	0.80722	D	1	D;D;D	0.89917	0.998;1.0;1.0	D;D;D	0.97110	0.934;1.0;1.0	T	0.47586	-0.9106	10	0.45353	T	0.12	0.4143	18.6904	0.91581	0.0:0.0:1.0:0.0	.	540;602;603	B4E014;Q9UBD5;Q9UBD5-2	.;ORC3_HUMAN;.	T	602;603;459	ENSP00000376586:A602T;ENSP00000257789:A603T;ENSP00000444695:A459T	ENSP00000257789:A603T	A	+	1	0	ORC3	88429552	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.267000	0.89874	2.712000	0.92718	0.561000	0.74099	GCA	ORC3	-	NULL	ENSG00000135336		0.443	ORC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ORC3	HGNC	protein_coding	OTTHUMT00000041452.2	-	0.00	51	0	G			88372833	+1	tier1	-	no_errors	ENST00000257789	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	A
PAPPA	5069	genome.wustl.edu	37	9	118950282	118950282	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:118950282A>T	ENST00000328252.3	+	2	1634	c.1265A>T	c.(1264-1266)gAg>gTg	p.E422V	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	422	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						ATTGGGGATGAGAACTGTGAC	0.627																																																	0													70.0	60.0	63.0					9																	118950282		2203	4300	6503	SO:0001583	missense	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1265A>T	9.37:g.118950282A>T	ENSP00000330658:p.Glu422Val		B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl_sf,superfamily_Sushi_SCR_CCP,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.E422V	ENST00000328252.3	37	c.1265	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	A	15.01	2.705615	0.48412	.	.	ENSG00000182752	ENST00000328252	D	0.91686	-2.89	6.17	6.17	0.99709	Notch domain (2);	0.101611	0.64402	D	0.000001	D	0.92890	0.7738	L	0.43152	1.355	0.80722	D	1	D	0.62365	0.991	P	0.60682	0.878	D	0.93010	0.6431	10	0.66056	D	0.02	-28.2076	11.0511	0.47889	0.9315:0.0:0.0685:0.0	.	422	Q13219	PAPP1_HUMAN	V	422	ENSP00000330658:E422V	ENSP00000330658:E422V	E	+	2	0	PAPPA	117990103	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.492000	0.66893	2.371000	0.80710	0.533000	0.62120	GAG	PAPPA	-	pfam_Notch_dom,smart_Notch_dom	ENSG00000182752		0.627	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	-	0.00	19	0	A	NM_002581		118950282	+1	tier1	-	no_errors	ENST00000328252	ensembl	human	known	74_37	missense	31.03	20	9	SNP	1.000	T
PARD3	56288	genome.wustl.edu	37	10	34625164	34625164	+	Silent	SNP	G	G	A	rs374061315		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:34625164G>A	ENST00000374789.3	-	18	2902	c.2577C>T	c.(2575-2577)gaC>gaT	p.D859D	PARD3_ENST00000346874.4_Silent_p.D859D|PARD3_ENST00000374788.3_Silent_p.D856D|PARD3_ENST00000545693.1_Silent_p.D843D|PARD3_ENST00000545260.1_Silent_p.D769D|PARD3_ENST00000350537.4_Silent_p.D813D|PARD3_ENST00000374794.3_Intron|PARD3_ENST00000374790.3_Silent_p.D799D|PARD3_ENST00000374773.1_Silent_p.D826D|PARD3_ENST00000466092.1_5'UTR|PARD3_ENST00000374776.1_Silent_p.D813D|PARD3_ENST00000340077.5_Silent_p.D856D|PARD3_ENST00000544292.1_Silent_p.D572D	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	859	Interacts with PRKCI and PRKCZ. {ECO:0000250}.				apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				GTTTAGTCTCGTCAGCTACTG	0.413																																																	0								G	,,,,,,,,,,	0,4406		0,0,2203	242.0	194.0	211.0		2568,2529,2577,2439,2439,2307,,2568,2475,2439,2577	6.0	1.0	10		211	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,intron,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PARD3	NM_001184785.1,NM_001184786.1,NM_001184787.1,NM_001184788.1,NM_001184789.1,NM_001184790.1,NM_001184791.1,NM_001184792.1,NM_001184793.1,NM_001184794.1,NM_019619.3	,,,,,,,,,,	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,,,,,,,,,,	856/1354,843/1341,859/1320,813/1311,813/1274,769/1267,,856/1032,825/1001,813/989,859/1357	34625164	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	0			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.2577C>T	10.37:g.34625164G>A			F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Silent	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D859	ENST00000374789.3	37	c.2577	CCDS7178.1	10																																																																																			PARD3	-	NULL	ENSG00000148498		0.413	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD3	HGNC	protein_coding	OTTHUMT00000047527.1		0.00	52	0	G	NM_019619		34625164	-1			no_errors	ENST00000374789	ensembl	human	known	74_37	silent	5.56	85	5	SNP	1.000	A
PARP9	83666	genome.wustl.edu	37	3	122274685	122274685	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:122274685C>T	ENST00000360356.2	-	4	665	c.438G>A	c.(436-438)ggG>ggA	p.G146G	PARP9_ENST00000462315.1_Silent_p.G111G|PARP9_ENST00000471785.1_Silent_p.G111G|PARP9_ENST00000492382.1_Intron|PARP9_ENST00000477522.2_Silent_p.G111G	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	146	Macro 1. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		CCAGGCCTCCCCCATGCAGAA	0.488																																																	0													94.0	91.0	92.0					3																	122274685		2203	4300	6503	SO:0001819	synonymous_variant	0			AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.438G>A	3.37:g.122274685C>T			A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Silent	SNP	pfam_Macro_dom,smart_Macro_dom,pfscan_Macro_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.G146	ENST00000360356.2	37	c.438	CCDS3014.1	3																																																																																			PARP9	-	pfam_Macro_dom,smart_Macro_dom,pfscan_Macro_dom	ENSG00000138496		0.488	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARP9	HGNC	protein_coding	OTTHUMT00000355957.1	-	0.00	14	0	C	NM_031458		122274685	-1	tier1	-	no_errors	ENST00000360356	ensembl	human	known	74_37	silent	26.47	25	9	SNP	0.000	T
PAXIP1	22976	genome.wustl.edu	37	7	154760285	154760285	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:154760285C>G	ENST00000404141.1	-	7	1780	c.1626G>C	c.(1624-1626)caG>caC	p.Q542H	PAXIP1_ENST00000473219.1_5'UTR|PAXIP1_ENST00000397192.1_Missense_Mutation_p.Q542H			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	542	Gln-rich.			Missing (in Ref. 4; AAB91434). {ECO:0000305}.	adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)		p.Q508H(1)		NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		gctgctgctgctggtgcatgc	0.627																																																	1	Substitution - Missense(1)	large_intestine(1)											13.0	13.0	13.0					7																	154760285		1934	3626	5560	SO:0001583	missense	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.1626G>C	7.37:g.154760285C>G	ENSP00000384048:p.Gln542His		O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.Q542H	ENST00000404141.1	37	c.1626	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548436	0.27652	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000323199	T;T	0.48201	0.82;0.82	4.96	-3.3	0.05003	.	0.298320	0.23000	N	0.053095	T	0.26593	0.0650	N	0.19112	0.55	0.25352	N	0.988853	B;B;B;B	0.14012	0.001;0.009;0.002;0.001	B;B;B;B	0.12156	0.003;0.007;0.007;0.003	T	0.11991	-1.0565	10	0.45353	T	0.12	-3.9012	9.2332	0.37450	0.0:0.4209:0.4486:0.1305	.	495;451;508;542	B4DEQ6;Q6ZW49-3;Q6ZW49-1;Q6ZW49	.;.;.;PAXI1_HUMAN	H	542;542;495	ENSP00000384048:Q542H;ENSP00000380376:Q542H	ENSP00000319149:Q495H	Q	-	3	2	PAXIP1	154391218	0.712000	0.27916	0.413000	0.26509	0.911000	0.54048	0.051000	0.14141	-0.530000	0.06349	-0.357000	0.07601	CAG	PAXIP1	-	NULL	ENSG00000157212		0.627	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1		0.00	35	0	C	NM_007349		154760285	-1			no_errors	ENST00000397192	ensembl	human	known	74_37	missense	8.57	32	3	SNP	0.930	G
PCDH11X	27328	genome.wustl.edu	37	X	91873794	91873794	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:91873794C>T	ENST00000373094.1	+	7	4744	c.3899C>T	c.(3898-3900)gCa>gTa	p.A1300V	PCDH11X_ENST00000361655.2_Missense_Mutation_p.A1282V|PCDH11X_ENST00000298274.8_Missense_Mutation_p.A1263V|PCDH11X_ENST00000504220.2_3'UTR|PCDH11X_ENST00000406881.1_Missense_Mutation_p.A1292V|PCDH11X_ENST00000373088.1_Missense_Mutation_p.A1263V|PCDH11X_ENST00000373097.1_Missense_Mutation_p.A1290V	NM_032968.3	NP_116750.1	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked	1300					homophilic cell adhesion (GO:0007156)|negative regulation of phosphatase activity (GO:0010923)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(30)|liver(4)|lung(92)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	159						CAAGGTAGTGCAACATCTCAG	0.478													C|||	1	0.000264901	0.0	0.0	3775	,	,		14903	0.001		0.0	False		,,,				2504	0.0				NSCLC(38;925 1092 2571 38200 45895)												0													256.0	225.0	235.0					X																	91873794		2203	4300	6503	SO:0001583	missense	0			AB026187	CCDS14461.1, CCDS14462.1, CCDS55458.1, CCDS55459.1, CCDS55460.1, CCDS55461.1	Xq21.3	2014-06-13	2002-05-22	2002-05-24	ENSG00000102290	ENSG00000102290		"""Cadherins / Protocadherins : Non-clustered"""	8656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 119"""	300246	"""protocadherin 11"""	PCDH11		10644456	Standard	NM_001168360		Approved	PCDH-X, PCDHX, PPP1R119	uc004efm.2	Q9BZA7	OTTHUMG00000021965	ENST00000373094.1:c.3899C>T	X.37:g.91873794C>T	ENSP00000362186:p.Ala1300Val		A6NIQ4|Q2TJH0|Q2TJH1|Q2TJH3|Q5JVZ0|Q70LR8|Q70LS7|Q70LS8|Q70LS9|Q70LT7|Q70LT8|Q70LT9|Q70LU0|Q70LU1|Q96RV4|Q96RW0|Q9BZA6|Q9H4E0|Q9P2M0|Q9P2X5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A1300V	ENST00000373094.1	37	c.3899	CCDS14461.1	X	.	.	.	.	.	.	.	.	.	.	C	12.25	1.880693	0.33255	.	.	ENSG00000102290	ENST00000373094;ENST00000373097;ENST00000373088;ENST00000361655;ENST00000406881;ENST00000356934;ENST00000298274	T;T;T;T;T;T	0.58210	0.38;0.39;0.43;0.35;0.37;0.43	4.58	1.78	0.24846	.	.	.	.	.	T	0.34600	0.0903	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.0	T	0.25293	-1.0136	9	0.66056	D	0.02	.	6.2121	0.20636	0.0:0.6722:0.15:0.1778	.	1263;1282;1292;1290;1300	Q9BZA7-5;Q9BZA7-4;Q9BZA7-8;Q9BZA7-3;Q9BZA7	.;.;.;.;PC11X_HUMAN	V	1300;1290;1263;1282;1292;1300;1263	ENSP00000362186:A1300V;ENSP00000362189:A1290V;ENSP00000362180:A1263V;ENSP00000355105:A1282V;ENSP00000384758:A1292V;ENSP00000298274:A1263V	ENSP00000298274:A1263V	A	+	2	0	PCDH11X	91760450	0.269000	0.24143	0.001000	0.08648	0.143000	0.21401	1.335000	0.33839	-0.048000	0.13401	0.466000	0.42574	GCA	PCDH11X	-	NULL	ENSG00000102290		0.478	PCDH11X-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH11X	HGNC	protein_coding	OTTHUMT00000057436.1	-	0.00	37	0	C	NM_032969		91873794	+1	tier1	-	no_errors	ENST00000373094	ensembl	human	known	74_37	missense	80.49	8	33	SNP	0.000	T
PCDH9	5101	genome.wustl.edu	37	13	67800669	67800669	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr13:67800669C>A	ENST00000377865.2	-	1	2038	c.1904G>T	c.(1903-1905)aGa>aTa	p.R635I	PCDH9_ENST00000544246.1_Missense_Mutation_p.R635I|PCDH9_ENST00000377861.3_Missense_Mutation_p.R635I|PCDH9_ENST00000328454.5_Missense_Mutation_p.R635I|PCDH9_ENST00000456367.1_Missense_Mutation_p.R635I			Q9HC56	PCDH9_HUMAN	protocadherin 9	635	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				forebrain development (GO:0030900)|homophilic cell adhesion (GO:0007156)	cell-cell contact zone (GO:0044291)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(33)|lung(30)|ovary(5)|pancreas(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	103		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		CTGCTGCTCTCTATCAAATGA	0.403																																																	0													108.0	99.0	102.0					13																	67800669		2203	4300	6503	SO:0001583	missense	0			AF169692	CCDS9443.1, CCDS9444.1	13q21.32	2010-02-22			ENSG00000184226	ENSG00000184226		"""Cadherins / Protocadherins : Non-clustered"""	8661	protein-coding gene	gene with protein product		603581				9787079	Standard	NM_020403		Approved		uc001vik.3	Q9HC56	OTTHUMG00000017040	ENST00000377865.2:c.1904G>T	13.37:g.67800669C>A	ENSP00000367096:p.Arg635Ile		A2A6U1|Q5VT83|Q7Z3U0|Q8N3K7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R635I	ENST00000377865.2	37	c.1904	CCDS9444.1	13	.	.	.	.	.	.	.	.	.	.	C	29.4	4.999459	0.93227	.	.	ENSG00000184226	ENST00000544246;ENST00000377865;ENST00000456367;ENST00000328454;ENST00000377861	T;T;T;T;T	0.59906	0.23;0.23;0.23;0.23;0.23	5.4	5.4	0.78164	Cadherin (5);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.81607	0.4858	M	0.90145	3.09	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;0.999;1.0;1.0	D	0.84797	0.0782	10	0.87932	D	0	.	19.3757	0.94508	0.0:1.0:0.0:0.0	.	635;635;635;635	B7ZM79;Q5VT82;Q9HC56-2;Q9HC56	.;.;.;PCDH9_HUMAN	I	635	ENSP00000442186:R635I;ENSP00000367096:R635I;ENSP00000401699:R635I;ENSP00000332060:R635I;ENSP00000367092:R635I	ENSP00000332060:R635I	R	-	2	0	PCDH9	66698670	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	7.651000	0.83577	2.814000	0.96858	0.655000	0.94253	AGA	PCDH9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000184226		0.403	PCDH9-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH9	HGNC	protein_coding	OTTHUMT00000276387.1		0.00	38	0	C	NM_203487		67800669	-1			no_errors	ENST00000377865	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	A
PCDHB3	56132	genome.wustl.edu	37	5	140481002	140481002	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:140481002G>A	ENST00000231130.2	+	1	769	c.769G>A	c.(769-771)Gtt>Att	p.V257I	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	257	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAATACCCCCGTTAACTCTGT	0.423																																																	0													71.0	78.0	76.0					5																	140481002		2203	4300	6503	SO:0001583	missense	0			AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.769G>A	5.37:g.140481002G>A	ENSP00000231130:p.Val257Ile		B2R8P2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V257I	ENST00000231130.2	37	c.769	CCDS4245.1	5	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.838245	0.00573	.	.	ENSG00000113205	ENST00000231130	T	0.52754	0.65	4.93	-9.86	0.00473	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.25457	0.0619	N	0.16201	0.385	0.09310	N	1	B	0.15719	0.014	B	0.18263	0.021	T	0.32348	-0.9910	9	0.25751	T	0.34	.	13.0908	0.59166	0.1246:0.3232:0.5522:0.0	.	257	Q9Y5E6	PCDB3_HUMAN	I	257	ENSP00000231130:V257I	ENSP00000231130:V257I	V	+	1	0	PCDHB3	140461186	0.000000	0.05858	0.000000	0.03702	0.062000	0.15995	-5.542000	0.00114	-2.892000	0.00315	-0.844000	0.03045	GTT	PCDHB3	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000113205		0.423	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB3	HGNC	protein_coding	OTTHUMT00000251817.2	-	0.00	19	0	G	NM_018937		140481002	+1	tier1	-	no_errors	ENST00000231130	ensembl	human	known	74_37	missense	29.41	24	10	SNP	0.000	A
PCDHGB4	8641	genome.wustl.edu	37	5	140767797	140767797	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:140767797T>A	ENST00000519479.1	+	1	346	c.346T>A	c.(346-348)Ttt>Att	p.F116I	PCDHGA7_ENST00000518325.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	116	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCACTGAACTTTTATCACGT	0.478																																																	0													33.0	30.0	31.0					5																	140767797		1803	4045	5848	SO:0001583	missense	0			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.346T>A	5.37:g.140767797T>A	ENSP00000428288:p.Phe116Ile		O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F116I	ENST00000519479.1	37	c.346	CCDS54928.1	5	.	.	.	.	.	.	.	.	.	.	.	8.564	0.878397	0.17395	.	.	ENSG00000253953	ENST00000519479	T	0.37411	1.2	4.95	3.75	0.43078	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.13457	0.0326	N	0.02357	-0.585	0.25955	N	0.9827	B;B	0.14438	0.01;0.001	B;B	0.15484	0.013;0.006	T	0.25117	-1.0141	9	0.06365	T	0.9	.	9.6092	0.39652	0.3986:0.0:0.0:0.6014	.	116;116	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	I	116	ENSP00000428288:F116I	ENSP00000428288:F116I	F	+	1	0	PCDHGB4	140747981	0.000000	0.05858	1.000000	0.80357	0.980000	0.70556	-1.046000	0.03525	0.807000	0.34208	0.529000	0.55759	TTT	PCDHGB4	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253953		0.478	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB4	HGNC	protein_coding	OTTHUMT00000374745.1	-	0.00	17	0	T	NM_003736		140767797	+1	tier1	-	no_errors	ENST00000519479	ensembl	human	known	74_37	missense	25.00	18	6	SNP	0.970	A
PCDHGB4	8641	genome.wustl.edu	37	5	140768512	140768512	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:140768512T>C	ENST00000519479.1	+	1	1061	c.1061T>C	c.(1060-1062)aTt>aCt	p.I354T	PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	354	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCAACCTAATTATGGAGGAC	0.463																																																	0													111.0	104.0	107.0					5																	140768512		1891	4121	6012	SO:0001583	missense	0			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1061T>C	5.37:g.140768512T>C	ENSP00000428288:p.Ile354Thr		O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I354T	ENST00000519479.1	37	c.1061	CCDS54928.1	5	.	.	.	.	.	.	.	.	.	.	.	16.15	3.040699	0.55003	.	.	ENSG00000253953	ENST00000519479	T	0.56776	0.44	5.09	2.63	0.31362	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.75708	0.3886	H	0.95043	3.615	0.09310	N	1	D;D	0.65815	0.995;0.988	D;D	0.64877	0.925;0.93	T	0.64863	-0.6307	9	0.72032	D	0.01	.	6.7934	0.23711	0.1352:0.0747:0.0:0.7901	.	354;354	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	T	354	ENSP00000428288:I354T	ENSP00000428288:I354T	I	+	2	0	PCDHGB4	140748696	0.975000	0.34042	0.001000	0.08648	0.008000	0.06430	7.768000	0.85345	0.337000	0.23665	0.533000	0.62120	ATT	PCDHGB4	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000253953		0.463	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB4	HGNC	protein_coding	OTTHUMT00000374745.1	-	0.00	43	0	T	NM_003736		140768512	+1	tier1	-	no_errors	ENST00000519479	ensembl	human	known	74_37	missense	28.81	42	17	SNP	0.024	C
PCDHGB4	8641	genome.wustl.edu	37	5	140769142	140769142	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:140769142C>T	ENST00000519479.1	+	1	1691	c.1691C>T	c.(1690-1692)gCg>gTg	p.A564V	PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	564					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTACCCCGCGCTGGGTCCC	0.672																																																	0													36.0	46.0	42.0					5																	140769142		2152	4262	6414	SO:0001583	missense	0			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.1691C>T	5.37:g.140769142C>T	ENSP00000428288:p.Ala564Val		O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A564V	ENST00000519479.1	37	c.1691	CCDS54928.1	5	.	.	.	.	.	.	.	.	.	.	.	21.5	4.164576	0.78339	.	.	ENSG00000253953	ENST00000519479	T	0.49432	0.78	5.05	5.05	0.67936	Cadherin-like (1);	.	.	.	.	T	0.41926	0.1180	N	0.02011	-0.69	0.23809	N	0.996783	D;D	0.69078	0.997;0.984	P;P	0.59761	0.863;0.631	T	0.55147	-0.8186	9	0.48119	T	0.1	.	18.4161	0.90571	0.0:1.0:0.0:0.0	.	564;564	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	V	564	ENSP00000428288:A564V	ENSP00000428288:A564V	A	+	2	0	PCDHGB4	140749326	0.000000	0.05858	1.000000	0.80357	0.925000	0.55904	0.583000	0.23849	2.503000	0.84419	0.563000	0.77884	GCG	PCDHGB4	-	superfamily_Cadherin-like	ENSG00000253953		0.672	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB4	HGNC	protein_coding	OTTHUMT00000374745.1	-	0.00	67	0	C	NM_003736		140769142	+1	tier1	-	no_errors	ENST00000519479	ensembl	human	known	74_37	missense	30.26	53	23	SNP	0.997	T
PCDHGC4	56098	genome.wustl.edu	37	5	140864808	140864808	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:140864808A>G	ENST00000306593.1	+	1	68	c.68A>G	c.(67-69)cAc>cGc	p.H23R	PCDHGA9_ENST00000573521.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	23					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTTTTACCACCTGGGTTAC	0.542																																																	0													58.0	63.0	61.0					5																	140864808		2203	4300	6503	SO:0001583	missense	0			AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.68A>G	5.37:g.140864808A>G	ENSP00000306918:p.His23Arg		Q495T2|Q9Y5C3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.H23R	ENST00000306593.1	37	c.68	CCDS4262.1	5	.	.	.	.	.	.	.	.	.	.	A	8.875	0.950272	0.18431	.	.	ENSG00000242419	ENST00000306593	T	0.46451	0.87	4.81	3.66	0.41972	.	.	.	.	.	T	0.17577	0.0422	N	0.02916	-0.46	0.21355	N	0.999719	B;B	0.21225	0.053;0.022	B;B	0.24701	0.055;0.021	T	0.20907	-1.0261	9	0.25106	T	0.35	.	3.8527	0.08962	0.6084:0.0:0.2407:0.1508	.	23;23	Q9Y5F7-2;Q9Y5F7	.;PCDGL_HUMAN	R	23	ENSP00000306918:H23R	ENSP00000306918:H23R	H	+	2	0	PCDHGC4	140844992	0.990000	0.36364	1.000000	0.80357	0.988000	0.76386	0.760000	0.26475	0.875000	0.35847	0.459000	0.35465	CAC	PCDHGC4	-	NULL	ENSG00000242419		0.542	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC4	HGNC	protein_coding	OTTHUMT00000251820.1	-	0.00	39	0	A	NM_018928		140864808	+1	tier1	-	no_errors	ENST00000306593	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.999	G
PDE3A	5139	genome.wustl.edu	37	12	20792793	20792793	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:20792793T>G	ENST00000359062.3	+	10	2193	c.2153T>G	c.(2152-2154)cTt>cGt	p.L718R	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	718					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	TCTTACAGACTTTTTGAAGAC	0.343																																																	0													114.0	108.0	110.0					12																	20792793		2201	4300	6501	SO:0001583	missense	0				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2153T>G	12.37:g.20792793T>G	ENSP00000351957:p.Leu718Arg		O60865|Q13348|Q17RD1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.L718R	ENST00000359062.3	37	c.2153	CCDS31754.1	12	.	.	.	.	.	.	.	.	.	.	T	20.1	3.936357	0.73442	.	.	ENSG00000172572	ENST00000359062	T	0.79940	-1.32	5.03	5.03	0.67393	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.000000	0.85682	D	0.000000	D	0.90428	0.7003	M	0.86343	2.81	0.58432	D	0.999999	D	0.89917	1.0	D	0.80764	0.994	D	0.92175	0.5747	10	0.87932	D	0	.	14.5798	0.68278	0.0:0.0:0.0:1.0	.	718	Q14432	PDE3A_HUMAN	R	718	ENSP00000351957:L718R	ENSP00000351957:L718R	L	+	2	0	PDE3A	20684060	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	7.153000	0.77428	2.113000	0.64589	0.402000	0.26972	CTT	PDE3A	-	NULL	ENSG00000172572		0.343	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE3A	HGNC	protein_coding	OTTHUMT00000401756.2	-	0.00	31	0	T			20792793	+1	tier1	-	no_errors	ENST00000359062	ensembl	human	known	74_37	missense	36.00	32	18	SNP	1.000	G
PDE4A	5141	genome.wustl.edu	37	19	10572336	10572336	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:10572336C>T	ENST00000352831.6	+	12	1710	c.1600C>T	c.(1600-1602)Cgc>Tgc	p.R534C	PDE4A_ENST00000380702.2_Missense_Mutation_p.R512C|PDE4A_ENST00000293683.5_Missense_Mutation_p.R508C|PDE4A_ENST00000592685.1_Missense_Mutation_p.R512C|PDE4A_ENST00000344979.3_Missense_Mutation_p.R295C|PDE4A_ENST00000440014.2_Missense_Mutation_p.R473C	NM_001111307.1	NP_001104777.1	P27815	PDE4A_HUMAN	phosphodiesterase 4A, cAMP-specific	534	Catalytic.				cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Caffeine(DB00201)|Dipyridamole(DB00975)|Drotaverine(DB06751)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theophylline(DB00277)|Tofisopam(DB08811)	GCAGAGCCTACGCAAGATGGT	0.637																																																	0													47.0	46.0	46.0					19																	10572336		2203	4300	6503	SO:0001583	missense	0				CCDS12238.1, CCDS45961.1, CCDS45962.1, CCDS45963.1, CCDS58649.1	19p13.2	2010-06-24	2010-06-24			ENSG00000065989	3.1.4.17	"""Phosphodiesterases"""	8780	protein-coding gene	gene with protein product	"""phosphodiesterase E2 dunce homolog (Drosophila)"""	600126	"""phosphodiesterase 4A, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E2)"""	DPDE2		8009369	Standard	NM_006202		Approved		uc002moj.2	P27815		ENST00000352831.6:c.1600C>T	19.37:g.10572336C>T	ENSP00000270474:p.Arg534Cys		O75522|O76092|Q16255|Q16691|Q5DM53|Q6PMT2|Q8IVA7|Q8WUQ3|Q9H3H2	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.R534C	ENST00000352831.6	37	c.1600	CCDS45961.1	19	.	.	.	.	.	.	.	.	.	.	C	21.4	4.151131	0.78001	.	.	ENSG00000065989	ENST00000380702;ENST00000352831;ENST00000293683;ENST00000440014;ENST00000344979;ENST00000380686	T;T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8;-0.8	3.92	3.92	0.45320	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	D	0.90106	0.6909	H	0.98542	4.26	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.998;1.0;1.0	D	0.91402	0.5144	10	0.87932	D	0	.	8.8009	0.34907	0.2249:0.7751:0.0:0.0	.	200;295;473;508;534	P27815-5;P27815-4;P27815-6;P27815-2;P27815	.;.;.;.;PDE4A_HUMAN	C	512;534;508;473;295;200	ENSP00000370078:R512C;ENSP00000270474:R534C;ENSP00000293683:R508C;ENSP00000394754:R473C;ENSP00000341007:R295C	ENSP00000293683:R508C	R	+	1	0	PDE4A	10433336	0.971000	0.33674	1.000000	0.80357	0.962000	0.63368	0.650000	0.24858	2.032000	0.59987	0.585000	0.79938	CGC	PDE4A	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	ENSG00000065989		0.637	PDE4A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE4A	HGNC	protein_coding	OTTHUMT00000451244.1	-	0.00	51	0	C			10572336	+1	tier1	-	no_errors	ENST00000352831	ensembl	human	known	74_37	missense	45.24	23	19	SNP	1.000	T
PDE4B	5142	genome.wustl.edu	37	1	66821268	66821268	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:66821268A>C	ENST00000329654.4	+	9	993	c.806A>C	c.(805-807)aAc>aCc	p.N269T	PDE4B_ENST00000480109.2_Missense_Mutation_p.N36T|PDE4B_ENST00000423207.2_Missense_Mutation_p.N254T|PDE4B_ENST00000371049.3_Missense_Mutation_p.N269T|PDE4B_ENST00000371045.5_Missense_Mutation_p.N97T	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	269					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	CGATCAGGGAACCAGGTGTCT	0.358																																																	0													69.0	73.0	72.0					1																	66821268		2203	4300	6503	SO:0001583	missense	0			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.806A>C	1.37:g.66821268A>C	ENSP00000332116:p.Asn269Thr		A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.N269T	ENST00000329654.4	37	c.806	CCDS632.1	1	.	.	.	.	.	.	.	.	.	.	A	18.01	3.527013	0.64860	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049;ENST00000423207;ENST00000528771;ENST00000371045;ENST00000531025;ENST00000526197;ENST00000480109	T;T;T;T;T;T;T;T;T	0.71103	-0.54;-0.54;-0.54;-0.54;0.89;-0.21;0.89;0.89;-0.2	6.01	6.01	0.97437	.	0.483859	0.28290	N	0.015900	T	0.61299	0.2336	M	0.78916	2.43	0.80722	D	1	B;B;B;B;B	0.28378	0.019;0.03;0.038;0.017;0.209	B;B;B;B;B	0.20577	0.013;0.03;0.013;0.013;0.022	T	0.63795	-0.6556	10	0.40728	T	0.16	.	16.5205	0.84312	1.0:0.0:0.0:0.0	.	36;254;139;259;269	A5YW33;Q07343-3;Q13945;Q59GM8;Q07343	.;.;.;.;PDE4B_HUMAN	T	269;269;269;254;50;97;50;50;36	ENSP00000332116:N269T;ENSP00000342637:N269T;ENSP00000360088:N269T;ENSP00000392947:N254T;ENSP00000431909:N50T;ENSP00000360084:N97T;ENSP00000437249:N50T;ENSP00000436104:N50T;ENSP00000432592:N36T	ENSP00000332116:N269T	N	+	2	0	PDE4B	66593856	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.313000	0.96297	2.299000	0.77371	0.533000	0.62120	AAC	PDE4B	-	NULL	ENSG00000184588		0.358	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	HGNC	protein_coding	OTTHUMT00000025188.3	-	0.00	67	0	A	NM_002600		66821268	+1	tier1	-	no_errors	ENST00000329654	ensembl	human	known	74_37	missense	32.76	39	19	SNP	1.000	C
JADE3	9767	genome.wustl.edu	37	X	46887392	46887392	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:46887392G>T	ENST00000218343.4	+	6	872	c.574G>T	c.(574-576)Ggg>Tgg	p.G192W	PHF16_ENST00000397189.1_Missense_Mutation_p.G192W	NM_014735.3	NP_055550.1														NS(2)|endometrium(8)|kidney(4)|large_intestine(5)|lung(12)|upper_aerodigestive_tract(2)	33						GACAGAGGAAGGGCTAGGCAT	0.443																																																	0													286.0	198.0	228.0					X																	46887392		2203	4300	6503	SO:0001583	missense	0																														ENST00000218343.4:c.574G>T	X.37:g.46887392G>T	ENSP00000218343:p.Gly192Trp			Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.G192W	ENST00000218343.4	37	c.574	CCDS14271.1	X	.	.	.	.	.	.	.	.	.	.	G	29.3	4.990871	0.93106	.	.	ENSG00000102221	ENST00000397189;ENST00000218343	D;D	0.87412	-2.25;-2.25	5.78	5.78	0.91487	Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.95348	0.8490	M	0.93062	3.375	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96034	0.9019	9	.	.	.	.	18.973	0.92722	0.0:0.0:1.0:0.0	.	192	Q92613	JADE3_HUMAN	W	192	ENSP00000380373:G192W;ENSP00000218343:G192W	.	G	+	1	0	PHF16	46772336	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.732000	0.98816	2.428000	0.82296	0.594000	0.82650	GGG	PHF16	-	superfamily_Znf_FYVE_PHD	ENSG00000102221		0.443	PHF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF16	HGNC	protein_coding	OTTHUMT00000056376.1	-	0.00	38	0	G			46887392	+1	tier1	-	no_errors	ENST00000218343	ensembl	human	known	74_37	missense	5.97	63	4	SNP	1.000	T
PIP5KL1	138429	genome.wustl.edu	37	9	130692076	130692076	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:130692076C>A	ENST00000388747.4	-	2	163	c.119G>T	c.(118-120)cGc>cTc	p.R40L	PIP5KL1_ENST00000300432.3_5'Flank|PIP5KL1_ENST00000490773.1_5'Flank	NM_001135219.1	NP_001128691.1	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	40	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cell projection (GO:0042995)|cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|skin(1)	8						CAGGCCCAGGCGAGACTGCTT	0.662																																																	0													18.0	19.0	19.0					9																	130692076		1551	3541	5092	SO:0001583	missense	0			BC042184	CCDS6885.1, CCDS48030.1	9q34.13	2008-02-05			ENSG00000167103	ENSG00000167103			28711	protein-coding gene	gene with protein product		612865				12477932	Standard	NM_001135219		Approved	bA203J24.5, MGC46424	uc011mao.2	Q5T9C9	OTTHUMG00000020719	ENST00000388747.4:c.119G>T	9.37:g.130692076C>A	ENSP00000373399:p.Arg40Leu		Q8IVS3	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.R40L	ENST00000388747.4	37	c.119	CCDS48030.1	9	.	.	.	.	.	.	.	.	.	.	C	4.384	0.070916	0.08436	.	.	ENSG00000167103	ENST00000388747	T	0.41758	0.99	5.29	4.31	0.51392	Phosphatidylinositol-4-phosphate 5-kinase, core (1);	0.079819	0.47455	D	0.000238	T	0.22126	0.0533	N	0.11064	0.09	0.26889	N	0.967369	B	0.12630	0.006	B	0.12837	0.008	T	0.08576	-1.0715	10	0.27082	T	0.32	-22.3071	9.4764	0.38873	0.265:0.735:0.0:0.0	.	40	Q5T9C9	PI5L1_HUMAN	L	40	ENSP00000373399:R40L	ENSP00000373399:R40L	R	-	2	0	PIP5KL1	129731897	1.000000	0.71417	0.558000	0.28319	0.991000	0.79684	3.702000	0.54800	2.446000	0.82766	0.561000	0.74099	CGC	PIP5KL1	-	NULL	ENSG00000167103		0.662	PIP5KL1-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PIP5KL1	HGNC	protein_coding	OTTHUMT00000054289.2	-	0.00	28	0	C	NM_173492		130692076	-1	tier1	-	no_errors	ENST00000388747	ensembl	human	novel	74_37	missense	36.84	12	7	SNP	0.334	A
PLA2G2E	30814	genome.wustl.edu	37	1	20249236	20249236	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:20249236G>T	ENST00000375116.3	-	2	110	c.53C>A	c.(52-54)aCc>aAc	p.T18N		NM_014589.1	NP_055404.1	Q9NZK7	PA2GE_HUMAN	phospholipase A2, group IIE	18					glycerophospholipid biosynthetic process (GO:0046474)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			breast(1)|endometrium(1)|large_intestine(1)|lung(6)|urinary_tract(1)	10		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.07e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|GBM - Glioblastoma multiforme(114;0.000146)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aminosalicylic Acid(DB00233)	CAGGTTCCCGGTGACCAGAGC	0.597																																																	0													71.0	71.0	71.0					1																	20249236		2203	4300	6503	SO:0001583	missense	0			AF189279	CCDS200.1	1p36.13	2008-09-19			ENSG00000188784	ENSG00000188784	3.1.1.4		13414	protein-coding gene	gene with protein product						10681567, 11922621	Standard	NM_014589		Approved		uc001bct.1	Q9NZK7	OTTHUMG00000002702	ENST00000375116.3:c.53C>A	1.37:g.20249236G>T	ENSP00000364257:p.Thr18Asn		Q5VXJ8	Missense_Mutation	SNP	pfam_PLipase_A2_dom,superfamily_PLipase_A2_dom,smart_PLipase_A2_dom,prints_PLipase_A2	p.T18N	ENST00000375116.3	37	c.53	CCDS200.1	1	.	.	.	.	.	.	.	.	.	.	G	5.781	0.328445	0.10956	.	.	ENSG00000188784	ENST00000375116	T	0.24723	1.84	5.97	0.849	0.18972	.	0.830541	0.11127	N	0.596763	T	0.13157	0.0319	N	0.17474	0.49	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.28235	-1.0050	10	0.87932	D	0	-30.0452	2.0904	0.03655	0.132:0.4982:0.1381:0.2316	.	18	Q9NZK7	PA2GE_HUMAN	N	18	ENSP00000364257:T18N	ENSP00000364257:T18N	T	-	2	0	PLA2G2E	20121823	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	0.064000	0.14437	0.129000	0.18514	-0.165000	0.13383	ACC	PLA2G2E	-	NULL	ENSG00000188784		0.597	PLA2G2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2E	HGNC	protein_coding	OTTHUMT00000007684.1	-	0.00	49	0	G	NM_014589		20249236	-1	tier1	-	no_errors	ENST00000375116	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.000	T
PLEKHH1	57475	genome.wustl.edu	37	14	68045937	68045937	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:68045937G>A	ENST00000329153.5	+	21	3068	c.2936G>A	c.(2935-2937)cGc>cAc	p.R979H	PLEKHH1_ENST00000417684.2_5'UTR	NM_020715.2	NP_065766.1	Q9ULM0	PKHH1_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 1	979	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.					cytoskeleton (GO:0005856)				endometrium(2)|kidney(4)|lung(12)|urinary_tract(1)	19				all cancers(60;0.000771)|OV - Ovarian serous cystadenocarcinoma(108;0.00502)|BRCA - Breast invasive adenocarcinoma(234;0.011)		AGGCCATCGCGCATGGAAGTG	0.602																																																	0													69.0	76.0	74.0					14																	68045937		2109	4218	6327	SO:0001583	missense	0			AB033026	CCDS45128.1	14q24.1	2013-01-10				ENSG00000054690		"""Pleckstrin homology (PH) domain containing"""	17733	protein-coding gene	gene with protein product						10574462	Standard	NM_020715		Approved	KIAA1200	uc001xjl.1	Q9ULM0		ENST00000329153.5:c.2936G>A	14.37:g.68045937G>A	ENSP00000330278:p.Arg979His		A6H8X6|Q6PJL4|Q6ZWC7	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.R979H	ENST00000329153.5	37	c.2936	CCDS45128.1	14	.	.	.	.	.	.	.	.	.	.	G	18.65	3.668723	0.67814	.	.	ENSG00000054690	ENST00000329153	D	0.92249	-3.0	5.27	4.38	0.52667	MyTH4 domain (3);	0.052697	0.85682	N	0.000000	D	0.92325	0.7565	M	0.80422	2.495	0.80722	D	1	B	0.16166	0.016	B	0.27796	0.083	D	0.90932	0.4791	10	0.87932	D	0	.	13.809	0.63250	0.0732:0.0:0.9268:0.0	.	979	Q9ULM0	PKHH1_HUMAN	H	979	ENSP00000330278:R979H	ENSP00000330278:R979H	R	+	2	0	PLEKHH1	67115690	1.000000	0.71417	0.995000	0.50966	0.738000	0.42128	7.432000	0.80349	1.450000	0.47717	0.655000	0.94253	CGC	PLEKHH1	-	pfam_MyTH4_dom,smart_MyTH4_dom,pfscan_MyTH4_dom	ENSG00000054690		0.602	PLEKHH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH1	HGNC	protein_coding	OTTHUMT00000412730.3	-	0.00	73	0	G	XM_031054		68045937	+1	tier1	-	no_errors	ENST00000329153	ensembl	human	known	74_37	missense	6.35	59	4	SNP	0.999	A
PNPLA4	8228	genome.wustl.edu	37	X	7870084	7870084	+	Silent	SNP	C	C	T	rs143864337	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:7870084C>T	ENST00000381042.4	-	6	746	c.576G>A	c.(574-576)ccG>ccA	p.P192P	PNPLA4_ENST00000444736.1_Silent_p.P192P|PNPLA4_ENST00000537427.1_Silent_p.P105P	NM_004650.2	NP_004641.1	P41247	PLPL4_HUMAN	patatin-like phospholipase domain containing 4	192					lipid catabolic process (GO:0016042)		triglyceride lipase activity (GO:0004806)			kidney(1)|large_intestine(3)|lung(2)|prostate(1)	7		Colorectal(8;0.0329)|Medulloblastoma(8;0.232)				CTTTGTCCTGCGGGGAGATGT	0.507													C|||	1	0.000264901	0.0008	0.0	3775	,	,		14267	0.0		0.0	False		,,,				2504	0.0																0								C	,,	16,3819		0,15,1,1617,570	125.0	109.0	115.0		576,315,576	-7.9	0.0	X	dbSNP_134	115	0,6727		0,0,0,2428,1871	no	coding-synonymous,coding-synonymous,coding-synonymous	PNPLA4	NM_001142389.1,NM_001172672.1,NM_004650.2	,,	0,15,1,4045,2441	TT,TC,T,CC,C		0.0,0.4172,0.1515	,,	192/254,105/167,192/254	7870084	16,10546	2203	4299	6502	SO:0001819	synonymous_variant	0			U03886	CCDS14129.1, CCDS55368.1	Xp22.3	2014-03-14			ENSG00000006757	ENSG00000006757	3.1.1.3	"""Patatin-like phospholipase domain containing"""	24887	protein-coding gene	gene with protein product		300102				7806223, 16799181, 19029121	Standard	NM_004650		Approved	DXS1283E, GS2, iPLA2eta	uc011mhr.1	P41247	OTTHUMG00000021103	ENST00000381042.4:c.576G>A	X.37:g.7870084C>T			A8K1H3|B4E362|Q8WW83	Silent	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.P192	ENST00000381042.4	37	c.576	CCDS14129.1	X																																																																																			PNPLA4	-	superfamily_Acyl_Trfase/lysoPLipase	ENSG00000006757		0.507	PNPLA4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PNPLA4	HGNC	protein_coding	OTTHUMT00000055687.1		0.00	35	0	C	NM_004650		7870084	-1			no_errors	ENST00000381042	ensembl	human	known	74_37	silent	5.63	67	4	SNP	0.009	T
POLE	5426	genome.wustl.edu	37	12	133250246	133250246	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:133250246T>A	ENST00000320574.5	-	13	1317	c.1274A>T	c.(1273-1275)aAg>aTg	p.K425M	POLE_ENST00000535270.1_Missense_Mutation_p.K398M	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	425					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GGCGGCCGCCTTGAGATTATG	0.582								DNA polymerases (catalytic subunits)																																									0													159.0	149.0	152.0					12																	133250246		2203	4300	6503	SO:0001583	missense	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.1274A>T	12.37:g.133250246T>A	ENSP00000322570:p.Lys425Met		Q13533|Q86VH9	Missense_Mutation	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.K425M	ENST00000320574.5	37	c.1274	CCDS9278.1	12	.	.	.	.	.	.	.	.	.	.	T	18.35	3.605839	0.66445	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270;ENST00000539006;ENST00000376577;ENST00000535934	T;T;T;T;T	0.47177	4.73;4.73;4.73;0.85;2.8	5.62	5.62	0.85841	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.76205	0.3955	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.82810	-0.0273	10	0.87932	D	0	.	15.8189	0.78626	0.0:0.0:0.0:1.0	.	398;425	F5H1D6;Q07864	.;DPOE1_HUMAN	M	425;436;398;205;360;43	ENSP00000322570:K425M;ENSP00000406383:K436M;ENSP00000445753:K398M;ENSP00000442519:K205M;ENSP00000443213:K43M	ENSP00000322570:K425M	K	-	2	0	POLE	131760319	1.000000	0.71417	1.000000	0.80357	0.100000	0.18952	7.956000	0.87863	2.148000	0.66965	0.254000	0.18369	AAG	POLE	-	pfam_DNA-dir_DNA_pol_B_exonuc,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	ENSG00000177084		0.582	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	-	0.00	53	0	T	NM_006231		133250246	-1	tier1	-	no_errors	ENST00000320574	ensembl	human	known	74_37	missense	26.15	48	17	SNP	1.000	A
POTEE	445582	genome.wustl.edu	37	2	132021429	132021429	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:132021429C>A	ENST00000356920.5	+	15	2495	c.2401C>A	c.(2401-2403)Cac>Aac	p.H801N	PLEKHB2_ENST00000404460.1_Intron|PLEKHB2_ENST00000303908.3_Intron|POTEE_ENST00000358087.5_3'UTR	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	801	Actin-like.				retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											TCCCGAGGAGCACCCCATCCT	0.577																																																	0													72.0	74.0	73.0					2																	132021429		2201	4296	6497	SO:0001583	missense	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.2401C>A	2.37:g.132021429C>A	ENSP00000439189:p.His801Asn		Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	pfam_Actin-related,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-related,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-related	p.H801N	ENST00000356920.5	37	c.2401	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	16.01	3.000238	0.54147	.	.	ENSG00000188219	ENST00000356920	D	0.97529	-4.42	.	.	.	.	.	.	.	.	D	0.96762	0.8943	H	0.95187	3.635	0.80722	D	1	P	0.44241	0.829	B	0.40134	0.32	D	0.94078	0.7341	8	0.72032	D	0.01	.	5.9051	0.18992	0.0:0.9992:0.0:8.0E-4	.	801	Q6S8J3	POTEE_HUMAN	N	801	ENSP00000439189:H801N	ENSP00000439189:H801N	H	+	1	0	AC131180.1	131737899	1.000000	0.71417	0.333000	0.25482	0.338000	0.28826	5.240000	0.65378	0.119000	0.18210	0.121000	0.15741	CAC	POTEE	-	pfam_Actin-related,smart_Actin-related	ENSG00000188219		0.577	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	HGNC	protein_coding			0.00	127	0	C	NM_001083538		132021429	+1			no_errors	ENST00000356920	ensembl	human	known	74_37	missense	11.27	126	16	SNP	1.000	A
PPP1R3C	5507	genome.wustl.edu	37	10	93389701	93389701	+	Silent	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:93389701A>G	ENST00000238994.5	-	2	1021	c.937T>C	c.(937-939)Ttg>Ctg	p.L313L		NM_005398.5	NP_005389.1			protein phosphatase 1, regulatory subunit 3C											breast(1)|endometrium(1)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(1)	12		Colorectal(252;0.235)				TAAGAGGCCAAGTTCTCCATT	0.478																																																	0													87.0	86.0	87.0					10																	93389701		2203	4300	6503	SO:0001819	synonymous_variant	0			Y18207	CCDS7416.1	10q23-q24	2012-04-17	2011-10-04	2001-08-01	ENSG00000119938	ENSG00000119938		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9293	protein-coding gene	gene with protein product	"""Phosphatase 1, regulatory inhibitor subunit 5"", ""protein targeting to glycogen"""	602999	"""protein phosphatase 1, regulatory (inhibitor) subunit 3C"""	PPP1R5		8985175	Standard	NM_005398		Approved	PTG	uc001kho.3	Q9UQK1	OTTHUMG00000018745	ENST00000238994.5:c.937T>C	10.37:g.93389701A>G				Silent	SNP	pfam_CBM_21,pirsf_Pase-1_Glycogen_target-su_met,pfscan_CBM_21	p.L313	ENST00000238994.5	37	c.937	CCDS7416.1	10																																																																																			PPP1R3C	-	pirsf_Pase-1_Glycogen_target-su_met	ENSG00000119938		0.478	PPP1R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3C	HGNC	protein_coding	OTTHUMT00000049372.1	-	0.00	25	0	A	NM_005398		93389701	-1	tier1	-	no_errors	ENST00000238994	ensembl	human	known	74_37	silent	23.21	43	13	SNP	0.997	G
PRCP	5547	genome.wustl.edu	37	11	82595914	82595914	+	Intron	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:82595914C>T	ENST00000313010.3	-	1	363				PRCP_ENST00000393399.2_Missense_Mutation_p.G61E|PRCP_ENST00000535099.1_Intron	NM_005040.2	NP_005031.1	P42785	PCP_HUMAN	prolylcarboxypeptidase (angiotensinase C)						angiogenesis involved in wound healing (GO:0060055)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|energy homeostasis (GO:0097009)|glucose homeostasis (GO:0042593)|negative regulation of systemic arterial blood pressure (GO:0003085)|plasma kallikrein-kinin cascade (GO:0002353)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						gtgcaactgcccagcagcaag	0.378																																																	0													99.0	98.0	98.0					11																	82595914		1838	4105	5943	SO:0001627	intron_variant	0			BC001500, BI827978, L13977	CCDS8262.1, CCDS41695.1	11q14	2005-10-04				ENSG00000137509			9344	protein-coding gene	gene with protein product		176785				8344943	Standard	NM_199418		Approved	PCP, HUMPCP	uc001ozr.3	P42785		ENST00000313010.3:c.168+15362G>A	11.37:g.82595914C>T			A8MU24|B2R7B7|B3KRK5|B5BU34	Missense_Mutation	SNP	pfam_Peptidase_S28	p.G61E	ENST00000313010.3	37	c.182	CCDS8262.1	11	.	.	.	.	.	.	.	.	.	.	C	6.151	0.395984	0.11638	.	.	ENSG00000137509	ENST00000393399	T	0.13657	2.57	3.17	0.136	0.14780	.	.	.	.	.	T	0.11750	0.0286	N	0.08118	0	0.09310	N	1	D	0.64830	0.994	D	0.65010	0.931	T	0.18618	-1.0331	8	.	.	.	.	2.4453	0.04505	0.2364:0.486:0.0:0.2776	.	61	A8MU24	.	E	61	ENSP00000377055:G61E	.	G	-	2	0	PRCP	82273562	0.003000	0.15002	0.000000	0.03702	0.033000	0.12548	0.546000	0.23284	0.029000	0.15352	0.561000	0.74099	GGG	PRCP	-	NULL	ENSG00000137509		0.378	PRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRCP	HGNC	protein_coding	OTTHUMT00000391792.1	-	0.00	19	0	C	NM_005040		82595914	-1	tier1	-	no_errors	ENST00000393399	ensembl	human	known	74_37	missense	25.00	24	8	SNP	0.000	T
PRDM5	11107	genome.wustl.edu	37	4	121698357	121698357	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:121698357A>T	ENST00000264808.3	-	13	1763	c.1523T>A	c.(1522-1524)aTc>aAc	p.I508N	PRDM5_ENST00000428209.2_Missense_Mutation_p.I477N|PRDM5_ENST00000515109.1_Missense_Mutation_p.I477N	NM_018699.2	NP_061169.2	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	508					histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|mitotic cell cycle (GO:0000278)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|repressing transcription factor binding (GO:0070491)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(17)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GTGGCTCCGGATATGAACTCT	0.373																																																	0													145.0	134.0	138.0					4																	121698357		2203	4300	6503	SO:0001583	missense	0			AF272897	CCDS3716.1, CCDS75187.1, CCDS75188.1	4q25-q26	2013-01-08			ENSG00000138738	ENSG00000138738		"""Zinc fingers, C2H2-type"""	9349	protein-coding gene	gene with protein product		614161					Standard	XM_005262706		Approved	PFM2	uc003idn.3	Q9NQX1	OTTHUMG00000132970	ENST00000264808.3:c.1523T>A	4.37:g.121698357A>T	ENSP00000264808:p.Ile508Asn		Q0VAI9|Q0VAJ0|Q6NXQ7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM5,pfscan_SET_dom,pfscan_Znf_C2H2	p.I508N	ENST00000264808.3	37	c.1523	CCDS3716.1	4	.	.	.	.	.	.	.	.	.	.	A	16.84	3.234407	0.58886	.	.	ENSG00000138738	ENST00000264808;ENST00000515109;ENST00000428209	T;T;T	0.29917	2.06;1.55;2.06	5.36	5.36	0.76844	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.049859	0.85682	D	0.000000	T	0.42921	0.1224	L	0.28054	0.825	0.80722	D	1	D;D;D	0.89917	0.996;1.0;0.998	P;D;D	0.72338	0.823;0.977;0.948	T	0.40136	-0.9579	10	0.59425	D	0.04	-16.0273	15.365	0.74513	1.0:0.0:0.0:0.0	.	477;477;508	Q0VAI9;Q9NQX1-2;Q9NQX1	.;.;PRDM5_HUMAN	N	508;477;477	ENSP00000264808:I508N;ENSP00000422309:I477N;ENSP00000404832:I477N	ENSP00000264808:I508N	I	-	2	0	PRDM5	121917807	1.000000	0.71417	0.962000	0.40283	0.958000	0.62258	8.977000	0.93446	2.032000	0.59987	0.533000	0.62120	ATC	PRDM5	-	smart_Znf_C2H2-like,pirsf_Znf_PRDM5,pfscan_Znf_C2H2	ENSG00000138738		0.373	PRDM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM5	HGNC	protein_coding	OTTHUMT00000256528.2	-	0.00	58	0	A			121698357	-1	tier1	-	no_errors	ENST00000264808	ensembl	human	known	74_37	missense	9.09	40	4	SNP	1.000	T
PROSER2	254427	genome.wustl.edu	37	10	11894050	11894050	+	5'UTR	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:11894050C>T	ENST00000277570.5	+	0	128				PROSER2_ENST00000474155.1_3'UTR|PROSER2-AS1_ENST00000445498.1_RNA	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2																		TTCCTGTGATCGAGCCGGCCC	0.582																																																	0													32.0	33.0	33.0					10																	11894050		2203	4300	6503	SO:0001623	5_prime_UTR_variant	0			BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.-27C>T	10.37:g.11894050C>T			D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	RNA	SNP	-	NULL	ENST00000277570.5	37	NULL	CCDS7085.1	10																																																																																			PROSER2	-	-	ENSG00000148426		0.582	PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER2	HGNC	protein_coding	OTTHUMT00000090189.2	-	0.00	18	0	C	NM_153256		11894050	+1	tier1	-	no_errors	ENST00000474155	ensembl	human	known	74_37	rna	28.57	15	6	SNP	0.000	T
PRR15	222171	genome.wustl.edu	37	7	29606312	29606312	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:29606312G>A	ENST00000319694.2	+	2	1079	c.367G>A	c.(367-369)Gac>Aac	p.D123N		NM_175887.2	NP_787083.1	Q8IV56	PRR15_HUMAN	proline rich 15	123					multicellular organismal development (GO:0007275)					endometrium(1)|lung(1)|skin(1)	3						CTTTCCTGGTGACCCCCACGA	0.647																																																	0													6.0	7.0	7.0					7																	29606312		2170	4249	6419	SO:0001583	missense	0			BC029131	CCDS5421.1	7p15.1	2006-08-21			ENSG00000176532	ENSG00000176532			22310	protein-coding gene	gene with protein product						12477932	Standard	NM_175887		Approved		uc003tac.1	Q8IV56	OTTHUMG00000128555	ENST00000319694.2:c.367G>A	7.37:g.29606312G>A	ENSP00000317836:p.Asp123Asn			Missense_Mutation	SNP	NULL	p.D123N	ENST00000319694.2	37	c.367	CCDS5421.1	7	.	.	.	.	.	.	.	.	.	.	G	15.04	2.714749	0.48622	.	.	ENSG00000176532	ENST00000319694	T	0.51325	0.71	5.43	4.54	0.55810	.	0.456035	0.21208	N	0.078344	T	0.40546	0.1121	L	0.57536	1.79	0.21386	N	0.999707	B	0.19073	0.033	B	0.22601	0.04	T	0.32613	-0.9900	10	0.09084	T	0.74	-18.6584	10.4246	0.44369	0.0915:0.0:0.9085:0.0	.	123	Q8IV56	PRR15_HUMAN	N	123	ENSP00000317836:D123N	ENSP00000317836:D123N	D	+	1	0	PRR15	29572837	0.831000	0.29352	0.037000	0.18230	0.156000	0.22039	2.380000	0.44327	1.278000	0.44430	0.491000	0.48974	GAC	PRR15	-	NULL	ENSG00000176532		0.647	PRR15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR15	HGNC	protein_coding	OTTHUMT00000250402.2	-	0.00	72	0	G	NM_175887		29606312	+1	tier1	-	no_errors	ENST00000319694	ensembl	human	known	74_37	missense	15.22	78	14	SNP	0.364	A
PRSS58	136541	genome.wustl.edu	37	7	141955419	141955419	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:141955419A>T	ENST00000552471.1	-	2	434	c.115T>A	c.(115-117)Ttg>Atg	p.L39M	PRSS58_ENST00000547058.2_Missense_Mutation_p.L39M			Q8IYP2	PRS58_HUMAN	protease, serine, 58	39	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	19						GCGCAGGGCAAGTAGTCAGAT	0.473																																																	0													84.0	81.0	82.0					7																	141955419		2203	4300	6503	SO:0001583	missense	0				CCDS5871.1	7q34	2012-10-03			ENSG00000258223	ENSG00000258223	3.4.21.4	"""Serine peptidases / Serine peptidases"""	39125	protein-coding gene	gene with protein product	"""trypsin X3"""						Standard	NM_001001317		Approved	TRYX3	uc003vxc.4	Q8IYP2	OTTHUMG00000158565	ENST00000552471.1:c.115T>A	7.37:g.141955419A>T	ENSP00000446916:p.Leu39Met		B3KVJ6|D3DXD2	Missense_Mutation	SNP	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.L39M	ENST00000552471.1	37	c.115	CCDS5871.1	7	.	.	.	.	.	.	.	.	.	.	A	18.91	3.723499	0.68959	.	.	ENSG00000258223	ENST00000547058;ENST00000552471	D;D	0.82167	-1.58;-1.58	5.0	-4.48	0.03515	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.89093	0.6617	M	0.82923	2.615	0.24003	N	0.996208	D	0.71674	0.998	D	0.68483	0.958	D	0.83531	0.0091	9	0.72032	D	0.01	.	11.2654	0.49108	0.1772:0.138:0.6847:0.0	.	39	Q8IYP2	PRS58_HUMAN	M	39	ENSP00000447588:L39M;ENSP00000446916:L39M	ENSP00000307206:L39M	L	-	1	2	PRSS58	141601896	0.962000	0.33011	0.137000	0.22149	0.399000	0.30720	-0.091000	0.11146	-0.927000	0.03766	0.533000	0.62120	TTG	PRSS58	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000258223		0.473	PRSS58-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRSS58	HGNC	protein_coding	OTTHUMT00000351328.2		0.00	58	0	A	NM_001001317		141955419	-1			no_errors	ENST00000547058	ensembl	human	known	74_37	missense	5.33	71	4	SNP	0.510	T
PRTN3	5657	genome.wustl.edu	37	19	843982	843982	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:843982T>C	ENST00000234347.5	+	3	363	c.317T>C	c.(316-318)tTt>tCt	p.F106S	PRTN3_ENST00000544537.2_Missense_Mutation_p.F65S	NM_002777.3	NP_002768.3	P24158	PRTN3_HUMAN	proteinase 3	106	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				collagen catabolic process (GO:0030574)|mature dendritic cell differentiation (GO:0097029)|negative regulation of phagocytosis (GO:0050765)|positive regulation of cell proliferation (GO:0008284)	cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			lung(1)|ovary(2)|urinary_tract(1)	4		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCAGGTGTTTCTGAACAAC	0.667																																																	0													40.0	41.0	41.0					19																	843982		2201	4298	6499	SO:0001583	missense	0				CCDS32860.1	19p13.3	2008-07-31	2008-07-31			ENSG00000196415			9495	protein-coding gene	gene with protein product	"""myeloblastin"", ""serine proteinase, neutrophil"", ""Wegener granulomatosis autoantigen"""	177020				2258701	Standard	NM_002777		Approved	PR-3, ACPA, C-ANCA, AGP7, MBT, P29	uc002lqa.1	P24158		ENST00000234347.5:c.317T>C	19.37:g.843982T>C	ENSP00000234347:p.Phe106Ser		P15637|P18078|Q4VB08|Q4VB09|Q6LBM7|Q6LBN2|Q9UD25|Q9UQD8	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1,prints_Peptidase_S1A	p.F106S	ENST00000234347.5	37	c.317	CCDS32860.1	19	.	.	.	.	.	.	.	.	.	.	t	10.93	1.490912	0.26774	.	.	ENSG00000196415	ENST00000234347;ENST00000544537	D	0.89050	-2.46	2.73	2.73	0.32206	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.85847	0.5792	L	0.45285	1.41	0.09310	N	1	P	0.47302	0.893	P	0.46510	0.519	T	0.77286	-0.2644	9	0.87932	D	0	.	7.2253	0.26012	0.0:0.0:0.0:1.0	.	106	P24158	PRTN3_HUMAN	S	106;65	ENSP00000234347:F106S	ENSP00000234347:F106S	F	+	2	0	PRTN3	794982	0.039000	0.19947	0.002000	0.10522	0.001000	0.01503	1.831000	0.39141	1.282000	0.44496	0.398000	0.26397	TTT	PRTN3	-	pfam_Peptidase_S1,pfam_Peptidase_S1A_nudel,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000196415		0.667	PRTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTN3	HGNC	protein_coding	OTTHUMT00000457888.2	-	0.00	62	0	T	NM_002777		843982	+1	tier1	-	no_errors	ENST00000234347	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.003	C
PSG6	5675	genome.wustl.edu	37	19	43421932	43421932	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:43421932A>G	ENST00000292125.2	-	1	57	c.13T>C	c.(13-15)Tca>Cca	p.S5P	PSG6_ENST00000402603.4_Missense_Mutation_p.S5P|PSG6_ENST00000601833.1_Intron|PSG6_ENST00000187910.2_Missense_Mutation_p.S5P	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	5					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GGAGGGGCTGAGAGGGGTCCC	0.597																																																	0													138.0	118.0	125.0					19																	43421932		2201	4300	6501	SO:0001583	missense	0				CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.13T>C	19.37:g.43421932A>G	ENSP00000292125:p.Ser5Pro		O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.S5P	ENST00000292125.2	37	c.13	CCDS12613.1	19	.	.	.	.	.	.	.	.	.	.	a	5.971	0.363043	0.11296	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125;ENST00000402456	T;T;T	0.35605	1.3;1.63;1.31	1.47	0.288	0.15719	.	.	.	.	.	T	0.36331	0.0963	M	0.80028	2.48	0.09310	N	1	B;B;B	0.17667	0.003;0.023;0.011	B;B;B	0.21917	0.016;0.037;0.012	T	0.43015	-0.9417	9	0.54805	T	0.06	.	3.4155	0.07375	0.6402:0.0:0.0:0.3598	.	5;5;5	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	P	5	ENSP00000187910:S5P;ENSP00000385736:S5P;ENSP00000292125:S5P	ENSP00000187910:S5P	S	-	1	0	PSG6	48113772	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	0.010000	0.13242	0.023000	0.15187	0.163000	0.16589	TCA	PSG6	-	NULL	ENSG00000170848		0.597	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG6	HGNC	protein_coding	OTTHUMT00000321436.1	-	0.00	114	0	A	NM_002782		43421932	-1	tier1	-	no_errors	ENST00000292125	ensembl	human	known	74_37	missense	23.18	115	35	SNP	0.001	G
PSMC6	5706	genome.wustl.edu	37	14	53194361	53194361	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:53194361C>T	ENST00000606149.1	+	0	1212				STYX_ENST00000354586.4_5'Flank|STYX_ENST00000442123.2_5'Flank|PSMC6_ENST00000557557.1_3'UTR|PSMC6_ENST00000445930.2_3'UTR	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					TTGATGGCTGCATGACAGATG	0.303																																																	0													64.0	67.0	66.0					14																	53194361		2203	4300	6503	SO:0001624	3_prime_UTR_variant	0				CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.*26C>T	14.37:g.53194361C>T			B2R975|P49719|Q6IBU3|Q92524	RNA	SNP	-	NULL	ENST00000606149.1	37	NULL		14																																																																																			PSMC6	-	-	ENSG00000100519		0.303	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	PSMC6	HGNC	protein_coding	OTTHUMT00000470741.1	-	0.00	57	0	C	NM_002806		53194361	+1	tier1	-	no_errors	ENST00000557557	ensembl	human	known	74_37	rna	7.84	47	4	SNP	1.000	T
PTP4A2	8073	genome.wustl.edu	37	1	32385113	32385113	+	5'UTR	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:32385113G>T	ENST00000344035.6	-	0	547				RP11-84A19.4_ENST00000602889.1_lincRNA|PTP4A2_ENST00000356536.3_5'UTR|PTP4A2_ENST00000470404.1_5'Flank|PTP4A2_ENST00000457805.2_5'Flank|PTP4A2_ENST00000526960.1_5'UTR|PTP4A2_ENST00000602725.1_5'Flank	NM_080391.3	NP_536316.1	Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2						peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)				CAGTCTCGGTGTCCAGGAGTC	0.408																																																	0																																										SO:0001623	5_prime_UTR_variant	0			L48723	CCDS348.1, CCDS53292.1, CCDS59193.1	1p35	2011-06-09			ENSG00000184007	ENSG00000184007		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9635	protein-coding gene	gene with protein product		601584		PTP4A		8661118, 9514946	Standard	NM_080391		Approved	HU-PP-1, PTPCAAX2, OV-1, ptp-IV1a, PRL-2	uc001bty.2	Q12974	OTTHUMG00000003801	ENST00000344035.6:c.-447C>A	1.37:g.32385113G>T			A8K9I8|B4DM39|D3DPP0|E9PGJ6|O00649|Q15197|Q15259|Q15260|Q15261|R4GN50	RNA	SNP	-	NULL	ENST00000344035.6	37	NULL	CCDS348.1	1																																																																																			PTP4A2	-	-	ENSG00000184007		0.408	PTP4A2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A2	HGNC	protein_coding		-	0.00	22	0	G	NM_080391		32385113	-1	tier1	-	no_errors	ENST00000494444	ensembl	human	known	74_37	rna	14.29	24	4	SNP	1.000	T
PTPN12	5782	genome.wustl.edu	37	7	77230012	77230012	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:77230012T>C	ENST00000248594.6	+	8	856	c.584T>C	c.(583-585)gTg>gCg	p.V195A	PTPN12_ENST00000415482.2_Missense_Mutation_p.V76A|PTPN12_ENST00000435495.2_Missense_Mutation_p.V65A	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	195	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						TTTCATTATGTGAACTGGCCA	0.338																																																	0													109.0	92.0	98.0					7																	77230012		2203	4299	6502	SO:0001583	missense	0				CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.584T>C	7.37:g.77230012T>C	ENSP00000248594:p.Val195Ala		A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Ptpn_12,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.V195A	ENST00000248594.6	37	c.584	CCDS5592.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	24.0|24.0	4.484423|4.484423	0.84854|0.84854	.|.	.|.	ENSG00000127947|ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000543073;ENST00000435495;ENST00000418110|ENST00000522115	T;D;D;T|.	0.82803|.	2.78;-1.65;-1.65;2.57|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Protein-tyrosine phosphatase, receptor/non-receptor type (4);|.	0.122893|.	0.53938|.	D|.	0.000043|.	T|.	0.72669|.	0.3489|.	M|M	0.66439|0.66439	2.03|2.03	0.44330|0.44330	D|D	0.997216|0.997216	D|.	0.67145|.	0.996|.	D|.	0.67382|.	0.951|.	T|.	0.72316|.	-0.4330|.	10|.	0.21540|.	T|.	0.41|.	.|.	15.6184|15.6184	0.76787|0.76787	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	195|.	Q05209|.	PTN12_HUMAN|.	A|R	195;76;76;65;76|134	ENSP00000248594:V195A;ENSP00000392429:V76A;ENSP00000397991:V65A;ENSP00000392526:V76A|.	ENSP00000248594:V195A|.	V|X	+|+	2|1	0|0	PTPN12|PTPN12	77067948|77067948	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.243000|6.243000	0.72384|0.72384	2.090000|2.090000	0.63153|0.63153	0.455000|0.455000	0.32223|0.32223	GTG|TGA	PTPN12	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Ptpn_12,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	ENSG00000127947		0.338	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN12	HGNC	protein_coding	OTTHUMT00000253183.3		0.00	26	0	T			77230012	+1			no_errors	ENST00000248594	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	C
PWAR6	100506965	genome.wustl.edu	37	15	25277916	25277916	+	lincRNA	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:25277916T>G	ENST00000552334.1	+	0	897				RP11-701H24.10_ENST00000552781.1_RNA|RP11-701H24.3_ENST00000546615.1_lincRNA					Prader Willi/Angelman region RNA 6																		tcctccagtgttggcttgctt	0.413																																																	0																																												0			BC043194, AK096584		15q11.2	2014-03-28	2013-09-11		ENSG00000257151	ENSG00000257151		"""Long non-coding RNAs"""	49129	non-coding RNA	RNA, long non-coding							Standard			Approved	HBT8, PAR-6			OTTHUMG00000170276		15.37:g.25277916T>G				RNA	SNP	-	NULL	ENST00000552334.1	37	NULL		15																																																																																			PWAR6	-	-	ENSG00000257151		0.413	PWAR6-001	KNOWN	basic	lincRNA	PWAR6	HGNC	lincRNA	OTTHUMT00000408286.1		0.00	11	0	T			25277916	+1			no_errors	ENST00000552334	ensembl	human	known	74_37	rna	16.00	21	4	SNP	0.001	G
PTPN9	5780	genome.wustl.edu	37	15	75798100	75798100	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:75798100A>G	ENST00000306726.2	-	7	1396	c.884T>C	c.(883-885)gTt>gCt	p.V295A	PTPN9_ENST00000564970.1_5'UTR	NM_002833.2	NP_002824.1	P43378	PTN9_HUMAN	protein tyrosine phosphatase, non-receptor type 9	295					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						CCTGGCATTAACATAGTCCAC	0.463																																																	0													171.0	149.0	156.0					15																	75798100		2197	4294	6491	SO:0001583	missense	0				CCDS10280.1	15q23	2011-06-09			ENSG00000169410	ENSG00000169410		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9661	protein-coding gene	gene with protein product		600768				1557404	Standard	NM_002833		Approved	MEG2	uc002bal.3	P43378	OTTHUMG00000142838	ENST00000306726.2:c.884T>C	15.37:g.75798100A>G	ENSP00000303554:p.Val295Ala		Q53XR9	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_CRAL-TRIO_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_CRAL-bd_toc_tran	p.V295A	ENST00000306726.2	37	c.884	CCDS10280.1	15	.	.	.	.	.	.	.	.	.	.	A	20.6	4.015421	0.75161	.	.	ENSG00000169410	ENST00000306726;ENST00000544966	T	0.13420	2.59	5.65	4.5	0.54988	.	0.359640	0.29321	N	0.012483	T	0.16727	0.0402	L	0.55213	1.73	0.50632	D	0.999885	P	0.36495	0.556	B	0.38880	0.284	T	0.01312	-1.1388	10	0.87932	D	0	.	11.2461	0.48998	0.863:0.0:0.0:0.137	.	295	P43378	PTN9_HUMAN	A	295;285	ENSP00000303554:V295A	ENSP00000303554:V295A	V	-	2	0	PTPN9	73585155	1.000000	0.71417	0.943000	0.38184	0.881000	0.50899	8.568000	0.90741	0.931000	0.37242	0.533000	0.62120	GTT	PTPN9	-	NULL	ENSG00000169410		0.463	PTPN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN9	HGNC	protein_coding	OTTHUMT00000286474.1	-	0.00	63	0	A			75798100	-1	tier1	-	no_errors	ENST00000306726	ensembl	human	known	74_37	missense	45.95	59	51	SNP	0.990	G
RAB40C	57799	genome.wustl.edu	37	16	676076	676076	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:676076G>A	ENST00000248139.3	+	5	723	c.520G>A	c.(520-522)Gtg>Atg	p.V174M	RAB40C_ENST00000538492.1_Missense_Mutation_p.V174M|RAB40C_ENST00000539661.1_Missense_Mutation_p.V174M|RAB40C_ENST00000535977.1_Missense_Mutation_p.V174M	NM_021168.4	NP_066991.3	Q96S21	RB40C_HUMAN	RAB40C, member RAS oncogene family	174					protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|small GTPase mediated signal transduction (GO:0007264)	perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	6		Hepatocellular(780;0.0218)				ATCCCGCATCGTGCTCATGCG	0.642																																					Melanoma(123;1631 1690 28262 44104 44957)												0													96.0	83.0	87.0					16																	676076		2201	4300	6501	SO:0001583	missense	0			Z84779	CCDS10413.1	16p13.3	2008-07-28	2003-10-14		ENSG00000197562	ENSG00000197562		"""RAB, member RAS oncogene"""	18285	protein-coding gene	gene with protein product			"""RAS-like, family 8, member C"""	RASL8C		11697911, 18485483	Standard	NM_021168		Approved	RARL	uc021szv.1	Q96S21	OTTHUMG00000047854	ENST00000248139.3:c.520G>A	16.37:g.676076G>A	ENSP00000248139:p.Val174Met		A2IDE2|D3DU54|O60795|Q4TT41|Q5PXE8|Q6PIU5	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_SOCS_C,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,smart_SOCS_C,pfscan_SOCS_C,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.V174M	ENST00000248139.3	37	c.520	CCDS10413.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.214224	0.95104	.	.	ENSG00000197562	ENST00000535977;ENST00000539661;ENST00000538492;ENST00000248139	T;T;T;T	0.80909	-1.43;-1.43;-1.43;-1.43	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	D	0.85204	0.5643	L	0.33624	1.015	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.95	D	0.87061	0.2153	10	0.87932	D	0	.	17.7582	0.88456	0.0:0.0:1.0:0.0	.	174;155	Q96S21;Q5PXE8	RB40C_HUMAN;.	M	174	ENSP00000438492:V174M;ENSP00000445050:V174M;ENSP00000438382:V174M;ENSP00000248139:V174M	ENSP00000248139:V174M	V	+	1	0	RAB40C	616077	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.747000	0.98863	2.438000	0.82558	0.561000	0.74099	GTG	RAB40C	-	pfam_Small_GTPase,superfamily_P-loop_NTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase	ENSG00000197562		0.642	RAB40C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB40C	HGNC	protein_coding	OTTHUMT00000109079.4		0.00	28	0	G	NM_021168		676076	+1			no_errors	ENST00000248139	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	A
RALYL	138046	genome.wustl.edu	37	8	85799845	85799845	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:85799845A>G	ENST00000521268.1	+	8	1797	c.692A>G	c.(691-693)cAg>cGg	p.Q231R	RALYL_ENST00000521376.1_Intron|RALYL_ENST00000517638.1_Missense_Mutation_p.Q244R|RALYL_ENST00000523850.1_Missense_Mutation_p.Q158R|RALYL_ENST00000518566.1_Missense_Mutation_p.Q220R|RALYL_ENST00000522455.1_Missense_Mutation_p.Q231R|RALYL_ENST00000521695.1_Missense_Mutation_p.Q231R	NM_173848.5	NP_776247.3	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like	231							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)	24						CCAGAAGCTCAGAAGAAGCAA	0.478																																																	0													98.0	94.0	95.0					8																	85799845		1884	4109	5993	SO:0001583	missense	0				CCDS55252.1, CCDS55253.1, CCDS75760.1, CCDS75761.1	8q21.2	2013-07-16			ENSG00000184672	ENSG00000184672		"""RNA binding motif (RRM) containing"""	27036	protein-coding gene	gene with protein product		614648				12688537	Standard	NM_001100391		Approved	HNRPCL3	uc003yct.4	Q86SE5	OTTHUMG00000164628	ENST00000521268.1:c.692A>G	8.37:g.85799845A>G	ENSP00000430367:p.Gln231Arg		B3KTH2|G3V129|Q6ZW87|Q8N1C2	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.Q231R	ENST00000521268.1	37	c.692	CCDS55253.1	8	.	.	.	.	.	.	.	.	.	.	A	16.60	3.168138	0.57476	.	.	ENSG00000184672	ENST00000522455;ENST00000521695;ENST00000521268;ENST00000518566;ENST00000517638;ENST00000523850	T;T;T;T;T;T	0.14391	2.89;2.89;2.89;2.9;2.89;2.51	5.34	5.34	0.76211	.	0.575016	0.17590	N	0.168817	T	0.26810	0.0656	L	0.51422	1.61	0.80722	D	1	B;D;B;B	0.56968	0.006;0.978;0.144;0.006	B;P;B;B	0.56788	0.003;0.806;0.087;0.006	T	0.00632	-1.1635	10	0.33141	T	0.24	-10.5285	15.609	0.76699	1.0:0.0:0.0:0.0	.	220;158;244;231	B3KT61;Q86SE5-2;G3V129;Q86SE5	.;.;.;RALYL_HUMAN	R	231;231;231;220;244;158	ENSP00000430394:Q231R;ENSP00000428667:Q231R;ENSP00000430367:Q231R;ENSP00000430065:Q220R;ENSP00000430128:Q244R;ENSP00000428807:Q158R	ENSP00000430128:Q244R	Q	+	2	0	RALYL	85962400	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.361000	0.73070	2.151000	0.67156	0.459000	0.35465	CAG	RALYL	-	pirsf_hnRNP_C_Raly	ENSG00000184672		0.478	RALYL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALYL	HGNC	protein_coding	OTTHUMT00000379448.1	-	0.00	43	0	A			85799845	+1	tier1	-	no_errors	ENST00000521268	ensembl	human	known	74_37	missense	19.05	51	12	SNP	1.000	G
RASGEF1B	153020	genome.wustl.edu	37	4	82368696	82368696	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:82368696G>A	ENST00000264400.2	-	6	842	c.691C>T	c.(691-693)Cag>Tag	p.Q231*	RASGEF1B_ENST00000509081.1_Nonsense_Mutation_p.Q230*|RASGEF1B_ENST00000335927.7_Nonsense_Mutation_p.Q189*	NM_152545.1	NP_689758.1	Q0VAM2	RGF1B_HUMAN	RasGEF domain family, member 1B	231	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				positive regulation of Ras GTPase activity (GO:0032320)|small GTPase mediated signal transduction (GO:0007264)	endosome (GO:0005768)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			endometrium(2)|kidney(5)|large_intestine(4)|lung(13)|prostate(1)|skin(1)	26						ACGAACGCCTGAACAAATTCT	0.403																																																	0													82.0	77.0	79.0					4																	82368696		2203	4300	6503	SO:0001587	stop_gained	0			AK056257	CCDS34022.1, CCDS75151.1, CCDS75152.1	4q21.21	2013-09-24				ENSG00000138670			24881	protein-coding gene	gene with protein product		614532				12488504	Standard	XM_005262776		Approved	GPIG4, FLJ31695	uc003hmi.1	Q0VAM2		ENST00000264400.2:c.691C>T	4.37:g.82368696G>A	ENSP00000264400:p.Gln231*		Q0VAM1|Q4W5L7|Q4W5M3|Q96MY8	Nonsense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.Q231*	ENST00000264400.2	37	c.691	CCDS34022.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.586909	0.96578	.	.	ENSG00000138670	ENST00000509081;ENST00000264400;ENST00000335927;ENST00000504863	.	.	.	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	18.107	0.89523	0.0:0.0:1.0:0.0	.	.	.	.	X	230;231;189;76	.	ENSP00000264400:Q231X	Q	-	1	0	RASGEF1B	82587720	1.000000	0.71417	1.000000	0.80357	0.584000	0.36387	9.157000	0.94714	2.606000	0.88127	0.655000	0.94253	CAG	RASGEF1B	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000138670		0.403	RASGEF1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASGEF1B	HGNC	protein_coding	OTTHUMT00000362830.1		0.00	56	0	G	NM_152545		82368696	-1			no_errors	ENST00000264400	ensembl	human	known	74_37	nonsense	7.55	49	4	SNP	1.000	A
RAPGEF2	9693	genome.wustl.edu	37	4	160265191	160265191	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:160265191G>A	ENST00000264431.4	+	17	3194	c.2775G>A	c.(2773-2775)aaG>aaA	p.K925K		NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	925	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		CTTACAGGAAGAAGAAATGGC	0.433																																																	0													151.0	141.0	144.0					4																	160265191		1902	4122	6024	SO:0001819	synonymous_variant	0			AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.2775G>A	4.37:g.160265191G>A			D3DP27	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-assoc,pfam_Ras-like_Gua-exchang_fac_N,pfam_PDZ,pfam_cNMP-bd_dom,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.K925	ENST00000264431.4	37	c.2775	CCDS43277.1	4																																																																																			RAPGEF2	-	superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000109756		0.433	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPGEF2	HGNC	protein_coding	OTTHUMT00000364980.2	-	0.00	64	0	G	NM_014247		160265191	+1	tier1	-	no_errors	ENST00000264431	ensembl	human	known	74_37	silent	36.84	36	21	SNP	1.000	A
RBMXL3	139804	genome.wustl.edu	37	X	114425637	114425637	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:114425637C>T	ENST00000424776.3	+	1	1675	c.1633C>T	c.(1633-1635)Cac>Tac	p.H545Y	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	545	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CGGCCAGAGCCACCGCTATGG	0.657																																																	0													34.0	39.0	37.0					X																	114425637		692	1591	2283	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1633C>T	X.37:g.114425637C>T	ENSP00000417451:p.His545Tyr		B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H545Y	ENST00000424776.3	37	c.1633	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	C	9.486	1.099520	0.20552	.	.	ENSG00000175718	ENST00000424776	T	0.04970	3.52	0.862	-1.72	0.08107	.	.	.	.	.	T	0.03178	0.0093	N	0.08118	0	0.21184	N	0.999764	B	0.30211	0.273	B	0.32762	0.152	T	0.43798	-0.9369	9	0.87932	D	0	.	3.6522	0.08208	0.0:0.5052:0.4948:0.0	.	545	Q8N7X1	RMXL3_HUMAN	Y	545	ENSP00000417451:H545Y	ENSP00000417451:H545Y	H	+	1	0	RBMXL3	114331893	0.001000	0.12720	0.040000	0.18447	0.040000	0.13550	0.344000	0.19962	0.122000	0.18314	0.124000	0.15798	CAC	RBMXL3	-	NULL	ENSG00000175718		0.657	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	-	0.00	106	0	C	NM_001145346		114425637	+1	tier1	-	no_errors	ENST00000424776	ensembl	human	known	74_37	missense	42.76	87	65	SNP	0.844	T
RDX	5962	genome.wustl.edu	37	11	110106906	110106906	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:110106906A>C	ENST00000343115.4	-	12	1581	c.1262T>G	c.(1261-1263)cTt>cGt	p.L421R	RDX_ENST00000544551.1_Missense_Mutation_p.L285R|RDX_ENST00000528900.1_Missense_Mutation_p.L74R|RDX_ENST00000530301.1_Intron|RDX_ENST00000405097.1_Missense_Mutation_p.L421R|RDX_ENST00000528498.1_Missense_Mutation_p.L421R	NM_001260494.1|NM_002906.3	NP_001247423.1|NP_002897.1	P35241	RADI_HUMAN	radixin	421	Glu-rich.				actin filament capping (GO:0051693)|apical protein localization (GO:0045176)|establishment of endothelial barrier (GO:0061028)|microvillus assembly (GO:0030033)|positive regulation of gene expression (GO:0010628)	apical part of cell (GO:0045177)|cell tip (GO:0051286)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|stereocilium (GO:0032420)|T-tubule (GO:0030315)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	18		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		GAATTCAGCAAGTTCTGCTGC	0.328																																					Esophageal Squamous(55;25 1062 11040 28755 44273)												0													103.0	94.0	97.0					11																	110106906		2201	4298	6499	SO:0001583	missense	0			BC020751	CCDS8343.1, CCDS58171.1, CCDS58172.1, CCDS58173.1, CCDS58174.1	11q23	2008-03-17				ENSG00000137710			9944	protein-coding gene	gene with protein product		179410	"""deafness, autosomal recessive 24"""	DFNB24		8486357, 17226784	Standard	NM_001260492		Approved		uc031qdy.1	P35241		ENST00000343115.4:c.1262T>G	11.37:g.110106906A>C	ENSP00000342830:p.Leu421Arg		A7YIJ8|A7YIK0|A7YIK3|B7Z9U6|F5H1A7|Q86Y61	Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C_dom,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin_tail,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Band_41_domain,prints_Ez/rad/moesin_like,prints_Band_41_fam,pfscan_FERM_domain	p.L421R	ENST00000343115.4	37	c.1262	CCDS8343.1	11	.	.	.	.	.	.	.	.	.	.	A	19.56	3.850930	0.71719	.	.	ENSG00000137710	ENST00000528498;ENST00000405097;ENST00000528900;ENST00000343115;ENST00000544551;ENST00000530085	D;D;D;D;D;D	0.82984	-1.67;-1.67;-1.67;-1.67;-1.67;-1.67	6.08	6.08	0.98989	Ezrin/radixin/moesin, C-terminal (1);	0.000000	0.64402	D	0.000003	D	0.90497	0.7023	M	0.82056	2.57	0.80722	D	1	D;D;D;P	0.59767	0.986;0.957;0.979;0.933	D;P;D;P	0.67103	0.94;0.782;0.949;0.889	D	0.88716	0.3226	10	0.24483	T	0.36	.	16.6512	0.85203	1.0:0.0:0.0:0.0	.	285;421;421;74	F5H1A7;A7YIJ8;P35241;A7YIK3	.;.;RADI_HUMAN;.	R	421;421;74;421;285;91	ENSP00000432112:L421R;ENSP00000384136:L421R;ENSP00000433580:L74R;ENSP00000342830:L421R;ENSP00000445826:L285R;ENSP00000434788:L91R	ENSP00000342830:L421R	L	-	2	0	RDX	109612116	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.287000	0.95975	2.333000	0.79357	0.482000	0.46254	CTT	RDX	-	pirsf_ERM,pfam_ERM_C_dom	ENSG00000137710		0.328	RDX-001	KNOWN	basic|CCDS	protein_coding	RDX	HGNC	protein_coding	OTTHUMT00000390535.2	-	0.00	45	0	A	NM_002906		110106906	-1	tier1	-	no_errors	ENST00000530749	ensembl	human	known	74_37	missense	34.69	32	17	SNP	1.000	C
RELN	5649	genome.wustl.edu	37	7	103191675	103191675	+	Missense_Mutation	SNP	G	G	T	rs79161241	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:103191675G>T	ENST00000428762.1	-	41	6300	c.6141C>A	c.(6139-6141)ttC>ttA	p.F2047L	RELN_ENST00000424685.2_Missense_Mutation_p.F2047L|RELN_ENST00000343529.5_Missense_Mutation_p.F2047L	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2047					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		AGGTCGCCCCGAAGTCCCTTG	0.532																																					NSCLC(146;835 1944 15585 22231 52158)												0													67.0	55.0	59.0					7																	103191675		2203	4300	6503	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6141C>A	7.37:g.103191675G>T	ENSP00000392423:p.Phe2047Leu		A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Sialidases,superfamily_Growth_fac_rcpt_N_dom,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.F2047L	ENST00000428762.1	37	c.6141	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	G	9.019	0.984464	0.18889	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.21191	2.02;2.02;2.02	5.96	-11.9	0.00025	Neuraminidase (1);	0.098697	0.64402	D	0.000001	T	0.16342	0.0393	L	0.46741	1.465	0.26567	N	0.973629	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.0	T	0.36866	-0.9730	10	0.34782	T	0.22	.	22.3012	0.99969	0.2353:0.0769:0.6878:0.0	.	2047;2047	P78509-2;P78509	.;RELN_HUMAN	L	2047	ENSP00000392423:F2047L;ENSP00000345694:F2047L;ENSP00000388446:F2047L	ENSP00000345694:F2047L	F	-	3	2	RELN	102978911	0.037000	0.19845	0.013000	0.15412	0.970000	0.65996	-0.583000	0.05807	-3.877000	0.00096	-0.827000	0.03088	TTC	RELN	-	pfam_BNR_rpt,superfamily_Sialidases	ENSG00000189056		0.532	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1		0.00	38	0	G	NM_005045		103191675	-1			no_errors	ENST00000424685	ensembl	human	known	74_37	missense	7.69	36	3	SNP	0.002	T
REV3L	5980	genome.wustl.edu	37	6	111696316	111696316	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:111696316G>A	ENST00000358835.3	-	14	3696	c.3242C>T	c.(3241-3243)tCa>tTa	p.S1081L	REV3L_ENST00000435970.1_Missense_Mutation_p.S1003L|REV3L_ENST00000368805.1_Missense_Mutation_p.S1081L|REV3L_ENST00000368802.3_Missense_Mutation_p.S1081L			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1081					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AATAGCATGTGACCGTTTTTT	0.323								DNA polymerases (catalytic subunits)																																									0													110.0	106.0	108.0					6																	111696316		2203	4300	6503	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.3242C>T	6.37:g.111696316G>A	ENSP00000351697:p.Ser1081Leu		O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.S1081L	ENST00000358835.3	37	c.3242	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	G	12.08	1.830770	0.32329	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01495	4.93;4.93;4.93;4.83	5.53	5.53	0.82687	Ribonuclease H-like (1);	0.453363	0.22104	N	0.064576	T	0.00875	0.0029	L	0.36672	1.1	0.25105	N	0.990758	B	0.20887	0.049	B	0.14023	0.01	T	0.44697	-0.9311	10	0.56958	D	0.05	.	12.7501	0.57304	0.0753:0.0:0.9247:0.0	.	1081	O60673	DPOLZ_HUMAN	L	1081;1081;1081;1003	ENSP00000357792:S1081L;ENSP00000357795:S1081L;ENSP00000351697:S1081L;ENSP00000402003:S1003L	ENSP00000351697:S1081L	S	-	2	0	REV3L	111803009	1.000000	0.71417	0.986000	0.45419	0.995000	0.86356	5.070000	0.64376	2.584000	0.87258	0.585000	0.79938	TCA	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.323	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	-	0.00	38	0	G	NM_002912		111696316	-1	tier1	-	no_errors	ENST00000358835	ensembl	human	known	74_37	missense	40.00	15	10	SNP	0.863	A
RHPN2	85415	genome.wustl.edu	37	19	33486951	33486951	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:33486951G>A	ENST00000254260.3	-	11	1436	c.1401C>T	c.(1399-1401)atC>atT	p.I467I	RHPN2_ENST00000400226.4_Silent_p.I316I	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	467					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TGGGGGCGTCGATCAGGTTCA	0.622																																																	0													84.0	65.0	72.0					19																	33486951		2203	4300	6503	SO:0001819	synonymous_variant	0			AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1401C>T	19.37:g.33486951G>A			B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Silent	SNP	pfam_BRO1_dom,pfam_HR1_rho-bd,superfamily_HR1_rho-bd,superfamily_PDZ,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom	p.I467	ENST00000254260.3	37	c.1401	CCDS12427.1	19																																																																																			RHPN2	-	pfam_BRO1_dom	ENSG00000131941		0.622	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN2	HGNC	protein_coding	OTTHUMT00000450828.2	-	0.00	84	0	G	NM_033103		33486951	-1	tier1	-	no_errors	ENST00000254260	ensembl	human	known	74_37	silent	31.71	56	26	SNP	0.000	A
RNF133	168433	genome.wustl.edu	37	7	122338319	122338319	+	Silent	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:122338319A>G	ENST00000340112.2	-	1	891	c.654T>C	c.(652-654)atT>atC	p.I218I	CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000334010.7_Intron|CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000412584.2_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	218					protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						TCCGGTTCTGAATCCTTGCTA	0.378																																					Colon(198;1778 2057 7449 19869 45985)												0													105.0	100.0	102.0					7																	122338319		2203	4300	6503	SO:0001819	synonymous_variant	0			AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.654T>C	7.37:g.122338319A>G			A4D0W2|Q8N7G7	Silent	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I218	ENST00000340112.2	37	c.654	CCDS5784.1	7																																																																																			RNF133	-	NULL	ENSG00000188050		0.378	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF133	HGNC	protein_coding	OTTHUMT00000347413.1	-	0.00	56	0	A	NM_139175		122338319	-1	tier1	-	no_errors	ENST00000340112	ensembl	human	known	74_37	silent	65.52	20	38	SNP	0.842	G
RNF180	285671	genome.wustl.edu	37	5	63621154	63621154	+	Silent	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:63621154T>C	ENST00000389100.4	+	6	1441	c.1369T>C	c.(1369-1371)Tta>Cta	p.L457L		NM_001113561.1	NP_001107033.1	Q86T96	RN180_HUMAN	ring finger protein 180	457	Interaction with ZIC2. {ECO:0000250}.				adult behavior (GO:0030534)|norepinephrine metabolic process (GO:0042415)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|regulation of catalytic activity (GO:0050790)|serotonin metabolic process (GO:0042428)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	20		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		TGAGCCCTGCTTACGGACTCT	0.433																																																	0													259.0	210.0	225.0					5																	63621154		692	1591	2283	SO:0001819	synonymous_variant	0			AK090756	CCDS34169.1, CCDS47219.1	5q12.3	2013-01-09			ENSG00000164197	ENSG00000164197		"""RING-type (C3HC4) zinc fingers"""	27752	protein-coding gene	gene with protein product							Standard	NM_178532		Approved		uc003jti.3	Q86T96	OTTHUMG00000162278	ENST00000389100.4:c.1369T>C	5.37:g.63621154T>C			Q0JSU3|Q495A8|Q8NBD1	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L457	ENST00000389100.4	37	c.1369	CCDS47219.1	5																																																																																			RNF180	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000164197		0.433	RNF180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF180	HGNC	protein_coding	OTTHUMT00000368394.1	-	0.00	61	0	T	NM_178532		63621154	+1	tier1	-	no_errors	ENST00000389100	ensembl	human	known	74_37	silent	29.17	68	28	SNP	0.998	C
ROBO3	64221	genome.wustl.edu	37	11	124735606	124735606	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:124735606C>T	ENST00000397801.1	+	1	325	c.133C>T	c.(133-135)Ctg>Ttg	p.L45L	ROBO3_ENST00000538940.1_5'Flank	NM_022370.3	NP_071765.2	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3 (Drosophila)	45					axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|neuron migration (GO:0001764)	axon (GO:0030424)|integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	35	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		CCACACCCTGCTGCCTCCCGG	0.632											OREG0021466	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													30.0	35.0	33.0					11																	124735606		2192	4296	6488	SO:0001819	synonymous_variant	0			AK024697	CCDS44755.1	11q24	2013-02-11	2001-11-28		ENSG00000154134	ENSG00000154134		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13433	protein-coding gene	gene with protein product		608630	"""roundabout (axon guidance receptor, Drosophila) homolog 3"", ""horizontal gaze palsy with progressive scoliosis"""	HGPPS		15105459	Standard	NM_022370		Approved	RBIG1, FLJ21044, HGPS	uc001qbc.3	Q96MS0	OTTHUMG00000165934	ENST00000397801.1:c.133C>T	11.37:g.124735606C>T		1536		Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L45	ENST00000397801.1	37	c.133	CCDS44755.1	11																																																																																			ROBO3	-	NULL	ENSG00000154134		0.632	ROBO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO3	HGNC	protein_coding	OTTHUMT00000387091.1		0.00	23	0	C	XM_370663		124735606	+1			no_errors	ENST00000397801	ensembl	human	known	74_37	silent	10.71	25	3	SNP	0.999	T
ROBO4	54538	genome.wustl.edu	37	11	124757376	124757376	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:124757376C>T	ENST00000306534.3	-	14	2561	c.2076G>A	c.(2074-2076)ctG>ctA	p.L692L	RP11-664I21.5_ENST00000524453.1_RNA|ROBO4_ENST00000533054.1_Silent_p.L547L	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	692					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GCCAGGCAACCAGAGCTTGGG	0.622																																																	0													50.0	54.0	53.0					11																	124757376		2201	4299	6500	SO:0001819	synonymous_variant	0			AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.2076G>A	11.37:g.124757376C>T			A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L692	ENST00000306534.3	37	c.2076	CCDS8455.1	11																																																																																			ROBO4	-	NULL	ENSG00000154133		0.622	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO4	HGNC	protein_coding	OTTHUMT00000387111.1	-	0.00	52	0	C	NM_019055		124757376	-1	tier1	-	no_errors	ENST00000306534	ensembl	human	known	74_37	silent	32.69	35	17	SNP	0.997	T
RTL1	388015	genome.wustl.edu	37	14	101348475	101348475	+	Missense_Mutation	SNP	G	G	A	rs527721034		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:101348475G>A	ENST00000534062.1	-	1	2709	c.2651C>T	c.(2650-2652)aCg>aTg	p.T884M	MIR431_ENST00000385266.1_RNA|MIR433_ENST00000384837.1_RNA|MIR136_ENST00000385207.1_RNA|MIR432_ENST00000606207.1_RNA|MIR127_ENST00000384876.1_RNA	NM_001134888.2	NP_001128360.1	A6NKG5	RTL1_HUMAN	retrotransposon-like 1	884					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)				breast(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(5)|pancreas(1)|prostate(2)|skin(2)	21						GTGCAGGGCCGTGCCGGTGAC	0.612													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17149	0.0		0.0	False		,,,				2504	0.0																0													27.0	27.0	27.0					14																	101348475		692	1591	2283	SO:0001583	missense	0				CCDS53910.1	14q32.2	2012-04-18			ENSG00000254656	ENSG00000254656			14665	protein-coding gene	gene with protein product		611896				16155747, 15854907, 12796779	Standard	NM_001134888		Approved	PEG11, MART1, Mar1	uc010txj.1	A6NKG5	OTTHUMG00000167573	ENST00000534062.1:c.2651C>T	14.37:g.101348475G>A	ENSP00000435342:p.Thr884Met		E9PKS8	Missense_Mutation	SNP	pfam_Retrotrans_gag_dom,superfamily_Peptidase_aspartic_dom	p.T884M	ENST00000534062.1	37	c.2651	CCDS53910.1	14	.	.	.	.	.	.	.	.	.	.	G	2.641	-0.284124	0.05642	.	.	ENSG00000254656	ENST00000534062	T	0.43688	0.94	3.33	0.287	0.15714	.	0.472552	0.15899	N	0.239156	T	0.21347	0.0514	L	0.27053	0.805	0.09310	N	1	B	0.30211	0.273	B	0.17098	0.017	T	0.09862	-1.0655	10	0.44086	T	0.13	.	2.8602	0.05584	0.2219:0.0:0.391:0.3872	.	884	E9PKS8	.	M	884	ENSP00000435342:T884M	ENSP00000435342:T884M	T	-	2	0	RTL1	100418228	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.083000	0.30815	0.060000	0.16281	-0.291000	0.09656	ACG	RTL1	-	NULL	ENSG00000254656		0.612	RTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTL1	HGNC	protein_coding	OTTHUMT00000395127.1	-	0.00	30	0	G	NM_001134888		101348475	-1	tier1	-	no_errors	ENST00000534062	ensembl	human	known	74_37	missense	45.24	23	19	SNP	0.000	A
RXFP2	122042	genome.wustl.edu	37	13	32376475	32376475	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr13:32376475C>G	ENST00000298386.2	+	18	2269	c.2198C>G	c.(2197-2199)tCt>tGt	p.S733C	RXFP2_ENST00000380314.1_Missense_Mutation_p.S709C	NM_130806.3	NP_570718.1	Q8WXD0	RXFP2_HUMAN	relaxin/insulin-like family peptide receptor 2	733					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|oocyte maturation (GO:0001556)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	peptide hormone binding (GO:0017046)|protein-hormone receptor activity (GO:0016500)			cervix(1)|endometrium(2)|large_intestine(15)|lung(13)|prostate(1)|stomach(1)	33		Lung SC(185;0.0262)		all cancers(112;0.000559)|Epithelial(112;0.0017)|OV - Ovarian serous cystadenocarcinoma(117;0.0145)|BRCA - Breast invasive adenocarcinoma(63;0.0535)		GAGGACTCCTCTTCCCTGAAA	0.368																																																	0													174.0	189.0	184.0					13																	32376475		2203	4300	6503	SO:0001583	missense	0			AF403384	CCDS9342.1, CCDS53862.1	13q12.3	2012-08-08	2006-05-09	2006-05-09	ENSG00000133105	ENSG00000133105		"""GPCR / Class A : Relaxin family peptide receptors"""	17318	protein-coding gene	gene with protein product		606655	"""leucine-rich repeat-containing G protein-coupled receptor 8"""	LGR8		12217959, 12970298, 15956688, 16507880	Standard	NM_130806		Approved	GREAT, GPR106, INSL3R, RXFPR2	uc001utt.3	Q8WXD0	OTTHUMG00000016690	ENST00000298386.2:c.2198C>G	13.37:g.32376475C>G	ENSP00000298386:p.Ser733Cys		B1ALE9|Q3KU23	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_Leu-rich_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_LDrepeatLR_classA_rpt,pfscan_GPCR_Rhodpsn_7TM,prints_Relaxin_rcpt,prints_GPCR_Rhodpsn,prints_Gphrmn_rcpt_fam	p.S733C	ENST00000298386.2	37	c.2198	CCDS9342.1	13	.	.	.	.	.	.	.	.	.	.	C	19.04	3.750311	0.69533	.	.	ENSG00000133105	ENST00000380314;ENST00000298386	T;T	0.73258	-0.73;-0.64	5.66	5.66	0.87406	.	0.068315	0.64402	D	0.000017	T	0.75796	0.3898	L	0.60455	1.87	0.31553	N	0.658568	D;D	0.64830	0.994;0.994	P;P	0.54460	0.753;0.753	T	0.79852	-0.1628	10	0.59425	D	0.04	.	12.6855	0.56946	0.0:0.9204:0.0:0.0795	.	709;733	Q3KU23;Q8WXD0	.;RXFP2_HUMAN	C	709;733	ENSP00000369670:S709C;ENSP00000298386:S733C	ENSP00000298386:S733C	S	+	2	0	RXFP2	31274475	0.999000	0.42202	0.972000	0.41901	0.948000	0.59901	5.167000	0.64972	2.690000	0.91761	0.655000	0.94253	TCT	RXFP2	-	NULL	ENSG00000133105		0.368	RXFP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RXFP2	HGNC	protein_coding	OTTHUMT00000044399.1	-	0.00	58	0	C	NM_130806		32376475	+1	tier1	-	no_errors	ENST00000298386	ensembl	human	known	74_37	missense	35.29	44	24	SNP	0.998	G
RXFP3	51289	genome.wustl.edu	37	5	33937201	33937201	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:33937201T>C	ENST00000330120.3	+	1	711	c.356T>C	c.(355-357)cTc>cCc	p.L119P		NM_016568.3	NP_057652.1	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	119					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|G-protein coupled receptor activity (GO:0004930)			endometrium(4)|large_intestine(9)|lung(24)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)	42						TCTATCAACCTCTTCGTCACC	0.592																																																	0													127.0	118.0	121.0					5																	33937201		2203	4300	6503	SO:0001583	missense	0			D88437	CCDS3900.1	5p15.1-p14	2012-08-08	2006-05-09	2006-03-15	ENSG00000182631	ENSG00000182631		"""GPCR / Class A : Relaxin family peptide receptors"""	24883	protein-coding gene	gene with protein product		609445	"""relaxin 3 receptor 1"", ""relaxin family peptide receptor 3"""	RLN3R1		15956688, 16507880	Standard	NM_016568		Approved	SALPR, GPCR135, RXFPR3	uc003jic.2	Q9NSD7	OTTHUMG00000090685	ENST00000330120.3:c.356T>C	5.37:g.33937201T>C	ENSP00000328708:p.Leu119Pro		Q14DA5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt	p.L119P	ENST00000330120.3	37	c.356	CCDS3900.1	5	.	.	.	.	.	.	.	.	.	.	T	18.54	3.646130	0.67358	.	.	ENSG00000182631	ENST00000330120	T	0.22743	1.94	5.72	5.72	0.89469	GPCR, rhodopsin-like superfamily (1);	0.126197	0.56097	D	0.000039	T	0.52661	0.1748	M	0.87971	2.92	0.80722	D	1	D	0.69078	0.997	D	0.72982	0.979	T	0.61247	-0.7101	10	0.87932	D	0	-29.3825	16.0014	0.80294	0.0:0.0:0.0:1.0	.	119	Q9NSD7	RL3R1_HUMAN	P	119	ENSP00000328708:L119P	ENSP00000328708:L119P	L	+	2	0	RXFP3	33972958	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	4.981000	0.63819	2.181000	0.69327	0.528000	0.53228	CTC	RXFP3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000182631		0.592	RXFP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RXFP3	HGNC	protein_coding	OTTHUMT00000207369.1	-	0.00	25	0	T	NM_016568		33937201	+1	tier1	-	no_errors	ENST00000330120	ensembl	human	known	74_37	missense	37.78	28	17	SNP	1.000	C
SALL1	6299	genome.wustl.edu	37	16	51171156	51171156	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:51171156T>G	ENST00000251020.4	-	3	3875	c.3842A>C	c.(3841-3843)aAc>aCc	p.N1281T	SALL1_ENST00000566102.1_3'UTR|SALL1_ENST00000541611.1_Missense_Mutation_p.N104T|SALL1_ENST00000440970.1_Missense_Mutation_p.N1184T	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	1281					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CCTCTCCAGGTTTCCCGTCAG	0.582																																					GBM(103;1352 1446 1855 4775 8890)												0													72.0	70.0	70.0					16																	51171156		2198	4300	6498	SO:0001583	missense	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.3842A>C	16.37:g.51171156T>G	ENSP00000251020:p.Asn1281Thr		Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N1281T	ENST00000251020.4	37	c.3842	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	T	6.239	0.412265	0.11812	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559;ENST00000541611	T;T;T	0.46451	0.87;0.87;0.87	5.8	4.69	0.59074	.	0.038809	0.85682	D	0.000000	T	0.22437	0.0541	N	0.19112	0.55	0.33064	D	0.534497	B;B	0.17038	0.02;0.013	B;B	0.16722	0.016;0.015	T	0.18587	-1.0332	10	0.22706	T	0.39	.	3.3531	0.07159	0.0:0.328:0.0:0.6719	.	1281;104	Q9NSC2;F5H733	SALL1_HUMAN;.	T	1281;1184;1245;104	ENSP00000251020:N1281T;ENSP00000407914:N1184T;ENSP00000442827:N104T	ENSP00000251020:N1281T	N	-	2	0	SALL1	49728657	1.000000	0.71417	0.953000	0.39169	0.986000	0.74619	3.986000	0.56937	2.221000	0.72209	0.523000	0.50628	AAC	SALL1	-	NULL	ENSG00000103449		0.582	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	-	0.00	58	0	T	NM_002968		51171156	-1	tier1	-	no_errors	ENST00000251020	ensembl	human	known	74_37	missense	33.33	39	20	SNP	1.000	G
SAMD9L	219285	genome.wustl.edu	37	7	92763306	92763306	+	Missense_Mutation	SNP	C	C	T	rs377186697		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:92763306C>T	ENST00000318238.4	-	5	3195	c.1979G>A	c.(1978-1980)tGt>tAt	p.C660Y	SAMD9L_ENST00000411955.1_Missense_Mutation_p.C660Y|SAMD9L_ENST00000437805.1_Missense_Mutation_p.C660Y	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	660					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			CTCATTTTCACAGAGGATTTC	0.408																																																	0								C	TYR/CYS	1,4405	2.1+/-5.4	0,1,2202	75.0	75.0	75.0		1979	4.0	1.0	7		75	0,8598		0,0,4299	no	missense	SAMD9L	NM_152703.2	194	0,1,6501	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	660/1585	92763306	1,13003	2203	4299	6502	SO:0001583	missense	0			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.1979G>A	7.37:g.92763306C>T	ENSP00000326247:p.Cys660Tyr		A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/pointed,superfamily_P-loop_NTPase,pfscan_SAM	p.C660Y	ENST00000318238.4	37	c.1979	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	C	15.53	2.861330	0.51482	2.27E-4	0.0	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.25749	1.78;1.78;1.78	4.86	3.96	0.45880	.	0.000000	0.85682	D	0.000000	T	0.49115	0.1538	M	0.69823	2.125	0.43913	D	0.996553	D	0.89917	1.0	D	0.70935	0.971	T	0.55205	-0.8177	10	0.87932	D	0	-8.423	14.717	0.69277	0.0:0.854:0.146:0.0	.	660	Q8IVG5	SAM9L_HUMAN	Y	660	ENSP00000326247:C660Y;ENSP00000405760:C660Y;ENSP00000408796:C660Y	ENSP00000326247:C660Y	C	-	2	0	SAMD9L	92601242	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	3.788000	0.55446	1.229000	0.43630	0.467000	0.42956	TGT	SAMD9L	-	NULL	ENSG00000177409		0.408	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	HGNC	protein_coding	OTTHUMT00000341730.1	-	0.00	26	0	C	NM_152703		92763306	-1	tier1	-	no_errors	ENST00000318238	ensembl	human	known	74_37	missense	23.08	38	12	SNP	1.000	T
SCML4	256380	genome.wustl.edu	37	6	108066254	108066254	+	Missense_Mutation	SNP	C	C	T	rs555376188		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:108066254C>T	ENST00000369020.3	-	5	826	c.581G>A	c.(580-582)cGa>cAa	p.R194Q	SCML4_ENST00000369022.2_Missense_Mutation_p.R136Q|SCML4_ENST00000479803.1_5'Flank|SCML4_ENST00000369021.3_Missense_Mutation_p.R165Q	NM_198081.3	NP_932347.2	Q8N228	SCML4_HUMAN	sex comb on midleg-like 4 (Drosophila)	194					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.R165Q(2)		endometrium(2)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(1)	25		all_cancers(87;3.26e-06)|Acute lymphoblastic leukemia(125;3.08e-08)|all_hematologic(75;1.15e-06)|all_epithelial(87;0.00142)|Colorectal(196;0.0316)		BRCA - Breast invasive adenocarcinoma(108;0.01)|Epithelial(106;0.0509)|all cancers(137;0.0586)|OV - Ovarian serous cystadenocarcinoma(136;0.0758)		CAGGAGGCTTCGGCACAGCTT	0.587																																																	2	Substitution - Missense(2)	large_intestine(2)											65.0	55.0	59.0					6																	108066254		2203	4300	6503	SO:0001583	missense	0				CCDS5060.2, CCDS69163.1, CCDS75500.1	6q21	2013-01-10			ENSG00000146285	ENSG00000146285		"""Sterile alpha motif (SAM) domain containing"""	21397	protein-coding gene	gene with protein product							Standard	NM_001286409		Approved	dJ47M23.1	uc010kdf.3	Q8N228	OTTHUMG00000015313	ENST00000369020.3:c.581G>A	6.37:g.108066254C>T	ENSP00000358016:p.Arg194Gln		B0QZ10|B0QZ11|B7ZBX3|Q5JXD0|Q5T0T6|Q8IYY6	Missense_Mutation	SNP	pfam_DUF3588	p.R165Q	ENST00000369020.3	37	c.494	CCDS5060.2	6	.	.	.	.	.	.	.	.	.	.	C	15.66	2.900077	0.52227	.	.	ENSG00000146285	ENST00000369022;ENST00000369020;ENST00000369021;ENST00000440927	T;T;T;T	0.41758	0.99;0.99;0.99;0.99	5.38	3.44	0.39384	.	0.169399	0.53938	N	0.000054	T	0.14700	0.0355	L	0.37750	1.13	0.58432	D	0.999999	B;B;P	0.39003	0.393;0.327;0.654	B;B;B	0.35312	0.081;0.053;0.2	T	0.03662	-1.1015	10	0.11794	T	0.64	.	12.8262	0.57721	0.0:0.8468:0.0:0.1532	.	194;194;165	B4E0X3;Q8N228;Q8N228-3	.;SCML4_HUMAN;.	Q	136;194;165;165	ENSP00000358018:R136Q;ENSP00000358016:R194Q;ENSP00000358017:R165Q;ENSP00000404688:R165Q	ENSP00000358016:R194Q	R	-	2	0	SCML4	108172947	1.000000	0.71417	0.996000	0.52242	0.946000	0.59487	2.326000	0.43849	1.475000	0.48197	0.655000	0.94253	CGA	SCML4	-	pfam_DUF3588	ENSG00000146285		0.587	SCML4-005	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SCML4	HGNC	protein_coding	OTTHUMT00000041700.3	-	0.00	21	0	C	XM_171128		108066254	-1	tier1	-	no_errors	ENST00000369021	ensembl	human	known	74_37	missense	42.11	22	16	SNP	0.995	T
SCN5A	6331	genome.wustl.edu	37	3	38592230	38592230	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:38592230T>G	ENST00000333535.4	-	28	5782	c.5633A>C	c.(5632-5634)aAg>aCg	p.K1878T	SCN5A_ENST00000414099.2_Missense_Mutation_p.K1860T|SCN5A_ENST00000449557.2_Missense_Mutation_p.K1824T|SCN5A_ENST00000464652.1_5'Flank|SCN5A_ENST00000451551.2_Missense_Mutation_p.K1824T|SCN5A_ENST00000455624.2_Missense_Mutation_p.K1845T|SCN5A_ENST00000443581.1_Missense_Mutation_p.K1877T|SCN5A_ENST00000450102.2_Missense_Mutation_p.K1824T|SCN5A_ENST00000413689.1_Missense_Mutation_p.K1878T|SCN5A_ENST00000425664.1_Missense_Mutation_p.K1860T|SCN5A_ENST00000423572.2_Missense_Mutation_p.K1877T			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	1878	Interaction with FGF13.				AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	TGCCATGAACTTCTCCTCCAT	0.577																																																	0													200.0	215.0	210.0					3																	38592230		2107	4215	6322	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.5633A>C	3.37:g.38592230T>G	ENSP00000328968:p.Lys1878Thr		A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.K1878T	ENST00000333535.4	37	c.5633	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	T	16.41	3.116072	0.56505	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.96396	-3.92;-3.94;-3.94;-3.98;-3.94;-3.92;-3.94;-4.0;-3.98;-3.98	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.97739	0.9258	M	0.74546	2.27	0.44055	D	0.996792	D;D;D;D;D;P	0.89917	0.999;0.999;1.0;0.999;1.0;0.951	D;D;D;D;D;P	0.97110	0.968;0.991;0.998;0.97;1.0;0.528	D	0.98503	1.0615	10	0.72032	D	0.01	.	14.5422	0.68002	0.0:0.0:0.0:1.0	.	1824;1845;1860;1878;1877;1878	E9PEF3;E9PHB6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;SCN5A_HUMAN;.;.	T	1860;1877;1878;1824;1877;1860;1878;1845;1824;1824	ENSP00000398962:K1860T;ENSP00000398266:K1877T;ENSP00000410257:K1878T;ENSP00000388797:K1824T;ENSP00000397915:K1877T;ENSP00000416634:K1860T;ENSP00000328968:K1878T;ENSP00000399524:K1845T;ENSP00000403355:K1824T;ENSP00000413996:K1824T	ENSP00000328968:K1878T	K	-	2	0	SCN5A	38567234	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.234000	0.43035	2.025000	0.59659	0.460000	0.39030	AAG	SCN5A	-	NULL	ENSG00000183873		0.577	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	-	0.00	67	0	T	NM_198056		38592230	-1	tier1	-	no_errors	ENST00000333535	ensembl	human	known	74_37	missense	41.18	40	28	SNP	1.000	G
SETBP1	26040	genome.wustl.edu	37	18	42618465	42618465	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr18:42618465A>T	ENST00000282030.5	+	5	4312	c.4016A>T	c.(4015-4017)cAc>cTc	p.H1339L		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1339						nucleus (GO:0005634)	DNA binding (GO:0003677)	p.H1339R(1)|p.H1285R(1)		NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CCAAGTCCCCACTTAAAAGTG	0.458									Schinzel-Giedion syndrome																																								2	Substitution - Missense(2)	endometrium(2)											131.0	115.0	120.0					18																	42618465		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.4016A>T	18.37:g.42618465A>T	ENSP00000282030:p.His1339Leu		A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	smart_AT_hook_DNA-bd_motif	p.H1339L	ENST00000282030.5	37	c.4016	CCDS11923.2	18	.	.	.	.	.	.	.	.	.	.	A	24.3	4.519545	0.85495	.	.	ENSG00000152217	ENST00000282030	T	0.70399	-0.48	5.84	5.84	0.93424	.	0.055514	0.64402	D	0.000001	T	0.77651	0.4162	L	0.32530	0.975	0.41759	D	0.989705	D	0.69078	0.997	D	0.78314	0.991	T	0.79386	-0.1825	10	0.54805	T	0.06	.	16.2141	0.82191	1.0:0.0:0.0:0.0	.	1339	Q9Y6X0	SETBP_HUMAN	L	1339	ENSP00000282030:H1339L	ENSP00000282030:H1339L	H	+	2	0	SETBP1	40872463	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.316000	0.72857	2.230000	0.72887	0.528000	0.53228	CAC	SETBP1	-	NULL	ENSG00000152217		0.458	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETBP1	HGNC	protein_coding	OTTHUMT00000255854.4		0.00	74	0	A	NM_001130110		42618465	+1			no_errors	ENST00000282030	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
SF3A1	10291	genome.wustl.edu	37	22	30736779	30736780	+	In_Frame_Ins	INS	-	-	CTT			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr22:30736779_30736780insCTT	ENST00000215793.8	-	8	1247_1248	c.1093_1094insAAG	c.(1093-1095)ggg>gAAGgg	p.364_365insE	SF3A1_ENST00000439242.1_In_Frame_Ins_p.299_300insE	NM_005877.4	NP_005868.1	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa	364					gene expression (GO:0010467)|mRNA 3'-splice site recognition (GO:0000389)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U2-type spliceosomal complex (GO:0005684)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|urinary_tract(1)	29						CACTTTCTGCCCTTCTTCTTCA	0.569																																																	0																																										SO:0001652	inframe_insertion	0			X85237	CCDS13875.1	22q12.2	2014-09-17	2002-08-29		ENSG00000099995	ENSG00000099995			10765	protein-coding gene	gene with protein product		605595	"""splicing factor 3a, subunit 1, 120kD"""			7489498	Standard	NM_005877		Approved	SF3a120, SAP114, PRPF21, Prp21	uc003ahl.3	Q15459	OTTHUMG00000151005	ENST00000215793.8:c.1091_1093dupAAG	22.37:g.30736786_30736788dupCTT	ENSP00000215793:p.Glu364_Glu364dup		E9PAW1	In_Frame_Ins	INS	pfam_PRP21-like,pfam_Surp,pfam_Ubiquitin_dom,superfamily_Surp,smart_Surp,smart_Ubiquitin_dom,pfscan_Surp,pfscan_Ubiquitin_supergroup	p.365in_frame_insE	ENST00000215793.8	37	c.1094_1093	CCDS13875.1	22																																																																																			SF3A1	-	pfam_PRP21-like	ENSG00000099995		0.569	SF3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3A1	HGNC	protein_coding	OTTHUMT00000320916.2		0.00	40	0	-	NM_005877		30736780	-1	tier1		no_errors	ENST00000215793	ensembl	human	known	74_37	in_frame_ins	25.93	20	7	INS	1.000:1.000	CTT
SGCZ	137868	genome.wustl.edu	37	8	14095139	14095139	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:14095139C>A	ENST00000382080.1	-	4	1101	c.386G>T	c.(385-387)aGa>aTa	p.R129I	SGCZ_ENST00000421524.2_Missense_Mutation_p.R82I	NM_139167.2	NP_631906.2	Q96LD1	SGCZ_HUMAN	sarcoglycan, zeta	116					membrane organization (GO:0061024)|muscle cell cellular homeostasis (GO:0046716)|muscle cell development (GO:0055001)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|sarcoglycan complex (GO:0016012)		p.R129I(1)		NS(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(14)|lung(15)|ovary(2)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	47				all cancers(2;0.000643)|Colorectal(111;0.00674)|COAD - Colon adenocarcinoma(73;0.0193)|GBM - Glioblastoma multiforme(2;0.026)		CATGTGATTTCTTGCATTCAC	0.388																																																	1	Substitution - Missense(1)	large_intestine(1)											350.0	336.0	340.0					8																	14095139		2203	4300	6503	SO:0001583	missense	0			AY028700	CCDS5992.2	8p22	2014-09-17	2010-04-21		ENSG00000185053	ENSG00000185053			14075	protein-coding gene	gene with protein product		608113				12189167	Standard	XM_006716287		Approved	ZSG1	uc003wwq.3	Q96LD1	OTTHUMG00000090827	ENST00000382080.1:c.386G>T	8.37:g.14095139C>A	ENSP00000371512:p.Arg129Ile		Q6REU0	Missense_Mutation	SNP	pfam_Sarcoglycan	p.R129I	ENST00000382080.1	37	c.386	CCDS5992.2	8	.	.	.	.	.	.	.	.	.	.	c	19.65	3.867254	0.72065	.	.	ENSG00000185053	ENST00000382080;ENST00000421524	D;D	0.95724	-3.79;-3.79	5.39	5.39	0.77823	.	0.089576	0.64402	D	0.000001	D	0.96150	0.8745	M	0.83774	2.66	0.80722	D	1	P;P	0.41748	0.761;0.717	B;B	0.44278	0.445;0.239	D	0.95505	0.8581	10	0.36615	T	0.2	.	18.5837	0.91181	0.0:1.0:0.0:0.0	.	82;129	Q08AT0;Q96LD1-2	.;.	I	129;82	ENSP00000371512:R129I;ENSP00000405224:R82I	ENSP00000371512:R129I	R	-	2	0	SGCZ	14139510	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.935000	0.75886	2.708000	0.92522	0.585000	0.79938	AGA	SGCZ	-	pfam_Sarcoglycan	ENSG00000185053		0.388	SGCZ-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SGCZ	HGNC	protein_coding	OTTHUMT00000207636.2	-	0.00	56	0	C	NM_139167		14095139	-1	tier1	-	no_errors	ENST00000382080	ensembl	human	known	74_37	missense	27.27	56	21	SNP	1.000	A
SH3GL1	6455	genome.wustl.edu	37	19	4361666	4361666	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:4361666G>A	ENST00000269886.3	-	10	1216	c.1038C>T	c.(1036-1038)ggC>ggT	p.G346G	SH3GL1_ENST00000598564.1_Silent_p.G282G|SH3GL1_ENST00000417295.2_Silent_p.G298G|AC007292.6_ENST00000594444.1_RNA	NM_003025.3	NP_003016.1	Q99961	SH3G1_HUMAN	SH3-domain GRB2-like 1	346	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|endosome (GO:0005768)|membrane (GO:0016020)	identical protein binding (GO:0042802)|lipid binding (GO:0008289)			NS(1)|endometrium(2)|kidney(16)|large_intestine(3)|lung(2)|ovary(2)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0152)|STAD - Stomach adenocarcinoma(1328;0.182)		CGTCCAGCATGCCCTCGTACC	0.657			T	MLL	AL																																NSCLC(94;1152 2133 30346 33362)			Dom	yes		19	19p13.3	6455	SH3-domain GRB2-like 1 (EEN)		L	0													105.0	74.0	85.0					19																	4361666		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS32874.1, CCDS56076.1, CCDS59335.1	19p13.3	2008-07-22							10830	protein-coding gene	gene with protein product	"""extra 11-19 leukemia fusion"", ""fusion partner of MLL"", ""SH3-containing Grb-2-like 1 protein"", ""SH3-containing protein EEN"", ""SH3 domain GRB2-like 1"""	601768				9169142	Standard	NM_003025		Approved	SH3P8, SH3D2B, CNSA1, EEN, MGC111371	uc002maj.3	Q99961		ENST00000269886.3:c.1038C>T	19.37:g.4361666G>A			B4DRA1|E7EVZ4|M0QZV5|Q99668	Silent	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_BAR_dom-cont,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	p.G346	ENST00000269886.3	37	c.1038	CCDS32874.1	19																																																																																			SH3GL1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	ENSG00000141985		0.657	SH3GL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GL1	HGNC	protein_coding	OTTHUMT00000458302.1	-	0.00	82	0	G	NM_003025		4361666	-1	tier1	-	no_errors	ENST00000269886	ensembl	human	known	74_37	silent	40.58	41	28	SNP	0.964	A
SH3TC2	79628	genome.wustl.edu	37	5	148384459	148384459	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:148384459G>T	ENST00000515425.1	-	17	3783	c.3682C>A	c.(3682-3684)Cat>Aat	p.H1228N	SH3TC2_ENST00000512049.1_Missense_Mutation_p.H1221N|SH3TC2_ENST00000502274.1_Missense_Mutation_p.H90N|SH3TC2_ENST00000538184.1_3'UTR	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	1228					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTGGCATCATGGGCATCCTAA	0.547																																																	0													63.0	63.0	63.0					5																	148384459		2203	4300	6503	SO:0001583	missense	0			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.3682C>A	5.37:g.148384459G>T	ENSP00000423660:p.His1228Asn		B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	pfam_SH3_domain,pfam_TPR_1,superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.H1228N	ENST00000515425.1	37	c.3682	CCDS4293.1	5	.	.	.	.	.	.	.	.	.	.	G	16.20	3.054799	0.55325	.	.	ENSG00000169247	ENST00000502274;ENST00000515425;ENST00000512049	T;T;T	0.75477	-0.94;-0.92;-0.94	6.04	6.04	0.98038	Tetratricopeptide-like helical (1);	0.178183	0.51477	D	0.000089	T	0.64216	0.2578	L	0.40543	1.245	0.80722	D	1	P;P	0.49559	0.925;0.925	B;B	0.37833	0.259;0.259	T	0.63363	-0.6654	10	0.23891	T	0.37	-16.1211	15.8357	0.78796	0.0:0.2478:0.7522:0.0	.	1221;1228	Q14CC0;Q8TF17	.;S3TC2_HUMAN	N	90;1228;1221	ENSP00000421092:H90N;ENSP00000423660:H1228N;ENSP00000421860:H1221N	ENSP00000421092:H90N	H	-	1	0	SH3TC2	148364652	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.939000	0.63526	2.873000	0.98535	0.561000	0.74099	CAT	SH3TC2	-	NULL	ENSG00000169247		0.547	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3TC2	HGNC	protein_coding	OTTHUMT00000252186.2	-	0.00	42	0	G	NM_024577		148384459	-1	tier1	-	no_errors	ENST00000515425	ensembl	human	known	74_37	missense	7.14	51	4	SNP	1.000	T
SIDT1	54847	genome.wustl.edu	37	3	113308848	113308848	+	Intron	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:113308848G>A	ENST00000264852.4	+	10	1727				SIDT1_ENST00000393830.3_Intron|SIDT1-AS1_ENST00000462180.1_RNA	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1						dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						atacaagcaagtaagcaatta	0.333																																																	0																																										SO:0001627	intron_variant	0			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1002-3004G>A	3.37:g.113308848G>A			Q17RR4	RNA	SNP	-	NULL	ENST00000264852.4	37	NULL	CCDS2974.1	3																																																																																			SIDT1-AS1	-	-	ENSG00000239453		0.333	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1-AS1	HGNC	protein_coding	OTTHUMT00000317564.1	-	0.00	12	0	G	NM_017699		113308848	-1	tier1	-	no_errors	ENST00000462180	ensembl	human	known	74_37	rna	50.00	10	10	SNP	0.001	A
SI	6476	genome.wustl.edu	37	3	164710142	164710142	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:164710142A>C	ENST00000264382.3	-	42	4947	c.4885T>G	c.(4885-4887)Tta>Gta	p.L1629V		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1629	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	GGACCCCATAAGAACTGCTTG	0.323										HNSCC(35;0.089)																																							0													56.0	57.0	57.0					3																	164710142		2203	4300	6503	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4885T>G	3.37:g.164710142A>C	ENSP00000264382:p.Leu1629Val		A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.L1629V	ENST00000264382.3	37	c.4885	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	A	16.94	3.261599	0.59431	.	.	ENSG00000090402	ENST00000264382	D	0.92858	-3.12	4.88	-2.72	0.05968	.	0.000000	0.64402	D	0.000002	D	0.96100	0.8729	H	0.94698	3.57	0.36563	D	0.872525	D	0.69078	0.997	D	0.69479	0.964	D	0.96214	0.9155	10	0.87932	D	0	.	12.6259	0.56630	0.4822:0.0:0.5178:0.0	.	1629	P14410	SUIS_HUMAN	V	1629	ENSP00000264382:L1629V	ENSP00000264382:L1629V	L	-	1	2	SI	166192836	0.998000	0.40836	0.363000	0.25875	0.878000	0.50629	0.522000	0.22909	-0.294000	0.08973	0.533000	0.62120	TTA	SI	-	pfam_Glyco_hydro_31	ENSG00000090402		0.323	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	-	0.00	148	0	A	NM_001041		164710142	-1	tier1	-	no_errors	ENST00000264382	ensembl	human	known	74_37	missense	19.40	162	39	SNP	0.727	C
SLC25A23	79085	genome.wustl.edu	37	19	6457545	6457545	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:6457545A>T	ENST00000301454.4	-	3	446	c.340T>A	c.(340-342)Tcg>Acg	p.S114T	SLC25A23_ENST00000334510.5_Missense_Mutation_p.S114T|SLC25A23_ENST00000414491.2_5'Flank	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	114	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						TGCTCCAGCGAGATGGAAATG	0.557																																																	0													60.0	58.0	59.0					19																	6457545		2203	4300	6503	SO:0001583	missense	0			AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.340T>A	19.37:g.6457545A>T	ENSP00000301454:p.Ser114Thr		B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,smart_EF_hand_dom,pfscan_EF_hand_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.S114T	ENST00000301454.4	37	c.340	CCDS32882.1	19	.	.	.	.	.	.	.	.	.	.	A	3.151	-0.174161	0.06421	.	.	ENSG00000125648	ENST00000264088;ENST00000301454;ENST00000334510	T;T;T	0.38887	1.11;1.11;1.11	4.69	-2.23	0.06930	EF-hand-like domain (1);	0.548916	0.18664	N	0.134628	T	0.32194	0.0821	L	0.39245	1.2	0.25304	N	0.989252	B	0.14012	0.009	B	0.23574	0.047	T	0.09684	-1.0663	10	0.36615	T	0.2	-3.1758	12.6055	0.56521	0.3776:0.0:0.0:0.6224	.	114	Q9BV35	SCMC3_HUMAN	T	114	ENSP00000264088:S114T;ENSP00000301454:S114T;ENSP00000334537:S114T	ENSP00000264088:S114T	S	-	1	0	SLC25A23	6408545	0.998000	0.40836	0.051000	0.19133	0.077000	0.17291	0.620000	0.24403	-1.668000	0.01471	-2.559000	0.00174	TCG	SLC25A23	-	pfscan_EF_hand_dom	ENSG00000125648		0.557	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A23	HGNC	protein_coding	OTTHUMT00000453325.1		0.00	32	0	A	NM_024103		6457545	-1			no_errors	ENST00000264088	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.684	T
SLC25A35	399512	genome.wustl.edu	37	17	8193951	8193951	+	Silent	SNP	G	G	T	rs555674428	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr17:8193951G>T	ENST00000577745.1	-	5	1285	c.775C>A	c.(775-777)Cgg>Agg	p.R259R	SLC25A35_ENST00000579192.1_Intron|SLC25A35_ENST00000580340.1_Intron|SLC25A35_ENST00000380067.2_Intron|SLC25A35_ENST00000396278.1_Silent_p.R259R|SLC25A35_ENST00000581320.1_5'Flank			Q3KQZ1	S2535_HUMAN	solute carrier family 25, member 35	259					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(2)|large_intestine(2)|lung(2)	6						CCCTCGGTCCGAGCTGTCTGC	0.597																																																	0																																										SO:0001819	synonymous_variant	0			AY498866	CCDS11138.1	17p13.1	2013-05-22			ENSG00000125434	ENSG00000125434		"""Solute carriers"""	31921	protein-coding gene	gene with protein product		610818					Standard	NM_201520		Approved	FLJ40217	uc002gku.1	Q3KQZ1		ENST00000577745.1:c.775C>A	17.37:g.8193951G>T			Q494X5|Q6RGS3|Q8N7Y5	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.R259	ENST00000577745.1	37	c.775		17																																																																																			SLC25A35	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000125434		0.597	SLC25A35-002	KNOWN	basic|appris_principal	protein_coding	SLC25A35	HGNC	protein_coding	OTTHUMT00000442146.1	-	0.00	55	0	G	NM_201520		8193951	-1	tier1	-	no_errors	ENST00000577745	ensembl	human	known	74_37	silent	6.56	57	4	SNP	1.000	T
SLC35F4	341880	genome.wustl.edu	37	14	58060677	58060677	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:58060677A>G	ENST00000339762.6	-	2	376	c.377T>C	c.(376-378)gTt>gCt	p.V126A	SLC35F4_ENST00000554729.1_5'UTR|SLC35F4_ENST00000556826.1_Missense_Mutation_p.V90A|SLC35F4_ENST00000557430.1_5'Flank			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	126					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTGTCTCTCAACTCTGTGTCC	0.438																																																	0													99.0	99.0	99.0					14																	58060677		1965	4147	6112	SO:0001583	missense	0					14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.377T>C	14.37:g.58060677A>G	ENSP00000342518:p.Val126Ala		A6NDQ3	Missense_Mutation	SNP	pfam_DMT,pfam_SLC35_F1/F2/F6	p.V126A	ENST00000339762.6	37	c.377		14	.	.	.	.	.	.	.	.	.	.	A	3.546	-0.092766	0.07053	.	.	ENSG00000151812	ENST00000556826;ENST00000339762	T;T	0.50277	0.79;0.75	5.83	2.33	0.28932	.	1.005080	0.07997	N	0.988131	T	0.27489	0.0675	N	0.14661	0.345	0.24034	N	0.996107	B	0.02656	0.0	B	0.01281	0.0	T	0.25984	-1.0116	10	0.14656	T	0.56	-4.9329	6.2101	0.20623	0.6144:0.2098:0.1759:0.0	.	126	A4IF30	S35F4_HUMAN	A	90;126	ENSP00000452086:V90A;ENSP00000342518:V126A	ENSP00000342518:V126A	V	-	2	0	SLC35F4	57130430	0.496000	0.26059	0.142000	0.22268	0.535000	0.34838	0.953000	0.29162	0.491000	0.27793	0.477000	0.44152	GTT	SLC35F4	-	NULL	ENSG00000151812		0.438	SLC35F4-201	KNOWN	basic	protein_coding	SLC35F4	HGNC	protein_coding		-	0.00	54	0	A	XM_292260		58060677	-1	tier1	-	no_errors	ENST00000339762	ensembl	human	known	74_37	missense	26.92	19	7	SNP	0.326	G
SLC25A47	283600	genome.wustl.edu	37	14	100793573	100793573	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:100793573C>A	ENST00000361529.3	+	4	271	c.193C>A	c.(193-195)Ctg>Atg	p.L65M	SLC25A47_ENST00000557052.1_5'UTR	NM_207117.2	NP_997000.2	Q6Q0C1	S2547_HUMAN	solute carrier family 25, member 47	65					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	13						CACGGTGTCCCTGGTATCTTC	0.662																																					GBM(11;1289 1351)												0													129.0	127.0	128.0					14																	100793573		2203	4300	6503	SO:0001583	missense	0				CCDS9959.1	14q32.2	2013-05-22	2010-07-19	2010-07-19	ENSG00000140107	ENSG00000140107		"""Solute carriers"""	20115	protein-coding gene	gene with protein product		609911	"""chromosome 14 open reading frame 68"""	C14orf68			Standard	NM_207117		Approved		uc001yhc.3	Q6Q0C1	OTTHUMG00000171571	ENST00000361529.3:c.193C>A	14.37:g.100793573C>A	ENSP00000354886:p.Leu65Met		B2RP39|Q68CL2|Q6PZD8|Q86U14	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.L65M	ENST00000361529.3	37	c.193	CCDS9959.1	14	.	.	.	.	.	.	.	.	.	.	C	7.651	0.682914	0.14907	.	.	ENSG00000140107	ENST00000361529	T	0.80033	-1.33	4.85	1.98	0.26296	Mitochondrial carrier domain (2);	0.512398	0.21308	N	0.076692	T	0.68988	0.3061	L	0.33753	1.03	0.80722	D	1	B	0.26147	0.143	B	0.33121	0.158	T	0.60078	-0.7333	10	0.36615	T	0.2	.	5.6032	0.17365	0.0:0.5527:0.1361:0.3112	.	65	Q6Q0C1	S2547_HUMAN	M	65	ENSP00000354886:L65M	ENSP00000354886:L65M	L	+	1	2	SLC25A47	99863326	0.126000	0.22350	0.998000	0.56505	0.234000	0.25298	0.557000	0.23454	0.661000	0.30985	0.485000	0.47835	CTG	SLC25A47	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000140107		0.662	SLC25A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A47	HGNC	protein_coding	OTTHUMT00000414231.1	-	0.00	37	0	C			100793573	+1	tier1	-	no_errors	ENST00000361529	ensembl	human	known	74_37	missense	46.51	23	20	SNP	0.919	A
SLC46A3	283537	genome.wustl.edu	37	13	29278217	29278217	+	Silent	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr13:29278217A>G	ENST00000266943.6	-	5	1533	c.1164T>C	c.(1162-1164)atT>atC	p.I388I	RNU6-53P_ENST00000365367.1_RNA|SLC46A3_ENST00000380814.4_Silent_p.I388I|SLC46A3_ENST00000475385.1_5'UTR	NM_001135919.1|NM_181785.3	NP_001129391.1|NP_861450.1	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3	388					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)	15		Lung SC(185;0.0367)		all cancers(112;0.159)		CTAAGAAAGCAATACAAGCAA	0.403																																																	0													68.0	73.0	72.0					13																	29278217		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9332.1, CCDS45021.1	13q12.3	2013-05-22	2007-03-29		ENSG00000139508	ENSG00000139508		"""Solute carriers"""	27501	protein-coding gene	gene with protein product							Standard	NM_001135919		Approved	DKFZp686A1775, FLJ42613	uc001usj.3	Q7Z3Q1	OTTHUMG00000016650	ENST00000266943.6:c.1164T>C	13.37:g.29278217A>G			Q3ZCV8|Q6NUK5|Q6P9B3|Q6ZVG5|Q96QA1	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.I388	ENST00000266943.6	37	c.1164	CCDS9332.1	13																																																																																			SLC46A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000139508		0.403	SLC46A3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC46A3	HGNC	protein_coding	OTTHUMT00000276111.1	-	0.00	55	0	A	NM_181785		29278217	-1	tier1	-	no_errors	ENST00000266943	ensembl	human	known	74_37	silent	5.56	68	4	SNP	0.970	G
SLITRK5	26050	genome.wustl.edu	37	13	88330472	88330472	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr13:88330472G>T	ENST00000325089.6	+	2	3048	c.2829G>T	c.(2827-2829)ccG>ccT	p.P943P	SLITRK5_ENST00000400028.3_Silent_p.P702P	NM_015567.1	NP_056382.1	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5	943					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|cardiovascular system development (GO:0072358)|dendrite morphogenesis (GO:0048813)|grooming behavior (GO:0007625)|response to xenobiotic stimulus (GO:0009410)|skin development (GO:0043588)|striatum development (GO:0021756)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(14)|lung(40)|ovary(2)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(4)	81	all_neural(89;0.101)|Medulloblastoma(90;0.163)					ACGTTGAGCCGGACTACCTCG	0.468																																																	0													107.0	116.0	113.0					13																	88330472		2195	4275	6470	SO:0001819	synonymous_variant	0			AB020725	CCDS9465.1	13q31.1	2004-04-16	2004-01-08		ENSG00000165300	ENSG00000165300			20295	protein-coding gene	gene with protein product		609680	"""leucine rich repeat containing 11"""	LRRC11		10048485, 14557068	Standard	NM_015567		Approved	bA364G4.2, KIAA0918	uc001vln.3	O94991	OTTHUMG00000017167	ENST00000325089.6:c.2829G>T	13.37:g.88330472G>T			B3KNB8|B4DSH5|Q5VT81	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.P943	ENST00000325089.6	37	c.2829	CCDS9465.1	13																																																																																			SLITRK5	-	NULL	ENSG00000165300		0.468	SLITRK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK5	HGNC	protein_coding	OTTHUMT00000045416.3		0.00	39	0	G			88330472	+1			no_errors	ENST00000325089	ensembl	human	known	74_37	silent	5.77	49	3	SNP	1.000	T
SNRPN	6638	genome.wustl.edu	37	15	25220656	25220656	+	Splice_Site	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:25220656A>C	ENST00000400100.1	+	8	1045	c.155A>C	c.(154-156)aAg>aCg	p.K52T	SNRPN_ENST00000400098.1_Splice_Site_p.K52T|SNRPN_ENST00000400097.1_Splice_Site_p.K52T|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000444203.2_Splice_Site_p.K56T|SNRPN_ENST00000390687.4_Splice_Site_p.K52T|SNRPN_ENST00000346403.6_Splice_Site_p.K52T|SNRPN_ENST00000554227.2_Splice_Site_p.K56T|SNRPN_ENST00000577565.1_Splice_Site_p.K52T|SNURF_ENST00000551312.2_Intron	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	52					response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		AGAAAGATCAAGTAAGGCTGA	0.463									Prader-Willi syndrome																																								0													126.0	122.0	123.0					15																	25220656		2203	4300	6503	SO:0001630	splice_region_variant	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.155+1A>C	15.37:g.25220656A>C			B3KVR1|P14648|P17135|Q0D2Q5	Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc,pirsf_snRNP-assoc_SmB/SmN	p.K56T	ENST00000400100.1	37	c.167	CCDS10017.1	15	.	.	.	.	.	.	.	.	.	.	A	17.77	3.471437	0.63737	.	.	ENSG00000128739	ENST00000400100;ENST00000400098;ENST00000400097;ENST00000554227;ENST00000390687;ENST00000444203	T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85	3.38	3.38	0.38709	Like-Sm ribonucleoprotein (LSM) domain, eukaryotic/archaea-type (1);Like-Sm ribonucleoprotein (LSM) domain (1);Like-Sm ribonucleoprotein (LSM)-related domain (1);	0.055265	0.64402	D	0.000001	T	0.63355	0.2504	M	0.73319	2.225	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.70716	0.97;0.97	T	0.66952	-0.5793	10	0.72032	D	0.01	-8.2681	10.3796	0.44104	1.0:0.0:0.0:0.0	.	56;52	B3KVR1;P63162	.;RSMN_HUMAN	T	52;52;52;56;52;56	ENSP00000382972:K52T;ENSP00000382970:K52T;ENSP00000382969:K52T;ENSP00000452342:K56T;ENSP00000375105:K52T;ENSP00000408767:K56T	ENSP00000375105:K52T	K	+	2	0	SNRPN	22771749	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	6.533000	0.73829	1.760000	0.52011	0.443000	0.29094	AAG	SNRPN	-	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc,pirsf_snRNP-assoc_SmB/SmN	ENSG00000128739		0.463	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRPN	HGNC	protein_coding	OTTHUMT00000413849.10	-	0.00	64	0	A	NM_003097	Missense_Mutation	25220656	+1	tier1	-	no_errors	ENST00000444203	ensembl	human	known	74_37	missense	21.05	105	28	SNP	1.000	C
SNRPN	6638	genome.wustl.edu	37	15	25223574	25223574	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:25223574C>T	ENST00000400100.1	+	13	1596	c.706C>T	c.(706-708)Cgt>Tgt	p.R236C	SNRPN_ENST00000400098.1_Missense_Mutation_p.R236C|SNHG14_ENST00000551631.2_RNA|SNRPN_ENST00000400097.1_Missense_Mutation_p.R236C|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000444203.2_Missense_Mutation_p.R240C|SNRPN_ENST00000390687.4_Missense_Mutation_p.R236C|SNRPN_ENST00000346403.6_Missense_Mutation_p.R236C|SNRPN_ENST00000554227.2_Missense_Mutation_p.R240C|SNRPN_ENST00000577565.1_Missense_Mutation_p.R236C|SNURF_ENST00000551312.2_Intron	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	236	Repeat-rich region.				response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		CCCAGGAATGCGTCCACCAAG	0.458									Prader-Willi syndrome																																								0													276.0	263.0	267.0					15																	25223574		1914	4129	6043	SO:0001583	missense	0	Familial Cancer Database	Prader-Labhart-Willi syndrome	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.706C>T	15.37:g.25223574C>T	ENSP00000382972:p.Arg236Cys		B3KVR1|P14648|P17135|Q0D2Q5	Missense_Mutation	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc,pirsf_snRNP-assoc_SmB/SmN	p.R240C	ENST00000400100.1	37	c.718	CCDS10017.1	15	.	.	.	.	.	.	.	.	.	.	C	13.25	2.179871	0.38511	.	.	ENSG00000128739	ENST00000400100;ENST00000400098;ENST00000400097;ENST00000554227;ENST00000390687;ENST00000444203	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	4.6	0.611	0.17586	.	0.254282	0.38164	N	0.001793	T	0.17704	0.0425	N	0.04297	-0.235	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.03641	-1.1017	10	0.41790	T	0.15	-1.1563	6.8565	0.24044	0.0:0.6158:0.0:0.3842	.	240;236	B3KVR1;P63162	.;RSMN_HUMAN	C	236;236;236;240;236;240	ENSP00000382972:R236C;ENSP00000382970:R236C;ENSP00000382969:R236C;ENSP00000452342:R240C;ENSP00000375105:R236C;ENSP00000408767:R240C	ENSP00000375105:R236C	R	+	1	0	SNRPN	22774667	1.000000	0.71417	0.782000	0.31804	0.994000	0.84299	3.545000	0.53648	0.034000	0.15491	0.591000	0.81541	CGT	SNRPN	-	pirsf_snRNP-assoc_SmB/SmN	ENSG00000128739		0.458	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRPN	HGNC	protein_coding	OTTHUMT00000413849.10	-	0.00	41	0	C	NM_003097		25223574	+1	tier1	-	no_errors	ENST00000444203	ensembl	human	known	74_37	missense	23.08	60	18	SNP	0.995	T
SNX14	57231	genome.wustl.edu	37	6	86224314	86224314	+	Missense_Mutation	SNP	G	G	A	rs377525323		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:86224314G>A	ENST00000314673.3	-	24	2478	c.2302C>T	c.(2302-2304)Cgt>Tgt	p.R768C	SNX14_ENST00000505648.1_Missense_Mutation_p.R716C|SNX14_ENST00000508980.1_5'UTR|SNX14_ENST00000369627.2_Missense_Mutation_p.R759C|SNX14_ENST00000513865.1_Missense_Mutation_p.R487C|SNX14_ENST00000346348.3_Missense_Mutation_p.R715C	NM_153816.3	NP_722523.1	Q9Y5W7	SNX14_HUMAN	sorting nexin 14	768					protein transport (GO:0015031)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)	phosphatidylinositol binding (GO:0035091)			NS(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(11)|skin(1)	22		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		TTTTCAGCACGGTTTGCATTA	0.299																																																	0								G	CYS/ARG,CYS/ARG	0,4406		0,0,2203	120.0	122.0	121.0		2143,2302	5.4	1.0	6		121	1,8597		0,1,4298	no	missense,missense	SNX14	NM_020468.3,NM_153816.3	180,180	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	715/894,768/947	86224314	1,13003	2203	4299	6502	SO:0001583	missense	0			AF121863	CCDS5003.1, CCDS5004.1, CCDS75490.1	6q15	2008-10-22			ENSG00000135317	ENSG00000135317		"""Sorting nexins"""	14977	protein-coding gene	gene with protein product						11485546, 11736640	Standard	XM_005248738		Approved	RGS-PX2	uc003pkr.3	Q9Y5W7	OTTHUMG00000015140	ENST00000314673.3:c.2302C>T	6.37:g.86224314G>A	ENSP00000313121:p.Arg768Cys		B4DI55|Q4VBR3|Q5TCF9|Q5TCG0|Q6NUI7|Q6PI37|Q9BSD1	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Phox,pfam_RGS_dom,superfamily_Phox,superfamily_Regulat_G_prot_signal_superfam,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal_superfam,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal_superfam	p.R768C	ENST00000314673.3	37	c.2302	CCDS5004.1	6	.	.	.	.	.	.	.	.	.	.	G	24.2	4.509791	0.85282	0.0	1.16E-4	ENSG00000135317	ENST00000346348;ENST00000369628;ENST00000314673;ENST00000513865;ENST00000505648;ENST00000369627;ENST00000515216;ENST00000418862	T;T;T;T;T;T	0.32988	1.87;1.87;1.43;1.87;1.86;1.85	5.36	5.36	0.76844	.	0.053835	0.85682	D	0.000000	T	0.29389	0.0732	N	0.22421	0.69	0.80722	D	1	D;B;D;D	0.76494	0.999;0.41;0.998;0.999	P;B;P;P	0.59221	0.854;0.017;0.719;0.854	T	0.02596	-1.1136	10	0.39692	T	0.17	-12.1882	19.4565	0.94892	0.0:0.0:1.0:0.0	.	759;715;768;716	Q9Y5W7-4;Q9Y5W7-2;Q9Y5W7;Q9Y5W7-3	.;.;SNX14_HUMAN;.	C	715;225;768;487;716;759;686;133	ENSP00000257769:R715C;ENSP00000313121:R768C;ENSP00000420938:R487C;ENSP00000427380:R716C;ENSP00000358641:R759C;ENSP00000425630:R686C	ENSP00000313121:R768C	R	-	1	0	SNX14	86281033	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.301000	0.96167	2.682000	0.91365	0.650000	0.86243	CGT	SNX14	-	NULL	ENSG00000135317		0.299	SNX14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX14	HGNC	protein_coding	OTTHUMT00000041393.2	-	0.00	34	0	G	NM_153816		86224314	-1	tier1	-	no_errors	ENST00000314673	ensembl	human	known	74_37	missense	38.46	8	5	SNP	1.000	A
SP8	221833	genome.wustl.edu	37	7	20824392	20824392	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:20824392G>T	ENST00000361443.4	-	3	1227	c.990C>A	c.(988-990)gcC>gcA	p.A330A	SP8_ENST00000418710.2_Silent_p.A348A	NM_198956.2	NP_945194.1	Q8IXZ3	SP8_HUMAN	Sp8 transcription factor	330					dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|proximal/distal pattern formation (GO:0009954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	8						AGTCGCAGGTGGCGCGGCCGG	0.776																																																	0													3.0	4.0	4.0					7																	20824392		1885	3744	5629	SO:0001819	synonymous_variant	0				CCDS5372.1, CCDS43555.1	7p21.2	2013-01-08			ENSG00000164651	ENSG00000164651		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	19196	protein-coding gene	gene with protein product		608306					Standard	NM_182700		Approved		uc003suz.3	Q8IXZ3	OTTHUMG00000094788	ENST00000361443.4:c.990C>A	7.37:g.20824392G>T			Q7Z615|Q7Z616|Q96MJ1	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2,prints_Antifreeze_1	p.A348	ENST00000361443.4	37	c.1044	CCDS5372.1	7																																																																																			SP8	-	NULL	ENSG00000164651		0.776	SP8-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SP8	HGNC	protein_coding	OTTHUMT00000326904.2	-	0.00	8	0	G			20824392	-1	tier1	-	no_errors	ENST00000418710	ensembl	human	known	74_37	silent	26.09	17	6	SNP	1.000	T
SPANXN1	494118	genome.wustl.edu	37	X	144337273	144337273	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:144337273C>A	ENST00000370493.3	+	2	917	c.158C>A	c.(157-159)gCg>gAg	p.A53E		NM_001009614.2	NP_001009614.1	Q5VSR9	SPXN1_HUMAN	SPANX family, member N1	53										endometrium(2)|kidney(2)|lung(8)|prostate(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;6.56e-05)					ACAGTATTAGCGTTTTGCTAC	0.428																																																	0													180.0	155.0	163.0					X																	144337273		2203	4297	6500	SO:0001583	missense	0				CCDS35421.1	Xq27.3	2009-03-25				ENSG00000203923			33174	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 6"""	300664				14973187, 17012309	Standard	NM_001009614		Approved	SPANX-N1, CT11.6	uc004fcb.2	Q5VSR9		ENST00000370493.3:c.158C>A	X.37:g.144337273C>A	ENSP00000359524:p.Ala53Glu			Missense_Mutation	SNP	pfam_SPANX_prot	p.A53E	ENST00000370493.3	37	c.158	CCDS35421.1	X	.	.	.	.	.	.	.	.	.	.	-	7.037	0.561702	0.13498	.	.	ENSG00000203923	ENST00000370493	T	0.06608	3.28	1.51	0.175	0.15045	.	.	.	.	.	T	0.04003	0.0112	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.43556	-0.9384	8	0.45353	T	0.12	.	1.5277	0.02529	0.307:0.217:0.0:0.4759	.	53	Q5VSR9	SPXN1_HUMAN	E	53	ENSP00000359524:A53E	ENSP00000359524:A53E	A	+	2	0	SPANXN1	144144965	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.217000	0.02979	-0.457000	0.07033	-1.350000	0.01237	GCG	SPANXN1	-	pfam_SPANX_prot	ENSG00000203923		0.428	SPANXN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXN1	HGNC	protein_coding	OTTHUMT00000058631.2	-	0.00	67	0	C	NM_001009614		144337273	+1	tier1	-	no_errors	ENST00000370493	ensembl	human	known	74_37	missense	35.53	49	27	SNP	0.000	A
SPATA31A6	389730	genome.wustl.edu	37	9	43627999	43627999	+	Missense_Mutation	SNP	G	G	A	rs562864863	byFrequency	TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:43627999G>A	ENST00000332857.6	-	4	716	c.688C>T	c.(688-690)Cgg>Tgg	p.R230W	SPATA31A6_ENST00000496386.1_5'UTR	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	230					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GTGGAGTCCCGCAGGGGAGGA	0.587													G|||	65	0.0129792	0.0469	0.0014	5008	,	,		16086	0.0		0.0	False		,,,				2504	0.002																0																																										SO:0001583	missense	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.688C>T	9.37:g.43627999G>A	ENSP00000329825:p.Arg230Trp			Missense_Mutation	SNP	NULL	p.R230W	ENST00000332857.6	37	c.688	CCDS47973.1	9	.	.	.	.	.	.	.	.	.	.	G	5.300	0.240738	0.10077	.	.	ENSG00000185775	ENST00000332857	T	0.04502	3.61	1.54	-0.533	0.11887	.	0.927636	0.08745	N	0.899951	T	0.05410	0.0143	L	0.58101	1.795	0.09310	N	1	B	0.15473	0.013	B	0.09377	0.004	T	0.42965	-0.9420	10	0.51188	T	0.08	4.561	2.3745	0.04338	0.1931:0.0:0.5176:0.2894	.	230	Q5VVP1	F75A6_HUMAN	W	230	ENSP00000329825:R230W	ENSP00000329825:R230W	R	-	1	2	FAM75A6	43567995	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.211000	0.09332	-0.163000	0.10946	-1.277000	0.01392	CGG	SPATA31A6	-	NULL	ENSG00000185775		0.587	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A6	HGNC	protein_coding	OTTHUMT00000036987.1	-	0.00	8	0	G	NM_001145196		43627999	-1	tier1	-	no_errors	ENST00000332857	ensembl	human	known	74_37	missense	93.75	1	15	SNP	0.000	A
RP11-383M4.6	0	genome.wustl.edu	37	9	84562504	84562504	+	lincRNA	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:84562504A>G	ENST00000585776.1	-	0	942				SPATA31D3_ENST00000334208.4_RNA																							ACTGCCCCAAAAAACCATCTC	0.483																																																	0													24.0	24.0	24.0					9																	84562504		655	1562	2217			0																															9.37:g.84562504A>G				RNA	SNP	-	NULL	ENST00000585776.1	37	NULL		9																																																																																			SPATA31D3	-	-	ENSG00000186788		0.483	RP11-383M4.6-001	KNOWN	basic	lincRNA	SPATA31D3	HGNC	lincRNA	OTTHUMT00000453562.1	-	0.00	109	0	A			84562504	+1	tier1	-	no_errors	ENST00000334208	ensembl	human	known	74_37	rna	17.24	96	20	SNP	0.004	G
SPTLC2	9517	genome.wustl.edu	37	14	77978710	77978710	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr14:77978710G>A	ENST00000216484.2	-	12	1799	c.1606C>T	c.(1606-1608)Cag>Tag	p.Q536*		NM_004863.3	NP_004854.1	O15270	SPTC2_HUMAN	serine palmitoyltransferase, long chain base subunit 2	536					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|serine C-palmitoyltransferase complex (GO:0017059)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(5)	19			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0346)	L-Serine(DB00133)	TACTTCAGCTGCAATAGGTCC	0.483																																																	0													139.0	127.0	131.0					14																	77978710		2203	4300	6503	SO:0001587	stop_gained	0			AB011098	CCDS9865.1	14q24.3	2014-09-17			ENSG00000100596	ENSG00000100596	2.3.1.50		11278	protein-coding gene	gene with protein product		605713				8921873, 9363775	Standard	NM_004863		Approved	KIAA0526, LCB2, LCB2A, hLCB2a	uc001xub.3	O15270		ENST00000216484.2:c.1606C>T	14.37:g.77978710G>A	ENSP00000216484:p.Gln536*		Q16685	Nonsense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase	p.Q536*	ENST00000216484.2	37	c.1606	CCDS9865.1	14	.	.	.	.	.	.	.	.	.	.	G	38	6.648687	0.97734	.	.	ENSG00000100596	ENST00000216484	.	.	.	5.56	5.56	0.83823	.	0.111999	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-5.8256	15.2113	0.73225	0.0:0.0:0.8587:0.1413	.	.	.	.	X	536	.	ENSP00000216484:Q536X	Q	-	1	0	SPTLC2	77048463	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	6.453000	0.73488	2.617000	0.88574	0.644000	0.83932	CAG	SPTLC2	-	superfamily_PyrdxlP-dep_Trfase	ENSG00000100596		0.483	SPTLC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC2	HGNC	protein_coding	OTTHUMT00000414030.1		0.00	68	0	G	NM_004863		77978710	-1			no_errors	ENST00000216484	ensembl	human	known	74_37	nonsense	7.14	52	4	SNP	1.000	A
SRBD1	55133	genome.wustl.edu	37	2	45616543	45616543	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:45616543A>G	ENST00000263736.4	-	21	2956	c.2894T>C	c.(2893-2895)cTt>cCt	p.L965P	SRBD1_ENST00000535761.1_Missense_Mutation_p.L484P|SRBD1_ENST00000490133.1_5'UTR	NM_018079.4	NP_060549.4	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1	965	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				nucleobase-containing compound metabolic process (GO:0006139)		hydrolase activity, acting on ester bonds (GO:0016788)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(13)|large_intestine(8)|lung(15)|skin(2)|stomach(1)|urinary_tract(1)	49		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			GCCCAGTCCAAGGCTTCTTCT	0.443																																																	0													87.0	89.0	88.0					2																	45616543		2203	4300	6503	SO:0001583	missense	0			AK056536	CCDS1823.1	2p21	2008-02-05			ENSG00000068784	ENSG00000068784			25521	protein-coding gene	gene with protein product						12477932	Standard	NM_018079		Approved	FLJ10379	uc002rus.3	Q8N5C6	OTTHUMG00000128814	ENST00000263736.4:c.2894T>C	2.37:g.45616543A>G	ENSP00000263736:p.Leu965Pro		Q53T56|Q96TA4|Q9NW11	Missense_Mutation	SNP	pfam_Tex-like_N,pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold,superfamily_RuvA_2-like,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.L965P	ENST00000263736.4	37	c.2894	CCDS1823.1	2	.	.	.	.	.	.	.	.	.	.	A	20.3	3.968026	0.74131	.	.	ENSG00000068784	ENST00000263736;ENST00000535761	T;T	0.44083	0.93;0.93	4.14	4.14	0.48551	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.000000	0.64402	D	0.000001	T	0.52757	0.1754	L	0.33485	1.01	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.57277	-0.7839	10	0.72032	D	0.01	.	14.2157	0.65792	1.0:0.0:0.0:0.0	.	965	Q8N5C6	SRBD1_HUMAN	P	965;484	ENSP00000263736:L965P;ENSP00000441272:L484P	ENSP00000263736:L965P	L	-	2	0	SRBD1	45470047	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	8.539000	0.90637	2.096000	0.63516	0.460000	0.39030	CTT	SRBD1	-	pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000068784		0.443	SRBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRBD1	HGNC	protein_coding	OTTHUMT00000250747.3	-	0.00	60	0	A	NM_018079		45616543	-1	tier1	-	no_errors	ENST00000263736	ensembl	human	known	74_37	missense	35.62	47	26	SNP	1.000	G
SRPK1	6732	genome.wustl.edu	37	6	35838068	35838068	+	Silent	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:35838068T>C	ENST00000373825.2	-	10	1266	c.981A>G	c.(979-981)caA>caG	p.Q327Q	SRPK1_ENST00000373822.1_Silent_p.Q220Q|SRPK1_ENST00000423325.2_Silent_p.Q311Q					SRSF protein kinase 1											endometrium(2)|large_intestine(10)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21						CAAGTTTTTCTTGGGTCATTT	0.358																																					NSCLC(31;67 978 16289 24856 26454)												0													94.0	87.0	90.0					6																	35838068		1824	4069	5893	SO:0001819	synonymous_variant	0			U09564	CCDS47415.1	6p21.31	2010-06-23	2010-06-23		ENSG00000096063	ENSG00000096063			11305	protein-coding gene	gene with protein product	"""SR protein kinase 1"", ""serine/arginine-rich splicing factor kinase 1"""	601939	"""SFRS protein kinase 1"""			8208298, 10198174	Standard	NM_003137		Approved	SFRSK1	uc003olj.3	Q96SB4	OTTHUMG00000014583	ENST00000373825.2:c.981A>G	6.37:g.35838068T>C				Silent	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.Q327	ENST00000373825.2	37	c.981	CCDS47415.1	6																																																																																			SRPK1	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	ENSG00000096063		0.358	SRPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPK1	HGNC	protein_coding	OTTHUMT00000040319.3	-	0.00	48	0	T	NM_003137		35838068	-1	tier1	-	no_errors	ENST00000373825	ensembl	human	known	74_37	silent	7.14	52	4	SNP	0.963	C
ST6GALNAC5	81849	genome.wustl.edu	37	1	77334346	77334346	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:77334346G>A	ENST00000477717.1	+	2	415	c.180G>A	c.(178-180)gcG>gcA	p.A60A	ST6GALNAC5_ENST00000496845.1_3'UTR	NM_030965.1	NP_112227.1	Q9BVH7	SIA7E_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 5	60					glycosphingolipid biosynthetic process (GO:0006688)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	integral component of Golgi membrane (GO:0030173)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	18						AGCCGGCGGCGGAGAGCAGCA	0.746																																																	0													4.0	6.0	5.0					1																	77334346		2031	3902	5933	SO:0001819	synonymous_variant	0				CCDS673.1	1p31.1	2013-03-01	2005-02-07	2005-02-07	ENSG00000117069	ENSG00000117069		"""Sialyltransferases"""	19342	protein-coding gene	gene with protein product		610134	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) E"""	SIAT7E		10521438, 10601645	Standard	NM_030965		Approved	MGC3184, ST6GalNAcV	uc001dhi.3	Q9BVH7	OTTHUMG00000009687	ENST00000477717.1:c.180G>A	1.37:g.77334346G>A			B1AK82	Silent	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.A60	ENST00000477717.1	37	c.180	CCDS673.1	1																																																																																			ST6GALNAC5	-	pirsf_Sialyl_trans	ENSG00000117069		0.746	ST6GALNAC5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC5	HGNC	protein_coding	OTTHUMT00000026692.2	-	0.00	31	0	G	NM_030965		77334346	+1	tier1	-	no_errors	ENST00000477717	ensembl	human	known	74_37	silent	42.86	16	12	SNP	0.997	A
ST8SIA2	8128	genome.wustl.edu	37	15	92977596	92977596	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:92977596T>C	ENST00000268164.3	+	3	518	c.281T>C	c.(280-282)cTg>cCg	p.L94P	ST8SIA2_ENST00000539113.1_Missense_Mutation_p.L73P	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	94					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			ACGCTCTCTCTGAGGATCAGG	0.473																																																	0													141.0	111.0	121.0					15																	92977596		2198	4298	6496	SO:0001583	missense	0			U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.281T>C	15.37:g.92977596T>C	ENSP00000268164:p.Leu94Pro		Q4VAZ0|Q92470|Q92746	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.L94P	ENST00000268164.3	37	c.281	CCDS10372.1	15	.	.	.	.	.	.	.	.	.	.	T	15.65	2.895803	0.52121	.	.	ENSG00000140557	ENST00000268164;ENST00000539113	T;T	0.18960	2.18;2.45	5.65	5.65	0.86999	.	0.499968	0.19793	N	0.105922	T	0.28067	0.0692	L	0.48642	1.525	0.80722	D	1	P;P	0.50443	0.472;0.935	B;P	0.48627	0.133;0.584	T	0.01192	-1.1423	10	0.30078	T	0.28	-0.3442	15.888	0.79269	0.0:0.0:0.0:1.0	.	73;94	C6G488;Q92186	.;SIA8B_HUMAN	P	94;73	ENSP00000268164:L94P;ENSP00000437382:L73P	ENSP00000268164:L94P	L	+	2	0	ST8SIA2	90778600	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.862000	0.56009	2.147000	0.66899	0.533000	0.62120	CTG	ST8SIA2	-	pirsf_Sialyl_trans	ENSG00000140557		0.473	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA2	HGNC	protein_coding	OTTHUMT00000313526.1	-	0.00	56	0	T	NM_006011		92977596	+1	tier1	-	no_errors	ENST00000268164	ensembl	human	known	74_37	missense	20.88	72	19	SNP	1.000	C
STAG2	10735	genome.wustl.edu	37	X	123215374	123215374	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:123215374C>T	ENST00000371160.1	+	28	3210	c.2920C>T	c.(2920-2922)Cac>Tac	p.H974Y	STAG2_ENST00000354548.5_Missense_Mutation_p.H905Y|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.H974Y|STAG2_ENST00000371157.3_Missense_Mutation_p.H974Y|STAG2_ENST00000371144.3_Missense_Mutation_p.H974Y|STAG2_ENST00000371145.3_Missense_Mutation_p.H974Y	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	974					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TGCCATGCTACACAAGTAATC	0.313																																																	0													94.0	90.0	91.0					X																	123215374		2203	4300	6503	SO:0001583	missense	0			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.2920C>T	X.37:g.123215374C>T	ENSP00000360202:p.His974Tyr		B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.H974Y	ENST00000371160.1	37	c.2920	CCDS14607.1	X	.	.	.	.	.	.	.	.	.	.	C	26.1	4.701667	0.88924	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T	0.47869	1.14;0.86;0.83;0.83;1.14;0.83	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.73289	0.3568	M	0.88570	2.965	0.80722	D	1	D;D	0.61697	0.99;0.982	P;P	0.62014	0.897;0.792	T	0.78623	-0.2132	10	0.72032	D	0.01	-7.4033	19.0619	0.93096	0.0:1.0:0.0:0.0	.	974;974	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	Y	974;905;974;974;974;974	ENSP00000218089:H974Y;ENSP00000346555:H905Y;ENSP00000360202:H974Y;ENSP00000360199:H974Y;ENSP00000360187:H974Y;ENSP00000360186:H974Y	ENSP00000218089:H974Y	H	+	1	0	STAG2	123043055	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.818000	0.86416	2.452000	0.82932	0.538000	0.68166	CAC	STAG2	-	NULL	ENSG00000101972		0.313	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAG2	HGNC	protein_coding	OTTHUMT00000156159.2	-	0.00	40	0	C	NM_006603		123215374	+1	tier1	-	no_errors	ENST00000218089	ensembl	human	known	74_37	missense	100.00	0	51	SNP	1.000	T
STAT2	6773	genome.wustl.edu	37	12	56737822	56737822	+	Missense_Mutation	SNP	T	T	A	rs56067838		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:56737822T>A	ENST00000314128.4	-	23	2223	c.2200A>T	c.(2200-2202)Agc>Tgc	p.S734C	STAT2_ENST00000557235.1_Missense_Mutation_p.S730C|STAT2_ENST00000556539.1_5'UTR			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	734					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						aagtccaggctgagctctggc	0.582																																																	0													37.0	34.0	35.0					12																	56737822		2203	4300	6503	SO:0001583	missense	0			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.2200A>T	12.37:g.56737822T>A	ENSP00000315768:p.Ser734Cys		B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT2_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.S734C	ENST00000314128.4	37	c.2200	CCDS8917.1	12	.	.	.	.	.	.	.	.	.	.	T	10.09	1.255218	0.22965	.	.	ENSG00000170581	ENST00000314128;ENST00000557235	D;D	0.86562	-2.14;-2.14	4.12	-2.71	0.05986	.	1.757540	0.03221	N	0.177524	T	0.72534	0.3472	N	0.12182	0.205	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.57347	-0.7827	10	0.46703	T	0.11	0.295	1.2094	0.01902	0.1585:0.2323:0.1562:0.4529	.	730;734	G3V2M6;P52630	.;STAT2_HUMAN	C	734;730	ENSP00000315768:S734C;ENSP00000450751:S730C	ENSP00000315768:S734C	S	-	1	0	STAT2	55024089	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.357000	0.07651	-0.550000	0.06183	-0.366000	0.07423	AGC	STAT2	-	NULL	ENSG00000170581		0.582	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	HGNC	protein_coding	OTTHUMT00000410277.1	-	0.00	46	0	T	NM_005419		56737822	-1	tier1	-	no_errors	ENST00000314128	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.000	A
STEAP4	79689	genome.wustl.edu	37	7	87913376	87913376	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr7:87913376G>A	ENST00000380079.4	-	2	310	c.209C>T	c.(208-210)gCa>gTa	p.A70V	AC003991.3_ENST00000595121.1_RNA|STEAP4_ENST00000301959.5_Missense_Mutation_p.A70V|AC003991.3_ENST00000600908.1_RNA|AC003991.3_ENST00000434733.1_RNA|STEAP4_ENST00000414498.1_Missense_Mutation_p.A70V|AC003991.3_ENST00000447758.1_RNA	NM_001205315.1|NM_024636.3	NP_001192244.1|NP_078912.2	Q687X5	STEA4_HUMAN	STEAP family member 4	70					copper ion import (GO:0015677)|fat cell differentiation (GO:0045444)|ferric iron import into cell (GO:0097461)|iron ion homeostasis (GO:0055072)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(3)	15	Esophageal squamous(14;0.00802)					CTTCTTGGCTGCTTCTGAATA	0.423																																																	0													129.0	121.0	123.0					7																	87913376		1856	4089	5945	SO:0001583	missense	0			AK026806	CCDS43611.1, CCDS56494.1	7q21.13	2014-01-28	2005-06-15	2005-06-15	ENSG00000127954	ENSG00000127954			21923	protein-coding gene	gene with protein product		611098	"""tumor necrosis factor, alpha-induced protein 9"""	TNFAIP9		11443137, 15897894	Standard	NM_024636		Approved	FLJ23153, TIARP, STAMP2	uc003ujs.3	Q687X5	OTTHUMG00000153853	ENST00000380079.4:c.209C>T	7.37:g.87913376G>A	ENSP00000369419:p.Ala70Val		Q658Q9|Q687X4|Q8WWB0|Q9H5R1	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom	p.A70V	ENST00000380079.4	37	c.209	CCDS43611.1	7	.	.	.	.	.	.	.	.	.	.	G	22.2	4.257843	0.80246	.	.	ENSG00000127954	ENST00000380079;ENST00000301959;ENST00000414498	T;T;T	0.56103	0.48;0.48;0.48	5.91	5.91	0.95273	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.75642	0.3877	M	0.76938	2.355	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.989;0.996;0.996	T	0.76884	-0.2794	10	0.87932	D	0	-10.6822	20.3011	0.98612	0.0:0.0:1.0:0.0	.	70;70;70	Q687X5-2;C9JS50;Q687X5	.;.;STEA4_HUMAN	V	70	ENSP00000369419:A70V;ENSP00000305545:A70V;ENSP00000394399:A70V	ENSP00000305545:A70V	A	-	2	0	STEAP4	87751312	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	6.540000	0.73861	2.804000	0.96469	0.650000	0.86243	GCA	STEAP4	-	NULL	ENSG00000127954		0.423	STEAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP4	HGNC	protein_coding	OTTHUMT00000332712.4	-	0.00	42	0	G	NM_024636		87913376	-1	tier1	-	no_errors	ENST00000380079	ensembl	human	known	74_37	missense	41.18	30	21	SNP	1.000	A
STIM1	6786	genome.wustl.edu	37	11	4091262	4091262	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:4091262G>A	ENST00000300737.4	+	6	1189	c.620G>A	c.(619-621)cGc>cAc	p.R207H	STIM1_ENST00000527651.1_Missense_Mutation_p.R207H|STIM1_ENST00000533977.1_Missense_Mutation_p.R34H|STIM1_ENST00000527484.1_3'UTR	NM_003156.3	NP_003147.2	Q13586	STIM1_HUMAN	stromal interaction molecule 1	207					activation of store-operated calcium channel activity (GO:0032237)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|regulation of calcium ion transport (GO:0051924)|regulation of store-operated calcium entry (GO:2001256)|store-operated calcium entry (GO:0002115)	cortical endoplasmic reticulum (GO:0032541)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|growth cone (GO:0030426)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of plasma membrane (GO:0005887)|microtubule (GO:0005874)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|microtubule plus-end binding (GO:0051010)|store-operated calcium channel activity (GO:0015279)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|liver(1)|lung(14)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		GCAGTGACTCGCCATAATCAC	0.537																																																	0													195.0	170.0	179.0					11																	4091262		2201	4298	6499	SO:0001583	missense	0			BC021300, U52426	CCDS7749.1, CCDS60706.1, CCDS73247.1	11p15.5	2014-09-17			ENSG00000167323	ENSG00000167323		"""Sterile alpha motif (SAM) domain containing"""	11386	protein-coding gene	gene with protein product		605921				8921403, 11463338, 11983428	Standard	NM_003156		Approved	GOK, D11S4896E	uc021qco.1	Q13586	OTTHUMG00000133360	ENST00000300737.4:c.620G>A	11.37:g.4091262G>A	ENSP00000300737:p.Arg207His		E9PQJ4|Q8N382	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R207H	ENST00000300737.4	37	c.620	CCDS7749.1	11	.	.	.	.	.	.	.	.	.	.	G	28.1	4.894904	0.91962	.	.	ENSG00000167323	ENST00000300737;ENST00000527651;ENST00000532919;ENST00000533977	T;T;T	0.78126	-0.19;-1.15;-0.18	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.77011	0.4068	N	0.08118	0	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.64410	0.818;0.925	T	0.79247	-0.1882	10	0.40728	T	0.16	-6.0432	18.9634	0.92685	0.0:0.0:1.0:0.0	.	207;207	E9PQJ4;Q13586	.;STIM1_HUMAN	H	207;207;133;34	ENSP00000300737:R207H;ENSP00000436208:R207H;ENSP00000434767:R34H	ENSP00000300737:R207H	R	+	2	0	STIM1	4047838	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.320000	0.79064	2.825000	0.97269	0.655000	0.94253	CGC	STIM1	-	NULL	ENSG00000167323		0.537	STIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STIM1	HGNC	protein_coding	OTTHUMT00000257196.1		0.00	100	0	G	NM_003156		4091262	+1			no_errors	ENST00000300737	ensembl	human	known	74_37	missense	5.26	72	4	SNP	1.000	A
SUMO3	6612	genome.wustl.edu	37	21	46228430	46228430	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr21:46228430delA	ENST00000397893.3	-	4	275	c.276delT	c.(274-276)tttfs	p.F92fs	SUMO3_ENST00000411651.2_Intron|SUMO3_ENST00000332859.6_Intron|SUMO3_ENST00000479153.1_Intron|SUMO3_ENST00000397898.3_Intron					small ubiquitin-like modifier 3											prostate(1)	1				Colorectal(79;0.058)		actccgtctcaaaaaaaaaag	0.498																																																	0																																										SO:0001589	frameshift_variant	0				CCDS33587.1, CCDS68220.1	21q22.3	2013-06-05	2013-06-05	2004-05-19	ENSG00000184900	ENSG00000184900			11124	protein-coding gene	gene with protein product		602231	"""SMT3 (suppressor of mif two 3, yeast) homolog 1"", ""SMT3 suppressor of mif two 3 homolog 3 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)"""	SMT3H1		9119407	Standard	NM_006936		Approved	SMT3A	uc002zfz.1	P55854	OTTHUMG00000090256	ENST00000397893.3:c.276delT	21.37:g.46228430delA	ENSP00000380990:p.Phe92fs			Frame_Shift_Del	DEL	pfam_Rad60/SUMO_like,pfam_Ubiquitin_dom,smart_Ubiquitin_dom	p.F92fs	ENST00000397893.3	37	c.276		21																																																																																			SUMO3	-	NULL	ENSG00000184900		0.498	SUMO3-005	PUTATIVE	basic|exp_conf	protein_coding	SUMO3	HGNC	protein_coding	OTTHUMT00000206564.1		0.00	19	0	A			46228430	-1			no_errors	ENST00000397893	ensembl	human	putative	74_37	frame_shift_del	37.50	5	3	DEL	0.008	0
SUV420H1	51111	genome.wustl.edu	37	11	67939073	67939073	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:67939073T>A	ENST00000304363.4	-	7	1110	c.757A>T	c.(757-759)Atg>Ttg	p.M253L	SUV420H1_ENST00000402789.1_Missense_Mutation_p.M253L|SUV420H1_ENST00000401547.2_Missense_Mutation_p.M253L|SUV420H1_ENST00000405515.1_Missense_Mutation_p.M253L|SUV420H1_ENST00000402185.2_Missense_Mutation_p.M230L	NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	253	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						GTGGAGTACATGACACTGAAG	0.438																																																	0													134.0	132.0	133.0					11																	67939073		2200	4294	6494	SO:0001583	missense	0			AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.757A>T	11.37:g.67939073T>A	ENSP00000305899:p.Met253Leu		B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.M253L	ENST00000304363.4	37	c.757	CCDS31623.1	11	.	.	.	.	.	.	.	.	.	.	T	32	5.190871	0.94923	.	.	ENSG00000110066	ENST00000304363;ENST00000401547;ENST00000405515;ENST00000402789;ENST00000402185	D;D;D;D;D	0.85411	-1.98;-1.98;-1.98;-1.98;-1.98	5.73	5.73	0.89815	SET domain (2);	0.073897	0.85682	D	0.000000	T	0.78710	0.4326	L	0.27975	0.815	0.80722	D	1	B;B;B;P	0.39809	0.381;0.277;0.123;0.689	B;B;B;B	0.38056	0.158;0.264;0.038;0.175	T	0.80603	-0.1309	10	0.51188	T	0.08	-32.4385	16.3197	0.82945	0.0:0.0:0.0:1.0	.	230;253;253;253	B7WNX0;B5MCB3;Q4FZB7-2;Q4FZB7	.;.;.;SV421_HUMAN	L	253;253;253;253;230	ENSP00000305899:M253L;ENSP00000385965:M253L;ENSP00000385640:M253L;ENSP00000385005:M253L;ENSP00000384724:M230L	ENSP00000305899:M253L	M	-	1	0	SUV420H1	67695649	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.997000	0.88414	2.302000	0.77476	0.533000	0.62120	ATG	SUV420H1	-	pfam_SET_dom,smart_SET_dom	ENSG00000110066		0.438	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H1	HGNC	protein_coding	OTTHUMT00000318319.1	-	0.00	58	0	T	NM_017635		67939073	-1	tier1	-	no_errors	ENST00000304363	ensembl	human	known	74_37	missense	64.20	29	52	SNP	1.000	A
SYNDIG1	79953	genome.wustl.edu	37	20	24523983	24523983	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr20:24523983G>A	ENST00000376862.3	+	2	883	c.250G>A	c.(250-252)Gag>Aag	p.E84K		NM_024893.1	NP_079169.1	Q9H7V2	SYNG1_HUMAN	synapse differentiation inducing 1	84					intracellular protein transport (GO:0006886)|positive regulation of synapse assembly (GO:0051965)|response to biotic stimulus (GO:0009607)|synaptic vesicle clustering (GO:0097091)	cell body (GO:0044297)|cell junction (GO:0030054)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	glutamate receptor binding (GO:0035254)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(1)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	24						GCAGTCAGTGGAGTCCCGCTA	0.672																																																	0													45.0	44.0	44.0					20																	24523983		2203	4300	6503	SO:0001583	missense	0			AK024282	CCDS13164.1	20p11.21	2011-06-30	2011-06-30	2011-06-30	ENSG00000101463	ENSG00000101463			15885	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 5"", ""synapse differentiation induced gene 1"""	614311	"""chromosome 20 open reading frame 39"", ""transmembrane protein 90B"""	C20orf39, TMEM90B		20152115	Standard	NM_024893		Approved	FLJ14220, IFITMD5, SynDIG1	uc002wtw.1	Q9H7V2	OTTHUMG00000032104	ENST00000376862.3:c.250G>A	20.37:g.24523983G>A	ENSP00000366058:p.Glu84Lys		Q6IA30|Q9H514	Missense_Mutation	SNP	pfam_CD225/Dispanin_fam	p.E84K	ENST00000376862.3	37	c.250	CCDS13164.1	20	.	.	.	.	.	.	.	.	.	.	G	13.02	2.111407	0.37242	.	.	ENSG00000101463	ENST00000376862	D	0.93247	-3.19	5.95	4.99	0.66335	.	0.330416	0.31660	N	0.007279	D	0.92113	0.7500	M	0.69823	2.125	0.44918	D	0.997931	B	0.27559	0.181	B	0.21151	0.033	D	0.90630	0.4566	10	0.87932	D	0	-19.8784	14.7808	0.69766	0.0:0.1575:0.8425:0.0	.	84	Q9H7V2	SYNG1_HUMAN	K	84	ENSP00000366058:E84K	ENSP00000366058:E84K	E	+	1	0	SYNDIG1	24471983	1.000000	0.71417	0.906000	0.35671	0.339000	0.28857	7.323000	0.79105	1.505000	0.48720	-0.211000	0.12701	GAG	SYNDIG1	-	NULL	ENSG00000101463		0.672	SYNDIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNDIG1	HGNC	protein_coding	OTTHUMT00000078376.1	-	0.00	53	0	G	NM_024893		24523983	+1	tier1	-	no_errors	ENST00000376862	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.994	A
SYNE1	23345	genome.wustl.edu	37	6	152668334	152668334	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:152668334A>C	ENST00000367255.5	-	73	12539	c.11938T>G	c.(11938-11940)Ttg>Gtg	p.L3980V	SYNE1_ENST00000448038.1_Missense_Mutation_p.L3909V|SYNE1_ENST00000423061.1_Missense_Mutation_p.L3909V|SYNE1_ENST00000341594.5_Intron|SYNE1_ENST00000265368.4_Missense_Mutation_p.L3980V	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	3980					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGATTGTTCAAACGGTCTTCA	0.393										HNSCC(10;0.0054)																																							0													133.0	118.0	123.0					6																	152668334		2203	4300	6503	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.11938T>G	6.37:g.152668334A>C	ENSP00000356224:p.Leu3980Val		E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L3980V	ENST00000367255.5	37	c.11938	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	A	11.42	1.632921	0.29068	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038	T;T;T;T	0.37235	1.35;1.21;1.35;1.21	5.91	0.895	0.19247	.	0.000000	0.47852	D	0.000209	T	0.37571	0.1008	M	0.66939	2.045	0.80722	D	1	D;D;D;B	0.89917	1.0;1.0;1.0;0.0	D;D;D;B	0.83275	0.996;0.996;0.996;0.0	T	0.22836	-1.0205	10	0.21540	T	0.41	.	10.2639	0.43443	0.5718:0.0:0.4282:0.0	.	3980;3980;3980;3909	B7ZBC3;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	V	3980;3909;3980;3909	ENSP00000356224:L3980V;ENSP00000396024:L3909V;ENSP00000265368:L3980V;ENSP00000390975:L3909V	ENSP00000265368:L3980V	L	-	1	2	SYNE1	152710027	0.998000	0.40836	0.994000	0.49952	0.990000	0.78478	1.184000	0.32053	-0.061000	0.13110	0.533000	0.62120	TTG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC1_TM_dom,smart_Spectrin/alpha-actinin	ENSG00000131018		0.393	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	-	0.00	46	0	A	NM_182961		152668334	-1	tier1	-	no_errors	ENST00000265368	ensembl	human	known	74_37	missense	38.71	19	12	SNP	0.966	C
TBC1D1	23216	genome.wustl.edu	37	4	38134385	38134385	+	Intron	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:38134385G>T	ENST00000261439.4	+	19	3487				TBC1D1_ENST00000407365.1_Intron|TBC1D1_ENST00000508802.1_Intron	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						AGTGAAATAAGAACTAAAAAT	0.284																																																	0																																										SO:0001627	intron_variant	0			AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.3133-320G>T	4.37:g.38134385G>T			B7Z3D9|E9PGH8|Q96K82|Q9UPP4	RNA	SNP	-	NULL	ENST00000261439.4	37	NULL	CCDS33972.1	4																																																																																			TBC1D1	-	-	ENSG00000065882		0.284	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D1	HGNC	protein_coding	OTTHUMT00000317443.2	-	0.00	69	0	G	NM_015173		38134385	+1	tier1	-	no_errors	ENST00000405444	ensembl	human	known	74_37	rna	64.08	36	66	SNP	0.003	T
TBL1XR1	79718	genome.wustl.edu	37	3	176771694	176771694	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:176771694G>A	ENST00000430069.1	-	4	330	c.71C>T	c.(70-72)tCa>tTa	p.S24L	TBL1XR1_ENST00000457928.2_Missense_Mutation_p.S24L			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	24	LisH. {ECO:0000255|PROSITE- ProRule:PRU00126}.				canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			GGTAAATGCTGAATGAGAAAA	0.378																																																	0													80.0	77.0	78.0					3																	176771694		1849	4098	5947	SO:0001583	missense	0			AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.71C>T	3.37:g.176771694G>A	ENSP00000405574:p.Ser24Leu		D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S24L	ENST00000430069.1	37	c.71	CCDS46961.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.295954	0.95574	.	.	ENSG00000177565	ENST00000430069;ENST00000457928;ENST00000352800;ENST00000437738;ENST00000450267;ENST00000431674;ENST00000422066;ENST00000443315;ENST00000422442;ENST00000427349;ENST00000413084	T;T;T;T;T;T;T;T;T;T;T	0.80123	-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34;-1.34	5.32	5.32	0.75619	LisH dimerisation motif (2);LisH dimerisation motif, subgroup (1);	0.000000	0.85682	D	0.000000	D	0.92047	0.7480	M	0.90870	3.155	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93461	0.6810	10	0.87932	D	0	-6.6605	18.3675	0.90397	0.0:0.0:1.0:0.0	.	24	Q9BZK7	TBL1R_HUMAN	L	24	ENSP00000405574:S24L;ENSP00000413251:S24L;ENSP00000263964:S24L;ENSP00000392180:S24L;ENSP00000406297:S24L;ENSP00000397450:S24L;ENSP00000398477:S24L;ENSP00000396120:S24L;ENSP00000387849:S24L;ENSP00000401044:S24L;ENSP00000415506:S24L	ENSP00000263964:S24L	S	-	2	0	TBL1XR1	178254388	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.869000	0.99810	2.660000	0.90430	0.655000	0.94253	TCA	TBL1XR1	-	pfam_LisH_dimerisation_subgr,smart_LisH_dimerisation,pfscan_LisH_dimerisation	ENSG00000177565		0.378	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL1XR1	HGNC	protein_coding	OTTHUMT00000347587.3	-	0.00	49	0	G	NM_024665		176771694	-1	tier1	-	no_errors	ENST00000430069	ensembl	human	known	74_37	missense	40.00	50	34	SNP	1.000	A
TCF23	150921	genome.wustl.edu	37	2	27375630	27375630	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:27375630C>T	ENST00000296096.5	+	3	670	c.540C>T	c.(538-540)acC>acT	p.T180T		NM_175769.2	NP_786951.1	Q7RTU1	TCF23_HUMAN	transcription factor 23	180					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	nucleus (GO:0005634)				large_intestine(2)|lung(11)|prostate(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGCCAGCACCCCCAGCCAAA	0.572																																																	0													87.0	83.0	84.0					2																	27375630		2203	4300	6503	SO:0001819	synonymous_variant	0			AC013403	CCDS33163.1	2p23.3	2013-05-21			ENSG00000163792	ENSG00000163792		"""Basic helix-loop-helix proteins"""	18602	protein-coding gene	gene with protein product		609635				11701948, 10652346	Standard	NM_175769		Approved	OUT, bHLHa24	uc010ylg.2	Q7RTU1	OTTHUMG00000152031	ENST00000296096.5:c.540C>T	2.37:g.27375630C>T			B2RNZ3	Silent	SNP	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.T180	ENST00000296096.5	37	c.540	CCDS33163.1	2																																																																																			TCF23	-	NULL	ENSG00000163792		0.572	TCF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF23	HGNC	protein_coding	OTTHUMT00000324980.1	-	0.00	40	0	C	NM_175769		27375630	+1	tier1	-	no_errors	ENST00000296096	ensembl	human	known	74_37	silent	18.18	36	8	SNP	0.000	T
TEK	7010	genome.wustl.edu	37	9	27197501	27197501	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:27197501T>G	ENST00000380036.4	+	12	2255	c.1813T>G	c.(1813-1815)Tta>Gta	p.L605V	TEK_ENST00000519097.1_Missense_Mutation_p.L458V|RNA5SP280_ENST00000411230.1_RNA|TEK_ENST00000406359.4_Missense_Mutation_p.L562V	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	605	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	ACTTAACAACTTACATCCCAG	0.463																																																	0													93.0	84.0	87.0					9																	27197501		2203	4300	6503	SO:0001583	missense	0			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.1813T>G	9.37:g.27197501T>G	ENSP00000369375:p.Leu605Val		A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tyr_kin_Tie2_Ig-like_dom-1_N,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L605V	ENST00000380036.4	37	c.1813	CCDS6519.1	9	.	.	.	.	.	.	.	.	.	.	T	12.64	1.997855	0.35226	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359;ENST00000519080	D;D;D;D	0.84800	-1.9;-1.9;-1.9;-1.9	5.43	0.261	0.15592	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.36444	N	0.002586	D	0.85026	0.5603	L	0.27053	0.805	0.25242	N	0.989741	B;B;D;B	0.69078	0.01;0.208;0.997;0.026	B;P;D;B	0.85130	0.026;0.536;0.997;0.022	T	0.77902	-0.2414	10	0.87932	D	0	.	10.2139	0.43158	0.0:0.3993:0.0:0.6007	.	458;638;562;605	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	V	458;605;562;415	ENSP00000430686:L458V;ENSP00000369375:L605V;ENSP00000383977:L562V;ENSP00000428337:L415V	ENSP00000369375:L605V	L	+	1	2	TEK	27187501	0.893000	0.30496	0.083000	0.20561	0.997000	0.91878	0.773000	0.26661	-0.185000	0.10550	0.533000	0.62120	TTA	TEK	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000120156		0.463	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEK	HGNC	protein_coding	OTTHUMT00000051965.3	-	0.00	47	0	T			27197501	+1	tier1	-	no_errors	ENST00000380036	ensembl	human	known	74_37	missense	33.33	34	17	SNP	0.334	G
TEK	7010	genome.wustl.edu	37	9	27229191	27229191	+	Silent	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:27229191T>G	ENST00000380036.4	+	23	3778	c.3336T>G	c.(3334-3336)acT>acG	p.T1112T	TEK_ENST00000519097.1_Silent_p.T964T|TEK_ENST00000406359.4_Silent_p.T1069T	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	1112					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	AGAAGTTTACTTATGCAGGAA	0.473																																																	0													186.0	167.0	173.0					9																	27229191		2203	4300	6503	SO:0001819	synonymous_variant	0			L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.3336T>G	9.37:g.27229191T>G			A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Tyr_kin_Tie2_Ig-like_dom-1_N,pfam_Prot_kinase_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T1112	ENST00000380036.4	37	c.3336	CCDS6519.1	9																																																																																			TEK	-	superfamily_Kinase-like_dom	ENSG00000120156		0.473	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TEK	HGNC	protein_coding	OTTHUMT00000051965.3	-	0.00	80	0	T			27229191	+1	tier1	-	no_errors	ENST00000380036	ensembl	human	known	74_37	silent	47.06	36	32	SNP	1.000	G
TENM1	10178	genome.wustl.edu	37	X	123654589	123654589	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:123654589T>G	ENST00000371130.3	-	18	3142	c.3079A>C	c.(3079-3081)Agt>Cgt	p.S1027R	TENM1_ENST00000422452.2_Missense_Mutation_p.S1027R	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1027					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CTCAGGTAACTCAGCCTCACA	0.453																																																	0													58.0	52.0	54.0					X																	123654589		2203	4300	6503	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.3079A>C	X.37:g.123654589T>G	ENSP00000360171:p.Ser1027Arg		B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD	p.S1027R	ENST00000371130.3	37	c.3079	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	T	13.21	2.168066	0.38315	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.85773	-2.03;-1.99	5.58	5.58	0.84498	.	0.092637	0.64402	D	0.000001	T	0.79417	0.4442	L	0.40543	1.245	0.45046	D	0.998064	P;P;P	0.50272	0.933;0.868;0.565	B;B;B	0.42386	0.386;0.23;0.205	T	0.76785	-0.2831	10	0.13108	T	0.6	.	14.7193	0.69294	0.0:0.0:0.0:1.0	.	1026;1027;1027	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	R	1027	ENSP00000360171:S1027R;ENSP00000403954:S1027R	ENSP00000360171:S1027R	S	-	1	0	ODZ1	123482270	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	3.191000	0.50981	1.857000	0.53885	0.486000	0.48141	AGT	TENM1	-	NULL	ENSG00000009694		0.453	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM1	HGNC	protein_coding	OTTHUMT00000058985.1	-	0.00	29	0	T	NM_014253		123654589	-1	tier1	-	no_errors	ENST00000422452	ensembl	human	known	74_37	missense	38.33	36	23	SNP	0.985	G
TFB1M	51106	genome.wustl.edu	37	6	155578990	155578990	+	Missense_Mutation	SNP	C	C	T	rs149125723		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:155578990C>T	ENST00000367166.4	-	7	1076	c.1021G>A	c.(1021-1023)Gca>Aca	p.A341T	RP11-477D19.2_ENST00000435295.1_RNA	NM_016020.3	NP_057104.2	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		TAATTCTCTGCGTCATCCTCT	0.418																																																	0								C	THR/ALA	1,4405	2.1+/-5.4	0,1,2202	101.0	92.0	95.0		1021	-10.3	0.0	6	dbSNP_134	95	0,8600		0,0,4300	no	missense	TFB1M	NM_016020.3	58	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	341/347	155578990	1,13005	2203	4300	6503	SO:0001583	missense	0			AF151833	CCDS5248.1	6q25.1-q25.3	2011-01-28			ENSG00000029639	ENSG00000029639			17037	protein-coding gene	gene with protein product	"""dimethyladenosine transferase 1, mitochondrial"""	607033				10810093, 11809803	Standard	NM_016020		Approved	mtTFB, CGI-75	uc003qqj.4	Q8WVM0	OTTHUMG00000015881	ENST00000367166.4:c.1021G>A	6.37:g.155578990C>T	ENSP00000356134:p.Ala341Thr		Q05DR0|Q9Y384	Missense_Mutation	SNP	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N	p.A341T	ENST00000367166.4	37	c.1021	CCDS5248.1	6	.	.	.	.	.	.	.	.	.	.	C	7.831	0.719902	0.15372	2.27E-4	0.0	ENSG00000029639	ENST00000367166	T	0.29917	1.55	5.17	-10.3	0.00346	.	3.037720	0.00812	N	0.001509	T	0.03053	0.0090	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09164	-1.0687	10	0.15952	T	0.53	7.0016	6.3301	0.21264	0.0869:0.4737:0.2644:0.1749	.	341	Q8WVM0	TFB1M_HUMAN	T	341	ENSP00000356134:A341T	ENSP00000356134:A341T	A	-	1	0	TFB1M	155620682	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.986000	0.01484	-2.210000	0.00738	-0.492000	0.04666	GCA	TFB1M	-	NULL	ENSG00000029639		0.418	TFB1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFB1M	HGNC	protein_coding	OTTHUMT00000042809.1	-	0.00	49	0	C			155578990	-1	tier1	rs149125723	no_errors	ENST00000367166	ensembl	human	known	74_37	missense	5.56	68	4	SNP	0.000	T
TG	7038	genome.wustl.edu	37	8	133899062	133899062	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:133899062A>T	ENST00000220616.4	+	9	1485	c.1445A>T	c.(1444-1446)cAg>cTg	p.Q482L	TG_ENST00000377869.1_Missense_Mutation_p.Q482L	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	482					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		AATGTTGGCCAGTTTAACTTG	0.478																																																	0													78.0	82.0	81.0					8																	133899062		2203	4300	6503	SO:0001583	missense	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1445A>T	8.37:g.133899062A>T	ENSP00000220616:p.Gln482Leu		O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.Q482L	ENST00000220616.4	37	c.1445	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	A	13.31	2.199999	0.38905	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.65364	-0.15;-0.15	5.67	1.52	0.23074	.	0.311546	0.27792	N	0.017830	T	0.51907	0.1702	M	0.65975	2.015	0.09310	N	1	P	0.38922	0.651	B	0.33042	0.157	T	0.51092	-0.8749	10	0.87932	D	0	.	6.2727	0.20963	0.6429:0.1273:0.2298:0.0	.	482	P01266	THYG_HUMAN	L	482	ENSP00000367100:Q482L;ENSP00000220616:Q482L	ENSP00000220616:Q482L	Q	+	2	0	TG	133968244	0.998000	0.40836	0.987000	0.45799	0.990000	0.78478	1.094000	0.30951	0.413000	0.25759	0.455000	0.32223	CAG	TG	-	pirsf_Thyroglobulin	ENSG00000042832		0.478	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	-	0.00	86	0	A	NM_003235		133899062	+1	tier1	-	no_errors	ENST00000220616	ensembl	human	known	74_37	missense	33.63	75	38	SNP	0.163	T
TGM6	343641	genome.wustl.edu	37	20	2375946	2375946	+	Silent	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr20:2375946T>G	ENST00000202625.2	+	3	349	c.288T>G	c.(286-288)acT>acG	p.T96T	TGM6_ENST00000381423.1_Silent_p.T96T|TGM6_ENST00000477505.1_Intron	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6	96					cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	TGGAGAAAACTCTGACCGTCA	0.612																																																	0													72.0	60.0	64.0					20																	2375946		2203	4300	6503	SO:0001819	synonymous_variant	0			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.288T>G	20.37:g.2375946T>G			Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Silent	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.T96	ENST00000202625.2	37	c.288	CCDS13025.1	20																																																																																			TGM6	-	pfam_Transglutaminase_N,superfamily_Ig_E-set	ENSG00000166948		0.612	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM6	HGNC	protein_coding	OTTHUMT00000077581.2	-	0.00	44	0	T	NM_198994		2375946	+1	tier1	-	no_errors	ENST00000202625	ensembl	human	known	74_37	silent	34.38	42	22	SNP	0.000	G
THOC2	57187	genome.wustl.edu	37	X	122754756	122754756	+	Splice_Site	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:122754756A>C	ENST00000245838.8	-	32	4307		c.e32+1		THOC2_ENST00000355725.4_Splice_Site|THOC2_ENST00000497887.1_5'Flank|THOC2_ENST00000491737.1_Splice_Site	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2						mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						GGCTATACTAACCTTTACTGT	0.428																																																	0													213.0	207.0	209.0					X																	122754756		2075	4205	6280	SO:0001630	splice_region_variant	0			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.4275+1T>G	X.37:g.122754756A>C			A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Splice_Site	SNP	-	e32+2	ENST00000245838.8	37	c.4275+2	CCDS43988.1	X	.	.	.	.	.	.	.	.	.	.	A	14.91	2.674949	0.47781	.	.	ENSG00000125676	ENST00000448128;ENST00000245838;ENST00000441692;ENST00000355725;ENST00000416618;ENST00000491737	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4115	0.67117	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	THOC2	122582437	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.108000	0.94275	1.782000	0.52362	0.486000	0.48141	.	THOC2	-	-	ENSG00000125676		0.428	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	HGNC	protein_coding	OTTHUMT00000058153.3	-	0.00	47	0	A		Intron	122754756	-1	tier1	-	no_errors	ENST00000245838	ensembl	human	known	74_37	splice_site	47.06	36	32	SNP	1.000	C
THSD1	55901	genome.wustl.edu	37	13	52952185	52952185	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr13:52952185G>T	ENST00000258613.4	-	5	2098	c.1920C>A	c.(1918-1920)tcC>tcA	p.S640S	THSD1_ENST00000349258.4_Silent_p.S587S|THSD1_ENST00000544466.1_Silent_p.S261S	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	640					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		GGCTCCTTTCGGACGGGCCCC	0.602																																																	0													45.0	46.0	46.0					13																	52952185		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.1920C>A	13.37:g.52952185G>T			A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Silent	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.S640	ENST00000258613.4	37	c.1920	CCDS9432.1	13																																																																																			THSD1	-	NULL	ENSG00000136114		0.602	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD1	HGNC	protein_coding	OTTHUMT00000045058.3	-	0.00	52	0	G			52952185	-1	tier1	-	no_errors	ENST00000258613	ensembl	human	known	74_37	silent	5.48	69	4	SNP	0.000	T
TMC4	147798	genome.wustl.edu	37	19	54669205	54669205	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:54669205C>A	ENST00000376591.4	-	6	1042	c.911G>T	c.(910-912)tGc>tTc	p.C304F	TMC4_ENST00000476013.2_Intron|TMC4_ENST00000301187.4_Missense_Mutation_p.C298F|TMC4_ENST00000416963.1_5'Flank	NM_001145303.1|NM_144686.2	NP_001138775|NP_653287.2	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4	304					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(7)|large_intestine(4)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	22	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GACGTCCCCGCAGAGACCGAA	0.627																																																	0													42.0	37.0	39.0					19																	54669205		2203	4300	6503	SO:0001583	missense	0			AY236492	CCDS12882.1, CCDS46174.1	19q13.42	2008-02-05			ENSG00000167608	ENSG00000167608			22998	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005277069		Approved		uc010erf.3	Q7Z404	OTTHUMG00000066485	ENST00000376591.4:c.911G>T	19.37:g.54669205C>A	ENSP00000365776:p.Cys304Phe		Q7Z5M3|Q8N5E4|Q8TBS7	Missense_Mutation	SNP	pfam_TMC	p.C298F	ENST00000376591.4	37	c.893	CCDS46174.1	19	.	.	.	.	.	.	.	.	.	.	C	11.16	1.556630	0.27827	.	.	ENSG00000167608	ENST00000301187;ENST00000376591	T;T	0.42131	0.98;0.98	4.8	2.53	0.30540	.	0.928718	0.09318	N	0.818622	T	0.34978	0.0916	L	0.56769	1.78	0.09310	N	0.999999	B;B	0.30281	0.275;0.083	B;B	0.33960	0.126;0.173	T	0.35051	-0.9804	10	0.10111	T	0.7	-4.6334	5.5515	0.17093	0.0:0.6875:0.2047:0.1078	.	304;298	Q7Z404;Q7Z404-1	TMC4_HUMAN;.	F	298;304	ENSP00000301187:C298F;ENSP00000365776:C304F	ENSP00000301187:C298F	C	-	2	0	TMC4	59361017	0.000000	0.05858	0.700000	0.30305	0.642000	0.38348	-0.117000	0.10708	2.418000	0.82041	0.650000	0.86243	TGC	TMC4	-	NULL	ENSG00000167608		0.627	TMC4-011	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TMC4	HGNC	protein_coding	OTTHUMT00000156164.2	-	0.00	69	0	C			54669205	-1	tier1	-	no_errors	ENST00000301187	ensembl	human	known	74_37	missense	30.56	50	22	SNP	0.004	A
TMCO6	55374	genome.wustl.edu	37	5	140023719	140023719	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:140023719C>T	ENST00000394671.3	+	10	1241	c.1140C>T	c.(1138-1140)tcC>tcT	p.S380S	NDUFA2_ENST00000510680.1_Intron|TMCO6_ENST00000252100.6_Silent_p.S386S|TMCO6_ENST00000537378.1_Silent_p.S140S	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	380					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTGCTCTCCCTGGATCTGA	0.488																																																	0													269.0	259.0	262.0					5																	140023719		1982	4182	6164	SO:0001819	synonymous_variant	0			BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.1140C>T	5.37:g.140023719C>T			Q9BUU0|Q9P198	Silent	SNP	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Importin-a_IBB	p.S386	ENST00000394671.3	37	c.1158	CCDS4233.2	5																																																																																			TMCO6	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000113119		0.488	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO6	HGNC	protein_coding	OTTHUMT00000251666.2	-	0.00	68	0	C	NM_018502		140023719	+1	tier1	-	no_errors	ENST00000252100	ensembl	human	known	74_37	silent	5.26	72	4	SNP	0.996	T
TMEM14B	81853	genome.wustl.edu	37	6	10756854	10756854	+	3'UTR	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:10756854C>T	ENST00000379542.5	+	0	615				TMEM14B_ENST00000491103.1_3'UTR|RP11-637O19.3_ENST00000480294.1_Intron|SYCP2L_ENST00000543878.1_Intron|TMEM14B_ENST00000379530.3_3'UTR|TMEM14B_ENST00000467317.1_Intron|TMEM14B_ENST00000481240.1_Intron|TMEM14B_ENST00000473276.1_3'UTR	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				TTGCATCTGACATTTTACCTA	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.*103C>T	6.37:g.10756854C>T			Q5THN7|Q5THN8|Q96IX7|Q9BVN8	RNA	SNP	-	NULL	ENST00000379542.5	37	NULL	CCDS4515.1	6																																																																																			TMEM14B	-	-	ENSG00000137210		0.373	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	HGNC	protein_coding	OTTHUMT00000039836.1	-	0.00	22	0	C	NM_030969		10756854	+1	tier1	-	no_errors	ENST00000486421	ensembl	human	known	74_37	rna	26.09	17	6	SNP	0.019	T
TMEM255A	55026	genome.wustl.edu	37	X	119438339	119438339	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chrX:119438339G>T	ENST00000309720.5	-	2	189	c.66C>A	c.(64-66)ttC>ttA	p.F22L	TMEM255A_ENST00000371369.4_Missense_Mutation_p.F22L|TMEM255A_ENST00000440464.1_Missense_Mutation_p.F22L	NM_017938.3	NP_060408.3	Q5JRV8	T255A_HUMAN	transmembrane protein 255A	22						integral component of membrane (GO:0016021)											TCCTCCGATTGAATGCTCCTG	0.423																																																	0													144.0	109.0	121.0					X																	119438339		2203	4300	6503	SO:0001583	missense	0			BC047054	CCDS14597.1, CCDS43986.1, CCDS48157.1	Xq24	2012-11-30	2012-11-30	2012-11-30	ENSG00000125355	ENSG00000125355			26086	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member A"""	FAM70A		12477932	Standard	NM_017938		Approved	FLJ20716	uc004eso.4	Q5JRV8	OTTHUMG00000022298	ENST00000309720.5:c.66C>A	X.37:g.119438339G>T	ENSP00000310110:p.Phe22Leu		A8K0W9|B1APR4|B3KPI6|E9PAR3|Q86Y72|Q9NWN8	Missense_Mutation	SNP	NULL	p.F22L	ENST00000309720.5	37	c.66	CCDS14597.1	X	.	.	.	.	.	.	.	.	.	.	G	17.50	3.404786	0.62288	.	.	ENSG00000125355	ENST00000309720;ENST00000371369;ENST00000440464;ENST00000519908	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.55	3.76	0.43208	.	0.000000	0.85682	D	0.000000	T	0.59128	0.2171	L	0.53249	1.67	0.80722	D	1	D;D;D	0.76494	0.974;0.974;0.999	D;D;D	0.83275	0.969;0.969;0.996	T	0.56709	-0.7934	10	0.41790	T	0.15	-21.577	8.7248	0.34463	0.2431:0.0:0.7569:0.0	.	22;22;22	E9PAR3;B1APR4;Q5JRV8	.;.;FA70A_HUMAN	L	22	ENSP00000310110:F22L;ENSP00000360420:F22L;ENSP00000405781:F22L;ENSP00000428013:F22L	ENSP00000310110:F22L	F	-	3	2	FAM70A	119322367	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	2.334000	0.43920	1.109000	0.41680	0.600000	0.82982	TTC	TMEM255A	-	NULL	ENSG00000125355		0.423	TMEM255A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM255A	HGNC	protein_coding	OTTHUMT00000058091.1	-	0.00	28	0	G	NM_017938		119438339	-1	tier1	-	no_errors	ENST00000309720	ensembl	human	known	74_37	missense	8.70	42	4	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577094	7577094	+	Missense_Mutation	SNP	G	G	A	rs28934574		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr17:7577094G>A	ENST00000269305.4	-	8	1033	c.844C>T	c.(844-846)Cgg>Tgg	p.R282W	TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R282W|TP53_ENST00000445888.2_Missense_Mutation_p.R282W|TP53_ENST00000359597.4_Missense_Mutation_p.R282W|TP53_ENST00000455263.2_Missense_Mutation_p.R282W	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	282	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		DR -> EW (in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in a sporadic cancer; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|Ref.22}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934574). {ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R282W(401)|p.R282G(29)|p.0?(8)|p.R282fs*24(4)|p.R282R(3)|p.?(2)|p.D281fs*63(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282_E287delRRTEEE(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.R282fs*63(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TCTGTGCGCCGGTCTCTCCCA	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	463	Substitution - Missense(430)|Whole gene deletion(8)|Deletion - In frame(6)|Deletion - Frameshift(5)|Insertion - Frameshift(4)|Substitution - coding silent(3)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - In frame(1)	large_intestine(136)|oesophagus(49)|upper_aerodigestive_tract(43)|stomach(33)|central_nervous_system(29)|breast(29)|lung(26)|ovary(21)|skin(20)|urinary_tract(16)|haematopoietic_and_lymphoid_tissue(16)|pancreas(10)|biliary_tract(5)|liver(5)|bone(5)|vulva(4)|prostate(4)|endometrium(3)|peritoneum(2)|thyroid(2)|NS(2)|autonomic_ganglia(1)|soft_tissue(1)|salivary_gland(1)	GRCh37	CM056413|CM920678	TP53	M	rs28934574	G	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	0,4406		0,0,2203	83.0	71.0	75.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	844,844,844,844,448,448,448	1.5	0.3	17	dbSNP_125	75	2,8598	2.2+/-6.3	1,0,4299	no	missense,missense,missense,missense,missense,missense,missense	TP53	NM_000546.4,NM_001126112.1,NM_001126113.1,NM_001126114.1,NM_001126115.1,NM_001126116.1,NM_001126117.1	101,101,101,101,101,101,101	1,0,6502	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	282/394,282/394,282/347,282/342,150/262,150/210,150/215	7577094	2,13004	2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.844C>T	17.37:g.7577094G>A	ENSP00000269305:p.Arg282Trp		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R282W	ENST00000269305.4	37	c.844	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057525	0.76074	0.0	2.33E-4	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.75	1.49	0.22878	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99825	0.9922	M	0.89968	3.075	0.58432	A	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.998;1.0;0.999	D	0.97713	1.0192	9	0.87932	D	0	-12.0909	8.7508	0.34613	0.0:0.1376:0.5833:0.2792	rs28934574	282;282;282;282	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	W	282;282;282;282;282;271;150	ENSP00000352610:R282W;ENSP00000269305:R282W;ENSP00000398846:R282W;ENSP00000391127:R282W;ENSP00000391478:R282W;ENSP00000425104:R150W	ENSP00000269305:R282W	R	-	1	2	TP53	7517819	1.000000	0.71417	0.327000	0.25402	0.901000	0.52897	4.477000	0.60223	0.174000	0.19809	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	38	0	G	NM_000546		7577094	-1	tier1	rs28934574	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	80.00	4	16	SNP	0.997	A
TMEM99	147184	genome.wustl.edu	37	17	38991522	38991522	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr17:38991522T>C	ENST00000301665.3	+	3	1058	c.754T>C	c.(754-756)Ttt>Ctt	p.F252L		NM_001195386.1|NM_001195387.1|NM_145274.3	NP_001182315.1|NP_001182316.1|NP_660317.2	Q8N816	TMM99_HUMAN	transmembrane protein 99	252						integral component of membrane (GO:0016021)				cervix(1)|large_intestine(1)|lung(5)|skin(2)|urinary_tract(1)	10		Breast(137;0.000301)				GGGCTGTTTGTTTTCTACGTT	0.428																																																	0													78.0	75.0	76.0					17																	38991522		1758	3741	5499	SO:0001583	missense	0			AK097454	CCDS42319.1	17q21.2	2008-11-06			ENSG00000167920	ENSG00000167920			28305	protein-coding gene	gene with protein product						12477932	Standard	NM_001195386		Approved	MGC21518	uc021txc.1	Q8N816	OTTHUMG00000133579	ENST00000301665.3:c.754T>C	17.37:g.38991522T>C	ENSP00000301665:p.Phe252Leu		B4DQ34|Q96BP9	Missense_Mutation	SNP	NULL	p.F252L	ENST00000301665.3	37	c.754	CCDS42319.1	17	.	.	.	.	.	.	.	.	.	.	T	8.620	0.891236	0.17613	.	.	ENSG00000167920	ENST00000301665	T	0.27256	1.68	3.57	0.711	0.18162	.	.	.	.	.	T	0.09642	0.0237	N	0.08118	0	0.09310	N	1	B	0.25521	0.128	B	0.20384	0.029	T	0.32561	-0.9902	8	.	.	.	.	2.2829	0.04119	0.5567:0.0:0.2036:0.2398	.	252	Q8N816	TMM99_HUMAN	L	252	ENSP00000301665:F252L	.	F	+	1	0	TMEM99	36245048	0.098000	0.21812	0.000000	0.03702	0.000000	0.00434	1.773000	0.38563	-0.092000	0.12417	-0.452000	0.05504	TTT	TMEM99	-	NULL	ENSG00000167920		0.428	TMEM99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM99	HGNC	protein_coding	OTTHUMT00000257681.1	-	0.00	43	0	T	NM_145274		38991522	+1	tier1	-	no_errors	ENST00000301665	ensembl	human	known	74_37	missense	52.50	19	21	SNP	0.000	C
DCHS1	8642	genome.wustl.edu	37	11	6640117	6640117	+	IGR	SNP	C	C	T	rs549309216		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr11:6640117C>T	ENST00000299441.3	-	0	10763				TPP1_ENST00000528657.1_3'UTR|TPP1_ENST00000534644.1_Intron|TPP1_ENST00000533371.1_De_novo_Start_OutOfFrame|RP11-732A19.9_ENST00000545572.1_RNA|TPP1_ENST00000299427.6_Missense_Mutation_p.R40H|RP11-732A19.5_ENST00000526456.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1						branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGGGTCCGCACGGCCCAGGGA	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		20661	0.001		0.0	False		,,,				2504	0.0																0													60.0	60.0	60.0					11																	6640117		2201	4296	6497	SO:0001628	intergenic_variant	0			AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398		11.37:g.6640117C>T			O15098	Missense_Mutation	SNP	pfam_Peptidase_S53_propep,pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom,superfamily_Prot_inh_propept,smart_Peptidase_S53_propep	p.R40H	ENST00000299441.3	37	c.119	CCDS7771.1	11	.	.	.	.	.	.	.	.	.	.	C	21.6	4.178886	0.78564	.	.	ENSG00000166340	ENST00000299427;ENST00000453338;ENST00000436873	T;T	0.72167	-0.63;-0.63	5.64	4.72	0.59763	Proteinase inhibitor, propeptide (1);Peptidase S53, propeptide (2);	0.057570	0.64402	D	0.000001	T	0.74741	0.3756	M	0.77712	2.385	0.80722	D	1	D;P	0.58970	0.984;0.649	P;B	0.46758	0.526;0.043	T	0.77659	-0.2505	10	0.49607	T	0.09	-18.6436	13.6352	0.62219	0.0:0.8447:0.1553:0.0	.	40;40	B4DEQ3;O14773	.;TPP1_HUMAN	H	40	ENSP00000299427:R40H;ENSP00000398136:R40H	ENSP00000299427:R40H	R	-	2	0	TPP1	6596693	0.402000	0.25311	0.984000	0.44739	0.991000	0.79684	0.912000	0.28597	1.360000	0.45960	0.462000	0.41574	CGT	TPP1	-	pfam_Peptidase_S53_propep,superfamily_Prot_inh_propept,smart_Peptidase_S53_propep	ENSG00000166340		0.587	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP1	HGNC	protein_coding	OTTHUMT00000257258.1		0.00	34	0	C	NM_003737		6640117	-1			no_errors	ENST00000299427	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	T
TPP2	7174	genome.wustl.edu	37	13	103279451	103279451	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr13:103279451C>G	ENST00000376065.4	+	7	910	c.874C>G	c.(874-876)Ctt>Gtt	p.L292V	TPP2_ENST00000376052.3_Missense_Mutation_p.L292V	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	292	Peptidase S8.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TGCTCAAATTCTTTCCATCAA	0.448																																																	0													134.0	131.0	132.0					13																	103279451		2203	4300	6503	SO:0001583	missense	0			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.874C>G	13.37:g.103279451C>G	ENSP00000365233:p.Leu292Val		Q5VZU8	Missense_Mutation	SNP	pfam_Peptidase_S8/S53_dom,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53_dom,prints_Peptidase_S8_subtilisin-rel	p.L292V	ENST00000376065.4	37	c.874	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	C	7.379	0.628485	0.14257	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	T;T	0.41400	1.0;1.0	5.58	5.58	0.84498	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	T	0.22322	0.0538	N	0.03983	-0.305	0.80722	D	1	B	0.25272	0.122	B	0.27380	0.079	T	0.16394	-1.0404	10	0.02654	T	1	.	19.9474	0.97186	0.0:1.0:0.0:0.0	.	292	P29144	TPP2_HUMAN	V	292	ENSP00000365233:L292V;ENSP00000365220:L292V	ENSP00000365220:L292V	L	+	1	0	TPP2	102077452	1.000000	0.71417	0.997000	0.53966	0.984000	0.73092	4.603000	0.61105	2.774000	0.95407	0.655000	0.94253	CTT	TPP2	-	pfam_Peptidase_S8/S53_dom,superfamily_Peptidase_S8/S53_dom	ENSG00000134900		0.448	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2	-	0.00	41	0	C			103279451	+1	tier1	-	no_errors	ENST00000376065	ensembl	human	known	74_37	missense	37.74	33	20	SNP	1.000	G
TREM2	54209	genome.wustl.edu	37	6	41126735	41126735	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:41126735G>A	ENST00000373113.3	-	4	645	c.552C>T	c.(550-552)ctC>ctT	p.L184L	TREM2_ENST00000338469.3_Intron|TREM2_ENST00000373122.4_Missense_Mutation_p.H198Y	NM_018965.2	NP_061838.1	Q9NZC2	TREM2_HUMAN	triggering receptor expressed on myeloid cells 2	184					axon guidance (GO:0007411)|dendritic cell differentiation (GO:0097028)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|positive regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002588)|positive regulation of C-C chemokine receptor CCR7 signaling pathway (GO:1903082)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of CD40 signaling pathway (GO:2000350)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to plasma membrane (GO:1903078)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			breast(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)	11	Ovarian(28;0.0418)|Colorectal(47;0.196)					GAATCTTGATGAGAAAGATGC	0.577																																																	0													51.0	56.0	55.0					6																	41126735		2203	4300	6503	SO:0001819	synonymous_variant	0			AF213457	CCDS4852.1, CCDS64422.1	6p21.1	2014-09-17	2002-08-15		ENSG00000095970	ENSG00000095970		"""Immunoglobulin superfamily / V-set domain containing"""	17761	protein-coding gene	gene with protein product		605086	"""triggering receptor expressed on myeloid cells 2a"""			10799849, 12080485	Standard	NM_001271821		Approved	TREM-2, Trem2a, Trem2b, Trem2c	uc003opy.3	Q9NZC2	OTTHUMG00000014671	ENST00000373113.3:c.552C>T	6.37:g.41126735G>A			Q8N5H8|Q8WYN6	Missense_Mutation	SNP	pfam_Ig_V-set	p.H198Y	ENST00000373113.3	37	c.592	CCDS4852.1	6																																																																																			TREM2	-	NULL	ENSG00000095970		0.577	TREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TREM2	HGNC	protein_coding	OTTHUMT00000040499.1	-	0.00	57	0	G	NM_018965		41126735	-1	tier1	-	no_errors	ENST00000373122	ensembl	human	known	74_37	missense	34.04	31	16	SNP	0.119	A
TRDN	10345	genome.wustl.edu	37	6	123653049	123653049	+	Silent	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr6:123653049T>C	ENST00000398178.3	-	23	1467	c.1446A>G	c.(1444-1446)aaA>aaG	p.K482K	TRDN_ENST00000334268.4_Silent_p.K482K	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	482					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		AAGCTGGAACTTTCTCTTCTT	0.328																																																	0													74.0	71.0	72.0					6																	123653049		1794	4043	5837	SO:0001819	synonymous_variant	0			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.1446A>G	6.37:g.123653049T>C			A5D6W5|F5H2W7|Q6NSB8	Silent	SNP	pfam_Asp-B-hydro/Triadin_dom	p.K482	ENST00000398178.3	37	c.1446	CCDS55053.1	6																																																																																			TRDN	-	NULL	ENSG00000186439		0.328	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	HGNC	protein_coding		-	0.00	48	0	T			123653049	-1	tier1	-	no_errors	ENST00000398178	ensembl	human	known	74_37	silent	47.50	21	19	SNP	0.014	C
TRHDE	29953	genome.wustl.edu	37	12	72956759	72956759	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:72956759C>G	ENST00000261180.4	+	9	1942	c.1846C>G	c.(1846-1848)Caa>Gaa	p.Q616E	TRHDE_ENST00000549138.1_3'UTR	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	616					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						AATAATTACCCAACAGCATTT	0.313																																																	0													90.0	95.0	93.0					12																	72956759		2203	4294	6497	SO:0001583	missense	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.1846C>G	12.37:g.72956759C>G	ENSP00000261180:p.Gln616Glu		A5PL19|Q6UWJ4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.Q616E	ENST00000261180.4	37	c.1846	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	C	25.7	4.662712	0.88251	.	.	ENSG00000072657	ENST00000261180	T	0.02812	4.15	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.21718	0.0523	H	0.96662	3.86	0.80722	D	1	D	0.56521	0.976	P	0.52343	0.696	T	0.27054	-1.0085	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	616	Q9UKU6	TRHDE_HUMAN	E	616	ENSP00000261180:Q616E	ENSP00000261180:Q616E	Q	+	1	0	TRHDE	71243026	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	6.135000	0.71696	2.941000	0.99782	0.655000	0.94253	CAA	TRHDE	-	NULL	ENSG00000072657		0.313	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	-	0.00	74	0	C	NM_013381		72956759	+1	tier1	-	no_errors	ENST00000261180	ensembl	human	known	74_37	missense	31.33	57	26	SNP	1.000	G
TRIML1	339976	genome.wustl.edu	37	4	189068495	189068495	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr4:189068495T>A	ENST00000332517.3	+	6	1516	c.1376T>A	c.(1375-1377)cTc>cAc	p.L459H	TRIML1_ENST00000507581.1_3'UTR	NM_178556.3	NP_848651.2	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	459	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				multicellular organismal development (GO:0007275)|protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)	p.L459P(1)		NS(3)|breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	60		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		ACAGACCCTCTCACCATCTGC	0.562																																					Melanoma(31;213 1036 16579 23968 32372)												1	Substitution - Missense(1)	central_nervous_system(1)											48.0	50.0	50.0					4																	189068495		2203	4300	6503	SO:0001583	missense	0			AK093499	CCDS3851.1	4q35.2	2013-01-09			ENSG00000184108	ENSG00000184108		"""RING-type (C3HC4) zinc fingers"""	26698	protein-coding gene	gene with protein product						12477932	Standard	NM_178556		Approved	FLJ36180, RNF209	uc003izm.1	Q8N9V2	OTTHUMG00000160237	ENST00000332517.3:c.1376T>A	4.37:g.189068495T>A	ENSP00000327738:p.Leu459His		Q96BE5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.L459H	ENST00000332517.3	37	c.1376	CCDS3851.1	4	.	.	.	.	.	.	.	.	.	.	t	13.73	2.324985	0.41197	.	.	ENSG00000184108	ENST00000332517	T	0.71341	-0.56	5.45	5.45	0.79879	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);	0.000000	0.46442	D	0.000281	D	0.84889	0.5572	M	0.85859	2.78	0.23126	N	0.998259	D	0.89917	1.0	D	0.78314	0.991	T	0.79286	-0.1866	10	0.87932	D	0	-17.4521	13.8043	0.63220	0.0:0.0:0.0:1.0	.	459	Q8N9V2	TRIML_HUMAN	H	459	ENSP00000327738:L459H	ENSP00000327738:L459H	L	+	2	0	TRIML1	189305489	0.757000	0.28394	0.567000	0.28434	0.125000	0.20455	4.877000	0.63086	2.220000	0.72140	0.451000	0.29950	CTC	TRIML1	-	superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000184108		0.562	TRIML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIML1	HGNC	protein_coding	OTTHUMT00000359813.1		0.00	21	0	T	NM_178556		189068495	+1			no_errors	ENST00000332517	ensembl	human	known	74_37	missense	7.14	26	2	SNP	0.330	A
TRPM1	4308	genome.wustl.edu	37	15	31360147	31360147	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:31360147C>A	ENST00000256552.6	-	5	575	c.428G>T	c.(427-429)gGg>gTg	p.G143V	MIR211_ENST00000384969.1_RNA|TRPM1_ENST00000542188.1_Missense_Mutation_p.G160V|TRPM1_ENST00000397795.2_Missense_Mutation_p.G121V	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CAGGCCTTTCCCAAAGACTTG	0.532																																																	0													109.0	108.0	109.0					15																	31360147		1890	4123	6013	SO:0001583	missense	0			AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.428G>T	15.37:g.31360147C>A	ENSP00000256552:p.Gly143Val			Missense_Mutation	SNP	pfam_Ion_trans_dom	p.G160V	ENST00000256552.6	37	c.479	CCDS58346.1	15	.	.	.	.	.	.	.	.	.	.	C	29.7	5.032333	0.93575	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.02974	4.09;4.09;4.09	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.14356	0.0347	L	0.57536	1.79	0.80722	D	1	D;P	0.71674	0.998;0.609	D;B	0.72075	0.976;0.436	T	0.00016	-1.2389	10	0.87932	D	0	-33.6838	20.3397	0.98756	0.0:1.0:0.0:0.0	.	121;121	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	V	121;160;143;121	ENSP00000380897:G121V;ENSP00000437849:G160V;ENSP00000256552:G143V	ENSP00000256552:G143V	G	-	2	0	TRPM1	29147439	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.798000	0.85924	2.803000	0.96430	0.585000	0.79938	GGG	TRPM1	-	NULL	ENSG00000134160		0.532	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	TRPM1	HGNC	protein_coding	OTTHUMT00000417166.2	-	0.00	50	0	C	NM_002420		31360147	-1	tier1	-	no_errors	ENST00000542188	ensembl	human	known	74_37	missense	17.43	90	19	SNP	1.000	A
TSC1	7248	genome.wustl.edu	37	9	135772673	135772673	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr9:135772673A>G	ENST00000298552.3	-	22	3094	c.2873T>C	c.(2872-2874)tTt>tCt	p.F958S	TSC1_ENST00000440111.2_Missense_Mutation_p.F958S|TSC1_ENST00000545250.1_Missense_Mutation_p.F907S	NM_000368.4|NM_001162426.1|NM_001162427.1	NP_000359.1|NP_001155898.1|NP_001155899.1	Q92574	TSC1_HUMAN	tuberous sclerosis 1	958					activation of Rho GTPase activity (GO:0032862)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|cell-matrix adhesion (GO:0007160)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|insulin receptor signaling pathway (GO:0008286)|kidney development (GO:0001822)|myelination (GO:0042552)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of translation (GO:0017148)|neural tube closure (GO:0001843)|positive regulation of focal adhesion assembly (GO:0051894)|potassium ion transport (GO:0006813)|protein heterooligomerization (GO:0051291)|protein stabilization (GO:0050821)|regulation of cell cycle (GO:0051726)|regulation of cell-matrix adhesion (GO:0001952)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of protein kinase activity (GO:0045859)|regulation of stress fiber assembly (GO:0051492)|regulation of translation (GO:0006417)|response to insulin (GO:0032868)|rRNA export from nucleus (GO:0006407)|synapse organization (GO:0050808)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|lamellipodium (GO:0030027)|membrane (GO:0016020)|protein complex (GO:0043234)|TSC1-TSC2 complex (GO:0033596)	chaperone binding (GO:0051087)|GTPase regulator activity (GO:0030695)|protein N-terminus binding (GO:0047485)	p.?(1)		NS(1)|bone(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(9)|lung(20)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	65				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		CTCCAATTCAAACACCTGGGT	0.448			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																														yes	Rec		Tuberous sclerosis 1	9	9q34	7248	tuberous sclerosis 1 gene		"""E, O"""	1	Unknown(1)	bone(1)											120.0	125.0	123.0					9																	135772673		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	AF013168	CCDS6956.1, CCDS55350.1	9q34	2014-09-17			ENSG00000165699	ENSG00000165699			12362	protein-coding gene	gene with protein product		605284		TSC		9242607, 10806479	Standard	NM_000368		Approved	KIAA0243, LAM, hamartin	uc004cca.2	Q92574	OTTHUMG00000020844	ENST00000298552.3:c.2873T>C	9.37:g.135772673A>G	ENSP00000298552:p.Phe958Ser		B7Z897|Q5VVN5	Missense_Mutation	SNP	pfam_Hamartin,superfamily_ARM-type_fold	p.F958S	ENST00000298552.3	37	c.2873	CCDS6956.1	9	.	.	.	.	.	.	.	.	.	.	A	20.6	4.021165	0.75275	.	.	ENSG00000165699	ENST00000298552;ENST00000440111;ENST00000545250	D;D;T	0.81659	-1.52;-1.52;-1.33	5.61	5.61	0.85477	.	0.184388	0.49916	D	0.000139	T	0.78904	0.4357	L	0.59436	1.845	0.80722	D	1	P;P	0.37398	0.593;0.593	B;B	0.37304	0.123;0.246	T	0.80650	-0.1288	10	0.59425	D	0.04	-6.531	14.9826	0.71321	1.0:0.0:0.0:0.0	.	907;958	B7Z897;Q92574	.;TSC1_HUMAN	S	958;958;907	ENSP00000298552:F958S;ENSP00000394524:F958S;ENSP00000444017:F907S	ENSP00000298552:F958S	F	-	2	0	TSC1	134762494	1.000000	0.71417	0.887000	0.34795	0.998000	0.95712	9.297000	0.96120	2.137000	0.66172	0.528000	0.53228	TTT	TSC1	-	NULL	ENSG00000165699		0.448	TSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC1	HGNC	protein_coding	OTTHUMT00000054799.1	-	0.00	47	0	A			135772673	-1	tier1	-	no_errors	ENST00000298552	ensembl	human	known	74_37	missense	5.00	76	4	SNP	1.000	G
TSHZ3	57616	genome.wustl.edu	37	19	31769655	31769655	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:31769655G>T	ENST00000240587.4	-	2	1371	c.1044C>A	c.(1042-1044)acC>acA	p.T348T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	348					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.N166fs*16(1)|p.N349fs*16(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GTGCATCGTTGGTGTCTGAGA	0.557																																																	2	Insertion - Frameshift(2)	prostate(2)											247.0	238.0	241.0					19																	31769655		2203	4300	6503	SO:0001819	synonymous_variant	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.1044C>A	19.37:g.31769655G>T			Q9H0G6|Q9P254	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Znf_C2H2	p.T348	ENST00000240587.4	37	c.1044	CCDS12421.2	19																																																																																			TSHZ3	-	NULL	ENSG00000121297		0.557	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	-	0.00	41	0	G	NM_020856		31769655	-1	tier1	-	no_errors	ENST00000240587	ensembl	human	known	74_37	silent	70.37	8	19	SNP	0.012	T
TTC23	64927	genome.wustl.edu	37	15	99761973	99761973	+	Missense_Mutation	SNP	G	G	T	rs140079058		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:99761973G>T	ENST00000394132.2	-	6	1094	c.277C>A	c.(277-279)Ctg>Atg	p.L93M	TTC23_ENST00000262074.4_Missense_Mutation_p.L93M|TTC23_ENST00000394130.1_Missense_Mutation_p.L93M|TTC23_ENST00000394135.3_Missense_Mutation_p.L93M|TTC23_ENST00000558613.1_Missense_Mutation_p.L93M|TTC23_ENST00000558663.1_Missense_Mutation_p.L93M|TTC23_ENST00000394129.2_Missense_Mutation_p.L93M|TTC23_ENST00000394136.1_Missense_Mutation_p.L93M			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	93										endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			CCTTGAGCCAGATTAACATGT	0.478																																																	0													134.0	104.0	114.0					15																	99761973		2197	4297	6494	SO:0001583	missense	0				CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.277C>A	15.37:g.99761973G>T	ENSP00000377690:p.Leu93Met		A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Missense_Mutation	SNP	smart_TPR_repeat	p.L93M	ENST00000394132.2	37	c.277	CCDS10379.2	15	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031160	0.75504	.	.	ENSG00000103852	ENST00000394132;ENST00000394136;ENST00000262074;ENST00000394135;ENST00000394130;ENST00000394129	T;T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29;0.78	5.39	4.46	0.54185	Tetratricopeptide-like helical (1);	0.000000	0.56097	D	0.000030	D	0.89040	0.6602	M	0.84683	2.71	0.31900	N	0.616054	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.88832	0.3306	10	0.51188	T	0.08	-5.5931	10.5774	0.45235	0.0936:0.0:0.9064:0.0	.	93;93	Q5W5X9-2;Q5W5X9	.;TTC23_HUMAN	M	93	ENSP00000377690:L93M;ENSP00000377693:L93M;ENSP00000262074:L93M;ENSP00000377692:L93M;ENSP00000377688:L93M;ENSP00000457901:L93M	ENSP00000262074:L93M	L	-	1	2	TTC23	97579496	0.880000	0.30214	0.962000	0.40283	0.997000	0.91878	0.648000	0.24828	2.674000	0.91012	0.655000	0.94253	CTG	TTC23	-	smart_TPR_repeat	ENSG00000103852		0.478	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC23	HGNC	protein_coding	OTTHUMT00000303953.2	-	0.00	47	0	G	NM_022905		99761973	-1	tier1	-	no_errors	ENST00000262074	ensembl	human	known	74_37	missense	5.43	87	5	SNP	0.979	T
TTC28	23331	genome.wustl.edu	37	22	28379631	28379631	+	Silent	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr22:28379631G>T	ENST00000397906.2	-	23	6165	c.6024C>A	c.(6022-6024)ccC>ccA	p.P2008P	TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000430853.1_RNA|TTC28-AS1_ENST00000425112.1_RNA|TTC28-AS1_ENST00000454996.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000419253.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000430525.1_RNA|TTC28-AS1_ENST00000435348.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	2008					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						ATCCACCCTCGGGTTTGGAGA	0.612																																																	0													36.0	34.0	35.0					22																	28379631		692	1591	2283	SO:0001819	synonymous_variant	0			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.6024C>A	22.37:g.28379631G>T			K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Silent	SNP	pfam_TPR_1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.P2008	ENST00000397906.2	37	c.6024	CCDS46678.1	22																																																																																			TTC28	-	NULL	ENSG00000100154		0.612	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	-	0.00	43	0	G	XM_929318		28379631	-1	tier1	-	no_errors	ENST00000397906	ensembl	human	novel	74_37	silent	11.43	31	4	SNP	0.024	T
TTN	7273	genome.wustl.edu	37	2	179455377	179455377	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:179455377T>G	ENST00000591111.1	-	254	56376	c.56152A>C	c.(56152-56154)Agt>Cgt	p.S18718R	TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S11419R|TTN_ENST00000460472.2_Missense_Mutation_p.S11294R|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S17791R|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S20359R|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S11486R|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	18718	Fibronectin type-III 35. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGATCAGAACTTGGGGATGGT	0.433																																																	0													119.0	115.0	116.0					2																	179455377		1871	4094	5965	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.56152A>C	2.37:g.179455377T>G	ENSP00000465570:p.Ser18718Arg		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S17791R	ENST00000591111.1	37	c.53371		2	.	.	.	.	.	.	.	.	.	.	T	7.620	0.676534	0.14841	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	6.11	6.11	0.99139	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.47340	0.1440	L	0.46947	1.48	0.28004	N	0.935151	P;P;P;P	0.45283	0.855;0.855;0.855;0.855	B;B;B;B	0.41571	0.36;0.36;0.36;0.271	T	0.54523	-0.8281	9	0.87932	D	0	.	8.8934	0.35449	0.0:0.1379:0.0:0.8621	.	11294;11419;11486;18718	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	17791;11294;11486;11419;11292	ENSP00000343764:S17791R;ENSP00000434586:S11294R;ENSP00000340554:S11486R;ENSP00000352154:S11419R	ENSP00000340554:S11486R	S	-	1	0	TTN	179163623	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	1.551000	0.36233	2.343000	0.79666	0.533000	0.62120	AGT	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,pfscan_Fibronectin_type3	ENSG00000155657		0.433	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	40	0	T	NM_133378		179455377	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	41.46	24	17	SNP	1.000	G
TUBB1	81027	genome.wustl.edu	37	20	57599434	57599434	+	Silent	SNP	C	C	A	rs121918555		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr20:57599434C>A	ENST00000217133.1	+	4	1221	c.952C>A	c.(952-954)Cgg>Agg	p.R318R		NM_030773.3	NP_110400.1	Q9H4B7	TBB1_HUMAN	tubulin, beta 1 class VI	318			R -> W (in MAD-TUBB1; dbSNP:rs121918555). {ECO:0000269|PubMed:18849486}.		'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|skin(2)	16	all_lung(29;0.00711)		Colorectal(105;0.109)		Cabazitaxel(DB06772)|Colchicine(DB01394)|Docetaxel(DB01248)|Paclitaxel(DB01229)|Vindesine(DB00309)	CTGCATTTTCCGGGGCAAGAT	0.597																																																	0			GRCh37	CM090175	TUBB1	M	rs121918555						57.0	48.0	51.0					20																	57599434		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ292757	CCDS13475.1	20q13.32	2014-09-17	2011-10-10		ENSG00000101162	ENSG00000101162		"""Tubulins"""	16257	protein-coding gene	gene with protein product	"""class VI beta-tubulin"""	612901	"""tubulin, beta 1"""				Standard	NM_030773		Approved	dJ543J19.4	uc002yak.3	Q9H4B7	OTTHUMG00000032860	ENST00000217133.1:c.952C>A	20.37:g.57599434C>A				Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_tubulin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Gamma_tubulin,prints_Alpha_tubulin	p.R318	ENST00000217133.1	37	c.952	CCDS13475.1	20																																																																																			TUBB1	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin	ENSG00000101162		0.597	TUBB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB1	HGNC	protein_coding	OTTHUMT00000079903.1		0.00	52	0	C	NM_030773		57599434	+1			no_errors	ENST00000217133	ensembl	human	known	74_37	silent	5.13	74	4	SNP	1.000	A
TVP23A	780776	genome.wustl.edu	37	16	10865591	10865591	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:10865591A>T	ENST00000299866.8	-	6	809	c.518T>A	c.(517-519)aTg>aAg	p.M173K	TVP23A_ENST00000572980.1_5'UTR	NM_001079512.2	NP_001072980.1	A6NH52	TV23A_HUMAN	trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)	173						integral component of membrane (GO:0016021)											GTTGCCTCCCATCTTACAAAG	0.502																																																	0													57.0	59.0	58.0					16																	10865591		1996	4176	6172	SO:0001583	missense	0				CCDS45408.1	16p13.3	2012-11-29	2012-11-29	2012-11-29	ENSG00000166676	ENSG00000166676			20398	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member A"""	FAM18A			Standard	NM_001079512		Approved	YDR084C	uc010buo.1	A6NH52	OTTHUMG00000177389	ENST00000299866.8:c.518T>A	16.37:g.10865591A>T	ENSP00000299866:p.Met173Lys		B2RUV4|B7ZW18	Missense_Mutation	SNP	pfam_DUF846_euk	p.M173K	ENST00000299866.8	37	c.518	CCDS45408.1	16	.	.	.	.	.	.	.	.	.	.	A	12.79	2.044993	0.36085	.	.	ENSG00000166676	ENST00000456096;ENST00000299866	T	0.26518	1.73	5.37	5.37	0.77165	.	0.345966	0.32548	N	0.005942	T	0.14227	0.0344	N	0.14661	0.345	0.30283	N	0.791143	B	0.21520	0.057	B	0.18871	0.023	T	0.10132	-1.0643	10	0.27082	T	0.32	-45.4819	9.1327	0.36854	0.9192:0.0:0.0808:0.0	.	173	A6NH52	FA18A_HUMAN	K	148;173	ENSP00000299866:M173K	ENSP00000299866:M173K	M	-	2	0	FAM18A	10773092	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.943000	0.56621	2.025000	0.59659	0.533000	0.62120	ATG	TVP23A	-	NULL	ENSG00000166676		0.502	TVP23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TVP23A	HGNC	protein_coding	OTTHUMT00000436680.1		0.00	71	0	A	NM_001079512		10865591	-1			no_errors	ENST00000299866	ensembl	human	known	74_37	missense	5.00	76	4	SNP	0.999	T
UBE3B	89910	genome.wustl.edu	37	12	109924360	109924360	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:109924360G>T	ENST00000342494.3	+	6	1022	c.427G>T	c.(427-429)Gat>Tat	p.D143Y	UBE3B_ENST00000280774.5_Missense_Mutation_p.D143Y|UBE3B_ENST00000434735.2_Missense_Mutation_p.D143Y|UBE3B_ENST00000540230.1_Missense_Mutation_p.D143Y|UBE3B_ENST00000536398.1_Missense_Mutation_p.D143Y|UBE3B_ENST00000340074.5_Missense_Mutation_p.D143Y|UBE3B_ENST00000537063.1_Missense_Mutation_p.D143Y	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	143					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						GTACTGCTGTGATTTTCTCAA	0.378																																																	0													132.0	118.0	123.0					12																	109924360		2203	4300	6503	SO:0001583	missense	0			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.427G>T	12.37:g.109924360G>T	ENSP00000340596:p.Asp143Tyr		A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	pfam_HECT,pfam_IQ_motif_EF-hand-BS,superfamily_HECT,superfamily_P-loop_NTPase,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.D143Y	ENST00000342494.3	37	c.427	CCDS9129.1	12	.	.	.	.	.	.	.	.	.	.	G	13.66	2.302884	0.40795	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000536398;ENST00000539599;ENST00000342494;ENST00000340074;ENST00000540230;ENST00000537063	T;T;T;T;T;T;T;T	0.67523	1.94;1.94;-0.27;1.94;1.94;-0.27;-0.27;1.94	5.93	1.38	0.22167	.	0.354438	0.34676	N	0.003777	T	0.38931	0.1059	N	0.03608	-0.345	0.26963	N	0.965776	B;B;B	0.23854	0.005;0.092;0.092	B;B;B	0.19148	0.024;0.01;0.01	T	0.35798	-0.9774	10	0.56958	D	0.05	.	9.0957	0.36638	0.1433:0.229:0.6277:0.0	.	143;143;143	Q7Z3V4;Q7Z3V4-3;F5H6D6	UBE3B_HUMAN;.;.	Y	143	ENSP00000391529:D143Y;ENSP00000280774:D143Y;ENSP00000440585:D143Y;ENSP00000443131:D143Y;ENSP00000340596:D143Y;ENSP00000342614:D143Y;ENSP00000443565:D143Y;ENSP00000437694:D143Y	ENSP00000280774:D143Y	D	+	1	0	UBE3B	108408743	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	1.859000	0.39418	0.364000	0.24374	0.655000	0.94253	GAT	UBE3B	-	NULL	ENSG00000151148		0.378	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	HGNC	protein_coding	OTTHUMT00000403119.1		0.00	28	0	G	NM_183415		109924360	+1			no_errors	ENST00000342494	ensembl	human	known	74_37	missense	6.25	30	2	SNP	1.000	T
UBTF	7343	genome.wustl.edu	37	17	42289815	42289815	+	Missense_Mutation	SNP	G	G	A	rs372626678		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr17:42289815G>A	ENST00000302904.4	-	8	1160	c.668C>T	c.(667-669)aCg>aTg	p.T223M	UBTF_ENST00000436088.1_Missense_Mutation_p.T223M|UBTF_ENST00000527034.1_Intron|UBTF_ENST00000343638.5_Intron|UBTF_ENST00000533177.1_Intron|UBTF_ENST00000537550.1_5'Flank|CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000526094.1_Intron|UBTF_ENST00000529383.1_Missense_Mutation_p.T223M|UBTF_ENST00000393606.3_Intron			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	223					chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		CACCTCCTTCGTAGTGGCCTG	0.627																																																	0								G	,,MET/THR	1,4405	2.1+/-5.4	0,1,2202	80.0	76.0	78.0		,,668	3.9	1.0	17		78	0,8600		0,0,4300	no	intron,intron,missense	UBTF	NM_001076683.1,NM_001076684.2,NM_014233.3	,,81	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	,,possibly-damaging	,,223/765	42289815	1,13005	2203	4300	6503	SO:0001583	missense	0			BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.668C>T	17.37:g.42289815G>A	ENSP00000302640:p.Thr223Met		A8K6R8	Missense_Mutation	SNP	pfam_HMG_box_dom,superfamily_HMG_box_dom,superfamily_ARM-type_fold,smart_HMG_box_dom,pfscan_HMG_box_dom	p.T223M	ENST00000302904.4	37	c.668	CCDS11480.1	17	.	.	.	.	.	.	.	.	.	.	g	16.37	3.103069	0.56183	2.27E-4	0.0	ENSG00000108312	ENST00000302904;ENST00000436088;ENST00000529383	D;D;D	0.97994	-4.65;-4.65;-4.65	4.9	3.89	0.44902	High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.294971	0.35555	N	0.003131	D	0.97536	0.9193	L	0.51422	1.61	0.40175	D	0.977228	D	0.63880	0.993	P	0.61201	0.885	D	0.96888	0.9651	10	0.33940	T	0.23	-7.8194	14.2626	0.66094	0.0:0.0:0.8496:0.1504	.	223	P17480	UBF1_HUMAN	M	223	ENSP00000302640:T223M;ENSP00000390669:T223M;ENSP00000435708:T223M	ENSP00000302640:T223M	T	-	2	0	UBTF	39645341	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.332000	0.65911	1.135000	0.42183	0.442000	0.29010	ACG	UBTF	-	pfam_HMG_box_dom,superfamily_HMG_box_dom,superfamily_ARM-type_fold,smart_HMG_box_dom,pfscan_HMG_box_dom	ENSG00000108312		0.627	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UBTF	HGNC	protein_coding	OTTHUMT00000395205.1	-	0.00	34	0	G	NM_014233		42289815	-1	tier1	-	no_errors	ENST00000302904	ensembl	human	known	74_37	missense	38.33	37	23	SNP	1.000	A
UCMA	221044	genome.wustl.edu	37	10	13264168	13264168	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:13264168G>T	ENST00000378681.3	-	5	424	c.352C>A	c.(352-354)Cag>Aag	p.Q118K	UCMA_ENST00000463405.2_Missense_Mutation_p.Q96K	NM_145314.1	NP_660357.2	Q8WVF2	UCMA_HUMAN	upper zone of growth plate and cartilage matrix associated	118					negative regulation of osteoblast differentiation (GO:0045668)	aggresome (GO:0016235)|extracellular space (GO:0005615)|perinuclear region of cytoplasm (GO:0048471)|proteinaceous extracellular matrix (GO:0005578)				breast(2)|endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	9						TGGCGCCACTGCTCCACAGCC	0.607																																																	0													108.0	94.0	99.0					10																	13264168		2203	4300	6503	SO:0001583	missense	0			BC018068	CCDS31147.1	10p13	2009-03-25	2009-03-25	2009-03-25	ENSG00000165623	ENSG00000165623			25205	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 49"""	C10orf49		12477932	Standard	NM_145314		Approved		uc001imd.3	Q8WVF2	OTTHUMG00000017692	ENST00000378681.3:c.352C>A	10.37:g.13264168G>T	ENSP00000367952:p.Gln118Lys			Missense_Mutation	SNP	NULL	p.Q118K	ENST00000378681.3	37	c.352	CCDS31147.1	10	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477742	0.84640	.	.	ENSG00000165623	ENST00000378681	.	.	.	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.77948	0.4207	M	0.72118	2.19	0.53688	D	0.999978	D	0.71674	0.998	D	0.78314	0.991	T	0.80607	-0.1307	9	0.87932	D	0	-5.0589	15.5703	0.76330	0.0:0.0:1.0:0.0	.	118	Q8WVF2	UCMA_HUMAN	K	118	.	ENSP00000367952:Q118K	Q	-	1	0	UCMA	13304174	1.000000	0.71417	0.989000	0.46669	0.892000	0.51952	6.819000	0.75262	2.412000	0.81896	0.448000	0.29417	CAG	UCMA	-	NULL	ENSG00000165623		0.607	UCMA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCMA	HGNC	protein_coding	OTTHUMT00000046843.2		0.00	30	0	G	NM_145314		13264168	-1			no_errors	ENST00000378681	ensembl	human	known	74_37	missense	5.00	57	3	SNP	1.000	T
UNC13C	440279	genome.wustl.edu	37	15	54307240	54307240	+	Missense_Mutation	SNP	T	T	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr15:54307240T>G	ENST00000260323.11	+	1	2140	c.2140T>G	c.(2140-2142)Tta>Gta	p.L714V	UNC13C_ENST00000537900.1_Missense_Mutation_p.L714V|UNC13C_ENST00000545554.1_Missense_Mutation_p.L714V	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	714					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		GAGCTACGACTTAACTCAAGA	0.413																																																	0													36.0	34.0	35.0					15																	54307240		1890	4121	6011	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2140T>G	15.37:g.54307240T>G	ENSP00000260323:p.Leu714Val		Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_dom,pfscan_C2_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.L714V	ENST00000260323.11	37	c.2140	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	T	7.996	0.754345	0.15778	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.80393	-1.37;-1.37;-1.37	5.79	2.21	0.28008	.	.	.	.	.	T	0.65893	0.2735	N	0.24115	0.695	0.24703	N	0.993249	B	0.02656	0.0	B	0.08055	0.003	T	0.54754	-0.8246	9	0.46703	T	0.11	.	5.9368	0.19171	0.0:0.1491:0.1411:0.7098	.	714	Q8NB66	UN13C_HUMAN	V	714	ENSP00000260323:L714V;ENSP00000438156:L714V;ENSP00000442569:L714V	ENSP00000260323:L714V	L	+	1	2	UNC13C	52094532	1.000000	0.71417	0.933000	0.37362	0.941000	0.58515	1.992000	0.40737	0.439000	0.26476	0.528000	0.53228	TTA	UNC13C	-	NULL	ENSG00000137766		0.413	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	-	0.00	15	0	T	NM_173166		54307240	+1	tier1	-	no_errors	ENST00000260323	ensembl	human	known	74_37	missense	28.57	15	6	SNP	0.985	G
UPK3A	7380	genome.wustl.edu	37	22	45691457	45691457	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr22:45691457G>T	ENST00000216211.4	+	6	753	c.721G>T	c.(721-723)Gat>Tat	p.D241Y	UPK3A_ENST00000396082.2_Missense_Mutation_p.D120Y	NM_006953.3	NP_008884.1	O75631	UPK3A_HUMAN	uroplakin 3A	241					cell morphogenesis (GO:0000902)|epithelial cell differentiation (GO:0030855)|kidney development (GO:0001822)|potassium ion homeostasis (GO:0055075)|sodium ion homeostasis (GO:0055078)|urea transport (GO:0015840)|urinary bladder development (GO:0060157)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|skin(1)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		GGGGAGTTCTGATGGGGAAAC	0.582																																																	0													127.0	130.0	129.0					22																	45691457		2203	4300	6503	SO:0001583	missense	0			AB010637	CCDS14064.1, CCDS54539.1	22q13.31	2005-11-14	2003-07-29	2003-07-30	ENSG00000100373	ENSG00000100373			12580	protein-coding gene	gene with protein product		611559	"""uroplakin 3"""	UPK3		9818021	Standard	NM_006953		Approved		uc003bfy.3	O75631	OTTHUMG00000151339	ENST00000216211.4:c.721G>T	22.37:g.45691457G>T	ENSP00000216211:p.Asp241Tyr		B0QY25|O60261|Q32N05|Q5TII6	Missense_Mutation	SNP	NULL	p.D241Y	ENST00000216211.4	37	c.721	CCDS14064.1	22	.	.	.	.	.	.	.	.	.	.	G	13.21	2.169823	0.38315	.	.	ENSG00000100373	ENST00000216211;ENST00000396082	T;D	0.86432	-0.4;-2.12	5.64	5.64	0.86602	.	0.283163	0.33732	N	0.004615	D	0.92854	0.7727	M	0.73962	2.25	0.09310	N	0.999994	D;D	0.89917	0.992;1.0	P;D	0.76575	0.875;0.988	D	0.87153	0.2210	10	0.72032	D	0.01	-9.7449	15.2084	0.73198	0.0:0.0:1.0:0.0	.	120;241	O75631-2;O75631	.;UPK3A_HUMAN	Y	241;120	ENSP00000216211:D241Y;ENSP00000379391:D120Y	ENSP00000216211:D241Y	D	+	1	0	UPK3A	44070121	0.939000	0.31865	0.030000	0.17652	0.118000	0.20060	4.233000	0.58651	2.676000	0.91093	0.557000	0.71058	GAT	UPK3A	-	NULL	ENSG00000100373		0.582	UPK3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UPK3A	HGNC	protein_coding	OTTHUMT00000322276.1	-	0.00	95	0	G	NM_006953		45691457	+1	tier1	-	no_errors	ENST00000216211	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.117	T
UQCRC2	7385	genome.wustl.edu	37	16	21983276	21983276	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:21983276G>T	ENST00000268379.4	+	10	1563	c.799G>T	c.(799-801)Gtc>Ttc	p.V267F	UQCRC2_ENST00000561553.1_Missense_Mutation_p.V267F	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	267					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		AGACAGTCTTGTCCATGCTGC	0.478																																					Colon(123;450 1645 12841 25393 45623)												0													121.0	112.0	115.0					16																	21983276		2198	4300	6498	SO:0001583	missense	0			J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.799G>T	16.37:g.21983276G>T	ENSP00000268379:p.Val267Phe		B3KSN4|Q9BQ05	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	p.V267F	ENST00000268379.4	37	c.799	CCDS10601.1	16	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544843	0.86022	.	.	ENSG00000140740	ENST00000268379	T	0.08193	3.12	4.66	4.66	0.58398	Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.055606	0.64402	D	0.000001	T	0.32615	0.0835	M	0.85630	2.765	0.80722	D	1	D	0.69078	0.997	D	0.68943	0.961	T	0.25398	-1.0133	10	0.87932	D	0	-11.4866	16.5284	0.84344	0.0:0.0:1.0:0.0	.	267	P22695	QCR2_HUMAN	F	267	ENSP00000268379:V267F	ENSP00000268379:V267F	V	+	1	0	UQCRC2	21890777	1.000000	0.71417	0.994000	0.49952	0.989000	0.77384	9.230000	0.95299	2.304000	0.77564	0.650000	0.86243	GTC	UQCRC2	-	pfam_Peptidase_M16_C,superfamily_Metalloenz_LuxS/M16	ENSG00000140740		0.478	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRC2	HGNC	protein_coding	OTTHUMT00000254466.1	-	0.00	53	0	G	NM_003366		21983276	+1	tier1	-	no_errors	ENST00000268379	ensembl	human	known	74_37	missense	6.25	60	4	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	216011345	216011345	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:216011345C>T	ENST00000307340.3	-	47	9745	c.9359G>A	c.(9358-9360)gGc>gAc	p.G3120D	USH2A_ENST00000366943.2_Missense_Mutation_p.G3120D	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3120	Fibronectin type-III 18. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGAAGTGATGCCACGAATTGT	0.388										HNSCC(13;0.011)																																							0													226.0	203.0	210.0					1																	216011345		2203	4300	6503	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.9359G>A	1.37:g.216011345C>T	ENSP00000305941:p.Gly3120Asp		Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.G3120D	ENST00000307340.3	37	c.9359	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	0.050	-1.254532	0.01457	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.52983	0.64;0.64	5.01	-2.38	0.06622	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.448360	0.04862	N	0.444315	T	0.29190	0.0726	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.16482	-1.0401	10	0.12103	T	0.63	.	7.0786	0.25219	0.1833:0.544:0.0:0.2727	.	3120	O75445	USH2A_HUMAN	D	3120	ENSP00000305941:G3120D;ENSP00000355910:G3120D	ENSP00000305941:G3120D	G	-	2	0	USH2A	214077968	0.000000	0.05858	0.006000	0.13384	0.043000	0.13939	0.059000	0.14322	-0.217000	0.10033	-0.302000	0.09304	GGC	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000042781		0.388	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1		0.00	28	0	C	NM_007123		216011345	-1			no_errors	ENST00000366943	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.000	T
VCL	7414	genome.wustl.edu	37	10	75873970	75873970	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:75873970G>A	ENST00000211998.4	+	20	3072	c.2978G>A	c.(2977-2979)cGc>cAc	p.R993H	VCL_ENST00000417648.2_Missense_Mutation_p.R186H|VCL_ENST00000372755.3_Missense_Mutation_p.R925H	NM_014000.2	NP_054706.1	P18206	VINC_HUMAN	vinculin	993	C-terminal tail.				adherens junction assembly (GO:0034333)|apical junction assembly (GO:0043297)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|epithelial cell-cell adhesion (GO:0090136)|lamellipodium assembly (GO:0030032)|morphogenesis of an epithelium (GO:0002009)|muscle contraction (GO:0006936)|negative regulation of cell migration (GO:0030336)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|protein localization to cell surface (GO:0034394)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cell-substrate junction (GO:0030055)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	actin binding (GO:0003779)|alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)		VCL/ALK(4)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	20	Prostate(51;0.0112)					GCAGCCAAGCGCATGGCTCTG	0.562																																																	0													85.0	70.0	75.0					10																	75873970		2203	4300	6503	SO:0001583	missense	0			M33308	CCDS7340.1, CCDS7341.1	10q22.1-q23	2014-09-17			ENSG00000035403	ENSG00000035403			12665	protein-coding gene	gene with protein product	"""metavinculin"""	193065				1339348	Standard	NM_014000		Approved		uc001jwd.3	P18206	OTTHUMG00000018498	ENST00000211998.4:c.2978G>A	10.37:g.75873970G>A	ENSP00000211998:p.Arg993His		Q16450|Q5SWX2|Q7Z3B8|Q8IXU7	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Vinculin	p.R993H	ENST00000211998.4	37	c.2978	CCDS7341.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.460829	0.96240	.	.	ENSG00000035403	ENST00000372755;ENST00000211998;ENST00000417648;ENST00000415462;ENST00000537043;ENST00000436396	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.55210	0.1906	L	0.28504	0.86	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.75484	0.982;0.986;0.936;0.976	T	0.45934	-0.9227	10	0.33940	T	0.23	.	20.4581	0.99154	0.0:0.0:1.0:0.0	.	186;852;925;993	B4DTM7;F5H7T3;P18206-2;P18206	.;.;.;VINC_HUMAN	H	925;993;186;900;852;665	ENSP00000361841:R925H;ENSP00000211998:R993H;ENSP00000411887:R186H;ENSP00000415489:R665H	ENSP00000211998:R993H	R	+	2	0	VCL	75543976	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.835000	0.97688	0.650000	0.86243	CGC	VCL	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin	ENSG00000035403		0.562	VCL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	VCL	HGNC	protein_coding		-	0.00	23	0	G	NM_003373, NM_014000		75873970	+1	tier1	-	no_errors	ENST00000211998	ensembl	human	known	74_37	missense	20.00	32	8	SNP	1.000	A
VWA3B	200403	genome.wustl.edu	37	2	98844703	98844703	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr2:98844703G>T	ENST00000477737.1	+	15	2262	c.2058G>T	c.(2056-2058)caG>caT	p.Q686H		NM_144992.4	NP_659429.4	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	686								p.Q686Q(1)		NS(3)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						AAATGGAACAGGGTCACAGTG	0.398																																																	1	Substitution - coding silent(1)	lung(1)											107.0	108.0	108.0					2																	98844703		1990	4159	6149	SO:0001583	missense	0			AL832761	CCDS42718.1	2q11.2	2008-02-05			ENSG00000168658	ENSG00000168658			28385	protein-coding gene	gene with protein product						12477932	Standard	NM_144992		Approved	DKFZp686F2227, MGC26733	uc002syo.3	Q502W6	OTTHUMG00000153104	ENST00000477737.1:c.2058G>T	2.37:g.98844703G>T	ENSP00000417955:p.Gln686His		B9EK71|Q86T73|Q8N2D0|Q8N770|Q8NA79|Q8ND63|Q8ND65|Q8WW02	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.Q686H	ENST00000477737.1	37	c.2058	CCDS42718.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.175|7.175	0.588440|0.588440	0.13812|0.13812	.|.	.|.	ENSG00000168658|ENSG00000168658	ENST00000473149|ENST00000477737	.|T	.|0.06933	.|3.24	5.8|5.8	3.05|3.05	0.35203|0.35203	.|.	.|0.420734	.|0.22406	.|N	.|0.060465	T|T	0.19805|0.19805	0.0476|0.0476	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|D;D;P;D	.|0.76494	.|0.995;0.999;0.459;0.98	.|P;P;B;P	.|0.58873	.|0.799;0.786;0.16;0.847	T|T	0.00099|0.00099	-1.2068|-1.2068	5|10	.|0.72032	.|D	.|0.01	.|.	12.1973|12.1973	0.54305|0.54305	0.2125:0.0:0.7875:0.0|0.2125:0.0:0.7875:0.0	.|.	.|78;686;686;686	.|Q502W6-5;Q502W6;Q502W6-8;Q502W6-6	.|.;VWA3B_HUMAN;.;.	W|H	97|686	.|ENSP00000417955:Q686H	.|ENSP00000417955:Q686H	G|Q	+|+	1|3	0|2	VWA3B|VWA3B	98211135|98211135	1.000000|1.000000	0.71417|0.71417	0.985000|0.985000	0.45067|0.45067	0.009000|0.009000	0.06853|0.06853	1.151000|1.151000	0.31651|0.31651	0.109000|0.109000	0.17891|0.17891	-1.595000|-1.595000	0.00837|0.00837	GGG|CAG	VWA3B	-	NULL	ENSG00000168658		0.398	VWA3B-020	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA3B	HGNC	protein_coding	OTTHUMT00000353469.2		0.00	40	0	G	NM_144992		98844703	+1			no_errors	ENST00000477737	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.996	T
WDFY4	57705	genome.wustl.edu	37	10	50029113	50029113	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr10:50029113C>T	ENST00000325239.5	+	33	5743	c.5716C>T	c.(5716-5718)Cca>Tca	p.P1906S	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1906						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CCAGGCTTCTCCAGACCACGC	0.592																																																	0													84.0	78.0	80.0					10																	50029113		692	1591	2283	SO:0001583	missense	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.5716C>T	10.37:g.50029113C>T	ENSP00000320563:p.Pro1906Ser		B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P1906S	ENST00000325239.5	37	c.5716	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.8|25.8	4.676910|4.676910	0.88445|0.88445	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000426033;ENST00000325239|ENST00000312002;ENST00000374161	T|.	0.62941|.	-0.01|.	5.92|5.92	5.92|5.92	0.95590|0.95590	.|.	0.066055|.	0.64402|.	D|.	0.000008|.	T|T	0.74921|0.74921	0.3780|0.3780	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	D;D|.	0.76494|.	0.999;0.997|.	D;D|.	0.70016|.	0.967;0.921|.	T|T	0.72988|0.72988	-0.4124|-0.4124	9|5	.|.	.|.	.|.	.|.	17.0406|17.0406	0.86488|0.86488	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	434;1906|.	F2Z372;Q6ZS81|.	.;WDFY4_HUMAN|.	S|F	1906|996;452	ENSP00000320563:P1906S|.	.|.	P|S	+|+	1|2	0|0	WDFY4|WDFY4	49699119|49699119	0.936000|0.936000	0.31750|0.31750	0.488000|0.488000	0.27440|0.27440	0.978000|0.978000	0.69477|0.69477	2.242000|2.242000	0.43106|0.43106	2.804000|2.804000	0.96469|0.96469	0.655000|0.655000	0.94253|0.94253	CCA|TCC	WDFY4	-	NULL	ENSG00000128815		0.592	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		-	0.00	53	0	C	XM_033379		50029113	+1	tier1	-	no_errors	ENST00000325239	ensembl	human	known	74_37	missense	22.73	51	15	SNP	1.000	T
WDR49	151790	genome.wustl.edu	37	3	167339318	167339318	+	Intron	SNP	A	A	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:167339318A>G	ENST00000308378.3	-	2	241				WDR49_ENST00000479765.1_Silent_p.D240D|WDR49_ENST00000453925.2_5'Flank	NM_178824.3	NP_849146.1	Q8IV35	WDR49_HUMAN	WD repeat domain 49											breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	50						CATACCAATAATCCATGCAAA	0.363																																																	0																																										SO:0001627	intron_variant	0			AK097556	CCDS3201.1	3q26.1	2013-01-11			ENSG00000174776	ENSG00000174776		"""WD repeat domain containing"""	26587	protein-coding gene	gene with protein product						12477932	Standard	NM_178824		Approved	FLJ33620	uc003fev.1	Q8IV35	OTTHUMG00000158290	ENST00000308378.3:c.65-17062T>C	3.37:g.167339318A>G			Q8N297	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_EF_hand_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D240	ENST00000308378.3	37	c.720	CCDS3201.1	3																																																																																			WDR49	-	superfamily_WD40_repeat_dom	ENSG00000174776		0.363	WDR49-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR49	HGNC	protein_coding	OTTHUMT00000350592.3	-	0.00	46	0	A	NM_178824		167339318	-1	tier1	-	no_errors	ENST00000479765	ensembl	human	putative	74_37	silent	20.31	51	13	SNP	1.000	G
WDR87	83889	genome.wustl.edu	37	19	38380066	38380066	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:38380066T>A	ENST00000303868.5	-	6	4352	c.4128A>T	c.(4126-4128)ttA>ttT	p.L1376F	WDR87_ENST00000447313.2_Missense_Mutation_p.L1415F	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1376										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TACCTGGTTCTAAAAAAATAA	0.403																																																	0													90.0	66.0	73.0					19																	38380066		692	1591	2283	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.4128A>T	19.37:g.38380066T>A	ENSP00000368025:p.Leu1376Phe		Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L1415F	ENST00000303868.5	37	c.4245	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	T	11.35	1.611417	0.28712	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.12569	2.67;2.67	3.79	2.76	0.32466	.	.	.	.	.	T	0.11707	0.0285	N	0.19112	0.55	0.20074	N	0.999937	D;D	0.58620	0.983;0.983	P;P	0.49140	0.601;0.601	T	0.14117	-1.0484	9	0.56958	D	0.05	.	6.0946	0.20013	0.0:0.1177:0.0:0.8823	.	1376;1415	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	F	1415;1376	ENSP00000405012:L1415F;ENSP00000368025:L1376F	ENSP00000368025:L1376F	L	-	3	2	WDR87	43071906	0.000000	0.05858	0.039000	0.18376	0.047000	0.14425	-1.247000	0.02893	0.786000	0.33708	0.445000	0.29226	TTA	WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.403	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	-	0.00	38	0	T	XM_940478		38380066	-1	tier1	-	no_errors	ENST00000447313	ensembl	human	known	74_37	missense	23.26	33	10	SNP	0.399	A
WFDC10A	140832	genome.wustl.edu	37	20	44258464	44258464	+	Silent	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr20:44258464G>A	ENST00000372643.3	+	1	300	c.12G>A	c.(10-12)caG>caA	p.Q4Q	WFDC9_ENST00000326000.1_Intron	NM_080753.2	NP_542791.1	Q9H1F0	WF10A_HUMAN	WAP four-disulfide core domain 10A	4						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			large_intestine(2)	2		Myeloproliferative disorder(115;0.0122)				TGGCACCCCAGACTCTGCTGC	0.562											OREG0025983	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													113.0	87.0	96.0					20																	44258464		2203	4300	6503	SO:0001819	synonymous_variant	0			AL031671	CCDS13363.1	20q13.11	2013-01-21	2003-02-21	2003-02-21	ENSG00000180305	ENSG00000180305		"""WAP four-disulfide core domain containing"""	16139	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 146"""	C20orf146		12206714	Standard	NM_080753		Approved	dJ688G8.3, WAP10	uc002xoz.3	Q9H1F0	OTTHUMG00000046331	ENST00000372643.3:c.12G>A	20.37:g.44258464G>A		922	A2RRE9|Q5TGZ7	Silent	SNP	pfam_WAP-type_4-diS_core,superfamily_WAP-type_4-diS_core	p.Q4	ENST00000372643.3	37	c.12	CCDS13363.1	20																																																																																			WFDC10A	-	NULL	ENSG00000180305		0.562	WFDC10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFDC10A	HGNC	protein_coding	OTTHUMT00000106944.2	-	0.00	39	0	G			44258464	+1	tier1	-	no_errors	ENST00000372643	ensembl	human	known	74_37	silent	27.85	57	22	SNP	0.042	A
WWOX	51741	genome.wustl.edu	37	16	78466480	78466480	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr16:78466480C>G	ENST00000566780.1	+	8	1253	c.887C>G	c.(886-888)tCc>tGc	p.S296C	WWOX_ENST00000402655.2_Intron|WWOX_ENST00000539474.2_Intron|WWOX_ENST00000406884.2_Intron|WWOX_ENST00000408984.3_Missense_Mutation_p.S296C	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	296	Interaction with MAPT. {ECO:0000250}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)			large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		TATAACAGGTCCAAGCTCTGC	0.502																																																	0													108.0	113.0	111.0					16																	78466480		2039	4185	6224	SO:0001583	missense	0			AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.887C>G	16.37:g.78466480C>G	ENSP00000457230:p.Ser296Cys		A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Missense_Mutation	SNP	pfam_WW_dom,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,superfamily_WW_dom,smart_WW_dom,pfscan_WW_dom,prints_Glc/ribitol_DH	p.S296C	ENST00000566780.1	37	c.887	CCDS42196.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.8|24.8	4.566886|4.566886	0.86439|0.86439	.|.	.|.	ENSG00000186153|ENSG00000186153	ENST00000299644|ENST00000408984	.|D	.|0.86865	.|-2.18	5.93|5.93	4.98|4.98	0.66077|0.66077	.|NAD(P)-binding domain (1);	.|0.055458	.|0.64402	.|D	.|0.000001	D|D	0.96052|0.96052	0.8714|0.8714	H|H	0.98936|0.98936	4.375|4.375	0.53005|0.53005	D|D	0.999964|0.999964	.|D	.|0.89917	.|1.0	.|D	.|0.65987	.|0.94	D|D	0.97642|0.97642	1.0149|1.0149	6|10	0.17369|0.87932	T|D	0.5|0	.|.	14.8479|14.8479	0.70272|0.70272	0.0:0.9312:0.0:0.0687|0.0:0.9312:0.0:0.0687	.|.	.|296	.|Q9NZC7	.|WWOX_HUMAN	A|C	139|296	.|ENSP00000386161:S296C	ENSP00000299644:P139A|ENSP00000386161:S296C	P|S	+|+	1|2	0|0	WWOX|WWOX	77023981|77023981	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.913000|0.913000	0.54294|0.54294	7.487000|7.487000	0.81328|0.81328	1.510000|1.510000	0.48803|0.48803	0.655000|0.655000	0.94253|0.94253	CCA|TCC	WWOX	-	NULL	ENSG00000186153		0.502	WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	WWOX	HGNC	protein_coding	OTTHUMT00000434328.1	-	0.00	38	0	C			78466480	+1	tier1	-	no_errors	ENST00000566780	ensembl	human	known	74_37	missense	22.73	34	10	SNP	1.000	G
YAF2	10138	genome.wustl.edu	37	12	42604244	42604244	+	Intron	SNP	G	G	A	rs371885898		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr12:42604244G>A	ENST00000534854.2	-	2	220				YAF2_ENST00000380790.4_Intron|YAF2_ENST00000327791.4_Intron|YAF2_ENST00000380788.3_Intron|YAF2_ENST00000442791.3_Intron	NM_005748.4	NP_005739.2	Q8IY57	YAF2_HUMAN	YY1 associated factor 2						negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(1)	8	all_cancers(12;0.000425)	Lung NSC(34;0.0402)|all_lung(34;0.057)		GBM - Glioblastoma multiforme(48;0.0514)		TTCCTGATGGGCATCCACTGG	0.473																																																	0																																										SO:0001627	intron_variant	0			U72209	CCDS31775.1, CCDS53778.1, CCDS53779.1, CCDS53780.1	12q12	2014-09-04			ENSG00000015153	ENSG00000015153			17363	protein-coding gene	gene with protein product		607534				9016636	Standard	NM_001190977		Approved		uc001rmw.3	Q8IY57	OTTHUMG00000169380	ENST00000534854.2:c.152+27156C>T	12.37:g.42604244G>A			A8K5P0|B4DFU3|G3V465|Q99710	Silent	SNP	pfam_Znf_RanBP2,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.C113	ENST00000534854.2	37	c.339	CCDS31775.1	12																																																																																			YAF2	-	NULL	ENSG00000015153		0.473	YAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YAF2	HGNC	protein_coding	OTTHUMT00000403781.1	-	0.00	59	0	G			42604244	-1	tier1	-	no_errors	ENST00000552928	ensembl	human	known	74_37	silent	6.35	59	4	SNP	0.101	A
ZFYVE20	64145	genome.wustl.edu	37	3	15124116	15124116	+	Splice_Site	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr3:15124116C>A	ENST00000253699.3	-	9	1212		c.e9-1		ZFYVE20_ENST00000449964.2_Intron|ZFYVE20_ENST00000476527.2_Splice_Site|ZFYVE20_ENST00000435849.3_Intron	NM_022340.2	NP_071735.2	Q9H1K0	RBNS5_HUMAN	zinc finger, FYVE domain containing 20						blood coagulation (GO:0007596)|endosomal transport (GO:0016197)|protein transport (GO:0015031)	endosome (GO:0005768)|endosome membrane (GO:0010008)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)	p.?(1)		NS(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|skin(3)|stomach(1)|urinary_tract(2)	26						GTGAGCTTGTCTGTAACCACA	0.572																																																	1	Unknown(1)	urinary_tract(1)											105.0	70.0	82.0					3																	15124116		2203	4300	6503	SO:0001630	splice_region_variant	0			AY009133	CCDS2623.1	3p25.1	2014-01-15			ENSG00000131381	ENSG00000131381		"""Zinc fingers, FYVE domain containing"""	20759	protein-coding gene	gene with protein product		609511				11062261	Standard	XR_427283		Approved	Rabenosyn-5	uc003bzm.1	Q9H1K0	OTTHUMG00000129860	ENST00000253699.3:c.599-1G>T	3.37:g.15124116C>A			B4DWY8|C9J4P5|Q3KP30|Q59EY8|Q8NAQ1	Splice_Site	SNP	-	e6-1	ENST00000253699.3	37	c.599-1	CCDS2623.1	3	.	.	.	.	.	.	.	.	.	.	C	21.7	4.186650	0.78789	.	.	ENSG00000131381	ENST00000253699;ENST00000476527	.	.	.	5.46	5.46	0.80206	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.309	0.94177	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZFYVE20	15099120	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.524000	0.81866	2.557000	0.86248	0.585000	0.79938	.	ZFYVE20	-	-	ENSG00000131381		0.572	ZFYVE20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFYVE20	HGNC	protein_coding	OTTHUMT00000252102.2		0.00	42	0	C	NM_022340	Intron	15124116	-1			no_errors	ENST00000253699	ensembl	human	known	74_37	splice_site	5.66	50	3	SNP	1.000	A
ZHX3	23051	genome.wustl.edu	37	20	39830877	39830877	+	Missense_Mutation	SNP	C	C	T	rs577583178		TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr20:39830877C>T	ENST00000309060.3	-	4	3095	c.2680G>A	c.(2680-2682)Gtg>Atg	p.V894M	ZHX3_ENST00000540170.1_Missense_Mutation_p.V894M|ZHX3_ENST00000432768.2_Missense_Mutation_p.V894M|ZHX3_ENST00000558993.1_Intron|ZHX3_ENST00000557816.1_Intron|ZHX3_ENST00000560361.1_Missense_Mutation_p.V894M|ZHX3_ENST00000544979.2_Intron|ZHX3_ENST00000559234.1_Missense_Mutation_p.V894M			Q9H4I2	ZHX3_HUMAN	zinc fingers and homeoboxes 3	894					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoblast differentiation (GO:0045669)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|kidney(5)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		Myeloproliferative disorder(115;0.00425)				GTGTCTGCCACGGCTCTGGTC	0.557																																																	0													212.0	200.0	205.0					20																	39830877		2203	4300	6503	SO:0001583	missense	0			AB007855	CCDS13315.1	20q12	2012-03-09	2004-01-29	2004-01-30	ENSG00000174306	ENSG00000174306		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	15935	protein-coding gene	gene with protein product		609598	"""triple homeobox 1"""	TIX1		9455477	Standard	XM_005260343		Approved	KIAA0395	uc002xjs.1	Q9H4I2	OTTHUMG00000032481	ENST00000309060.3:c.2680G>A	20.37:g.39830877C>T	ENSP00000312222:p.Val894Met		E1P5W5|F5H820|O43145|Q6NUJ7	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.V894M	ENST00000309060.3	37	c.2680	CCDS13315.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.98|11.98	1.799409|1.799409	0.31869|0.31869	.|.	.|.	ENSG00000174306|ENSG00000174306	ENST00000421422|ENST00000309060;ENST00000373263;ENST00000540170;ENST00000373262	.|T;T	.|0.11063	.|2.81;2.81	6.02|6.02	5.08|5.08	0.68730|0.68730	.|Homeodomain-like (1);	.|0.654140	.|0.14913	.|N	.|0.291093	T|T	0.17874|0.17874	0.0429|0.0429	L|L	0.29908|0.29908	0.895|0.895	0.29639|0.29639	N|N	0.844834|0.844834	.|D;D	.|0.76494	.|0.999;0.999	.|P;P	.|0.60236	.|0.828;0.871	T|T	0.03993|0.03993	-1.0986|-1.0986	5|10	.|0.52906	.|T	.|0.07	-12.9776|-12.9776	10.3626|10.3626	0.44003|0.44003	0.0:0.8131:0.0:0.1869|0.0:0.8131:0.0:0.1869	.|.	.|894;894	.|A8K8Q0;Q9H4I2	.|.;ZHX3_HUMAN	H|M	602|894;894;894;672	.|ENSP00000362360:V894M;ENSP00000442290:V894M	.|ENSP00000312222:V894M	R|V	-|-	2|1	0|0	ZHX3|ZHX3	39264291|39264291	0.077000|0.077000	0.21312|0.21312	0.894000|0.894000	0.35097|0.35097	0.500000|0.500000	0.33767|0.33767	0.819000|0.819000	0.27308|0.27308	1.568000|1.568000	0.49683|0.49683	-0.137000|-0.137000	0.14449|0.14449	CGT|GTG	ZHX3	-	superfamily_Homeodomain-like	ENSG00000174306		0.557	ZHX3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZHX3	HGNC	protein_coding	OTTHUMT00000079262.3	-	0.00	59	0	C	NM_015035		39830877	-1	tier1	-	no_errors	ENST00000309060	ensembl	human	known	74_37	missense	27.14	51	19	SNP	0.724	T
ZNF428	126299	genome.wustl.edu	37	19	44111802	44111802	+	Silent	SNP	C	C	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:44111802C>T	ENST00000300811.3	-	3	980	c.534G>A	c.(532-534)ggG>ggA	p.G178G	SRRM5_ENST00000526798.1_Intron|SRRM5_ENST00000607544.1_Intron	NM_182498.3	NP_872304.2	Q96B54	ZN428_HUMAN	zinc finger protein 428	178							metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	5		Prostate(69;0.0153)				GCATGAAGTGCCCGTGCAGCT	0.637																																																	0													91.0	69.0	77.0					19																	44111802		2203	4300	6503	SO:0001819	synonymous_variant	0			AY257197	CCDS12626.1	19q13.31	2008-05-02	2006-07-04	2006-07-04				"""Zinc fingers, C2H2-type"""	20804	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 37"""	C19orf37			Standard	NM_182498		Approved	MGC51082, Zfp428	uc002oxa.3	Q96B54		ENST00000300811.3:c.534G>A	19.37:g.44111802C>T			O95054|Q6X3Y3	Silent	SNP	pfscan_Znf_C2H2	p.G178	ENST00000300811.3	37	c.534	CCDS12626.1	19																																																																																			ZNF428	-	pfscan_Znf_C2H2	ENSG00000131116		0.637	ZNF428-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF428	HGNC	protein_coding	OTTHUMT00000463349.1	-	0.00	50	0	C	NM_182498		44111802	-1	tier1	-	no_errors	ENST00000300811	ensembl	human	known	74_37	silent	9.26	49	5	SNP	0.913	T
ZNF454	285676	genome.wustl.edu	37	5	178392970	178392970	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr5:178392970A>C	ENST00000320129.3	+	5	1868	c.1565A>C	c.(1564-1566)aAg>aCg	p.K522T	ZNF454_ENST00000519564.1_Missense_Mutation_p.K522T	NM_001178090.1|NM_182594.2	NP_001171561.1|NP_872400.2	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	522					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(11)|lung(18)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	46	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		ATTGGAGAGAAGTGATATGAA	0.363																																																	0													60.0	62.0	61.0					5																	178392970		2202	4300	6502	SO:0001583	missense	0			AK094763	CCDS4441.1	5q35.3	2013-01-08			ENSG00000178187	ENSG00000178187		"""Zinc fingers, C2H2-type"", ""-"""	21200	protein-coding gene	gene with protein product							Standard	NM_182594		Approved	FLJ37444	uc021yjc.1	Q8N9F8	OTTHUMG00000130891	ENST00000320129.3:c.1565A>C	5.37:g.178392970A>C	ENSP00000326249:p.Lys522Thr		Q2M1P2|Q2M323	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K522T	ENST00000320129.3	37	c.1565	CCDS4441.1	5	.	.	.	.	.	.	.	.	.	.	A	11.97	1.798783	0.31777	.	.	ENSG00000178187	ENST00000320129;ENST00000519564	T;T	0.08896	3.04;3.04	4.46	3.26	0.37387	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.39615	N	0.001306	T	0.25791	0.0628	M	0.86864	2.845	0.30929	N	0.727105	P	0.51933	0.949	P	0.59288	0.855	T	0.21449	-1.0245	10	0.87932	D	0	.	8.5819	0.33634	0.9053:0.0:0.0947:0.0	.	522	Q8N9F8	ZN454_HUMAN	T	522	ENSP00000326249:K522T;ENSP00000430354:K522T	ENSP00000326249:K522T	K	+	2	0	ZNF454	178325576	0.123000	0.22298	0.962000	0.40283	0.008000	0.06430	1.578000	0.36525	0.813000	0.34350	0.528000	0.53228	AAG	ZNF454	-	pfscan_Znf_C2H2	ENSG00000178187		0.363	ZNF454-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF454	HGNC	protein_coding	OTTHUMT00000253476.2	-	0.00	25	0	A	XM_209718		178392970	+1	tier1	-	no_errors	ENST00000320129	ensembl	human	known	74_37	missense	32.69	35	17	SNP	1.000	C
ZNF568	374900	genome.wustl.edu	37	19	37488332	37488332	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:37488332G>A	ENST00000455427.2	+	9	1876	c.1547G>A	c.(1546-1548)cGa>cAa	p.R516Q		NM_001204839.1	NP_001191768.1	Q3ZCX4	ZN568_HUMAN	zinc finger protein 568	547					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(9)|ovary(1)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAACTTGTTCGACATCAAAAA	0.448																																																	0																																										SO:0001583	missense	0			BX640681	CCDS42558.1, CCDS56092.1, CCDS56093.1, CCDS74351.1	19q13.12	2013-09-20			ENSG00000198453	ENSG00000198453		"""Zinc fingers, C2H2-type"", ""-"""	25392	protein-coding gene	gene with protein product							Standard	NM_198539		Approved	DKFZp686B0797	uc002ofc.3	Q3ZCX4	OTTHUMG00000048160	ENST00000455427.2:c.1547G>A	19.37:g.37488332G>A	ENSP00000413396:p.Arg516Gln		B4DS92|E7ER33|Q6N060|Q8NA64	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R516Q	ENST00000455427.2	37	c.1547	CCDS56093.1	19	.	.	.	.	.	.	.	.	.	.	g	0.915	-0.717761	0.03182	.	.	ENSG00000198453	ENST00000444991;ENST00000455427	T;T	0.26223	3.17;1.75	3.8	-2.94	0.05581	.	.	.	.	.	T	0.14227	0.0344	L	0.48260	1.515	0.09310	N	0.999996	B;B	0.15719	0.014;0.014	B;B	0.12156	0.007;0.007	T	0.41431	-0.9509	9	0.02654	T	1	.	3.8182	0.08824	0.2778:0.0:0.4393:0.2828	.	516;516	E7ER33;B4DS92	.;.	Q	580;516	ENSP00000389794:R580Q;ENSP00000413396:R516Q	ENSP00000389794:R580Q	R	+	2	0	ZNF568	42180172	0.000000	0.05858	0.007000	0.13788	0.976000	0.68499	-6.271000	0.00073	-0.153000	0.11137	-0.172000	0.13284	CGA	ZNF568	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198453		0.448	ZNF568-007	KNOWN	basic|CCDS	protein_coding	ZNF568	HGNC	protein_coding	OTTHUMT00000457465.1	-	0.00	47	0	G	NM_198539		37488332	+1	tier1	-	no_errors	ENST00000455427	ensembl	human	known	74_37	missense	25.00	39	13	SNP	0.001	A
ZNF570	148268	genome.wustl.edu	37	19	37975537	37975537	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:37975537C>A	ENST00000330173.1	+	5	1542	c.1013C>A	c.(1012-1014)gCa>gAa	p.A338E	ZNF570_ENST00000388801.3_Missense_Mutation_p.A135E|ZNF570_ENST00000586475.1_Missense_Mutation_p.A394E	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	338					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGTGGGAAAGCATTTAGCAAC	0.443																																																	0													107.0	100.0	103.0					19																	37975537		2203	4300	6503	SO:0001583	missense	0			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.1013C>A	19.37:g.37975537C>A	ENSP00000331540:p.Ala338Glu		A1L472|B4DMP1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A338E	ENST00000330173.1	37	c.1013	CCDS12504.1	19	.	.	.	.	.	.	.	.	.	.	C	13.69	2.310988	0.40895	.	.	ENSG00000171827	ENST00000330173;ENST00000388801	T;T	0.35789	1.29;1.29	4.18	4.18	0.49190	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42420	D	0.000704	T	0.42743	0.1216	N	0.21617	0.685	0.09310	N	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.967;0.984	T	0.18398	-1.0338	10	0.87932	D	0	.	10.9288	0.47205	0.0:0.6832:0.3168:0.0	.	135;338	B4DMP1;Q96NI8	.;ZN570_HUMAN	E	338;135	ENSP00000331540:A338E;ENSP00000373453:A135E	ENSP00000331540:A338E	A	+	2	0	ZNF570	42667377	0.000000	0.05858	0.992000	0.48379	0.931000	0.56810	0.346000	0.19997	2.317000	0.78254	0.563000	0.77884	GCA	ZNF570	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171827		0.443	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	HGNC	protein_coding	OTTHUMT00000109600.1	-	0.00	48	0	C	NM_144694		37975537	+1	tier1	-	no_errors	ENST00000330173	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.028	A
ZNF572	137209	genome.wustl.edu	37	8	125989785	125989785	+	Silent	SNP	C	C	A			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr8:125989785C>A	ENST00000319286.5	+	3	1429	c.1275C>A	c.(1273-1275)tcC>tcA	p.S425S		NM_152412.2	NP_689625.2	Q7Z3I7	ZN572_HUMAN	zinc finger protein 572	425					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)	31	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			GTCAGAGTTCCACCCTGGTGA	0.433										HNSCC(60;0.17)																																							0													78.0	78.0	78.0					8																	125989785		2203	4300	6503	SO:0001819	synonymous_variant	0			BX537876	CCDS6354.1	8q24.13	2013-09-20			ENSG00000180938	ENSG00000180938		"""Zinc fingers, C2H2-type"""	26758	protein-coding gene	gene with protein product							Standard	NM_152412		Approved	FLJ38002	uc003yrr.3	Q7Z3I7	OTTHUMG00000164988	ENST00000319286.5:c.1275C>A	8.37:g.125989785C>A			A1L4F1|Q8N1Q0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S425	ENST00000319286.5	37	c.1275	CCDS6354.1	8																																																																																			ZNF572	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180938		0.433	ZNF572-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF572	HGNC	protein_coding	OTTHUMT00000381359.1	-	0.00	28	0	C	NM_152412		125989785	+1	tier1	-	no_errors	ENST00000319286	ensembl	human	known	74_37	silent	21.05	30	8	SNP	0.822	A
ZNF585B	92285	genome.wustl.edu	37	19	37676130	37676130	+	Nonstop_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:37676130C>G	ENST00000532828.2	-	5	2560	c.2309G>C	c.(2308-2310)tGa>tCa	p.*770S	ZNF585B_ENST00000312908.5_Nonstop_Mutation_p.*358S|ZNF585B_ENST00000531805.1_Nonstop_Mutation_p.*715S|ZNF585B_ENST00000527838.1_3'UTR|CTC-454I21.3_ENST00000585860.2_Intron	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTGTTTCTCTCAAGCGTGGCT	0.448																																					Melanoma(93;882 1454 18863 28917 48427)												0													103.0	94.0	97.0					19																	37676130		2203	4300	6503	SO:0001578	stop_lost	0			AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.2309G>C	19.37:g.37676130C>G			Q8IZD3|Q96JW6	Nonstop_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.*770S	ENST00000532828.2	37	c.2309	CCDS12500.1	19	.	.	.	.	.	.	.	.	.	.	C	3.449	-0.112346	0.06881	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000312908	.	.	.	2.72	-2.9	0.05648	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.6518	0.08206	0.0:0.4374:0.1909:0.3717	.	.	.	.	S	715;770;358	.	.	X	-	2	2	ZNF585B	42367970	0.000000	0.05858	0.000000	0.03702	0.206000	0.24218	0.279000	0.18771	-0.710000	0.05001	0.305000	0.20034	TGA	ZNF585B	-	NULL	ENSG00000245680		0.448	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585B	HGNC	protein_coding	OTTHUMT00000388272.2	-	0.00	48	0	C	NM_152279		37676130	-1	tier1	-	no_errors	ENST00000532828	ensembl	human	known	74_37	nonstop	32.65	33	16	SNP	0.984	G
ZNF583	147949	genome.wustl.edu	37	19	56935519	56935519	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:56935519G>T	ENST00000333201.9	+	5	1702	c.1492G>T	c.(1492-1494)Ggg>Tgg	p.G498W	ZNF583_ENST00000291598.7_Missense_Mutation_p.G498W|ZNF583_ENST00000585612.1_Intron	NM_001159861.1|NM_152478.2	NP_001153333.1|NP_689691.2	Q96ND8	ZN583_HUMAN	zinc finger protein 583	498					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0564)		TAATGTTTGTGGGAAAGCATT	0.378																																																	0													106.0	111.0	109.0					19																	56935519		2203	4300	6503	SO:0001583	missense	0			AK055592	CCDS12943.1	19q13.43	2013-09-20			ENSG00000198440	ENSG00000198440		"""Zinc fingers, C2H2-type"", ""-"""	26427	protein-coding gene	gene with protein product							Standard	NM_152478		Approved	FLJ31030	uc010ygl.1	Q96ND8	OTTHUMG00000168874	ENST00000333201.9:c.1492G>T	19.37:g.56935519G>T	ENSP00000388502:p.Gly498Trp		O14850|Q2NKK3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G498W	ENST00000333201.9	37	c.1492	CCDS12943.1	19	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192648	0.58017	.	.	ENSG00000198440	ENST00000291598;ENST00000333201	T;T	0.07800	3.16;3.16	4.65	-1.82	0.07857	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45606	D	0.000358	T	0.30916	0.0780	H	0.96633	3.855	0.33959	D	0.645377	D	0.89917	1.0	D	0.91635	0.999	T	0.29488	-1.0010	9	.	.	.	.	2.225	0.03981	0.2956:0.1203:0.4609:0.1232	.	498	Q96ND8	ZN583_HUMAN	W	498	ENSP00000291598:G498W;ENSP00000388502:G498W	.	G	+	1	0	ZNF583	61627331	0.985000	0.35326	0.301000	0.25044	0.996000	0.88848	0.375000	0.20518	-0.225000	0.09913	0.655000	0.94253	GGG	ZNF583	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198440		0.378	ZNF583-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF583	HGNC	protein_coding	OTTHUMT00000401453.1		0.00	49	0	G	NM_152478		56935519	+1			no_errors	ENST00000291598	ensembl	human	known	74_37	missense	5.97	63	4	SNP	0.999	T
ZNF667	63934	genome.wustl.edu	37	19	56972109	56972109	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:56972109C>G	ENST00000504904.3	-	5	828	c.109G>C	c.(109-111)Gat>Cat	p.D37H	ZNF667_ENST00000292069.6_Missense_Mutation_p.D37H|ZNF667_ENST00000591790.1_Missense_Mutation_p.D37H|ZNF667_ENST00000342634.3_Missense_Mutation_p.D130H			Q5HYK9	ZN667_HUMAN	zinc finger protein 667	37	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	38		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0615)		TCATACAAATCCTTCTGAATG	0.468																																																	0													112.0	102.0	106.0					19																	56972109		2203	4300	6503	SO:0001583	missense	0				CCDS12944.1	19q13.43	2013-01-08				ENSG00000198046		"""Zinc fingers, C2H2-type"", ""-"""	28854	protein-coding gene	gene with protein product		611024					Standard	NM_022103		Approved	FLJ14011	uc002qnd.3	Q5HYK9		ENST00000504904.3:c.109G>C	19.37:g.56972109C>G	ENSP00000439402:p.Asp37His		B2RMS6|B9EK36|Q6B093|Q9H807	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D130H	ENST00000504904.3	37	c.388	CCDS12944.1	19	.	.	.	.	.	.	.	.	.	.	C	9.285	1.049019	0.19827	.	.	ENSG00000198046	ENST00000342634;ENST00000504904;ENST00000292069	T;T;T	0.01918	4.56;4.56;4.56	3.97	1.73	0.24493	Krueppel-associated box (4);	0.914087	0.09030	N	0.858806	T	0.03783	0.0107	L	0.59436	1.845	0.09310	N	0.999992	B	0.19073	0.033	B	0.15870	0.014	T	0.35126	-0.9801	10	0.56958	D	0.05	-4.9373	10.1269	0.42654	0.0:0.6014:0.3986:0.0	.	37	Q5HYK9	ZN667_HUMAN	H	130;37;37	ENSP00000344699:D130H;ENSP00000439402:D37H;ENSP00000292069:D37H	ENSP00000292069:D37H	D	-	1	0	ZNF667	61663921	0.001000	0.12720	0.205000	0.23548	0.008000	0.06430	0.473000	0.22132	0.585000	0.29608	-0.176000	0.13171	GAT	ZNF667	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000198046		0.468	ZNF667-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF667	HGNC	protein_coding	OTTHUMT00000458394.1	-	0.00	88	0	C	NM_022103		56972109	-1	tier1	-	no_errors	ENST00000342634	ensembl	human	known	74_37	missense	30.00	63	27	SNP	0.233	G
ZNF678	339500	genome.wustl.edu	37	1	227843248	227843248	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr1:227843248T>C	ENST00000343776.5	+	4	1642	c.1297T>C	c.(1297-1299)Tac>Cac	p.Y433H	ZNF678_ENST00000397097.3_Missense_Mutation_p.Y488H|ZNF678_ENST00000608949.1_Intron	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				AGAGAAACCCTACAAATGTAA	0.368																																																	0													35.0	40.0	38.0					1																	227843248		2200	4293	6493	SO:0001583	missense	0			BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.1297T>C	1.37:g.227843248T>C	ENSP00000344828:p.Tyr433His		Q8IVQ9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y488H	ENST00000343776.5	37	c.1462		1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.613913	0.28712	.	.	ENSG00000181450	ENST00000343776;ENST00000397097	T;T	0.21734	1.99;1.99	1.63	0.207	0.15214	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.30324	0.0761	L	0.40543	1.245	0.09310	N	0.999996	D	0.54207	0.965	D	0.66979	0.948	T	0.13845	-1.0494	9	0.66056	D	0.02	.	5.8513	0.18694	0.0:0.0:0.2711:0.7289	.	433	Q5SXM1	ZN678_HUMAN	H	433;488	ENSP00000344828:Y433H;ENSP00000440403:Y488H	ENSP00000344828:Y433H	Y	+	1	0	ZNF678	225909871	0.024000	0.19004	0.003000	0.11579	0.004000	0.04260	2.314000	0.43743	-0.165000	0.10908	-0.386000	0.06593	TAC	ZNF678	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181450		0.368	ZNF678-001	KNOWN	basic	protein_coding	ZNF678	HGNC	protein_coding	OTTHUMT00000091976.2	-	0.00	30	0	T	NM_178549		227843248	+1	tier1	-	no_errors	ENST00000397097	ensembl	human	known	74_37	missense	7.02	53	4	SNP	0.376	C
ZNF880	400713	genome.wustl.edu	37	19	52877731	52877731	+	Intron	SNP	A	A	T			TCGA-L5-A8NJ-01A-11D-A36J-09	TCGA-L5-A8NJ-11A-11D-A36M-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	d4c92b60-4b59-483f-8deb-9dcf8b98b980	c2aa2b87-814c-46f7-9f91-d29955e0a5a2	g.chr19:52877731A>T	ENST00000422689.2	+	3	283				ZNF880_ENST00000344085.5_Intron|ZNF880_ENST00000600321.1_Intron|ZNF880_ENST00000597976.1_Nonsense_Mutation_p.K107*|ZNF880_ENST00000424032.2_Intron	NM_001145434.1	NP_001138906.1	Q6PDB4	ZN880_HUMAN	zinc finger protein 880						regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(2)|skin(1)	10						ttttttttttaaacagggtct	0.478																																																	0													13.0	14.0	13.0					19																	52877731		692	1591	2283	SO:0001627	intron_variant	0			BC058819	CCDS46164.1	19q13.41	2013-01-08			ENSG00000221923	ENSG00000221923		"""Zinc fingers, C2H2-type"", ""-"""	37249	protein-coding gene	gene with protein product							Standard	NM_001145434		Approved		uc002pzc.3	Q6PDB4	OTTHUMG00000167972	ENST00000422689.2:c.268+51A>T	19.37:g.52877731A>T			B4DNA6	Nonsense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.K107*	ENST00000422689.2	37	c.319	CCDS46164.1	19																																																																																			ZNF880	-	NULL	ENSG00000221923		0.478	ZNF880-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF880	HGNC	protein_coding	OTTHUMT00000397374.1	-	0.00	40	0	A	NM_001145434		52877731	+1	tier1	-	no_errors	ENST00000597976	ensembl	human	putative	74_37	nonsense	17.02	39	8	SNP	0.031	T
