#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_ORegAnno_bin	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_header	i_normal_VAF	i_normal_ref_reads	i_normal_var_reads	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_tier	i_title	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_tumor_VAF	i_tumor_ref_reads	i_tumor_var_reads	i_type	i_ucsc_cons	i_variant
ABCC8	6833	genome.wustl.edu	37	11	17434248	17434248	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:17434248G>A	ENST00000389817.3	-	21	2589	c.2521C>T	c.(2521-2523)Cga>Tga	p.R841*	ABCC8_ENST00000302539.4_Nonsense_Mutation_p.R842*			Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 8	841	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> G (in HHF1). {ECO:0000269|PubMed:10202168}.		carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium ion transmembrane transporter activity (GO:0015079)|sulfonylurea receptor activity (GO:0008281)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(38)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	67				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Chlorpropamide(DB00672)|Gliclazide(DB01120)|Glimepiride(DB00222)|Glipizide(DB01067)|Gliquidone(DB01251)|Glyburide(DB01016)|Glycodiazine(DB01382)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)|Tolbutamide(DB01124)	TAGAGGGCTCGGGCCACACTG	0.587																																																	0			GRCh37	CM011258|CM086758	ABCC8	M							169.0	104.0	126.0					11																	17434248		2200	4293	6493	SO:0001587	stop_gained	0			L78207	CCDS31437.1, CCDS73264.1	11p15.1	2014-09-17			ENSG00000006071	ENSG00000006071		"""ATP binding cassette transporters / subfamily C"""	59	protein-coding gene	gene with protein product	"""sulfonylurea receptor (hyperinsulinemia)"""	600509		SUR, HRINS		7920639, 7716548	Standard	NM_000352		Approved	HI, PHHI, SUR1, MRP8, ABC36, HHF1, TNDM2	uc001mnc.3	Q09428	OTTHUMG00000166316	ENST00000389817.3:c.2521C>T	11.37:g.17434248G>A	ENSP00000374467:p.Arg841*		A6NMX8|E3UYX6|O75948|Q16583	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC1_TM_dom,superfamily_P-loop_NTPase,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Surea_rcpt-1,pfscan_ABC_transporter-like,pfscan_ABC1_TM_dom	p.R842*	ENST00000389817.3	37	c.2524	CCDS31437.1	11	.	.	.	.	.	.	.	.	.	.	G	41	8.581859	0.98872	.	.	ENSG00000006071	ENST00000389817;ENST00000302539;ENST00000379493	.	.	.	5.82	4.86	0.63082	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6183	0.76784	0.0:0.0:0.7881:0.2119	.	.	.	.	X	841;842;845	.	ENSP00000303960:R842X	R	-	1	2	ABCC8	17390824	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.625000	0.37029	2.756000	0.94617	0.563000	0.77884	CGA	ABCC8	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000006071		0.587	ABCC8-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCC8	HGNC	protein_coding	OTTHUMT00000389093.1	-	0.00	20	0	G	NM_000352		17434248	-1	tier1	-	no_errors	ENST00000302539	ensembl	human	known	74_37	nonsense	35.71	18	10	SNP	1.000	A
ABCG4	64137	genome.wustl.edu	37	11	119025273	119025273	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:119025273G>A	ENST00000449422.2	+	5	716	c.528G>A	c.(526-528)gtG>gtA	p.V176V	ABCG4_ENST00000307417.3_Silent_p.V176V|ABCG4_ENST00000531739.1_Silent_p.V176V	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	176	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		AGCAGGAGGTGAAGAAGGAGC	0.592																																																	0													62.0	61.0	61.0					11																	119025273		2200	4295	6495	SO:0001819	synonymous_variant	0			AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.528G>A	11.37:g.119025273G>A			A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Silent	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.V176	ENST00000449422.2	37	c.528	CCDS8415.1	11																																																																																			ABCG4	-	pfam_ABC_transporter-like,superfamily_P-loop_NTPase,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000172350		0.592	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ABCG4	HGNC	protein_coding	OTTHUMT00000388215.1		0.00	40	0	G	NM_022169		119025273	+1			no_errors	ENST00000307417	ensembl	human	known	74_37	silent	11.11	24	3	SNP	1.000	A
ADAMTS12	81792	genome.wustl.edu	37	5	33637836	33637836	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:33637836C>T	ENST00000504830.1	-	12	2069	c.1734G>A	c.(1732-1734)ggG>ggA	p.G578G	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Silent_p.G578G	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	578	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						TGCAATATTTCCCTCCAAACT	0.463										HNSCC(64;0.19)																																							0													94.0	88.0	90.0					5																	33637836		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1734G>A	5.37:g.33637836C>T			A2RRN9|A5D6V6|Q6UWL3	Silent	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.G578	ENST00000504830.1	37	c.1734	CCDS34140.1	5																																																																																			ADAMTS12	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000151388		0.463	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS12	HGNC	protein_coding	OTTHUMT00000367164.2	-	0.00	81	0	C	NM_030955		33637836	-1	tier1	-	no_errors	ENST00000504830	ensembl	human	known	74_37	silent	10.53	102	12	SNP	0.903	T
ADAMTS19	171019	genome.wustl.edu	37	5	128983525	128983525	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:128983525T>A	ENST00000274487.4	+	12	2067	c.1922T>A	c.(1921-1923)cTg>cAg	p.L641Q	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	641	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GAGTGGAGCCTGTGGAGTCCT	0.517																																																	0													145.0	144.0	145.0					5																	128983525		2203	4300	6503	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1922T>A	5.37:g.128983525T>A	ENSP00000274487:p.Leu641Gln			Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.L641Q	ENST00000274487.4	37	c.1922	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	T	5.056	0.195999	0.09599	.	.	ENSG00000145808	ENST00000274487	T	0.52295	0.67	4.52	-1.17	0.09648	.	1.745050	0.03009	N	0.149168	T	0.26304	0.0642	N	0.05554	-0.025	0.09310	N	1	B	0.18166	0.026	B	0.13407	0.009	T	0.12319	-1.0552	9	.	.	.	.	6.6209	0.22802	0.13:0.4705:0.0:0.3995	.	641	Q8TE59	ATS19_HUMAN	Q	641	ENSP00000274487:L641Q	.	L	+	2	0	ADAMTS19	129011424	0.000000	0.05858	0.027000	0.17364	0.997000	0.91878	-0.168000	0.09925	-0.152000	0.11156	0.528000	0.53228	CTG	ADAMTS19	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000145808		0.517	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2		0.00	37	0	T	NM_133638		128983525	+1			no_errors	ENST00000274487	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.001	A
ADAMTS19	171019	genome.wustl.edu	37	5	129019948	129019948	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:129019948G>A	ENST00000274487.4	+	18	2927	c.2782G>A	c.(2782-2784)Gat>Aat	p.D928N	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	928	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.D928N(1)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GGAAGATTGCGATGCCACTTG	0.403																																																	1	Substitution - Missense(1)	large_intestine(1)											78.0	74.0	75.0					5																	129019948		2203	4300	6503	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2782G>A	5.37:g.129019948G>A	ENSP00000274487:p.Asp928Asn			Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.D928N	ENST00000274487.4	37	c.2782	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028928	0.35797	.	.	ENSG00000145808	ENST00000274487	T	0.60920	0.15	4.56	2.77	0.32553	.	0.227351	0.37393	N	0.002109	T	0.36853	0.0982	N	0.17082	0.46	0.34979	D	0.753911	B	0.14438	0.01	B	0.06405	0.002	T	0.36040	-0.9764	9	.	.	.	.	10.9237	0.47180	0.1578:0.0:0.8422:0.0	.	928	Q8TE59	ATS19_HUMAN	N	928	ENSP00000274487:D928N	.	D	+	1	0	ADAMTS19	129047847	0.960000	0.32886	0.934000	0.37439	0.982000	0.71751	1.628000	0.37060	0.839000	0.34971	-0.143000	0.13931	GAT	ADAMTS19	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000145808		0.403	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	-	0.00	27	0	G	NM_133638		129019948	+1	tier1	-	no_errors	ENST00000274487	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.994	A
AGO4	192670	genome.wustl.edu	37	1	36316572	36316572	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:36316572G>T	ENST00000373210.3	+	17	2640	c.2395G>T	c.(2395-2397)Gtc>Ttc	p.V799F	AGO4_ENST00000488778.1_3'UTR	NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	799	Piwi. {ECO:0000255|HAMAP-Rule:MF_03033}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										CACTCGCTCAGTCTCTATTCC	0.483																																																	0													110.0	94.0	99.0					1																	36316572		2203	4300	6503	SO:0001583	missense	0			AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.2395G>T	1.37:g.36316572G>T	ENSP00000362306:p.Val799Phe		A7MD27	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ_dom,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ_dom,smart_PAZ_dom,smart_Piwi,pfscan_PAZ_dom,pfscan_Piwi	p.V799F	ENST00000373210.3	37	c.2395	CCDS397.1	1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.714292	0.89112	.	.	ENSG00000134698	ENST00000373210	T	0.34859	1.34	5.22	5.22	0.72569	Stem cell self-renewal protein Piwi (3);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.77765	0.4179	H	0.99336	4.52	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.88074	0.2802	10	0.87932	D	0	-12.0192	18.7904	0.91971	0.0:0.0:1.0:0.0	.	799	Q9HCK5	AGO4_HUMAN	F	799	ENSP00000362306:V799F	ENSP00000362306:V799F	V	+	1	0	EIF2C4	36089159	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	9.864000	0.99589	2.417000	0.82017	0.591000	0.81541	GTC	AGO4	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi	ENSG00000134698		0.483	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGO4	HGNC	protein_coding	OTTHUMT00000012213.3	-	0.00	47	0	G	NM_017629		36316572	+1	tier1	-	no_errors	ENST00000373210	ensembl	human	known	74_37	missense	5.13	74	4	SNP	1.000	T
AHCTF1	25909	genome.wustl.edu	37	1	247003024	247003024	+	3'UTR	SNP	A	A	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:247003024A>T	ENST00000391829.2	-	0	8008				AHCTF1_ENST00000366508.1_3'UTR|AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_3'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1						cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TTAATAGTCCATTCATTACAC	0.303																																					Colon(145;197 1800 4745 15099 26333)												0																																										SO:0001624	3_prime_UTR_variant	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.*1084T>A	1.37:g.247003024A>T			A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	RNA	SNP	-	NULL	ENST00000391829.2	37	NULL		1																																																																																			AHCTF1	-	-	ENSG00000153207		0.303	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		-	0.00	48	0	A	NM_015446		247003024	-1	tier1	-	no_errors	ENST00000470300	ensembl	human	known	74_37	rna	10.00	36	4	SNP	0.971	T
AJUBA	84962	genome.wustl.edu	37	14	23450684	23450685	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	CA	CA					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:23450684_23450685delCA	ENST00000262713.2	-	1	1166_1167	c.791_792delTG	c.(790-792)gtgfs	p.V264fs	RP11-298I3.4_ENST00000556503.1_RNA|RP11-298I3.4_ENST00000557615.1_RNA|AJUBA_ENST00000361265.4_Frame_Shift_Del_p.V264fs|RP11-298I3.5_ENST00000555074.1_Intron|RP11-298I3.4_ENST00000555294.1_RNA	NM_032876.4	NP_116265.1	Q96IF1	AJUBA_HUMAN	ajuba LIM protein	264	PreLIM.				calcium-dependent cell-cell adhesion (GO:0016339)|cellular protein localization (GO:0034613)|focal adhesion assembly (GO:0048041)|G2/M transition of mitotic cell cycle (GO:0000086)|gene silencing by miRNA (GO:0035195)|glycerophospholipid biosynthetic process (GO:0046474)|lamellipodium assembly (GO:0030032)|mitotic cell cycle (GO:0000278)|negative regulation of hippo signaling (GO:0035331)|negative regulation of kinase activity (GO:0033673)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular biosynthetic process (GO:0031328)|positive regulation of gene silencing by miRNA (GO:2000637)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein complex assembly (GO:0031334)|regulation of cell migration (GO:0030334)|regulation of cellular response to hypoxia (GO:1900037)|regulation of GTPase activity (GO:0043087)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|wound healing, spreading of epidermal cells (GO:0035313)	cell-cell junction (GO:0005911)|cytoplasmic mRNA processing body (GO:0000932)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcription factor complex (GO:0005667)	alpha-catenin binding (GO:0045294)|chromatin binding (GO:0003682)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)										CGTAGCCGGTCACAGAGTGTCG	0.728																																																	0																																										SO:0001589	frameshift_variant	0			AK025567	CCDS9581.1, CCDS9582.1	14q11.2	2011-11-10	2011-11-10	2011-11-10	ENSG00000129474	ENSG00000129474			20250	protein-coding gene	gene with protein product		609066	"""jub, ajuba homolog (Xenopus laevis)"""	JUB		10330178	Standard	NM_032876		Approved	MGC15563	uc001whz.3	Q96IF1	OTTHUMG00000028711	ENST00000262713.2:c.791_792delTG	14.37:g.23450686_23450687delCA	ENSP00000262713:p.Val264fs		A8MX18|D3DS37	Frame_Shift_Del	DEL	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.V264fs	ENST00000262713.2	37	c.792_791	CCDS9581.1	14																																																																																			AJUBA	-	NULL	ENSG00000129474		0.728	AJUBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AJUBA	HGNC	protein_coding	OTTHUMT00000071685.2		0.00	21	0	CA			23450685	-1	tier1		no_errors	ENST00000262713	ensembl	human	known	74_37	frame_shift_del	38.10	13	8	DEL	1.000:1.000	-
ALDH2	217	genome.wustl.edu	37	12	112221026	112221026	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:112221026G>A	ENST00000261733.2	+	3	345	c.284G>A	c.(283-285)cGc>cAc	p.R95H	RP11-162P23.2_ENST00000546840.2_Missense_Mutation_p.A92T|ALDH2_ENST00000416293.3_Intron	NM_000690.3	NP_000681.2	P05091	ALDH2_HUMAN	aldehyde dehydrogenase 2 family (mitochondrial)	95					alcohol metabolic process (GO:0006066)|carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|aldehyde dehydrogenase [NAD(P)+] activity (GO:0004030)|electron carrier activity (GO:0009055)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	22					Amyl Nitrite(DB01612)|Benzyl alcohol(DB06770)|Disulfiram(DB00822)|Guanidine(DB00536)|Nitric Oxide(DB00435)|Nitroglycerin(DB00727)	CCTTGGCGCCGCATGGACGCA	0.637			T	HMGA2	leiomyoma																																			Dom	yes		12	12q24.2	217	aldehyde dehydrogenase 2 family (mitochondrial)		M	0													67.0	78.0	74.0					12																	112221026		2203	4299	6502	SO:0001583	missense	0			M26760	CCDS9155.1, CCDS55885.1	12q24.12	2007-12-14				ENSG00000111275	1.2.1.3	"""Aldehyde dehydrogenases"""	404	protein-coding gene	gene with protein product		100650				4015823, 2987944	Standard	NM_000690		Approved		uc001tst.3	P05091	OTTHUMG00000169603	ENST00000261733.2:c.284G>A	12.37:g.112221026G>A	ENSP00000261733:p.Arg95His		B4DW54|E7EUE5|Q03639|Q6IB13|Q6IV71	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.R95H	ENST00000261733.2	37	c.284	CCDS9155.1	12	.	.	.	.	.	.	.	.	.	.	g	25.1	4.603686	0.87157	.	.	ENSG00000257767;ENSG00000111275;ENSG00000111275	ENST00000546840;ENST00000261733;ENST00000553044	T	0.76578	-1.03	5.57	3.41	0.39046	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.101452	0.64402	D	0.000004	T	0.68851	0.3046	L	0.57536	1.79	0.80722	D	1	P;B	0.46912	0.886;0.014	B;B	0.32533	0.147;0.015	T	0.73827	-0.3860	10	0.54805	T	0.06	.	13.4074	0.60922	0.1482:0.0:0.8518:0.0	.	95;95	F8VXI5;P05091	.;ALDH2_HUMAN	H	76;95;95	ENSP00000261733:R95H	ENSP00000261733:R95H	R	+	2	0	ALDH2;RP11-162P23.2	110705409	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	7.595000	0.82710	1.352000	0.45808	0.651000	0.88453	CGC	ALDH2	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000111275		0.637	ALDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH2	HGNC	protein_coding	OTTHUMT00000405008.1		0.00	37	0	G	NM_000690		112221026	+1			no_errors	ENST00000261733	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	A
ALKBH3	221120	genome.wustl.edu	37	11	43904227	43904227	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:43904227C>T	ENST00000302708.4	+	2	436	c.25C>T	c.(25-27)Cga>Tga	p.R9*	RP11-613D13.5_ENST00000530450.1_RNA|ALKBH3_ENST00000378840.4_Nonsense_Mutation_p.R9*	NM_139178.3	NP_631917.1	Q96Q83	ALKB3_HUMAN	alkB, alkylation repair homolog 3 (E. coli)	9					cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA repair (GO:0006281)|oxidative single-stranded DNA demethylation (GO:0035552)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA-N1-methyladenine dioxygenase activity (GO:0043734)|ferrous iron binding (GO:0008198)|L-ascorbic acid binding (GO:0031418)			endometrium(2)|kidney(1)|lung(4)|prostate(1)	8					Vitamin C(DB00126)	ACGGCGAGCCCGAGTTCAGGG	0.488								Direct reversal of damage																																									0													51.0	54.0	53.0					11																	43904227		2203	4300	6503	SO:0001587	stop_gained	0			AB042029	CCDS7906.1	11p11.2	2013-10-11			ENSG00000166199	ENSG00000166199		"""Alkylation repair homologs"""	30141	protein-coding gene	gene with protein product		610603				22055184	Standard	NM_139178		Approved	DEPC-1	uc001mxs.2	Q96Q83	OTTHUMG00000166417	ENST00000302708.4:c.25C>T	11.37:g.43904227C>T	ENSP00000302232:p.Arg9*		A6NDJ1|Q3SYI0|Q6NX57|Q96BU8	Nonsense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase	p.R9*	ENST00000302708.4	37	c.25	CCDS7906.1	11	.	.	.	.	.	.	.	.	.	.	C	39	7.699789	0.98441	.	.	ENSG00000166199	ENST00000302708;ENST00000378840;ENST00000524742;ENST00000529366	.	.	.	5.38	3.36	0.38483	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.9501	11.2648	0.49104	0.3402:0.6598:0.0:0.0	.	.	.	.	X	9	.	ENSP00000302232:R9X	R	+	1	2	ALKBH3	43860803	0.993000	0.37304	1.000000	0.80357	0.870000	0.49936	0.533000	0.23082	1.358000	0.45922	0.650000	0.86243	CGA	ALKBH3	-	NULL	ENSG00000166199		0.488	ALKBH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH3	HGNC	protein_coding	OTTHUMT00000389693.1	-	0.00	24	0	C	NM_139178		43904227	+1	tier1	-	no_errors	ENST00000302708	ensembl	human	known	74_37	nonsense	15.22	38	7	SNP	1.000	T
ALLC	55821	genome.wustl.edu	37	2	3743330	3743330	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:3743330G>T	ENST00000252505.3	+	8	697	c.535G>T	c.(535-537)Gta>Tta	p.V179L	ALLC_ENST00000471711.1_3'UTR	NM_018436.3	NP_060906.3	Q8N6M5	ALLC_HUMAN	allantoicase	198					allantoin catabolic process (GO:0000256)		allantoicase activity (GO:0004037)			breast(4)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	30	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.088)	all_cancers(51;0.24)		OV - Ovarian serous cystadenocarcinoma(76;0.088)|all cancers(51;0.151)|Epithelial(75;0.206)		ACGACTTAGAGTATTCGGTAC	0.453										HNSCC(21;0.051)																																							0													89.0	89.0	89.0					2																	3743330		1911	4123	6034	SO:0001583	missense	0			AF215924	CCDS46223.1	2p25.3	2008-02-05			ENSG00000151360	ENSG00000151360			17377	protein-coding gene	gene with protein product		612396				11054555	Standard	NM_018436		Approved	ALC	uc010ewt.3	Q8N6M5	OTTHUMG00000151485	ENST00000252505.3:c.535G>T	2.37:g.3743330G>T	ENSP00000252505:p.Val179Leu		Q53T95|Q5RL81|Q96RE6|Q9NZA7	Missense_Mutation	SNP	pfam_Allantoicase_dom,superfamily_Galactose-bd-like,tigrfam_Allantoicase	p.V179L	ENST00000252505.3	37	c.535	CCDS46223.1	2	.	.	.	.	.	.	.	.	.	.	G	15.23	2.770635	0.49680	.	.	ENSG00000151360	ENST00000252505	.	.	.	5.42	5.42	0.78866	Allantoicase domain (1);Galactose-binding domain-like (1);	0.111469	0.64402	D	0.000012	T	0.65523	0.2699	L	0.41632	1.29	0.48571	D	0.999673	D	0.60575	0.988	P	0.61940	0.896	T	0.60662	-0.7219	9	0.28530	T	0.3	-14.5835	16.7056	0.85371	0.0:0.0:1.0:0.0	.	198	Q8N6M5	ALLC_HUMAN	L	179	.	ENSP00000252505:V179L	V	+	1	0	ALLC	3721205	1.000000	0.71417	0.141000	0.22245	0.090000	0.18270	5.547000	0.67249	2.554000	0.86153	0.561000	0.74099	GTA	ALLC	-	pfam_Allantoicase_dom,superfamily_Galactose-bd-like,tigrfam_Allantoicase	ENSG00000151360		0.453	ALLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALLC	HGNC	protein_coding	OTTHUMT00000322855.1	-	0.00	52	0	G			3743330	+1	tier1	-	no_errors	ENST00000252505	ensembl	human	known	74_37	missense	16.67	35	7	SNP	0.870	T
AMBN	258	genome.wustl.edu	37	4	71467351	71467351	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:71467351G>A	ENST00000322937.6	+	6	614	c.511G>A	c.(511-513)Gat>Aat	p.D171N	AMBN_ENST00000449493.2_Missense_Mutation_p.D156N	NM_016519.5	NP_057603.1	Q9NP70	AMBN_HUMAN	ameloblastin (enamel matrix protein)	171					biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|odontogenesis of dentin-containing tooth (GO:0042475)	proteinaceous extracellular matrix (GO:0005578)	growth factor activity (GO:0008083)|structural constituent of tooth enamel (GO:0030345)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)	29			Lung(101;0.235)			GGCACCATCAGATAAGCCACC	0.478											OREG0016218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													81.0	78.0	79.0					4																	71467351		2203	4300	6503	SO:0001583	missense	0			AF209780	CCDS3543.1	4q21	2006-11-28	2006-04-27		ENSG00000178522	ENSG00000178522			452	protein-coding gene	gene with protein product		601259	"""ameloblastin, enamel matrix protein"""			9126491	Standard	NM_016519		Approved		uc003hfl.3	Q9NP70	OTTHUMG00000129913	ENST00000322937.6:c.511G>A	4.37:g.71467351G>A	ENSP00000313809:p.Asp171Asn	1130	Q3B862|Q9H2X1|Q9H4L1	Missense_Mutation	SNP	pfam_Amelin,smart_Amelin	p.D171N	ENST00000322937.6	37	c.511	CCDS3543.1	4	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622499	0.46840	.	.	ENSG00000178522	ENST00000322937;ENST00000538728;ENST00000449493	T;T	0.33216	1.42;1.42	5.95	5.1	0.69264	.	0.754765	0.12423	N	0.470205	T	0.29749	0.0743	L	0.40543	1.245	0.09310	N	1	P	0.43231	0.801	B	0.43225	0.412	T	0.15009	-1.0452	10	0.56958	D	0.05	-2.737	10.0735	0.42347	0.0887:0.0:0.9113:0.0	.	171	Q9NP70	AMBN_HUMAN	N	171;171;156	ENSP00000313809:D171N;ENSP00000391234:D156N	ENSP00000313809:D171N	D	+	1	0	AMBN	71501940	0.341000	0.24801	0.999000	0.59377	0.182000	0.23217	2.280000	0.43443	2.826000	0.97356	0.563000	0.77884	GAT	AMBN	-	pfam_Amelin,smart_Amelin	ENSG00000178522		0.478	AMBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMBN	HGNC	protein_coding	OTTHUMT00000252165.1	-	0.00	35	0	G	NM_016519		71467351	+1	tier1	-	no_errors	ENST00000322937	ensembl	human	known	74_37	missense	11.94	59	8	SNP	0.148	A
ANKRD55	79722	genome.wustl.edu	37	5	55422898	55422898	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:55422898G>A	ENST00000341048.4	-	8	799	c.648C>T	c.(646-648)agC>agT	p.S216S	RNU6-299P_ENST00000517223.1_RNA|ANKRD55_ENST00000504958.2_Silent_p.S173S|ANKRD55_ENST00000505970.2_Intron	NM_024669.2	NP_078945.2	Q3KP44	ANR55_HUMAN	ankyrin repeat domain 55	216										breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(1)	34		Lung NSC(810;8.69e-05)|Prostate(74;0.00634)|Breast(144;0.0334)|Ovarian(174;0.223)				CCTGGTGATGGCTCAGAATGA	0.463																																																	0													101.0	98.0	99.0					5																	55422898		2203	4300	6503	SO:0001819	synonymous_variant	0			AK021857	CCDS34161.1	5q11.2	2013-01-10			ENSG00000164512	ENSG00000164512		"""Ankyrin repeat domain containing"""	25681	protein-coding gene	gene with protein product		615189					Standard	XM_005248599		Approved	FLJ11795	uc003jqu.3	Q3KP44	OTTHUMG00000162305	ENST00000341048.4:c.648C>T	5.37:g.55422898G>A			B3KVT8|Q3KP45|Q9HAD3	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S216	ENST00000341048.4	37	c.648	CCDS34161.1	5																																																																																			ANKRD55	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000164512		0.463	ANKRD55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD55	HGNC	protein_coding	OTTHUMT00000368510.4	-	0.00	40	0	G	NM_024669		55422898	-1	tier1	-	no_errors	ENST00000341048	ensembl	human	known	74_37	silent	8.89	40	4	SNP	1.000	A
ANKRD62	342850	genome.wustl.edu	37	18	12125725	12125725	+	Silent	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr18:12125725C>G	ENST00000587848.2	+	13	2070	c.1905C>G	c.(1903-1905)ctC>ctG	p.L635L	ANKRD62_ENST00000314074.8_Silent_p.L621L|ANKRD62_ENST00000418274.2_3'UTR			A6NC57	ANR62_HUMAN	ankyrin repeat domain 62	635										breast(2)|haematopoietic_and_lymphoid_tissue(1)	3						ATACAATGCTCAATTCTGAGC	0.398																																																	0																																										SO:0001819	synonymous_variant	0			BX648696	CCDS67439.1	18p11.21	2014-01-21			ENSG00000181626	ENSG00000181626		"""Ankyrin repeat domain containing"""	35241	protein-coding gene	gene with protein product							Standard	XM_003959949		Approved	DKFZp779B1634	uc031rhk.1	A6NC57	OTTHUMG00000180673	ENST00000587848.2:c.1905C>G	18.37:g.12125725C>G				Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L621	ENST00000587848.2	37	c.1863		18																																																																																			ANKRD62	-	NULL	ENSG00000181626		0.398	ANKRD62-003	PUTATIVE	basic|appris_candidate_longest	protein_coding	ANKRD62	HGNC	protein_coding	OTTHUMT00000452521.2	-	0.00	55	0	C	XM_001715728		12125725	+1	tier1	-	no_errors	ENST00000314074	ensembl	human	known	74_37	silent	31.75	43	20	SNP	0.432	G
ANKS1A	23294	genome.wustl.edu	37	6	34952981	34952981	+	Missense_Mutation	SNP	G	G	T	rs147778746		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:34952981G>T	ENST00000360359.3	+	8	1273	c.1135G>T	c.(1135-1137)Ggg>Tgg	p.G379W	ANKS1A_ENST00000535627.1_Intron	NM_015245.2	NP_056060.2	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1A	379					ephrin receptor signaling pathway (GO:0048013)|neuron remodeling (GO:0016322)|substrate-dependent cell migration (GO:0006929)	cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleus (GO:0005634)				cervix(2)|endometrium(3)|large_intestine(4)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CATGGCCAGCGGGCGATCATC	0.527																																																	0													96.0	89.0	91.0					6																	34952981		2203	4300	6503	SO:0001583	missense	0			D86982	CCDS4798.1	6p21.31	2013-01-10	2006-02-17	2006-02-17	ENSG00000064999	ENSG00000064999		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20961	protein-coding gene	gene with protein product		608994	"""ankyrin repeat and SAM domain containing 1"", ""ankyrin repeat and sterile alpha motif domain containing 1"""	ANKS1		9039502	Standard	NM_015245		Approved	KIAA0229	uc003ojx.4	Q92625	OTTHUMG00000014559	ENST00000360359.3:c.1135G>T	6.37:g.34952981G>T	ENSP00000353518:p.Gly379Trp		A2RUC1|B4DQW8|Q5JYI9|Q5SYR2|Q86WQ7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTB/PI_dom,pfam_SAM_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTB/PI_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTB/PI_dom,pfscan_SAM,prints_Ankyrin_rpt	p.G379W	ENST00000360359.3	37	c.1135	CCDS4798.1	6	.	.	.	.	.	.	.	.	.	.	G	19.84	3.902876	0.72754	.	.	ENSG00000064999	ENST00000544150;ENST00000360359	T	0.43294	0.95	5.74	5.74	0.90152	.	0.000000	0.49916	D	0.000126	T	0.47414	0.1444	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.50242	-0.8851	10	0.72032	D	0.01	-26.0549	18.0945	0.89485	0.0:0.0:1.0:0.0	.	379	Q92625	ANS1A_HUMAN	W	379	ENSP00000353518:G379W	ENSP00000353518:G379W	G	+	1	0	ANKS1A	35060959	1.000000	0.71417	0.922000	0.36590	0.342000	0.28953	8.582000	0.90791	2.700000	0.92200	0.655000	0.94253	GGG	ANKS1A	-	NULL	ENSG00000064999		0.527	ANKS1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKS1A	HGNC	protein_coding	OTTHUMT00000040262.1		0.00	26	0	G	XM_166478		34952981	+1			no_errors	ENST00000360359	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
ANXA5	308	genome.wustl.edu	37	4	122599640	122599640	+	Nonsense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:122599640G>C	ENST00000296511.5	-	7	689	c.404C>G	c.(403-405)tCa>tGa	p.S135*	ANXA5_ENST00000515017.1_Nonsense_Mutation_p.S35*|ANXA5_ENST00000501272.2_Nonsense_Mutation_p.S75*|ANXA5_ENST00000509016.1_5'UTR	NM_001154.3	NP_001145.1	P08758	ANXA5_HUMAN	annexin A5	135				S -> L (in Ref. 10; CAG38759). {ECO:0000305}.	blood coagulation (GO:0007596)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of coagulation (GO:0050819)|response to organic substance (GO:0010033)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipase inhibitor activity (GO:0004859)|phospholipid binding (GO:0005543)			NS(1)|breast(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)	15						TTCCAGGCTTGAGCCATATTC	0.393																																					Pancreas(191;1279 2147 16046 17806 52646)|GBM(88;628 1285 16585 32846 50188)												0													95.0	93.0	94.0					4																	122599640		2203	4300	6503	SO:0001587	stop_gained	0			U05770	CCDS3720.1	4q27	2008-02-05			ENSG00000164111	ENSG00000164111		"""Annexins"""	543	protein-coding gene	gene with protein product		131230		ENX2, ANX5		2960376	Standard	NM_001154		Approved		uc003idv.4	P08758	OTTHUMG00000133034	ENST00000296511.5:c.404C>G	4.37:g.122599640G>C	ENSP00000296511:p.Ser135*		D3DNW7|Q6FHB3|Q6FI16|Q8WV69|Q9UDH9	Nonsense_Mutation	SNP	pfam_Annexin_repeat,smart_Annexin_repeat,prints_Annexin,prints_AnnexinV,prints_AnnexinIV	p.S135*	ENST00000296511.5	37	c.404	CCDS3720.1	4	.	.	.	.	.	.	.	.	.	.	G	33	5.290065	0.95546	.	.	ENSG00000164111	ENST00000296511;ENST00000512232;ENST00000501272;ENST00000515017	.	.	.	5.03	5.03	0.67393	.	0.618908	0.17610	N	0.168126	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	13.6767	0.62458	0.0:0.1552:0.8448:0.0	.	.	.	.	X	135;135;75;35	.	ENSP00000296511:S135X	S	-	2	0	ANXA5	122819090	0.980000	0.34600	0.983000	0.44433	0.987000	0.75469	2.476000	0.45171	2.345000	0.79718	0.655000	0.94253	TCA	ANXA5	-	pfam_Annexin_repeat,smart_Annexin_repeat,prints_AnnexinIV	ENSG00000164111		0.393	ANXA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA5	HGNC	protein_coding	OTTHUMT00000256636.2	-	0.00	31	0	G	NM_001154		122599640	-1	tier1	-	no_errors	ENST00000296511	ensembl	human	known	74_37	nonsense	24.00	19	6	SNP	0.918	C
ARRDC5	645432	genome.wustl.edu	37	19	4891301	4891301	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:4891301G>T	ENST00000381781.2	-	3	785	c.786C>A	c.(784-786)ttC>ttA	p.F262L	AC027319.1_ENST00000408608.1_RNA	NM_001080523.1	NP_001073992.1	A6NEK1	ARRD5_HUMAN	arrestin domain containing 5	262								p.F262F(1)		endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	12				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0257)		TGGTGGTGTTGAAGCGGGTCA	0.622																																																	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											84.0	97.0	92.0					19																	4891301		2110	4218	6328	SO:0001583	missense	0				CCDS45929.1	19p13.3	2007-10-05				ENSG00000205784			31407	protein-coding gene	gene with protein product						12886014	Standard	NM_001080523		Approved		uc002mbm.3	A6NEK1		ENST00000381781.2:c.786C>A	19.37:g.4891301G>T	ENSP00000371200:p.Phe262Leu			Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.F262L	ENST00000381781.2	37	c.786	CCDS45929.1	19	.	.	.	.	.	.	.	.	.	.	G	9.298	1.052465	0.19907	.	.	ENSG00000205784	ENST00000381781	T	0.16073	2.37	4.91	2.8	0.32819	Immunoglobulin E-set (1);Arrestin-like, C-terminal (1);	0.000000	0.48286	D	0.000187	T	0.21921	0.0528	L	0.29908	0.895	0.32985	D	0.524249	D	0.76494	0.999	D	0.87578	0.998	T	0.10314	-1.0635	10	0.11182	T	0.66	-42.5032	8.2592	0.31775	0.1908:0.0:0.8092:0.0	.	262	A6NEK1	ARRD5_HUMAN	L	262	ENSP00000371200:F262L	ENSP00000371200:F262L	F	-	3	2	ARRDC5	4842301	0.650000	0.27331	0.695000	0.30226	0.013000	0.08279	0.774000	0.26675	1.389000	0.46526	0.650000	0.86243	TTC	ARRDC5	-	pfam_Arrestin_C-like,superfamily_Ig_E-set	ENSG00000205784		0.622	ARRDC5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ARRDC5	HGNC	protein_coding	OTTHUMT00000450443.1		0.00	38	0	G	XM_292803		4891301	-1			no_errors	ENST00000381781	ensembl	human	known	74_37	missense	5.88	32	2	SNP	0.697	T
ASAP2	8853	genome.wustl.edu	37	2	9528534	9528534	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:9528534G>T	ENST00000281419.3	+	22	2582	c.2242G>T	c.(2242-2244)Gag>Tag	p.E748*	ASAP2_ENST00000491413.1_3'UTR|ASAP2_ENST00000315273.4_Nonsense_Mutation_p.E748*	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	748			E -> D (in dbSNP:rs2715860). {ECO:0000269|PubMed:15489334}.		positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						CCTTGCCAAGGAGAAGCAGAG	0.607																																																	0													57.0	62.0	61.0					2																	9528534		2203	4300	6503	SO:0001587	stop_gained	0			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2242G>T	2.37:g.9528534G>T	ENSP00000281419:p.Glu748*		D6W4Y8	Nonsense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.E748*	ENST00000281419.3	37	c.2242	CCDS1661.1	2	.	.	.	.	.	.	.	.	.	.	G	45	11.398698	0.99556	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	.	.	.	5.58	5.58	0.84498	.	0.622139	0.16303	N	0.220363	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	19.5623	0.95376	0.0:0.0:1.0:0.0	.	.	.	.	X	748	.	ENSP00000281419:E748X	E	+	1	0	ASAP2	9445985	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	9.369000	0.97156	2.620000	0.88729	0.561000	0.74099	GAG	ASAP2	-	NULL	ENSG00000151693		0.607	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	HGNC	protein_coding	OTTHUMT00000237522.1	-	0.00	86	0	G	NM_003887		9528534	+1	tier1	-	no_errors	ENST00000281419	ensembl	human	known	74_37	nonsense	5.36	106	6	SNP	1.000	T
ATF7IP	55729	genome.wustl.edu	37	12	14610171	14610171	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:14610171G>T	ENST00000540793.1	+	7	2255	c.2100G>T	c.(2098-2100)gaG>gaT	p.E700D	ATF7IP_ENST00000543189.1_Missense_Mutation_p.E699D|ATF7IP_ENST00000536444.1_Missense_Mutation_p.E699D|ATF7IP_ENST00000541654.1_Intron|ATF7IP_ENST00000261168.4_Missense_Mutation_p.E700D|ATF7IP_ENST00000544627.1_Missense_Mutation_p.E708D			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	700	Interaction with SETDB1.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						AGATGCTGGAGTCCAAAAGAA	0.363																																																	0													113.0	112.0	112.0					12																	14610171		2203	4300	6503	SO:0001583	missense	0			AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.2100G>T	12.37:g.14610171G>T	ENSP00000444589:p.Glu700Asp		F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.E700D	ENST00000540793.1	37	c.2100	CCDS8663.1	12	.	.	.	.	.	.	.	.	.	.	G	20.4	3.981564	0.74474	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T;T	0.22539	1.97;1.95;1.97;1.97;1.97	5.75	2.9	0.33743	.	0.000000	0.64402	D	0.000001	T	0.40473	0.1118	M	0.61703	1.905	0.42599	D	0.993274	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.83275	0.996;0.987;0.996;0.996	T	0.26224	-1.0109	10	0.66056	D	0.02	-17.7109	10.918	0.47148	0.261:0.0:0.739:0.0	.	699;700;699;311	G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;MCAF1_HUMAN;.;.	D	700;699;699;708;700	ENSP00000261168:E700D;ENSP00000443179:E699D;ENSP00000445955:E699D;ENSP00000440440:E708D;ENSP00000444589:E700D	ENSP00000261168:E700D	E	+	3	2	ATF7IP	14501438	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.396000	0.20867	0.874000	0.35823	0.650000	0.86243	GAG	ATF7IP	-	NULL	ENSG00000171681		0.363	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATF7IP	HGNC	protein_coding	OTTHUMT00000401400.1	-	0.00	64	0	G	NM_018179		14610171	+1	tier1	-	no_errors	ENST00000261168	ensembl	human	known	74_37	missense	5.06	75	4	SNP	1.000	T
ATP13A2	23400	genome.wustl.edu	37	1	17314657	17314657	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:17314657G>C	ENST00000326735.8	-	25	2868	c.2835C>G	c.(2833-2835)ttC>ttG	p.F945L	ATP13A2_ENST00000341676.5_Missense_Mutation_p.F901L|ATP13A2_ENST00000452699.1_Missense_Mutation_p.F940L|RP1-37C10.3_ENST00000446261.1_RNA			Q9NQ11	AT132_HUMAN	ATPase type 13A2	945					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		GGACGGAGATGAACTGGGTCA	0.602																																																	0													142.0	125.0	131.0					1																	17314657		2203	4300	6503	SO:0001583	missense	0			AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.2835C>G	1.37:g.17314657G>C	ENSP00000327214:p.Phe945Leu		O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_Cation_typ_V,pfam_HAD-like_dom,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	p.F945L	ENST00000326735.8	37	c.2835	CCDS175.1	1	.	.	.	.	.	.	.	.	.	.	g	18.00	3.525537	0.64860	.	.	ENSG00000159363	ENST00000326735;ENST00000341676;ENST00000452699;ENST00000502418	D;D;D;D	0.96232	-2.32;-2.32;-2.32;-3.95	5.51	2.56	0.30785	.	0.000000	0.85682	D	0.000000	D	0.96331	0.8803	M	0.74546	2.27	0.41910	D	0.990465	P;D;D	0.56035	0.893;0.963;0.974	B;P;P	0.57283	0.286;0.817;0.677	D	0.93732	0.7042	10	0.45353	T	0.12	-32.6874	5.3814	0.16194	0.17:0.0:0.6708:0.1592	.	901;940;945	Q5JXY1;Q6S9Z9;Q9NQ11	.;.;AT132_HUMAN	L	945;901;940;141	ENSP00000327214:F945L;ENSP00000341115:F901L;ENSP00000413307:F940L;ENSP00000423065:F141L	ENSP00000327214:F945L	F	-	3	2	ATP13A2	17187244	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	1.251000	0.32862	0.273000	0.22049	-0.215000	0.12644	TTC	ATP13A2	-	tigrfam_ATPase_P-typ_Cation_typ_V,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000159363		0.602	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP13A2	HGNC	protein_coding	OTTHUMT00000006617.1		0.00	27	0	G	NM_022089		17314657	-1			no_errors	ENST00000326735	ensembl	human	known	74_37	missense	7.32	38	3	SNP	1.000	C
ATP2B3	492	genome.wustl.edu	37	X	152815520	152815520	+	Silent	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chrX:152815520C>A	ENST00000349466.2	+	11	1925	c.1599C>A	c.(1597-1599)ggC>ggA	p.G533G	ATP2B3_ENST00000370181.2_Silent_p.G519G|ATP2B3_ENST00000393842.1_Silent_p.G519G|ATP2B3_ENST00000359149.3_Silent_p.G533G|ATP2B3_ENST00000263519.4_Silent_p.G533G|ATP2B3_ENST00000370186.1_Silent_p.G519G			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	533					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGAAGGAAGGCGCCCTCCCAC	0.677																																																	0													39.0	30.0	33.0					X																	152815520		2202	4300	6502	SO:0001819	synonymous_variant	0			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.1599C>A	X.37:g.152815520C>A			B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.G533	ENST00000349466.2	37	c.1599	CCDS35440.1	X																																																																																			ATP2B3	-	pfam_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_plasma	ENSG00000067842		0.677	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B3	HGNC	protein_coding	OTTHUMT00000060957.1		0.00	93	0	C	NM_021949		152815520	+1			no_errors	ENST00000263519	ensembl	human	known	74_37	silent	6.15	61	4	SNP	0.261	A
ATP2B4	493	genome.wustl.edu	37	1	203652486	203652486	+	Silent	SNP	A	A	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:203652486A>G	ENST00000357681.5	+	2	1276	c.153A>G	c.(151-153)gtA>gtG	p.V51V	ATP2B4_ENST00000341360.2_Silent_p.V51V|ATP2B4_ENST00000391954.2_Silent_p.V51V|ATP2B4_ENST00000367219.3_Silent_p.V51V|ATP2B4_ENST00000367218.3_Silent_p.V51V	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	51					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ATGGAGGTGTACAGAATCTCT	0.493																																																	0													131.0	118.0	123.0					1																	203652486		2203	4300	6503	SO:0001819	synonymous_variant	0			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.153A>G	1.37:g.203652486A>G			B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Silent	SNP	pfam_ATPase_P-typ_transduc_dom_A,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_HAD-like_dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_P-typ_cyto_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Ca-transp_plasma,tigrfam_Cation_transp_P_typ_ATPase	p.V51	ENST00000357681.5	37	c.153	CCDS1440.1	1																																																																																			ATP2B4	-	pfam_ATPase_P-typ_cation-transptr_N,smart_ATPase_P-typ_cation-transptr_N	ENSG00000058668		0.493	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1		0.00	47	0	A	NM_001001396		203652486	+1			no_errors	ENST00000357681	ensembl	human	known	74_37	silent	5.56	33	2	SNP	0.000	G
ATP6V1D	51382	genome.wustl.edu	37	14	67814144	67814144	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:67814144A>G	ENST00000216442.7	-	5	884	c.334T>C	c.(334-336)Tac>Cac	p.Y112H	ATP6V1D_ENST00000554236.1_Missense_Mutation_p.Y112H|ATP6V1D_ENST00000555431.1_Missense_Mutation_p.Y57H|ATP6V1D_ENST00000555474.1_Intron	NM_015994.3	NP_057078.1	Q9Y5K8	VATD_HUMAN	ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D	112					cellular iron ion homeostasis (GO:0006879)|cilium assembly (GO:0042384)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|protein localization to cilium (GO:0061512)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	7				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		CCTTCATGGTAATGTTCAAAT	0.343																																																	0													107.0	116.0	113.0					14																	67814144		2203	4300	6503	SO:0001583	missense	0			AF145316	CCDS9780.1	14q23-q24.2	2010-04-21	2002-08-29	2002-05-10	ENSG00000100554	ENSG00000100554		"""ATPases / V-type"""	13527	protein-coding gene	gene with protein product		609398	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"""	ATP6M		9442887	Standard	NM_015994		Approved	VATD, VMA8	uc001xjf.3	Q9Y5K8		ENST00000216442.7:c.334T>C	14.37:g.67814144A>G	ENSP00000216442:p.Tyr112His		B2RE33|Q9Y688	Missense_Mutation	SNP	pfam_V_ATPase_D,tigrfam_V_ATPase_D	p.Y112H	ENST00000216442.7	37	c.334	CCDS9780.1	14	.	.	.	.	.	.	.	.	.	.	A	25.7	4.667630	0.88348	.	.	ENSG00000100554	ENST00000216442;ENST00000555431;ENST00000554236;ENST00000555723	.	.	.	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.66268	0.2772	M	0.74467	2.265	0.80722	D	1	B	0.29805	0.257	B	0.32090	0.14	T	0.65776	-0.6086	9	0.51188	T	0.08	-14.8978	16.8222	0.85835	1.0:0.0:0.0:0.0	.	112	Q9Y5K8	VATD_HUMAN	H	112;57;112;64	.	ENSP00000216442:Y112H	Y	-	1	0	ATP6V1D	66883897	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.963000	0.93385	2.371000	0.80710	0.533000	0.62120	TAC	ATP6V1D	-	pfam_V_ATPase_D,tigrfam_V_ATPase_D	ENSG00000100554		0.343	ATP6V1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1D	HGNC	protein_coding	OTTHUMT00000412511.1	-	0.00	66	0	A	NM_015994		67814144	-1	tier1	-	no_errors	ENST00000216442	ensembl	human	known	74_37	missense	5.75	82	5	SNP	1.000	G
ATP8A2	51761	genome.wustl.edu	37	13	26343293	26343293	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr13:26343293G>A	ENST00000381655.2	+	26	2636	c.2494G>A	c.(2494-2496)Gcc>Acc	p.A832T	ATP8A2_ENST00000255283.8_Missense_Mutation_p.A792T|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	792					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GATCCAGACAGCCCACGTGGG	0.592																																																	0													99.0	108.0	105.0					13																	26343293		2160	4248	6408	SO:0001583	missense	0			AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.2494G>A	13.37:g.26343293G>A	ENSP00000371070:p.Ala832Thr		Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	pfam_ATPase_P-typ_transduc_dom_A,superfamily_HAD-like_dom,superfamily_ATPase_P-typ_cyto_domN,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	p.A832T	ENST00000381655.2	37	c.2494	CCDS41873.1	13	.	.	.	.	.	.	.	.	.	.	G	36	5.726926	0.96847	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	D;D	0.88201	-2.35;-2.35	6.17	6.17	0.99709	HAD-like domain (2);	0.116216	0.64402	D	0.000018	D	0.97170	0.9075	H	0.98276	4.19	0.80722	D	1	D;D;D	0.76494	0.999;0.998;0.996	D;D;D	0.74023	0.931;0.982;0.931	D	0.97672	1.0167	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	792;612;792	B7Z880;F5GZN5;Q9NTI2	.;.;AT8A2_HUMAN	T	832;792;612	ENSP00000371070:A832T;ENSP00000255283:A792T	ENSP00000255283:A792T	A	+	1	0	ATP8A2	25241293	1.000000	0.71417	0.915000	0.36163	0.938000	0.57974	9.476000	0.97823	2.941000	0.99782	0.655000	0.94253	GCC	ATP8A2	-	superfamily_HAD-like_dom,prints_Cation_transp_P_typ_ATPase,tigrfam_ATPase_P-typ_Plipid-transp,tigrfam_Cation_transp_P_typ_ATPase	ENSG00000132932		0.592	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8A2	HGNC	protein_coding	OTTHUMT00000044236.2	-	0.00	30	0	G	NM_016529		26343293	+1	tier1	-	no_errors	ENST00000381655	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	A
ATXN2	6311	genome.wustl.edu	37	12	111958776	111958776	+	Splice_Site	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:111958776G>C	ENST00000377617.3	-	7	1339	c.1178C>G	c.(1177-1179)tCt>tGt	p.S393C	ATXN2_ENST00000608853.1_Splice_Site_p.S233C|ATXN2_ENST00000550104.1_Splice_Site_p.S393C|ATXN2_ENST00000542287.2_Splice_Site_p.S128C|ATXN2_ENST00000549455.1_5'UTR|ATXN2_ENST00000389153.4_Splice_Site_p.S128C|ATXN2_ENST00000535949.1_Splice_Site_p.S104C	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	393					cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						CCATCCATTAGACTAGAAGAA	0.308																																																	0													81.0	74.0	76.0					12																	111958776		2201	4294	6495	SO:0001630	splice_region_variant	0			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.1177-1C>G	12.37:g.111958776G>C			A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.S393C	ENST00000377617.3	37	c.1178	CCDS31902.1	12	.	.	.	.	.	.	.	.	.	.	G	23.6	4.429986	0.83776	.	.	ENSG00000204842	ENST00000389153;ENST00000377617;ENST00000550104;ENST00000542287;ENST00000535949;ENST00000471866;ENST00000548492	T;T	0.70399	-0.41;-0.48	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.82628	0.5078	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;0.999;1.0	D;D;D;D	0.85130	0.993;0.993;0.99;0.997	D	0.84303	0.0506	10	0.87932	D	0	-12.1879	18.8486	0.92218	0.0:0.0:1.0:0.0	.	128;393;104;128	B3KT59;Q99700;Q24JQ7;F8VQP2	.;ATX2_HUMAN;.;.	C	128;393;393;128;104;69;136	ENSP00000366843:S393C;ENSP00000446576:S393C	ENSP00000366843:S393C	S	-	2	0	ATXN2	110443159	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.363000	0.97131	2.451000	0.82905	0.557000	0.71058	TCT	ATXN2	-	NULL	ENSG00000204842		0.308	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN2	HGNC	protein_coding	OTTHUMT00000257351.3	-	0.00	40	0	G	NM_002973	Missense_Mutation	111958776	-1	tier1	-	no_errors	ENST00000377617	ensembl	human	known	74_37	missense	25.49	38	13	SNP	1.000	C
B3GNT7	93010	genome.wustl.edu	37	2	232262814	232262814	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:232262814G>C	ENST00000287590.5	+	2	645	c.384G>C	c.(382-384)gaG>gaC	p.E128D	B3GNT7_ENST00000479618.1_3'UTR	NM_145236.2	NP_660279.1	Q8NFL0	B3GN7_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 7	128					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			endometrium(2)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)	17		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;3.22e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0139)		ACCACCCGGAGAAGTGCAGGG	0.657																																																	0													25.0	28.0	27.0					2																	232262814		2044	4182	6226	SO:0001583	missense	0			AK000770	CCDS46540.1	2q36.1	2013-02-21			ENSG00000156966	ENSG00000156966		"""Beta 3-glycosyltransferases"""	18811	protein-coding gene	gene with protein product		615313				12061784	Standard	NM_145236		Approved	beta3GnT7	uc002vrs.3	Q8NFL0	OTTHUMG00000153880	ENST00000287590.5:c.384G>C	2.37:g.232262814G>C	ENSP00000287590:p.Glu128Asp		B3KWY4|B7WNP0	Missense_Mutation	SNP	pfam_Glyco_trans_31,pfam_Fringe-like	p.E128D	ENST00000287590.5	37	c.384	CCDS46540.1	2	.	.	.	.	.	.	.	.	.	.	G	17.39	3.377289	0.61735	.	.	ENSG00000156966	ENST00000287590	T	0.35789	1.29	5.27	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.40839	0.1133	L	0.38953	1.18	0.58432	D	0.999999	D	0.64830	0.994	P	0.54629	0.757	T	0.13361	-1.0512	10	0.35671	T	0.21	.	12.9315	0.58290	0.0784:0.0:0.9216:0.0	.	128	Q8NFL0	B3GN7_HUMAN	D	128	ENSP00000287590:E128D	ENSP00000287590:E128D	E	+	3	2	B3GNT7	231971058	1.000000	0.71417	0.999000	0.59377	0.411000	0.31082	3.902000	0.56310	1.221000	0.43506	-0.136000	0.14681	GAG	B3GNT7	-	NULL	ENSG00000156966		0.657	B3GNT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT7	HGNC	protein_coding	OTTHUMT00000332827.1	-	0.00	42	0	G	NM_145236		232262814	+1	tier1	-	no_errors	ENST00000287590	ensembl	human	known	74_37	missense	12.82	34	5	SNP	1.000	C
BCAS3	54828	genome.wustl.edu	37	17	59067470	59067470	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:59067470C>T	ENST00000390652.5	+	15	1391	c.1360C>T	c.(1360-1362)Cgc>Tgc	p.R454C	BCAS3_ENST00000589222.1_Missense_Mutation_p.R454C|BCAS3_ENST00000588462.1_Missense_Mutation_p.R454C|BCAS3_ENST00000407086.3_Missense_Mutation_p.R454C|BCAS3_ENST00000588874.1_Missense_Mutation_p.R225C|BCAS3_ENST00000408905.3_Missense_Mutation_p.R454C|BCAS3_ENST00000585744.1_Missense_Mutation_p.R225C	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			AGTAGTGAATCGCATGAGCCG	0.507																																																	0													81.0	83.0	82.0					17																	59067470		1979	4161	6140	SO:0001583	missense	0			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.1360C>T	17.37:g.59067470C>T	ENSP00000375067:p.Arg454Cys			Missense_Mutation	SNP	pfam_BCAS3,pfam_WD40_repeat	p.R454C	ENST00000390652.5	37	c.1360	CCDS45749.1	17	.	.	.	.	.	.	.	.	.	.	C	29.3	4.998366	0.93227	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000405070;ENST00000408905;ENST00000360207;ENST00000405217	T;T;T	0.35048	1.33;1.33;2.82	5.38	5.38	0.77491	.	0.053577	0.85682	D	0.000000	T	0.60130	0.2245	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0;1.0;0.998	P;P;P;P;D;D;P	0.79108	0.683;0.855;0.855;0.891;0.992;0.982;0.799	T	0.61845	-0.6979	10	0.87932	D	0	.	19.4833	0.95018	0.0:1.0:0.0:0.0	.	245;454;454;259;454;454;454	B4E3M9;Q9H6U6-3;Q9H6U6-8;Q70WD9;Q9H6U6-7;Q9H6U6;Q9H6U6-2	.;.;.;.;.;BCAS3_HUMAN;.	C	454;454;454;454;246;259	ENSP00000375067:R454C;ENSP00000385323:R454C;ENSP00000386173:R454C	ENSP00000353336:R246C	R	+	1	0	BCAS3	56422252	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.359000	0.79477	2.666000	0.90696	0.591000	0.81541	CGC	BCAS3	-	NULL	ENSG00000141376		0.507	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS3	HGNC	protein_coding	OTTHUMT00000449578.1		0.00	38	0	C	NM_017679		59067470	+1			no_errors	ENST00000390652	ensembl	human	known	74_37	missense	9.09	50	5	SNP	1.000	T
BMP6	654	genome.wustl.edu	37	6	7880445	7880445	+	Missense_Mutation	SNP	G	G	C	rs368529770		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:7880445G>C	ENST00000283147.6	+	7	1570	c.1411G>C	c.(1411-1413)Gag>Cag	p.E471Q		NM_001718.4	NP_001709.1	P22004	BMP6_HUMAN	bone morphogenetic protein 6	471					BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular response to mechanical stimulus (GO:0071260)|endochondral ossification (GO:0001958)|eye development (GO:0001654)|growth (GO:0040007)|immune response (GO:0006955)|inflammatory response (GO:0006954)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|osteoblast differentiation (GO:0001649)|positive regulation of aldosterone biosynthetic process (GO:0032349)|positive regulation of aldosterone secretion (GO:2000860)|positive regulation of bone mineralization (GO:0030501)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to activity (GO:0014823)|response to glucocorticoid (GO:0051384)|response to iron ion (GO:0010039)|response to magnesium ion (GO:0032026)|response to retinoic acid (GO:0032526)|skeletal system development (GO:0001501)|SMAD protein signal transduction (GO:0060395)|type B pancreatic cell development (GO:0003323)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)|protein heterodimerization activity (GO:0046982)			breast(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	23	Ovarian(93;0.0721)					TATGAACCCCGAGTATGTCCC	0.443																																																	0													183.0	193.0	190.0					6																	7880445		2203	4300	6503	SO:0001583	missense	0			AF083030	CCDS4503.1	6p24-p23	2014-01-30	2003-10-06		ENSG00000153162	ENSG00000153162		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1073	protein-coding gene	gene with protein product		112266	"""vegetal related growth factor (TGFB-related)"""	VGR		1427904, 1453478	Standard	NM_001718		Approved	VGR1	uc003mxu.4	P22004	OTTHUMG00000014217	ENST00000283147.6:c.1411G>C	6.37:g.7880445G>C	ENSP00000283147:p.Glu471Gln		Q5TCP3	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.E471Q	ENST00000283147.6	37	c.1411	CCDS4503.1	6	.	.	.	.	.	.	.	.	.	.	G	31	5.065308	0.93898	.	.	ENSG00000153162	ENST00000537240;ENST00000283147;ENST00000540959	D	0.84223	-1.82	5.65	5.65	0.86999	Transforming growth factor-beta, C-terminal (3);	0.156215	0.64402	D	0.000016	D	0.82921	0.5142	N	0.20574	0.59	0.80722	D	1	D	0.61080	0.989	P	0.57846	0.828	D	0.85497	0.1189	10	0.62326	D	0.03	.	19.7244	0.96157	0.0:0.0:1.0:0.0	.	471	P22004	BMP6_HUMAN	Q	393;471;434	ENSP00000283147:E471Q	ENSP00000283147:E471Q	E	+	1	0	BMP6	7825444	1.000000	0.71417	0.984000	0.44739	0.981000	0.71138	9.472000	0.97709	2.659000	0.90383	0.655000	0.94253	GAG	BMP6	-	pfam_TGF-b_C,smart_TGF-b_C	ENSG00000153162		0.443	BMP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP6	HGNC	protein_coding	OTTHUMT00000039794.1	-	0.00	68	0	G	NM_001718		7880445	+1	tier1	-	no_errors	ENST00000283147	ensembl	human	known	74_37	missense	27.27	40	15	SNP	1.000	C
BTN2A3P	54718	genome.wustl.edu	37	6	26423187	26423187	+	RNA	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:26423187G>A	ENST00000466808.2	+	0	106							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)											GGGGCCCACTGATCCCATCCT	0.537																																																	0													117.0	97.0	104.0					6																	26423187		2203	4300	6503			0			AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26423187G>A			A6NEF4	RNA	SNP	-	NULL	ENST00000466808.2	37	NULL		6																																																																																			BTN2A3P	-	-	ENSG00000124549		0.537	BTN2A3P-001	KNOWN	basic	processed_transcript	BTN2A3P	HGNC	pseudogene	OTTHUMT00000040118.4	-	0.00	100	0	G	NR_027795		26423187	+1	tier1	-	no_errors	ENST00000465856	ensembl	human	known	74_37	rna	15.38	88	16	SNP	0.033	A
BUB1	699	genome.wustl.edu	37	2	111427127	111427127	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:111427127C>G	ENST00000302759.6	-	6	588	c.470G>C	c.(469-471)aGa>aCa	p.R157T	BUB1_ENST00000535254.1_Missense_Mutation_p.R137T|BUB1_ENST00000409311.1_Missense_Mutation_p.R157T	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	157	BUB1 N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00822}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		TTCTGAGGTTCTAGCTATGAG	0.343																																																	0													107.0	105.0	106.0					2																	111427127		2203	4300	6503	SO:0001583	missense	0			AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.470G>C	2.37:g.111427127C>G	ENSP00000302530:p.Arg157Thr		E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Missense_Mutation	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.R157T	ENST00000302759.6	37	c.470	CCDS33273.1	2	.	.	.	.	.	.	.	.	.	.	C	6.908	0.537144	0.13188	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759;ENST00000541432	T;T;T	0.29655	2.29;1.56;2.55	4.91	0.872	0.19113	Mad3/BUB1 homology region 1 (1);	0.721746	0.13812	N	0.361009	T	0.16214	0.0390	L	0.27053	0.805	0.21822	N	0.999523	B;B;B	0.15473	0.008;0.008;0.013	B;B;B	0.08055	0.003;0.002;0.002	T	0.30001	-0.9993	10	0.14656	T	0.56	-5.6911	5.1691	0.15101	0.0:0.4372:0.2955:0.2673	.	137;157;157	F5GXI5;E9PC26;O43683	.;.;BUB1_HUMAN	T	137;157;157;157	ENSP00000441013:R137T;ENSP00000386701:R157T;ENSP00000302530:R157T	ENSP00000302530:R157T	R	-	2	0	BUB1	111143598	0.473000	0.25878	0.958000	0.39756	0.912000	0.54170	0.165000	0.16564	0.177000	0.19895	0.460000	0.39030	AGA	BUB1	-	NULL	ENSG00000169679		0.343	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1	HGNC	protein_coding	OTTHUMT00000331925.1	-	0.00	33	0	C	NM_004336		111427127	-1	tier1	-	no_errors	ENST00000302759	ensembl	human	known	74_37	missense	8.70	42	4	SNP	0.672	G
C11orf30	56946	genome.wustl.edu	37	11	76237670	76237670	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:76237670G>A	ENST00000529032.1	+	12	1986	c.1986G>A	c.(1984-1986)ggG>ggA	p.G662G	C11orf30_ENST00000524490.1_Silent_p.G578G|C11orf30_ENST00000343878.3_Silent_p.G662G|C11orf30_ENST00000525038.1_Silent_p.G677G|C11orf30_ENST00000533248.1_Silent_p.G676G|C11orf30_ENST00000524767.1_Silent_p.G677G|C11orf30_ENST00000525919.1_Silent_p.G663G|C11orf30_ENST00000334736.3_Silent_p.G662G			Q7Z589	EMSY_HUMAN	chromosome 11 open reading frame 30	662					chromatin modification (GO:0016568)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(10)|liver(1)|lung(23)|ovary(5)|prostate(2)|skin(4)|stomach(1)|urinary_tract(2)	60						GGCAGCAAGGGAAAACGCAGG	0.363																																																	0													92.0	85.0	88.0					11																	76237670		2200	4292	6492	SO:0001819	synonymous_variant	0			AF226047	CCDS8244.1, CCDS73349.1, CCDS73350.1, CCDS73351.1	11q13.5	2010-07-01			ENSG00000158636	ENSG00000158636			18071	protein-coding gene	gene with protein product		608574					Standard	XM_005274106		Approved	EMSY	uc001oxl.3	Q7Z589	OTTHUMG00000165282	ENST00000529032.1:c.1986G>A	11.37:g.76237670G>A			B7ZKT8|B7ZKU0|B7ZKU2|Q17RM7|Q4G109|Q8NBU6|Q8TE50|Q9H8I9|Q9NRH0	Silent	SNP	pfam_ENT_N,pfscan_ENT_N	p.G662	ENST00000529032.1	37	c.1986	CCDS8244.1	11																																																																																			C11orf30	-	NULL	ENSG00000158636		0.363	C11orf30-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C11orf30	HGNC	protein_coding	OTTHUMT00000383288.2		0.00	21	0	G	NM_020193		76237670	+1			no_errors	ENST00000334736	ensembl	human	known	74_37	silent	10.00	27	3	SNP	0.994	A
C14orf182	283551	genome.wustl.edu	37	14	50470433	50470433	+	5'UTR	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:50470433G>A	ENST00000529902.1	-	0	2804				C14orf182_ENST00000399206.1_Intron			A1A4T8	CN182_HUMAN	chromosome 14 open reading frame 182											large_intestine(2)|urinary_tract(1)	3						GATGGTCTCTGCAGCAGTCAG	0.622																																																	0																																										SO:0001623	5_prime_UTR_variant	0			AK090420	CCDS41949.1	14q22.1	2009-02-24			ENSG00000214900	ENSG00000214900			27503	protein-coding gene	gene with protein product							Standard	NM_001012706		Approved		uc001wxi.1	A1A4T8		ENST00000529902.1:c.-1475C>T	14.37:g.50470433G>A			A8MYX4	RNA	SNP	-	NULL	ENST00000529902.1	37	NULL		14																																																																																			C14orf182	-	-	ENSG00000214900		0.622	C14orf182-004	KNOWN	basic	processed_transcript	C14orf182	HGNC	protein_coding	OTTHUMT00000395721.1	-	0.00	55	0	G	NM_001012706		50470433	-1	tier1	-	no_errors	ENST00000529902	ensembl	human	known	74_37	rna	21.43	55	15	SNP	0.001	A
C14orf80	283643	genome.wustl.edu	37	14	105962375	105962375	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:105962375G>T	ENST00000392523.4	+	6	964	c.843G>T	c.(841-843)ttG>ttT	p.L281F	C14orf80_ENST00000329886.7_Intron|C14orf80_ENST00000334656.7_Intron|C14orf80_ENST00000450383.1_Intron|C14orf80_ENST00000392522.3_Intron|C14orf80_ENST00000551054.1_Intron|C14orf80_ENST00000392527.1_Intron|C14orf80_ENST00000354560.6_Intron			Q86SX3	CN080_HUMAN	chromosome 14 open reading frame 80	281										central_nervous_system(1)	1		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.239)		CAGCACCCTTGGATCCTGGTG	0.637																																																	0																																										SO:0001583	missense	0				CCDS45180.1, CCDS45181.1, CCDS45182.1, CCDS55955.1	14q32.33	2012-09-25			ENSG00000185347	ENSG00000185347			20127	protein-coding gene	gene with protein product							Standard	NM_001134875		Approved		uc001yrn.3	Q86SX3	OTTHUMG00000170426	ENST00000392523.4:c.843G>T	14.37:g.105962375G>T	ENSP00000376308:p.Leu281Phe		B5MDG3|E9PAQ4|Q86TT3|Q86TT4|Q86TT5|Q96B41|Q9H7H4	Missense_Mutation	SNP	NULL	p.L281F	ENST00000392523.4	37	c.843		14	.	.	.	.	.	.	.	.	.	.	G	3.518	-0.098304	0.07010	.	.	ENSG00000185347	ENST00000392523	.	.	.	2.69	1.74	0.24563	.	.	.	.	.	T	0.28995	0.0720	.	.	.	0.09310	N	0.99999	B	0.14805	0.011	B	0.15052	0.012	T	0.20405	-1.0276	7	0.39692	T	0.17	.	7.7904	0.29116	0.0:0.262:0.738:0.0	.	281	Q86SX3	CN080_HUMAN	F	281	.	ENSP00000376308:L281F	L	+	3	2	C14orf80	105033420	0.003000	0.15002	0.001000	0.08648	0.004000	0.04260	0.971000	0.29396	0.391000	0.25143	0.491000	0.48974	TTG	C14orf80	-	NULL	ENSG00000185347		0.637	C14orf80-017	KNOWN	basic	protein_coding	C14orf80	HGNC	protein_coding	OTTHUMT00000409090.1	-	0.00	52	0	G	NM_001134875		105962375	+1	tier1	-	no_errors	ENST00000392523	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.002	T
C19orf12	83636	genome.wustl.edu	37	19	30193476	30193476	+	3'UTR	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:30193476C>G	ENST00000392278.2	-	0	728				C19orf12_ENST00000323670.9_3'UTR|C19orf12_ENST00000392275.1_5'UTR|C19orf12_ENST00000392276.1_3'UTR|C19orf12_ENST00000592153.1_3'UTR	NM_001031726.3	NP_001026896.2	Q9NSK7	CS012_HUMAN	chromosome 19 open reading frame 12						cell death (GO:0008219)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)						Ovarian(5;0.000567)|Breast(6;0.0203)|Esophageal squamous(110;0.239)		UCEC - Uterine corpus endometrioid carcinoma (4;2.65e-06)|STAD - Stomach adenocarcinoma(5;1.7e-06)|Lung(7;0.0435)|LUAD - Lung adenocarcinoma(5;0.0989)|BRCA - Breast invasive adenocarcinoma(6;0.183)			GCGGTGGCCTCTCCAGCGGGA	0.552																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AK057185	CCDS12418.2, CCDS42542.1, CCDS59373.1, CCDS74325.1	19q13.11	2013-07-24			ENSG00000131943	ENSG00000131943			25443	protein-coding gene	gene with protein product	"""neurodegeneration with brain iron accumulation 4"""	614297	"""spastic paraplegia 43 (autosomal recessive)"""	SPG43		21981780, 23857908	Standard	NM_031448		Approved	MGC10922, DKFZP762D096, NBIA4	uc002nsj.3	Q9NSK7	OTTHUMG00000149838	ENST00000392278.2:c.*143G>C	19.37:g.30193476C>G			B3KQ16|Q0D2Q0|Q6P4C5|Q9BSL7	RNA	SNP	-	NULL	ENST00000392278.2	37	NULL	CCDS42542.1	19																																																																																			C19orf12	-	-	ENSG00000131943		0.552	C19orf12-003	KNOWN	basic|exp_conf|CCDS	protein_coding	C19orf12	HGNC	protein_coding	OTTHUMT00000313509.2	-	0.00	14	0	C	NM_031448		30193476	-1	tier1	-	no_errors	ENST00000392275	ensembl	human	known	74_37	rna	40.74	16	11	SNP	0.104	G
C1QC	714	genome.wustl.edu	37	1	22973906	22973906	+	Missense_Mutation	SNP	C	C	T	rs369345026		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:22973906C>T	ENST00000374639.3	+	3	486	c.368C>T	c.(367-369)aCg>aTg	p.T123M	C1QC_ENST00000374637.1_Missense_Mutation_p.T123M|C1QC_ENST00000374640.4_Missense_Mutation_p.T123M	NM_001114101.1	NP_001107573.1	P02747	C1QC_HUMAN	complement component 1, q subcomponent, C chain	123	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of macrophage differentiation (GO:0045650)	blood microparticle (GO:0072562)|collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.T123M(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	15		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.21e-27)|Colorectal(126;1.5e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.61e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000538)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.196)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TCAGTGTTCACGGTCACTCGG	0.622																																					Ovarian(26;671 750 8290 29071 43278)												1	Substitution - Missense(1)	endometrium(1)						C	MET/THR,MET/THR	0,4406		0,0,2203	84.0	84.0	84.0		368,368	4.0	0.9	1		84	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	C1QC	NM_001114101.1,NM_172369.3	81,81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	123/246,123/246	22973906	1,13005	2203	4300	6503	SO:0001583	missense	0			AK057792	CCDS227.1	1p36.11	2014-09-17	2006-02-09	2006-02-09	ENSG00000159189	ENSG00000159189		"""Complement system"""	1245	protein-coding gene	gene with protein product		120575	"""complement component 1, q subcomponent, gamma polypeptide"""	C1QG		1706597	Standard	NM_001114101		Approved		uc001bga.4	P02747	OTTHUMG00000002891	ENST00000374639.3:c.368C>T	1.37:g.22973906C>T	ENSP00000363770:p.Thr123Met		Q7Z502|Q96DL2|Q96H05	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q,prints_C1q	p.T123M	ENST00000374639.3	37	c.368	CCDS227.1	1	.	.	.	.	.	.	.	.	.	.	C	17.22	3.333256	0.60853	0.0	1.16E-4	ENSG00000159189	ENST00000374640;ENST00000374639;ENST00000374637	T;T;T	0.76316	-1.01;-1.01;-1.01	4.94	4.0	0.46444	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.321832	0.32416	N	0.006121	D	0.87212	0.6121	M	0.80183	2.485	0.38692	D	0.952783	D	0.76494	0.999	D	0.70935	0.971	D	0.89130	0.3509	10	0.56958	D	0.05	.	13.668	0.62407	0.0:0.8434:0.1566:0.0	.	123	P02747	C1QC_HUMAN	M	123	ENSP00000363771:T123M;ENSP00000363770:T123M;ENSP00000363768:T123M	ENSP00000363768:T123M	T	+	2	0	C1QC	22846493	0.605000	0.26941	0.920000	0.36463	0.710000	0.40934	1.240000	0.32731	1.017000	0.39495	0.561000	0.74099	ACG	C1QC	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like_dom,smart_C1q,pfscan_C1q	ENSG00000159189		0.622	C1QC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QC	HGNC	protein_coding	OTTHUMT00000008083.1		0.00	33	0	C	NM_172369		22973906	+1			no_errors	ENST00000374637	ensembl	human	known	74_37	missense	7.32	38	3	SNP	0.982	T
C20orf166	128826	genome.wustl.edu	37	20	61167762	61167762	+	Missense_Mutation	SNP	C	C	T	rs375026064		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr20:61167762C>T	ENST00000370527.3	+	4	1011	c.232C>T	c.(232-234)Cca>Tca	p.P78S	C20orf166_ENST00000370523.1_Missense_Mutation_p.P60S|C20orf166_ENST00000370524.2_Missense_Mutation_p.P60S	NM_178463.3	NP_848558.1			chromosome 20 open reading frame 166									p.P78S(1)		endometrium(1)|kidney(1)|lung(2)	4	Breast(26;1.04e-08)		BRCA - Breast invasive adenocarcinoma(19;7.17e-06)			CCACAGTGCTCCAGTGTGTGA	0.522																																																	1	Substitution - Missense(1)	lung(1)											54.0	57.0	56.0					20																	61167762		2045	4180	6225	SO:0001583	missense	0			AL449263	CCDS46627.1	20q13.33	2014-01-21			ENSG00000174407	ENSG00000174407			16159	protein-coding gene	gene with protein product	"""MIR133A2 host gene"""						Standard	NM_178463		Approved	dJ353C17.1, MIR1-1HG, MIR133A2HG	uc011aaj.2	Q9H1L0	OTTHUMG00000048000	ENST00000370527.3:c.232C>T	20.37:g.61167762C>T	ENSP00000359558:p.Pro78Ser			Missense_Mutation	SNP	NULL	p.P78S	ENST00000370527.3	37	c.232	CCDS46627.1	20	.	.	.	.	.	.	.	.	.	.	C	5.965	0.361996	0.11296	.	.	ENSG00000174407	ENST00000370527;ENST00000370524;ENST00000370523	T;T;T	0.35605	1.3;1.3;1.3	1.25	-2.5	0.06384	.	.	.	.	.	T	0.14313	0.0346	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.17048	-1.0382	9	0.87932	D	0	.	0.076	0.00027	0.2479:0.2221:0.2488:0.2812	.	78	Q9H1L0	CT166_HUMAN	S	78;60;60	ENSP00000359558:P78S;ENSP00000359555:P60S;ENSP00000359554:P60S	ENSP00000359554:P60S	P	+	1	0	C20orf166	60578207	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-2.850000	0.00732	-1.385000	0.02101	0.313000	0.20887	CCA	C20orf166	-	NULL	ENSG00000174407		0.522	C20orf166-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf166	HGNC	protein_coding	OTTHUMT00000109262.1		0.00	45	0	C	NM_178463		61167762	+1			no_errors	ENST00000370527	ensembl	human	known	74_37	missense	5.17	55	3	SNP	0.000	T
C2CD2	25966	genome.wustl.edu	37	21	43339044	43339044	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr21:43339044C>G	ENST00000380486.3	-	4	759	c.518G>C	c.(517-519)aGa>aCa	p.R173T	C2CD2_ENST00000329623.7_Missense_Mutation_p.R18T	NM_015500.1	NP_056315.1	Q9Y426	CU025_HUMAN	C2 calcium-dependent domain containing 2	173						cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|ovary(3)|prostate(1)|stomach(1)	15						GAGGTCCTCTCTCTTCTCCTT	0.473																																																	0													97.0	86.0	90.0					21																	43339044		2203	4300	6503	SO:0001583	missense	0			AB047784	CCDS13677.1, CCDS42933.1	21q22.3	2008-11-24	2007-10-17	2007-10-17	ENSG00000157617	ENSG00000157617			1266	protein-coding gene	gene with protein product	"""TMEM24-like"""		"""chromosome 21 open reading frame 25"""	C21orf25		15289880	Standard	NM_015500		Approved	TMEM24L, DKFZP586F0422, C21orf258	uc002yzw.3	Q9Y426	OTTHUMG00000086779	ENST00000380486.3:c.518G>C	21.37:g.43339044C>G	ENSP00000369853:p.Arg173Thr		Q5R2V7|Q6AHX8|Q9NSE6	Missense_Mutation	SNP	pfam_C2_dom,superfamily_C2_dom	p.R173T	ENST00000380486.3	37	c.518	CCDS42933.1	21	.	.	.	.	.	.	.	.	.	.	C	2.125	-0.400423	0.04865	.	.	ENSG00000157617	ENST00000329623;ENST00000380486	T;T	0.23147	1.92;1.93	5.53	0.664	0.17890	.	0.460473	0.23083	N	0.052137	T	0.17534	0.0421	M	0.62723	1.935	0.09310	N	1	P;P	0.38922	0.454;0.651	B;B	0.32677	0.15;0.15	T	0.19614	-1.0300	10	0.18710	T	0.47	-5.4656	4.8639	0.13598	0.0:0.5278:0.1455:0.3267	.	18;173	Q6P6D1;Q9Y426	.;CU025_HUMAN	T	18;173	ENSP00000329302:R18T;ENSP00000369853:R173T	ENSP00000329302:R18T	R	-	2	0	C2CD2	42212113	0.006000	0.16342	0.023000	0.16930	0.009000	0.06853	0.376000	0.20535	-0.152000	0.11156	-0.742000	0.03525	AGA	C2CD2	-	NULL	ENSG00000157617		0.473	C2CD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2CD2	HGNC	protein_coding	OTTHUMT00000195228.2	-	0.00	41	0	C	NM_015500		43339044	-1	tier1	-	no_errors	ENST00000380486	ensembl	human	known	74_37	missense	16.13	52	10	SNP	0.168	G
C3orf30	152405	genome.wustl.edu	37	3	118865478	118865478	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:118865478C>T	ENST00000295622.1	+	1	482	c.442C>T	c.(442-444)Cga>Tga	p.R148*	IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000354673.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank|IGSF11_ENST00000425327.2_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	148										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		ACAGACTGAACGAAGATTACC	0.498																																																	0													55.0	52.0	53.0					3																	118865478		2203	4300	6503	SO:0001587	stop_gained	0			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.442C>T	3.37:g.118865478C>T	ENSP00000295622:p.Arg148*		A1L4B7	Nonsense_Mutation	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.R148*	ENST00000295622.1	37	c.442	CCDS2984.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.23|19.23	3.787964|3.787964	0.70337|0.70337	.|.	.|.	ENSG00000163424|ENSG00000163424	ENST00000295622;ENST00000470341|ENST00000460150	.|.	.|.	.|.	3.57|3.57	1.74|1.74	0.24563|0.24563	.|.	1.428600|.	0.05082|.	N|.	0.483620|.	.|T	.|0.39462	.|0.1079	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.45396	.|-0.9264	.|3	0.11485|.	T|.	0.65|.	1.5151|1.5151	6.0316|6.0316	0.19683|0.19683	0.1885:0.7058:0.0:0.1058|0.1885:0.7058:0.0:0.1058	.|.	.|.	.|.	.|.	X|M	148|111	.|.	ENSP00000295622:R148X|.	R|T	+|+	1|2	2|0	C3orf30|C3orf30	120348168|120348168	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.079000|0.079000	0.17450|0.17450	0.202000|0.202000	0.17295|0.17295	0.493000|0.493000	0.27837|0.27837	0.563000|0.563000	0.77884|0.77884	CGA|ACG	C3orf30	-	NULL	ENSG00000163424		0.498	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf30	HGNC	protein_coding	OTTHUMT00000354838.1	-	0.00	25	0	C	NM_152539		118865478	+1	tier1	-	no_errors	ENST00000295622	ensembl	human	known	74_37	nonsense	18.75	26	6	SNP	0.000	T
C4orf36	132989	genome.wustl.edu	37	4	87809349	87809349	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:87809349C>A	ENST00000473559.1	-	6	808	c.145G>T	c.(145-147)Gaa>Taa	p.E49*	C4orf36_ENST00000295898.3_Nonsense_Mutation_p.E49*|C4orf36_ENST00000503001.1_5'UTR			Q96KX1	CD036_HUMAN	chromosome 4 open reading frame 36	49										breast(1)|kidney(1)|lung(1)|prostate(1)	4		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00141)		AATGAAATTTCTTCCAAGAAA	0.408																																																	0													95.0	93.0	94.0					4																	87809349		2203	4300	6503	SO:0001587	stop_gained	0			BC016746	CCDS3615.1	4q21.3	2008-02-05			ENSG00000163633	ENSG00000163633			28386	protein-coding gene	gene with protein product						12477932	Standard	NM_144645		Approved	MGC26744	uc003hqe.4	Q96KX1	OTTHUMG00000130597	ENST00000473559.1:c.145G>T	4.37:g.87809349C>A	ENSP00000420949:p.Glu49*			Nonsense_Mutation	SNP	NULL	p.E49*	ENST00000473559.1	37	c.145	CCDS3615.1	4	.	.	.	.	.	.	.	.	.	.	C	39	7.751750	0.98471	.	.	ENSG00000163633	ENST00000295898;ENST00000473559;ENST00000506308;ENST00000504008	.	.	.	5.13	4.28	0.50868	.	0.109676	0.41194	D	0.000929	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-21.9942	10.8729	0.46894	0.1879:0.8121:0.0:0.0	.	.	.	.	X	49	.	ENSP00000295898:E49X	E	-	1	0	C4orf36	88028373	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	3.343000	0.52167	1.371000	0.46172	0.591000	0.81541	GAA	C4orf36	-	NULL	ENSG00000163633		0.408	C4orf36-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C4orf36	HGNC	protein_coding	OTTHUMT00000253045.2	-	0.00	39	0	C	NM_144645		87809349	-1	tier1	-	no_errors	ENST00000295898	ensembl	human	known	74_37	nonsense	25.45	41	14	SNP	1.000	A
C6orf222	389384	genome.wustl.edu	37	6	36291264	36291264	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:36291264G>A	ENST00000437635.2	-	8	1454	c.1277C>T	c.(1276-1278)cCa>cTa	p.P426L		NM_001010903.4	NP_001010903.3	P0C671	CF222_HUMAN	chromosome 6 open reading frame 222	426										breast(4)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(4)|urinary_tract(4)	26						TCTGCAGTGTGGGGCCGGGTT	0.537																																																	0													115.0	120.0	118.0					6																	36291264		2203	4300	6503	SO:0001583	missense	0				CCDS34439.1	6p21.31	2012-02-22			ENSG00000189325	ENSG00000189325			33769	protein-coding gene	gene with protein product							Standard	NM_001010903		Approved	DKFZp779B1540	uc003oly.3	P0C671	OTTHUMG00000014591	ENST00000437635.2:c.1277C>T	6.37:g.36291264G>A	ENSP00000418983:p.Pro426Leu		B2RTY8	Missense_Mutation	SNP	NULL	p.P426L	ENST00000437635.2	37	c.1277	CCDS34439.1	6	.	.	.	.	.	.	.	.	.	.	G	12.86	2.064724	0.36470	.	.	ENSG00000189325	ENST00000437635	T	0.70282	-0.47	4.68	0.901	0.19284	.	0.749679	0.11954	N	0.513411	T	0.34424	0.0897	L	0.35414	1.06	0.09310	N	0.999999	B	0.20052	0.041	B	0.20184	0.028	T	0.26573	-1.0099	10	0.30078	T	0.28	-29.2539	7.4082	0.27004	0.3706:0.0:0.6294:0.0	.	426	P0C671	CF222_HUMAN	L	426	ENSP00000418983:P426L	ENSP00000418983:P426L	P	-	2	0	C6orf222	36399242	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.373000	0.20484	0.027000	0.15297	-0.136000	0.14681	CCA	C6orf222	-	NULL	ENSG00000189325		0.537	C6orf222-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf222	HGNC	protein_coding	OTTHUMT00000040338.2	-	0.00	68	0	G	NM_001010903		36291264	-1	tier1	-	no_errors	ENST00000437635	ensembl	human	known	74_37	missense	13.33	52	8	SNP	0.000	A
CACNA1C	775	genome.wustl.edu	37	12	2787022	2787022	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:2787022G>A	ENST00000347598.4	+	43	5224	c.5224G>A	c.(5224-5226)Gac>Aac	p.D1742N	CACNA1C_ENST00000399644.1_Missense_Mutation_p.D1694N|CACNA1C_ENST00000399629.1_Missense_Mutation_p.D1711N|CACNA1C_ENST00000399601.1_Missense_Mutation_p.D1694N|CACNA1C_ENST00000327702.7_Missense_Mutation_p.D1694N|CACNA1C_ENST00000399591.1_Missense_Mutation_p.D1702N|CACNA1C_ENST00000399634.1_Missense_Mutation_p.D1694N|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399637.1_Missense_Mutation_p.D1713N|CACNA1C_ENST00000399603.1_Missense_Mutation_p.D1694N|CACNA1C_ENST00000344100.3_Missense_Mutation_p.D1735N|CACNA1C_ENST00000399655.1_Missense_Mutation_p.D1694N|CACNA1C_ENST00000399595.1_Missense_Mutation_p.D1702N|CACNA1C_ENST00000399606.1_Missense_Mutation_p.D1714N|CACNA1C_ENST00000399641.1_Missense_Mutation_p.D1694N|CACNA1C_ENST00000402845.3_Missense_Mutation_p.D1713N|CACNA1C_ENST00000399638.1_Missense_Mutation_p.D1722N|CACNA1C_ENST00000399649.1_Missense_Mutation_p.D1700N|CACNA1C_ENST00000399617.1_Missense_Mutation_p.D1694N|CACNA1C_ENST00000406454.3_Missense_Mutation_p.D1694N|CACNA1C_ENST00000335762.5_Missense_Mutation_p.D1719N|CACNA1C_ENST00000399621.1_Missense_Mutation_p.D1713N|CACNA1C_ENST00000399597.1_Missense_Mutation_p.D1694N	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1742					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TTCTGAAGATGACATCTTCAG	0.592																																																	0													62.0	68.0	66.0					12																	2787022		2113	4232	6345	SO:0001583	missense	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.5224G>A	12.37:g.2787022G>A	ENSP00000266376:p.Asp1742Asn		B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.D1694N	ENST00000347598.4	37	c.5080	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.229976	0.79688	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.96459	-3.96;-3.97;-3.97;-3.94;-3.97;-3.99;-3.88;-3.91;-3.97;-3.87;-3.9;-3.97;-4.01;-3.88;-3.87;-4.02;-3.98;-3.97;-4.01;-3.97;-4.01;-4.02	4.48	4.48	0.54585	.	7739.210000	0.00166	N	0.000001	D	0.98311	0.9440	M	0.71581	2.175	0.80722	D	1	P;P;P;B;P;P;P;P;B;B;P;P;P;P;P;P;D;B;D;B;P;P;P;P;P	0.71674	0.882;0.95;0.787;0.389;0.915;0.912;0.825;0.95;0.159;0.278;0.95;0.787;0.683;0.913;0.792;0.766;0.998;0.024;0.971;0.209;0.873;0.95;0.95;0.894;0.634	P;P;B;B;P;P;B;P;B;B;P;B;B;P;B;P;D;B;P;B;B;P;P;P;B	0.78314	0.76;0.447;0.273;0.065;0.544;0.628;0.342;0.628;0.142;0.098;0.628;0.273;0.3;0.628;0.255;0.493;0.991;0.026;0.628;0.098;0.273;0.628;0.628;0.521;0.23	D	0.91643	0.5328	10	0.45353	T	0.12	.	17.3387	0.87289	0.0:0.0:1.0:0.0	.	385;1735;1691;1742;1694;1713;1694;1711;1722;1694;1714;1694;1654;1742;1694;1694;1694;1702;1700;1702;1683;1713;1713;1694;1694	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	N	1719;1694;1694;1722;1694;1713;1713;1702;1694;1742;1714;1694;1735;1711;1694;1700;1713;1694;1694;1694;1694;1702;1524	ENSP00000336982:D1719N;ENSP00000382563:D1694N;ENSP00000382552:D1694N;ENSP00000382547:D1722N;ENSP00000382506:D1694N;ENSP00000382530:D1713N;ENSP00000382546:D1713N;ENSP00000382500:D1702N;ENSP00000382549:D1694N;ENSP00000266376:D1742N;ENSP00000382515:D1714N;ENSP00000382510:D1694N;ENSP00000341092:D1735N;ENSP00000382537:D1711N;ENSP00000329877:D1694N;ENSP00000382557:D1700N;ENSP00000385724:D1713N;ENSP00000382512:D1694N;ENSP00000382542:D1694N;ENSP00000382526:D1694N;ENSP00000385896:D1694N;ENSP00000382504:D1702N	ENSP00000323129:D1524N	D	+	1	0	CACNA1C	2657283	1.000000	0.71417	0.991000	0.47740	0.670000	0.39368	9.579000	0.98204	2.332000	0.79248	0.313000	0.20887	GAC	CACNA1C	-	NULL	ENSG00000151067		0.592	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	-	0.00	41	0	G	NM_000719		2787022	+1	tier1	-	no_errors	ENST00000399634	ensembl	human	known	74_37	missense	11.48	54	7	SNP	1.000	A
CACNG8	59283	genome.wustl.edu	37	19	54485522	54485522	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:54485522G>C	ENST00000270458.2	+	4	800	c.697G>C	c.(697-699)Gag>Cag	p.E233Q	MIR935_ENST00000401179.1_RNA	NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	233					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		GCGCAGCCGCGAGGCGCACTG	0.687																																																	0													28.0	22.0	24.0					19																	54485522		2195	4295	6490	SO:0001583	missense	0			AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.697G>C	19.37:g.54485522G>C	ENSP00000270458:p.Glu233Gln		Q9BXT0|Q9BY23	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu,prints_VDCC_g8su,prints_Claudin	p.E233Q	ENST00000270458.2	37	c.697	CCDS33104.1	19	.	.	.	.	.	.	.	.	.	.	.	15.23	2.772882	0.49680	.	.	ENSG00000142408	ENST00000270458	T	0.48836	0.8	1.82	1.82	0.25136	.	0.077548	0.49305	U	0.000149	T	0.47948	0.1473	L	0.28054	0.825	0.31938	N	0.611278	D	0.76494	0.999	D	0.69307	0.963	T	0.55341	-0.8156	9	0.29301	T	0.29	.	9.2411	0.37498	0.0:0.0:1.0:0.0	.	233	Q8WXS5	CCG8_HUMAN	Q	233	ENSP00000270458:E233Q	ENSP00000270458:E233Q	E	+	1	0	CACNG8	59177334	0.980000	0.34600	1.000000	0.80357	0.985000	0.73830	1.468000	0.35332	0.998000	0.38996	0.281000	0.19383	GAG	CACNG8	-	prints_VDCC_g8su	ENSG00000142408		0.687	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	CACNG8	HGNC	protein_coding	OTTHUMT00000139361.3	-	0.00	61	0	G			54485522	+1	tier1	-	no_errors	ENST00000270458	ensembl	human	known	74_37	missense	20.55	58	15	SNP	1.000	C
CACYBP	27101	genome.wustl.edu	37	1	174979138	174979138	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:174979138G>A	ENST00000367679.2	+	6	1058	c.610G>A	c.(610-612)Gat>Aat	p.D204N	MRPS14_ENST00000498253.1_5'Flank|CACYBP_ENST00000367681.2_Missense_Mutation_p.D161N|CACYBP_ENST00000405362.1_Missense_Mutation_p.D161N	NM_014412.2	NP_055227.1	Q9HB71	CYBP_HUMAN	calcyclin binding protein	204	Interaction with S100A6. {ECO:0000250}.|Interaction with SKP1.|SGS. {ECO:0000255|PROSITE- ProRule:PRU00386}.				aging (GO:0007568)|cardiac muscle cell differentiation (GO:0055007)|cellular response to calcium ion (GO:0071277)|negative regulation of cell death (GO:0060548)|positive regulation of DNA replication (GO:0045740)|response to growth hormone (GO:0060416)	beta-catenin destruction complex (GO:0030877)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(1)|prostate(1)	11						AGATGGAGACGATGATATGAA	0.383																																																	0													97.0	94.0	95.0					1																	174979138		2203	4300	6503	SO:0001583	missense	0			BC022352	CCDS1315.1, CCDS30942.1	1q24-q25	2008-02-05			ENSG00000116161	ENSG00000116161			30423	protein-coding gene	gene with protein product		606186				11389839, 12421809	Standard	XM_005245092		Approved	SIP, S100A6BP	uc001gkj.1	Q9HB71	OTTHUMG00000034941	ENST00000367679.2:c.610G>A	1.37:g.174979138G>A	ENSP00000356652:p.Asp204Asn		B2ZWH2|B3KSF1|O60666|Q5R370|Q5R371	Missense_Mutation	SNP	pfam_Siah-Interact_N,pfam_CS_dom,pfam_SGS,superfamily_HSP20-like_chaperone,pfscan_CS_dom,pfscan_SGS	p.D204N	ENST00000367679.2	37	c.610	CCDS1315.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.560342	0.96527	.	.	ENSG00000116161	ENST00000367681;ENST00000450101;ENST00000367679;ENST00000405362	.	.	.	5.89	5.89	0.94794	SGS (2);	0.000000	0.85682	D	0.000000	D	0.86251	0.5888	M	0.90483	3.12	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87919	0.2702	9	0.87932	D	0	-22.5047	20.2561	0.98419	0.0:0.0:1.0:0.0	.	204	Q9HB71	CYBP_HUMAN	N	161;177;204;161	.	ENSP00000356652:D204N	D	+	1	0	CACYBP	173245761	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.296000	0.96104	2.797000	0.96272	0.563000	0.77884	GAT	CACYBP	-	pfam_SGS,pfscan_SGS	ENSG00000116161		0.383	CACYBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACYBP	HGNC	protein_coding	OTTHUMT00000084583.3	-	0.00	47	0	G	NM_014412		174979138	+1	tier1	-	no_errors	ENST00000367679	ensembl	human	known	74_37	missense	17.78	37	8	SNP	1.000	A
CARS	833	genome.wustl.edu	37	11	3028157	3028157	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:3028157G>A	ENST00000397111.5	-	18	2097	c.1852C>T	c.(1852-1854)Cgg>Tgg	p.R618W	CARS_ENST00000470221.2_5'UTR|CARS_ENST00000278224.9_Missense_Mutation_p.R618W|CARS_ENST00000401769.3_Missense_Mutation_p.R631W|CARS_ENST00000380525.4_Missense_Mutation_p.R701W|CARS_ENST00000397114.3_Missense_Mutation_p.R608W			P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase	618					cysteinyl-tRNA aminoacylation (GO:0006423)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|cysteine-tRNA ligase activity (GO:0004817)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)		CARS/ALK(5)	central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)	31		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	ATGTTGTCCCGCAGGGCATCG	0.587			T	ALK	ALCL																																Ovarian(61;932 1157 5961 20446 52152)			Dom	yes		11	11p15.5	833	cysteinyl-tRNA synthetase		L	0													161.0	154.0	157.0					11																	3028157		2202	4298	6500	SO:0001583	missense	0			AF288207	CCDS7742.1, CCDS41600.1, CCDS41602.1	11p15.5	2011-07-01			ENSG00000110619	ENSG00000110619	6.1.1.16	"""Aminoacyl tRNA synthetases / Class I"""	1493	protein-coding gene	gene with protein product	"""cysteine tRNA ligase 1, cytoplasmic"""	123859				8468064	Standard	NM_139273		Approved	CARS1	uc001lxf.3	P49589	OTTHUMG00000010927	ENST00000397111.5:c.1852C>T	11.37:g.3028157G>A	ENSP00000380300:p.Arg618Trp		Q53XI8|Q5HYE4|Q9HD24|Q9HD25	Missense_Mutation	SNP	pfam_Cys-tRNA/MSH_ligase,pfam_Methionyl/Leucyl_tRNA_Synth,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Glutathione-S-Trfase_C-like,prints_Cys-tRNA/MSH_ligase,tigrfam_Cys-tRNA-ligase	p.R701W	ENST00000397111.5	37	c.2101	CCDS7742.1	11	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614420	0.46631	.	.	ENSG00000110619	ENST00000380525;ENST00000397111;ENST00000278224;ENST00000397114;ENST00000401769	T;T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61;-0.61	4.42	3.49	0.39957	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.071181	0.56097	D	0.000025	D	0.86810	0.6022	M	0.93978	3.48	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.998;0.996;0.999;0.999;0.996	D	0.89228	0.3575	10	0.87932	D	0	-24.9277	12.2761	0.54735	0.0:0.0:0.8307:0.1693	.	631;701;618;618;701;608	B4DKY1;B4DPV7;P49589;P49589-2;Q5HYE4;A8MVQ3	.;.;SYCC_HUMAN;.;.;.	W	701;618;618;608;631	ENSP00000369897:R701W;ENSP00000380300:R618W;ENSP00000278224:R618W;ENSP00000380303:R608W;ENSP00000384069:R631W	ENSP00000278224:R618W	R	-	1	2	CARS	2984733	1.000000	0.71417	0.999000	0.59377	0.161000	0.22273	2.739000	0.47409	1.051000	0.40369	0.462000	0.41574	CGG	CARS	-	superfamily_tRNAsynth_1a_anticodon-bd,tigrfam_Cys-tRNA-ligase	ENSG00000110619		0.587	CARS-001	KNOWN	basic|CCDS	protein_coding	CARS	HGNC	protein_coding	OTTHUMT00000030117.4	-	0.00	22	0	G	NM_001751		3028157	-1	tier1	-	no_errors	ENST00000380525	ensembl	human	known	74_37	missense	18.75	13	3	SNP	1.000	A
CBX8	57332	genome.wustl.edu	37	17	77770322	77770322	+	Silent	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:77770322G>C	ENST00000269385.4	-	2	204	c.87C>G	c.(85-87)ctC>ctG	p.L29L	CBX8_ENST00000485449.1_Intron	NM_020649.2	NP_065700.1	Q9HC52	CBX8_HUMAN	chromobox homolog 8	29	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.				histone ubiquitination (GO:0016574)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	methylated histone binding (GO:0035064)|single-stranded RNA binding (GO:0003727)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|stomach(1)	14			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			TCCATTTCACGAGGTATTCCA	0.463																																																	0													154.0	134.0	141.0					17																	77770322		2203	4300	6503	SO:0001819	synonymous_variant	0			AF174482	CCDS11765.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141570	ENSG00000141570			15962	protein-coding gene	gene with protein product	"""polycomb 3"", ""Pc class 3 homolog (Drosophila)"""		"""chromobox homolog 8 (Drosophila Pc class)"""			10825164	Standard	NM_020649		Approved	RC1, HPC3, PC3	uc002jxd.2	Q9HC52	OTTHUMG00000150416	ENST00000269385.4:c.87C>G	17.37:g.77770322G>C			Q96H39|Q9NR07	Silent	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	p.L29	ENST00000269385.4	37	c.87	CCDS11765.1	17																																																																																			CBX8	-	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,pfscan_Chromo_domain/shadow	ENSG00000141570		0.463	CBX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX8	HGNC	protein_coding	OTTHUMT00000318011.1	-	0.00	40	0	G	NM_020649		77770322	-1	tier1	-	no_errors	ENST00000269385	ensembl	human	known	74_37	silent	10.53	34	4	SNP	1.000	C
CCDC151	115948	genome.wustl.edu	37	19	11537020	11537020	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:11537020C>G	ENST00000356392.4	-	7	994	c.907G>C	c.(907-909)Gag>Cag	p.E303Q	CCDC151_ENST00000591179.1_Missense_Mutation_p.E243Q|CCDC151_ENST00000545100.1_Missense_Mutation_p.E249Q|CCDC151_ENST00000586836.1_Missense_Mutation_p.E112Q	NM_145045.4	NP_659482.3	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151	303										endometrium(2)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)	12						TTCTTGCACTCACTTATGTAG	0.632																																																	0													45.0	47.0	46.0					19																	11537020		2003	4176	6179	SO:0001583	missense	0				CCDS42501.1	19p13.2	2014-02-20				ENSG00000198003			28303	protein-coding gene	gene with protein product		615956				24067530	Standard	NM_145045		Approved	MGC20983	uc002mrs.3	A5D8V7		ENST00000356392.4:c.907G>C	19.37:g.11537020C>G	ENSP00000348757:p.Glu303Gln		B4DXT0|Q96CG5	Missense_Mutation	SNP	NULL	p.E303Q	ENST00000356392.4	37	c.907	CCDS42501.1	19	.	.	.	.	.	.	.	.	.	.	C	13.36	2.212768	0.39102	.	.	ENSG00000198003	ENST00000545100;ENST00000356392;ENST00000543934	D;D	0.84298	-1.83;-1.83	4.46	4.46	0.54185	.	0.684758	0.15174	N	0.276495	D	0.88299	0.6399	L	0.58669	1.825	0.09310	N	0.999995	D;D;D	0.61080	0.989;0.989;0.989	P;P;P	0.58266	0.836;0.836;0.836	T	0.79783	-0.1658	10	0.32370	T	0.25	-16.6016	12.9572	0.58434	0.0:1.0:0.0:0.0	.	303;303;283	B3KPH7;A5D8V7;B4DG09	.;CC151_HUMAN;.	Q	249;303;282	ENSP00000442987:E249Q;ENSP00000348757:E303Q	ENSP00000348757:E303Q	E	-	1	0	CCDC151	11398020	0.598000	0.26882	0.323000	0.25347	0.064000	0.16182	2.408000	0.44574	2.187000	0.69744	0.561000	0.74099	GAG	CCDC151	-	NULL	ENSG00000198003		0.632	CCDC151-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC151	HGNC	protein_coding	OTTHUMT00000458800.1	-	0.00	69	0	C	NM_145045		11537020	-1	tier1	-	no_errors	ENST00000356392	ensembl	human	known	74_37	missense	14.55	47	8	SNP	0.415	G
CCDC37	348807	genome.wustl.edu	37	3	126139001	126139001	+	Silent	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:126139001G>C	ENST00000352312.1	+	11	1110	c.1011G>C	c.(1009-1011)cgG>cgC	p.R337R	CCDC37_ENST00000505024.1_Silent_p.R338R|CCDC37_ENST00000393425.1_Silent_p.R338R	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	337										NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		GGCTGGGGCGGAGCCCGTCTT	0.647																																																	0													23.0	25.0	24.0					3																	126139001		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.1011G>C	3.37:g.126139001G>C			D3DNA8|Q494V1|Q494V4|Q8N838	Silent	SNP	superfamily_SuperAg_toxin_C	p.R338	ENST00000352312.1	37	c.1014	CCDS3037.1	3																																																																																			CCDC37	-	NULL	ENSG00000163885		0.647	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	CCDC37	HGNC	protein_coding	OTTHUMT00000370099.4	-	0.00	57	0	G	NM_182628		126139001	+1	tier1	-	no_errors	ENST00000393425	ensembl	human	known	74_37	silent	24.05	60	19	SNP	0.000	C
CCDC91	55297	genome.wustl.edu	37	12	28515424	28515424	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:28515424C>T	ENST00000545336.1	+	10	1049	c.630C>T	c.(628-630)ctC>ctT	p.L210L	CCDC91_ENST00000540401.1_3'UTR|CCDC91_ENST00000306172.5_Silent_p.L180L|CCDC91_ENST00000381256.1_Silent_p.L210L|CCDC91_ENST00000539107.1_Silent_p.L210L|CCDC91_ENST00000381259.1_Silent_p.L210L			Q7Z6B0	CCD91_HUMAN	coiled-coil domain containing 91	210	Homodimerization.				protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|skin(1)	22	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					ACGAAGCCCTCAGCATTATTG	0.333																																																	0													113.0	118.0	117.0					12																	28515424		2203	4300	6503	SO:0001819	synonymous_variant	0			AK093152	CCDS8716.1	12p11.22	2006-03-17				ENSG00000123106			24855	protein-coding gene	gene with protein product	"""GGA binding partner"""					12808037	Standard	XM_005253413		Approved	p56, FLJ11088, DKFZp779L1558	uc001riq.3	Q7Z6B0		ENST00000545336.1:c.630C>T	12.37:g.28515424C>T			B3KSA3|C9JR07|Q68D43|Q6IA78|Q8NEN7|Q9NUW9	Silent	SNP	NULL	p.L210	ENST00000545336.1	37	c.630	CCDS8716.1	12																																																																																			CCDC91	-	NULL	ENSG00000123106		0.333	CCDC91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC91	HGNC	protein_coding	OTTHUMT00000402447.1	-	0.00	23	0	C	NM_018318		28515424	+1	tier1	-	no_errors	ENST00000381259	ensembl	human	known	74_37	silent	26.00	37	13	SNP	0.995	T
CCNJL	79616	genome.wustl.edu	37	5	159766534	159766534	+	5'UTR	SNP	A	A	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:159766534A>T	ENST00000377503.2	-	0	123				CCNJL_ENST00000505287.2_5'Flank			Q8IV13	CCNJL_HUMAN	cyclin J-like							nucleus (GO:0005634)				endometrium(2)|kidney(5)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTCATTTTCCAAATCTTTGTC	0.358																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC013353	CCDS4350.2	5q33.3	2008-10-31			ENSG00000135083	ENSG00000135083			25876	protein-coding gene	gene with protein product						12477932	Standard	XM_005265982		Approved	FLJ14166	uc003lyb.1	Q8IV13	OTTHUMG00000130325	ENST00000377503.2:c.-3319T>A	5.37:g.159766534A>T			Q6ZN43|Q9H7W8	RNA	SNP	-	NULL	ENST00000377503.2	37	NULL		5																																																																																			CCNJL	-	-	ENSG00000135083		0.358	CCNJL-004	KNOWN	basic	processed_transcript	CCNJL	HGNC	protein_coding	OTTHUMT00000374064.2	-	0.00	52	0	A	NM_024565		159766534	-1	tier1	-	no_errors	ENST00000377503	ensembl	human	known	74_37	rna	6.25	60	4	SNP	0.479	T
CCT4	10575	genome.wustl.edu	37	2	62099446	62099446	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:62099446A>G	ENST00000394440.3	-	12	1558	c.1262T>C	c.(1261-1263)cTt>cCt	p.L421P	CCT4_ENST00000544185.1_Missense_Mutation_p.L271P|CCT4_ENST00000538252.1_Missense_Mutation_p.L365P|CCT4_ENST00000544079.1_Missense_Mutation_p.L391P|AC107081.5_ENST00000425779.1_RNA|CCT4_ENST00000461540.2_Intron	NM_006430.3	NP_006421.2	P50991	TCPD_HUMAN	chaperonin containing TCP1, subunit 4 (delta)	421					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(6)|ovary(2)	11	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;6.5e-06)|Epithelial(17;0.0647)|all cancers(80;0.221)			TCCTGCAATAAGAGCCCTGAA	0.308																																																	0													31.0	31.0	31.0					2																	62099446		2203	4300	6503	SO:0001583	missense	0				CCDS33206.1, CCDS58711.1	2p15	2011-09-02			ENSG00000115484	ENSG00000115484		"""Heat Shock Proteins / Chaperonins"""	1617	protein-coding gene	gene with protein product		605142				9819444	Standard	NM_001256721		Approved	Cctd	uc002sbo.4	P50991	OTTHUMG00000152166	ENST00000394440.3:c.1262T>C	2.37:g.62099446A>G	ENSP00000377958:p.Leu421Pro		B2R6I3|B7Z8B1|F5H5W3|O14870|Q53QP9|Q96C51	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,superfamily_GroEL-like_apical_dom,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_delta	p.L421P	ENST00000394440.3	37	c.1262	CCDS33206.1	2	.	.	.	.	.	.	.	.	.	.	A	21.0	4.080246	0.76528	.	.	ENSG00000115484	ENST00000394440;ENST00000544079;ENST00000544185;ENST00000538252	T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.93618	0.7962	H	0.98594	4.275	0.80722	D	1	D;D	0.65815	0.993;0.995	D;D	0.71870	0.943;0.975	D	0.95970	0.8969	10	0.87932	D	0	-10.8348	15.3121	0.74042	1.0:0.0:0.0:0.0	.	391;421	F5H5W3;P50991	.;TCPD_HUMAN	P	421;391;271;365	ENSP00000377958:L421P;ENSP00000443061:L391P;ENSP00000443451:L271P;ENSP00000442174:L365P	ENSP00000377958:L421P	L	-	2	0	CCT4	61952950	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.253000	0.95501	2.156000	0.67533	0.533000	0.62120	CTT	CCT4	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_delta	ENSG00000115484		0.308	CCT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT4	HGNC	protein_coding	OTTHUMT00000325548.2	-	0.00	43	0	A			62099446	-1	tier1	-	no_errors	ENST00000394440	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	G
CD97	976	genome.wustl.edu	37	19	14513415	14513415	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:14513415C>T	ENST00000242786.5	+	12	1270	c.1190C>T	c.(1189-1191)gCc>gTc	p.A397V	CD97_ENST00000358600.3_Missense_Mutation_p.A304V|CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000357355.3_Missense_Mutation_p.A348V	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	397					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CCAGGCCCCGCCGTGGCGGGC	0.582																																																	0													81.0	82.0	82.0					19																	14513415		2203	4300	6503	SO:0001583	missense	0				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1190C>T	19.37:g.14513415C>T	ENSP00000242786:p.Ala397Val		A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd_dom,pfam_GPS_dom,pfam_EG-like_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_secretin-like,prints_GPCR_2_EMR1_rcpt	p.A397V	ENST00000242786.5	37	c.1190	CCDS32929.1	19	.	.	.	.	.	.	.	.	.	.	C	16.55	3.154102	0.57259	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.71934	-0.61;-0.53;-0.15	5.25	3.04	0.35103	.	.	.	.	.	T	0.64227	0.2579	L	0.55481	1.735	0.09310	N	1	P;P;B	0.40398	0.716;0.716;0.178	B;B;B	0.43082	0.407;0.407;0.197	T	0.49716	-0.8910	9	0.18710	T	0.47	.	6.4511	0.21903	0.1793:0.7272:0.0:0.0935	.	304;348;397	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	V	397;348;304;347	ENSP00000242786:A397V;ENSP00000349918:A348V;ENSP00000351413:A304V	ENSP00000242786:A397V	A	+	2	0	CD97	14374415	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.477000	0.22196	0.545000	0.28902	0.555000	0.69702	GCC	CD97	-	NULL	ENSG00000123146		0.582	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	HGNC	protein_coding	OTTHUMT00000459821.2	-	0.00	32	0	C	NM_078481		14513415	+1	tier1	-	no_errors	ENST00000242786	ensembl	human	known	74_37	missense	16.00	21	4	SNP	0.001	T
CDC40	51362	genome.wustl.edu	37	6	110501659	110501659	+	Silent	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:110501659G>T	ENST00000368932.1	+	2	113	c.12G>T	c.(10-12)gcG>gcT	p.A4A	WASF1_ENST00000392588.1_5'Flank|WASF1_ENST00000392587.2_5'Flank|WASF1_ENST00000392589.1_5'Flank|WASF1_ENST00000392586.1_5'Flank|CDC40_ENST00000368930.1_Silent_p.A4A|CDC40_ENST00000307731.1_Silent_p.A4A|WASF1_ENST00000359451.2_5'Flank			O60508	PRP17_HUMAN	cell division cycle 40	4					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TGTCGGCTGCGATTGCAGCTC	0.592																																																	0													52.0	50.0	50.0					6																	110501659		2203	4300	6503	SO:0001819	synonymous_variant	0			AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.12G>T	6.37:g.110501659G>T			B2RBC5|O75471|Q5SRN0|Q9UPG1	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A4	ENST00000368932.1	37	c.12	CCDS5081.1	6																																																																																			CDC40	-	NULL	ENSG00000168438		0.592	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC40	HGNC	protein_coding	OTTHUMT00000041791.1	-	0.00	20	0	G	NM_015891		110501659	+1	tier1	-	no_errors	ENST00000307731	ensembl	human	known	74_37	silent	41.94	18	13	SNP	0.784	T
CDC40	51362	genome.wustl.edu	37	6	110501702	110501702	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:110501702G>C	ENST00000368932.1	+	2	156	c.55G>C	c.(55-57)Gaa>Caa	p.E19Q	WASF1_ENST00000392588.1_5'Flank|WASF1_ENST00000392587.2_5'Flank|WASF1_ENST00000392589.1_5'Flank|WASF1_ENST00000392586.1_5'Flank|CDC40_ENST00000368930.1_Missense_Mutation_p.E19Q|CDC40_ENST00000307731.1_Missense_Mutation_p.E19Q|WASF1_ENST00000359451.2_5'Flank			O60508	PRP17_HUMAN	cell division cycle 40	19					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TTCAGGGTCCGAATCGGACTC	0.587																																																	0													61.0	58.0	59.0					6																	110501702		2203	4300	6503	SO:0001583	missense	0			AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.55G>C	6.37:g.110501702G>C	ENSP00000357928:p.Glu19Gln		B2RBC5|O75471|Q5SRN0|Q9UPG1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E19Q	ENST00000368932.1	37	c.55	CCDS5081.1	6	.	.	.	.	.	.	.	.	.	.	G	17.34	3.364548	0.61513	.	.	ENSG00000168438	ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731;ENST00000439165	T;T;T;T	0.61980	0.18;0.06;0.06;0.18	5.54	4.67	0.58626	.	0.143965	0.64402	D	0.000007	T	0.40932	0.1137	L	0.43152	1.355	0.58432	D	0.999991	B	0.22414	0.069	B	0.28011	0.085	T	0.40739	-0.9547	10	0.36615	T	0.2	-26.5964	13.1962	0.59740	0.0:0.0:0.8405:0.1595	.	19	O60508	PRP17_HUMAN	Q	19	ENSP00000357928:E19Q;ENSP00000357929:E19Q;ENSP00000357926:E19Q;ENSP00000304370:E19Q	ENSP00000304370:E19Q	E	+	1	0	CDC40	110608395	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.761000	0.62243	1.565000	0.49641	0.655000	0.94253	GAA	CDC40	-	NULL	ENSG00000168438		0.587	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC40	HGNC	protein_coding	OTTHUMT00000041791.1	-	0.00	28	0	G	NM_015891		110501702	+1	tier1	-	no_errors	ENST00000307731	ensembl	human	known	74_37	missense	41.18	20	14	SNP	1.000	C
CDH10	1008	genome.wustl.edu	37	5	24492981	24492981	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:24492981T>A	ENST00000264463.4	-	10	2076	c.1569A>T	c.(1567-1569)aaA>aaT	p.K523N	CDH10_ENST00000502921.1_5'UTR	NM_006727.3	NP_006718.2	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 (T2-cadherin)	523	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.K523N(1)		NS(1)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(29)|lung(111)|ovary(6)|pancreas(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)	185				STAD - Stomach adenocarcinoma(35;0.0556)		TGAAAAAAAATTTCTGTCCAC	0.318										HNSCC(23;0.051)																																							1	Substitution - Missense(1)	pancreas(1)											171.0	185.0	180.0					5																	24492981		2203	4297	6500	SO:0001583	missense	0			AF039747	CCDS3892.1	5p14.2	2010-01-26			ENSG00000040731	ENSG00000040731		"""Cadherins / Major cadherins"""	1749	protein-coding gene	gene with protein product		604555				2059658	Standard	NM_006727		Approved		uc003jgr.2	Q9Y6N8	OTTHUMG00000090667	ENST00000264463.4:c.1569A>T	5.37:g.24492981T>A	ENSP00000264463:p.Lys523Asn		Q9ULB3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.K523N	ENST00000264463.4	37	c.1569	CCDS3892.1	5	.	.	.	.	.	.	.	.	.	.	T	18.97	3.735924	0.69189	.	.	ENSG00000040731	ENST00000264463	T	0.51325	0.71	4.94	2.56	0.30785	Cadherin (4);Cadherin-like (1);	0.054335	0.64402	D	0.000002	T	0.52468	0.1736	M	0.78637	2.42	0.40025	D	0.975457	P	0.43909	0.821	P	0.47299	0.543	T	0.56366	-0.7991	10	0.62326	D	0.03	.	7.7647	0.28972	0.0:0.1777:0.0:0.8223	.	523	Q9Y6N8	CAD10_HUMAN	N	523	ENSP00000264463:K523N	ENSP00000264463:K523N	K	-	3	2	CDH10	24528738	0.994000	0.37717	1.000000	0.80357	0.982000	0.71751	0.285000	0.18883	0.849000	0.35215	0.477000	0.44152	AAA	CDH10	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000040731		0.318	CDH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH10	HGNC	protein_coding	OTTHUMT00000207345.2		0.00	23	0	T	NM_006727		24492981	-1			no_errors	ENST00000264463	ensembl	human	known	74_37	missense	7.41	50	4	SNP	1.000	A
CDK12	51755	genome.wustl.edu	37	17	37680952	37680952	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:37680952G>A	ENST00000447079.4	+	12	3154	c.3121G>A	c.(3121-3123)Gag>Aag	p.E1041K	CDK12_ENST00000430627.2_Missense_Mutation_p.E1041K	NM_015083.1|NM_016507.2	NP_055898.1|NP_057591.2	Q9NYV4	CDK12_HUMAN	cyclin-dependent kinase 12	1041					mRNA processing (GO:0006397)|phosphorylation of RNA polymerase II C-terminal domain (GO:0070816)|protein autophosphorylation (GO:0046777)|regulation of MAP kinase activity (GO:0043405)|RNA splicing (GO:0008380)	cyclin K-CDK12 complex (GO:0002944)|nuclear cyclin-dependent protein kinase holoenzyme complex (GO:0019908)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin binding (GO:0030332)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)			NS(4)|breast(3)|endometrium(5)|kidney(4)|large_intestine(11)|lung(23)|ovary(11)|prostate(4)|skin(2)|urinary_tract(3)	70						GGATTGCCATGAGTTGTGGAG	0.478			"""Mis, N, F"""		serous ovarian					TCGA Ovarian(9;0.13)																														Rec	yes		17	17q12	51755	cyclin-dependent kinase 12		E	0													83.0	84.0	84.0					17																	37680952		2203	4300	6503	SO:0001583	missense	0			AF227198	CCDS11337.1, CCDS45666.1	17q12	2011-10-25	2009-12-16	2009-12-16	ENSG00000167258	ENSG00000167258		"""Cyclin-dependent kinases"""	24224	protein-coding gene	gene with protein product	"""CDC2 related protein kinase 7"""	615514	"""Cdc2-related kinase, arginine/serine-rich"""	CRKRS		10048485, 11683387, 19884882	Standard	XM_005257456		Approved	CRK7, CRKR, KIAA0904	uc010cvv.3	Q9NYV4	OTTHUMG00000133214	ENST00000447079.4:c.3121G>A	17.37:g.37680952G>A	ENSP00000398880:p.Glu1041Lys		A7E2B2|B4DYX4|B9EIQ6|O94978	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom	p.E1041K	ENST00000447079.4	37	c.3121	CCDS11337.1	17	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663605	0.88251	.	.	ENSG00000167258	ENST00000430627;ENST00000447079	T;T	0.75154	-0.9;-0.91	4.98	4.98	0.66077	Protein kinase-like domain (1);	0.000000	0.44285	D	0.000461	D	0.84745	0.5540	M	0.62723	1.935	0.80722	D	1	D;D;D	0.71674	0.997;0.997;0.998	D;D;D	0.80764	0.985;0.985;0.994	D	0.86237	0.1641	10	0.87932	D	0	-14.3036	18.0521	0.89353	0.0:0.0:1.0:0.0	.	1040;1041;1041	E7EUM9;Q9NYV4;Q9NYV4-2	.;CDK12_HUMAN;.	K	1041	ENSP00000407720:E1041K;ENSP00000398880:E1041K	ENSP00000407720:E1041K	E	+	1	0	CDK12	34934478	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.657000	0.98554	2.591000	0.87537	0.563000	0.77884	GAG	CDK12	-	superfamily_Kinase-like_dom	ENSG00000167258		0.478	CDK12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDK12	HGNC	protein_coding	OTTHUMT00000256941.4	-	0.00	70	0	G	NM_016507		37680952	+1	tier1	-	no_errors	ENST00000447079	ensembl	human	known	74_37	missense	14.55	47	8	SNP	1.000	A
CEP95	90799	genome.wustl.edu	37	17	62525459	62525459	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:62525459C>G	ENST00000556440.2	+	12	1870	c.1360C>G	c.(1360-1362)Cca>Gca	p.P454A	CEP95_ENST00000553412.1_Missense_Mutation_p.P290A|CEP95_ENST00000577476.1_3'UTR|AC009994.2_ENST00000579926.1_RNA	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	454						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						CTCTCCATCTCCAGTTAACAA	0.458																																																	0													70.0	70.0	70.0					17																	62525459		1923	4143	6066	SO:0001583	missense	0			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.1360C>G	17.37:g.62525459C>G	ENSP00000450461:p.Pro454Ala		B4DMD2|Q96M81	Missense_Mutation	SNP	superfamily_CH-domain	p.P454A	ENST00000556440.2	37	c.1360	CCDS45763.1	17	.	.	.	.	.	.	.	.	.	.	C	9.504	1.103887	0.20632	.	.	ENSG00000258890	ENST00000553956;ENST00000556440;ENST00000553412	T;T	0.33438	1.41;1.42	5.48	4.51	0.55191	.	0.133731	0.50627	D	0.000119	T	0.27967	0.0689	L	0.53249	1.67	0.35048	D	0.760356	P	0.40431	0.717	B	0.41271	0.352	T	0.31110	-0.9955	10	0.14656	T	0.56	-7.4676	9.633	0.39791	0.0:0.9022:0.0:0.0978	.	454	Q96GE4	CEP95_HUMAN	A	389;454;290	ENSP00000450461:P454A;ENSP00000450906:P290A	ENSP00000438458:P389A	P	+	1	0	CEP95	59955921	0.948000	0.32251	0.996000	0.52242	0.089000	0.18198	2.069000	0.41481	1.421000	0.47157	0.655000	0.94253	CCA	CEP95	-	NULL	ENSG00000258890		0.458	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP95	HGNC	protein_coding	OTTHUMT00000445100.2	-	0.00	44	0	C	NM_138363		62525459	+1	tier1	-	no_errors	ENST00000556440	ensembl	human	known	74_37	missense	23.81	48	15	SNP	0.998	G
CFH	3075	genome.wustl.edu	37	1	196706631	196706631	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:196706631C>T	ENST00000367429.4	+	17	2863	c.2623C>T	c.(2623-2625)Cag>Tag	p.Q875*		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	875	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						ACAACCACCTCAGATAGAACA	0.308																																																	0													50.0	48.0	49.0					1																	196706631		2203	4300	6503	SO:0001587	stop_gained	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2623C>T	1.37:g.196706631C>T	ENSP00000356399:p.Gln875*		A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Nonsense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.Q875*	ENST00000367429.4	37	c.2623	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	.	38	7.067073	0.98040	.	.	ENSG00000000971	ENST00000367429	.	.	.	5.52	-6.09	0.02145	.	.	.	.	.	.	.	.	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	4.4254	0.11500	0.417:0.2747:0.2399:0.0683	.	.	.	.	X	875	.	ENSP00000356399:Q875X	Q	+	1	0	CFH	194973254	0.000000	0.05858	0.004000	0.12327	0.128000	0.20619	-1.146000	0.03191	-0.646000	0.05452	0.650000	0.86243	CAG	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.308	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2	-	0.00	47	0	C	NM_000186		196706631	+1	tier1	-	no_errors	ENST00000367429	ensembl	human	known	74_37	nonsense	18.03	50	11	SNP	0.001	T
CFHR2	3080	genome.wustl.edu	37	1	196927174	196927174	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:196927174G>A	ENST00000367415.5	+	4	684	c.584G>A	c.(583-585)gGa>gAa	p.G195E	CFHR2_ENST00000476712.2_Missense_Mutation_p.G179E|CFHR2_ENST00000367421.3_Missense_Mutation_p.G195E|CFHR2_ENST00000496448.1_3'UTR	NM_005666.2	NP_005657.1	P36980	FHR2_HUMAN	complement factor H-related 2	195	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					extracellular region (GO:0005576)				large_intestine(2)|ovary(1)|skin(3)	6						TGTAGAAACGGACAATGGTCA	0.373																																																	0													173.0	156.0	162.0					1																	196927174		2203	4300	6503	SO:0001583	missense	0			X64877	CCDS30959.1	1q31.3	2008-02-05	2004-08-09	2006-02-28	ENSG00000080910	ENSG00000080910		"""Complement system"""	4890	protein-coding gene	gene with protein product		600889	"""H factor (complement)-like 3"""	HFL3, CFHL2		1533657, 7672821	Standard	NM_005666		Approved	FHR2	uc001gtq.1	P36980	OTTHUMG00000036518	ENST00000367415.5:c.584G>A	1.37:g.196927174G>A	ENSP00000356385:p.Gly195Glu		Q14310|Q5T9T1	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.G195E	ENST00000367415.5	37	c.584	CCDS30959.1	1	.	.	.	.	.	.	.	.	.	.	.	20.2	3.955482	0.73902	.	.	ENSG00000080910	ENST00000367421;ENST00000367415	T;T	0.60424	0.19;0.19	4.14	4.14	0.48551	Complement control module (2);Sushi/SCR/CCP (3);	0.251419	0.20792	N	0.085598	T	0.81683	0.4874	H	0.95884	3.735	0.26244	N	0.978827	D;D	0.63046	0.992;0.992	D;D	0.64506	0.926;0.926	T	0.77542	-0.2549	10	0.72032	D	0.01	.	13.9049	0.63828	0.0:0.0:1.0:0.0	.	168;195	P36980-2;P36980	.;FHR2_HUMAN	E	195	ENSP00000356391:G195E;ENSP00000356385:G195E	ENSP00000356385:G195E	G	+	2	0	CFHR2	195193797	0.998000	0.40836	0.341000	0.25589	0.186000	0.23388	3.728000	0.54991	1.831000	0.53308	0.609000	0.83330	GGA	CFHR2	-	pfam_Sushi_SCR_CCP,superfamily_Sushi_SCR_CCP,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000080910		0.373	CFHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFHR2	HGNC	protein_coding	OTTHUMT00000088815.2	-	0.00	54	0	G	NM_005666		196927174	+1	tier1	-	no_errors	ENST00000367415	ensembl	human	known	74_37	missense	15.15	56	10	SNP	0.994	A
CHD7	55636	genome.wustl.edu	37	8	61778006	61778006	+	Silent	SNP	G	G	T	rs371399850		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr8:61778006G>T	ENST00000423902.2	+	38	8987	c.8508G>T	c.(8506-8508)ccG>ccT	p.P2836P	CHD7_ENST00000524602.1_Silent_p.P787P	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2836					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AAGGAGAACCGGAAGACAGCA	0.507																																																	0													74.0	75.0	75.0					8																	61778006		2005	4171	6176	SO:0001819	synonymous_variant	0			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.8508G>T	8.37:g.61778006G>T			D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P2836	ENST00000423902.2	37	c.8508	CCDS47865.1	8																																																																																			CHD7	-	NULL	ENSG00000171316		0.507	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	-	0.00	32	0	G	XM_098762		61778006	+1	tier1	-	no_errors	ENST00000423902	ensembl	human	known	74_37	silent	34.15	27	14	SNP	0.841	T
CLNK	116449	genome.wustl.edu	37	4	10492148	10492148	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:10492148C>T	ENST00000226951.6	-	19	1469	c.1230G>A	c.(1228-1230)agG>agA	p.R410R	CLNK_ENST00000515667.1_Silent_p.R148R	NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	410	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						GACACTGTTTCCTGTGGACCC	0.438																																					GBM(87;402 1286 6949 13902 35851)												0													118.0	131.0	127.0					4																	10492148		1994	4152	6146	SO:0001819	synonymous_variant	0			AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.1230G>A	4.37:g.10492148C>T			Q05C27|Q9P2U9	Silent	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.R410	ENST00000226951.6	37	c.1230	CCDS47024.1	4																																																																																			CLNK	-	pfscan_SH2	ENSG00000109684		0.438	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLNK	HGNC	protein_coding	OTTHUMT00000359047.1	-	0.00	65	0	C	NM_052964		10492148	-1	tier1	-	no_errors	ENST00000226951	ensembl	human	known	74_37	silent	27.12	43	16	SNP	0.907	T
CLUH	23277	genome.wustl.edu	37	17	2597225	2597225	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:2597225C>T	ENST00000570628.2	-	19	3188	c.3083G>A	c.(3082-3084)cGc>cAc	p.R1028H	CLUH_ENST00000435359.1_Missense_Mutation_p.R1028H|CLUH_ENST00000538975.1_Missense_Mutation_p.R1028H			O75153	CLU_HUMAN	clustered mitochondria (cluA/CLU1) homolog	1028					intracellular distribution of mitochondria (GO:0048312)	cytoplasm (GO:0005737)											GTAGTGGAGGCGGGCGAGGAG	0.632																																																	0													25.0	34.0	31.0					17																	2597225		2097	4211	6308	SO:0001583	missense	0			AB014564	CCDS45572.1	17p13.3	2012-12-18	2012-11-30	2012-11-30	ENSG00000132361	ENSG00000132361			29094	protein-coding gene	gene with protein product			"""KIAA0664"""	KIAA0664			Standard	XM_005256567		Approved	CLU1	uc002fuy.1	O75153	OTTHUMG00000177575	ENST00000570628.2:c.3083G>A	17.37:g.2597225C>T	ENSP00000458986:p.Arg1028His		Q6AHY2|Q6P3X7|Q6ZUG8|Q8N4U7|Q9BTA3|Q9H979	Missense_Mutation	SNP	superfamily_GSKIP_dom	p.R1028H	ENST00000570628.2	37	c.3083	CCDS45572.1	17	.	.	.	.	.	.	.	.	.	.	c	33	5.204791	0.95033	.	.	ENSG00000132361	ENST00000435359;ENST00000322335;ENST00000538975	T;T	0.63744	-0.06;-0.06	5.44	5.44	0.79542	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	D	0.82504	0.5051	M	0.86805	2.84	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.85335	0.1092	10	0.72032	D	0.01	.	18.2477	0.89992	0.0:1.0:0.0:0.0	.	1028;1029	O75153;C9J6D7	K0664_HUMAN;.	H	1028;1029;1028	ENSP00000388872:R1028H;ENSP00000439628:R1028H	ENSP00000320468:R1029H	R	-	2	0	KIAA0664	2543975	1.000000	0.71417	0.983000	0.44433	0.788000	0.44548	7.485000	0.81204	2.565000	0.86533	0.556000	0.70494	CGC	CLUH	-	NULL	ENSG00000132361		0.632	CLUH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLUH	HGNC	protein_coding	OTTHUMT00000437807.2	-	0.00	105	0	C	NM_015229		2597225	-1	tier1	-	no_errors	ENST00000435359	ensembl	human	known	74_37	missense	9.17	99	10	SNP	1.000	T
CMYA5	202333	genome.wustl.edu	37	5	79030935	79030935	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:79030935C>T	ENST00000446378.2	+	2	6378	c.6347C>T	c.(6346-6348)gCt>gTt	p.A2116V		NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2116					negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		ATTGATGATGCTGATGAGGGA	0.433																																																	0													65.0	63.0	64.0					5																	79030935		1909	4120	6029	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.6347C>T	5.37:g.79030935C>T	ENSP00000394770:p.Ala2116Val		A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.A2116V	ENST00000446378.2	37	c.6347	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	C	3.535	-0.094881	0.07010	.	.	ENSG00000164309	ENST00000446378	T	0.05025	3.51	5.94	-0.715	0.11215	.	0.765174	0.11503	N	0.557540	T	0.03739	0.0106	N	0.22421	0.69	0.09310	N	1	B	0.21905	0.062	B	0.22386	0.039	T	0.45789	-0.9237	10	0.24483	T	0.36	.	3.6302	0.08128	0.3707:0.3133:0.241:0.0751	.	2116	Q8N3K9	CMYA5_HUMAN	V	2116	ENSP00000394770:A2116V	ENSP00000394770:A2116V	A	+	2	0	CMYA5	79066691	0.002000	0.14202	0.000000	0.03702	0.038000	0.13279	0.318000	0.19504	-0.139000	0.11414	0.650000	0.86243	GCT	CMYA5	-	NULL	ENSG00000164309		0.433	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	-	0.00	37	0	C	NM_153610		79030935	+1	tier1	-	no_errors	ENST00000446378	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.000	T
CNTN4	152330	genome.wustl.edu	37	3	3067916	3067916	+	Silent	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:3067916G>C	ENST00000397461.1	+	14	2001	c.1617G>C	c.(1615-1617)ctG>ctC	p.L539L	CNTN4_ENST00000427331.1_Silent_p.L539L|CNTN4_ENST00000418658.1_Silent_p.L539L|CNTN4_ENST00000448906.2_Silent_p.L211L|CNTN4_ENST00000358480.3_Silent_p.L320L|CNTN4_ENST00000397459.2_Silent_p.L211L	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	539	Ig-like C2-type 6.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		ATGGACACCTGATAGACTTTG	0.408																																																	0													143.0	122.0	129.0					3																	3067916		2203	4300	6503	SO:0001819	synonymous_variant	0			AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.1617G>C	3.37:g.3067916G>C			B2RAX3|Q8IX14|Q8TC35	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.L539	ENST00000397461.1	37	c.1617	CCDS43041.1	3																																																																																			CNTN4	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000144619		0.408	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN4	HGNC	protein_coding	OTTHUMT00000239236.2	-	0.00	59	0	G			3067916	+1	tier1	-	no_errors	ENST00000397461	ensembl	human	known	74_37	silent	30.00	35	15	SNP	1.000	C
COASY	80347	genome.wustl.edu	37	17	40717518	40717518	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:40717518G>A	ENST00000393818.2	+	7	1873	c.1417G>A	c.(1417-1419)Gtg>Atg	p.V473M	MLX_ENST00000346833.4_5'Flank|COASY_ENST00000420359.1_Missense_Mutation_p.V473M|COASY_ENST00000590958.1_Missense_Mutation_p.V502M|MLX_ENST00000435881.2_5'Flank|COASY_ENST00000421097.2_Missense_Mutation_p.V473M|COASY_ENST00000449624.1_Missense_Mutation_p.V178M|MLX_ENST00000246912.4_5'Flank	NM_025233.6	NP_079509.5	Q13057	COASY_HUMAN	CoA synthase	473	DPCK.				cell death (GO:0008219)|coenzyme A biosynthetic process (GO:0015937)|coenzyme biosynthetic process (GO:0009108)|pantothenate metabolic process (GO:0015939)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|dephospho-CoA kinase activity (GO:0004140)|pantetheine-phosphate adenylyltransferase activity (GO:0004595)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	21		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		TGATGCCGCTGTGTTGCTTGA	0.607																																																	0													149.0	121.0	131.0					17																	40717518		2203	4300	6503	SO:0001583	missense	0			AF453478	CCDS11429.1, CCDS45685.1	17q12-q21	2010-04-30	2010-04-30			ENSG00000068120	2.7.7.3		29932	protein-coding gene	gene with protein product		609855	"""Coenzyme A synthase"""			11923312, 11980892	Standard	NM_025233		Approved	DPCK, NBP, CoASY, PPAT	uc010cyj.4	Q13057		ENST00000393818.2:c.1417G>A	17.37:g.40717518G>A	ENSP00000377406:p.Val473Met		B2RA78|B4DLU0|Q6GS23|Q8NBM7|Q8NEW1|Q8WXD4|Q9NRM3	Missense_Mutation	SNP	pfam_Depp_CoAkinase,pfam_Cyt_trans-like,superfamily_P-loop_NTPase,tigrfam_Depp_CoAkinase	p.V502M	ENST00000393818.2	37	c.1504	CCDS11429.1	17	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454172	0.43634	.	.	ENSG00000068120	ENST00000421097;ENST00000449624;ENST00000420359;ENST00000393818	T;T;T	0.42900	0.96;0.96;0.96	5.6	-4.05	0.03998	.	0.445385	0.26286	N	0.025255	T	0.50051	0.1593	M	0.90595	3.13	0.32510	N	0.537694	B;P	0.37083	0.251;0.581	B;P	0.48089	0.155;0.566	T	0.54125	-0.8340	10	0.34782	T	0.22	-7.9485	4.6822	0.12741	0.2948:0.1088:0.4771:0.1192	.	502;473	Q13057-2;Q13057	.;COASY_HUMAN	M	502;178;473;473	ENSP00000407740:V178M;ENSP00000413338:V473M;ENSP00000377406:V473M	ENSP00000377406:V473M	V	+	1	0	COASY	37971044	0.059000	0.20769	0.826000	0.32828	0.748000	0.42578	0.315000	0.19451	-0.419000	0.07439	-0.459000	0.05422	GTG	COASY	-	pfam_Depp_CoAkinase,superfamily_P-loop_NTPase,tigrfam_Depp_CoAkinase	ENSG00000068120		0.607	COASY-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	COASY	HGNC	protein_coding	OTTHUMT00000450409.1	-	0.00	30	0	G	NM_025233		40717518	+1	tier1	-	no_errors	ENST00000590958	ensembl	human	known	74_37	missense	9.09	40	4	SNP	0.403	A
COG4	25839	genome.wustl.edu	37	16	70524289	70524289	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:70524289G>T	ENST00000323786.5	-	13	1675	c.1654C>A	c.(1654-1656)Ctg>Atg	p.L552M		NM_001195139.1|NM_015386.2	NP_001182068.1|NP_056201.2	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	548					Golgi organization (GO:0007030)|Golgi vesicle prefusion complex stabilization (GO:0048213)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.L552L(1)		breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|pancreas(1)|prostate(2)	33		Ovarian(137;0.0694)				ACGTTGTTCAGAGTCACCTGG	0.527																																																	1	Substitution - coding silent(1)	large_intestine(1)											167.0	133.0	145.0					16																	70524289		2198	4300	6498	SO:0001583	missense	0			AL050101	CCDS10892.2, CCDS73909.1	16q22.1	2013-09-20			ENSG00000103051	ENSG00000103051		"""Components of oligomeric golgi complex"""	18620	protein-coding gene	gene with protein product		606976				11980916	Standard	NM_015386		Approved	COD1, DKFZP586E1519	uc002ezc.3	Q9H9E3	OTTHUMG00000128515	ENST00000323786.5:c.1654C>A	16.37:g.70524289G>T	ENSP00000315775:p.Leu552Met		B4DMN8|C9JS23|Q96D40|Q9BRF0|Q9BVZ2|Q9H5Y4|Q9Y3W3	Missense_Mutation	SNP	pfam_COG_su4,smart_COG_su4	p.L552M	ENST00000323786.5	37	c.1654	CCDS10892.2	16	.	.	.	.	.	.	.	.	.	.	G	19.64	3.865602	0.71949	.	.	ENSG00000103051	ENST00000323786;ENST00000539961	T	0.59224	0.28	6.17	4.03	0.46877	.	0.000000	0.85682	D	0.000000	T	0.73666	0.3616	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.76038	-0.3105	10	0.72032	D	0.01	-10.42	7.8475	0.29435	0.1163:0.0:0.7134:0.1703	.	458;548	Q8N8L9;Q9H9E3	.;COG4_HUMAN	M	552;210	ENSP00000315775:L552M	ENSP00000315775:L552M	L	-	1	2	COG4	69081790	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	3.745000	0.55119	1.607000	0.50170	-0.181000	0.13052	CTG	COG4	-	NULL	ENSG00000103051		0.527	COG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG4	HGNC	protein_coding	OTTHUMT00000250326.3		0.00	41	0	G			70524289	-1			no_errors	ENST00000323786	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.990	T
COL23A1	91522	genome.wustl.edu	37	5	177733909	177733909	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:177733909G>A	ENST00000390654.3	-	3	730	c.373C>T	c.(373-375)Cgg>Tgg	p.R125W	COL23A1_ENST00000407622.1_Missense_Mutation_p.R98W	NM_173465.3	NP_775736.2	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1	125	Collagen-like 1.|Gly-rich.				collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		TTGCCGCGCCGTCCAGGGGGC	0.617																																																	0													20.0	25.0	23.0					5																	177733909		1945	4113	6058	SO:0001583	missense	0			AL137461	CCDS4436.1	5q35.3	2013-01-16			ENSG00000050767	ENSG00000050767		"""Collagens"""	22990	protein-coding gene	gene with protein product		610043				12644459	Standard	NM_173465		Approved	DKFZp434K0621	uc021yiz.1	Q86Y22	OTTHUMG00000130890	ENST00000390654.3:c.373C>T	5.37:g.177733909G>A	ENSP00000375069:p.Arg125Trp		Q8IVR4|Q9NT93	Missense_Mutation	SNP	pfam_Collagen	p.R125W	ENST00000390654.3	37	c.373	CCDS4436.1	5	.	.	.	.	.	.	.	.	.	.	G	15.06	2.722372	0.48728	.	.	ENSG00000050767	ENST00000390654;ENST00000407622	D;D	0.93659	-3.26;-3.26	3.2	3.2	0.36748	.	0.355912	0.20906	N	0.083543	D	0.95652	0.8586	M	0.73962	2.25	0.33908	D	0.63932	D	0.89917	1.0	D	0.83275	0.996	D	0.96519	0.9384	10	0.72032	D	0.01	-3.8587	10.2279	0.43236	0.0:0.0:1.0:0.0	.	125	Q86Y22	CONA1_HUMAN	W	125;98	ENSP00000375069:R125W;ENSP00000385092:R98W	ENSP00000375069:R125W	R	-	1	2	COL23A1	177666515	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	0.974000	0.29436	2.119000	0.64992	0.478000	0.44815	CGG	COL23A1	-	pfam_Collagen	ENSG00000050767		0.617	COL23A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL23A1	HGNC	protein_coding	OTTHUMT00000253475.1	-	0.00	62	0	G	NM_173465		177733909	-1	tier1	-	no_errors	ENST00000390654	ensembl	human	known	74_37	missense	14.29	48	8	SNP	1.000	A
CORO1B	57175	genome.wustl.edu	37	11	67207948	67207948	+	Intron	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:67207948C>T	ENST00000341356.5	-	7	867				CORO1B_ENST00000393893.1_Intron|CORO1B_ENST00000539724.1_5'Flank|PTPRCAP_ENST00000326294.3_5'Flank	NM_020441.2	NP_065174.1	Q9BR76	COR1B_HUMAN	coronin, actin binding protein, 1B						actin cytoskeleton organization (GO:0030036)|actin filament branching (GO:0090135)|actin filament bundle assembly (GO:0051017)|cell migration (GO:0016477)|endothelial cell chemotaxis (GO:0035767)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|positive regulation of lamellipodium morphogenesis (GO:2000394)|protein localization to cell leading edge (GO:1902463)|ruffle organization (GO:0031529)|wound healing (GO:0042060)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|identical protein binding (GO:0042802)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			GCAGAACCTCCTCACCCCCTA	0.622																																																	0													50.0	43.0	46.0					11																	67207948		2193	4291	6484	SO:0001627	intron_variant	0			AK000860	CCDS8164.1	11q13.1	2013-01-10	2001-11-28		ENSG00000172725	ENSG00000172725		"""Coronins"", ""WD repeat domain containing"""	2253	protein-coding gene	gene with protein product		609849	"""coronin, actin-binding protein, 1B"""			9778037	Standard	NM_001018070		Approved	coronin-2	uc001olk.1	Q9BR76	OTTHUMG00000167775	ENST00000341356.5:c.757-38G>A	11.37:g.67207948C>T			B2RD45	RNA	SNP	-	NULL	ENST00000341356.5	37	NULL	CCDS8164.1	11	.	.	.	.	.	.	.	.	.	.	C	12.43	1.935003	0.34189	.	.	ENSG00000172725	ENST00000393886	.	.	.	3.48	1.49	0.22878	.	.	.	.	.	T	0.31136	0.0787	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.24905	-1.0147	5	0.24483	T	0.36	.	8.1588	0.31185	0.0:0.784:0.0:0.216	.	.	.	.	K	282	.	ENSP00000377464:R282K	R	-	2	0	CORO1B	66964524	0.015000	0.18098	0.000000	0.03702	0.326000	0.28443	3.561000	0.53770	0.240000	0.21263	0.491000	0.48974	AGG	CORO1B	-	-	ENSG00000172725		0.622	CORO1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO1B	HGNC	protein_coding	OTTHUMT00000396220.1	-	0.00	56	0	C	NM_020441		67207948	-1	tier1	-	no_errors	ENST00000539970	ensembl	human	putative	74_37	rna	8.24	78	7	SNP	0.001	T
CORO7	79585	genome.wustl.edu	37	16	4408369	4408369	+	Splice_Site	SNP	C	C	T	rs569079730		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:4408369C>T	ENST00000251166.4	-	24	2601	c.2456G>A	c.(2455-2457)cGg>cAg	p.R819Q	CORO7_ENST00000537233.2_Splice_Site_p.R801Q|CORO7-PAM16_ENST00000572274.1_5'UTR|PAM16_ENST00000576217.1_5'Flank|CORO7_ENST00000539968.1_Splice_Site_p.R599Q|CORO7-PAM16_ENST00000572467.1_Splice_Site_p.R819Q|CORO7_ENST00000574025.1_Splice_Site_p.R734Q	NM_024535.4	NP_078811.3	P57737	CORO7_HUMAN	coronin 7	819					actin filament polymerization (GO:0030041)|Golgi to endosome transport (GO:0006895)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)			breast(3)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|prostate(2)|skin(2)|urinary_tract(2)	23						CACCCTCACCCGGACTCGGGG	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		17717	0.001		0.0	False		,,,				2504	0.0																0													21.0	23.0	22.0					16																	4408369		2191	4289	6480	SO:0001630	splice_region_variant	0			AK097238	CCDS10513.1, CCDS55982.1, CCDS58417.1	16p13.3	2013-01-10			ENSG00000262246	ENSG00000262246		"""Coronins"", ""WD repeat domain containing"""	26161	protein-coding gene	gene with protein product		611668				15327992	Standard	NM_024535		Approved	FLJ22021		P57737	OTTHUMG00000129465	ENST00000251166.4:c.2457+1G>A	16.37:g.4408369C>T			B4DFD6|B4DL18|I3L416|Q17RK4	Missense_Mutation	SNP	pfam_DUF1900,pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R819Q	ENST00000251166.4	37	c.2456	CCDS10513.1	16	.	.	.	.	.	.	.	.	.	.	C	15.06	2.720032	0.48728	.	.	ENSG00000103426	ENST00000251166;ENST00000537233;ENST00000539968	T;T	0.28666	1.6;1.6	5.56	3.26	0.37387	Domain of unknown function DUF1900 (1);	0.358239	0.31697	N	0.007215	T	0.43100	0.1232	M	0.66560	2.04	0.80722	D	1	P;B;D;D;P	0.63880	0.896;0.426;0.993;0.958;0.538	B;B;P;B;B	0.58210	0.245;0.094;0.835;0.37;0.128	T	0.34004	-0.9846	10	0.52906	T	0.07	-16.8173	7.6216	0.28189	0.0:0.7335:0.0:0.2665	.	734;801;599;819;800	P57737-2;B4DFD6;B3KUH7;P57737;B4DKU9	.;.;.;CORO7_HUMAN;.	Q	819;734;599	ENSP00000251166:R819Q;ENSP00000446221:R599Q	ENSP00000251166:R819Q	R	-	2	0	CORO7	4348370	1.000000	0.71417	1.000000	0.80357	0.236000	0.25371	1.656000	0.37355	1.352000	0.45808	0.484000	0.47621	CGG	CORO7-PAM16	-	pfam_DUF1900	ENSG00000103426		0.667	CORO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO7-PAM16	HGNC	protein_coding	OTTHUMT00000251628.2	-	0.00	50	0	C	NM_024535	Missense_Mutation	4408369	-1	tier1	-	no_errors	ENST00000572467	ensembl	human	known	74_37	missense	32.79	41	20	SNP	1.000	T
CP	1356	genome.wustl.edu	37	3	148917609	148917609	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:148917609G>T	ENST00000264613.6	-	8	1653	c.1391C>A	c.(1390-1392)aCc>aAc	p.T464N	CP_ENST00000462336.1_5'Flank	NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	464	F5/8 type A 2.|Plastocyanin-like 3.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	GTTATGGAAGGTTACTCTGAT	0.438																																																	0													169.0	143.0	151.0					3																	148917609		2203	4300	6503	SO:0001583	missense	0			M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.1391C>A	3.37:g.148917609G>T	ENSP00000264613:p.Thr464Asn		Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	pfam_Cu-oxidase_2,pfam_Cu-oxidase_3,pfam_Cu-oxidase,superfamily_Cupredoxin	p.T464N	ENST00000264613.6	37	c.1391	CCDS3141.1	3	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887036	0.52014	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	D;D	0.99023	-5.34;-5.34	5.79	5.79	0.91817	Cupredoxin (2);	0.111351	0.64402	D	0.000007	D	0.98998	0.9658	L	0.58302	1.8	0.50467	D	0.999874	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.77004	0.975;0.961;0.975;0.989	D	0.99544	1.0964	10	0.35671	T	0.21	-25.8275	17.8293	0.88676	0.0:0.0:1.0:0.0	.	464;464;464;464	A5PL27;A8K5A4;P00450;Q1L857	.;.;CERU_HUMAN;.	N	464;247	ENSP00000264613:T464N;ENSP00000420545:T247N	ENSP00000264613:T464N	T	-	2	0	CP	150400299	1.000000	0.71417	0.985000	0.45067	0.147000	0.21601	2.988000	0.49386	2.739000	0.93911	0.655000	0.94253	ACC	CP	-	superfamily_Cupredoxin	ENSG00000047457		0.438	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CP	HGNC	protein_coding	OTTHUMT00000317498.1	-	0.00	45	0	G	NM_000096		148917609	-1	tier1	-	no_errors	ENST00000264613	ensembl	human	known	74_37	missense	8.33	44	4	SNP	0.996	T
CPEB3	22849	genome.wustl.edu	37	10	94000046	94000046	+	Missense_Mutation	SNP	C	C	T	rs552534752	byFrequency	TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:94000046C>T	ENST00000265997.4	-	2	234	c.62G>A	c.(61-63)cGg>cAg	p.R21Q	CPEB3_ENST00000412050.4_Missense_Mutation_p.R21Q	NM_014912.4	NP_055727.3	Q8NE35	CPEB3_HUMAN	cytoplasmic polyadenylation element binding protein 3	21	Gln-rich.				3'-UTR-mediated mRNA destabilization (GO:0061158)|cellular response to amino acid stimulus (GO:0071230)|long-term memory (GO:0007616)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation (GO:0017148)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of mRNA polyadenylation (GO:1900365)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of translation (GO:0045727)|regulation of dendritic spine development (GO:0060998)|regulation of synaptic plasticity (GO:0048167)|translation (GO:0006412)	apical dendrite (GO:0097440)|CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuron projection (GO:0043005)|nucleus (GO:0005634)|synapse (GO:0045202)	mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)|translation factor activity, nucleic acid binding (GO:0008135)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0869)				ctgctgctgccgctgctgctg	0.602																																																	0													7.0	7.0	7.0					10																	94000046		1874	3746	5620	SO:0001583	missense	0			AB023157	CCDS31246.1, CCDS53553.1	10q23.33	2013-02-12			ENSG00000107864	ENSG00000107864		"""RNA binding motif (RRM) containing"""	21746	protein-coding gene	gene with protein product		610606				10231032, 12672660	Standard	NM_014912		Approved	KIAA0940	uc001khw.2	Q8NE35	OTTHUMG00000018756	ENST00000265997.4:c.62G>A	10.37:g.94000046C>T	ENSP00000265997:p.Arg21Gln		Q5T389|Q9NQJ7|Q9Y2E9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R21Q	ENST00000265997.4	37	c.62	CCDS31246.1	10	.	.	.	.	.	.	.	.	.	.	C	3.741	-0.053655	0.07362	.	.	ENSG00000107864	ENST00000394210;ENST00000412050;ENST00000265997	T;T	0.40225	1.04;1.04	4.47	-4.3	0.03710	.	0.575829	0.16183	N	0.225749	T	0.17831	0.0428	N	0.11427	0.14	0.23483	N	0.997588	B;B;B	0.17038	0.02;0.001;0.002	B;B;B	0.01281	0.0;0.0;0.0	T	0.31806	-0.9930	10	0.09590	T	0.72	0.057	12.6075	0.56531	0.0:0.4182:0.0:0.5818	.	21;21;21	Q8NE35;Q5QP71;Q8NE35-2	CPEB3_HUMAN;.;.	Q	21	ENSP00000398310:R21Q;ENSP00000265997:R21Q	ENSP00000265997:R21Q	R	-	2	0	CPEB3	93990026	1.000000	0.71417	0.846000	0.33378	0.756000	0.42949	1.276000	0.33156	-0.700000	0.05070	-1.063000	0.02288	CGG	CPEB3	-	NULL	ENSG00000107864		0.602	CPEB3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CPEB3	HGNC	protein_coding	OTTHUMT00000049387.2		0.00	59	0	C	NM_014912		94000046	-1			no_errors	ENST00000265997	ensembl	human	known	74_37	missense	5.48	69	4	SNP	0.457	T
CPNE8	144402	genome.wustl.edu	37	12	39047846	39047846	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:39047846G>T	ENST00000331366.5	-	20	1629	c.1533C>A	c.(1531-1533)gaC>gaA	p.D511E	CPNE8_ENST00000360449.3_Missense_Mutation_p.D499E|CPNE8_ENST00000546603.1_5'UTR|CPNE8_ENST00000538596.2_Missense_Mutation_p.D180E	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	511						extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				TTCCACTTCTGTCAATATAAT	0.398																																																	0													82.0	74.0	77.0					12																	39047846		2203	4300	6503	SO:0001583	missense	0			AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.1533C>A	12.37:g.39047846G>T	ENSP00000329748:p.Asp511Glu		Q2TB41|Q86VY2	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.D511E	ENST00000331366.5	37	c.1533	CCDS8733.1	12	.	.	.	.	.	.	.	.	.	.	G	14.55	2.569936	0.45798	.	.	ENSG00000139117	ENST00000331366;ENST00000538596;ENST00000360449	T;T;T	0.24350	1.86;1.99;1.86	4.82	3.9	0.45041	.	0.000000	0.85682	D	0.000000	T	0.30727	0.0774	M	0.76727	2.345	0.58432	D	0.999998	B	0.20164	0.042	B	0.21151	0.033	T	0.22521	-1.0214	10	0.54805	T	0.06	-18.7828	13.0474	0.58935	0.0862:0.0:0.9138:0.0	.	511	Q86YQ8	CPNE8_HUMAN	E	511;180;499	ENSP00000329748:D511E;ENSP00000439237:D180E;ENSP00000353633:D499E	ENSP00000329748:D511E	D	-	3	2	CPNE8	37334113	1.000000	0.71417	0.992000	0.48379	0.983000	0.72400	6.054000	0.71096	2.372000	0.80975	0.655000	0.94253	GAC	CPNE8	-	NULL	ENSG00000139117		0.398	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	HGNC	protein_coding	OTTHUMT00000403856.1	-	0.00	36	0	G	NM_153634		39047846	-1	tier1	-	no_errors	ENST00000331366	ensembl	human	known	74_37	missense	13.04	20	3	SNP	1.000	T
CPNE8	144402	genome.wustl.edu	37	12	39170060	39170060	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:39170060C>G	ENST00000331366.5	-	7	547	c.451G>C	c.(451-453)Gag>Cag	p.E151Q	CPNE8_ENST00000360449.3_Missense_Mutation_p.E139Q	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	151	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				TTTAATTCCTCTGCTGTAAGT	0.244																																																	0													82.0	86.0	85.0					12																	39170060		2201	4269	6470	SO:0001583	missense	0			AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.451G>C	12.37:g.39170060C>G	ENSP00000329748:p.Glu151Gln		Q2TB41|Q86VY2	Missense_Mutation	SNP	pfam_Copine,pfam_C2_dom,superfamily_C2_dom,smart_C2_dom,smart_VWF_A,pfscan_C2_dom,pfscan_VWF_A	p.E151Q	ENST00000331366.5	37	c.451	CCDS8733.1	12	.	.	.	.	.	.	.	.	.	.	C	21.8	4.208993	0.79240	.	.	ENSG00000139117	ENST00000331366;ENST00000360449	T;T	0.30182	1.55;1.54	5.17	5.17	0.71159	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.51176	0.1659	M	0.75085	2.285	0.80722	D	1	D	0.55800	0.973	P	0.55923	0.787	T	0.48658	-0.9016	10	0.44086	T	0.13	-25.5139	18.3196	0.90232	0.0:1.0:0.0:0.0	.	151	Q86YQ8	CPNE8_HUMAN	Q	151;139	ENSP00000329748:E151Q;ENSP00000353633:E139Q	ENSP00000329748:E151Q	E	-	1	0	CPNE8	37456327	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.883000	0.75595	2.793000	0.96121	0.591000	0.81541	GAG	CPNE8	-	superfamily_C2_dom	ENSG00000139117		0.244	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	HGNC	protein_coding	OTTHUMT00000403856.1	-	0.00	193	0	C	NM_153634		39170060	-1	tier1	-	no_errors	ENST00000331366	ensembl	human	known	74_37	missense	16.34	169	33	SNP	1.000	G
CSMD3	114788	genome.wustl.edu	37	8	113678558	113678558	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr8:113678558C>T	ENST00000297405.5	-	17	3008	c.2764G>A	c.(2764-2766)Gag>Aag	p.E922K	CSMD3_ENST00000352409.3_Missense_Mutation_p.E922K|CSMD3_ENST00000343508.3_Missense_Mutation_p.E882K|CSMD3_ENST00000455883.2_Missense_Mutation_p.E818K	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	922	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						ATCACCCACTCACAATTCAAA	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													66.0	63.0	64.0					8																	113678558		2203	4299	6502	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2764G>A	8.37:g.113678558C>T	ENSP00000297405:p.Glu922Lys		Q96PZ3	Missense_Mutation	SNP	pfam_CUB_dom,pfam_Sushi_SCR_CCP,superfamily_CUB_dom,superfamily_Sushi_SCR_CCP,smart_CUB_dom,smart_Sushi_SCR_CCP,pfscan_CUB_dom,pfscan_Sushi_SCR_CCP	p.E922K	ENST00000297405.5	37	c.2764	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	33	5.243635	0.95272	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2	5.97	5.97	0.96955	CUB (5);	0.000000	0.64402	D	0.000001	T	0.65523	0.2699	L	0.33189	0.99	0.49915	D	0.999836	D;D;P	0.76494	0.999;0.999;0.934	D;D;P	0.87578	0.997;0.998;0.888	T	0.54523	-0.8281	10	0.06494	T	0.89	.	20.4301	0.99081	0.0:1.0:0.0:0.0	.	818;922;882	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	K	882;922;262;818;922	ENSP00000345799:E882K;ENSP00000297405:E922K;ENSP00000341558:E262K;ENSP00000412263:E818K;ENSP00000343124:E922K	ENSP00000297405:E922K	E	-	1	0	CSMD3	113747734	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.834000	0.97654	0.557000	0.71058	GAG	CSMD3	-	pfam_CUB_dom,superfamily_CUB_dom,smart_CUB_dom,pfscan_CUB_dom	ENSG00000164796		0.373	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	-	0.00	74	0	C	NM_052900		113678558	-1	tier1	-	no_errors	ENST00000297405	ensembl	human	known	74_37	missense	15.24	89	16	SNP	1.000	T
CSPG4	1464	genome.wustl.edu	37	15	75981846	75981846	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:75981846C>T	ENST00000308508.5	-	3	1652	c.1560G>A	c.(1558-1560)ctG>ctA	p.L520L		NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	520	Globular or compact configuration stabilized by disulfide bonds.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CCGACACCTCCAGCACCAGCT	0.627																																																	0													35.0	34.0	34.0					15																	75981846		2188	4265	6453	SO:0001819	synonymous_variant	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.1560G>A	15.37:g.75981846C>T			D3DW77|Q92675	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G	p.L520	ENST00000308508.5	37	c.1560	CCDS10284.1	15																																																																																			CSPG4	-	NULL	ENSG00000173546		0.627	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	-	0.00	193	0	C	NM_001897		75981846	-1	tier1	-	no_errors	ENST00000308508	ensembl	human	known	74_37	silent	40.55	129	88	SNP	0.991	T
CSTF2	1478	genome.wustl.edu	37	X	100079173	100079173	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chrX:100079173G>A	ENST00000372972.2	+	6	645	c.629G>A	c.(628-630)gGt>gAt	p.G210D	SNORA9_ENST00000365361.1_RNA|CSTF2_ENST00000415585.2_Missense_Mutation_p.G210D	NM_001325.2	NP_001316.1	P33240	CSTF2_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	210	Gly/Pro-rich.|Interactions with CSTF3 and SYMPK.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cleavage body (GO:0071920)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	13						CCAGTCCATGGTGCTGGGCCT	0.483																																																	0													80.0	75.0	76.0					X																	100079173		2203	4300	6503	SO:0001583	missense	0			BC017712	CCDS14473.1	Xq22.1	2013-02-12	2002-08-29		ENSG00000101811	ENSG00000101811		"""RNA binding motif (RRM) containing"""	2484	protein-coding gene	gene with protein product		300907	"""cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kD"""			1741396	Standard	XM_006724622		Approved		uc004egh.3	P33240	OTTHUMG00000022709	ENST00000372972.2:c.629G>A	X.37:g.100079173G>A	ENSP00000362063:p.Gly210Asp		Q5H951|Q6LA74|Q8N502	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G210D	ENST00000372972.2	37	c.629	CCDS14473.1	X	.	.	.	.	.	.	.	.	.	.	G	4.987	0.183305	0.09495	.	.	ENSG00000101811	ENST00000415585;ENST00000372972;ENST00000413437	T;T;T	0.16073	2.64;2.61;2.37	4.05	-0.112	0.13572	.	0.449872	0.24920	N	0.034553	T	0.06280	0.0162	N	0.08118	0	0.22001	N	0.999422	B;B;B	0.19583	0.021;0.01;0.037	B;B;B	0.20767	0.031;0.014;0.016	T	0.32798	-0.9893	10	0.23302	T	0.38	0.026	3.9775	0.09481	0.0879:0.2921:0.4669:0.1531	.	210;210;210	E7EWR4;P33240-2;P33240	.;.;CSTF2_HUMAN	D	210;210;201	ENSP00000387996:G210D;ENSP00000362063:G210D;ENSP00000415705:G201D	ENSP00000362063:G210D	G	+	2	0	CSTF2	99965829	0.842000	0.29525	0.027000	0.17364	0.984000	0.73092	1.071000	0.30666	-0.142000	0.11354	0.600000	0.82982	GGT	CSTF2	-	NULL	ENSG00000101811		0.483	CSTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF2	HGNC	protein_coding	OTTHUMT00000058926.1	-	0.00	69	0	G	NM_001325		100079173	+1	tier1	-	no_errors	ENST00000415585	ensembl	human	known	74_37	missense	37.74	33	20	SNP	0.359	A
CTNNA2	1496	genome.wustl.edu	37	2	80874927	80874927	+	Missense_Mutation	SNP	G	G	A	rs529691509		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:80874927G>A	ENST00000402739.4	+	18	2797	c.2792G>A	c.(2791-2793)cGa>cAa	p.R931Q	CTNNA2_ENST00000466387.1_Missense_Mutation_p.R883Q|CTNNA2_ENST00000541047.1_Missense_Mutation_p.R883Q|CTNNA2_ENST00000343114.3_Missense_Mutation_p.R562Q|CTNNA2_ENST00000496558.1_Missense_Mutation_p.R883Q|CTNNA2_ENST00000540488.1_Missense_Mutation_p.R838Q|CTNNA2_ENST00000361291.4_Missense_Mutation_p.R917Q	NM_001282597.1	NP_001269526.1	P26232	CTNA2_HUMAN	catenin (cadherin-associated protein), alpha 2	931					axonogenesis (GO:0007409)|brain morphogenesis (GO:0048854)|dendrite morphogenesis (GO:0048813)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|prepulse inhibition (GO:0060134)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of synapse structural plasticity (GO:0051823)|single organismal cell-cell adhesion (GO:0016337)	actin cytoskeleton (GO:0015629)|adherens junction (GO:0005912)|axon (GO:0030424)|basolateral plasma membrane (GO:0016323)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	structural constituent of cytoskeleton (GO:0005200)	p.G932A(1)|p.R883P(1)		breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(49)|pancreas(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	78						CGAGTTCGACGAGGTTCTCAG	0.438																																																	2	Substitution - Missense(2)	skin(2)											130.0	129.0	129.0					2																	80874927		1848	4090	5938	SO:0001583	missense	0				CCDS42703.2, CCDS62944.1, CCDS62945.1, CCDS74531.1	2p12-p11.1	2010-05-04			ENSG00000066032	ENSG00000066032			2510	protein-coding gene	gene with protein product	"""cadherin-associated protein, related"", ""cancer/testis antigen 114"""	114025				8432524	Standard	NM_004389		Approved	CAP-R, CT114	uc010ysf.2	P26232	OTTHUMG00000152903	ENST00000402739.4:c.2792G>A	2.37:g.80874927G>A	ENSP00000384638:p.Arg931Gln		B3KXE5|B7Z2W7|B7Z352|B7Z898|Q4ZFW1|Q53R26|Q53R33|Q53T67|Q53T71|Q53TM8|Q7Z3L1|Q7Z3Y0	Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.R917Q	ENST00000402739.4	37	c.2750		2	.	.	.	.	.	.	.	.	.	.	G	35	5.439588	0.96168	.	.	ENSG00000066032	ENST00000466387;ENST00000496558;ENST00000361291;ENST00000402739;ENST00000541047;ENST00000540488;ENST00000343114	T;T;T;T;T;T;T	0.51574	0.86;0.86;0.82;0.7;0.86;0.74;2.09	5.94	5.94	0.96194	.	0.000000	0.64402	D	0.000002	T	0.65637	0.2710	L	0.54323	1.7	0.58432	D	0.999994	D;D;D;D	0.89917	0.995;1.0;1.0;1.0	P;D;D;D	0.68353	0.794;0.957;0.956;0.956	T	0.59799	-0.7386	9	.	.	.	.	20.3658	0.98878	0.0:0.0:1.0:0.0	.	515;931;838;883	F6KRI5;P26232;P26232-3;P26232-2	.;CTNA2_HUMAN;.;.	Q	883;883;917;931;883;838;562	ENSP00000418191:R883Q;ENSP00000419295:R883Q;ENSP00000355398:R917Q;ENSP00000384638:R931Q;ENSP00000444675:R883Q;ENSP00000441705:R838Q;ENSP00000341500:R562Q	.	R	+	2	0	CTNNA2	80728438	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.820000	0.97059	0.650000	0.86243	CGA	CTNNA2	-	NULL	ENSG00000066032		0.438	CTNNA2-003	PUTATIVE	basic|exp_conf	protein_coding	CTNNA2	HGNC	protein_coding	OTTHUMT00000328511.4		0.00	31	0	G	NM_004389		80874927	+1			no_errors	ENST00000361291	ensembl	human	known	74_37	missense	15.15	28	5	SNP	1.000	A
CTNND2	1501	genome.wustl.edu	37	5	11082916	11082916	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:11082916G>A	ENST00000304623.8	-	16	2869	c.2680C>T	c.(2680-2682)Ctg>Ttg	p.L894L	CTNND2_ENST00000503622.1_Silent_p.L557L|CTNND2_ENST00000458100.2_Silent_p.L461L|CTNND2_ENST00000511377.1_Silent_p.L803L|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000359640.2_Silent_p.L836L	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	894				L -> R (in Ref. 1; AAC63103 and 11; AAB96357). {ECO:0000305}.	cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						AGGATGGGCAGGCCTTTCTCT	0.542																																																	0													95.0	85.0	88.0					5																	11082916		2203	4300	6503	SO:0001819	synonymous_variant	0			U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2680C>T	5.37:g.11082916G>A			B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.L894	ENST00000304623.8	37	c.2680	CCDS3881.1	5																																																																																			CTNND2	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	ENSG00000169862		0.542	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNND2	HGNC	protein_coding	OTTHUMT00000206999.1		0.00	41	0	G	NM_001332		11082916	-1			no_errors	ENST00000304623	ensembl	human	known	74_37	silent	6.67	42	3	SNP	1.000	A
CUL3	8452	genome.wustl.edu	37	2	225368421	225368421	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:225368421G>T	ENST00000264414.4	-	9	1663	c.1325C>A	c.(1324-1326)aCa>aAa	p.T442K	CUL3_ENST00000344951.4_Missense_Mutation_p.T376K|CUL3_ENST00000409777.1_Missense_Mutation_p.T418K|CUL3_ENST00000409096.1_Missense_Mutation_p.T418K	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	442					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)	p.T442R(1)		endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		ACTTTTATTTGTGAGAAGTCT	0.313																																																	1	Substitution - Missense(1)	kidney(1)											131.0	117.0	122.0					2																	225368421		2202	4298	6500	SO:0001583	missense	0			U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1325C>A	2.37:g.225368421G>T	ENSP00000264414:p.Thr442Lys		A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.T442K	ENST00000264414.4	37	c.1325	CCDS2462.1	2	.	.	.	.	.	.	.	.	.	.	G	16.62	3.173162	0.57584	.	.	ENSG00000036257	ENST00000264414;ENST00000344951;ENST00000409096;ENST00000409777	T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71	5.67	5.67	0.87782	Cullin, N-terminal (1);Cullin homology (3);	0.044682	0.85682	D	0.000000	T	0.59376	0.2189	N	0.19112	0.55	0.80722	D	1	P;B;B	0.35226	0.491;0.267;0.267	B;B;B	0.33620	0.104;0.167;0.167	T	0.58086	-0.7698	10	0.33141	T	0.24	.	19.7689	0.96353	0.0:0.0:1.0:0.0	.	376;420;442	Q13618-3;Q53S54;Q13618	.;.;CUL3_HUMAN	K	442;376;418;418	ENSP00000264414:T442K;ENSP00000343601:T376K;ENSP00000387200:T418K;ENSP00000386525:T418K	ENSP00000264414:T442K	T	-	2	0	CUL3	225076665	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.757000	0.62213	2.656000	0.90262	0.650000	0.86243	ACA	CUL3	-	pfam_Cullin_N,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology	ENSG00000036257		0.313	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL3	HGNC	protein_coding	OTTHUMT00000256871.2		0.00	38	0	G			225368421	-1			no_errors	ENST00000264414	ensembl	human	known	74_37	missense	7.89	35	3	SNP	1.000	T
DAP3	7818	genome.wustl.edu	37	1	155698908	155698908	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:155698908G>C	ENST00000368336.5	+	8	803	c.679G>C	c.(679-681)Gaa>Caa	p.E227Q	DAP3_ENST00000343043.3_Missense_Mutation_p.E227Q|MSTO1_ENST00000538143.1_Intron|DAP3_ENST00000421487.2_Missense_Mutation_p.E193Q|MSTO1_ENST00000452804.2_Intron|DAP3_ENST00000471642.2_Missense_Mutation_p.E186Q|DAP3_ENST00000535183.1_Missense_Mutation_p.E186Q	NM_001199849.1|NM_004632.3	NP_001186778.1|NP_004623.1	P51398	RT29_HUMAN	death associated protein 3	227					apoptotic mitochondrial changes (GO:0008637)|apoptotic signaling pathway (GO:0097190)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	24	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					AGAAGTGGTTGAACAGGTATA	0.398																																																	0													106.0	116.0	113.0					1																	155698908		2203	4300	6503	SO:0001583	missense	0			X83544	CCDS1120.1, CCDS55646.1, CCDS55647.1	1q22	2012-11-14			ENSG00000132676	ENSG00000132676		"""Mitochondrial ribosomal proteins / small subunits"""	2673	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S29"""	602074				7499268, 9284927	Standard	NM_004632		Approved	MRPS29, DAP-3, MRP-S29, bMRP-10, MGC126058, MGC126059, DKFZp686G12159	uc001flr.3	P51398	OTTHUMG00000035439	ENST00000368336.5:c.679G>C	1.37:g.155698908G>C	ENSP00000357320:p.Glu227Gln		B4DP59|B4DY62|E7EM60|Q13044|Q68CT7|Q96Q20	Missense_Mutation	SNP	pfam_Ribosomal_S23/S29_mit,superfamily_P-loop_NTPase,prints_Ribosomal_S29_mit	p.E227Q	ENST00000368336.5	37	c.679	CCDS1120.1	1	.	.	.	.	.	.	.	.	.	.	G	25.6	4.653117	0.88056	.	.	ENSG00000132676	ENST00000368336;ENST00000343043;ENST00000421487;ENST00000535183	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.55	5.55	0.83447	.	0.052222	0.85682	D	0.000000	T	0.56470	0.1987	M	0.67397	2.05	0.58432	D	0.999996	D;D;D	0.67145	0.992;0.996;0.992	D;D;D	0.66847	0.915;0.947;0.915	T	0.57106	-0.7868	10	0.72032	D	0.01	-21.6396	17.4437	0.87573	0.0:0.0:1.0:0.0	.	186;193;227	B4DP59;E7EM60;P51398	.;.;RT29_HUMAN	Q	227;227;193;186	ENSP00000357320:E227Q;ENSP00000341692:E227Q;ENSP00000412605:E193Q;ENSP00000445003:E186Q	ENSP00000341692:E227Q	E	+	1	0	DAP3	153965532	1.000000	0.71417	0.960000	0.40013	0.993000	0.82548	5.939000	0.70179	2.890000	0.99128	0.585000	0.79938	GAA	DAP3	-	pfam_Ribosomal_S23/S29_mit,superfamily_P-loop_NTPase,prints_Ribosomal_S29_mit	ENSG00000132676		0.398	DAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAP3	HGNC	protein_coding	OTTHUMT00000086042.1	-	0.00	44	0	G	NM_004632		155698908	+1	tier1	-	no_errors	ENST00000343043	ensembl	human	known	74_37	missense	20.34	47	12	SNP	0.997	C
DCAF16	54876	genome.wustl.edu	37	4	17805730	17805730	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:17805730G>A	ENST00000382247.1	-	3	1095	c.35C>T	c.(34-36)tCa>tTa	p.S12L	DCAF16_ENST00000536863.1_Missense_Mutation_p.S12L|DCAF16_ENST00000507768.1_5'Flank	NM_017741.3	NP_060211.3	Q9NXF7	DCA16_HUMAN	DDB1 and CUL4 associated factor 16	12					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)				cervix(1)|endometrium(1)|lung(2)|ovary(1)	5						TTCTGATTCTGACAAGTGGTC	0.418																																																	0													46.0	47.0	47.0					4																	17805730		2203	4300	6503	SO:0001583	missense	0			AK000287	CCDS3423.1	4p15.32	2009-07-17	2009-07-17	2009-07-17	ENSG00000163257	ENSG00000163257		"""DDB1 and CUL4 associated factors"""	25987	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 30"""	C4orf30		12477932	Standard	XM_005248169		Approved	FLJ20280	uc003gpn.3	Q9NXF7	OTTHUMG00000128536	ENST00000382247.1:c.35C>T	4.37:g.17805730G>A	ENSP00000371682:p.Ser12Leu		B3KPB7	Missense_Mutation	SNP	NULL	p.S12L	ENST00000382247.1	37	c.35	CCDS3423.1	4	.	.	.	.	.	.	.	.	.	.	G	4.618	0.114852	0.08831	.	.	ENSG00000163257	ENST00000382247;ENST00000536863	T;T	0.38240	1.15;1.15	4.1	4.1	0.47936	.	.	.	.	.	T	0.21186	0.0510	N	0.08118	0	0.28197	N	0.927492	B	0.22604	0.072	B	0.15052	0.012	T	0.10613	-1.0622	9	0.87932	D	0	-6.1044	12.1217	0.53895	0.0:0.0:1.0:0.0	.	12	Q9NXF7	DCA16_HUMAN	L	12	ENSP00000371682:S12L;ENSP00000445736:S12L	ENSP00000371682:S12L	S	-	2	0	DCAF16	17414828	0.985000	0.35326	0.977000	0.42913	0.027000	0.11550	1.726000	0.38085	2.589000	0.87451	0.561000	0.74099	TCA	DCAF16	-	NULL	ENSG00000163257		0.418	DCAF16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF16	HGNC	protein_coding	OTTHUMT00000250371.1	-	0.00	24	0	G	NM_017741		17805730	-1	tier1	-	no_errors	ENST00000382247	ensembl	human	known	74_37	missense	31.25	11	5	SNP	0.982	A
DCHS2	54798	genome.wustl.edu	37	4	155156083	155156083	+	Missense_Mutation	SNP	C	C	T	rs375321525		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:155156083C>T	ENST00000357232.4	-	25	8355	c.8356G>A	c.(8356-8358)Gag>Aag	p.E2786K		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2786					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AATTTGGGCTCCCAACTAAGA	0.393																																																	0								C	LYS/GLU	0,4406		0,0,2203	116.0	116.0	116.0		8356	5.9	1.0	4		116	1,8599	1.2+/-3.3	0,1,4299	no	missense	DCHS2	NM_017639.3	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	2786/2917	155156083	1,13005	2203	4300	6503	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8356G>A	4.37:g.155156083C>T	ENSP00000349768:p.Glu2786Lys		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E2786K	ENST00000357232.4	37	c.8356	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	C	21.6	4.173575	0.78452	0.0	1.16E-4	ENSG00000197410	ENST00000357232	T	0.55413	0.52	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.55114	0.1900	M	0.71581	2.175	0.80722	D	1	D	0.53312	0.959	P	0.46076	0.503	T	0.52525	-0.8564	10	0.11794	T	0.64	.	15.4364	0.75149	0.0:0.9321:0.0:0.0679	.	2786	Q6V1P9	PCD23_HUMAN	K	2786	ENSP00000349768:E2786K	ENSP00000349768:E2786K	E	-	1	0	DCHS2	155375533	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	2.593000	0.46180	2.812000	0.96745	0.557000	0.71058	GAG	DCHS2	-	NULL	ENSG00000197410		0.393	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	25	0	C	NM_001142552		155156083	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	missense	52.38	10	11	SNP	1.000	T
DCHS2	54798	genome.wustl.edu	37	4	155219049	155219049	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:155219049G>A	ENST00000357232.4	-	18	5051	c.5052C>T	c.(5050-5052)ttC>ttT	p.F1684F		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1684	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GGTGGTGGCTGAAGGAAATCT	0.443																																																	0													79.0	79.0	79.0					4																	155219049		2203	4300	6503	SO:0001819	synonymous_variant	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.5052C>T	4.37:g.155219049G>A			B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F1684	ENST00000357232.4	37	c.5052	CCDS3785.1	4																																																																																			DCHS2	-	superfamily_Cadherin-like	ENSG00000197410		0.443	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	42	0	G	NM_001142552		155219049	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	silent	20.45	35	9	SNP	1.000	A
DCHS2	54798	genome.wustl.edu	37	4	155254137	155254137	+	Nonsense_Mutation	SNP	T	T	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:155254137T>A	ENST00000357232.4	-	9	1725	c.1726A>T	c.(1726-1728)Aaa>Taa	p.K576*	DCHS2_ENST00000507542.1_5'Flank|DCHS2_ENST00000339452.1_Nonsense_Mutation_p.K1075*	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	576	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TGTTCGCGTTTCTCGATAACG	0.582																																																	0													85.0	86.0	86.0					4																	155254137		2203	4300	6503	SO:0001587	stop_gained	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1726A>T	4.37:g.155254137T>A	ENSP00000349768:p.Lys576*		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K576*	ENST00000357232.4	37	c.1726	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	T	40	8.026017	0.98616	.	.	ENSG00000197410	ENST00000357232;ENST00000339452;ENST00000544161	.	.	.	5.43	-2.47	0.06442	.	1.233600	0.05866	N	0.623815	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	7.4867	0.27437	0.0:0.3812:0.4026:0.2161	.	.	.	.	X	576;1075;1075	.	ENSP00000345062:K1075X	K	-	1	0	DCHS2	155473587	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.167000	0.16602	-0.560000	0.06102	0.533000	0.62120	AAA	DCHS2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.582	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	-	0.00	21	0	T	NM_001142552		155254137	-1	tier1	-	no_errors	ENST00000357232	ensembl	human	known	74_37	nonsense	20.59	27	7	SNP	0.000	A
DCHS2	54798	genome.wustl.edu	37	4	155410844	155410844	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:155410844C>A	ENST00000339452.1	-	1	2024	c.1664G>T	c.(1663-1665)gGc>gTc	p.G555V	DCHS2_ENST00000443500.1_Missense_Mutation_p.G555V|DCHS2_ENST00000456341.2_Missense_Mutation_p.G548V	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1700	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GACTACAGTGCCAGGGGCCGC	0.617																																																	0													55.0	64.0	61.0					4																	155410844		692	1591	2283	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.1664G>T	4.37:g.155410844C>A	ENSP00000345062:p.Gly555Val		B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G555V	ENST00000339452.1	37	c.1664	CCDS47150.1	4	.	.	.	.	.	.	.	.	.	.	C	15.43	2.830281	0.50845	.	.	ENSG00000197410	ENST00000339452;ENST00000544161;ENST00000456341;ENST00000443500	T;T;T	0.70399	1.43;-0.48;-0.48	5.29	5.29	0.74685	.	.	.	.	.	D	0.86707	0.5997	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88515	0.3092	9	0.87932	D	0	.	18.7317	0.91738	0.0:1.0:0.0:0.0	.	555;555	E9PG03;E9PC11	.;.	V	555;555;548;555	ENSP00000345062:G555V;ENSP00000408543:G548V;ENSP00000395539:G555V	ENSP00000345062:G555V	G	-	2	0	DCHS2	155630294	1.000000	0.71417	1.000000	0.80357	0.051000	0.14879	5.869000	0.69613	2.752000	0.94435	0.557000	0.71058	GGC	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000197410		0.617	DCHS2-002	KNOWN	basic|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365282.1	-	0.00	29	0	C	NM_001142552		155410844	-1	tier1	-	no_errors	ENST00000339452	ensembl	human	known	74_37	missense	13.21	46	7	SNP	1.000	A
DCHS2	54798	genome.wustl.edu	37	4	155411596	155411596	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:155411596C>T	ENST00000339452.1	-	1	1272	c.912G>A	c.(910-912)gcG>gcA	p.A304A	DCHS2_ENST00000443500.1_Silent_p.A304A|DCHS2_ENST00000456341.2_Silent_p.A297A	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1486	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CCTCGCGCACCGCGGCGCGGT	0.746																																																	0													3.0	6.0	5.0					4																	155411596		610	1472	2082	SO:0001819	synonymous_variant	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.912G>A	4.37:g.155411596C>T			B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A304	ENST00000339452.1	37	c.912	CCDS47150.1	4																																																																																			DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000197410		0.746	DCHS2-002	KNOWN	basic|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365282.1		0.00	15	0	C	NM_001142552		155411596	-1			no_errors	ENST00000339452	ensembl	human	known	74_37	silent	25.00	9	3	SNP	0.000	T
DCTN2	10540	genome.wustl.edu	37	12	57926560	57926560	+	Missense_Mutation	SNP	C	C	A	rs141248212	byFrequency	TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:57926560C>A	ENST00000548249.1	-	10	1075	c.808G>T	c.(808-810)Gcc>Tcc	p.A270S	DCTN2_ENST00000537439.1_Missense_Mutation_p.A247S|DCTN2_ENST00000434715.3_Missense_Mutation_p.A275S|DCTN2_ENST00000551400.1_5'Flank|DCTN2_ENST00000543672.1_Missense_Mutation_p.A275S	NM_001261412.1|NM_001261413.1	NP_001248341.1|NP_001248342.1	Q13561	DCTN2_HUMAN	dynactin 2 (p50)	270					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|vesicle (GO:0031982)	motor activity (GO:0003774)|spectrin binding (GO:0030507)	p.A275T(2)		endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|upper_aerodigestive_tract(2)	11						AGGTCTAGGGCGCTCACCTTT	0.493																																																	2	Substitution - Missense(2)	large_intestine(2)											83.0	79.0	80.0					12																	57926560		1922	4143	6065	SO:0001583	missense	0			U50733	CCDS44930.1, CCDS58245.1, CCDS73489.1	12q13.3	2008-05-14				ENSG00000175203			2712	protein-coding gene	gene with protein product		607376				8647893	Standard	NM_001261412		Approved	RBP50, DCTN-50	uc001som.2	Q13561	OTTHUMG00000170124	ENST00000548249.1:c.808G>T	12.37:g.57926560C>A	ENSP00000447824:p.Ala270Ser		B2RBK5|Q86YN2|Q9BW17	Missense_Mutation	SNP	NULL	p.A275S	ENST00000548249.1	37	c.823	CCDS58245.1	12	.	.	.	.	.	.	.	.	.	.	C	15.46	2.839964	0.51057	.	.	ENSG00000175203	ENST00000548249;ENST00000434715;ENST00000543672;ENST00000537439;ENST00000354743;ENST00000543105;ENST00000550086	.	.	.	5.18	2.36	0.29203	.	0.113945	0.64402	D	0.000017	T	0.40423	0.1116	L	0.47716	1.5	0.43412	D	0.995559	B;B;B	0.15930	0.006;0.015;0.007	B;B;B	0.13407	0.005;0.005;0.009	T	0.10894	-1.0610	9	0.09084	T	0.74	-5.9565	4.5941	0.12322	0.418:0.4181:0.0:0.1639	.	270;275;270	F8WAG8;F5H2S7;Q13561	.;.;DCTN2_HUMAN	S	270;275;275;247;270;183;111	.	ENSP00000346785:A270S	A	-	1	0	DCTN2	56212827	0.991000	0.36638	1.000000	0.80357	0.993000	0.82548	0.852000	0.27764	0.873000	0.35799	0.557000	0.71058	GCC	DCTN2	-	NULL	ENSG00000175203		0.493	DCTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCTN2	HGNC	protein_coding	OTTHUMT00000407393.2		0.00	28	0	C	NM_006400		57926560	-1			no_errors	ENST00000434715	ensembl	human	known	74_37	missense	6.90	27	2	SNP	1.000	A
DENND1B	163486	genome.wustl.edu	37	1	197552366	197552366	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:197552366G>A	ENST00000367396.3	-	15	1234	c.1065C>T	c.(1063-1065)ttC>ttT	p.F355F	DENND1B_ENST00000235453.4_Silent_p.F325F|DENND1B_ENST00000400967.2_Silent_p.F325F	NM_144977.4	NP_659414.2	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B	355	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|kidney(2)|large_intestine(3)|lung(12)|upper_aerodigestive_tract(1)	22						TCTCCTCACAGAAAGTGATGG	0.413																																																	0													75.0	72.0	73.0					1																	197552366		1852	4112	5964	SO:0001819	synonymous_variant	0			BC016588	CCDS41452.2, CCDS72996.1, CCDS72997.1	1q31.3	2012-10-03	2005-08-17	2005-08-17	ENSG00000213047	ENSG00000213047		"""DENN/MADD domain containing"""	28404	protein-coding gene	gene with protein product		613292	"""family with sequence similarity 31, member B"", ""chromosome 1 open reading frame 218"""	FAM31B, C1orf218		12477932	Standard	NM_144977		Approved	MGC27044, FLJ20054	uc021pgu.1	Q6P3S1	OTTHUMG00000035653	ENST00000367396.3:c.1065C>T	1.37:g.197552366G>A			B5MD89|D3PFD5|Q5T3B8|Q5T3B9|Q5T3C1|Q5TAI8|Q6B0I8|Q8NDT1|Q8TBE6|Q9H774|Q9NXU2	Silent	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.F355	ENST00000367396.3	37	c.1065	CCDS41452.2	1																																																																																			DENND1B	-	pfam_dDENN_dom,smart_dDENN_dom,pfscan_dDENN_dom	ENSG00000213047		0.413	DENND1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND1B	HGNC	protein_coding	OTTHUMT00000086539.1	-	0.00	31	0	G	NM_144977		197552366	-1	tier1	-	no_errors	ENST00000367396	ensembl	human	known	74_37	silent	13.64	19	3	SNP	1.000	A
DICER1	23405	genome.wustl.edu	37	14	95570227	95570227	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:95570227G>T	ENST00000526495.1	-	23	3797	c.3506C>A	c.(3505-3507)tCa>tAa	p.S1169*	DICER1_ENST00000393063.1_Nonsense_Mutation_p.S1169*|DICER1_ENST00000527414.1_Nonsense_Mutation_p.S1169*|DICER1_ENST00000541352.1_Nonsense_Mutation_p.S1169*|DICER1_ENST00000556045.1_Nonsense_Mutation_p.S67*|DICER1_ENST00000343455.3_Nonsense_Mutation_p.S1169*			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	1169					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		AAGATCTGCTGAAACTTCAAC	0.423			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																														yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	0													85.0	84.0	85.0					14																	95570227		2203	4300	6503	SO:0001587	stop_gained	0	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.3506C>A	14.37:g.95570227G>T	ENSP00000437256:p.Ser1169*		A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Nonsense_Mutation	SNP	pfam_RNase_III_dom,pfam_PAZ_dom,pfam_Dicer_dimerisation_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_RNase_III_dom,superfamily_P-loop_NTPase,superfamily_PAZ_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_PAZ_dom,smart_RNase_III_dom,smart_dsRNA-bd_dom,pfscan_PAZ_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_dsRNA-bd_dom,pfscan_RNase_III_dom	p.S1169*	ENST00000526495.1	37	c.3506	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	G	42	9.452609	0.99175	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000556045;ENST00000541352	.	.	.	5.24	3.42	0.39159	.	0.563380	0.16132	N	0.228149	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08179	T	0.78	1.4328	11.2734	0.49153	0.147:0.0:0.853:0.0	.	.	.	.	X	1169;1169;1169;1169;67;1169	.	ENSP00000343745:S1169X	S	-	2	0	DICER1	94639980	0.941000	0.31946	0.000000	0.03702	0.979000	0.70002	3.932000	0.56537	0.611000	0.30052	0.561000	0.74099	TCA	DICER1	-	NULL	ENSG00000100697		0.423	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	HGNC	protein_coding	OTTHUMT00000387997.1	-	0.00	50	0	G			95570227	-1	tier1	-	no_errors	ENST00000343455	ensembl	human	known	74_37	nonsense	6.25	60	4	SNP	0.018	T
DIDO1	11083	genome.wustl.edu	37	20	61513083	61513083	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr20:61513083C>T	ENST00000266070.4	-	16	4550	c.4225G>A	c.(4225-4227)Gag>Aag	p.E1409K	DIDO1_ENST00000395343.1_Missense_Mutation_p.E1409K	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1409					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.E1409*(1)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CTTTCCACCTCGTGGCGCCGC	0.602																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												1	Substitution - Nonsense(1)	lung(1)											75.0	81.0	79.0					20																	61513083		2203	4300	6503	SO:0001583	missense	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.4225G>A	20.37:g.61513083C>T	ENSP00000266070:p.Glu1409Lys		A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.E1409K	ENST00000266070.4	37	c.4225	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	C	16.18	3.049421	0.55218	.	.	ENSG00000101191	ENST00000266070;ENST00000395343	T;T	0.09723	2.95;2.95	5.67	5.67	0.87782	.	0.309842	0.22708	N	0.056604	T	0.09818	0.0241	L	0.50333	1.59	0.40496	D	0.980595	P	0.35226	0.491	B	0.20184	0.028	T	0.05131	-1.0904	10	0.52906	T	0.07	-29.0191	10.8151	0.46571	0.0:0.8859:0.0:0.1141	.	1409	Q9BTC0	DIDO1_HUMAN	K	1409	ENSP00000266070:E1409K;ENSP00000378752:E1409K	ENSP00000266070:E1409K	E	-	1	0	DIDO1	60983528	0.029000	0.19370	0.011000	0.14972	0.001000	0.01503	2.321000	0.43805	2.667000	0.90743	0.563000	0.77884	GAG	DIDO1	-	NULL	ENSG00000101191		0.602	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	-	0.00	30	0	C	NM_080796		61513083	-1	tier1	-	no_errors	ENST00000266070	ensembl	human	known	74_37	missense	16.67	40	8	SNP	0.021	T
DNAH17	8632	genome.wustl.edu	37	17	76502823	76502823	+	Silent	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:76502823G>T	ENST00000585328.1	-	30	4897	c.4773C>A	c.(4771-4773)tcC>tcA	p.S1591S	DNAH17_ENST00000389840.5_Silent_p.S1590S	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1590	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CATTGCCATTGGAGAGAATGT	0.552																																																	0													58.0	62.0	61.0					17																	76502823		1911	4121	6032	SO:0001819	synonymous_variant	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.4773C>A	17.37:g.76502823G>T			O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_P-loop_NTPase,superfamily_HR1_rho-bd	p.S1590	ENST00000585328.1	37	c.4770		17																																																																																			DNAH17	-	pfam_Dynein_heavy_dom-2	ENSG00000187775		0.552	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	-	0.00	56	0	G	NM_173628		76502823	-1	tier1	-	no_errors	ENST00000389840	ensembl	human	known	74_37	silent	5.56	68	4	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56479180	56479180	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:56479180C>T	ENST00000361203.3	-	33	4406	c.4399G>A	c.(4399-4401)Gga>Aga	p.G1467R	DST_ENST00000446842.2_Missense_Mutation_p.G1141R|DST_ENST00000244364.6_Missense_Mutation_p.G1141R|DST_ENST00000370754.5_Missense_Mutation_p.G1645R|DST_ENST00000370769.4_Missense_Mutation_p.G1467R|DST_ENST00000312431.6_Missense_Mutation_p.G1467R|DST_ENST00000370788.2_Missense_Mutation_p.G1467R|DST_ENST00000421834.2_Missense_Mutation_p.G1467R			Q03001	DYST_HUMAN	dystonin	1467					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GGAGGTTTTCCAGCCTTCTCT	0.368																																																	0													182.0	163.0	169.0					6																	56479180		1830	4087	5917	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.4399G>A	6.37:g.56479180C>T	ENSP00000354508:p.Gly1467Arg		B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC1_TM_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_dom,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_hand_dom	p.G1645R	ENST00000361203.3	37	c.4933		6	.	.	.	.	.	.	.	.	.	.	C	18.07	3.540754	0.65085	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000312431;ENST00000370788;ENST00000361203;ENST00000439203	T;T;T;T;T;T;T;T;T	0.21361	2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01;2.01	5.88	5.88	0.94601	.	0.250691	0.27996	N	0.017020	T	0.26340	0.0643	L	0.34521	1.04	0.19300	N	0.99998	B;D;P;D;B;B	0.71674	0.0;0.998;0.604;0.996;0.041;0.0	B;D;B;D;B;B	0.69824	0.0;0.959;0.135;0.966;0.07;0.002	T	0.00998	-1.1486	9	0.21540	T	0.41	.	20.2422	0.98381	0.0:1.0:0.0:0.0	.	1467;1467;1645;1141;1467;1141	Q5TBT1;E7ERU2;E9PEB9;Q03001-9;Q03001;Q03001-8	.;.;.;.;DYST_HUMAN;.	R	1141;1645;1467;1467;1141;1467;1467;1467;1141	ENSP00000244364:G1141R;ENSP00000359790:G1645R;ENSP00000359805:G1467R;ENSP00000400883:G1467R;ENSP00000393645:G1141R;ENSP00000307959:G1467R;ENSP00000359824:G1467R;ENSP00000354508:G1467R;ENSP00000404924:G1141R	ENSP00000244364:G1141R	G	-	1	0	DST	56587139	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	3.402000	0.52608	2.788000	0.95919	0.650000	0.86243	GGA	DST	-	superfamily_ABC1_TM_dom	ENSG00000151914		0.368	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	-	0.00	51	0	C	NM_001723		56479180	-1	tier1	-	no_errors	ENST00000370754	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
DZIP1L	199221	genome.wustl.edu	37	3	137822572	137822572	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:137822572G>A	ENST00000327532.2	-	2	604	c.242C>T	c.(241-243)cCg>cTg	p.P81L	DZIP1L_ENST00000469243.1_Missense_Mutation_p.P81L	NM_173543.2	NP_775814.2	Q8IYY4	DZI1L_HUMAN	DAZ interacting zinc finger protein 1-like	81					cilium assembly (GO:0042384)	ciliary basal body (GO:0036064)	metal ion binding (GO:0046872)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|pancreas(2)|prostate(1)|skin(1)	35						GAGCAGTGCCGGGTCCACAGG	0.622																																																	0													33.0	33.0	33.0					3																	137822572		2203	4300	6503	SO:0001583	missense	0			AK057406	CCDS3096.1, CCDS54645.1	3q22.3	2013-05-22	2013-05-22		ENSG00000158163	ENSG00000158163			26551	protein-coding gene	gene with protein product			"""DAZ interacting protein 1-like"""			12477932	Standard	NM_173543		Approved	FLJ32844, DZIP2	uc003erq.3	Q8IYY4	OTTHUMG00000159819	ENST00000327532.2:c.242C>T	3.37:g.137822572G>A	ENSP00000332148:p.Pro81Leu		C9JUG5|Q96M38	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.P81L	ENST00000327532.2	37	c.242	CCDS3096.1	3	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104643	0.77096	.	.	ENSG00000158163	ENST00000327532;ENST00000469243;ENST00000536706	T;T	0.46819	0.86;0.86	4.83	3.96	0.45880	.	0.177079	0.35870	N	0.002937	T	0.62539	0.2436	L	0.56340	1.77	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65080	-0.6255	10	0.87932	D	0	-12.7787	12.6673	0.56849	0.0815:0.0:0.9185:0.0	.	81;81	Q8IYY4-2;Q8IYY4	.;DZI1L_HUMAN	L	81	ENSP00000332148:P81L;ENSP00000419486:P81L	ENSP00000332148:P81L	P	-	2	0	DZIP1L	139305262	1.000000	0.71417	0.764000	0.31436	0.975000	0.68041	5.807000	0.69157	1.035000	0.39972	0.655000	0.94253	CCG	DZIP1L	-	NULL	ENSG00000158163		0.622	DZIP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DZIP1L	HGNC	protein_coding	OTTHUMT00000357548.1	-	0.00	51	0	G	NM_173543		137822572	-1	tier1	-	no_errors	ENST00000327532	ensembl	human	known	74_37	missense	25.00	45	15	SNP	0.989	A
EFCAB13	124989	genome.wustl.edu	37	17	45447865	45447865	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:45447865G>C	ENST00000331493.2	+	11	1279	c.868G>C	c.(868-870)Gag>Cag	p.E290Q	EFCAB13_ENST00000517484.1_Missense_Mutation_p.E194Q	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	290						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										GGAACAGTATGAGGATGTTTG	0.279																																																	0													152.0	159.0	157.0					17																	45447865		2203	4299	6502	SO:0001583	missense	0			BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.868G>C	17.37:g.45447865G>C	ENSP00000332111:p.Glu290Gln		G3V128|Q49AG9	Missense_Mutation	SNP	NULL	p.E290Q	ENST00000331493.2	37	c.868	CCDS11512.1	17	.	.	.	.	.	.	.	.	.	.	G	19.11	3.763134	0.69763	.	.	ENSG00000178852	ENST00000331493;ENST00000517484;ENST00000344176	T;T	0.71222	0.78;-0.55	3.86	3.86	0.44501	.	0.350546	0.20483	N	0.091447	T	0.78000	0.4215	L	0.46157	1.445	0.25221	N	0.9899	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.996	T	0.67995	-0.5526	10	0.87932	D	0	-4.3342	11.4616	0.50213	0.0:0.0:1.0:0.0	.	242;290;194	Q8N7U2;Q8IY85;G3V128	.;CQ057_HUMAN;.	Q	290;194;242	ENSP00000332111:E290Q;ENSP00000430048:E194Q	ENSP00000332111:E290Q	E	+	1	0	C17orf57	42802864	1.000000	0.71417	0.989000	0.46669	0.345000	0.29048	2.297000	0.43593	2.122000	0.65172	0.591000	0.81541	GAG	EFCAB13	-	NULL	ENSG00000178852		0.279	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFCAB13	HGNC	protein_coding	OTTHUMT00000380147.4	-	0.00	58	0	G	NM_152347		45447865	+1	tier1	-	no_errors	ENST00000331493	ensembl	human	known	74_37	missense	18.52	44	10	SNP	1.000	C
EFCAB14	9813	genome.wustl.edu	37	1	47154135	47154135	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:47154135C>A	ENST00000371933.3	-	7	1853	c.877G>T	c.(877-879)Gag>Tag	p.E293*	EFCAB14_ENST00000484461.1_5'UTR|EFCAB14-AS1_ENST00000442839.1_RNA|EFCAB14-AS1_ENST00000418985.1_RNA|EFCAB14_ENST00000544071.1_Intron	NM_014774.2	NP_055589.1	O75071	EFC14_HUMAN	EF-hand calcium binding domain 14	293							calcium ion binding (GO:0005509)										TTCATTCCCTCGAGTTTAAGA	0.428																																																	0													235.0	186.0	202.0					1																	47154135		2203	4300	6503	SO:0001587	stop_gained	0			AB007963	CCDS30706.1	1p33	2013-01-10	2012-11-29	2012-11-29	ENSG00000159658	ENSG00000159658		"""EF-hand domain containing"""	29051	protein-coding gene	gene with protein product			"""KIAA0494"""	KIAA0494		9455484	Standard	NM_014774		Approved		uc001cqk.4	O75071	OTTHUMG00000007992	ENST00000371933.3:c.877G>T	1.37:g.47154135C>A	ENSP00000361001:p.Glu293*		D3DQ23|Q5SXB8	Nonsense_Mutation	SNP	pfscan_EF_hand_dom	p.E293*	ENST00000371933.3	37	c.877	CCDS30706.1	1	.	.	.	.	.	.	.	.	.	.	C	44	10.981510	0.99498	.	.	ENSG00000159658	ENST00000371933	.	.	.	5.3	-4.26	0.03755	.	0.686968	0.15278	N	0.270833	.	.	.	.	.	.	0.25935	N	0.982942	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-0.0193	4.2263	0.10582	0.1007:0.1762:0.1448:0.5784	.	.	.	.	X	293	.	ENSP00000361001:E293X	E	-	1	0	KIAA0494	46926722	0.000000	0.05858	0.933000	0.37362	0.945000	0.59286	-0.923000	0.04000	-0.590000	0.05866	0.561000	0.74099	GAG	EFCAB14	-	NULL	ENSG00000159658		0.428	EFCAB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB14	HGNC	protein_coding	OTTHUMT00000021931.1		0.00	54	0	C	NM_014774		47154135	-1			no_errors	ENST00000371933	ensembl	human	known	74_37	nonsense	5.26	72	4	SNP	0.400	A
EFNA3	1944	genome.wustl.edu	37	1	155057657	155057657	+	Silent	SNP	C	C	G	rs199552063	byFrequency	TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:155057657C>G	ENST00000368408.3	+	2	289	c.219C>G	c.(217-219)ccC>ccG	p.P73P	EFNA3_ENST00000505139.1_Silent_p.P68P|EFNA3_ENST00000418360.2_Silent_p.P73P|EFNA3_ENST00000556931.1_Silent_p.P68P	NM_004952.4	NP_004943.1	P52797	EFNA3_HUMAN	ephrin-A3	73	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.			Missing (in Ref. 2; AAA52368). {ECO:0000305}.	axon guidance (GO:0007411)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)	anchored component of membrane (GO:0031225)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		all cancers(21;5.67e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000284)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGGTgggccccggggcgggac	0.662																																																	0													19.0	25.0	23.0					1																	155057657		2168	4252	6420	SO:0001819	synonymous_variant	0			BC017722	CCDS1090.1	1q21-q22	2011-03-09			ENSG00000143590	ENSG00000143590		"""Ephrins"""	3223	protein-coding gene	gene with protein product		601381		EPLG3		8660976	Standard	NM_004952		Approved	LERK3, Ehk1-L	uc001fhf.3	P52797	OTTHUMG00000035313	ENST00000368408.3:c.219C>G	1.37:g.155057657C>G			B7ZAD3|D3DV85|Q0VGC9|Q5SR70	Silent	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.P73	ENST00000368408.3	37	c.219	CCDS1090.1	1																																																																																			EFNA3	-	pfam_Ephrin,superfamily_Cupredoxin	ENSG00000143590		0.662	EFNA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFNA3	HGNC	protein_coding	OTTHUMT00000085429.1		0.00	23	0	C	NM_004952		155057657	+1			no_errors	ENST00000368408	ensembl	human	known	74_37	silent	25.00	24	8	SNP	0.969	G
EML5	161436	genome.wustl.edu	37	14	89171240	89171240	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:89171240G>T	ENST00000380664.5	-	13	2014	c.2015C>A	c.(2014-2016)gCt>gAt	p.A672D	EML5_ENST00000352093.5_Missense_Mutation_p.A672D|EML5_ENST00000554922.1_Missense_Mutation_p.A672D			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	672						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						ATTTCCTGGAGCCCGCTCTCT	0.328																																																	0													161.0	143.0	149.0					14																	89171240		1808	4073	5881	SO:0001583	missense	0			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.2015C>A	14.37:g.89171240G>T	ENSP00000370039:p.Ala672Asp		B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A672D	ENST00000380664.5	37	c.2015	CCDS45148.1	14	.	.	.	.	.	.	.	.	.	.	G	21.1	4.098473	0.76870	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.34072	1.38;1.38;1.38	5.04	5.04	0.67666	HELP (1);	0.218004	0.38111	N	0.001814	T	0.58293	0.2112	M	0.83774	2.66	0.49915	D	0.99983	P	0.41102	0.738	P	0.54965	0.765	T	0.54002	-0.8358	10	0.14656	T	0.56	-10.7085	18.5812	0.91171	0.0:0.0:1.0:0.0	.	672	Q05BV3	EMAL5_HUMAN	D	672	ENSP00000451998:A672D;ENSP00000298315:A672D;ENSP00000370039:A672D	ENSP00000298315:A672D	A	-	2	0	EML5	88240993	1.000000	0.71417	0.971000	0.41717	0.954000	0.61252	9.188000	0.94921	2.615000	0.88500	0.557000	0.71058	GCT	EML5	-	pfam_HELP	ENSG00000165521		0.328	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	-	0.00	34	0	G			89171240	-1	tier1	-	no_errors	ENST00000554922	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	T
ENO4	387712	genome.wustl.edu	37	10	118633653	118633653	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:118633653G>T	ENST00000369207.2	+	7	753	c.577G>T	c.(577-579)Gtg>Ttg	p.V193L	ENO4_ENST00000341276.5_Missense_Mutation_p.V431L|ENO4_ENST00000409522.1_Intron			A6NNW6	ENO4_HUMAN	enolase family member 4	431	Pro-rich.				glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						TGACCTGTATGTGGATCTGAT	0.358																																																	0																																										SO:0001583	missense	0				CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000369207.2:c.577G>T	10.37:g.118633653G>T	ENSP00000358208:p.Val193Leu		B8ZZN9	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N	p.V431L	ENST00000369207.2	37	c.1291		10	.	.	.	.	.	.	.	.	.	.	G	15.49	2.848521	0.51164	.	.	ENSG00000188316	ENST00000341276;ENST00000369207	T;T	0.51574	0.7;0.7	5.95	5.95	0.96441	.	0.352958	0.29266	N	0.012657	T	0.61887	0.2383	M	0.73598	2.24	0.24603	N	0.993764	.	.	.	.	.	.	T	0.57493	-0.7802	8	0.36615	T	0.2	-10.4028	16.6176	0.84920	0.0:0.1298:0.8702:0.0	.	.	.	.	L	431;193	ENSP00000345555:V431L;ENSP00000358208:V193L	ENSP00000345555:V431L	V	+	1	0	ENO4	118623643	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	5.347000	0.65998	2.824000	0.97209	0.655000	0.94253	GTG	ENO4	-	pfam_Enolase_C	ENSG00000188316		0.358	ENO4-001	PUTATIVE	basic	protein_coding	ENO4	HGNC	protein_coding	OTTHUMT00000050552.2	-	0.00	69	0	G	NM_001242699		118633653	+1	tier1	-	no_errors	ENST00000341276	ensembl	human	known	74_37	missense	5.88	64	4	SNP	0.999	T
AC010150.2	0	genome.wustl.edu	37	2	25945154	25945154	+	RNA	DEL	T	T	-			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:25945154delT	ENST00000410138.1	+	0	94																											aacctaaTAATTTTGGCATGC	0.338																																																	0																																												0																															2.37:g.25945154delT				RNA	DEL	-	NULL	ENST00000410138.1	37	NULL		2																																																																																			AC010150.2	-	-	ENSG00000222070		0.338	AC010150.2-201	NOVEL	basic	miRNA	ENSG00000222070	Clone_based_ensembl_gene	miRNA			0.00	28	0	T			25945154	+1	tier1		no_errors	ENST00000410138	ensembl	human	novel	74_37	rna	6.25	30	2	DEL	0.000	-
ITIH4	3700	genome.wustl.edu	37	3	52864530	52864530	+	Intron	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:52864530C>T	ENST00000266041.4	-	1	187				RP5-966M1.6_ENST00000468472.1_Intron|ITIH4_ENST00000485816.1_Intron|ITIH4_ENST00000346281.5_Intron|RP5-966M1.6_ENST00000513520.1_5'UTR|ITIH4_ENST00000434759.3_Intron|ITIH4_ENST00000406595.1_Intron	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4						acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		GGCGTTCTCTCATCCCCCAGC	0.572																																																	0													100.0	94.0	96.0					3																	52864530		2203	4300	6503	SO:0001627	intron_variant	0			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.90+38G>A	3.37:g.52864530C>T			B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	RNA	SNP	-	NULL	ENST00000266041.4	37	NULL	CCDS2865.1	3																																																																																			RP5-966M1.6	-	-	ENSG00000243696		0.572	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000243696	Clone_based_vega_gene	protein_coding	OTTHUMT00000317715.1	-	0.00	65	0	C	NM_002218		52864530	-1	tier1	-	no_errors	ENST00000513520	ensembl	human	known	74_37	rna	41.67	21	15	SNP	0.000	T
RP11-146E13.4	0	genome.wustl.edu	37	14	19855220	19855220	+	lincRNA	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:19855220C>T	ENST00000548109.1	+	0	72																											CAGAGGCGTTCCCTGTACTGG	0.602																																																	0																																												0																															14.37:g.19855220C>T				RNA	SNP	-	NULL	ENST00000548109.1	37	NULL		14																																																																																			CTD-2314B22.3	-	-	ENSG00000244306		0.602	RP11-146E13.4-001	KNOWN	basic	lincRNA	ENSG00000244306	Clone_based_vega_gene	lincRNA	OTTHUMT00000409408.1	-	0.00	8	0	C			19855220	-1	tier1	-	no_errors	ENST00000551334	ensembl	human	known	74_37	rna	78.95	4	15	SNP	1.000	T
KLRC3	3823	genome.wustl.edu	37	12	10588462	10588462	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:10588462C>G	ENST00000539033.1	-	1	138	c.124G>C	c.(124-126)Gaa>Caa	p.E42Q	KLRC2_ENST00000381901.1_Missense_Mutation_p.E42Q|KLRC2_ENST00000536833.2_Intron|KLRC2_ENST00000381902.2_Missense_Mutation_p.E42Q														p.E42*(1)									AGATTTAATTCTACTTGGAAT	0.368																																																	1	Substitution - Nonsense(1)	ovary(1)											145.0	159.0	155.0					12																	10588462		2202	4299	6501	SO:0001583	missense	0																														ENST00000539033.1:c.124G>C	12.37:g.10588462C>G	ENSP00000437563:p.Glu42Gln			Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.E42Q	ENST00000539033.1	37	c.124		12	.	.	.	.	.	.	.	.	.	.	C	11.94	1.790114	0.31685	.	.	ENSG00000255641;ENSG00000205809;ENSG00000205809	ENST00000539033;ENST00000381902;ENST00000381901	T;T;T	0.05199	3.48;3.48;3.48	2.57	0.579	0.17397	.	0.445755	0.19718	N	0.107641	T	0.21674	0.0522	M	0.91920	3.255	0.09310	N	1	P;P;P	0.50819	0.867;0.939;0.919	P;P;P	0.58873	0.611;0.847;0.682	T	0.04650	-1.0936	10	0.87932	D	0	.	5.4666	0.16646	0.0:0.687:0.0:0.313	.	28;42;42	Q3KQS7;P26717;F5H6K3	.;NKG2C_HUMAN;.	Q	42	ENSP00000437563:E42Q;ENSP00000371327:E42Q;ENSP00000371326:E42Q	ENSP00000371326:E42Q	E	-	1	0	KLRC2;RP11-277P12.6	10479729	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	0.293000	0.19029	-0.003000	0.14444	-1.206000	0.01644	GAA	NKG2-E	-	NULL	ENSG00000255641		0.368	NKG2-E-001	KNOWN	basic|appris_principal|readthrough_transcript	protein_coding	ENSG00000255641	Uniprot_gn	protein_coding	OTTHUMT00000400274.1	-	0.00	113	0	C			10588462	-1	tier1	-	no_errors	ENST00000539033	ensembl	human	known	74_37	missense	10.46	137	16	SNP	0.000	G
RELT	84957	genome.wustl.edu	37	11	73107274	73107274	+	3'UTR	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:73107274G>T	ENST00000064780.2	+	0	2292				RP11-809N8.2_ENST00000544674.1_RNA|RELT_ENST00000393580.2_3'UTR	NM_152222.1	NP_689408.1	Q969Z4	TR19L_HUMAN	RELT tumor necrosis factor receptor							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	12						CCATGGCTCTGCCTACGGAAG	0.537																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF319553	CCDS8222.1	11q13.2	2013-05-22	2007-06-14	2007-06-14		ENSG00000054967		"""Tumor necrosis factor receptor superfamily"""	13764	protein-coding gene	gene with protein product		611211	"""tumor necrosis factor receptor superfamily, member 19-like"""	TNFRSF19L		11313261, 16547002, 16950202, 16389068	Standard	NM_032871		Approved	FLJ14993	uc001otv.3	Q969Z4		ENST00000064780.2:c.*738G>T	11.37:g.73107274G>T			Q86V34|Q96JU1|Q9BUX7	RNA	SNP	-	NULL	ENST00000064780.2	37	NULL	CCDS8222.1	11																																																																																			RP11-809N8.2	-	-	ENSG00000256928		0.537	RELT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000256928	Clone_based_vega_gene	protein_coding	OTTHUMT00000397380.2	-	0.00	33	0	G	NM_032871		73107274	-1	tier1	-	no_errors	ENST00000544674	ensembl	human	known	74_37	rna	72.22	5	13	SNP	0.002	T
CSF2RA	1438	genome.wustl.edu	37	X	1410990	1410990	+	Intron	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chrX:1410990C>T	ENST00000381524.3	+	7	832				CSF2RA_ENST00000501036.2_Intron|CSF2RA_ENST00000381500.1_Intron|CSF2RA_ENST00000361536.3_Intron|BX649553.2_ENST00000578699.1_RNA|CSF2RA_ENST00000417535.2_Intron|CSF2RA_ENST00000432318.2_Intron|CSF2RA_ENST00000381529.3_Intron|CSF2RA_ENST00000381509.3_Intron|BX649553.3_ENST00000581137.1_RNA|CSF2RA_ENST00000355805.2_Intron|BX649553.1_ENST00000583047.1_RNA|MIR3690_ENST00000580266.1_RNA|BX649553.4_ENST00000580687.1_RNA|CSF2RA_ENST00000355432.3_Intron|CSF2RA_ENST00000494969.2_Intron			P15509	CSF2R_HUMAN	colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)						response to ethanol (GO:0045471)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(6)|lung(21)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	45		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	CCCTGCACCACCTCCACCTGG	0.577																																					Esophageal Squamous(131;723 1707 25334 40494 41806)												0																																										SO:0001627	intron_variant	0			M64445	CCDS35190.1, CCDS35191.1, CCDS35192.1, CCDS35193.1, CCDS55359.1, CCDS55360.1, CCDS55361.1	Xp22.32 and Yp11.3	2014-09-17			ENSG00000198223	ENSG00000198223		"""CD molecules"", ""Pseudoautosomal regions / PAR1"""	2435	protein-coding gene	gene with protein product		306250, 425000		CSF2R		1702217	Standard	NM_006140		Approved	CD116	uc010ncv.2	P15509	OTTHUMG00000012533	ENST00000381524.3:c.646+1588C>T	X.37:g.1410990C>T			A7J003|A8KAM1|B4DW68|J3JS76|J3JS77|O00207|Q14429|Q14430|Q14431|Q16564	RNA	SNP	-	NULL	ENST00000381524.3	37	NULL	CCDS35191.1	X																																																																																			BX649553.4	-	-	ENSG00000264819		0.577	CSF2RA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000264819	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000035013.2	-	0.00	96	0	C			1410990	+1	tier1	-	no_errors	ENST00000580687	ensembl	human	novel	74_37	rna	11.36	78	10	SNP	0.737	T
SP9	100131390	genome.wustl.edu	37	2	175200929	175200929	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:175200929C>G	ENST00000394967.2	+	2	263	c.116C>G	c.(115-117)tCg>tGg	p.S39W	AC018470.1_ENST00000595354.1_Missense_Mutation_p.R408P	NM_001145250.1	NP_001138722.1	P0CG40	SP9_HUMAN	Sp9 transcription factor	39					embryonic limb morphogenesis (GO:0030326)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			lung(1)	1						CTGCCAGAGTCGAGCGCCTTC	0.682																																																	0													31.0	30.0	31.0					2																	175200929		692	1591	2283	SO:0001583	missense	0				CCDS46453.1	2q31.1	2013-01-08	2012-12-07		ENSG00000217236	ENSG00000217236		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	30690	protein-coding gene	gene with protein product	"""zinc finger protein 990"""		"""Sp9 transcription factor homolog (mouse)"""				Standard	NM_001145250		Approved	ZNF990	uc010zem.1	P0CG40	OTTHUMG00000150371	ENST00000394967.2:c.116C>G	2.37:g.175200929C>G	ENSP00000378418:p.Ser39Trp			Missense_Mutation	SNP	NULL	p.R408P	ENST00000394967.2	37	c.1223	CCDS46453.1	2	.	.	.	.	.	.	.	.	.	.	C	23.8	4.459019	0.84317	.	.	ENSG00000217236	ENST00000394967	T	0.12984	2.63	3.92	3.92	0.45320	.	.	.	.	.	T	0.25344	0.0616	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.70716	0.97	T	0.05305	-1.0893	9	0.66056	D	0.02	.	15.7269	0.77766	0.0:1.0:0.0:0.0	.	39	P0CG40	SP9_HUMAN	W	39	ENSP00000378418:S39W	ENSP00000378418:S39W	S	+	2	0	SP9	174909175	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.884000	0.69729	2.024000	0.59613	0.591000	0.81541	TCG	AC018470.1	-	NULL	ENSG00000268241		0.682	SP9-001	NOVEL	not_organism_supported|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000268241	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000317878.1		0.00	10	0	C	NM_001145250		175200929	-1			no_errors	ENST00000595354	ensembl	human	known	74_37	missense	27.27	8	3	SNP	1.000	G
EP400	57634	genome.wustl.edu	37	12	132547096	132547096	+	Silent	SNP	G	G	A	rs74479394|rs113304321	byFrequency	TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:132547096G>A	ENST00000333577.4	+	48	8401	c.8292G>A	c.(8290-8292)caG>caA	p.Q2764Q	EP400_ENST00000389561.2_Silent_p.Q2728Q|EP400_ENST00000332482.4_Silent_p.Q2691Q|EP400_ENST00000389562.2_Silent_p.Q2727Q|EP400_ENST00000330386.6_Silent_p.Q2647Q			Q96L91	EP400_HUMAN	E1A binding protein p400	2764	Interaction with ZNF42. {ECO:0000250}.|Poly-Gln.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		agcaacaacagcagcagcagc	0.567													G|||	734	0.146565	0.3215	0.0432	5008	,	,		15582	0.1111		0.0417	False		,,,				2504	0.1278																0								G		0,4324		0,0,2162	24.0	29.0	27.0		8184	0.5	0.9	12	dbSNP_131	27	1,8349		0,1,4174	no	coding-synonymous	EP400	NM_015409.4		0,1,6336	AA,AG,GG		0.012,0.0,0.0079		2728/3124	132547096	1,12673	2162	4175	6337	SO:0001819	synonymous_variant	0			U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.8292G>A	12.37:g.132547096G>A			O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	pfam_SNF2_N,pfam_Helicase/SANT-assoc_DNA-bd,pfam_Helicase_C,superfamily_P-loop_NTPase,superfamily_Homeodomain-like,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Myb-like_dom,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q2764	ENST00000333577.4	37	c.8292		12																																																																																			EP400	-	NULL	ENSG00000183495		0.567	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	EP400	HGNC	protein_coding		-	0.00	37	0	G	NM_015409		132547096	+1	tier1	rs74479394	no_errors	ENST00000333577	ensembl	human	known	74_37	silent	9.84	55	6	SNP	0.957	A
EPG5	57724	genome.wustl.edu	37	18	43496415	43496415	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr18:43496415G>A	ENST00000282041.5	-	18	3406	c.3372C>T	c.(3370-3372)aaC>aaT	p.N1124N	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1124					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GGATCATGCTGTTGAGAAGCT	0.557																																																	0													86.0	91.0	89.0					18																	43496415		2091	4218	6309	SO:0001819	synonymous_variant	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.3372C>T	18.37:g.43496415G>A			A2BDF3|Q9H8C8	Silent	SNP	NULL	p.N1124	ENST00000282041.5	37	c.3372	CCDS11926.2	18																																																																																			EPG5	-	NULL	ENSG00000152223		0.557	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1		0.00	39	0	G	NM_020964		43496415	-1			no_errors	ENST00000282041	ensembl	human	known	74_37	silent	5.00	38	2	SNP	1.000	A
ERN2	10595	genome.wustl.edu	37	16	23718123	23718123	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:23718123G>T	ENST00000457008.2	-	6	477	c.439C>A	c.(439-441)Ctg>Atg	p.L147M	ERN2_ENST00000256797.4_Missense_Mutation_p.L195M					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		TCTGTGGTCAGTGTCATCTGG	0.602																																																	0													50.0	48.0	49.0					16																	23718123		2197	4300	6497	SO:0001583	missense	0			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.439C>A	16.37:g.23718123G>T	ENSP00000413812:p.Leu147Met			Missense_Mutation	SNP	pfam_KEN_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like_supfam,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_dom	p.L195M	ENST00000457008.2	37	c.583		16	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587986	0.46110	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.59638	0.25;0.25	5.73	3.78	0.43462	Quinonprotein alcohol dehydrogenase-like (2);	0.000000	0.64402	D	0.000001	T	0.72827	0.3509	M	0.73598	2.24	0.50039	D	0.999847	D;D;P	0.89917	0.999;1.0;0.947	D;D;P	0.87578	0.971;0.998;0.74	T	0.73177	-0.4065	10	0.56958	D	0.05	.	10.5799	0.45248	0.1575:0.0:0.8425:0.0	.	147;147;147	Q76MJ5;E7ETG2;A5YM65	ERN2_HUMAN;.;.	M	195;147	ENSP00000256797:L195M;ENSP00000413812:L147M	ENSP00000256797:L195M	L	-	1	2	ERN2	23625624	0.975000	0.34042	0.958000	0.39756	0.862000	0.49288	1.700000	0.37815	0.781000	0.33589	-0.252000	0.11476	CTG	ERN2	-	superfamily_Quinonprotein_ADH-like_supfam,smart_PQQ_beta_propeller_repeat	ENSG00000134398		0.602	ERN2-002	NOVEL	basic|exp_conf	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000434886.1		0.00	42	0	G			23718123	-1			no_errors	ENST00000256797	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.959	T
ESX1	80712	genome.wustl.edu	37	X	103495090	103495090	+	Missense_Mutation	SNP	G	G	C	rs200088361		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chrX:103495090G>C	ENST00000372588.4	-	4	1123	c.1040C>G	c.(1039-1041)cCt>cGt	p.P347R		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	347	15 X 9 AA tandem repeats of P-P-x-x-P-x- P-P-x.				labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)	p.P347R(1)		endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						GGGTGGCAGAGGCGCCATGGG	0.796																																					Pancreas(200;1705 2227 25194 28471 45274)												1	Substitution - Missense(1)	skin(1)											2.0	3.0	3.0					X																	103495090		902	2342	3244	SO:0001583	missense	0			AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.1040C>G	X.37:g.103495090G>C	ENSP00000361669:p.Pro347Arg		B0QYU3|Q7Z6K7	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom,prints_POU	p.P347R	ENST00000372588.4	37	c.1040	CCDS14516.1	X	.	.	.	.	.	.	.	.	.	.	G	12.24	1.879915	0.33162	.	.	ENSG00000123576	ENST00000372588	T	0.62788	0.0	3.19	2.27	0.28462	.	.	.	.	.	T	0.65984	0.2744	L	0.43923	1.385	0.09310	N	1	D	0.69078	0.997	D	0.63488	0.915	T	0.52275	-0.8597	9	0.31617	T	0.26	-7.6561	8.3413	0.32245	0.1439:0.0:0.8561:0.0	.	347	Q8N693	ESX1_HUMAN	R	347	ENSP00000361669:P347R	ENSP00000361669:P347R	P	-	2	0	ESX1	103381746	0.731000	0.28111	0.047000	0.18901	0.019000	0.09904	0.954000	0.29175	1.347000	0.45714	0.483000	0.47432	CCT	ESX1	-	NULL	ENSG00000123576		0.796	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESX1	HGNC	protein_coding	OTTHUMT00000057763.2		0.00	17	0	G	NM_153448		103495090	-1			no_errors	ENST00000372588	ensembl	human	known	74_37	missense	13.95	37	6	SNP	0.116	C
EVC2	132884	genome.wustl.edu	37	4	5642402	5642402	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:5642402G>T	ENST00000344408.5	-	10	1362	c.1309C>A	c.(1309-1311)Cta>Ata	p.L437I	EVC2_ENST00000344938.1_Missense_Mutation_p.L437I|EVC2_ENST00000310917.2_Missense_Mutation_p.L357I	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	437					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.L437V(1)		NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						TCCAGCAATAGAAACTGCTTT	0.428																																																	1	Substitution - Missense(1)	prostate(1)											207.0	198.0	201.0					4																	5642402		2203	4300	6503	SO:0001583	missense	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1309C>A	4.37:g.5642402G>T	ENSP00000342144:p.Leu437Ile		Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_Limbin	p.L437I	ENST00000344408.5	37	c.1309	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	G	6.245	0.413317	0.11812	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.80994	-1.44;-1.44;-1.44	4.25	2.33	0.28932	.	0.064419	0.64402	D	0.000018	T	0.78413	0.4279	L	0.60455	1.87	0.21220	N	0.999756	P	0.47034	0.889	P	0.46758	0.526	T	0.68554	-0.5378	10	0.41790	T	0.15	-4.3873	9.8567	0.41090	0.0:0.1291:0.6033:0.2677	.	437	Q86UK5	LBN_HUMAN	I	437;357;437	ENSP00000339954:L437I;ENSP00000311683:L357I;ENSP00000342144:L437I	ENSP00000311683:L357I	L	-	1	2	EVC2	5693303	1.000000	0.71417	0.996000	0.52242	0.151000	0.21798	2.153000	0.42282	0.365000	0.24400	-1.378000	0.01179	CTA	EVC2	-	pfam_Limbin	ENSG00000173040		0.428	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2		0.00	42	0	G	NM_147127		5642402	-1			no_errors	ENST00000344408	ensembl	human	known	74_37	missense	5.26	36	2	SNP	0.548	T
F11	2160	genome.wustl.edu	37	4	187208943	187208943	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:187208943C>T	ENST00000403665.2	+	14	2034	c.1682C>T	c.(1681-1683)gCc>gTc	p.A561V	F11_ENST00000264692.4_Missense_Mutation_p.A509V|F11-AS1_ENST00000505103.1_RNA	NM_000128.3	NP_000119.1	P03951	FA11_HUMAN	coagulation factor XI	561	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	32		all_cancers(14;6.2e-52)|all_epithelial(14;1.62e-38)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;2.13e-11)|BRCA - Breast invasive adenocarcinoma(30;4.59e-06)|GBM - Glioblastoma multiforme(59;0.000149)|STAD - Stomach adenocarcinoma(60;0.000314)|LUSC - Lung squamous cell carcinoma(40;0.00112)|READ - Rectum adenocarcinoma(43;0.176)	Coagulation Factor IX(DB00100)	ATGATCTGTGCCGGCTACAGG	0.428																																																	0													125.0	124.0	124.0					4																	187208943		2203	4300	6503	SO:0001583	missense	0			M13142	CCDS3847.1	4q35	2008-08-01	2008-08-01		ENSG00000088926	ENSG00000088926	3.4.21.27		3529	protein-coding gene	gene with protein product	"""plasma thromboplastin antecedent"""	264900					Standard	NM_000128		Approved	FXI	uc003iza.1	P03951	OTTHUMG00000150311	ENST00000403665.2:c.1682C>T	4.37:g.187208943C>T	ENSP00000384957:p.Ala561Val		D3DP64|Q4W5C2|Q9Y495	Missense_Mutation	SNP	pfam_Peptidase_S1,pfam_PAN-1_domain,superfamily_Trypsin-like_Pept_dom,smart_Apple,smart_Peptidase_S1,pfscan_Pan_app,pfscan_Peptidase_S1,prints_Apple,prints_Peptidase_S1A	p.A561V	ENST00000403665.2	37	c.1682	CCDS3847.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.23|18.23	3.577465|3.577465	0.65878|0.65878	.|.	.|.	ENSG00000088926|ENSG00000088926	ENST00000403665;ENST00000264692|ENST00000264691	D;D|.	0.94966|.	-3.57;-3.57|.	4.77|4.77	4.77|4.77	0.60923|0.60923	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);|.	0.000000|.	0.64402|.	D|.	0.000002|.	T|T	0.77471|0.77471	0.4135|0.4135	M|M	0.78344|0.78344	2.41|2.41	0.58432|0.58432	D|D	0.999999|0.999999	P|.	0.35807|.	0.522|.	B|.	0.35770|.	0.21|.	T|T	0.78130|0.78130	-0.2324|-0.2324	10|5	0.87932|.	D|.	0|.	.|.	18.3386|18.3386	0.90297|0.90297	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	561|.	P03951|.	FA11_HUMAN|.	V|S	561;509|95	ENSP00000384957:A561V;ENSP00000264692:A509V|.	ENSP00000264692:A509V|.	A|P	+|+	2|1	0|0	F11|F11	187445937|187445937	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.207000|0.207000	0.24258|0.24258	6.873000|6.873000	0.75541|0.75541	2.620000|2.620000	0.88729|0.88729	0.561000|0.561000	0.74099|0.74099	GCC|CCG	F11	-	pfam_Peptidase_S1,superfamily_Trypsin-like_Pept_dom,smart_Peptidase_S1,pfscan_Peptidase_S1	ENSG00000088926		0.428	F11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F11	HGNC	protein_coding	OTTHUMT00000317519.4	-	0.00	45	0	C			187208943	+1	tier1	-	no_errors	ENST00000403665	ensembl	human	known	74_37	missense	6.85	68	5	SNP	1.000	T
FAM104A	84923	genome.wustl.edu	37	17	71205859	71205861	+	In_Frame_Del	DEL	TGC	TGC	-	rs141426163	byFrequency	TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	TGC	TGC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:71205859_71205861delTGC	ENST00000403627.3	-	3	428_430	c.368_370delGCA	c.(367-372)agcatc>atc	p.S123del	FAM104A_ENST00000405159.3_In_Frame_Del_p.S144del|FAM104A_ENST00000583178.1_5'UTR|FAM104A_ENST00000583024.1_In_Frame_Del_p.A96del|FAM104A_ENST00000580032.1_In_Frame_Del_p.S33del|FAM104A_ENST00000581110.1_In_Frame_Del_p.A90del	NM_032837.2	NP_116226.2	Q969W3	F104A_HUMAN	family with sequence similarity 104, member A	123	Ser-rich.									endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6			LUSC - Lung squamous cell carcinoma(166;0.197)			GGGCTATTGAtgctgctgctgct	0.596																																																	0																																										SO:0001651	inframe_deletion	0			AK027681	CCDS11693.2, CCDS45766.1, CCDS74143.1, CCDS74144.1	17q25.1	2005-12-16			ENSG00000133193	ENSG00000133193			25918	protein-coding gene	gene with protein product							Standard	NM_032837		Approved	FLJ14775	uc002jjj.4	Q969W3	OTTHUMG00000150564	ENST00000403627.3:c.368_370delGCA	17.37:g.71205868_71205870delTGC	ENSP00000384648:p.Ser123del		B4E339	In_Frame_Del	DEL	NULL	p.S144in_frame_del	ENST00000403627.3	37	c.433_431	CCDS11693.2	17																																																																																			FAM104A	-	NULL	ENSG00000133193		0.596	FAM104A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM104A	HGNC	protein_coding	OTTHUMT00000318935.1		0.00	51	0	TGC	NM_032837		71205861	-1	tier1		no_errors	ENST00000405159	ensembl	human	known	74_37	in_frame_del	11.43	31	4	DEL	1.000:1.000:1.000	-
FAM129A	116496	genome.wustl.edu	37	1	184792837	184792837	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:184792837G>C	ENST00000367511.3	-	7	950	c.757C>G	c.(757-759)Ctt>Gtt	p.L253V	RNU7-13P_ENST00000516413.1_RNA|FAM129A_ENST00000487074.1_Intron	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	253					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						TCTGTCTGAAGAGTGGGCAGG	0.527																																																	0													128.0	114.0	119.0					1																	184792837		2203	4300	6503	SO:0001583	missense	0			AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.757C>G	1.37:g.184792837G>C	ENSP00000356481:p.Leu253Val		Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	NULL	p.L253V	ENST00000367511.3	37	c.757	CCDS1364.1	1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787743	0.90367	.	.	ENSG00000135842	ENST00000367511	T	0.21543	2.0	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.49762	0.1576	M	0.78049	2.395	0.58432	D	0.999992	D	0.89917	1.0	D	0.83275	0.996	T	0.41963	-0.9479	10	0.45353	T	0.12	-18.8693	18.1565	0.89693	0.0:0.0:1.0:0.0	.	253	Q9BZQ8	NIBAN_HUMAN	V	253	ENSP00000356481:L253V	ENSP00000356481:L253V	L	-	1	0	FAM129A	183059460	1.000000	0.71417	0.908000	0.35775	0.942000	0.58702	6.419000	0.73345	2.713000	0.92767	0.655000	0.94253	CTT	FAM129A	-	NULL	ENSG00000135842		0.527	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129A	HGNC	protein_coding	OTTHUMT00000085786.1	-	0.00	32	0	G			184792837	-1	tier1	-	no_errors	ENST00000367511	ensembl	human	known	74_37	missense	18.75	39	9	SNP	0.999	C
FAM155A	728215	genome.wustl.edu	37	13	108518473	108518473	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr13:108518473G>C	ENST00000375915.2	-	1	610	c.472C>G	c.(472-474)Cta>Gta	p.L158V		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	158						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						GAGTTTCCTAGAAAAAGAGCC	0.697																																																	0													15.0	21.0	19.0					13																	108518473		2162	4207	6369	SO:0001583	missense	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.472C>G	13.37:g.108518473G>C	ENSP00000365080:p.Leu158Val		B2RUV1|B7Z334	Missense_Mutation	SNP	NULL	p.L158V	ENST00000375915.2	37	c.472	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.102011	0.00360	.	.	ENSG00000204442	ENST00000375915	T	0.10099	2.91	5.59	4.75	0.60458	.	0.297796	0.26983	N	0.021520	T	0.08846	0.0219	L	0.27053	0.805	0.25853	N	0.983913	B	0.30914	0.3	B	0.33454	0.164	T	0.28299	-1.0048	10	0.16420	T	0.52	.	13.5589	0.61777	0.0744:0.0:0.9256:0.0	.	158	B1AL88	F155A_HUMAN	V	158	ENSP00000365080:L158V	ENSP00000365080:L158V	L	-	1	2	FAM155A	107316474	1.000000	0.71417	0.982000	0.44146	0.017000	0.09413	3.329000	0.52060	1.378000	0.46305	0.561000	0.74099	CTA	FAM155A	-	NULL	ENSG00000204442		0.697	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	-	0.00	38	0	G	NM_001080396		108518473	-1	tier1	-	no_errors	ENST00000375915	ensembl	human	known	74_37	missense	30.77	36	16	SNP	1.000	C
FAM196B	100131897	genome.wustl.edu	37	5	169310792	169310792	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:169310792C>T	ENST00000377365.3	-	2	1492	c.111G>A	c.(109-111)gtG>gtA	p.V37V	DOCK2_ENST00000540750.1_Intron|FAM196B_ENST00000523970.1_5'Flank|DOCK2_ENST00000256935.8_Intron|DOCK2_ENST00000523351.1_Intron|DOCK2_ENST00000520908.1_Intron	NM_001129891.1	NP_001123363.1	A6NMK8	F196B_HUMAN	family with sequence similarity 196, member B	37										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)	5						CCTTGAATCTCACCTGCTGGG	0.483																																																	0													80.0	79.0	79.0					5																	169310792		692	1591	2283	SO:0001819	synonymous_variant	0				CCDS47336.1	5q35.1	2010-02-17	2009-09-11	2009-09-11	ENSG00000204767	ENSG00000204767			37271	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 57"""	C5orf57			Standard	NM_001129891		Approved		uc003mag.2	A6NMK8	OTTHUMG00000163083	ENST00000377365.3:c.111G>A	5.37:g.169310792C>T				Silent	SNP	NULL	p.V37	ENST00000377365.3	37	c.111	CCDS47336.1	5																																																																																			FAM196B	-	NULL	ENSG00000204767		0.483	FAM196B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM196B	HGNC	protein_coding	OTTHUMT00000371629.1	-	0.00	29	0	C	NM_001129891		169310792	-1	tier1	-	no_errors	ENST00000377365	ensembl	human	known	74_37	silent	18.75	39	9	SNP	0.906	T
FAM49A	81553	genome.wustl.edu	37	2	16769367	16769367	+	Silent	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:16769367G>C	ENST00000381323.3	-	3	241	c.21C>G	c.(19-21)gtC>gtG	p.V7V	FAM49A_ENST00000355549.2_Silent_p.V7V|FAM49A_ENST00000406434.1_Silent_p.V7V	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	7						intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			CCCTGGTAAGGACTTTGAGCA	0.343																																																	0													48.0	49.0	49.0					2																	16769367		2203	4300	6503	SO:0001819	synonymous_variant	0			AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.21C>G	2.37:g.16769367G>C			B3KNZ1|Q53QW2	Silent	SNP	pfam_DUF1394	p.V7	ENST00000381323.3	37	c.21	CCDS1688.1	2																																																																																			FAM49A	-	NULL	ENSG00000197872		0.343	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49A	HGNC	protein_coding	OTTHUMT00000207203.2	-	0.00	66	0	G	NM_030797		16769367	-1	tier1	-	no_errors	ENST00000355549	ensembl	human	known	74_37	silent	11.94	59	8	SNP	1.000	C
FAM83G	644815	genome.wustl.edu	37	17	18907093	18907093	+	Nonsense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:18907093G>A	ENST00000388995.6	-	2	485	c.262C>T	c.(262-264)Cag>Tag	p.Q88*	FAM83G_ENST00000585154.2_Nonsense_Mutation_p.Q88*|SLC5A10_ENST00000395647.2_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000395645.3_Intron|SLC5A10_ENST00000317977.6_Intron|SLC5A10_ENST00000417251.2_Intron|FAM83G_ENST00000345041.4_Nonsense_Mutation_p.Q88*|SLC5A10_ENST00000395643.2_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	88					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						TCGGGCCCCTGAGAGGGGCCC	0.701																																																	0																																										SO:0001587	stop_gained	0			AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.262C>T	17.37:g.18907093G>A	ENSP00000373647:p.Gln88*		Q3KQZ4|Q6ZW60	Nonsense_Mutation	SNP	pfam_DUF1669	p.Q88*	ENST00000388995.6	37	c.262	CCDS42276.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.087375	0.97271	.	.	ENSG00000188522	ENST00000388995;ENST00000345041;ENST00000399096	.	.	.	4.79	1.22	0.21188	.	7.777730	0.00589	U	0.000352	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	-3.6454	8.642	0.33983	0.0993:0.2826:0.6181:0.0	.	.	.	.	X	88	.	ENSP00000343279:Q88X	Q	-	1	0	FAM83G	18847818	0.000000	0.05858	0.004000	0.12327	0.305000	0.27757	0.222000	0.17699	0.985000	0.38656	0.491000	0.48974	CAG	FAM83G	-	pfam_DUF1669	ENSG00000188522		0.701	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM83G	HGNC	protein_coding	OTTHUMT00000253108.4	-	0.00	54	0	G			18907093	-1	tier1	-	no_errors	ENST00000345041	ensembl	human	known	74_37	nonsense	21.92	57	16	SNP	0.000	A
FANCD2OS	115795	genome.wustl.edu	37	3	10146306	10146306	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:10146306G>T	ENST00000450660.2	-	2	369	c.153C>A	c.(151-153)tgC>tgA	p.C51*	FANCD2OS_ENST00000524279.1_Nonsense_Mutation_p.C51*	NM_001164839.1	NP_001158311.1	Q96PS1	FACOS_HUMAN	FANCD2 opposite strand	51																	CCTCTTGAAAGCACAGCTGCA	0.552																																																	0													165.0	162.0	163.0					3																	10146306		2203	4300	6503	SO:0001587	stop_gained	0			AF230334	CCDS2596.1	3p25.3	2012-11-12	2012-11-12	2012-11-12	ENSG00000163705	ENSG00000163705			28623	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 24"""	C3orf24		12477932	Standard	NM_001164839		Approved	MGC40179	uc003buz.3	Q96PS1	OTTHUMG00000128669	ENST00000450660.2:c.153C>A	3.37:g.10146306G>T	ENSP00000429608:p.Cys51*			Nonsense_Mutation	SNP	NULL	p.C51*	ENST00000450660.2	37	c.153	CCDS2596.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.631950	0.96682	.	.	ENSG00000163705	ENST00000524279;ENST00000453223;ENST00000450660	.	.	.	5.62	1.72	0.24424	.	0.147778	0.47455	D	0.000227	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.5224	0.33285	0.3375:0.0:0.6625:0.0	.	.	.	.	X	51;49;51	.	ENSP00000429608:C51X	C	-	3	2	C3orf24	10121306	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	0.858000	0.27845	0.038000	0.15604	0.558000	0.71614	TGC	FANCD2OS	-	NULL	ENSG00000163705		0.552	FANCD2OS-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2OS	HGNC	protein_coding	OTTHUMT00000339891.2	-	0.00	32	0	G	NM_173472		10146306	-1	tier1	-	no_errors	ENST00000450660	ensembl	human	known	74_37	nonsense	7.84	47	4	SNP	1.000	T
FAT4	79633	genome.wustl.edu	37	4	126242132	126242132	+	Silent	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:126242132C>A	ENST00000394329.3	+	1	4579	c.4566C>A	c.(4564-4566)ctC>ctA	p.L1522L		NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1522	Cadherin 14. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						TTACAGACCTCAATGACAATG	0.433																																																	0													167.0	153.0	157.0					4																	126242132		1949	4149	6098	SO:0001819	synonymous_variant	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.4566C>A	4.37:g.126242132C>A			A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd_dom,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl_sf,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.L1522	ENST00000394329.3	37	c.4566	CCDS3732.3	4																																																																																			FAT4	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.433	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	-	0.00	18	0	C	NM_024582		126242132	+1	tier1	-	no_errors	ENST00000394329	ensembl	human	known	74_37	silent	19.05	17	4	SNP	1.000	A
FBXL7	23194	genome.wustl.edu	37	5	15937134	15937134	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:15937134G>T	ENST00000504595.1	+	4	1796	c.1315G>T	c.(1315-1317)Gag>Tag	p.E439*	FBXL7_ENST00000329673.7_Nonsense_Mutation_p.E427*|FBXL7_ENST00000510662.1_Nonsense_Mutation_p.E392*|MIR887_ENST00000401258.1_RNA	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	439					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						CAAGTCCTGCGAGAGCATCAC	0.617																																																	0													56.0	60.0	58.0					5																	15937134		2069	4219	6288	SO:0001587	stop_gained	0			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.1315G>T	5.37:g.15937134G>T	ENSP00000423630:p.Glu439*		B9EGF1|D6RDY7|O94926	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_F-box_dom,superfamily_F-box_dom,smart_F-box_dom,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom	p.E439*	ENST00000504595.1	37	c.1315	CCDS54833.1	5	.	.	.	.	.	.	.	.	.	.	G	29.3	4.998259	0.93227	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	.	.	.	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	.	19.109	0.93309	0.0:0.0:1.0:0.0	.	.	.	.	X	439;392;427	.	ENSP00000329632:E427X	E	+	1	0	FBXL7	15990134	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.511000	0.98006	2.525000	0.85131	0.655000	0.94253	GAG	FBXL7	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000183580		0.617	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL7	HGNC	protein_coding	OTTHUMT00000366117.1		0.00	17	0	G	NM_012304		15937134	+1			no_errors	ENST00000504595	ensembl	human	known	74_37	nonsense	5.56	51	3	SNP	1.000	T
FCRLB	127943	genome.wustl.edu	37	1	161693354	161693354	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:161693354C>T	ENST00000367948.2	+	5	465	c.250C>T	c.(250-252)Cga>Tga	p.R84*	FCRLB_ENST00000367946.3_Nonsense_Mutation_p.R84*|FCRLB_ENST00000392158.1_Nonsense_Mutation_p.R84*|FCRLB_ENST00000336830.5_Nonsense_Mutation_p.R84*|FCRLB_ENST00000367944.3_Nonsense_Mutation_p.R77*|FCRLB_ENST00000367945.1_Nonsense_Mutation_p.R77*			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	84	Ig-like C2-type 1.				negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			AGGGGTGTATCGATGCCAGAC	0.592																																																	0													89.0	79.0	83.0					1																	161693354		2203	4300	6503	SO:0001587	stop_gained	0			AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.250C>T	1.37:g.161693354C>T	ENSP00000356925:p.Arg84*		A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	Nonsense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like_dom	p.R84*	ENST00000367948.2	37	c.250	CCDS30927.1	1	.	.	.	.	.	.	.	.	.	.	C	38	7.222844	0.98146	.	.	ENSG00000162746	ENST00000367948;ENST00000367946;ENST00000367945;ENST00000336830;ENST00000367944;ENST00000392158	.	.	.	5.61	3.72	0.42706	.	0.000000	0.44285	D	0.000462	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8371	0.52330	0.2689:0.7311:0.0:0.0	.	.	.	.	X	84;84;77;84;77;84	.	ENSP00000338598:R84X	R	+	1	2	FCRLB	159959978	0.997000	0.39634	0.999000	0.59377	0.998000	0.95712	0.886000	0.28241	0.701000	0.31803	0.655000	0.94253	CGA	FCRLB	-	smart_Ig_sub,pfscan_Ig-like_dom	ENSG00000162746		0.592	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCRLB	HGNC	protein_coding	OTTHUMT00000083585.1		0.00	35	0	C	NM_152378		161693354	+1			no_errors	ENST00000367948	ensembl	human	known	74_37	nonsense	5.00	38	2	SNP	1.000	T
FLII	2314	genome.wustl.edu	37	17	18150102	18150102	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:18150102C>G	ENST00000327031.4	-	23	3082	c.2857G>C	c.(2857-2859)Gaa>Caa	p.E953Q	FLII_ENST00000379450.4_Missense_Mutation_p.E867Q|FLII_ENST00000579294.1_Missense_Mutation_p.E942Q|FLII_ENST00000545457.2_Missense_Mutation_p.E898Q|FLII_ENST00000578558.1_Intron	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	953	Glu-rich.				multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					tccttgtcttccttcttttcc	0.602																																																	0													126.0	111.0	116.0					17																	18150102		2203	4300	6503	SO:0001583	missense	0			U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.2857G>C	17.37:g.18150102C>G	ENSP00000324573:p.Glu953Gln		B4DIL0|F5H407|J3QLG3	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Villin/Gelsolin,prints_Villin/Gelsolin	p.E953Q	ENST00000327031.4	37	c.2857	CCDS11192.1	17	.	.	.	.	.	.	.	.	.	.	C	5.532	0.283069	0.10458	.	.	ENSG00000177731	ENST00000327031;ENST00000545457;ENST00000379450	T;T	0.40756	1.02;1.13	5.56	-1.08	0.09936	.	1.490010	0.04339	N	0.353809	T	0.29749	0.0743	N	0.24115	0.695	0.19575	N	0.999964	B;B;B;B;B	0.22604	0.012;0.012;0.009;0.072;0.012	B;B;B;B;B	0.24155	0.006;0.006;0.023;0.051;0.006	T	0.25328	-1.0135	10	0.23302	T	0.38	-0.0274	9.7132	0.40258	0.0:0.3743:0.0:0.6257	.	867;867;832;953;922	E7EPM0;B4DIL0;F5H407;Q13045;B4DIX0	.;.;.;FLII_HUMAN;.	Q	953;832;867	ENSP00000324573:E953Q;ENSP00000368763:E867Q	ENSP00000324573:E953Q	E	-	1	0	FLII	18090827	0.000000	0.05858	0.001000	0.08648	0.033000	0.12548	-0.379000	0.07437	0.055000	0.16094	-0.218000	0.12543	GAA	FLII	-	smart_Villin/Gelsolin	ENSG00000177731		0.602	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLII	HGNC	protein_coding	OTTHUMT00000132032.2	-	0.00	23	0	C	NM_002018		18150102	-1	tier1	-	no_errors	ENST00000327031	ensembl	human	known	74_37	missense	15.15	28	5	SNP	0.062	G
FLT3	2322	genome.wustl.edu	37	13	28626732	28626732	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr13:28626732G>A	ENST00000241453.7	-	5	645	c.564C>T	c.(562-564)agC>agT	p.S188S	FLT3_ENST00000537084.1_Silent_p.S188S|FLT3_ENST00000380982.4_Silent_p.S188S	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	188					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	GCTCTGGAACGCTCTCAGATA	0.433			"""Mis, O"""		"""AML, ALL"""																																			Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	0													133.0	124.0	127.0					13																	28626732		2203	4300	6503	SO:0001819	synonymous_variant	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.564C>T	13.37:g.28626732G>A			A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.S188	ENST00000241453.7	37	c.564	CCDS31953.1	13																																																																																			FLT3	-	NULL	ENSG00000122025		0.433	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	HGNC	protein_coding	OTTHUMT00000044319.2	-	0.00	49	0	G			28626732	-1	tier1	-	no_errors	ENST00000380982	ensembl	human	known	74_37	silent	44.64	31	25	SNP	0.059	A
FOXK1	221937	genome.wustl.edu	37	7	4800867	4800867	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:4800867C>T	ENST00000328914.4	+	8	1869	c.1869C>T	c.(1867-1869)acC>acT	p.T623T	FOXK1_ENST00000446823.1_Silent_p.T460T	NM_001037165.1	NP_001032242.1			forkhead box K1											breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;7.43e-15)		GGGCCGTGACCCAGAACGGAA	0.662																																																	0													48.0	46.0	47.0					7																	4800867		2203	4300	6503	SO:0001819	synonymous_variant	0			BK004104	CCDS34591.1	7p22	2006-12-15			ENSG00000164916	ENSG00000164916		"""Forkhead boxes"""	23480	protein-coding gene	gene with protein product						15202027	Standard	NM_001037165		Approved	IMAGE:5164497	uc003snc.1	P85037	OTTHUMG00000151739	ENST00000328914.4:c.1869C>T	7.37:g.4800867C>T				Silent	SNP	pfam_TF_fork_head,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_TF_fork_head,pfscan_FHA_dom,pfscan_TF_fork_head,prints_TF_fork_head	p.T623	ENST00000328914.4	37	c.1869	CCDS34591.1	7																																																																																			FOXK1	-	NULL	ENSG00000164916		0.662	FOXK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXK1	HGNC	protein_coding	OTTHUMT00000323729.2	-	0.00	93	0	C			4800867	+1	tier1	-	no_errors	ENST00000328914	ensembl	human	known	74_37	silent	13.22	105	16	SNP	0.177	T
FPR2	2358	genome.wustl.edu	37	19	52272700	52272700	+	Silent	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:52272700G>T	ENST00000598776.1	+	2	1561	c.789G>T	c.(787-789)ctG>ctT	p.L263L	FPR2_ENST00000598953.1_Silent_p.L263L|FPR2_ENST00000340023.6_Silent_p.L263L	NM_001462.3	NP_001453.1	P25090	FPR2_HUMAN	formyl peptide receptor 2	263					cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|N-formyl peptide receptor activity (GO:0004982)			endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	33						TTGCCCTTCTGGGCACCGTCT	0.498																																																	0													122.0	103.0	109.0					19																	52272700		2203	4300	6503	SO:0001819	synonymous_variant	0			M88107	CCDS12840.1	19q13.3-q13.4	2012-08-10	2008-04-17	2008-04-17		ENSG00000171049		"""GPCR / Class A : Formyl peptide receptors"", ""GPCR / Class A : Leukotriene receptors"""	3827	protein-coding gene	gene with protein product		136538	"""formyl peptide receptor-like 1"""	FPRL1		9054386	Standard	NM_001462		Approved	LXA4R, HM63, FPRH2, FMLPX, FPR2A, FMLP-R-II, ALXR	uc002pxr.3	P25090		ENST00000598776.1:c.789G>T	19.37:g.52272700G>T			A8K3E2	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Formyl_pep_rcpt,prints_GPCR_Rhodpsn,prints_Anphylx_rcpt,prints_DEZorph_rcpt	p.L263	ENST00000598776.1	37	c.789	CCDS12840.1	19																																																																																			FPR2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000171049		0.498	FPR2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FPR2	HGNC	protein_coding	OTTHUMT00000466912.2	-	0.00	41	0	G	NM_001005738		52272700	+1	tier1	-	no_errors	ENST00000340023	ensembl	human	known	74_37	silent	20.24	67	17	SNP	0.000	T
FUS	2521	genome.wustl.edu	37	16	31201647	31201647	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:31201647G>T	ENST00000254108.7	+	12	1325	c.1220G>T	c.(1219-1221)cGa>cTa	p.R407L	FUS_ENST00000568685.1_Missense_Mutation_p.R408L|FUS_ENST00000474990.1_3'UTR|FUS_ENST00000380244.3_Missense_Mutation_p.R406L	NM_001170634.1|NM_001170937.1|NM_004960.3	NP_001164105.1|NP_001164408.1|NP_004951.1	P35637	FUS_HUMAN	FUS RNA binding protein	407	Arg/Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		FUS/ERG(167)|FUS/DDIT3(631)|FUS/FEV(2)|FUS/ATF1(4)|FUS/CREB3L1(6)|FUS/CREB3L2(158)	breast(3)|endometrium(5)|kidney(3)|large_intestine(1)|lung(5)|prostate(3)|skin(1)|urinary_tract(1)	22		Renal(780;0.000219)|Breast(268;0.00957)|Hepatocellular(780;0.121)		GBM - Glioblastoma multiforme(240;2.31e-05)|Kidney(780;0.000209)		ggtggtggccgaggaggattt	0.542			T	"""DDIT3, ERG, FEV, ATF1, CREB3L2, CREB3L1"""	"""liposarcoma, AML, Ewing sarcoma, angiomatoid fibrous histiocytoma, fibromyxoid sarcoma"""																																			Dom	yes		16	16p11.2	2521	"""fusion, derived from t(12;16) malignant liposarcoma"""		"""M, L"""	0													153.0	110.0	125.0					16																	31201647		2197	4300	6497	SO:0001583	missense	0			AF071213	CCDS10707.1, CCDS58454.1	16p11.2	2014-09-17	2014-05-09		ENSG00000089280	ENSG00000089280		"""RNA binding motif (RRM) containing"""	4010	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein P2"", ""translocated in liposarcoma"""	137070	"""fusion, derived from t(12;16) malignant liposarcoma"", ""amyotrophic lateral sclerosis 6"", ""fusion (involved in t(12;16) in malignant liposarcoma)"", ""fused in sarcoma"""	ALS6		2372777, 7503811, 19251628, 19251627	Standard	NM_004960		Approved	TLS, FUS1, hnRNP-P2, HNRNPP2	uc002ebe.2	P35637	OTTHUMG00000132395	ENST00000254108.7:c.1220G>T	16.37:g.31201647G>T	ENSP00000254108:p.Arg407Leu		Q9H4A8	Missense_Mutation	SNP	pfam_Znf_RanBP2,pfam_RRM_dom,smart_RRM_dom,smart_Znf_RanBP2,pfscan_Znf_RanBP2,pfscan_RRM_dom	p.R407L	ENST00000254108.7	37	c.1220	CCDS10707.1	16	.	.	.	.	.	.	.	.	.	.	G	11.23	1.577546	0.28180	.	.	ENSG00000089280	ENST00000254108;ENST00000380244;ENST00000394533	D	0.97114	-4.25	5.31	2.3	0.28687	.	0.221723	0.36932	N	0.002332	D	0.91845	0.7419	N	0.19112	0.55	0.28498	N	0.914156	B;P;P;P;P;P	0.37573	0.008;0.465;0.465;0.6;0.465;0.465	B;B;B;B;B;B	0.34991	0.005;0.095;0.095;0.193;0.095;0.095	D	0.86819	0.2003	10	0.66056	D	0.02	-0.7982	9.8355	0.40966	0.2285:0.0:0.7715:0.0	.	406;407;407;406;181;407	A8K4H1;Q8TBR3;Q6IBQ5;P35637-2;Q59H57;P35637	.;.;.;.;.;FUS_HUMAN	L	407;134;336	ENSP00000254108:R407L	ENSP00000254108:R407L	R	+	2	0	FUS	31109148	1.000000	0.71417	0.829000	0.32907	0.287000	0.27160	6.080000	0.71299	0.244000	0.21351	-0.150000	0.13652	CGA	FUS	-	NULL	ENSG00000089280		0.542	FUS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FUS	HGNC	protein_coding	OTTHUMT00000255526.2	-	0.00	41	0	G	NM_004960		31201647	+1	tier1	-	no_errors	ENST00000254108	ensembl	human	known	74_37	missense	7.14	52	4	SNP	0.519	T
FZD9	8326	genome.wustl.edu	37	7	72849459	72849459	+	Silent	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:72849459G>C	ENST00000344575.3	+	1	1351	c.1122G>C	c.(1120-1122)ctG>ctC	p.L374L		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	374					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				TCGTCATCCTGACCCTGCGCA	0.657																																					Pancreas(144;909 1878 36867 38226 39554)												0													44.0	42.0	43.0					7																	72849459		2203	4300	6503	SO:0001819	synonymous_variant	0			U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.1122G>C	7.37:g.72849459G>C				Silent	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.L374	ENST00000344575.3	37	c.1122	CCDS5548.1	7																																																																																			FZD9	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled	ENSG00000188763		0.657	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD9	HGNC	protein_coding	OTTHUMT00000252120.1	-	0.00	23	0	G			72849459	+1	tier1	-	no_errors	ENST00000344575	ensembl	human	known	74_37	silent	31.11	31	14	SNP	1.000	C
GABRB3	2562	genome.wustl.edu	37	15	27018791	27018791	+	5'Flank	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:27018791C>T	ENST00000311550.5	-	0	0				GABRB3_ENST00000299267.4_Splice_Site|GABRB3_ENST00000557641.1_Intron|GABRB3_ENST00000541819.2_Intron	NM_000814.5|NM_001278631.1	NP_000805.1|NP_001265560.1	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 3						cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|GABA-gated chloride ion channel activity (GO:0022851)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(41)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	68		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ivermectin(DB00602)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Piperazine(DB00592)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	CCCCGCCTCACCTGCGGGGCT	0.756																																																	0													11.0	13.0	12.0					15																	27018791		2122	4185	6307	SO:0001631	upstream_gene_variant	0				CCDS10018.1, CCDS10019.1, CCDS53920.1, CCDS53921.1	15q12	2012-06-22			ENSG00000166206	ENSG00000166206		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4083	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 3"""	137192					Standard	NM_000814		Approved		uc001zaz.3	P28472	OTTHUMG00000129231		15.37:g.27018791C>T	Exception_encountered		B7Z2W1|B7Z825|F5H3D2|H7BYV8|Q14352|Q96FM5	Splice_Site	SNP	-	e1+1	ENST00000311550.5	37	c.80+1	CCDS10019.1	15	.	.	.	.	.	.	.	.	.	.	C	15.60	2.880855	0.51801	.	.	ENSG00000166206	ENST00000299267	.	.	.	3.53	2.61	0.31194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.8385	0.18621	0.0:0.7537:0.0:0.2463	.	.	.	.	.	-1	.	.	.	-	.	.	GABRB3	24569884	1.000000	0.71417	0.991000	0.47740	0.897000	0.52465	1.468000	0.35332	0.805000	0.34159	0.514000	0.50259	.	GABRB3	-	-	ENSG00000166206		0.756	GABRB3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB3	HGNC	protein_coding	OTTHUMT00000251352.2		0.00	10	0	C			27018791	-1			no_errors	ENST00000299267	ensembl	human	known	74_37	splice_site	25.00	15	5	SNP	0.984	T
GATA6	2627	genome.wustl.edu	37	18	19762733	19762733	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr18:19762733G>T	ENST00000269216.3	+	5	1721	c.1444G>T	c.(1444-1446)Gct>Tct	p.A482S	GATA6_ENST00000581694.1_Missense_Mutation_p.A482S|RNU6-702P_ENST00000364982.1_RNA	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	482					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			CAGACCACTTGCTATGAAAAA	0.328																																					Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)												0													50.0	52.0	51.0					18																	19762733		2203	4299	6502	SO:0001583	missense	0			U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.1444G>T	18.37:g.19762733G>T	ENSP00000269216:p.Ala482Ser		B0YJ17|P78327	Missense_Mutation	SNP	pfam_GATA_N,pfam_Znf_GATA,smart_Znf_GATA,pfscan_Znf_GATA,prints_Znf_GATA	p.A482S	ENST00000269216.3	37	c.1444	CCDS11872.1	18	.	.	.	.	.	.	.	.	.	.	G	23.9	4.467233	0.84533	.	.	ENSG00000141448	ENST00000269216	D	0.99582	-6.22	5.97	5.97	0.96955	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (2);	0.053759	0.64402	D	0.000001	D	0.98899	0.9627	L	0.58428	1.81	0.80722	D	1	B	0.25105	0.118	B	0.29440	0.102	D	0.98968	1.0800	10	0.30854	T	0.27	-2.6479	20.4251	0.99070	0.0:0.0:1.0:0.0	.	482	Q92908	GATA6_HUMAN	S	482	ENSP00000269216:A482S	ENSP00000269216:A482S	A	+	1	0	GATA6	18016731	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.476000	0.97823	2.829000	0.97493	0.650000	0.86243	GCT	GATA6	-	smart_Znf_GATA,pfscan_Znf_GATA	ENSG00000141448		0.328	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA6	HGNC	protein_coding	OTTHUMT00000254696.1	-	0.00	85	0	G	NM_005257		19762733	+1	tier1	-	no_errors	ENST00000269216	ensembl	human	known	74_37	missense	7.35	63	5	SNP	1.000	T
GC	2638	genome.wustl.edu	37	4	72607471	72607471	+	3'UTR	SNP	T	T	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:72607471T>G	ENST00000273951.8	-	0	1910				GC_ENST00000513476.1_3'UTR|GC_ENST00000504199.1_3'UTR|GC_ENST00000503472.1_5'UTR	NM_000583.3|NM_001204306.1	NP_000574.2|NP_001191235.1	P02774	VTDB_HUMAN	group-specific component (vitamin D binding protein)						small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin transport (GO:0051180)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	actin binding (GO:0003779)|calcidiol binding (GO:1902118)|vitamin D binding (GO:0005499)|vitamin transporter activity (GO:0051183)			endometrium(5)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	45		all_hematologic(202;0.107)	Lung(101;0.148)		Alfacalcidol(DB01436)|Cholecalciferol(DB00169)	TGTCATTGTATGAAGATATTG	0.348																																																	0																																										SO:0001624	3_prime_UTR_variant	0			L10641	CCDS3550.1, CCDS56332.1	4q12-q13	2008-08-29			ENSG00000145321	ENSG00000145321			4187	protein-coding gene	gene with protein product		139200				558959	Standard	NM_000583		Approved	DBP, VDBP, hDBP	uc010iif.3	P02774	OTTHUMG00000129915	ENST00000273951.8:c.*142A>C	4.37:g.72607471T>G			B4DPP2|D6RAK8|Q16309|Q16310|Q53F31|Q6GTG1	RNA	SNP	-	NULL	ENST00000273951.8	37	NULL	CCDS3550.1	4																																																																																			GC	-	-	ENSG00000145321		0.348	GC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GC	HGNC	protein_coding	OTTHUMT00000252167.2	-	0.00	33	0	T			72607471	-1	tier1	-	no_errors	ENST00000503364	ensembl	human	known	74_37	rna	28.57	30	12	SNP	0.000	G
GGNBP1	449520	genome.wustl.edu	37	6	33556733	33556733	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:33556733C>T	ENST00000374458.1	+	6	890	c.260C>T	c.(259-261)tCa>tTa	p.S87L	LINC00336_ENST00000477984.1_RNA			Q5YKI7	GGNB1_HUMAN	gametogenetin binding protein 1 (pseudogene)	87	Interaction with GGN. {ECO:0000250}.				cell differentiation (GO:0030154)|mitochondrial fission (GO:0000266)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)											CATCTTCCTTCACCCATTTCT	0.602																																																	0																																										SO:0001583	missense	0					6p21	2012-04-19	2012-04-19		ENSG00000204188	ENSG00000204188			19427	pseudogene	pseudogene		609495	"""gametogenetin binding protein 1"""			15642376	Standard	NR_028361		Approved		uc021ywq.1	Q5YKI7		ENST00000374458.1:c.260C>T	6.37:g.33556733C>T	ENSP00000363582:p.Ser87Leu		Q5YKI8	Missense_Mutation	SNP	NULL	p.S87L	ENST00000374458.1	37	c.260		6	.	.	.	.	.	.	.	.	.	.	C	14.66	2.602514	0.46423	.	.	ENSG00000204188	ENST00000374458	.	.	.	4.34	1.48	0.22813	.	.	.	.	.	T	0.22437	0.0541	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.22836	-1.0205	5	0.87932	D	0	-7.7073	6.4031	0.21650	0.0:0.5453:0.3543:0.1004	.	.	.	.	L	87	.	ENSP00000363582:S87L	S	+	2	0	GGNBP1	33664711	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.265000	0.08644	0.112000	0.17975	0.650000	0.86243	TCA	GGNBP1	-	NULL	ENSG00000204188		0.602	GGNBP1-201	KNOWN	basic|appris_principal	protein_coding	GGNBP1	HGNC	protein_coding			0.00	32	0	C			33556733	+1			no_errors	ENST00000374458	ensembl	human	known	74_37	missense	8.00	46	4	SNP	0.000	T
GIGYF1	64599	genome.wustl.edu	37	7	100283635	100283637	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:100283635_100283637delTCC	ENST00000275732.5	-	9	2223_2225	c.1014_1016delGGA	c.(1012-1017)gaggaa>gaa	p.338_339EE>E	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	338	Poly-Glu.				insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					TTCGGAAGGTTCCTCCTCCTCCT	0.675																																																	0																																										SO:0001651	inframe_deletion	0			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.1014_1016delGGA	7.37:g.100283644_100283646delTCC	ENSP00000275732:p.Glu339del		Q6Y7W7|Q8WZ38	In_Frame_Del	DEL	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.E339in_frame_del	ENST00000275732.5	37	c.1016_1014	CCDS34708.1	7																																																																																			GIGYF1	-	NULL	ENSG00000146830		0.675	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	HGNC	protein_coding	OTTHUMT00000347205.2		0.00	20	0	TCC	NM_022574		100283637	-1	tier1		no_errors	ENST00000275732	ensembl	human	known	74_37	in_frame_del	8.70	21	2	DEL	0.962:1.000:0.999	-
GINS1	9837	genome.wustl.edu	37	20	25394423	25394423	+	Intron	SNP	T	T	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr20:25394423T>A	ENST00000262460.4	+	2	169				GINS1_ENST00000429262.2_Intron|GINS1_ENST00000484893.1_Intron	NM_021067.3	NP_066545.3	Q14691	PSF1_HUMAN	GINS complex subunit 1 (Psf1 homolog)						DNA strand elongation involved in DNA replication (GO:0006271)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	7						TTATATGTTCTAGGAGGATGG	0.343																																																	0													122.0	118.0	119.0					20																	25394423		2203	4300	6503	SO:0001627	intron_variant	0			BC012542	CCDS33451.1	20p11.21	2006-05-04			ENSG00000101003	ENSG00000101003			28980	protein-coding gene	gene with protein product		610608				8724849, 8786132	Standard	NM_021067		Approved	KIAA0186, PSF1	uc002wuv.1	Q14691	OTTHUMG00000032124	ENST00000262460.4:c.76-3T>A	20.37:g.25394423T>A			Q9NQE2|Q9NQI7	RNA	SNP	-	NULL	ENST00000262460.4	37	NULL	CCDS33451.1	20																																																																																			GINS1	-	-	ENSG00000101003		0.343	GINS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GINS1	HGNC	protein_coding	OTTHUMT00000078433.1	-	0.00	31	0	T	NM_021067		25394423	+1	tier1	-	no_errors	ENST00000473460	ensembl	human	known	74_37	rna	8.33	44	4	SNP	0.697	A
GLI2	2736	genome.wustl.edu	37	2	121746894	121746894	+	Missense_Mutation	SNP	C	C	G	rs140601980		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:121746894C>G	ENST00000452319.1	+	14	3464	c.3404C>G	c.(3403-3405)tCc>tGc	p.S1135C	GLI2_ENST00000314490.11_Missense_Mutation_p.S807C|GLI2_ENST00000361492.4_Missense_Mutation_p.S1135C					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				GGGGCGCCCTCCAGCCTGAAC	0.647																																																	0													29.0	29.0	29.0					2																	121746894		2198	4292	6490	SO:0001583	missense	0				CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.3404C>G	2.37:g.121746894C>G	ENSP00000390436:p.Ser1135Cys			Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S1135C	ENST00000452319.1	37	c.3404	CCDS33283.1	2	.	.	.	.	.	.	.	.	.	.	C	13.52	2.262776	0.39995	.	.	ENSG00000074047	ENST00000452319;ENST00000361492;ENST00000314490	T;T;T	0.15718	2.4;2.4;2.47	4.77	4.77	0.60923	.	1.013780	0.07876	N	0.968773	T	0.33847	0.0877	L	0.53249	1.67	0.09310	N	1	P;P;P;P	0.52577	0.923;0.954;0.946;0.954	B;P;P;P	0.53035	0.338;0.639;0.716;0.54	T	0.32666	-0.9898	10	0.62326	D	0.03	.	16.2067	0.82134	0.0:1.0:0.0:0.0	.	1135;790;790;807	P10070;P10070-2;P10070-4;P10070-3	GLI2_HUMAN;.;.;.	C	1135;1135;807	ENSP00000390436:S1135C;ENSP00000354586:S1135C;ENSP00000312694:S807C	ENSP00000312694:S807C	S	+	2	0	GLI2	121463364	0.794000	0.28838	0.242000	0.24170	0.876000	0.50452	4.432000	0.59922	2.485000	0.83878	0.449000	0.29647	TCC	GLI2	-	NULL	ENSG00000074047		0.647	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	GLI2	HGNC	protein_coding	OTTHUMT00000332293.3	-	0.00	40	0	C	NM_005270		121746894	+1	tier1	-	no_errors	ENST00000361492	ensembl	human	known	74_37	missense	13.46	45	7	SNP	0.057	G
GNAS	2778	genome.wustl.edu	37	20	57485067	57485067	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr20:57485067G>T	ENST00000371085.3	+	11	1325	c.901G>T	c.(901-903)Gtc>Ttc	p.V301F	GNAS_ENST00000354359.7_Missense_Mutation_p.V302F|GNAS_ENST00000265620.7_Missense_Mutation_p.V286F|GNAS_ENST00000371100.4_Missense_Mutation_p.V944F|GNAS_ENST00000371095.3_Missense_Mutation_p.V287F|GNAS_ENST00000306090.10_Missense_Mutation_p.V287F|GNAS_ENST00000313949.7_3'UTR|GNAS_ENST00000371075.3_3'UTR|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000371102.4_Missense_Mutation_p.V930F	NM_000516.4	NP_000507.1	P63092	GNAS2_HUMAN	GNAS complex locus	301					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CGCTGAGAAAGTCCTTGCTGG	0.507			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)			Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													129.0	126.0	127.0					20																	57485067		2203	4300	6503	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371085.3:c.901G>T	20.37:g.57485067G>T	ENSP00000360126:p.Val301Phe		A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_P-loop_NTPase,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.V302F	ENST00000371085.3	37	c.904	CCDS13472.1	20	.	.	.	.	.	.	.	.	.	.	G	32	5.142971	0.94560	.	.	ENSG00000087460	ENST00000371100;ENST00000371102;ENST00000371095;ENST00000371085;ENST00000354359;ENST00000265620;ENST00000306090;ENST00000371082	D;D;D;D;D;D;D	0.89415	-2.51;-2.51;-2.51;-2.51;-2.51;-2.51;-2.51	5.29	5.29	0.74685	.	0.115720	0.64402	D	0.000019	D	0.96027	0.8706	M	0.92367	3.3	0.80722	D	1	D;D;D;D	0.89917	0.997;0.999;0.997;1.0	D;D;D;D	0.91635	0.973;0.983;0.958;0.999	D	0.96719	0.9531	10	0.87932	D	0	.	19.2712	0.94010	0.0:0.0:1.0:0.0	.	301;302;286;944	P63092;A6NI00;P63092-3;Q5JWF2	GNAS2_HUMAN;.;.;GNAS1_HUMAN	F	944;930;287;301;302;286;287;67	ENSP00000360141:V944F;ENSP00000360143:V930F;ENSP00000360136:V287F;ENSP00000360126:V301F;ENSP00000346328:V302F;ENSP00000265620:V286F;ENSP00000304472:V287F	ENSP00000265620:V286F	V	+	1	0	GNAS	56918462	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.457000	0.80775	2.625000	0.88918	0.591000	0.81541	GTC	GNAS	-	pfam_Gprotein_alpha_su,superfamily_P-loop_NTPase,smart_Gprotein_alpha_su	ENSG00000087460		0.507	GNAS-015	KNOWN	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080431.2	-	0.00	38	0	G	NM_000516		57485067	+1	tier1	-	no_errors	ENST00000354359	ensembl	human	known	74_37	missense	13.46	45	7	SNP	1.000	T
GNB2	2783	genome.wustl.edu	37	7	100276334	100276334	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:100276334C>T	ENST00000303210.4	+	10	1415	c.933C>T	c.(931-933)caC>caT	p.H311H	GNB2_ENST00000419828.1_Silent_p.H211H|GNB2_ENST00000424361.1_Silent_p.H267H|GNB2_ENST00000393924.1_Silent_p.H311H|GNB2_ENST00000427895.1_Silent_p.H211H|GNB2_ENST00000393926.1_Silent_p.H311H|GNB2_ENST00000436220.1_Silent_p.H267H	NM_005273.3	NP_005264.2	P62879	GBB2_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2	311					cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|G-protein coupled receptor signaling pathway (GO:0007186)|GTP catabolic process (GO:0006184)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell body (GO:0044297)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	calcium channel regulator activity (GO:0005246)|GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			endometrium(1)|lung(3)|ovary(2)|prostate(1)	7	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)				TCGCTGGCCACGACAACCGCG	0.647																																																	0													61.0	64.0	63.0					7																	100276334		2203	4300	6503	SO:0001819	synonymous_variant	0			M16514	CCDS5703.1	7q21.3-q22.1	2013-01-10			ENSG00000172354	ENSG00000172354		"""WD repeat domain containing"""	4398	protein-coding gene	gene with protein product	"""G protein, beta-2 subunit"", ""guanine nucleotide-binding protein G(I)/G(S)/G(T) beta subunit 2"", ""signal-transducing guanine nucleotide-binding regulatory protein beta subunit"", ""transducin beta chain 2"""	139390				9799793	Standard	NM_005273		Approved		uc003uwb.3	P62879	OTTHUMG00000137419	ENST00000303210.4:c.933C>T	7.37:g.100276334C>T			B3KPU1|P11016|P54312	Silent	SNP	pirsf_Guanine_nucleotide-bd_bsu,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Gprotein_B,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H311	ENST00000303210.4	37	c.933	CCDS5703.1	7																																																																																			GNB2	-	pirsf_Guanine_nucleotide-bd_bsu,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000172354		0.647	GNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNB2	HGNC	protein_coding	OTTHUMT00000268391.2	-	0.00	37	0	C	NM_005273		100276334	+1	tier1	-	no_errors	ENST00000303210	ensembl	human	known	74_37	silent	42.86	40	30	SNP	0.296	T
GOLGA3	2802	genome.wustl.edu	37	12	133365747	133365747	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:133365747C>G	ENST00000450791.2	-	12	2860	c.2677G>C	c.(2677-2679)Gag>Cag	p.E893Q	GOLGA3_ENST00000537452.1_Missense_Mutation_p.E893Q|GOLGA3_ENST00000545875.1_Missense_Mutation_p.E893Q|GOLGA3_ENST00000204726.3_Missense_Mutation_p.E893Q|GOLGA3_ENST00000456883.2_Missense_Mutation_p.E893Q			Q08378	GOGA3_HUMAN	golgin A3	893					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		GTCCGCTTCTCCCCGTGCACT	0.637																																																	0													63.0	58.0	60.0					12																	133365747		2203	4299	6502	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.2677G>C	12.37:g.133365747C>G	ENSP00000410378:p.Glu893Gln		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.E893Q	ENST00000450791.2	37	c.2677	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	C	21.6	4.174084	0.78452	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.34275	1.85;1.85;1.84;1.37;1.37	5.52	5.52	0.82312	.	0.090748	0.85682	D	0.000000	T	0.59878	0.2226	M	0.72894	2.215	0.80722	D	1	D;D;D	0.67145	0.991;0.991;0.996	P;P;D	0.63703	0.876;0.837;0.917	T	0.61262	-0.7098	10	0.59425	D	0.04	.	19.4375	0.94801	0.0:1.0:0.0:0.0	.	893;893;893	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	Q	893	ENSP00000204726:E893Q;ENSP00000410378:E893Q;ENSP00000409303:E893Q;ENSP00000442143:E893Q;ENSP00000442603:E893Q	ENSP00000204726:E893Q	E	-	1	0	GOLGA3	131875820	1.000000	0.71417	0.992000	0.48379	0.106000	0.19336	7.739000	0.84976	2.610000	0.88304	0.563000	0.77884	GAG	GOLGA3	-	superfamily_Prefoldin	ENSG00000090615		0.637	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	-	0.00	30	0	C	NM_005895		133365747	-1	tier1	-	no_errors	ENST00000204726	ensembl	human	known	74_37	missense	18.18	27	6	SNP	1.000	G
GOLGA3	2802	genome.wustl.edu	37	12	133365805	133365805	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:133365805C>A	ENST00000450791.2	-	12	2802	c.2619G>T	c.(2617-2619)agG>agT	p.R873S	GOLGA3_ENST00000537452.1_Missense_Mutation_p.R873S|GOLGA3_ENST00000545875.1_Missense_Mutation_p.R873S|GOLGA3_ENST00000204726.3_Missense_Mutation_p.R873S|GOLGA3_ENST00000456883.2_Missense_Mutation_p.R873S			Q08378	GOGA3_HUMAN	golgin A3	873					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CCAGCCTCTTCCTGGTGGCTT	0.642																																																	0													49.0	44.0	46.0					12																	133365805		2202	4300	6502	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.2619G>T	12.37:g.133365805C>A	ENSP00000410378:p.Arg873Ser		A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.R873S	ENST00000450791.2	37	c.2619	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	C	12.88	2.071965	0.36566	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883;ENST00000537452;ENST00000545875	T;T;T;T;T	0.32272	1.97;1.97;1.97;1.46;1.46	5.42	4.52	0.55395	.	0.132773	0.64402	D	0.000002	T	0.21347	0.0514	L	0.29908	0.895	0.80722	D	1	P;B;B	0.34955	0.477;0.204;0.199	B;B;B	0.33620	0.115;0.115;0.167	T	0.05241	-1.0897	10	0.59425	D	0.04	.	8.1791	0.31300	0.0:0.7561:0.0:0.2439	.	873;873;873	Q08378-4;Q08378-2;Q08378	.;.;GOGA3_HUMAN	S	873	ENSP00000204726:R873S;ENSP00000410378:R873S;ENSP00000409303:R873S;ENSP00000442143:R873S;ENSP00000442603:R873S	ENSP00000204726:R873S	R	-	3	2	GOLGA3	131875878	1.000000	0.71417	0.908000	0.35775	0.045000	0.14185	0.921000	0.28718	1.267000	0.44247	0.563000	0.77884	AGG	GOLGA3	-	superfamily_Prefoldin	ENSG00000090615		0.642	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	-	0.00	43	0	C	NM_005895		133365805	-1	tier1	-	no_errors	ENST00000204726	ensembl	human	known	74_37	missense	20.59	27	7	SNP	1.000	A
GOLGA6L2	283685	genome.wustl.edu	37	15	23685739	23685739	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:23685739C>G	ENST00000567107.1	-	8	1935	c.1883G>C	c.(1882-1884)aGa>aCa	p.R628T	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						ctctcctcctctcgcatcttc	0.582																																																	0																																										SO:0001583	missense	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.1883G>C	15.37:g.23685739C>G	ENSP00000454407:p.Arg628Thr		A1L301	Missense_Mutation	SNP	NULL	p.R628T	ENST00000567107.1	37	c.1883		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.582	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	-	0.00	239	0	C	NM_182561		23685739	-1	tier1	-	no_errors	ENST00000567107	ensembl	human	putative	74_37	missense	17.42	218	46	SNP	0.012	G
GOLGA8T	653075	genome.wustl.edu	37	15	30437044	30437044	+	Silent	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:30437044C>G	ENST00000569052.1	+	16	1431	c.1431C>G	c.(1429-1431)ctC>ctG	p.L477L	RN7SL469P_ENST00000491512.2_RNA|AC120045.2_ENST00000408858.1_RNA					golgin A8 family, member T																		AAAAAGAACTCTGCTTCATCC	0.592																																																	0																																										SO:0001819	synonymous_variant	0					15q13.2	2013-01-17			ENSG00000261247	ENSG00000261247			44410	other	unknown							Standard	NR_033933		Approved		uc021sha.1		OTTHUMG00000175638	ENST00000569052.1:c.1431C>G	15.37:g.30437044C>G				Silent	SNP	NULL	p.L477	ENST00000569052.1	37	c.1431		15																																																																																			GOLGA8T	-	NULL	ENSG00000261247		0.592	GOLGA8T-001	NOVEL	basic|appris_principal	protein_coding	GOLGA8T	HGNC	protein_coding	OTTHUMT00000430690.1	-	0.00	57	0	C	NR_033933		30437044	+1	tier1	-	no_errors	ENST00000569052	ensembl	human	novel	74_37	silent	23.44	49	15	SNP	0.990	G
GPHN	10243	genome.wustl.edu	37	14	67291233	67291233	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:67291233G>C	ENST00000315266.5	+	4	1364	c.243G>C	c.(241-243)ttG>ttC	p.L81F	GPHN_ENST00000544752.2_3'UTR|GPHN_ENST00000459628.1_Intron|GPHN_ENST00000543237.1_Missense_Mutation_p.L81F|GPHN_ENST00000305960.9_Intron|GPHN_ENST00000478722.1_Missense_Mutation_p.L81F	NM_001024218.1	NP_001019389.1	Q9NQX3	GEPH_HUMAN	gephyrin	81	MPT Mo-transferase.				establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycine receptor clustering (GO:0072579)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|molybdopterin adenylyltransferase activity (GO:0061598)|molybdopterin molybdotransferase activity (GO:0061599)|transferase activity (GO:0016740)			large_intestine(8)|liver(1)|ovary(2)|stomach(1)	12		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		AACTTAATTTGATATTAACAA	0.368			T	MLL	AL																																			Dom	yes		14	14q24	10243	gephyrin (GPH)		L	0													101.0	94.0	97.0					14																	67291233		2203	4300	6503	SO:0001583	missense	0			AB037806	CCDS9777.1, CCDS32103.1	14q23.3	2008-04-22			ENSG00000171723	ENSG00000171723			15465	protein-coding gene	gene with protein product		603930				1319186, 10325225, 18403029	Standard	XM_005267250		Approved	KIAA1385	uc001xix.3	Q9NQX3	OTTHUMG00000029785	ENST00000315266.5:c.243G>C	14.37:g.67291233G>C	ENSP00000312771:p.Leu81Phe		Q9H4E9|Q9P2G2	Missense_Mutation	SNP	pfam_Mopterin-bd_dom,pfam_MoeA_linker/N,pfam_MoeA_C_domain_IV,superfamily_MoeA_linker/N,superfamily_Mopterin-bd_dom,superfamily_MoeA_C_domain_IV,smart_Mopterin-bd_dom,tigrfam_Mo_cofactor_synthesis	p.L81F	ENST00000315266.5	37	c.243	CCDS32103.1	14	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430040	0.62844	.	.	ENSG00000171723	ENST00000315266;ENST00000478722;ENST00000543237;ENST00000555456	T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26	5.48	2.68	0.31781	Molybdenum cofactor synthesis (1);Molybdenum cofactor biosynthesis, conserved site (1);Molybdopterin binding (4);	0.000000	0.85682	D	0.000000	D	0.87977	0.6314	M	0.87180	2.865	0.80722	D	1	D;D;D	0.89917	1.0;0.989;1.0	D;D;D	0.85130	0.997;0.968;0.994	D	0.87553	0.2466	10	0.72032	D	0.01	-3.0175	11.3188	0.49407	0.147:0.0:0.853:0.0	.	81;81;81	F5H039;Q9NQX3;Q9NQX3-2	.;GEPH_HUMAN;.	F	81;81;81;14	ENSP00000312771:L81F;ENSP00000417901:L81F;ENSP00000438404:L81F;ENSP00000450706:L14F	ENSP00000312771:L81F	L	+	3	2	GPHN	66360986	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	1.354000	0.34056	0.294000	0.22547	0.305000	0.20034	TTG	GPHN	-	pfam_Mopterin-bd_dom,superfamily_Mopterin-bd_dom,smart_Mopterin-bd_dom,tigrfam_Mo_cofactor_synthesis	ENSG00000171723		0.368	GPHN-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	GPHN	HGNC	protein_coding	OTTHUMT00000074299.2	-	0.00	32	0	G	NM_020806		67291233	+1	tier1	-	no_errors	ENST00000478722	ensembl	human	known	74_37	missense	20.37	43	11	SNP	1.000	C
GPR32	2854	genome.wustl.edu	37	19	51273966	51273966	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:51273966G>C	ENST00000270590.4	+	1	246	c.109G>C	c.(109-111)Gag>Cag	p.E37Q		NM_001506.1	NP_001497.1	O75388	GPR32_HUMAN	G protein-coupled receptor 32	37					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)			breast(4)|endometrium(4)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	29		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		ATGCCTGTCTGAGGAGGTGGG	0.597																																					Esophageal Squamous(113;152 1581 5732 15840 44398)												0													146.0	116.0	126.0					19																	51273966		2203	4300	6503	SO:0001583	missense	0			AF045764	CCDS12801.1	19q13.33	2012-08-20			ENSG00000142511	ENSG00000142511		"""GPCR / Class A : Resolvin receptors"""	4487	protein-coding gene	gene with protein product	"""resolvin D1 receptor"""	603195				9653656	Standard	NM_001506		Approved	RVDR1	uc010ycf.3	O75388		ENST00000270590.4:c.109G>C	19.37:g.51273966G>C	ENSP00000270590:p.Glu37Gln		Q502U7|Q6NWS5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Formyl_pep_rcpt	p.E37Q	ENST00000270590.4	37	c.109	CCDS12801.1	19	.	.	.	.	.	.	.	.	.	.	G	11.25	1.584644	0.28268	.	.	ENSG00000142511	ENST00000270590	T	0.32272	1.46	2.73	0.454	0.16644	.	.	.	.	.	T	0.11665	0.0284	N	0.08118	0	0.09310	N	1	B	0.16603	0.018	B	0.13407	0.009	T	0.34179	-0.9839	9	0.12430	T	0.62	.	3.3129	0.07022	0.1674:0.2834:0.5492:0.0	.	37	O75388	GPR32_HUMAN	Q	37	ENSP00000270590:E37Q	ENSP00000270590:E37Q	E	+	1	0	GPR32	55965778	0.000000	0.05858	0.002000	0.10522	0.351000	0.29236	-0.438000	0.06905	0.405000	0.25532	0.313000	0.20887	GAG	GPR32	-	NULL	ENSG00000142511		0.597	GPR32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR32	HGNC	protein_coding	OTTHUMT00000465016.1	-	0.00	64	0	G			51273966	+1	tier1	-	no_errors	ENST00000270590	ensembl	human	known	74_37	missense	7.14	91	7	SNP	0.003	C
GRIK2	2898	genome.wustl.edu	37	6	102250255	102250255	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:102250255G>T	ENST00000421544.1	+	8	1635	c.1145G>T	c.(1144-1146)gGc>gTc	p.G382V	GRIK2_ENST00000318991.6_Missense_Mutation_p.G382V|GRIK2_ENST00000369138.1_Missense_Mutation_p.G382V|GRIK2_ENST00000413795.1_Missense_Mutation_p.G382V|GRIK2_ENST00000369134.4_Missense_Mutation_p.G333V|GRIK2_ENST00000369137.3_Missense_Mutation_p.G382V	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	382					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	AAAACCAATGGCTTGAGAACA	0.343																																																	0													116.0	118.0	117.0					6																	102250255		2203	4299	6502	SO:0001583	missense	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.1145G>T	6.37:g.102250255G>T	ENSP00000397026:p.Gly382Val		A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,superfamily_Peripla_BP_I,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G382V	ENST00000421544.1	37	c.1145	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	G	21.7	4.181188	0.78677	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076;ENST00000455610	T;T;T;T;T;T;T	0.39787	1.06;1.06;1.06;1.06;1.06;1.06;1.06	5.61	4.73	0.59995	Extracellular ligand-binding receptor (1);	0.056798	0.64402	D	0.000001	T	0.67002	0.2847	M	0.92077	3.27	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.997;0.998;0.995	T	0.78518	-0.2173	10	0.87932	D	0	.	16.4336	0.83861	0.0:0.1316:0.8684:0.0	.	382;382;382	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	V	382;382;382;382;382;382;333;344;95	ENSP00000397026:G382V;ENSP00000405596:G382V;ENSP00000358134:G382V;ENSP00000358133:G382V;ENSP00000313276:G382V;ENSP00000358130:G333V;ENSP00000391988:G95V	ENSP00000313276:G382V	G	+	2	0	GRIK2	102356948	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.398000	0.97281	1.322000	0.45245	0.544000	0.68410	GGC	GRIK2	-	pfam_ANF_lig-bd_rcpt,superfamily_Peripla_BP_I	ENSG00000164418		0.343	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	-	0.00	56	0	G			102250255	+1	tier1	-	no_errors	ENST00000421544	ensembl	human	known	74_37	missense	12.50	49	7	SNP	1.000	T
HAL	3034	genome.wustl.edu	37	12	96380981	96380981	+	Silent	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:96380981G>C	ENST00000261208.3	-	12	1283	c.915C>G	c.(913-915)ctC>ctG	p.L305L	HAL_ENST00000541929.1_Silent_p.L97L|HAL_ENST00000538703.1_Silent_p.L305L|HAL_ENST00000551562.1_5'Flank	NM_002108.3	NP_002099.1	P42357	HUTH_HUMAN	histidine ammonia-lyase	305					biosynthetic process (GO:0009058)|cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	histidine ammonia-lyase activity (GO:0004397)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	34					L-Histidine(DB00117)	TCCCATTGATGAGTGCCAGGC	0.512																																					NSCLC(169;943 2815 23563 30031)												0													98.0	94.0	95.0					12																	96380981		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9058.1, CCDS58264.1, CCDS58265.1	12q22-q24.1	1991-07-12				ENSG00000084110	4.3.1.3		4806	protein-coding gene	gene with protein product		609457		HIS			Standard	NM_002108		Approved		uc001tem.2	P42357	OTTHUMG00000170354	ENST00000261208.3:c.915C>G	12.37:g.96380981G>C			B4DQC1|B4E0V8|F5GXF2|F5H1U5|Q4VB92|Q4VB93	Silent	SNP	pfam_Aromatic_Lyase,superfamily_L-Aspartase-like,tigrfam_HutH	p.L305	ENST00000261208.3	37	c.915	CCDS9058.1	12																																																																																			HAL	-	pfam_Aromatic_Lyase,superfamily_L-Aspartase-like,tigrfam_HutH	ENSG00000084110		0.512	HAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAL	HGNC	protein_coding	OTTHUMT00000408644.1	-	0.00	31	0	G			96380981	-1	tier1	-	no_errors	ENST00000261208	ensembl	human	known	74_37	silent	19.44	29	7	SNP	1.000	C
HDX	139324	genome.wustl.edu	37	X	83599383	83599383	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chrX:83599383G>T	ENST00000297977.5	-	6	1646	c.1535C>A	c.(1534-1536)tCt>tAt	p.S512Y	HDX_ENST00000506585.2_Missense_Mutation_p.S454Y|HDX_ENST00000373177.2_Missense_Mutation_p.S512Y	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	512						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						AGGCTGCTCAGAGAAATCAGC	0.443																																					Pancreas(53;231 1169 36156 43751 51139)												0													81.0	79.0	79.0					X																	83599383		2203	4300	6503	SO:0001583	missense	0			BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.1535C>A	X.37:g.83599383G>T	ENSP00000297977:p.Ser512Tyr		A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.S512Y	ENST00000297977.5	37	c.1535	CCDS35342.1	X	.	.	.	.	.	.	.	.	.	.	G	22.8	4.333910	0.81801	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585	T;T;T	0.46451	0.87;0.87;0.87	5.47	5.47	0.80525	.	0.119478	0.64402	D	0.000017	T	0.56455	0.1986	L	0.32530	0.975	0.58432	D	0.999992	D	0.76494	0.999	D	0.83275	0.996	T	0.60311	-0.7288	10	0.87932	D	0	-28.0279	18.3986	0.90507	0.0:0.0:1.0:0.0	.	512	Q7Z353	HDX_HUMAN	Y	512;454;512	ENSP00000297977:S512Y;ENSP00000362272:S454Y;ENSP00000423670:S512Y	ENSP00000297977:S512Y	S	-	2	0	HDX	83486039	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	5.968000	0.70413	2.285000	0.76669	0.600000	0.82982	TCT	HDX	-	NULL	ENSG00000165259		0.443	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HDX	HGNC	protein_coding	OTTHUMT00000057379.2	-	0.00	75	0	G	NM_144657		83599383	-1	tier1	-	no_errors	ENST00000297977	ensembl	human	known	74_37	missense	18.87	43	10	SNP	1.000	T
HEATR1	55127	genome.wustl.edu	37	1	236717912	236717912	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:236717912G>T	ENST00000366582.3	-	42	6178	c.6064C>A	c.(6064-6066)Cct>Act	p.P2022T	HEATR1_ENST00000366581.2_Missense_Mutation_p.P1941T	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	2022					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			TCCACCAGAGGCATCATCAAG	0.408																																																	0													89.0	87.0	88.0					1																	236717912		2203	4300	6503	SO:0001583	missense	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.6064C>A	1.37:g.236717912G>T	ENSP00000355541:p.Pro2022Thr		Q5T3Q8|Q6P197|Q9NW23	Missense_Mutation	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.P2022T	ENST00000366582.3	37	c.6064	CCDS31066.1	1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.695215	0.88830	.	.	ENSG00000119285	ENST00000366582;ENST00000366581	T;T	0.63913	-0.07;-0.07	5.65	5.65	0.86999	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.84374	0.5458	M	0.90870	3.155	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.97110	0.966;1.0	D	0.86058	0.1530	10	0.59425	D	0.04	.	19.9142	0.97043	0.0:0.0:1.0:0.0	.	1941;2022	Q5T3Q7;Q9H583	.;HEAT1_HUMAN	T	2022;1941	ENSP00000355541:P2022T;ENSP00000355540:P1941T	ENSP00000355540:P1941T	P	-	1	0	HEATR1	234784535	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	8.974000	0.93433	2.941000	0.99782	0.655000	0.94253	CCT	HEATR1	-	superfamily_ARM-type_fold	ENSG00000119285		0.408	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1	-	0.00	46	0	G	XM_375853		236717912	-1	tier1	-	no_errors	ENST00000366582	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
HEATR5B	54497	genome.wustl.edu	37	2	37268374	37268374	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:37268374G>T	ENST00000233099.5	-	19	2853	c.2758C>A	c.(2758-2760)Cat>Aat	p.H920N	HEATR5B_ENST00000354531.2_Missense_Mutation_p.H920N	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	920						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)		p.H920Y(1)		breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				ACATAACGATGCAAACAACCA	0.433																																																	1	Substitution - Missense(1)	lung(1)											178.0	155.0	163.0					2																	37268374		2203	4300	6503	SO:0001583	missense	0			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.2758C>A	2.37:g.37268374G>T	ENSP00000233099:p.His920Asn		B5MDU8|Q7Z3B2|Q9NVL7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.H920N	ENST00000233099.5	37	c.2758	CCDS33181.1	2	.	.	.	.	.	.	.	.	.	.	G	31	5.099521	0.94197	.	.	ENSG00000008869	ENST00000233099;ENST00000354531	T;T	0.08720	3.06;3.06	5.45	5.45	0.79879	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.37237	0.0996	M	0.88450	2.955	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.35251	-0.9796	10	0.59425	D	0.04	-16.8044	19.2841	0.94063	0.0:0.0:1.0:0.0	.	920	Q9P2D3	HTR5B_HUMAN	N	920	ENSP00000233099:H920N;ENSP00000346531:H920N	ENSP00000233099:H920N	H	-	1	0	HEATR5B	37121878	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.906000	0.87423	2.535000	0.85469	0.655000	0.94253	CAT	HEATR5B	-	superfamily_ARM-type_fold	ENSG00000008869		0.433	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR5B	HGNC	protein_coding	OTTHUMT00000325492.1		0.00	50	0	G	NM_019024		37268374	-1			no_errors	ENST00000233099	ensembl	human	known	74_37	missense	5.48	69	4	SNP	1.000	T
HEPACAM2	253012	genome.wustl.edu	37	7	92848665	92848665	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:92848665G>T	ENST00000394468.2	-	2	256	c.179C>A	c.(178-180)cCa>cAa	p.P60Q	HEPACAM2_ENST00000341723.4_Missense_Mutation_p.P48Q|HEPACAM2_ENST00000440868.1_Missense_Mutation_p.P48Q|HEPACAM2_ENST00000453812.2_Missense_Mutation_p.P83Q	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	60					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						GTCTGATGCTGGAGTGTGGAA	0.527																																																	0													141.0	139.0	139.0					7																	92848665		2203	4300	6503	SO:0001583	missense	0			AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.179C>A	7.37:g.92848665G>T	ENSP00000377980:p.Pro60Gln		B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.P60Q	ENST00000394468.2	37	c.179	CCDS43616.1	7	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788311	0.31593	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24	5.72	-1.81	0.07882	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.725376	0.14559	N	0.312210	T	0.43478	0.1249	N	0.19112	0.55	0.09310	N	1	B;P;B;B	0.39601	0.391;0.68;0.301;0.34	B;B;B;B	0.38880	0.212;0.284;0.16;0.064	T	0.37407	-0.9707	10	0.72032	D	0.01	0.9167	2.731	0.05227	0.2904:0.1104:0.4859:0.1133	.	83;48;60;48	E9PDV5;C9JN07;A8MVW5;A8MVW5-2	.;.;HECA2_HUMAN;.	Q	60;48;48;83	ENSP00000377980:P60Q;ENSP00000340532:P48Q;ENSP00000389592:P48Q;ENSP00000390204:P83Q	ENSP00000340532:P48Q	P	-	2	0	HEPACAM2	92686601	0.000000	0.05858	0.009000	0.14445	0.580000	0.36256	0.077000	0.14738	-0.390000	0.07774	-0.913000	0.02753	CCA	HEPACAM2	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000188175		0.527	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEPACAM2	HGNC	protein_coding	OTTHUMT00000254651.1	-	0.00	49	0	G	NM_198151		92848665	-1	tier1	-	no_errors	ENST00000394468	ensembl	human	known	74_37	missense	5.80	65	4	SNP	0.004	T
HERC2	8924	genome.wustl.edu	37	15	28501404	28501404	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:28501404G>A	ENST00000261609.7	-	18	2685	c.2577C>T	c.(2575-2577)agC>agT	p.S859S		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TCAGGAGGATGCTGCCCAGAC	0.562																																																	0													19.0	19.0	19.0					15																	28501404		2161	4187	6348	SO:0001819	synonymous_variant	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.2577C>T	15.37:g.28501404G>A				Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5-like_heme/steroid-bd,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_RCC1/BLIP-II,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5-like_heme/steroid-bd,superfamily_UBA-like,superfamily_CUB_dom,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5-like_heme/steroid-bd,prints_Reg_chr_condens	p.S859	ENST00000261609.7	37	c.2577	CCDS10021.1	15																																																																																			HERC2	-	NULL	ENSG00000128731		0.562	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	-	0.00	84	0	G	NM_004667		28501404	-1	tier1	-	no_errors	ENST00000261609	ensembl	human	known	74_37	silent	11.36	117	15	SNP	0.911	A
HFE	3077	genome.wustl.edu	37	6	26092860	26092860	+	Intron	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:26092860C>T	ENST00000357618.5	+	4	738				HFE_ENST00000336625.8_Intron|HFE_ENST00000488199.1_Intron|HFE_ENST00000352392.4_Intron|HFE_ENST00000470149.1_Missense_Mutation_p.P214S|HFE_ENST00000353147.5_Intron|HFE_ENST00000317896.7_Intron|HFE_ENST00000349999.4_Intron|HFE_ENST00000309234.6_Intron|HFE_ENST00000397022.3_Intron|HFE_ENST00000461397.1_Intron	NM_000410.3|NM_139006.2	NP_000401.1|NP_620575.1	Q30201	HFE_HUMAN	hemochromatosis						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular iron ion homeostasis (GO:0006879)|cellular response to iron ion starvation (GO:0010106)|female pregnancy (GO:0007565)|hormone biosynthetic process (GO:0042446)|immune response (GO:0006955)|iron ion import into cell (GO:0097459)|multicellular organismal iron ion homeostasis (GO:0060586)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein complex assembly (GO:0006461)	apical part of cell (GO:0045177)|basal part of cell (GO:0045178)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|integral component of plasma membrane (GO:0005887)|MHC class I protein complex (GO:0042612)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	peptide antigen binding (GO:0042605)|receptor binding (GO:0005102)			endometrium(3)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						TTCCAGTCTTCCTGGCAAGGG	0.453									Hemochromatosis																																								0																																										SO:0001627	intron_variant	0	Familial Cancer Database			CCDS4578.1, CCDS4579.1, CCDS4580.1, CCDS4581.1, CCDS4582.1, CCDS47386.1, CCDS47387.1, CCDS54974.1, CCDS54975.1, CCDS75412.1	6p21.3	2014-09-17			ENSG00000010704	ENSG00000010704		"""Immunoglobulin superfamily / C1-set domain containing"""	4886	protein-coding gene	gene with protein product	"""high Fe"""	613609				3460331	Standard	XR_241893		Approved	HLA-H	uc003nfx.1	Q30201	OTTHUMG00000016348	ENST00000357618.5:c.617-53C>T	6.37:g.26092860C>T			B2CKL0|O75929|O75930|O75931|Q17RT0|Q96KU5|Q96KU6|Q96KU7|Q96KU8|Q9HC64|Q9HC68|Q9HC70|Q9HC83	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like_dom,prints_MHC_I_a	p.P214S	ENST00000357618.5	37	c.640	CCDS4578.1	6	.	.	.	.	.	.	.	.	.	.	C	3.031	-0.199642	0.06219	.	.	ENSG00000010704	ENST00000470149	T	0.12569	2.67	4.99	-2.18	0.07037	.	.	.	.	.	T	0.02342	0.0072	.	.	.	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.45308	-0.9270	8	0.87932	D	0	.	0.8852	0.01243	0.1465:0.2572:0.2873:0.309	.	214	Q6B0J5	.	S	214	ENSP00000419725:P214S	ENSP00000419725:P214S	P	+	1	0	HFE	26200839	0.000000	0.05858	0.000000	0.03702	0.196000	0.23810	-0.491000	0.06474	-0.218000	0.10018	0.650000	0.86243	CCT	HFE	-	pfam_Ig_C1-set,pfscan_Ig-like_dom	ENSG00000010704		0.453	HFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HFE	HGNC	protein_coding	OTTHUMT00000356133.1	-	0.00	38	0	C			26092860	+1	tier1	-	no_errors	ENST00000470149	ensembl	human	known	74_37	missense	27.66	34	13	SNP	0.000	T
HGSNAT	138050	genome.wustl.edu	37	8	43037398	43037398	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr8:43037398G>T	ENST00000458501.2	+	11	1207	c.1207G>T	c.(1207-1209)Gcc>Tcc	p.A403S	HGSNAT_ENST00000379644.4_Missense_Mutation_p.A375S|HGSNAT_ENST00000521576.1_Missense_Mutation_p.A92S|HGSNAT_ENST00000297798.7_Missense_Mutation_p.A107S			Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	403					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lysosomal transport (GO:0007041)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	heparan-alpha-glucosaminide N-acetyltransferase activity (GO:0015019)|transferase activity, transferring acyl groups (GO:0016746)			cervix(1)|endometrium(2)|large_intestine(4)|lung(6)	13	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			TGAACATTGTGCCTCGGTGAG	0.423																																																	0													431.0	408.0	415.0					8																	43037398		2001	4173	6174	SO:0001583	missense	0				CCDS47852.1	8p11.1	2011-11-16	2006-09-05	2006-08-16	ENSG00000165102	ENSG00000165102	2.3.1.78		26527	protein-coding gene	gene with protein product		610453	"""transmembrane protein 76"""	TMEM76		17033958, 16960811	Standard	NM_152419		Approved	FLJ32731, HGNAT	uc003xpx.4	Q68CP4	OTTHUMG00000164102	ENST00000458501.2:c.1207G>T	8.37:g.43037398G>T	ENSP00000389524:p.Ala403Ser		B4E2V0	Missense_Mutation	SNP	pfam_DUF1624	p.A403S	ENST00000458501.2	37	c.1207		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.75|11.75	1.730680|1.730680	0.30684|0.30684	.|.	.|.	ENSG00000165102|ENSG00000165102	ENST00000458501;ENST00000379644;ENST00000522082;ENST00000521576;ENST00000297798|ENST00000524016	T;T;T;T;T|T	0.21734|0.41400	2.29;2.29;2.52;1.99;2.0|1.0	5.13|5.13	-2.76|-2.76	0.05896|0.05896	.|.	0.873151|.	0.10145|.	N|.	0.710393|.	T|T	0.13500|0.13500	0.0327|0.0327	N|N	0.02721|0.02721	-0.515|-0.515	0.09310|0.09310	N|N	1|1	B|.	0.20550|.	0.046|.	B|.	0.15484|.	0.013|.	T|T	0.31081|0.31081	-0.9956|-0.9956	10|7	0.10111|0.10111	T|T	0.7|0.7	-0.2249|-0.2249	5.3932|5.3932	0.16255|0.16255	0.5486:0.0:0.3027:0.1486|0.5486:0.0:0.3027:0.1486	.|.	403|.	Q68CP4|.	HGNAT_HUMAN|.	S|F	403;375;122;92;107|76	ENSP00000389524:A403S;ENSP00000368965:A375S;ENSP00000430151:A122S;ENSP00000429029:A92S;ENSP00000297798:A107S|ENSP00000428322:C76F	ENSP00000297798:A107S|ENSP00000428322:C76F	A|C	+|+	1|2	0|0	HGSNAT|HGSNAT	43156555|43156555	0.000000|0.000000	0.05858|0.05858	0.007000|0.007000	0.13788|0.13788	0.947000|0.947000	0.59692|0.59692	-0.043000|-0.043000	0.12043|0.12043	-0.199000|-0.199000	0.10317|0.10317	-0.143000|-0.143000	0.13931|0.13931	GCC|TGC	HGSNAT	-	NULL	ENSG00000165102		0.423	HGSNAT-202	KNOWN	basic	protein_coding	HGSNAT	HGNC	protein_coding		-	0.00	69	0	G	XM_372038		43037398	+1	tier1	-	no_errors	ENST00000458501	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.000	T
HIST1H2BB	3018	genome.wustl.edu	37	6	26043872	26043872	+	Missense_Mutation	SNP	G	G	T	rs372198960		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:26043872G>T	ENST00000357905.2	-	1	13	c.14C>A	c.(13-15)tCt>tAt	p.S5Y	HIST1H3C_ENST00000540144.1_5'Flank	NM_021062.2	NP_066406.1	P33778	H2B1B_HUMAN	histone cluster 1, H2bb	5					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						AGCAGACTTAGAGGGTTCAGG	0.453																																																	0													57.0	58.0	58.0					6																	26043872		2203	4300	6503	SO:0001583	missense	0			AF531285	CCDS4575.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196226			"""Histones / Replication-dependent"""	4751	protein-coding gene	gene with protein product		602803	"""H2B histone family, member F"", ""histone 1, H2bb"""	H2BFF		8227173, 12408966	Standard	NM_021062		Approved	H2B/f	uc003nfu.3	P33778	OTTHUMG00000014421	ENST00000357905.2:c.14C>A	6.37:g.26043872G>T	ENSP00000350580:p.Ser5Tyr		Q4KN36	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.S5Y	ENST00000357905.2	37	c.14	CCDS4575.1	6	.	.	.	.	.	.	.	.	.	.	G	9.326	1.059379	0.19987	.	.	ENSG00000196226	ENST00000357905	T	0.18502	2.21	5.24	4.36	0.52297	Histone-fold (2);	0.097441	0.38326	U	0.001739	T	0.05090	0.0136	N	0.16478	0.41	0.27427	N	0.95414	B	0.26876	0.162	B	0.27887	0.084	T	0.24261	-1.0165	10	0.87932	D	0	.	14.4896	0.67642	0.0:0.0:0.8518:0.1482	.	5	P33778	H2B1B_HUMAN	Y	5	ENSP00000350580:S5Y	ENSP00000350580:S5Y	S	-	2	0	HIST1H2BB	26151851	0.868000	0.29978	0.004000	0.12327	0.005000	0.04900	4.262000	0.58847	1.293000	0.44690	-0.293000	0.09583	TCT	HIST1H2BB	-	superfamily_Histone-fold	ENSG00000196226		0.453	HIST1H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BB	HGNC	protein_coding	OTTHUMT00000040083.1	-	0.00	42	0	G	NM_021062		26043872	-1	tier1	-	no_errors	ENST00000357905	ensembl	human	known	74_37	missense	21.05	45	12	SNP	0.590	T
HIST1H3E	8353	genome.wustl.edu	37	6	26225496	26225496	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:26225496delG	ENST00000360408.1	+	1	114	c.114delG	c.(112-114)aagfs	p.K38fs		NM_003532.2	NP_003523.1	P68431	H31_HUMAN	histone cluster 1, H3e	38					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(5)|skin(1)	8		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)				GCGTGAAGAAGCCCCATCGCT	0.637																																																	0													51.0	52.0	52.0					6																	26225496		2203	4300	6503	SO:0001589	frameshift_variant	0			M60746	CCDS4596.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196966	ENSG00000274750		"""Histones / Replication-dependent"""	4769	protein-coding gene	gene with protein product		602813	"""H3 histone family, member D"", ""histone 1, H3e"""	H3FD		1916825, 12408966	Standard	NM_003532		Approved	H3/d, H3.1	uc003nhc.4	P68431	OTTHUMG00000014434	ENST00000360408.1:c.114delG	6.37:g.26225496delG	ENSP00000353581:p.Lys38fs		A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Frame_Shift_Del	DEL	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.K38fs	ENST00000360408.1	37	c.114	CCDS4596.1	6																																																																																			HIST1H3E	-	superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000196966		0.637	HIST1H3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3E	HGNC	protein_coding	OTTHUMT00000040097.1		0.00	94	0	G	NM_003532		26225496	+1	tier1		no_errors	ENST00000360408	ensembl	human	known	74_37	frame_shift_del	12.99	67	10	DEL	1.000	-
HMGN4	10473	genome.wustl.edu	37	6	26545537	26545537	+	Missense_Mutation	SNP	C	C	T	rs146576097		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:26545537C>T	ENST00000377575.2	+	2	280	c.103C>T	c.(103-105)Cca>Tca	p.P35S		NM_006353.2	NP_006344.1	O00479	HMGN4_HUMAN	high mobility group nucleosomal binding domain 4	35						chromatin (GO:0000785)|nucleus (GO:0005634)	DNA binding (GO:0003677)			lung(2)|skin(1)	3						ACCAGCTCCTCCAAAACCAGA	0.502																																																	0								C	SER/PRO	0,4406		0,0,2203	77.0	71.0	73.0		103	1.6	0.5	6	dbSNP_134	73	1,8599	1.2+/-3.3	0,1,4299	no	missense	HMGN4	NM_006353.2	74	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	35/91	26545537	1,13005	2203	4300	6503	SO:0001583	missense	0			U90549	CCDS4615.1	6p21.3	2011-07-01	2002-07-25	2002-07-26	ENSG00000182952	ENSG00000182952		"""High-mobility group / Canonical"""	4989	protein-coding gene	gene with protein product			"""high-mobility group (nonhistone chromosomal) protein 17-like 3"""	HMG17L3		9149941, 11410162	Standard	NM_006353		Approved	NHC	uc003nig.3	O00479	OTTHUMG00000014458	ENST00000377575.2:c.103C>T	6.37:g.26545537C>T	ENSP00000366798:p.Pro35Ser		B2R4I6|Q53XL9	Missense_Mutation	SNP	pfam_HMGN_fam,smart_HMGN_fam,prints_HMGN_fam	p.P35S	ENST00000377575.2	37	c.103	CCDS4615.1	6	.	.	.	.	.	.	.	.	.	.	C	15.60	2.881672	0.51908	0.0	1.16E-4	ENSG00000182952	ENST00000328219;ENST00000377575	.	.	.	3.45	1.56	0.23342	.	0.086868	0.45867	D	0.000321	T	0.20700	0.0498	.	.	.	0.35480	D	0.798042	B	0.26672	0.156	B	0.24394	0.053	T	0.03221	-1.1059	8	0.51188	T	0.08	-2.4565	5.5618	0.17148	0.1976:0.6889:0.0:0.1134	.	35	O00479	HMGN4_HUMAN	S	35	.	ENSP00000327691:P35S	P	+	1	0	HMGN4	26653516	0.949000	0.32298	0.456000	0.27044	0.805000	0.45488	2.057000	0.41365	0.395000	0.25257	0.561000	0.74099	CCA	HMGN4	-	pfam_HMGN_fam,smart_HMGN_fam,prints_HMGN_fam	ENSG00000182952		0.502	HMGN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGN4	HGNC	protein_coding	OTTHUMT00000040123.2	-	0.00	34	0	C			26545537	+1	tier1	rs146576097	no_errors	ENST00000377575	ensembl	human	known	74_37	missense	14.71	29	5	SNP	0.989	T
HIST1H1B	3009	genome.wustl.edu	37	6	27834849	27834849	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:27834849C>A	ENST00000331442.3	-	1	510	c.459G>T	c.(457-459)aaG>aaT	p.K153N		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	153					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						TCGGAGTCTTCTTCACTGCCT	0.602																																																	0													93.0	107.0	103.0					6																	27834849		2203	4299	6502	SO:0001583	missense	0			AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.459G>T	6.37:g.27834849C>A	ENSP00000330074:p.Lys153Asn		Q14529|Q3MJ42	Missense_Mutation	SNP	pfam_Histone_H1/H5_H15,smart_Histone_H1/H5_H15,prints_Histone_H5	p.K153N	ENST00000331442.3	37	c.459	CCDS4635.1	6	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953948	0.53293	.	.	ENSG00000184357	ENST00000331442	T	0.17691	2.26	5.19	4.3	0.51218	.	0.191066	0.43110	D	0.000603	T	0.06462	0.0166	N	0.08118	0	0.46356	D	0.999006	D	0.69078	0.997	P	0.52598	0.703	T	0.22068	-1.0227	10	0.28530	T	0.3	-5.6145	8.9898	0.36017	0.0:0.9012:0.0:0.0988	.	153	P16401	H15_HUMAN	N	153	ENSP00000330074:K153N	ENSP00000330074:K153N	K	-	3	2	HIST1H1B	27942828	0.985000	0.35326	1.000000	0.80357	0.951000	0.60555	0.641000	0.24720	2.600000	0.87896	0.655000	0.94253	AAG	HIST1H1B	-	NULL	ENSG00000184357		0.602	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H1B	HGNC	protein_coding	OTTHUMT00000043371.1	-	0.00	40	0	C	NM_005322		27834849	-1	tier1	-	no_errors	ENST00000331442	ensembl	human	known	74_37	missense	40.91	26	18	SNP	1.000	A
HNRNPA0	10949	genome.wustl.edu	37	5	137088929	137088931	+	In_Frame_Del	DEL	CCG	CCG	-			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	CCG	CCG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:137088929_137088931delCCG	ENST00000314940.4	-	1	1108_1110	c.825_827delCGG	c.(823-828)ggcggt>ggt	p.275_276GG>G		NM_006805.3	NP_006796.1	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	275	Gly-rich.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|response to lipopolysaccharide (GO:0032496)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)	p.G275G(1)		large_intestine(1)|lung(2)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			ACTgcctccaccgccgccgccgc	0.626																																																	1	Substitution - coding silent(1)	large_intestine(1)								24,2808		2,20,1394							0.0			12	72,5960		7,58,2951	no	coding	HNRNPA0	NM_006805.3		9,78,4345	A1A1,A1R,RR		1.1936,0.8475,1.083				96,8768				SO:0001651	inframe_deletion	0			U23803	CCDS4193.1	5q31	2013-02-12		2007-08-16	ENSG00000177733	ENSG00000177733		"""RNA binding motif (RRM) containing"""	5030	protein-coding gene	gene with protein product		609409		HNRPA0		7585247	Standard	NM_006805		Approved	hnRNPA0	uc003lbt.3	Q13151	OTTHUMG00000129156	ENST00000314940.4:c.825_827delCGG	5.37:g.137088938_137088940delCCG	ENSP00000316042:p.Gly278del		Q6IB18	In_Frame_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G278in_frame_del	ENST00000314940.4	37	c.827_825	CCDS4193.1	5																																																																																			HNRNPA0	-	NULL	ENSG00000177733		0.626	HNRNPA0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPA0	HGNC	protein_coding	OTTHUMT00000251221.1		0.00	25	0	CCG	NM_006805		137088931	-1	tier1		no_errors	ENST00000314940	ensembl	human	known	74_37	in_frame_del	9.09	20	2	DEL	0.372:0.361:0.351	-
HOXA7	3204	genome.wustl.edu	37	7	27192510	27192510	+	IGR	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:27192510G>A	ENST00000242159.3	-	0	2020				HOXA-AS3_ENST00000521197.1_RNA|HOXA-AS3_ENST00000518947.2_RNA|HOXA-AS3_ENST00000521231.1_RNA|HOXA-AS3_ENST00000524304.1_RNA|HOXA6_ENST00000521478.1_5'Flank|RP1-170O19.23_ENST00000498652.1_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA7_ENST00000523796.2_5'Flank|HOXA-AS3_ENST00000518848.1_RNA	NM_006896.3	NP_008827.2	P31268	HXA7_HUMAN	homeobox A7						angiogenesis (GO:0001525)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of monocyte differentiation (GO:0045656)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell differentiation (GO:0048863)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(3)|large_intestine(1)|lung(10)|prostate(1)|urinary_tract(1)	16						GACTGGAGACGAGGTCTTGCA	0.632																																																	0																																										SO:0001628	intergenic_variant	0				CCDS5408.1	7p15.2	2011-06-20	2005-12-22		ENSG00000122592	ENSG00000122592		"""Homeoboxes / ANTP class : HOXL subclass"""	5108	protein-coding gene	gene with protein product		142950	"""homeo box A7"""	HOX1A, HOX1		1973146, 1358459	Standard	NM_006896		Approved		uc003sys.3	P31268	OTTHUMG00000023217		7.37:g.27192510G>A			A4D191|O43368|O43486|O95655|Q9NSC8|Q9UDM1	RNA	SNP	-	NULL	ENST00000242159.3	37	NULL	CCDS5408.1	7																																																																																			HOXA-AS3	-	-	ENSG00000254369		0.632	HOXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA-AS3	HGNC	protein_coding	OTTHUMT00000358695.1	-	0.00	158	0	G			27192510	+1	tier1	-	no_errors	ENST00000518947	ensembl	human	known	74_37	rna	16.18	145	28	SNP	0.001	A
HS6ST1	9394	genome.wustl.edu	37	2	129026040	129026040	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:129026040T>C	ENST00000259241.6	-	2	945	c.932A>G	c.(931-933)aAg>aGg	p.K311R		NM_004807.2	NP_004798.3	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	311					angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|labyrinthine layer blood vessel development (GO:0060716)|lung alveolus development (GO:0048286)|neuron development (GO:0048666)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	heparan sulfate 6-O-sulfotransferase activity (GO:0017095)|sulfotransferase activity (GO:0008146)			endometrium(3)|liver(1)|lung(7)|pancreas(1)|prostate(2)|skin(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		CCGGATGAACTTGAGGTTGAA	0.617																																																	0													37.0	38.0	38.0					2																	129026040		2101	4218	6319	SO:0001583	missense	0			AB006179	CCDS42748.1	2q21	2010-03-19		2002-08-23	ENSG00000136720	ENSG00000136720		"""Sulfotransferases, membrane-bound"""	5201	protein-coding gene	gene with protein product		604846		HS6ST		9535912	Standard	NM_004807		Approved		uc002tpt.4	O60243	OTTHUMG00000153542	ENST00000259241.6:c.932A>G	2.37:g.129026040T>C	ENSP00000259241:p.Lys311Arg		B4DEP2|B4DJ29|Q53SL2|Q9BVI1	Missense_Mutation	SNP	pfam_Sulfotransferase,superfamily_P-loop_NTPase	p.K311R	ENST00000259241.6	37	c.932	CCDS42748.1	2	.	.	.	.	.	.	.	.	.	.	T	8.597	0.885888	0.17540	.	.	ENSG00000136720	ENST00000259241	D	0.82893	-1.66	4.78	2.38	0.29361	.	0.116513	0.64402	D	0.000020	T	0.62514	0.2434	N	0.05608	-0.01	0.40354	D	0.979165	B	0.09022	0.002	B	0.08055	0.003	T	0.46512	-0.9186	9	.	.	.	-6.5638	8.7591	0.34663	0.0:0.156:0.0:0.844	.	311	O60243	H6ST1_HUMAN	R	311	ENSP00000259241:K311R	.	K	-	2	0	HS6ST1	128742510	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	3.853000	0.55941	0.213000	0.20722	0.379000	0.24179	AAG	HS6ST1	-	pfam_Sulfotransferase	ENSG00000136720		0.617	HS6ST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS6ST1	HGNC	protein_coding	OTTHUMT00000331572.1	-	0.00	69	0	T	NM_004807		129026040	-1	tier1	-	no_errors	ENST00000259241	ensembl	human	known	74_37	missense	24.49	37	12	SNP	1.000	C
IARS2	55699	genome.wustl.edu	37	1	220279397	220279397	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:220279397C>T	ENST00000302637.5	+	9	1335	c.1231C>T	c.(1231-1233)Ccc>Tcc	p.P411S	IARS2_ENST00000366922.1_Missense_Mutation_p.P339S	NM_018060.3	NP_060530.3	Q9NSE4	SYIM_HUMAN	isoleucyl-tRNA synthetase 2, mitochondrial	411					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			NS(1)|breast(1)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(7)|lung(17)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	GCACAACCTGCCCATGGTACT	0.383																																																	0													144.0	136.0	139.0					1																	220279397		2203	4300	6503	SO:0001583	missense	0			AK022665	CCDS1523.1	1q41	2011-07-01	2007-02-26		ENSG00000067704	ENSG00000067704	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	29685	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 2, mitochondrial"""	612801					Standard	NM_018060		Approved	FLJ10326	uc001hmc.3	Q9NSE4	OTTHUMG00000037287	ENST00000302637.5:c.1231C>T	1.37:g.220279397C>T	ENSP00000303279:p.Pro411Ser		B2RPG8|Q1M2P9|Q6PI85|Q7L439|Q86WU9|Q96D91|Q9H9Q8|Q9NW42	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_Znf_DNA_glyclase/IsotRNA_synth,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Val/Leu/Ile-tRNA-synth_edit,prints_Ile-tRNA-ligase,tigrfam_Ile-tRNA-ligase	p.P411S	ENST00000302637.5	37	c.1231	CCDS1523.1	1	.	.	.	.	.	.	.	.	.	.	C	9.440	1.087823	0.20390	.	.	ENSG00000067704	ENST00000366922;ENST00000302637	T;T	0.79033	-1.23;-1.23	5.47	-2.45	0.06481	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class Ia, editing domain (2);Aminoacyl-tRNA synthetase, class Ia (1);	0.452495	0.26731	N	0.022793	T	0.72003	0.3407	L	0.61387	1.9	0.53688	D	0.999978	B	0.14012	0.009	B	0.17979	0.02	T	0.64253	-0.6451	10	0.51188	T	0.08	-17.6978	14.4824	0.67592	0.0:0.7327:0.0:0.2673	.	411	Q9NSE4	SYIM_HUMAN	S	339;411	ENSP00000355889:P339S;ENSP00000303279:P411S	ENSP00000303279:P411S	P	+	1	0	IARS2	218346020	0.972000	0.33761	0.281000	0.24762	0.267000	0.26476	0.277000	0.18734	-0.312000	0.08741	-0.218000	0.12543	CCC	IARS2	-	pfam_aa-tRNA-synth_Ia,superfamily_Val/Leu/Ile-tRNA-synth_edit,tigrfam_Ile-tRNA-ligase	ENSG00000067704		0.383	IARS2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS2	HGNC	protein_coding			0.00	25	0	C	NM_018060		220279397	+1			no_errors	ENST00000302637	ensembl	human	known	74_37	missense	5.41	35	2	SNP	0.930	T
IFIH1	64135	genome.wustl.edu	37	2	163133265	163133265	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:163133265C>T	ENST00000263642.2	-	11	2631	c.2236G>A	c.(2236-2238)Gaa>Aaa	p.E746K		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	746	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						ACTCCTACTTCAGCAAATTTT	0.418																																																	0													223.0	219.0	221.0					2																	163133265		2203	4300	6503	SO:0001583	missense	0			AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.2236G>A	2.37:g.163133265C>T	ENSP00000263642:p.Glu746Lys		Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_CARD,superfamily_P-loop_NTPase,superfamily_DEATH-like_dom,superfamily_ARM-type_fold,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E746K	ENST00000263642.2	37	c.2236	CCDS2217.1	2	.	.	.	.	.	.	.	.	.	.	C	22.6	4.314863	0.81358	.	.	ENSG00000115267	ENST00000263642;ENST00000543192	T	0.05319	3.46	5.55	4.67	0.58626	Helicase, C-terminal (2);	0.091972	0.85682	D	0.000000	T	0.06600	0.0169	N	0.04245	-0.25	0.51012	D	0.999906	B	0.30511	0.282	B	0.43274	0.414	T	0.53194	-0.8473	10	0.38643	T	0.18	-21.8514	16.5586	0.84534	0.0:0.8694:0.1306:0.0	.	746	Q9BYX4	IFIH1_HUMAN	K	746	ENSP00000263642:E746K	ENSP00000263642:E746K	E	-	1	0	IFIH1	162841511	1.000000	0.71417	0.990000	0.47175	0.983000	0.72400	4.792000	0.62467	1.324000	0.45282	-0.150000	0.13652	GAA	IFIH1	-	superfamily_P-loop_NTPase,smart_Helicase_C,pfscan_Helicase_C	ENSG00000115267		0.418	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIH1	HGNC	protein_coding	OTTHUMT00000255078.2	-	0.00	66	0	C	NM_022168		163133265	-1	tier1	-	no_errors	ENST00000263642	ensembl	human	known	74_37	missense	30.00	49	21	SNP	1.000	T
ILF3	3609	genome.wustl.edu	37	19	10789847	10789847	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:10789847C>T	ENST00000590261.1	+	6	726	c.726C>T	c.(724-726)acC>acT	p.T242T	ILF3_ENST00000592763.1_Silent_p.T242T|ILF3_ENST00000250241.8_Silent_p.T242T|ILF3_ENST00000420083.1_Silent_p.T242T|ILF3_ENST00000589998.1_Silent_p.T242T|ILF3_ENST00000318511.3_Silent_p.T242T|ILF3_ENST00000407004.3_Silent_p.T242T|ILF3_ENST00000588657.1_Silent_p.T242T|ILF3_ENST00000449870.1_Silent_p.T242T			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa	242	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			GCGTGCCCACCTGGGGTCCCC	0.582																																																	0													77.0	65.0	69.0					19																	10789847		2203	4300	6503	SO:0001819	synonymous_variant	0			U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.726C>T	19.37:g.10789847C>T			A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Silent	SNP	pfam_DZF,pfam_dsRNA-bd_dom,smart_DZF,smart_dsRNA-bd_dom,pfscan_dsRNA-bd_dom	p.T242	ENST00000590261.1	37	c.726	CCDS12246.1	19																																																																																			ILF3	-	pfam_DZF,smart_DZF	ENSG00000129351		0.582	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ILF3	HGNC	protein_coding	OTTHUMT00000452074.1	-	0.00	44	0	C			10789847	+1	tier1	-	no_errors	ENST00000449870	ensembl	human	known	74_37	silent	12.90	27	4	SNP	1.000	T
ILK	3611	genome.wustl.edu	37	11	6631827	6631827	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:6631827G>C	ENST00000396751.2	+	12	1800	c.1344G>C	c.(1342-1344)aaG>aaC	p.K448N	ILK_ENST00000420936.2_Missense_Mutation_p.K448N|TAF10_ENST00000531760.1_5'Flank|ILK_ENST00000537806.1_Missense_Mutation_p.K314N|ILK_ENST00000528995.1_Missense_Mutation_p.K387N|RP11-732A19.2_ENST00000527398.1_RNA|ILK_ENST00000299421.4_Missense_Mutation_p.K448N	NM_001014795.1	NP_001014795.1	Q13418	ILK_HUMAN	integrin-linked kinase	448					branching involved in ureteric bud morphogenesis (GO:0001658)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell junction assembly (GO:0034329)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|extracellular fibril organization (GO:0043206)|fibroblast migration (GO:0010761)|integrin-mediated signaling pathway (GO:0007229)|myelin assembly (GO:0032288)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|peptidyl-serine phosphorylation (GO:0018105)|platelet aggregation (GO:0070527)|positive regulation of axon extension (GO:0045773)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		TCCTTGAGAAGATGCAGGACA	0.512																																																	0													85.0	87.0	86.0					11																	6631827		2201	4296	6497	SO:0001583	missense	0			U40282	CCDS7768.1, CCDS60712.1, CCDS60713.1	11p15.4	2014-09-17			ENSG00000166333	ENSG00000166333		"""Ankyrin repeat domain containing"""	6040	protein-coding gene	gene with protein product		602366				8538749	Standard	NM_004517		Approved		uc001mef.3	Q13418	OTTHUMG00000133407	ENST00000396751.2:c.1344G>C	11.37:g.6631827G>C	ENSP00000379975:p.Lys448Asn		B7Z1I0|B7Z418|D3DQU0|P57043|Q68DZ3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ankyrin_rpt,pfam_Prot_kinase_dom,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Integrin-linked_kinase,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Prot_kinase_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.K448N	ENST00000396751.2	37	c.1344	CCDS7768.1	11	.	.	.	.	.	.	.	.	.	.	G	16.00	2.999738	0.54147	.	.	ENSG00000166333	ENST00000299421;ENST00000537806;ENST00000420936;ENST00000528995;ENST00000396751	T;D;T;T;T	0.83506	-1.33;-1.73;-1.33;-1.4;-1.33	5.29	5.29	0.74685	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.89825	0.6827	M	0.64630	1.985	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.71414	0.973;0.941	D	0.90423	0.4418	10	0.87932	D	0	.	18.1648	0.89722	0.0:0.0:1.0:0.0	.	387;448	B7Z418;Q13418	.;ILK_HUMAN	N	448;314;448;387;448	ENSP00000299421:K448N;ENSP00000439606:K314N;ENSP00000403487:K448N;ENSP00000435323:K387N;ENSP00000379975:K448N	ENSP00000299421:K448N	K	+	3	2	ILK	6588403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.452000	0.66638	2.753000	0.94483	0.650000	0.86243	AAG	ILK	-	superfamily_Kinase-like_dom,pirsf_Integrin-linked_kinase	ENSG00000166333		0.512	ILK-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ILK	HGNC	protein_coding	OTTHUMT00000384519.1	-	0.00	40	0	G	NM_004517		6631827	+1	tier1	-	no_errors	ENST00000299421	ensembl	human	known	74_37	missense	34.21	25	13	SNP	1.000	C
IMPG1	3617	genome.wustl.edu	37	6	76751789	76751789	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:76751789C>T	ENST00000369950.3	-	2	311	c.122G>A	c.(121-123)aGa>aAa	p.R41K	IMPG1_ENST00000369963.3_Intron	NM_001282368.1|NM_001563.2	NP_001269297.1|NP_001554.2			interphotoreceptor matrix proteoglycan 1											breast(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(8)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	63		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				TGTTTCATTTCTTGGGGGATT	0.318																																					Pancreas(37;839 1141 2599 26037)												0													166.0	160.0	162.0					6																	76751789		2203	4299	6502	SO:0001583	missense	0			AF017776	CCDS4985.1, CCDS75483.1	6q14.2-q15	2008-02-05	2004-05-25		ENSG00000112706	ENSG00000112706			6055	protein-coding gene	gene with protein product		602870	"""sialoprotein associated with cones and rods"""	SPACR			Standard	NM_001282368		Approved	IPM150, GP147	uc003pik.1	Q17R60	OTTHUMG00000015063	ENST00000369950.3:c.122G>A	6.37:g.76751789C>T	ENSP00000358966:p.Arg41Lys			Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.R41K	ENST00000369950.3	37	c.122	CCDS4985.1	6	.	.	.	.	.	.	.	.	.	.	C	13.42	2.231571	0.39399	.	.	ENSG00000112706	ENST00000369950	T	0.20463	2.07	6.07	4.3	0.51218	.	0.250028	0.35708	N	0.003029	T	0.07324	0.0185	L	0.53249	1.67	0.80722	D	1	P	0.37864	0.61	B	0.29598	0.104	T	0.12811	-1.0533	9	.	.	.	.	8.3646	0.32378	0.0:0.7377:0.1277:0.1345	.	41	Q17R60	IMPG1_HUMAN	K	41	ENSP00000358966:R41K	.	R	-	2	0	IMPG1	76808509	0.773000	0.28580	0.983000	0.44433	0.650000	0.38633	0.873000	0.28052	0.900000	0.36469	0.655000	0.94253	AGA	IMPG1	-	NULL	ENSG00000112706		0.318	IMPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG1	HGNC	protein_coding	OTTHUMT00000041288.1	-	0.00	48	0	C	NM_001563		76751789	-1	tier1	-	no_errors	ENST00000369950	ensembl	human	known	74_37	missense	17.74	51	11	SNP	0.915	T
IQGAP3	128239	genome.wustl.edu	37	1	156509318	156509318	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:156509318G>C	ENST00000361170.2	-	25	2914	c.2904C>G	c.(2902-2904)atC>atG	p.I968M	IQGAP3_ENST00000498755.1_5'Flank	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	968					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGGCCAGGTAGATGGGCTGAG	0.512																																																	0													86.0	78.0	81.0					1																	156509318		2203	4300	6503	SO:0001583	missense	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.2904C>G	1.37:g.156509318G>C	ENSP00000354451:p.Ile968Met		Q5T3H8	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_P-loop_NTPase,superfamily_WW_dom,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.I968M	ENST00000361170.2	37	c.2904	CCDS1144.1	1	.	.	.	.	.	.	.	.	.	.	G	10.19	1.282209	0.23392	.	.	ENSG00000183856	ENST00000361170	D	0.82081	-1.57	4.8	4.8	0.61643	Rho GTPase activation protein (1);	0.448765	0.24504	N	0.037941	T	0.61299	0.2336	L	0.29908	0.895	0.32733	N	0.508797	B	0.33448	0.412	B	0.34722	0.188	T	0.63603	-0.6600	10	0.46703	T	0.11	-7.8644	8.2515	0.31724	0.0:0.1688:0.6567:0.1746	.	968	Q86VI3	IQGA3_HUMAN	M	968	ENSP00000354451:I968M	ENSP00000354451:I968M	I	-	3	3	IQGAP3	154775942	0.001000	0.12720	1.000000	0.80357	0.938000	0.57974	-0.086000	0.11233	2.482000	0.83794	0.655000	0.94253	ATC	IQGAP3	-	superfamily_Rho_GTPase_activation_prot	ENSG00000183856		0.512	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1		0.00	26	0	G	NM_178229		156509318	-1			no_errors	ENST00000361170	ensembl	human	known	74_37	missense	6.12	46	3	SNP	1.000	C
ISL2	64843	genome.wustl.edu	37	15	76629258	76629258	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:76629258G>T	ENST00000290759.4	+	1	194	c.34G>T	c.(34-36)Ggt>Tgt	p.G12C	RP11-685G9.2_ENST00000559539.1_RNA	NM_145805.1	NP_665804.1	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	12					negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|peripheral nervous system neuron development (GO:0048935)|regulation of transcription, DNA-templated (GO:0006355)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord motor neuron cell fate specification (GO:0021520)|visceral motor neuron differentiation (GO:0021524)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)	p.G12C(1)		breast(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6						TCCTTTTCTGGGTGCTATGGG	0.468																																					GBM(97;953 1391 16164 31496 36951)												1	Substitution - Missense(1)	lung(1)											289.0	308.0	302.0					15																	76629258		2197	4294	6491	SO:0001583	missense	0			AK001022	CCDS10290.1	15q24.3	2012-03-09	2007-07-13		ENSG00000159556	ENSG00000159556		"""Homeoboxes / LIM class"""	18524	protein-coding gene	gene with protein product		609481	"""ISL2 transcription factor, LIM/homeodomain, (islet-2)"""				Standard	NM_145805		Approved	FLJ10160	uc002bbw.1	Q96A47	OTTHUMG00000143723	ENST00000290759.4:c.34G>T	15.37:g.76629258G>T	ENSP00000290759:p.Gly12Cys		B3KM37	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeobox_dom,pfscan_Znf_LIM,pfscan_Homeobox_dom	p.G12C	ENST00000290759.4	37	c.34	CCDS10290.1	15	.	.	.	.	.	.	.	.	.	.	G	18.59	3.657629	0.67586	.	.	ENSG00000159556	ENST00000290759	D	0.85339	-1.97	5.12	5.12	0.69794	.	0.164731	0.53938	D	0.000057	D	0.83529	0.5274	L	0.42245	1.32	0.53688	D	0.999971	P	0.52170	0.951	P	0.45971	0.499	D	0.86028	0.1511	10	0.72032	D	0.01	.	16.0455	0.80717	0.0:0.0:1.0:0.0	.	12	Q96A47	ISL2_HUMAN	C	12	ENSP00000290759:G12C	ENSP00000290759:G12C	G	+	1	0	ISL2	74416313	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.355000	0.90083	2.366000	0.80165	0.561000	0.74099	GGT	ISL2	-	NULL	ENSG00000159556		0.468	ISL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISL2	HGNC	protein_coding	OTTHUMT00000289779.1		0.00	29	0	G			76629258	+1			no_errors	ENST00000290759	ensembl	human	known	74_37	missense	7.41	24	2	SNP	1.000	T
KCNC1	3746	genome.wustl.edu	37	11	17794164	17794164	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:17794164G>A	ENST00000379472.3	+	2	1553	c.1523G>A	c.(1522-1524)gGc>gAc	p.G508D	KCNC1_ENST00000265969.6_Intron	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	508					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)	p.G508D(1)		breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	CCTCTTAGAGGCATGTCGATC	0.522																																																	1	Substitution - Missense(1)	large_intestine(1)											59.0	60.0	60.0					11																	17794164		2200	4290	6490	SO:0001583	missense	0			M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.1523G>A	11.37:g.17794164G>A	ENSP00000368785:p.Gly508Asp		K4DI87	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_2pore_dom_K_chnl_dom,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv3.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9	p.G508D	ENST00000379472.3	37	c.1523	CCDS7827.1	11	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703908	0.48412	.	.	ENSG00000129159	ENST00000379472	D	0.97138	-4.26	5.42	5.42	0.78866	.	2.715750	0.00897	N	0.002306	D	0.98036	0.9353	M	0.75264	2.295	0.47737	D	0.999506	D	0.61080	0.989	P	0.49665	0.618	D	0.90470	0.4452	9	.	.	.	.	19.2221	0.93801	0.0:0.0:1.0:0.0	.	508	P48547	KCNC1_HUMAN	D	508	ENSP00000368785:G508D	.	G	+	2	0	KCNC1	17750740	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.976000	0.63785	2.530000	0.85305	0.561000	0.74099	GGC	KCNC1	-	NULL	ENSG00000129159		0.522	KCNC1-001	KNOWN	basic|CCDS	protein_coding	KCNC1	HGNC	protein_coding	OTTHUMT00000389389.1		0.00	51	0	G	NM_004976		17794164	+1			no_errors	ENST00000379472	ensembl	human	known	74_37	missense	5.26	54	3	SNP	1.000	A
KCNMB3	27094	genome.wustl.edu	37	3	178960754	178960754	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:178960754C>G	ENST00000314235.5	-	4	1289	c.778G>C	c.(778-780)Gaa>Caa	p.E260Q	KCNMB3_ENST00000497599.1_Intron|KCNMB3_ENST00000392685.2_Missense_Mutation_p.E256Q|KCNMB3_ENST00000486944.1_Intron|KCNMB3_ENST00000485523.1_Missense_Mutation_p.E238Q|KCNMB3_ENST00000349697.2_Missense_Mutation_p.E258Q	NM_014407.3	NP_055222.3	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	260					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	TGATGCTGTTCTATATAAGGT	0.418																																																	0													100.0	96.0	98.0					3																	178960754		2203	4300	6503	SO:0001583	missense	0			AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000314235.5:c.778G>C	3.37:g.178960754C>G	ENSP00000319370:p.Glu260Gln		B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_bsu	p.E260Q	ENST00000314235.5	37	c.778	CCDS3226.1	3	.	.	.	.	.	.	.	.	.	.	c	9.539	1.112804	0.20795	.	.	ENSG00000171121	ENST00000392685;ENST00000349697;ENST00000314235;ENST00000485523	T;T;T;T	0.10763	2.84;2.85;2.86;2.86	5.29	1.54	0.23209	.	1.046320	0.07612	N	0.925582	T	0.08802	0.0218	N	0.24115	0.695	0.09310	N	1	B;B;B;B	0.34015	0.16;0.078;0.435;0.148	B;B;B;B	0.33521	0.075;0.118;0.165;0.055	T	0.40421	-0.9564	10	0.54805	T	0.06	.	9.09	0.36605	0.0:0.6918:0.0:0.3082	.	258;238;256;260	Q9NPA1-2;Q9NPA1-4;Q9NPA1-3;Q9NPA1	.;.;.;KCMB3_HUMAN	Q	256;258;260;238	ENSP00000376451:E256Q;ENSP00000327866:E258Q;ENSP00000319370:E260Q;ENSP00000418536:E238Q	ENSP00000319370:E260Q	E	-	1	0	KCNMB3	180443448	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.504000	0.22626	0.072000	0.16694	-0.801000	0.03215	GAA	KCNMB3	-	NULL	ENSG00000171121		0.418	KCNMB3-004	KNOWN	basic|CCDS	protein_coding	KCNMB3	HGNC	protein_coding	OTTHUMT00000348484.1	-	0.00	66	0	C			178960754	-1	tier1	-	no_errors	ENST00000314235	ensembl	human	known	74_37	missense	24.39	62	20	SNP	0.000	G
KDM1B	221656	genome.wustl.edu	37	6	18160169	18160169	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:18160169G>T	ENST00000297792.5	+	3	220	c.43G>T	c.(43-45)Gat>Tat	p.D15Y	KDM1B_ENST00000546309.2_Intron|KDM1B_ENST00000388870.2_Missense_Mutation_p.D15Y|KDM1B_ENST00000397244.1_Missense_Mutation_p.D15Y			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	15					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						AGCATCTTTTGATCATTCTCC	0.378																																																	0													81.0	72.0	75.0					6																	18160169		2203	4300	6503	SO:0001583	missense	0			AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000297792.5:c.43G>T	6.37:g.18160169G>T	ENSP00000297792:p.Asp15Tyr		A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Missense_Mutation	SNP	pfam_Amino_oxidase,pfam_Znf_CW,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_SWIRM,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_mOase_FAD-bd,pfam_CHP00275_HI0933-like,pfam_FAD_bind_dom,superfamily_Homeodomain-like,pfscan_SWIRM,pfscan_Znf_CW	p.D15Y	ENST00000297792.5	37	c.43	CCDS34343.1	6	.	.	.	.	.	.	.	.	.	.	G	19.34	3.808006	0.70797	.	.	ENSG00000165097	ENST00000388870;ENST00000397244;ENST00000297792;ENST00000388869	T;T;T	0.34859	1.39;1.34;1.34	4.75	4.75	0.60458	.	1.143330	0.06393	N	0.717380	T	0.31104	0.0786	L	0.36672	1.1	0.80722	D	1	P	0.46395	0.877	P	0.47626	0.552	T	0.19549	-1.0302	10	0.72032	D	0.01	-8.5885	16.3056	0.82846	0.0:0.0:1.0:0.0	.	15	A2A2C6	.	Y	15	ENSP00000373522:D15Y;ENSP00000380419:D15Y;ENSP00000297792:D15Y	ENSP00000297792:D15Y	D	+	1	0	KDM1B	18268148	1.000000	0.71417	0.995000	0.50966	0.912000	0.54170	5.805000	0.69143	2.335000	0.79485	0.557000	0.71058	GAT	KDM1B	-	NULL	ENSG00000165097		0.378	KDM1B-002	KNOWN	basic|CCDS	protein_coding	KDM1B	HGNC	protein_coding	OTTHUMT00000277080.1	-	0.00	42	0	G	NM_153042		18160169	+1	tier1	-	no_errors	ENST00000388870	ensembl	human	known	74_37	missense	9.76	37	4	SNP	1.000	T
KDM2A	22992	genome.wustl.edu	37	11	67023822	67023823	+	3'UTR	INS	-	-	A	rs112132478		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:67023822_67023823insA	ENST00000529006.2	+	0	5231_5232				KDM2A_ENST00000308783.5_3'UTR|KDM2A_ENST00000530342.1_3'UTR|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000398645.2_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A						histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						TTTTGCACTTTAAAAAAAAAAA	0.446																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.*1297->A	11.37:g.67023833_67023833dupA			D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	RNA	INS	-	NULL	ENST00000529006.2	37	NULL	CCDS44657.1	11																																																																																			KDM2A	-	-	ENSG00000173120		0.446	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2		0.00	23	0	-	NM_012308		67023823	+1	tier1		no_errors	ENST00000524657	ensembl	human	known	74_37	rna	12.50	28	4	INS	1.000:1.000	A
KIAA0195	9772	genome.wustl.edu	37	17	73491440	73491440	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:73491440C>A	ENST00000314256.7	+	21	3198	c.2804C>A	c.(2803-2805)aCg>aAg	p.T935K	KIAA0195_ENST00000375248.5_Missense_Mutation_p.T945K|KIAA0195_ENST00000579208.1_Missense_Mutation_p.T586K|AC100787.1_ENST00000579379.1_RNA	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	935						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			TTCCAGCCTACGGACAGCGAC	0.602																																																	0													72.0	69.0	70.0					17																	73491440		2203	4300	6503	SO:0001583	missense	0				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.2804C>A	17.37:g.73491440C>A	ENSP00000313885:p.Thr935Lys		O75536|Q86XF1	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-transptr_C	p.T935K	ENST00000314256.7	37	c.2804	CCDS32732.1	17	.	.	.	.	.	.	.	.	.	.	C	16.22	3.062898	0.55432	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.49720	0.77;0.77	5.96	5.96	0.96718	.	0.104547	0.64402	D	0.000004	T	0.69333	0.3099	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.76071	0.921;0.987;0.97	T	0.67035	-0.5772	10	0.51188	T	0.08	-17.7902	20.4084	0.99013	0.0:1.0:0.0:0.0	.	945;945;935	B4DGC6;C9JL75;Q12767	.;.;K0195_HUMAN	K	935;945	ENSP00000313885:T935K;ENSP00000364397:T945K	ENSP00000313885:T935K	T	+	2	0	KIAA0195	71003035	1.000000	0.71417	0.717000	0.30585	0.987000	0.75469	5.686000	0.68211	2.833000	0.97629	0.650000	0.86243	ACG	KIAA0195	-	NULL	ENSG00000177728		0.602	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	HGNC	protein_coding	OTTHUMT00000447303.1	-	0.00	43	0	C	NM_014738		73491440	+1	tier1	-	no_errors	ENST00000314256	ensembl	human	known	74_37	missense	6.25	60	4	SNP	0.998	A
KIAA0319L	79932	genome.wustl.edu	37	1	35919200	35919200	+	Nonsense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:35919200G>C	ENST00000325722.3	-	12	2105	c.1871C>G	c.(1870-1872)tCa>tGa	p.S624*	KIAA0319L_ENST00000373266.4_Nonsense_Mutation_p.S61*|KIAA0319L_ENST00000485551.1_5'UTR	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	624	PKD 4. {ECO:0000255|PROSITE- ProRule:PRU00151}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CTGATCATCTGAGCTCTTGCT	0.448																																																	0													118.0	115.0	116.0					1																	35919200		2203	4300	6503	SO:0001587	stop_gained	0			AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.1871C>G	1.37:g.35919200G>C	ENSP00000318406:p.Ser624*		B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Nonsense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.S624*	ENST00000325722.3	37	c.1871	CCDS390.1	1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.939141	0.73557	.	.	ENSG00000142687	ENST00000325722;ENST00000373266;ENST00000426982;ENST00000440579	.	.	.	5.56	4.63	0.57726	.	0.654515	0.15032	N	0.284382	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-4.4586	14.447	0.67359	0.0746:0.0:0.9254:0.0	.	.	.	.	X	624;61;624;624	.	ENSP00000318406:S624X	S	-	2	0	KIAA0319L	35691787	0.916000	0.31088	0.995000	0.50966	0.996000	0.88848	2.855000	0.48333	2.777000	0.95525	0.655000	0.94253	TCA	KIAA0319L	-	superfamily_PKD_dom,smart_PKD/Chitinase_dom	ENSG00000142687		0.448	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319L	HGNC	protein_coding	OTTHUMT00000012684.2	-	0.00	49	0	G	NM_024874		35919200	-1	tier1	-	no_errors	ENST00000325722	ensembl	human	known	74_37	nonsense	21.31	48	13	SNP	0.960	C
KIAA0391	9692	genome.wustl.edu	37	14	35596726	35596726	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:35596726A>G	ENST00000557565.1	+	4	1457	c.1076A>G	c.(1075-1077)cAg>cGg	p.Q359R	KIAA0391_ENST00000250377.7_Missense_Mutation_p.Q264R|KIAA0391_ENST00000605870.1_5'UTR|KIAA0391_ENST00000603544.1_Missense_Mutation_p.Q343R|KIAA0391_ENST00000321130.10_Missense_Mutation_p.Q343R|KIAA0391_ENST00000603588.1_3'UTR|KIAA0391_ENST00000604948.1_Missense_Mutation_p.Q264R|KIAA0391_ENST00000534898.4_Missense_Mutation_p.Q359R	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	359					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		GAGTCTATTCAGCTGAGTCCA	0.373																																																	0													77.0	75.0	76.0					14																	35596726		2203	4300	6503	SO:0001583	missense	0			AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.1076A>G	14.37:g.35596726A>G	ENSP00000454657:p.Gln359Arg		B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Missense_Mutation	SNP	NULL	p.Q359R	ENST00000557565.1	37	c.1076	CCDS32063.1	14	.	.	.	.	.	.	.	.	.	.	A	7.748	0.702696	0.15172	.	.	ENSG00000100890	ENST00000554896;ENST00000250377;ENST00000321130;ENST00000534898;ENST00000556121	T;T;T	0.42900	0.97;0.96;0.96	5.63	3.29	0.37713	.	0.344687	0.31507	N	0.007524	T	0.24586	0.0596	N	0.14661	0.345	0.20074	N	0.999934	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.14924	-1.0455	10	0.36615	T	0.2	-0.2009	9.9089	0.41392	0.8617:0.0:0.1383:0.0	.	343;359	O15091-2;O15091	.;MRRP3_HUMAN	R	264;264;343;359;343	ENSP00000250377:Q264R;ENSP00000324697:Q343R;ENSP00000440915:Q359R	ENSP00000250377:Q264R	Q	+	2	0	KIAA0391	34666477	0.973000	0.33851	0.243000	0.24186	0.395000	0.30598	4.314000	0.59166	0.416000	0.25844	0.528000	0.53228	CAG	KIAA0391	-	NULL	ENSG00000100890		0.373	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	KIAA0391	HGNC	protein_coding	OTTHUMT00000411280.1	-	0.00	69	0	A	NM_014672		35596726	+1	tier1	-	no_errors	ENST00000534898	ensembl	human	known	74_37	missense	5.38	88	5	SNP	0.806	G
KIAA1598	57698	genome.wustl.edu	37	10	118671344	118671344	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:118671344G>T	ENST00000355371.4	-	14	1813	c.1316C>A	c.(1315-1317)tCg>tAg	p.S439*	KIAA1598_ENST00000260777.10_Nonsense_Mutation_p.S439*|KIAA1598_ENST00000497044.1_5'UTR|KIAA1598_ENST00000392901.4_Nonsense_Mutation_p.S379*|KIAA1598_ENST00000392903.2_Nonsense_Mutation_p.S439*	NM_001127211.2|NM_001258298.1|NM_001258299.1	NP_001120683.1|NP_001245227.1|NP_001245228.1	A0MZ66	SHOT1_HUMAN	KIAA1598	439					axon guidance (GO:0007411)|regulation of establishment of cell polarity (GO:2000114)|regulation of neuron migration (GO:2001222)	axonal growth cone (GO:0044295)				endometrium(1)|kidney(1)|large_intestine(5)|lung(3)	10				all cancers(201;0.00494)		GCAGCCTTTCGAAGATTCTGG	0.308																																																	0													69.0	71.0	70.0					10																	118671344		2203	4297	6500	SO:0001587	stop_gained	0			BC022348	CCDS31293.1, CCDS44482.1, CCDS58097.1, CCDS73207.1, CCDS73208.1	10q26.12	2007-01-30			ENSG00000187164	ENSG00000187164			29319	protein-coding gene	gene with protein product		611171				10997877, 17030985	Standard	NM_001127211		Approved	shootin1, shootin-1	uc009xyw.4	A0MZ66	OTTHUMG00000019114	ENST00000355371.4:c.1316C>A	10.37:g.118671344G>T	ENSP00000347532:p.Ser439*		A8MYU7|B3KRD3|B3KRH2|B3KTE0|B3KTJ7|B3KTJ8|B4E3U1|B7Z7Z9|Q68DG1|Q6PIM5|Q9HCH4|Q9NUV0	Nonsense_Mutation	SNP	superfamily_Adenylate_cyclase-assoc_CAP_N	p.S439*	ENST00000355371.4	37	c.1316	CCDS44482.1	10	.	.	.	.	.	.	.	.	.	.	G	34	5.330400	0.95733	.	.	ENSG00000187164	ENST00000392903;ENST00000260777;ENST00000355371;ENST00000392901	.	.	.	5.98	5.07	0.68467	.	1.073050	0.07073	N	0.835777	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	0.7309	12.6396	0.56702	0.0768:0.0:0.9232:0.0	.	.	.	.	X	439;439;439;379	.	ENSP00000260777:S439X	S	-	2	0	KIAA1598	118661334	1.000000	0.71417	0.677000	0.29947	0.693000	0.40251	3.430000	0.52807	1.507000	0.48752	0.650000	0.86243	TCG	KIAA1598	-	NULL	ENSG00000187164		0.308	KIAA1598-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1598	HGNC	protein_coding			0.00	32	0	G	NM_018330		118671344	-1			no_errors	ENST00000392903	ensembl	human	known	74_37	nonsense	5.56	34	2	SNP	0.918	T
KIAA2018	205717	genome.wustl.edu	37	3	113377482	113377482	+	Frame_Shift_Del	DEL	T	T	-	rs78597857		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:113377482delT	ENST00000478658.1	-	5	3064	c.3047delA	c.(3046-3048)aacfs	p.N1016fs	KIAA2018_ENST00000316407.4_Frame_Shift_Del_p.N1016fs|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1016						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.N1016fs*8(1)|p.N1016fs*9(1)|p.N1016fs*23(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TTTCTGAGGGTTTTTTTTTTT	0.363																																																	3	Deletion - Frameshift(2)|Insertion - Frameshift(1)	ovary(3)											99.0	91.0	93.0					3																	113377482		1809	4067	5876	SO:0001589	frameshift_variant	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3047delA	3.37:g.113377482delT	ENSP00000420721:p.Asn1016fs		Q7Z3L9|Q8IVF3|Q9H8T4	Frame_Shift_Del	DEL	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pfscan_bHLH_dom	p.N1016fs	ENST00000478658.1	37	c.3047	CCDS43133.1	3																																																																																			KIAA2018	-	NULL	ENSG00000176542		0.363	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1		0.00	27	0	T	NM_001009899		113377482	-1	tier1		no_errors	ENST00000316407	ensembl	human	known	74_37	frame_shift_del	10.00	27	3	DEL	0.827	-
KIF20B	9585	genome.wustl.edu	37	10	91478507	91478507	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:91478507C>T	ENST00000371728.3	+	12	1377	c.1312C>T	c.(1312-1314)Cac>Tac	p.H438Y	KIF20B_ENST00000394289.2_Missense_Mutation_p.H438Y|KIF20B_ENST00000416354.1_Missense_Mutation_p.H438Y|KIF20B_ENST00000260753.4_Missense_Mutation_p.H438Y	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	438	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TAAACTGACTCACTATTTTCA	0.313																																																	0													60.0	63.0	62.0					10																	91478507		2202	4296	6498	SO:0001583	missense	0			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.1312C>T	10.37:g.91478507C>T	ENSP00000360793:p.His438Tyr		A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.H438Y	ENST00000371728.3	37	c.1312		10	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768046	0.90020	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.75050	-0.9;-0.9;-0.9;-0.9	5.51	5.51	0.81932	Kinesin, motor domain (4);	0.000000	0.53938	D	0.000045	T	0.79341	0.4429	N	0.20328	0.56	0.80722	D	1	D;B	0.71674	0.998;0.073	D;B	0.76071	0.987;0.31	T	0.82139	-0.0605	10	0.87932	D	0	-9.7804	19.7654	0.96337	0.0:1.0:0.0:0.0	.	438;438	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	Y	438	ENSP00000260753:H438Y;ENSP00000411545:H438Y;ENSP00000377830:H438Y;ENSP00000360793:H438Y	ENSP00000260753:H438Y	H	+	1	0	KIF20B	91468487	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	4.462000	0.60121	2.750000	0.94351	0.655000	0.94253	CAC	KIF20B	-	pfam_Kinesin_motor_dom,superfamily_P-loop_NTPase,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000138182		0.313	KIF20B-003	KNOWN	basic	protein_coding	KIF20B	HGNC	protein_coding	OTTHUMT00000049330.1	-	0.00	61	0	C	NM_016195		91478507	+1	tier1	-	no_errors	ENST00000416354	ensembl	human	known	74_37	missense	24.62	49	16	SNP	1.000	T
KIFC3	3801	genome.wustl.edu	37	16	57799613	57799613	+	Intron	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:57799613G>T	ENST00000379655.4	-	11	1588				KIFC3_ENST00000541240.1_Intron|KIFC3_ENST00000445690.2_Intron|KIFC3_ENST00000540079.2_Intron|KIFC3_ENST00000421376.2_Intron|KIFC3_ENST00000539578.1_Intron|KIFC3_ENST00000543930.1_Intron|KIFC3_ENST00000465878.2_Intron|KIFC3_ENST00000562903.1_Intron	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3						ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				CTCCATTCTGGTCCACTGGTG	0.562																																																	0																																										SO:0001627	intron_variant	0			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.1331-61C>A	16.37:g.57799613G>T			A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	RNA	SNP	-	NULL	ENST00000379655.4	37	NULL	CCDS10789.2	16																																																																																			KIFC3	-	-	ENSG00000140859		0.562	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIFC3	HGNC	protein_coding	OTTHUMT00000257329.2	-	0.00	28	0	G	NM_005550		57799613	-1	tier1	-	no_errors	ENST00000563266	ensembl	human	known	74_37	rna	13.51	32	5	SNP	0.001	T
KIRREL	55243	genome.wustl.edu	37	1	158063162	158063162	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:158063162C>T	ENST00000359209.6	+	12	1572	c.1505C>T	c.(1504-1506)aCc>aTc	p.T502I	KIRREL_ENST00000416935.2_Missense_Mutation_p.T402I|KIRREL_ENST00000360089.4_Missense_Mutation_p.T338I|KIRREL_ENST00000368172.1_Missense_Mutation_p.T316I|KIRREL_ENST00000368173.3_Missense_Mutation_p.T518I|KIRREL_ENST00000392272.2_Missense_Mutation_p.T399I			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	502					excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					GCTGGGGCCACCATCGGCGCG	0.577																																																	0													214.0	208.0	210.0					1																	158063162		2203	4300	6503	SO:0001583	missense	0			AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1505C>T	1.37:g.158063162C>T	ENSP00000352138:p.Thr502Ile		Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T518I	ENST00000359209.6	37	c.1553	CCDS1172.2	1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.824150	0.90873	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	T;T;T;T;T;T	0.68903	0.62;-0.36;0.29;0.01;0.1;0.45	5.52	5.52	0.82312	.	0.000000	0.44483	D	0.000444	T	0.68586	0.3017	L	0.47716	1.5	0.54753	D	0.999982	D;D;D;D	0.71674	0.992;0.998;0.993;0.993	P;P;P;P	0.59288	0.764;0.855;0.738;0.738	T	0.70619	-0.4822	10	0.56958	D	0.05	-35.6452	16.9353	0.86202	0.0:1.0:0.0:0.0	.	402;338;316;502	B4DN67;Q5W0F9;Q5W0G0;Q96J84	.;.;.;KIRR1_HUMAN	I	338;518;399;502;402;316	ENSP00000353202:T338I;ENSP00000357155:T518I;ENSP00000376098:T399I;ENSP00000352138:T502I;ENSP00000389674:T402I;ENSP00000357154:T316I	ENSP00000352138:T502I	T	+	2	0	KIRREL	156329786	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.483000	0.66838	2.589000	0.87451	0.491000	0.48974	ACC	KIRREL	-	NULL	ENSG00000183853		0.577	KIRREL-001	KNOWN	basic|CCDS	protein_coding	KIRREL	HGNC	protein_coding	OTTHUMT00000058342.3	-	0.00	40	0	C	NM_018240		158063162	+1	tier1	-	no_errors	ENST00000368173	ensembl	human	known	74_37	missense	11.11	31	4	SNP	1.000	T
KMT2C	58508	genome.wustl.edu	37	7	151873959	151873959	+	Nonsense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:151873959G>C	ENST00000262189.6	-	38	8797	c.8579C>G	c.(8578-8580)tCa>tGa	p.S2860*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.S2860*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	2860					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										ATTTAGGTCTGAGTGAGCAGA	0.403																																																	0													130.0	127.0	128.0					7																	151873959		2203	4300	6503	SO:0001587	stop_gained	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.8579C>G	7.37:g.151873959G>C	ENSP00000262189:p.Ser2860*		Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_box_dom,smart_Znf_PHD,smart_Znf_RING,smart_HMG_box_dom,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.S2860*	ENST00000262189.6	37	c.8579	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	G	47	13.593136	0.99751	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.4	3.58	0.41010	.	0.476844	0.17092	N	0.187321	.	.	.	.	.	.	0.22940	N	0.998533	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	8.295	0.31980	0.1375:0.0:0.7348:0.1277	.	.	.	.	X	2860	.	ENSP00000262189:S2860X	S	-	2	0	MLL3	151504892	0.042000	0.20092	0.000000	0.03702	0.088000	0.18126	1.568000	0.36418	0.641000	0.30601	-0.188000	0.12872	TCA	KMT2C	-	NULL	ENSG00000055609		0.403	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KMT2C	HGNC	protein_coding	OTTHUMT00000318887.3	-	0.00	19	0	G			151873959	-1	tier1	-	no_errors	ENST00000355193	ensembl	human	known	74_37	nonsense	38.64	27	17	SNP	0.002	C
KPRP	448834	genome.wustl.edu	37	1	152732307	152732307	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:152732307G>A	ENST00000606109.1	+	1	271	c.243G>A	c.(241-243)gtG>gtA	p.V81V	KPRP_ENST00000368773.1_Silent_p.V81V			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	81	Gln-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAAGCAGGTGAAGGGCCAGG	0.552																																																	0													193.0	166.0	175.0					1																	152732307		2203	4300	6503	SO:0001819	synonymous_variant	0			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.243G>A	1.37:g.152732307G>A				Silent	SNP	NULL	p.V81	ENST00000606109.1	37	c.243	CCDS30862.1	1																																																																																			KPRP	-	NULL	ENSG00000203786		0.552	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	HGNC	protein_coding	OTTHUMT00000034522.2	-	0.00	29	0	G	NM_001025231		152732307	+1	tier1	-	no_errors	ENST00000368773	ensembl	human	known	74_37	silent	16.67	40	8	SNP	0.000	A
KRI1	65095	genome.wustl.edu	37	19	10671094	10671094	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:10671094C>G	ENST00000312962.6	-	9	731	c.712G>C	c.(712-714)Gag>Cag	p.E238Q	KRI1_ENST00000361821.5_Missense_Mutation_p.E234Q|KRI1_ENST00000537964.1_5'Flank	NM_023008.3	NP_075384.3	Q8N9T8	KRI1_HUMAN	KRI1 homolog (S. cerevisiae)	232	Glu-rich.					nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)	p.E238Q(1)		NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			TCATCCAACTCAGGGTCGTTC	0.542																																																	1	Substitution - Missense(1)	lung(1)											111.0	92.0	98.0					19																	10671094		2203	4300	6503	SO:0001583	missense	0				CCDS12242.1	19p13.2	2008-02-05			ENSG00000129347	ENSG00000129347			25769	protein-coding gene	gene with protein product						12878157	Standard	NM_023008		Approved	FLJ12949	uc002moy.1	Q8N9T8	OTTHUMG00000150343	ENST00000312962.6:c.712G>C	19.37:g.10671094C>G	ENSP00000320917:p.Glu238Gln		Q2M1R5|Q2M1R7|Q7L5J7|Q96G92|Q9BU50|Q9H6I1|Q9H978	Missense_Mutation	SNP	pfam_KRR1-interact_protein_1	p.E238Q	ENST00000312962.6	37	c.712	CCDS12242.1	19	.	.	.	.	.	.	.	.	.	.	C	12.16	1.854581	0.32791	.	.	ENSG00000129347	ENST00000312962;ENST00000361821;ENST00000541101	T;T	0.09723	3.1;2.95	5.36	1.27	0.21489	.	0.494226	0.22335	N	0.061404	T	0.07369	0.0186	L	0.45285	1.41	0.19575	N	0.999969	B;B	0.27117	0.098;0.168	B;B	0.17433	0.012;0.018	T	0.28681	-1.0036	10	0.23891	T	0.37	-32.6087	6.0666	0.19866	0.0:0.5047:0.3512:0.1441	.	238;234	Q8N9T8;D3YTE0	KRI1_HUMAN;.	Q	238;234;238	ENSP00000320917:E238Q;ENSP00000355366:E234Q	ENSP00000320917:E238Q	E	-	1	0	KRI1	10532094	0.007000	0.16637	1.000000	0.80357	0.890000	0.51754	-0.074000	0.11450	1.223000	0.43536	0.563000	0.77884	GAG	KRI1	-	NULL	ENSG00000129347		0.542	KRI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KRI1	HGNC	protein_coding	OTTHUMT00000317705.1	-	0.00	33	0	C	NM_023008		10671094	-1	tier1	-	no_errors	ENST00000312962	ensembl	human	known	74_37	missense	13.33	26	4	SNP	0.577	G
KRTAP10-11	386678	genome.wustl.edu	37	21	46066408	46066408	+	Missense_Mutation	SNP	C	C	A	rs587690905		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr21:46066408C>A	ENST00000334670.8	+	1	78	c.33C>A	c.(31-33)agC>agA	p.S11R	TSPEAR_ENST00000323084.4_Intron	NM_198692.2	NP_941965.2	P60412	KR10B_HUMAN	keratin associated protein 10-11	11						keratin filament (GO:0045095)		p.S11S(1)		NS(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)	12						TCTGCTCCAGCGCTTACTCCG	0.672																																																	1	Substitution - coding silent(1)	ovary(1)											69.0	74.0	72.0					21																	46066408		2203	4298	6501	SO:0001583	missense	0			AB076359	CCDS42962.1	21q22.3	2006-03-13	2004-07-12	2004-07-14	ENSG00000243489	ENSG00000243489		"""Keratin associated proteins"""	20528	protein-coding gene	gene with protein product			"""keratin associated protein 10-11"""	KRTAP18-11			Standard	NM_198692		Approved	KRTAP18.11, KAP18.11, KAP10.11	uc002zfr.4	P60412	OTTHUMG00000057626	ENST00000334670.8:c.33C>A	21.37:g.46066408C>A	ENSP00000334197:p.Ser11Arg		A2RRF9	Missense_Mutation	SNP	NULL	p.S11R	ENST00000334670.8	37	c.33	CCDS42962.1	21	.	.	.	.	.	.	.	.	.	.	c	6.581	0.475624	0.12521	.	.	ENSG00000243489	ENST00000334670	T	0.08102	3.13	3.83	-0.361	0.12564	.	.	.	.	.	T	0.27832	0.0685	M	0.87097	2.86	0.18873	N	0.999989	D	0.89917	1.0	D	0.72625	0.978	T	0.04481	-1.0948	9	0.72032	D	0.01	.	7.6955	0.28592	0.0:0.5193:0.0:0.4807	.	11	P60412	KR10B_HUMAN	R	11	ENSP00000334197:S11R	ENSP00000334197:S11R	S	+	3	2	KRTAP10-11	44890836	0.061000	0.20836	0.931000	0.37212	0.007000	0.05969	-1.076000	0.03420	0.006000	0.14734	0.462000	0.41574	AGC	KRTAP10-11	-	NULL	ENSG00000243489		0.672	KRTAP10-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-11	HGNC	protein_coding	OTTHUMT00000128029.1	-	0.00	162	0	C	NM_198692		46066408	+1	tier1	-	no_errors	ENST00000334670	ensembl	human	known	74_37	missense	5.56	119	7	SNP	0.212	A
L3MBTL2	83746	genome.wustl.edu	37	22	41623140	41623140	+	Silent	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr22:41623140G>T	ENST00000216237.5	+	14	1793	c.1635G>T	c.(1633-1635)gtG>gtT	p.V545V		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	545					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						TGGAGGCCGTGGACCTGATGG	0.612																																																	0													49.0	35.0	40.0					22																	41623140		2203	4300	6503	SO:0001819	synonymous_variant	0			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1635G>T	22.37:g.41623140G>T			Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Silent	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.V545	ENST00000216237.5	37	c.1635	CCDS14011.1	22																																																																																			L3MBTL2	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000100395		0.612	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL2	HGNC	protein_coding	OTTHUMT00000320613.1		0.00	61	0	G	NM_031488		41623140	+1			no_errors	ENST00000216237	ensembl	human	known	74_37	silent	6.06	62	4	SNP	1.000	T
LAMTOR5	10542	genome.wustl.edu	37	1	110950516	110950516	+	5'Flank	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:110950516C>T	ENST00000602318.1	-	0	0				LAMTOR5-AS1_ENST00000608602.1_RNA|LAMTOR5-AS1_ENST00000587691.1_RNA|LAMTOR5-AS1_ENST00000590413.1_RNA|LAMTOR5-AS1_ENST00000609512.1_RNA|LAMTOR5-AS1_ENST00000457535.1_RNA|LAMTOR5-AS1_ENST00000608499.1_RNA|LAMTOR5-AS1_ENST00000609244.1_RNA|LAMTOR5-AS1_ENST00000590826.1_RNA|LAMTOR5_ENST00000483260.1_5'Flank|LAMTOR5-AS1_ENST00000598454.1_RNA|LAMTOR5_ENST00000602858.1_5'Flank|LAMTOR5-AS1_ENST00000608253.1_RNA|LAMTOR5-AS1_ENST00000609709.1_RNA|LAMTOR5-AS1_ENST00000608067.1_RNA|LAMTOR5-AS1_ENST00000610148.1_RNA|LAMTOR5_ENST00000256644.4_5'UTR|LAMTOR5-AS1_ENST00000608486.1_RNA|LAMTOR5_ENST00000474861.2_5'Flank			O43504	LTOR5_HUMAN	late endosomal/lysosomal adaptor, MAPK and MTOR activator 5						cellular response to amino acid stimulus (GO:0071230)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of GTPase activity (GO:0043547)|positive regulation of TOR signaling (GO:0032008)|protein localization to lysosome (GO:0061462)|regulation of cell size (GO:0008361)|response to virus (GO:0009615)|viral genome replication (GO:0019079)	cytosol (GO:0005829)|lysosome (GO:0005764)|Ragulator complex (GO:0071986)											CGGATTATTCCCCTCTCGGGA	0.612																																																	0													13.0	14.0	14.0					1																	110950516		2198	4298	6496	SO:0001631	upstream_gene_variant	0			AF029890	CCDS824.1	1p12	2012-09-24	2012-09-24	2012-09-24	ENSG00000134248	ENSG00000134248			17955	protein-coding gene	gene with protein product	"""HBx-interacting protein"", ""hepatitis B virus x-interacting protein (9.6kD)"""	608521	"""hepatitis B virus x interacting protein"""	HBXIP		9499022, 22980980	Standard	NM_006402		Approved	XIP, MGC71071	uc001dzr.3	O43504	OTTHUMG00000011568		1.37:g.110950516C>T	Exception_encountered		Q6IBD8	RNA	SNP	-	NULL	ENST00000602318.1	37	NULL		1																																																																																			LAMTOR5-AS1	-	-	ENSG00000224699		0.612	LAMTOR5-007	NOVEL	basic|appris_principal	protein_coding	LAMTOR5-AS1	HGNC	protein_coding	OTTHUMT00000467909.1	-	0.00	27	0	C	NM_006402		110950516	+1	tier1	-	no_errors	ENST00000457535	ensembl	human	known	74_37	rna	16.67	25	5	SNP	0.000	T
SPACA6P-AS	102238594	genome.wustl.edu	37	19	52196977	52196977	+	lincRNA	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:52196977C>G	ENST00000602324.1	-	0	0				LINC00085_ENST00000573266.1_RNA|MIR99B_ENST00000384819.1_RNA|MIR125A_ENST00000385273.1_RNA|MIRLET7E_ENST00000362102.1_RNA	NR_029482.1|NR_029693.1																						TCCAGGGCCTCTCTGACACCG	0.612																																																	0																																												0																															19.37:g.52196977C>G				RNA	SNP	-	NULL	ENST00000602324.1	37	NULL		19																																																																																			LINC00085	-	-	ENSG00000182310		0.612	hsa-mir-125a.1-001	KNOWN	basic	lincRNA	LINC00085	HGNC	lincRNA	OTTHUMT00000467329.1	-	0.00	11	0	C			52196977	+1	tier1	-	no_errors	ENST00000573266	ensembl	human	known	74_37	rna	29.41	12	5	SNP	0.000	G
LINC00303	284573	genome.wustl.edu	37	1	204010308	204010308	+	lincRNA	SNP	G	G	A	rs555100193		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:204010308G>A	ENST00000367207.3	-	0	85							Q3SY05	CA157_HUMAN	long intergenic non-protein coding RNA 303																		aacaaGAAATGAAAGTCCAAG	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		19820	0.0		0.001	False		,,,				2504	0.0																0													35.0	31.0	32.0					1																	204010308		1819	4039	5858			0			AK097662		1q32.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000176754	ENSG00000176754		"""Long non-coding RNAs"""	26865	non-coding RNA	RNA, long non-coding			"""chromosome 1 open reading frame 157"", ""non-protein coding RNA 303"""	C1orf157, NCRNA00303			Standard	NR_027902		Approved	FLJ40343	uc010pqo.1	Q3SY05	OTTHUMG00000036054		1.37:g.204010308G>A			Q3SY06|Q8N7U1	RNA	SNP	-	NULL	ENST00000367207.3	37	NULL		1																																																																																			LINC00303	-	-	ENSG00000176754		0.448	LINC00303-001	KNOWN	basic	lincRNA	LINC00303	HGNC	lincRNA	OTTHUMT00000087885.3	-	0.00	28	0	G	NR_027902		204010308	-1	tier1	-	no_errors	ENST00000367207	ensembl	human	known	74_37	rna	24.14	22	7	SNP	0.592	A
LINC00654	149837	genome.wustl.edu	37	20	5479726	5479726	+	lincRNA	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr20:5479726G>A	ENST00000379053.4	-	0	3099				RP5-1022P6.7_ENST00000587737.1_lincRNA	NR_015406.1				long intergenic non-protein coding RNA 654																		caccctctctgagctccaatt	0.463																																																	0																																												0			BC067900		20p12.3	2012-10-12			ENSG00000205181	ENSG00000205181		"""Long non-coding RNAs"""	27154	non-coding RNA	RNA, long non-coding							Standard	NR_015406		Approved		uc002wmc.4		OTTHUMG00000031810		20.37:g.5479726G>A				RNA	SNP	-	NULL	ENST00000379053.4	37	NULL		20																																																																																			LINC00654	-	-	ENSG00000205181		0.463	LINC00654-001	KNOWN	basic	lincRNA	LINC00654	HGNC	lincRNA	OTTHUMT00000077878.3	-	0.00	54	0	G	NR_015406		5479726	-1	tier1	-	no_errors	ENST00000379053	ensembl	human	known	74_37	rna	25.00	45	15	SNP	0.000	A
LIX1	167410	genome.wustl.edu	37	5	96460290	96460290	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:96460290C>T	ENST00000274382.4	-	2	421	c.126G>A	c.(124-126)caG>caA	p.Q42Q	CTD-2215E18.1_ENST00000509481.1_Intron	NM_153234.4	NP_694966.3	Q8N485	LIX1_HUMAN	Lix1 homolog (chicken)	42										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(2)|ovary(1)	10		all_cancers(142;4.28e-07)|all_epithelial(76;1.06e-09)|all_lung(232;0.00101)|Lung NSC(167;0.00137)|Ovarian(225;0.024)|Colorectal(57;0.0318)|Breast(839;0.244)		COAD - Colon adenocarcinoma(37;0.0733)		CCTTCTGCTGCTGCTTGCTTT	0.478																																																	0													104.0	88.0	93.0					5																	96460290		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS4088.1	5q15	2008-03-06	2008-03-06	2005-02-07	ENSG00000145721	ENSG00000145721			18581	protein-coding gene	gene with protein product		610466	"""chromosome 5 open reading frame 11"", ""Lix1 homolog (mouse)"""	C5orf11		11731258	Standard	NM_153234		Approved		uc003kmy.4	Q8N485	OTTHUMG00000128720	ENST00000274382.4:c.126G>A	5.37:g.96460290C>T			A8K4R9|Q8N7I2	Silent	SNP	NULL	p.Q42	ENST00000274382.4	37	c.126	CCDS4088.1	5																																																																																			LIX1	-	NULL	ENSG00000145721		0.478	LIX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIX1	HGNC	protein_coding	OTTHUMT00000250625.1		0.00	43	0	C	NM_153234		96460290	-1			no_errors	ENST00000274382	ensembl	human	known	74_37	silent	5.00	38	2	SNP	1.000	T
LOC644669	644669	genome.wustl.edu	37	18	15330244	15330244	+	RNA	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr18:15330244G>A	ENST00000455308.2	-	0	18					NR_027417.1																						CTCTGGGCCCGTCTGGCCCTT	0.627																																																	0																																												0																															18.37:g.15330244G>A				RNA	SNP	-	NULL	ENST00000455308.2	37	NULL		18																																																																																			AP005901.1	-	-	ENSG00000215512		0.627	AP005901.1-001	KNOWN	basic	processed_transcript	LOC644669	Clone_based_vega_gene	pseudogene	OTTHUMT00000373635.1	-	0.00	63	0	G			15330244	-1	tier1	-	no_errors	ENST00000455308	ensembl	human	known	74_37	rna	32.84	45	22	SNP	0.025	A
LRFN5	145581	genome.wustl.edu	37	14	42077703	42077704	+	5'UTR	DNP	GC	GC	AA			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G|C	G|C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:42077703_42077704GC>AA	ENST00000298119.4	+	0	931_932				LRFN5_ENST00000555279.1_3'UTR|LRFN5_ENST00000554120.1_5'UTR	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5							integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GAGCCACCTTGCCGGGATTGTA	0.55										HNSCC(30;0.082)																																							0																																										SO:0001623	5_prime_UTR_variant	0			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	Exception_encountered	14.37:g.42077703_42077704delinsAA			B3KU78|Q86XL2	RNA	SNP	-	NULL	ENST00000298119.4	37	NULL	CCDS9678.1	14																																																																																			LRFN5	-	-	ENSG00000165379		0.550	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN5	HGNC	protein_coding	OTTHUMT00000276786.1	-	0.00	75|73	0	G|C	NM_152447		42077703|42077704	+1	tier1	-	no_errors	ENST00000553926	ensembl	human	known	74_37	rna	23.00|22.22	77|76	23|22	SNP	1.000	A
LRP2	4036	genome.wustl.edu	37	2	170101433	170101433	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:170101433C>A	ENST00000263816.3	-	22	3485	c.3200G>T	c.(3199-3201)tGt>tTt	p.C1067F	LRP2_ENST00000443831.1_Missense_Mutation_p.C930F	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	1067	LDL-receptor class A 9. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CGAAGATGAACAGGTATTATC	0.443																																																	0													139.0	123.0	128.0					2																	170101433		2203	4300	6503	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.3200G>T	2.37:g.170101433C>A	ENSP00000263816:p.Cys1067Phe		O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.C1067F	ENST00000263816.3	37	c.3200	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515638	0.64634	.	.	ENSG00000081479	ENST00000263816;ENST00000443831	D;D	0.99519	-6.07;-6.07	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.99819	0.9920	H	0.99143	4.445	0.80722	D	1	D;D	0.67145	0.996;0.984	D;D	0.77004	0.989;0.911	D	0.96894	0.9655	10	0.87932	D	0	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	930;1067	E9PC35;P98164	.;LRP2_HUMAN	F	1067;930	ENSP00000263816:C1067F;ENSP00000409813:C930F	ENSP00000263816:C1067F	C	-	2	0	LRP2	169809679	1.000000	0.71417	0.786000	0.31890	0.038000	0.13279	7.567000	0.82357	2.880000	0.98712	0.650000	0.86243	TGT	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.443	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2		0.00	20	0	C	NM_004525		170101433	-1			no_errors	ENST00000263816	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	A
LRP4	4038	genome.wustl.edu	37	11	46911919	46911919	+	Silent	SNP	G	G	T	rs368577516		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:46911919G>T	ENST00000378623.1	-	14	2066	c.1824C>A	c.(1822-1824)gcC>gcA	p.A608A		NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	608					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		TACGGCGCCCGGCATAGTCGA	0.592											OREG0020948	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													88.0	75.0	79.0					11																	46911919		2201	4299	6500	SO:0001819	synonymous_variant	0			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.1824C>A	11.37:g.46911919G>T		942	B2RN39|Q4AC85|Q5KTZ5	Silent	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd_dom,superfamily_Growth_fac_rcpt_N_dom,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt,prints_LDrepeatLR_classA_rpt	p.A608	ENST00000378623.1	37	c.1824	CCDS31478.1	11																																																																																			LRP4	-	superfamily_Growth_fac_rcpt_N_dom,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000134569		0.592	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	HGNC	protein_coding	OTTHUMT00000391133.1	-	0.00	30	0	G	NM_002334		46911919	-1	tier1	-	no_errors	ENST00000378623	ensembl	human	known	74_37	silent	12.90	27	4	SNP	0.391	T
LY75	4065	genome.wustl.edu	37	2	160755458	160755458	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:160755458C>A	ENST00000263636.4	-	2	234	c.207G>T	c.(205-207)tgG>tgT	p.W69C	LY75_ENST00000553424.1_Missense_Mutation_p.W69C|LY75-CD302_ENST00000505052.1_Missense_Mutation_p.W69C|LY75_ENST00000554112.1_Missense_Mutation_p.W69C|LY75-CD302_ENST00000504764.1_Missense_Mutation_p.W69C	NM_002349.3	NP_002340.2	O60449	LY75_HUMAN	lymphocyte antigen 75	69	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				endocytosis (GO:0006897)|immune response (GO:0006955)|inflammatory response (GO:0006954)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(22)|prostate(7)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	59				COAD - Colon adenocarcinoma(177;0.132)		GCTGGGACACCCACTTCCATA	0.483																																																	0													149.0	127.0	135.0					2																	160755458		2203	4300	6503	SO:0001583	missense	0			AF011333	CCDS2211.1	2q24	2011-08-30			ENSG00000054219	ENSG00000054219		"""CD molecules"", ""C-type lectin domain containing"""	6729	protein-coding gene	gene with protein product		604524				9553150	Standard	NM_002349		Approved	DEC-205, CLEC13B, CD205		O60449	OTTHUMG00000132025	ENST00000263636.4:c.207G>T	2.37:g.160755458C>A	ENSP00000263636:p.Trp69Cys		O75913|Q53R46|Q53TF5|Q7Z575|Q7Z577	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.W69C	ENST00000263636.4	37	c.207	CCDS2211.1	2	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423841	0.83667	.	.	ENSG00000054219;ENSG00000054219;ENSG00000054219;ENSG00000248672;ENSG00000248672	ENST00000554112;ENST00000553424;ENST00000263636;ENST00000504764;ENST00000505052	T;T;T;T;T	0.33865	1.39;1.39;1.39;1.39;1.39	6.02	6.02	0.97574	Ricin B-related lectin (1);Ricin B lectin (2);	0.000000	0.33180	N	0.005198	T	0.67683	0.2919	M	0.85859	2.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.70346	-0.4897	10	0.87932	D	0	-8.2306	20.5407	0.99260	0.0:1.0:0.0:0.0	.	69;69;69	O60449-3;O60449;O60449-2	.;LY75_HUMAN;.	C	69	ENSP00000451511:W69C;ENSP00000451446:W69C;ENSP00000263636:W69C;ENSP00000423463:W69C;ENSP00000421035:W69C	ENSP00000423463:W69C	W	-	3	0	LY75;LY75-CD302	160463704	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.750000	0.74888	2.865000	0.98341	0.655000	0.94253	TGG	LY75	-	superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000054219		0.483	LY75-001	KNOWN	basic|CCDS	protein_coding	LY75	HGNC	protein_coding	OTTHUMT00000255035.1	-	0.00	41	0	C			160755458	-1	tier1	-	no_errors	ENST00000554112	ensembl	human	known	74_37	missense	9.30	39	4	SNP	1.000	A
MACF1	23499	genome.wustl.edu	37	1	39924237	39924237	+	Intron	DEL	A	A	-	rs375611872		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:39924237delA	ENST00000372915.3	+	89	20980				MACF1_ENST00000361689.2_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000545844.1_Intron|MACF1_ENST00000539005.1_Intron			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1						ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AATGCCTATCAAAAAAAATTA	0.393																																																	0																																										SO:0001627	intron_variant	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.20893+75A>-	1.37:g.39924237delA			B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	RNA	DEL	-	NULL	ENST00000372915.3	37	NULL		1																																																																																			MACF1	-	-	ENSG00000127603		0.393	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1		0.00	18	0	A	NM_033044		39924237	+1	tier1		no_errors	ENST00000497964	ensembl	human	known	74_37	rna	13.79	25	4	DEL	0.002	-
MAN2C1	4123	genome.wustl.edu	37	15	75651724	75651724	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:75651724G>A	ENST00000267978.5	-	17	2037	c.1991C>T	c.(1990-1992)cCc>cTc	p.P664L	MAN2C1_ENST00000563622.1_Missense_Mutation_p.P565L|MAN2C1_ENST00000569482.1_Missense_Mutation_p.P664L|MAN2C1_ENST00000565683.1_Silent_p.S668S	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	664					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						TGAGGTGGGGGGAGGAACAGG	0.632																																																	0													27.0	30.0	29.0					15																	75651724		2197	4294	6491	SO:0001583	missense	0			AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.1991C>T	15.37:g.75651724G>A	ENSP00000267978:p.Pro664Leu		H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Missense_Mutation	SNP	pfam_Glyco_hydro_38_N,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Gal_mutarotase_SF_dom,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.P664L	ENST00000267978.5	37	c.1991	CCDS32298.1	15	.	.	.	.	.	.	.	.	.	.	G	5.560	0.288162	0.10513	.	.	ENSG00000140400	ENST00000267978	T	0.13420	2.59	4.38	2.25	0.28309	Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	0.782162	0.11204	N	0.588526	T	0.08313	0.0207	N	0.16266	0.395	0.09310	N	1	B;B	0.12013	0.005;0.0	B;B	0.14023	0.01;0.001	T	0.35699	-0.9778	10	0.27082	T	0.32	-1.1983	8.3652	0.32382	0.0:0.1696:0.6558:0.1746	.	664;664	Q68EM8;Q9NTJ4	.;MA2C1_HUMAN	L	664	ENSP00000267978:P664L	ENSP00000267978:P664L	P	-	2	0	MAN2C1	73438777	0.670000	0.27512	0.061000	0.19648	0.586000	0.36452	0.753000	0.26376	0.906000	0.36621	0.561000	0.74099	CCC	MAN2C1	-	pfam_Glyco_hydro_38_C,superfamily_Gal_mutarotase_SF_dom	ENSG00000140400		0.632	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2C1	HGNC	protein_coding	OTTHUMT00000419965.1	-	0.00	51	0	G			75651724	-1	tier1	-	no_errors	ENST00000267978	ensembl	human	known	74_37	missense	17.81	60	13	SNP	0.014	A
MAP1B	4131	genome.wustl.edu	37	5	71493385	71493385	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:71493385G>A	ENST00000296755.7	+	5	4501	c.4203G>A	c.(4201-4203)ccG>ccA	p.P1401P		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1401					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)	p.P1401P(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		TACGCAGCCCGCCCCTCATTG	0.478																																					Melanoma(17;367 822 11631 31730 47712)												1	Substitution - coding silent(1)	large_intestine(1)											47.0	49.0	48.0					5																	71493385		2203	4300	6503	SO:0001819	synonymous_variant	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.4203G>A	5.37:g.71493385G>A			A2BDK5	Silent	SNP	pfam_MAP1B_neuraxin	p.P1401	ENST00000296755.7	37	c.4203	CCDS4012.1	5																																																																																			MAP1B	-	NULL	ENSG00000131711		0.478	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6		0.00	18	0	G	NM_005909		71493385	+1			no_errors	ENST00000296755	ensembl	human	known	74_37	silent	6.06	31	2	SNP	0.994	A
MAP3K9	4293	genome.wustl.edu	37	14	71204982	71204982	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:71204982C>T	ENST00000554752.2	-	8	1823	c.1824G>A	c.(1822-1824)gaG>gaA	p.E608E	MAP3K9_ENST00000381250.4_Silent_p.E608E|MAP3K9_ENST00000555993.2_Silent_p.E608E|MAP3K9_ENST00000553414.1_Silent_p.E350E|MAP3K9_ENST00000554146.1_Silent_p.E345E	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	608					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		CCGAGGCAAGCTCCTTCTGAC	0.502																																					GBM(114;411 1587 13539 28235 50070)												0													134.0	120.0	125.0					14																	71204982		2203	4300	6503	SO:0001819	synonymous_variant	0			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.1824G>A	14.37:g.71204982C>T			A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Silent	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_Regulat_G_prot_signal_superfam,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_dom	p.E608	ENST00000554752.2	37	c.1824		14																																																																																			MAP3K9	-	pirsf_MAPKKK9/10/11	ENSG00000006432		0.502	MAP3K9-001	KNOWN	basic	protein_coding	MAP3K9	HGNC	protein_coding	OTTHUMT00000412550.2	-	0.00	42	0	C			71204982	-1	tier1	-	no_errors	ENST00000555993	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.146	T
MARVELD2	153562	genome.wustl.edu	37	5	68715775	68715775	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:68715775C>T	ENST00000325631.5	+	2	637	c.563C>T	c.(562-564)tCg>tTg	p.S188L	MARVELD2_ENST00000413223.2_Missense_Mutation_p.S188L	NM_001038603.2|NM_001244734.1	NP_001033692.2|NP_001231663.1	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2	188	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|establishment of endothelial barrier (GO:0061028)|sensory perception of sound (GO:0007605)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(4)|skin(1)|urinary_tract(1)	15		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		TACATGAAGTCGTGGGCAGGC	0.522																																																	0													156.0	151.0	153.0					5																	68715775		2203	4300	6503	SO:0001583	missense	0			AK055094	CCDS34175.1, CCDS58956.1	5q13.1	2007-05-01	2004-07-12	2004-07-14	ENSG00000152939	ENSG00000152939			26401	protein-coding gene	gene with protein product	"""tricellulin"""	610572	"""MARVEL (membrane-associating) domain containing 2"", ""deafness, autosomal recessive 49"""	MRVLDC2, DFNB49		17186462	Standard	NM_001038603		Approved	FLJ30532, TRIC	uc003jwq.3	Q8N4S9	OTTHUMG00000162512	ENST00000325631.5:c.563C>T	5.37:g.68715775C>T	ENSP00000323264:p.Ser188Leu		A1BQX0|A1BQX1|A8KA97|Q96NM9	Missense_Mutation	SNP	pfam_Occludin_RNApol2_elong_fac_ELL,pfam_Marvel	p.S188L	ENST00000325631.5	37	c.563	CCDS34175.1	5	.	.	.	.	.	.	.	.	.	.	C	29.8	5.040345	0.93630	.	.	ENSG00000152939	ENST00000325631;ENST00000282886;ENST00000454295;ENST00000512803;ENST00000436532;ENST00000413223	T;T;T;T;T	0.68181	0.33;0.33;0.33;-0.31;-0.31	5.16	5.16	0.70880	Marvel (1);	0.000000	0.85682	D	0.000000	D	0.82912	0.5140	M	0.80183	2.485	0.58432	D	0.999995	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;1.0	D	0.85557	0.1225	10	0.87932	D	0	-20.7807	17.4129	0.87492	0.0:1.0:0.0:0.0	.	188;188;188	Q8N4S9-3;Q8N4S9-2;Q8N4S9	.;.;MALD2_HUMAN	L	188	ENSP00000323264:S188L;ENSP00000396244:S188L;ENSP00000423490:S188L;ENSP00000414776:S188L;ENSP00000398922:S188L	ENSP00000282886:S188L	S	+	2	0	MARVELD2	68751531	1.000000	0.71417	0.993000	0.49108	0.980000	0.70556	7.699000	0.84547	2.396000	0.81511	0.655000	0.94253	TCG	MARVELD2	-	NULL	ENSG00000152939		0.522	MARVELD2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MARVELD2	HGNC	protein_coding	OTTHUMT00000369583.1		0.00	43	0	C	NM_144724		68715775	+1			no_errors	ENST00000325631	ensembl	human	known	74_37	missense	6.25	45	3	SNP	1.000	T
MAST2	23139	genome.wustl.edu	37	1	46499772	46499772	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:46499772G>C	ENST00000361297.2	+	28	3985	c.3702G>C	c.(3700-3702)aaG>aaC	p.K1234N	MAST2_ENST00000372009.2_Missense_Mutation_p.K1141N	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					TGTTCCGCAAGATCACCAAGC	0.597																																																	0													112.0	121.0	118.0					1																	46499772		2098	4229	6327	SO:0001583	missense	0			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.3702G>C	1.37:g.46499772G>C	ENSP00000354671:p.Lys1234Asn			Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_dom	p.K1234N	ENST00000361297.2	37	c.3702	CCDS41326.1	1	.	.	.	.	.	.	.	.	.	.	g	15.26	2.781899	0.49891	.	.	ENSG00000086015	ENST00000361297;ENST00000372009	T;T	0.29917	1.55;1.55	4.43	3.5	0.40072	.	0.102343	0.64402	D	0.000004	T	0.55386	0.1917	M	0.85710	2.77	0.38830	D	0.955825	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.987	T	0.62134	-0.6918	10	0.87932	D	0	-8.4511	9.1414	0.36906	0.1796:0.0:0.8204:0.0	.	1141;1234	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	N	1234;1141	ENSP00000354671:K1234N;ENSP00000361079:K1141N	ENSP00000354671:K1234N	K	+	3	2	MAST2	46272359	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	3.163000	0.50763	1.051000	0.40369	0.552000	0.68991	AAG	MAST2	-	NULL	ENSG00000086015		0.597	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	HGNC	protein_coding	OTTHUMT00000021977.1	-	0.00	44	0	G	NM_015112		46499772	+1	tier1	-	no_errors	ENST00000361297	ensembl	human	known	74_37	missense	16.67	35	7	SNP	1.000	C
MDGA2	161357	genome.wustl.edu	37	14	47613337	47613337	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:47613337C>T	ENST00000399232.2	-	4	893	c.529G>A	c.(529-531)Gtc>Atc	p.V177I	MDGA2_ENST00000426342.1_5'UTR|MDGA2_ENST00000357362.3_5'UTR|MDGA2_ENST00000439988.3_Missense_Mutation_p.V246I	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	177	Ig-like 2.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TGCAGCAAGACCTCCTGGCCA	0.433																																																	0													136.0	121.0	126.0					14																	47613337		692	1591	2283	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.529G>A	14.37:g.47613337C>T	ENSP00000382178:p.Val177Ile		F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like_dom	p.V246I	ENST00000399232.2	37	c.736		14	.	.	.	.	.	.	.	.	.	.	C	12.35	1.912661	0.33721	.	.	ENSG00000139915	ENST00000439988;ENST00000399232	T;T	0.41758	0.99;0.99	5.73	5.73	0.89815	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.132546	0.32161	U	0.006486	T	0.33644	0.0870	L	0.33485	1.01	0.80722	D	1	B	0.14805	0.011	B	0.27608	0.081	T	0.09818	-1.0657	10	0.24483	T	0.36	.	11.8787	0.52562	0.0:0.9201:0.0:0.0799	.	177	Q7Z553	MDGA2_HUMAN	I	177;246	ENSP00000400011:V177I;ENSP00000382178:V246I	ENSP00000382178:V246I	V	-	1	0	MDGA2	46683087	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.067000	0.50010	2.718000	0.92993	0.585000	0.79938	GTC	MDGA2	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000272781		0.433	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	Uniprot_gn	protein_coding	OTTHUMT00000073352.5	-	0.00	61	0	C	NM_182830		47613337	-1	tier1	-	no_errors	ENST00000439988	ensembl	human	known	74_37	missense	27.63	55	21	SNP	1.000	T
MED12L	116931	genome.wustl.edu	37	3	150877776	150877776	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:150877776C>T	ENST00000474524.1	+	7	1033	c.995C>T	c.(994-996)cCc>cTc	p.P332L	MED12L_ENST00000273432.4_Intron|MED12L_ENST00000309237.4_Missense_Mutation_p.P332L|MED12L_ENST00000422248.2_Missense_Mutation_p.P332L	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	332						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ATCGGGGCCCCCAGCCCTGGC	0.607																																																	0													89.0	99.0	96.0					3																	150877776		2203	4300	6503	SO:0001583	missense	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.995C>T	3.37:g.150877776C>T	ENSP00000417235:p.Pro332Leu		Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.P332L	ENST00000474524.1	37	c.995	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	C	19.83	3.899708	0.72754	.	.	ENSG00000144893	ENST00000422248;ENST00000309237;ENST00000474524	T;T;T	0.29142	1.58;1.58;1.58	5.41	5.41	0.78517	Mediator complex, subunit Med12, LCEWAV-domain (1);	0.061595	0.64402	D	0.000003	T	0.39989	0.1099	M	0.65975	2.015	0.80722	D	1	B;B;B	0.34329	0.0;0.0;0.449	B;B;B	0.37091	0.005;0.002;0.241	T	0.39187	-0.9626	10	0.87932	D	0	-18.1126	18.813	0.92065	0.0:1.0:0.0:0.0	.	332;332;332	Q86YW9;Q86YW9-2;Q86YW9-3	MD12L_HUMAN;.;.	L	332	ENSP00000403308:P332L;ENSP00000310760:P332L;ENSP00000417235:P332L	ENSP00000310760:P332L	P	+	2	0	MED12L	152360466	0.895000	0.30542	1.000000	0.80357	0.998000	0.95712	3.400000	0.52594	2.533000	0.85409	0.561000	0.74099	CCC	MED12L	-	pfam_Mediator_Med12_LCEWAV	ENSG00000144893		0.607	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2		0.00	33	0	C	NM_053002		150877776	+1			no_errors	ENST00000474524	ensembl	human	known	74_37	missense	5.17	55	3	SNP	1.000	T
METTL2A	339175	genome.wustl.edu	37	17	60526062	60526062	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:60526062G>A	ENST00000311506.5	+	9	1145	c.1109G>A	c.(1108-1110)tGc>tAc	p.C370Y		NM_181725.3	NP_859076.3	Q96IZ6	MET2A_HUMAN	methyltransferase like 2A	370					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(2)|central_nervous_system(1)|endometrium(1)|upper_aerodigestive_tract(2)	6			BRCA - Breast invasive adenocarcinoma(2;1.08e-10)			TGCAAATACTGCAAGCCCCTT	0.498																																																	0													151.0	156.0	154.0					17																	60526062		2203	4300	6503	SO:0001583	missense	0			AK000991	CCDS45752.1	17q23.3	2012-12-20		2006-02-10	ENSG00000087995	ENSG00000087995			25755	protein-coding gene	gene with protein product						12477932	Standard	NM_181725		Approved	FLJ12760, METTL2	uc002izv.2	Q96IZ6	OTTHUMG00000164527	ENST00000311506.5:c.1109G>A	17.37:g.60526062G>A	ENSP00000309610:p.Cys370Tyr		A6NNC4|Q9H9G9|Q9NUI8|Q9P0B5	Missense_Mutation	SNP	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase	p.C370Y	ENST00000311506.5	37	c.1109	CCDS45752.1	17	.	.	.	.	.	.	.	.	.	.	G	13.21	2.169086	0.38315	.	.	ENSG00000087995	ENST00000311506	T	0.11063	2.81	4.48	4.48	0.54585	.	0.481200	0.23338	N	0.049267	T	0.07098	0.0180	N	0.14661	0.345	0.24440	N	0.994535	B	0.16396	0.017	B	0.11329	0.006	T	0.21621	-1.0240	10	0.72032	D	0.01	-3.8494	10.0673	0.42311	0.0:0.0:0.7991:0.2009	.	370	Q96IZ6	MTL2A_HUMAN	Y	370	ENSP00000309610:C370Y	ENSP00000309610:C370Y	C	+	2	0	METTL2A	57879794	1.000000	0.71417	0.995000	0.50966	0.933000	0.57130	3.478000	0.53158	2.051000	0.60960	0.505000	0.49811	TGC	METTL2A	-	pirsf_MeTrfase	ENSG00000087995		0.498	METTL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL2A	HGNC	protein_coding	OTTHUMT00000445130.1		0.00	51	0	G	NM_181725		60526062	+1			no_errors	ENST00000311506	ensembl	human	known	74_37	missense	5.71	66	4	SNP	0.994	A
MFRP	83552	genome.wustl.edu	37	11	119212576	119212576	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:119212576G>A	ENST00000530681.1	-	12	1650	c.1506C>T	c.(1504-1506)agC>agT	p.S502S	MFRP_ENST00000555262.1_Silent_p.S502S|MFRP_ENST00000360167.4_Intron|C1QTNF5_ENST00000445041.2_5'UTR|C1QTNF5_ENST00000528368.1_5'Flank|C1QTNF5_ENST00000525657.1_5'Flank|MFRP_ENST00000449574.2_Silent_p.S502S	NM_001278431.1	NP_001265360.1	Q9BY79	MFRP_HUMAN	membrane frizzled-related protein	502	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				embryo development (GO:0009790)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|urinary_tract(1)	18		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		CCTTGTAACCGCTGAGGACCT	0.627																																																	0													88.0	77.0	81.0					11																	119212576		2199	4295	6494	SO:0001819	synonymous_variant	0			AB055505	CCDS8421.1	11q23.3	2014-01-28			ENSG00000235718	ENSG00000235718			18121	protein-coding gene	gene with protein product	"""membrane-type frizzled-related protein"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 1"""	606227				11263980	Standard	NM_031433		Approved	FLJ30570, rd6, NNO2, C1QTNF5	uc001pwj.2	Q9BY79		ENST00000530681.1:c.1506C>T	11.37:g.119212576G>A			B0YJ36|B0YJ37|B4DHN8|Q335M3|Q96DQ9	Silent	SNP	pfam_CUB_dom,pfam_Frizzled_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB_dom,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB_dom,smart_LDrepeatLR_classA_rpt,smart_Frizzled_dom,pfscan_CUB_dom,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt,prints_LDrepeatLR_classA_rpt	p.S502	ENST00000530681.1	37	c.1506	CCDS8421.1	11																																																																																			MFRP	-	pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom	ENSG00000235718		0.627	MFRP-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	MFRP	HGNC	protein_coding	OTTHUMT00000415179.1		0.00	74	0	G	NM_031433		119212576	-1			no_errors	ENST00000449574	ensembl	human	known	74_37	silent	5.63	67	4	SNP	0.853	A
MGA	23269	genome.wustl.edu	37	15	42040914	42040914	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:42040914G>C	ENST00000570161.1	+	15	5292	c.5292G>C	c.(5290-5292)ttG>ttC	p.L1764F	MGA_ENST00000545763.1_Missense_Mutation_p.L1555F|MGA_ENST00000219905.7_Missense_Mutation_p.L1764F|MGA_ENST00000389936.4_Intron|MGA_ENST00000566586.1_Missense_Mutation_p.L1555F			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GATTGTTGTTGATTCCAGTGC	0.473																																																	0													109.0	97.0	101.0					15																	42040914		1962	4170	6132	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.5292G>C	15.37:g.42040914G>C	ENSP00000457035:p.Leu1764Phe		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.L1764F	ENST00000570161.1	37	c.5292	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	G	12.58	1.980397	0.34942	.	.	ENSG00000174197	ENST00000219905;ENST00000545763	D;D	0.90004	-2.54;-2.6	5.68	3.81	0.43845	.	.	.	.	.	D	0.87857	0.6283	N	0.14661	0.345	0.21627	N	0.999611	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.997	T	0.77413	-0.2597	9	0.87932	D	0	.	7.1168	0.25421	0.1415:0.0:0.7198:0.1387	.	380;1555;1764	B4DVS1;F5H7K2;E7ENI0	.;.;.	F	1764;1555	ENSP00000219905:L1764F;ENSP00000442467:L1555F	ENSP00000219905:L1764F	L	+	3	2	MGA	39828206	1.000000	0.71417	0.996000	0.52242	0.552000	0.35366	2.484000	0.45242	0.760000	0.33108	-0.225000	0.12378	TTG	MGA	-	NULL	ENSG00000174197		0.473	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	-	0.00	65	0	G	NM_001164273.1		42040914	+1	tier1	-	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	40.38	31	21	SNP	0.996	C
MGA	23269	genome.wustl.edu	37	15	42041585	42041585	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:42041585G>C	ENST00000570161.1	+	16	5780	c.5780G>C	c.(5779-5781)gGa>gCa	p.G1927A	MGA_ENST00000545763.1_Missense_Mutation_p.G1718A|MGA_ENST00000219905.7_Missense_Mutation_p.G1927A|MGA_ENST00000389936.4_Missense_Mutation_p.G1888A|MGA_ENST00000566586.1_Missense_Mutation_p.G1718A			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TATAGCTCAGGAGGACAGCCT	0.468																																																	0													50.0	47.0	48.0					15																	42041585		1886	4108	5994	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.5780G>C	15.37:g.42041585G>C	ENSP00000457035:p.Gly1927Ala		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.G1927A	ENST00000570161.1	37	c.5780	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	G	15.86	2.956428	0.53293	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.22134	1.97;1.97;1.97	5.72	5.72	0.89469	.	0.000000	0.51477	D	0.000088	T	0.31136	0.0787	N	0.19112	0.55	0.25442	N	0.988085	D;D;D;D	0.76494	0.991;0.99;0.999;0.999	P;P;D;D	0.83275	0.787;0.814;0.996;0.996	T	0.12993	-1.0526	10	0.72032	D	0.01	.	13.1246	0.59346	0.073:0.0:0.927:0.0	.	543;1718;1927;1888	B4DVS1;F5H7K2;E7ENI0;Q8IWI9	.;.;.;MGAP_HUMAN	A	1927;1888;1718	ENSP00000219905:G1927A;ENSP00000374586:G1888A;ENSP00000442467:G1718A	ENSP00000219905:G1927A	G	+	2	0	MGA	39828877	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.709000	0.47160	2.704000	0.92352	0.563000	0.77884	GGA	MGA	-	NULL	ENSG00000174197		0.468	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	-	0.00	38	0	G	NM_001164273.1		42041585	+1	tier1	-	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	34.21	25	13	SNP	1.000	C
MGA	23269	genome.wustl.edu	37	15	42041731	42041731	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:42041731G>C	ENST00000570161.1	+	16	5926	c.5926G>C	c.(5926-5928)Gac>Cac	p.D1976H	MGA_ENST00000545763.1_Missense_Mutation_p.D1767H|MGA_ENST00000219905.7_Missense_Mutation_p.D1976H|MGA_ENST00000389936.4_Missense_Mutation_p.D1937H|MGA_ENST00000566586.1_Missense_Mutation_p.D1767H			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TCAGAATCCAGACCAGAAAGA	0.423																																																	0													46.0	45.0	45.0					15																	42041731		1865	4101	5966	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.5926G>C	15.37:g.42041731G>C	ENSP00000457035:p.Asp1976His		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.D1976H	ENST00000570161.1	37	c.5926	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	G	13.43	2.235965	0.39498	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	T;T;T	0.23552	1.9;1.9;1.9	5.72	5.72	0.89469	.	0.331298	0.25869	N	0.027779	T	0.31389	0.0795	N	0.19112	0.55	0.21897	N	0.999484	D;D;D;D	0.76494	0.964;0.989;0.999;0.999	B;P;D;D	0.65573	0.436;0.723;0.936;0.936	T	0.16482	-1.0401	10	0.72032	D	0.01	.	9.1816	0.37146	0.0725:0.0:0.7157:0.2118	.	592;1767;1976;1937	B4DVS1;F5H7K2;E7ENI0;Q8IWI9	.;.;.;MGAP_HUMAN	H	1976;1937;1767	ENSP00000219905:D1976H;ENSP00000374586:D1937H;ENSP00000442467:D1767H	ENSP00000219905:D1976H	D	+	1	0	MGA	39829023	0.999000	0.42202	1.000000	0.80357	0.787000	0.44495	2.007000	0.40883	2.704000	0.92352	0.563000	0.77884	GAC	MGA	-	NULL	ENSG00000174197		0.423	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	-	0.00	27	0	G	NM_001164273.1		42041731	+1	tier1	-	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	31.82	15	7	SNP	0.859	C
MGA	23269	genome.wustl.edu	37	15	42041736	42041736	+	Frame_Shift_Del	DEL	G	G	-			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:42041736delG	ENST00000570161.1	+	16	5931	c.5931delG	c.(5929-5931)cagfs	p.Q1977fs	MGA_ENST00000545763.1_Frame_Shift_Del_p.Q1768fs|MGA_ENST00000219905.7_Frame_Shift_Del_p.Q1977fs|MGA_ENST00000389936.4_Frame_Shift_Del_p.Q1938fs|MGA_ENST00000566586.1_Frame_Shift_Del_p.Q1768fs			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ATCCAGACCAGAAAGATGAAA	0.423																																																	0													48.0	47.0	47.0					15																	42041736		1863	4097	5960	SO:0001589	frameshift_variant	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.5931delG	15.37:g.42041736delG	ENSP00000457035:p.Gln1977fs		Q0VAX6|Q75ME7|Q86UM5	Frame_Shift_Del	DEL	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.D1979fs	ENST00000570161.1	37	c.5931	CCDS55959.1	15																																																																																			MGA	-	NULL	ENSG00000174197		0.423	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1		0.00	25	0	G	NM_001164273.1		42041736	+1	tier1		no_errors	ENST00000219905	ensembl	human	known	74_37	frame_shift_del	29.17	17	7	DEL	0.998	-
MGA	23269	genome.wustl.edu	37	15	42041908	42041908	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:42041908G>C	ENST00000570161.1	+	16	6103	c.6103G>C	c.(6103-6105)Gaa>Caa	p.E2035Q	MGA_ENST00000545763.1_Missense_Mutation_p.E1826Q|MGA_ENST00000219905.7_Missense_Mutation_p.E2035Q|MGA_ENST00000389936.4_Missense_Mutation_p.E1996Q|MGA_ENST00000566586.1_Missense_Mutation_p.E1826Q			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTTGGATGAAGAATGCCTTCC	0.403																																																	0													146.0	141.0	143.0					15																	42041908		1894	4123	6017	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.6103G>C	15.37:g.42041908G>C	ENSP00000457035:p.Glu2035Gln		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.E2035Q	ENST00000570161.1	37	c.6103	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	G	14.42	2.529003	0.44969	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.84873	-1.91;-1.9;-1.91	5.01	5.01	0.66863	.	0.456120	0.19000	N	0.125376	T	0.82190	0.4983	L	0.27053	0.805	0.19775	N	0.999951	P;P;D;D	0.63880	0.596;0.718;0.993;0.993	B;B;P;P	0.52957	0.188;0.346;0.714;0.714	T	0.74131	-0.3764	10	0.42905	T	0.14	.	11.0768	0.48036	0.0875:0.0:0.9125:0.0	.	651;1826;2035;1996	B4DVS1;F5H7K2;E7ENI0;Q8IWI9	.;.;.;MGAP_HUMAN	Q	2035;1996;1826	ENSP00000219905:E2035Q;ENSP00000374586:E1996Q;ENSP00000442467:E1826Q	ENSP00000219905:E2035Q	E	+	1	0	MGA	39829200	0.709000	0.27886	0.997000	0.53966	0.812000	0.45895	1.500000	0.35682	2.602000	0.87976	0.563000	0.77884	GAA	MGA	-	NULL	ENSG00000174197		0.403	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	-	0.00	22	0	G	NM_001164273.1		42041908	+1	tier1	-	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	31.71	28	13	SNP	0.857	C
MGA	23269	genome.wustl.edu	37	15	42042323	42042323	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:42042323G>T	ENST00000570161.1	+	16	6518	c.6518G>T	c.(6517-6519)aGa>aTa	p.R2173I	MGA_ENST00000545763.1_Missense_Mutation_p.R1964I|MGA_ENST00000219905.7_Missense_Mutation_p.R2173I|MGA_ENST00000389936.4_Missense_Mutation_p.R2134I|MGA_ENST00000566586.1_Missense_Mutation_p.R1964I			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GACAGGGAAAGATGGAGAAAA	0.433																																																	0													70.0	70.0	70.0					15																	42042323		1894	4128	6022	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.6518G>T	15.37:g.42042323G>T	ENSP00000457035:p.Arg2173Ile		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_bHLH_dom,superfamily_p53-like_TF_DNA-bd,superfamily_bHLH_dom,smart_TF_T-box,smart_bHLH_dom,pfscan_bHLH_dom,pfscan_TF_T-box,prints_TF_T-box	p.R2173I	ENST00000570161.1	37	c.6518	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456078	0.26161	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.84944	-1.92;-1.89;-1.91	4.5	2.58	0.30949	.	0.840050	0.10385	N	0.681061	D	0.84817	0.5556	N	0.24115	0.695	0.09310	N	1	P;P;D;D	0.67145	0.838;0.729;0.996;0.996	B;B;D;D	0.71656	0.202;0.282;0.974;0.974	T	0.72243	-0.4350	10	0.87932	D	0	.	6.2629	0.20910	0.3099:0.0:0.6901:0.0	.	789;1964;2173;2134	B4DVS1;F5H7K2;E7ENI0;Q8IWI9	.;.;.;MGAP_HUMAN	I	2173;2134;1964	ENSP00000219905:R2173I;ENSP00000374586:R2134I;ENSP00000442467:R1964I	ENSP00000219905:R2173I	R	+	2	0	MGA	39829615	0.005000	0.15991	0.991000	0.47740	0.288000	0.27193	0.351000	0.20096	1.131000	0.42111	0.467000	0.42956	AGA	MGA	-	NULL	ENSG00000174197		0.433	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	-	0.00	22	0	G	NM_001164273.1		42042323	+1	tier1	-	no_errors	ENST00000219905	ensembl	human	known	74_37	missense	33.33	24	12	SNP	0.028	T
MGAM	8972	genome.wustl.edu	37	7	141754576	141754576	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:141754576G>T	ENST00000549489.2	+	27	3277	c.3182G>T	c.(3181-3183)cGg>cTg	p.R1061L	MGAM_ENST00000475668.2_Missense_Mutation_p.R1061L	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1061					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AACAAGAATCGGTATGAAGTT	0.413																																																	0													157.0	149.0	151.0					7																	141754576		1897	4102	5999	SO:0001583	missense	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3182G>T	7.37:g.141754576G>T	ENSP00000447378:p.Arg1061Leu		Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Gal_mutarotase_SF_dom,smart_P_trefoil	p.R1061L	ENST00000549489.2	37	c.3182	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	G	16.99	3.273161	0.59649	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	T	0.23348	1.91	4.1	4.1	0.47936	Glycoside hydrolase-type carbohydrate-binding (1);	0.000000	0.35585	N	0.003115	T	0.62950	0.2470	H	0.95365	3.66	0.40036	D	0.975591	D	0.89917	1.0	D	0.97110	1.0	T	0.77563	-0.2541	10	0.87932	D	0	.	15.075	0.72071	0.0:0.0:1.0:0.0	.	1061	O43451	MGA_HUMAN	L	1061;1061;938	ENSP00000447378:R1061L	ENSP00000316431:R938L	R	+	2	0	MGAM	141401045	1.000000	0.71417	0.589000	0.28718	0.180000	0.23129	8.923000	0.92808	1.818000	0.53035	0.305000	0.20034	CGG	MGAM	-	superfamily_Gal_mutarotase_SF_dom	ENSG00000257335		0.413	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	-	0.00	83	0	G			141754576	+1	tier1	-	no_errors	ENST00000549489	ensembl	human	known	74_37	missense	24.14	44	14	SNP	0.992	T
MGAT4A	11320	genome.wustl.edu	37	2	99271934	99271934	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:99271934G>C	ENST00000264968.3	-	7	1111	c.748C>G	c.(748-750)Caa>Gaa	p.Q250E	MGAT4A_ENST00000393487.1_Missense_Mutation_p.Q250E|MGAT4A_ENST00000409391.1_Missense_Mutation_p.Q250E|MGAT4A_ENST00000414521.2_Missense_Mutation_p.Q122E|MGAT4A_ENST00000461884.1_5'Flank			Q9UM21	MGT4A_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A	250					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	19						CCCTTTTCTTGAGCATACATC	0.294																																																	0													115.0	108.0	110.0					2																	99271934		2203	4300	6503	SO:0001583	missense	0			AB000616	CCDS2036.1, CCDS54380.1	2q12	2013-02-25	2005-11-16		ENSG00000071073	ENSG00000071073	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7047	protein-coding gene	gene with protein product		604623	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme A"""			10024668	Standard	NM_001160154		Approved	GnT-Iva, GnT-4a	uc002sze.3	Q9UM21	OTTHUMG00000130563	ENST00000264968.3:c.748C>G	2.37:g.99271934G>C	ENSP00000264968:p.Gln250Glu		B4E2R6|D3DVH6|E9PEN2|Q53S97|Q86Z15	Missense_Mutation	SNP	pfam_Glyco_transf_54	p.Q250E	ENST00000264968.3	37	c.748	CCDS2036.1	2	.	.	.	.	.	.	.	.	.	.	G	17.09	3.299651	0.60195	.	.	ENSG00000071073	ENST00000393487;ENST00000414521;ENST00000264968;ENST00000409391	T;T;T;T	0.44482	0.92;0.92;0.92;0.92	5.23	5.23	0.72850	.	0.110840	0.64402	D	0.000007	T	0.54240	0.1846	M	0.85462	2.755	0.44798	D	0.997807	P;P	0.42123	0.771;0.771	B;B	0.42738	0.389;0.396	T	0.59473	-0.7448	10	0.37606	T	0.19	-2.1389	18.1482	0.89665	0.0:0.0:1.0:0.0	.	122;250	E9PEN2;Q9UM21	.;MGT4A_HUMAN	E	250;122;250;250	ENSP00000377127:Q250E;ENSP00000404889:Q122E;ENSP00000264968:Q250E;ENSP00000386841:Q250E	ENSP00000264968:Q250E	Q	-	1	0	MGAT4A	98638366	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.256000	0.58810	2.599000	0.87857	0.655000	0.94253	CAA	MGAT4A	-	pfam_Glyco_transf_54	ENSG00000071073		0.294	MGAT4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT4A	HGNC	protein_coding	OTTHUMT00000252988.2		0.00	21	0	G	NM_012214		99271934	-1			no_errors	ENST00000264968	ensembl	human	known	74_37	missense	11.54	22	3	SNP	1.000	C
VMP1	81671	genome.wustl.edu	37	17	57918642	57918642	+	IGR	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:57918642C>T	ENST00000262291.4	+	0	2712				MIR21_ENST00000362134.1_RNA	NM_030938.3	NP_112200.2	Q96GC9	VMP1_HUMAN	vacuole membrane protein 1						autophagy (GO:0006914)|cell junction assembly (GO:0034329)|embryo implantation (GO:0007566)|regulation of autophagy (GO:0010506)|single organismal cell-cell adhesion (GO:0016337)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|pre-autophagosomal structure (GO:0000407)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|skin(2)	16						GGTAGCTTATCAGACTGATGT	0.423																																																	0													144.0	113.0	123.0					17																	57918642		1568	3582	5150	SO:0001628	intergenic_variant	0				CCDS11619.1	17q23.1	2014-05-20	2011-03-02	2011-03-02	ENSG00000062716	ENSG00000062716			29559	protein-coding gene	gene with protein product	"""ectopic P-granules autophagy protein 3 homolog (C. elegans)"", ""transport and golgi organization 5 homolog (Drosophila)"""	611753	"""transmembrane protein 49"""	TMEM49		11230166, 11785947	Standard	NM_030938		Approved	EPG3, TANGO5	uc002ixu.4	Q96GC9	OTTHUMG00000179882		17.37:g.57918642C>T			B4DVV9|Q9H0P4|Q9P089	RNA	SNP	-	NULL	ENST00000262291.4	37	NULL	CCDS11619.1	17																																																																																			MIR21	-	-	ENSG00000199004		0.423	VMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR21	HGNC	protein_coding	OTTHUMT00000448793.1	-	0.00	47	0	C	NM_030938		57918642	+1	tier1	-	no_errors	ENST00000362134	ensembl	human	known	74_37	rna	23.21	43	13	SNP	1.000	T
MIR518F	574472	genome.wustl.edu	37	19	54204512	54204512	+	RNA	SNP	A	A	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:54204512A>C	ENST00000384973.1	+	0	87				MIR520B_ENST00000384989.1_RNA|MIR518B_ENST00000385127.1_RNA|MIR523_ENST00000385281.1_RNA	NR_030194.1				microRNA 518f																		CTGTTGTCTGAAAGAAAAGAA	0.423																																																	0													76.0	71.0	73.0					19																	54204512		1568	3582	5150			0					19q13.42	2011-09-12		2008-12-18	ENSG00000207706	ENSG00000207706		"""ncRNAs / Micro RNAs"""	32104	non-coding RNA	RNA, micro				MIRN518F			Standard	NR_030194		Approved	hsa-mir-518f	uc021uzx.1				19.37:g.54204512A>C				RNA	SNP	-	NULL	ENST00000384973.1	37	NULL		19																																																																																			MIR520B	-	-	ENSG00000207722		0.423	MIR518F-201	KNOWN	basic	miRNA	MIR520B	HGNC	miRNA		-	0.00	38	0	A	NR_030194		54204512	+1	tier1	-	no_errors	ENST00000384989	ensembl	human	known	74_37	rna	11.29	55	7	SNP	0.144	C
MKI67	4288	genome.wustl.edu	37	10	129903622	129903622	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:129903622C>T	ENST00000368654.3	-	13	6857	c.6482G>A	c.(6481-6483)aGg>aAg	p.R2161K	MKI67_ENST00000368653.3_Missense_Mutation_p.R1801K	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	2161	16 X 122 AA approximate repeats.				cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGCAGTTTCCCTGAACACGTT	0.498																																																	0													195.0	176.0	182.0					10																	129903622		2203	4300	6503	SO:0001583	missense	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.6482G>A	10.37:g.129903622C>T	ENSP00000357643:p.Arg2161Lys		Q5VWH2	Missense_Mutation	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.R2161K	ENST00000368654.3	37	c.6482	CCDS7659.1	10	.	.	.	.	.	.	.	.	.	.	C	0.192	-1.052450	0.01981	.	.	ENSG00000148773	ENST00000368654;ENST00000368653;ENST00000537609	T;T	0.01505	4.82;4.82	4.64	-9.29	0.00653	.	2.201100	0.02421	N	0.082616	T	0.00695	0.0023	N	0.01576	-0.805	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.09377	0.001;0.004;0.002	T	0.41360	-0.9513	10	0.05959	T	0.93	.	8.8808	0.35374	0.5202:0.3594:0.0:0.1204	.	2160;1801;2161	F5H4V4;P46013-2;P46013	.;.;KI67_HUMAN	K	2161;1801;2160	ENSP00000357643:R2161K;ENSP00000357642:R1801K	ENSP00000357642:R1801K	R	-	2	0	MKI67	129793612	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-2.027000	0.01433	-3.124000	0.00238	-1.541000	0.00910	AGG	MKI67	-	pfam_K167R	ENSG00000148773		0.498	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	-	0.00	46	0	C	NM_002417		129903622	-1	tier1	-	no_errors	ENST00000368654	ensembl	human	known	74_37	missense	15.56	38	7	SNP	0.000	T
MMP14	4323	genome.wustl.edu	37	14	23306043	23306043	+	Missense_Mutation	SNP	G	G	A	rs17884647		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:23306043G>A	ENST00000311852.6	+	1	278	c.17G>A	c.(16-18)aGa>aAa	p.R6K	MMP14_ENST00000548162.1_3'UTR	NM_004995.2	NP_004986.1	P50281	MMP14_HUMAN	matrix metallopeptidase 14 (membrane-inserted)	6			R -> K (in dbSNP:rs17884647). {ECO:0000269|Ref.8}.		angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|branching morphogenesis of an epithelial tube (GO:0048754)|chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|endodermal cell differentiation (GO:0035987)|endothelial cell proliferation (GO:0001935)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|male gonad development (GO:0008584)|negative regulation of focal adhesion assembly (GO:0051895)|ovarian follicle development (GO:0001541)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|tissue remodeling (GO:0048771)|zymogen activation (GO:0031638)	extracellular matrix (GO:0031012)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|peptidase activator activity (GO:0016504)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.R6K(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)	Marimastat(DB00786)	CCCGCCCCAAGACCCCCCCGT	0.731											OREG0022586	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - Missense(1)	lung(1)											28.0	23.0	25.0					14																	23306043		2203	4298	6501	SO:0001583	missense	0				CCDS9577.1	14q11-q12	2011-06-29	2005-08-08		ENSG00000157227	ENSG00000157227			7160	protein-coding gene	gene with protein product	"""membrane type 1 metalloprotease"""	600754	"""matrix metalloproteinase 14 (membrane-inserted)"""			8015608	Standard	NM_004995		Approved	MT1-MMP	uc001whc.3	P50281	OTTHUMG00000028704	ENST00000311852.6:c.17G>A	14.37:g.23306043G>A	ENSP00000308208:p.Arg6Lys	762	A8K5L0|Q6GSF3|Q92678	Missense_Mutation	SNP	pirsf_Pept_M10A_Metazoans,pfam_Hemopexin-like_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin-like_dom,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin-like_repeat,prints_Pept_M10A	p.R6K	ENST00000311852.6	37	c.17	CCDS9577.1	14	.	.	.	.	.	.	.	.	.	.	G	13.67	2.305447	0.40795	.	.	ENSG00000157227	ENST00000311852;ENST00000547279	T;T	0.61392	2.5;0.11	4.53	2.58	0.30949	.	1.914000	0.02309	N	0.071871	T	0.37732	0.1014	N	0.08118	0	0.20196	N	0.99992	B	0.02656	0.0	B	0.01281	0.0	T	0.26467	-1.0102	10	0.05721	T	0.95	.	11.4536	0.50167	0.0:0.5026:0.4973:0.0	rs17884647	6	P50281	MMP14_HUMAN	K	6	ENSP00000308208:R6K;ENSP00000450323:R6K	ENSP00000308208:R6K	R	+	2	0	MMP14	22375883	0.008000	0.16893	0.935000	0.37517	0.977000	0.68977	0.664000	0.25068	0.523000	0.28482	0.655000	0.94253	AGA	MMP14	-	pirsf_Pept_M10A_Metazoans	ENSG00000157227		0.731	MMP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP14	HGNC	protein_coding	OTTHUMT00000071660.3	-	0.00	146	0	G	NM_004995		23306043	+1	tier1	rs17884647	no_errors	ENST00000311852	ensembl	human	known	74_37	missense	21.84	161	45	SNP	0.673	A
MRPS11	64963	genome.wustl.edu	37	15	89018446	89018446	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:89018446G>A	ENST00000325844.4	+	4	652	c.387G>A	c.(385-387)caG>caA	p.Q129Q	MRPS11_ENST00000353598.6_Silent_p.Q96Q|MRPS11_ENST00000557974.1_3'UTR	NM_022839.3	NP_073750.2	P82912	RT11_HUMAN	mitochondrial ribosomal protein S11	129					DNA damage response, detection of DNA damage (GO:0042769)|translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(3)	3	Lung NSC(78;0.203)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TCGCAGCACAGACAGCAGGCA	0.532																																																	0													137.0	114.0	122.0					15																	89018446		2201	4299	6500	SO:0001819	synonymous_variant	0			AB051349	CCDS10342.1, CCDS10343.1	15q25	2012-09-13			ENSG00000181991	ENSG00000181991		"""Mitochondrial ribosomal proteins / small subunits"""	14050	protein-coding gene	gene with protein product	"""cervical cancer proto-oncogene 2"""	611977				11402041	Standard	NM_022839		Approved	FLJ23406, HCC-2, FLJ22512	uc002bml.3	P82912	OTTHUMG00000148678	ENST00000325844.4:c.387G>A	15.37:g.89018446G>A			B2RD52|Q969D7|Q96GI3|Q9BYC3	Missense_Mutation	SNP	NULL	p.D109N	ENST00000325844.4	37	c.325	CCDS10342.1	15																																																																																			MRPS11	-	NULL	ENSG00000181991		0.532	MRPS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS11	HGNC	protein_coding	OTTHUMT00000309067.2	-	0.00	63	0	G	NM_022839		89018446	+1	tier1	-	no_errors	ENST00000560708	ensembl	human	known	74_37	missense	34.12	56	29	SNP	1.000	A
MTMR11	10903	genome.wustl.edu	37	1	149902816	149902816	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:149902816G>A	ENST00000439741.2	-	14	1582	c.1332C>T	c.(1330-1332)ctC>ctT	p.L444L	SF3B4_ENST00000271628.8_5'Flank|MTMR11_ENST00000492824.1_5'UTR|MTMR11_ENST00000406732.3_3'UTR|MTMR11_ENST00000361405.6_Missense_Mutation_p.S242F|MTMR11_ENST00000369140.3_Silent_p.L372L	NM_001145862.1	NP_001139334.1	A4FU01	MTMRB_HUMAN	myotubularin related protein 11	444	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.						phosphatase activity (GO:0016791)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(13)|prostate(2)|stomach(1)|urinary_tract(4)	34	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			ACTGCTGGAGGAGCTGCCAGA	0.463																																																	0													34.0	36.0	35.0					1																	149902816		2203	4300	6503	SO:0001819	synonymous_variant	0			AK097000	CCDS72901.1, CCDS72902.1	1q12-q21	2011-06-09			ENSG00000014914	ENSG00000014914		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	24307	protein-coding gene	gene with protein product	"""cisplatin resistance associated"""					12495846	Standard	NM_181873		Approved	CRA	uc001etl.4	A4FU01	OTTHUMG00000012207	ENST00000439741.2:c.1332C>T	1.37:g.149902816G>A			B3KUE4|B4DJI6|B4DQF5|B4E3Q6|Q3ZCP7|Q5SZ62|Q6P2Q8|Q99752|Q99753	Missense_Mutation	SNP	NULL	p.S242F	ENST00000439741.2	37	c.725	CCDS53360.1	1	.	.	.	.	.	.	.	.	.	.	G	11.62	1.694393	0.30052	.	.	ENSG00000014914	ENST00000361405	T	0.50001	0.76	5.16	3.18	0.36537	.	.	.	.	.	T	0.44052	0.1275	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47898	-0.9081	6	0.62326	D	0.03	.	9.5816	0.39490	0.0873:0.1811:0.7315:0.0	.	.	.	.	F	242	ENSP00000354941:S242F	ENSP00000354941:S242F	S	-	2	0	MTMR11	148169440	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	0.570000	0.23653	1.372000	0.46190	0.655000	0.94253	TCC	MTMR11	-	NULL	ENSG00000014914		0.463	MTMR11-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR11	HGNC	protein_coding		-	0.00	32	0	G	NM_181873		149902816	-1	tier1	-	no_errors	ENST00000361405	ensembl	human	known	74_37	missense	20.00	32	8	SNP	1.000	A
MUC17	140453	genome.wustl.edu	37	7	100680134	100680134	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:100680134A>C	ENST00000306151.4	+	3	5501	c.5437A>C	c.(5437-5439)Aca>Cca	p.T1813P		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1813	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ATTAACAAGCACACCTGTCAG	0.498																																																	0													229.0	233.0	232.0					7																	100680134		2203	4300	6503	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5437A>C	7.37:g.100680134A>C	ENSP00000302716:p.Thr1813Pro		O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA_dom,smart_SEA_dom,pfscan_EG-like_dom,pfscan_SEA_dom	p.T1813P	ENST00000306151.4	37	c.5437	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	a	0.019	-1.453869	0.01071	.	.	ENSG00000169876	ENST00000306151	T	0.03301	3.98	0.824	-1.65	0.08291	.	.	.	.	.	T	0.01387	0.0045	N	0.08118	0	0.09310	N	1	B	0.33266	0.404	B	0.18263	0.021	T	0.42865	-0.9426	9	0.27785	T	0.31	.	1.655	0.02779	0.4184:0.0:0.2622:0.3194	.	1813	Q685J3	MUC17_HUMAN	P	1813	ENSP00000302716:T1813P	ENSP00000302716:T1813P	T	+	1	0	MUC17	100466854	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.583000	0.05807	-1.802000	0.01244	-1.567000	0.00876	ACA	MUC17	-	NULL	ENSG00000169876		0.498	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	-	0.00	83	0	A	NM_001040105		100680134	+1	tier1	-	no_errors	ENST00000306151	ensembl	human	known	74_37	missense	13.64	114	18	SNP	0.000	C
MUC19	283463	genome.wustl.edu	37	12	40921250	40921250	+	3'UTR	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:40921250C>A	ENST00000474954.1	+	0	2528				MUC19_ENST00000454784.4_Intron			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						GCAAGTGATTCAAAATAGATT	0.338																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000474954.1:c.*2525C>A	12.37:g.40921250C>A			Q8NA85	RNA	SNP	-	NULL	ENST00000474954.1	37	NULL		12																																																																																			MUC19	-	-	ENSG00000205592		0.338	MUC19-006	KNOWN	basic	processed_transcript	MUC19	HGNC	protein_coding	OTTHUMT00000134360.1	-	0.00	13	0	C	XM_003403524		40921250	+1	tier1	-	no_errors	ENST00000474954	ensembl	human	known	74_37	rna	23.68	29	9	SNP	0.001	A
MVD	4597	genome.wustl.edu	37	16	88722868	88722868	+	Intron	SNP	G	G	T	rs142373947		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:88722868G>T	ENST00000301012.3	-	5	433				MVD_ENST00000568709.1_5'UTR	NM_002461.1	NP_002452.1	P53602	MVD1_HUMAN	mevalonate (diphospho) decarboxylase						cellular protein metabolic process (GO:0044267)|cholesterol biosynthetic process (GO:0006695)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|isoprenoid biosynthetic process (GO:0008299)|positive regulation of cell proliferation (GO:0008284)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|diphosphomevalonate decarboxylase activity (GO:0004163)|Hsp70 protein binding (GO:0030544)|protein homodimerization activity (GO:0042803)			endometrium(3)|large_intestine(1)|lung(7)|ovary(1)	12				BRCA - Breast invasive adenocarcinoma(80;0.0478)		AGCATTCACCGGCCCAGCCGT	0.622																																																	0																																										SO:0001627	intron_variant	0			U49260	CCDS10968.1	16q24.3	2010-04-29			ENSG00000167508	ENSG00000167508	4.1.1.33		7529	protein-coding gene	gene with protein product	"""mevalonate pyrophosphate decarboxylase"""	603236				8626466	Standard	NM_002461		Approved	MPD	uc002flg.1	P53602	OTTHUMG00000137865	ENST00000301012.3:c.404-156C>A	16.37:g.88722868G>T			Q53Y65	RNA	SNP	-	NULL	ENST00000301012.3	37	NULL	CCDS10968.1	16																																																																																			MVD	-	-	ENSG00000167508		0.622	MVD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MVD	HGNC	protein_coding	OTTHUMT00000269547.2	-	0.00	10	0	G	NM_002461		88722868	-1	tier1	-	no_errors	ENST00000565720	ensembl	human	known	74_37	rna	50.00	6	6	SNP	0.000	T
MYH3	4621	genome.wustl.edu	37	17	10551879	10551879	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:10551879G>T	ENST00000583535.1	-	8	817	c.730C>A	c.(730-732)Cgt>Agt	p.R244S	MYH3_ENST00000226209.7_Missense_Mutation_p.R244S	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	244	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CTCACAAAACGGGAGGAGTTG	0.483																																																	0													127.0	122.0	124.0					17																	10551879		2203	4300	6503	SO:0001583	missense	0				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.730C>A	17.37:g.10551879G>T	ENSP00000464317:p.Arg244Ser		Q15492	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_P-loop_NTPase,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R244S	ENST00000583535.1	37	c.730	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	G	18.88	3.716913	0.68844	.	.	ENSG00000109063	ENST00000226209	D	0.84589	-1.87	4.94	4.94	0.65067	Myosin head, motor domain (3);	.	.	.	.	D	0.96907	0.8990	H	0.99985	5.24	0.43141	D	0.994897	D	0.67145	0.996	D	0.72625	0.978	D	0.99636	1.0987	9	0.87932	D	0	.	18.3353	0.90286	0.0:0.0:1.0:0.0	.	244	P11055	MYH3_HUMAN	S	244	ENSP00000226209:R244S	ENSP00000226209:R244S	R	-	1	0	MYH3	10492604	1.000000	0.71417	1.000000	0.80357	0.634000	0.38068	3.728000	0.54991	2.563000	0.86464	0.462000	0.41574	CGT	MYH3	-	pfam_Myosin_head_motor_dom,superfamily_P-loop_NTPase,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000109063		0.483	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	-	0.00	76	0	G	NM_002470		10551879	-1	tier1	-	no_errors	ENST00000226209	ensembl	human	known	74_37	missense	6.67	56	4	SNP	1.000	T
MYOF	26509	genome.wustl.edu	37	10	95079771	95079771	+	Splice_Site	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:95079771C>A	ENST00000359263.4	-	49	5456		c.e49-1		MYOF_ENST00000371501.4_Splice_Site|MYOF_ENST00000358334.5_Splice_Site|MYOF_ENST00000371502.4_Splice_Site	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin						blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						AGGAATCCAGCTGAAAGGCAG	0.413																																																	0													90.0	80.0	83.0					10																	95079771		1916	4123	6039	SO:0001630	splice_region_variant	0			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.5457-1G>T	10.37:g.95079771C>A			B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Splice_Site	SNP	-	e49-1	ENST00000359263.4	37	c.5457-1	CCDS41551.1	10	.	.	.	.	.	.	.	.	.	.	C	25.3	4.624235	0.87560	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.2371	0.98361	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYOF	95069761	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.788000	0.95919	0.555000	0.69702	.	MYOF	-	-	ENSG00000138119		0.413	MYOF-005	KNOWN	basic|CCDS	protein_coding	MYOF	HGNC	protein_coding	OTTHUMT00000049423.2	-	0.00	30	0	C	NM_013451	Intron	95079771	-1	tier1	-	no_errors	ENST00000359263	ensembl	human	known	74_37	splice_site	11.76	30	4	SNP	1.000	A
N4BP1	9683	genome.wustl.edu	37	16	48596162	48596162	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:48596162C>T	ENST00000262384.3	-	2	628	c.392G>A	c.(391-393)aGg>aAg	p.R131K	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	131					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				AATGTGACTCCTAGCCATGAC	0.413																																																	0													71.0	72.0	72.0					16																	48596162		1925	4136	6061	SO:0001583	missense	0			AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.392G>A	16.37:g.48596162C>T	ENSP00000262384:p.Arg131Lys		A7MD49|Q2YDX1	Missense_Mutation	SNP	pfam_RNase_Zc3h12	p.R131K	ENST00000262384.3	37	c.392	CCDS45479.1	16	.	.	.	.	.	.	.	.	.	.	C	11.31	1.602465	0.28534	.	.	ENSG00000102921	ENST00000262384	T	0.39406	1.08	5.45	3.49	0.39957	.	0.119054	0.56097	D	0.000021	T	0.26268	0.0641	L	0.29908	0.895	0.09310	N	0.999999	P	0.35844	0.524	B	0.31946	0.138	T	0.12218	-1.0556	10	0.38643	T	0.18	-13.3797	7.8622	0.29516	0.0:0.6944:0.0:0.3056	.	131	O75113	N4BP1_HUMAN	K	131	ENSP00000262384:R131K	ENSP00000262384:R131K	R	-	2	0	N4BP1	47153663	0.215000	0.23574	0.103000	0.21229	0.990000	0.78478	2.973000	0.49264	1.437000	0.47472	0.655000	0.94253	AGG	N4BP1	-	NULL	ENSG00000102921		0.413	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP1	HGNC	protein_coding	OTTHUMT00000429920.1	-	0.00	37	0	C	NM_014664		48596162	-1	tier1	-	no_errors	ENST00000262384	ensembl	human	known	74_37	missense	10.00	45	5	SNP	0.337	T
NAA25	80018	genome.wustl.edu	37	12	112509837	112509837	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:112509837delC	ENST00000261745.4	-	10	1146	c.898delG	c.(898-900)gaafs	p.E300fs	Y_RNA_ENST00000363818.1_RNA	NM_024953.3	NP_079229.2	Q14CX7	NAA25_HUMAN	N(alpha)-acetyltransferase 25, NatB auxiliary subunit	300						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(1)|lung(14)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	46						ACAGCTTTTTCTGCAGAATAA	0.408																																																	0													82.0	69.0	74.0					12																	112509837		2203	4300	6503	SO:0001589	frameshift_variant	0			AB054990	CCDS9159.1	12q24.13	2013-10-11	2010-01-14	2010-01-14		ENSG00000111300		"""N(alpha)-acetyltransferase subunits"""	25783	protein-coding gene	gene with protein product		612755	"""chromosome 12 open reading frame 30"""	C12orf30		19660095	Standard	NM_024953		Approved	FLJ13089	uc001ttm.3	Q14CX7	OTTHUMG00000169638	ENST00000261745.4:c.898delG	12.37:g.112509837delC	ENSP00000261745:p.Glu300fs		A0JLU7|Q6MZH1|Q7Z4N6|Q9H911	Frame_Shift_Del	DEL	pfam_N-acetylTrfase_B_cplx_non-cat,pfscan_TPR-contain_dom	p.E300fs	ENST00000261745.4	37	c.898	CCDS9159.1	12																																																																																			NAA25	-	pfam_N-acetylTrfase_B_cplx_non-cat	ENSG00000111300		0.408	NAA25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA25	HGNC	protein_coding	OTTHUMT00000405205.1		0.00	34	0	C	NM_024953		112509837	-1	tier1		no_errors	ENST00000261745	ensembl	human	known	74_37	frame_shift_del	10.81	33	4	DEL	1.000	-
NACA	4666	genome.wustl.edu	37	12	57111774	57111774	+	Silent	SNP	A	A	G	rs111848322		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:57111774A>G	ENST00000454682.1	-	3	3821	c.3540T>C	c.(3538-3540)ccT>ccC	p.P1180P	NACA_ENST00000551793.1_Intron|NACA_ENST00000552540.1_Intron|NACA_ENST00000356769.3_Intron|NACA_ENST00000550952.1_Intron|NACA_ENST00000546392.1_Intron|NACA_ENST00000393891.4_Intron|NACA_ENST00000548563.1_Intron	NM_001113203.2	NP_001106674.2	E9PAV3	NACAM_HUMAN	nascent polypeptide-associated complex alpha subunit	1180	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	10						CTTTTGGGGAAGGAGGAGTTG	0.632			T	BCL6	NHL																																			Dom	yes		12	12q23-q24.1	4666	nascent-polypeptide-associated complex alpha polypeptide		L	0													65.0	74.0	71.0					12																	57111774		1202	2821	4023	SO:0001819	synonymous_variant	0			X80909	CCDS31837.1, CCDS44925.1, CCDS44925.2	12q23-q24.1	2008-09-05	2007-04-20		ENSG00000196531	ENSG00000196531			7629	protein-coding gene	gene with protein product		601234	"""nascent-polypeptide-associated complex alpha polypeptide"""			8047162	Standard	NM_001113202		Approved	NACA1	uc001sma.2	E9PAV3		ENST00000454682.1:c.3540T>C	12.37:g.57111774A>G				Silent	SNP	pfam_Nas_poly-pep-assoc_cplx_dom,superfamily_UBA-like,pfscan_Nas_poly-pep-assoc_cplx_dom	p.P1180	ENST00000454682.1	37	c.3540		12																																																																																			NACA	-	NULL	ENSG00000196531		0.632	NACA-201	KNOWN	basic	protein_coding	NACA	HGNC	protein_coding		-	0.00	30	0	A	NM_005594		57111774	-1	tier1	rs111848322	no_errors	ENST00000454682	ensembl	human	known	74_37	silent	12.50	21	3	SNP	0.002	G
NAB2	4665	genome.wustl.edu	37	12	57485167	57485167	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:57485167C>T	ENST00000300131.3	+	2	721	c.343C>T	c.(343-345)Caa>Taa	p.Q115*	NAB2_ENST00000342556.6_Nonsense_Mutation_p.Q115*|NAB2_ENST00000554718.1_3'UTR|NAB2_ENST00000357680.4_Nonsense_Mutation_p.Q115*	NM_005967.3	NP_005958.1	Q15742	NAB2_HUMAN	NGFI-A binding protein 2 (EGR1 binding protein 2)	115					cell proliferation (GO:0008283)|endochondral ossification (GO:0001958)|myelination (GO:0042552)|negative regulation of transcription from RNA polymerase III promoter (GO:0016480)|nervous system development (GO:0007399)|regulation of epidermis development (GO:0045682)|Schwann cell differentiation (GO:0014037)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	20						GCTCTTCAGTCAACCAGTGCC	0.612																																																	0													77.0	85.0	82.0					12																	57485167		2203	4300	6503	SO:0001587	stop_gained	0			BC065931	CCDS8930.1	12q13.3	2008-05-14				ENSG00000166886			7627	protein-coding gene	gene with protein product		602381				8668170, 8649813	Standard	XM_005268894		Approved	MADER	uc001smz.3	Q15742		ENST00000300131.3:c.343C>T	12.37:g.57485167C>T	ENSP00000300131:p.Gln115*		B2RAK3|O76006|Q14797	Nonsense_Mutation	SNP	pfam_NAB_co-repressor_dom,pfam_Nab_N,superfamily_SAM/pointed	p.Q115*	ENST00000300131.3	37	c.343	CCDS8930.1	12	.	.	.	.	.	.	.	.	.	.	C	38	6.975522	0.97975	.	.	ENSG00000166886	ENST00000300131;ENST00000342556;ENST00000357680	.	.	.	4.59	4.59	0.56863	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-12.3865	14.9499	0.71064	0.0:1.0:0.0:0.0	.	.	.	.	X	115	.	ENSP00000300131:Q115X	Q	+	1	0	NAB2	55771434	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.645000	0.83430	2.375000	0.81037	0.462000	0.41574	CAA	NAB2	-	pfam_Nab_N	ENSG00000166886		0.612	NAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAB2	HGNC	protein_coding	OTTHUMT00000412222.1	-	0.00	30	0	C	NM_005967		57485167	+1	tier1	-	no_errors	ENST00000300131	ensembl	human	known	74_37	nonsense	18.00	41	9	SNP	1.000	T
NALCN	259232	genome.wustl.edu	37	13	101710386	101710386	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr13:101710386A>G	ENST00000251127.6	-	43	5009	c.4928T>C	c.(4927-4929)cTg>cCg	p.L1643P	NALCN-AS1_ENST00000457843.1_RNA	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1643					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CGTGGGGCTCAGGAGCTGCTG	0.557																																																	0													68.0	65.0	66.0					13																	101710386		2203	4300	6503	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4928T>C	13.37:g.101710386A>G	ENSP00000251127:p.Leu1643Pro		Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.L1643P	ENST00000251127.6	37	c.4928	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	A	17.78	3.473792	0.63737	.	.	ENSG00000102452	ENST00000251127	D	0.97906	-4.6	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	D	0.97832	0.9288	L	0.43923	1.385	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	D	0.98821	1.0747	10	0.59425	D	0.04	.	15.2261	0.73352	1.0:0.0:0.0:0.0	.	1643	Q8IZF0	NALCN_HUMAN	P	1643	ENSP00000251127:L1643P	ENSP00000251127:L1643P	L	-	2	0	NALCN	100508387	1.000000	0.71417	0.995000	0.50966	0.965000	0.64279	7.061000	0.76699	1.987000	0.57996	0.533000	0.62120	CTG	NALCN	-	NULL	ENSG00000102452		0.557	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2		0.00	26	0	A	NM_052867		101710386	-1			no_errors	ENST00000251127	ensembl	human	known	74_37	missense	19.05	17	4	SNP	1.000	G
ICE2	79664	genome.wustl.edu	37	15	60748894	60748894	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:60748894C>G	ENST00000261520.4	-	6	862	c.628G>C	c.(628-630)Gag>Cag	p.E210Q	NARG2_ENST00000561114.1_Missense_Mutation_p.E210Q|NARG2_ENST00000439632.1_Missense_Mutation_p.E73Q	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						AATCCCATCTCTACTCTGAAT	0.353																																																	0													72.0	78.0	76.0					15																	60748894		2202	4300	6502	SO:0001583	missense	0																														ENST00000261520.4:c.628G>C	15.37:g.60748894C>G	ENSP00000261520:p.Glu210Gln			Missense_Mutation	SNP	pfam_NARG2_C	p.E210Q	ENST00000261520.4	37	c.628	CCDS10176.1	15	.	.	.	.	.	.	.	.	.	.	C	14.77	2.634940	0.47049	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	5.44	5.44	0.79542	.	0.294748	0.36101	N	0.002786	T	0.27241	0.0668	N	0.22421	0.69	0.27440	N	0.953735	P;P	0.46142	0.873;0.615	B;B	0.43225	0.412;0.1	T	0.12167	-1.0558	9	0.27785	T	0.31	-15.4616	12.8624	0.57922	0.0:0.8364:0.1636:0.0	.	73;210	G3V0H6;Q659A1	.;NARG2_HUMAN	Q	210;73	.	ENSP00000261520:E210Q	E	-	1	0	NARG2	58536186	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.202000	0.51067	2.720000	0.93068	0.561000	0.74099	GAG	NARG2	-	NULL	ENSG00000128915		0.353	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARG2	HGNC	protein_coding	OTTHUMT00000256136.1	-	0.00	87	0	C			60748894	-1	tier1	-	no_errors	ENST00000261520	ensembl	human	known	74_37	missense	39.18	59	38	SNP	1.000	G
NBEA	26960	genome.wustl.edu	37	13	35733522	35733522	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr13:35733522G>A	ENST00000400445.3	+	22	3748	c.3214G>A	c.(3214-3216)Gat>Aat	p.D1072N	NBEA_ENST00000540320.1_Missense_Mutation_p.D1072N|NBEA_ENST00000379939.2_Missense_Mutation_p.D1072N|NBEA_ENST00000310336.4_Missense_Mutation_p.D1072N	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1072					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		AGTAAAGCTCGATGATATGGA	0.403																																																	0													119.0	114.0	116.0					13																	35733522		1885	4110	5995	SO:0001583	missense	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.3214G>A	13.37:g.35733522G>A	ENSP00000383295:p.Asp1072Asn		B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl_sf,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.D1072N	ENST00000400445.3	37	c.3214	CCDS45026.1	13	.	.	.	.	.	.	.	.	.	.	G	14.39	2.521223	0.44866	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	5.1	5.1	0.69264	.	0.059810	0.64402	D	0.000005	T	0.45054	0.1323	N	0.19112	0.55	0.80722	D	1	B	0.12630	0.006	B	0.06405	0.002	T	0.27226	-1.0080	10	0.29301	T	0.29	.	18.505	0.90894	0.0:0.0:1.0:0.0	.	1072	Q5T321	.	N	1072	ENSP00000440951:D1072N;ENSP00000383295:D1072N;ENSP00000369271:D1072N;ENSP00000308534:D1072N	ENSP00000308534:D1072N	D	+	1	0	NBEA	34631522	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	7.318000	0.79029	2.374000	0.81015	0.561000	0.74099	GAT	NBEA	-	NULL	ENSG00000172915		0.403	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		-	0.00	51	0	G	NM_015678		35733522	+1	tier1	-	no_errors	ENST00000310336	ensembl	human	known	74_37	missense	37.70	38	23	SNP	1.000	A
NDEL1	81565	genome.wustl.edu	37	17	8350156	8350156	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:8350156G>T	ENST00000334527.7	+	4	522	c.325G>T	c.(325-327)Gag>Tag	p.E109*	NDEL1_ENST00000380025.4_Nonsense_Mutation_p.E109*|NDEL1_ENST00000402554.3_Nonsense_Mutation_p.E109*|NDEL1_ENST00000585098.1_Intron|NDEL1_ENST00000299734.7_Nonsense_Mutation_p.E109*	NM_030808.4	NP_110435.1	Q9GZM8	NDEL1_HUMAN	nudE neurodevelopment protein 1-like 1	109	Interaction with KATNB1. {ECO:0000250}.|Self-association. {ECO:0000250}.				activation of Cdc42 GTPase activity (GO:0032864)|central nervous system neuron axonogenesis (GO:0021955)|centrosome localization (GO:0051642)|cerebral cortex radially oriented cell migration (GO:0021799)|chromosome segregation (GO:0007059)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|neurofilament cytoskeleton organization (GO:0060052)|neuron migration (GO:0001764)|neuron projection extension (GO:1990138)|nuclear envelope disassembly (GO:0051081)|positive regulation of axon extension (GO:0045773)|positive regulation of axon regeneration (GO:0048680)|retrograde axon cargo transport (GO:0008090)|vesicle transport along microtubule (GO:0047496)	axon hillock (GO:0043203)|cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|neurofilament cytoskeleton (GO:0060053)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)	oligopeptidase activity (GO:0070012)			large_intestine(6)|lung(4)|skin(3)	13						GGCCATTAAGGAGCAGTTGCA	0.453																																																	0													108.0	99.0	102.0					17																	8350156		2203	4300	6503	SO:0001587	stop_gained	0			AF182078	CCDS11143.1, CCDS32564.1	17p13.1	2013-08-06	2013-08-06	2003-04-16	ENSG00000166579	ENSG00000166579			17620	protein-coding gene	gene with protein product		607538	"""nudE nuclear distribution gene E homolog (A. nidulans)-like 1"", ""nudE nuclear distribution E homolog (A. nidulans)-like 1"""			11163260, 11163259	Standard	NM_001025579		Approved	NUDEL, MITAP1, NDE1L1, NDE2	uc002glj.4	Q9GZM8	OTTHUMG00000108193	ENST00000334527.7:c.325G>T	17.37:g.8350156G>T	ENSP00000333982:p.Glu109*		B3KP93|D3DTS0|J3QT32|Q86T80|Q8TAR7|Q9UH50	Nonsense_Mutation	SNP	pfam_NUDE_C	p.E109*	ENST00000334527.7	37	c.325	CCDS11143.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.566040	0.96540	.	.	ENSG00000166579	ENST00000299734;ENST00000380025;ENST00000402554;ENST00000334527	.	.	.	5.01	5.01	0.66863	.	0.152557	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-5.8871	18.5074	0.90902	0.0:0.0:1.0:0.0	.	.	.	.	X	109;109;164;109	.	ENSP00000299734:E109X	E	+	1	0	NDEL1	8290881	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.429000	0.97481	2.618000	0.88619	0.561000	0.74099	GAG	NDEL1	-	NULL	ENSG00000166579		0.453	NDEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDEL1	HGNC	protein_coding	OTTHUMT00000226999.2	-	0.00	50	0	G	NM_030808		8350156	+1	tier1	-	no_errors	ENST00000299734	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	1.000	T
NEUROD4	58158	genome.wustl.edu	37	12	55420518	55420518	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:55420518C>T	ENST00000242994.3	+	2	673	c.295C>T	c.(295-297)Cgg>Tgg	p.R99W		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	99	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						AGAACGGACCCGGATGCATGG	0.498																																																	0													80.0	82.0	81.0					12																	55420518		2203	4300	6503	SO:0001583	missense	0			AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.295C>T	12.37:g.55420518C>T	ENSP00000242994:p.Arg99Trp		B2RAC9	Missense_Mutation	SNP	pfam_Neurogenic_DUF,pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pirsf_TF_bHLH_NeuroD,pfscan_bHLH_dom	p.R99W	ENST00000242994.3	37	c.295	CCDS8886.1	12	.	.	.	.	.	.	.	.	.	.	C	24.4	4.526029	0.85600	.	.	ENSG00000123307	ENST00000242994	D	0.99722	-6.53	5.22	5.22	0.72569	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99864	0.9936	H	0.98901	4.365	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96477	0.9353	10	0.87932	D	0	-1.696	16.6752	0.85277	0.0:1.0:0.0:0.0	.	99	Q9HD90	NDF4_HUMAN	W	99	ENSP00000242994:R99W	ENSP00000242994:R99W	R	+	1	2	NEUROD4	53706785	0.994000	0.37717	1.000000	0.80357	0.992000	0.81027	3.128000	0.50492	2.603000	0.88011	0.655000	0.94253	CGG	NEUROD4	-	pfam_bHLH_dom,superfamily_bHLH_dom,smart_bHLH_dom,pirsf_TF_bHLH_NeuroD,pfscan_bHLH_dom	ENSG00000123307		0.498	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD4	HGNC	protein_coding	OTTHUMT00000406104.1	-	0.00	39	0	C			55420518	+1	tier1	-	no_errors	ENST00000242994	ensembl	human	known	74_37	missense	11.11	32	4	SNP	1.000	T
NKX2-1	7080	genome.wustl.edu	37	14	36988599	36988599	+	5'UTR	DEL	A	A	-	rs200779342|rs74985314		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:36988599delA	ENST00000498187.2	-	0	299				NKX2-1_ENST00000518149.1_Intron|NKX2-1_ENST00000354822.5_Intron|NKX2-1_ENST00000522719.2_Intron|RP11-896J10.3_ENST00000521945.1_RNA|NKX2-1-AS1_ENST00000521292.2_RNA	NM_003317.3	NP_003308.1	P43699	NKX21_HUMAN	NK2 homeobox 1						anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|brain development (GO:0007420)|cerebral cortex cell migration (GO:0021795)|cerebral cortex GABAergic interneuron differentiation (GO:0021892)|Clara cell differentiation (GO:0060486)|developmental induction (GO:0031128)|endoderm development (GO:0007492)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|forebrain development (GO:0030900)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain neuron fate commitment (GO:0021877)|globus pallidus development (GO:0021759)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|locomotory behavior (GO:0007626)|lung development (GO:0030324)|lung saccule development (GO:0060430)|menarche (GO:0042696)|negative regulation of cell migration (GO:0030336)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron migration (GO:0001764)|oligodendrocyte differentiation (GO:0048709)|phospholipid metabolic process (GO:0006644)|pituitary gland development (GO:0021983)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|rhythmic process (GO:0048511)|thyroid gland development (GO:0030878)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(2)	7	all_cancers(3;4.47e-51)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.165)		Lung(8;1.8e-08)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.014)|all cancers(34;0.0366)|LUSC - Lung squamous cell carcinoma(13;0.132)	GBM - Glioblastoma multiforme(112;0.0171)		GAAGAGGAGGAAAAAAAAGGG	0.512			A		NSCLC																																			Dom	yes		14	14q13	7080	NK2 homeobox 1		E	0									,	21,57,3536		3,0,15,4,49,1736	10.0	13.0	12.0		,	5.1	1.0	14	dbSNP_131	12	33,63,7090		1,0,31,2,59,3500	no	utr-5,intron	NKX2-1	NM_003317.3,NM_001079668.2	,	4,0,46,6,108,5236	A1A1,A1A2,A1R,A2A2,A2R,RR		1.3359,2.1583,1.6111	,	,	36988599	54,120,10626	1973	3897	5870	SO:0001623	5_prime_UTR_variant	0				CCDS9659.1, CCDS41945.1	14q13.3	2012-03-09	2007-07-26	2007-07-26	ENSG00000136352	ENSG00000136352		"""Homeoboxes / ANTP class : NKL subclass"""	11825	protein-coding gene	gene with protein product		600635	"""benign chorea"", ""thyroid transcription factor 1"""	NKX2A, BCH, TITF1		1976511	Standard	NM_001079668		Approved	TTF-1, TTF1	uc001wtu.3	P43699	OTTHUMG00000140225	ENST00000498187.2:c.-37T>-	14.37:g.36988599delA			D3DSA3|O14954|O14955|Q7KZF6|Q9BRJ8	RNA	DEL	-	NULL	ENST00000498187.2	37	NULL	CCDS9659.1	14																																																																																			NKX2-1-AS1	-	-	ENSG00000253563		0.512	NKX2-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX2-1-AS1	HGNC	protein_coding	OTTHUMT00000276688.4		0.00	31	0	A	NM_003317		36988599	+1	tier1		no_errors	ENST00000521292	ensembl	human	known	74_37	rna	6.98	40	3	DEL	1.000	-
NOC4L	79050	genome.wustl.edu	37	12	132629510	132629510	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:132629510G>A	ENST00000330579.1	+	2	270	c.229G>A	c.(229-231)Gtc>Atc	p.V77I	DDX51_ENST00000397333.3_5'Flank	NM_024078.1	NP_076983.1	Q9BVI4	NOC4L_HUMAN	nucleolar complex associated 4 homolog (S. cerevisiae)	77					rRNA processing (GO:0006364)	integral component of membrane (GO:0016021)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(2)|large_intestine(1)|lung(7)|skin(2)	14	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.2e-08)|Epithelial(86;3.34e-07)|all cancers(50;1.97e-05)		TGAGGAGATGGTCATGACAGG	0.652																																																	0													36.0	34.0	34.0					12																	132629510		2187	4292	6479	SO:0001583	missense	0				CCDS9277.1	12q24.33	2011-08-12			ENSG00000184967	ENSG00000184967			28461	protein-coding gene	gene with protein product		612819				12446671	Standard	NM_024078		Approved	MGC3162, NET49, UTP19	uc001ujz.1	Q9BVI4	OTTHUMG00000168260	ENST00000330579.1:c.229G>A	12.37:g.132629510G>A	ENSP00000328854:p.Val77Ile		Q8N2S5|Q96I14	Missense_Mutation	SNP	pfam_CCAAT-binding_factor,superfamily_ARM-type_fold	p.V77I	ENST00000330579.1	37	c.229	CCDS9277.1	12	.	.	.	.	.	.	.	.	.	.	G	9.004	0.980823	0.18812	.	.	ENSG00000184967	ENST00000330579;ENST00000541954	T	0.30182	1.54	4.59	1.72	0.24424	Armadillo-like helical (1);	0.983012	0.08341	N	0.960885	T	0.24547	0.0595	L	0.51422	1.61	0.09310	N	1	B	0.26318	0.146	B	0.19666	0.026	T	0.27331	-1.0077	10	0.34782	T	0.22	-37.6275	3.9713	0.09454	0.2762:0.0:0.5214:0.2024	.	77	Q9BVI4	NOC4L_HUMAN	I	77;2	ENSP00000328854:V77I	ENSP00000328854:V77I	V	+	1	0	NOC4L	131195463	0.013000	0.17824	0.001000	0.08648	0.002000	0.02628	1.749000	0.38319	0.376000	0.24707	-0.339000	0.08088	GTC	NOC4L	-	superfamily_ARM-type_fold	ENSG00000184967		0.652	NOC4L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOC4L	HGNC	protein_coding	OTTHUMT00000398999.1	-	0.00	53	0	G	NM_024078		132629510	+1	tier1	-	no_errors	ENST00000330579	ensembl	human	known	74_37	missense	29.03	44	18	SNP	0.000	A
NONO	4841	genome.wustl.edu	37	X	70520905	70520905	+	3'UTR	DEL	T	T	-			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chrX:70520905delT	ENST00000276079.8	+	0	2600				NONO_ENST00000490044.1_3'UTR|ITGB1BP2_ENST00000373829.3_5'Flank|NONO_ENST00000373841.1_3'UTR|ITGB1BP2_ENST00000538820.1_5'Flank|NONO_ENST00000535149.1_3'UTR	NM_007363.4	NP_031389.3	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding						circadian rhythm (GO:0007623)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mRNA processing (GO:0006397)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)		NONO/TFE3(2)	endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	19	Renal(35;0.156)					ATGCTGTGCATTTTTTTTTTC	0.368			T	TFE3	papillary renal cancer																																			Dom	yes		X	Xq13.1	4841	"""non-POU domain containing, octamer-binding"""		E	0																																										SO:0001624	3_prime_UTR_variant	0			L14599	CCDS14410.1, CCDS55445.1	Xq13.1	2014-06-13	2002-01-14		ENSG00000147140	ENSG00000147140		"""RNA binding motif (RRM) containing"""	7871	protein-coding gene	gene with protein product	"""Nuclear RNA-binding protein, 54-kD"", ""non-Pou domain-containing octamer (ATGCAAAT) binding protein"", ""protein phosphatase 1, regulatory subunit 114"""	300084	"""non-POU-domain-containing, octamer-binding"""			8371983, 9360842	Standard	NM_007363		Approved	NRB54, NMT55, P54NRB, P54, PPP1R114	uc004dzp.3	Q15233	OTTHUMG00000021798	ENST00000276079.8:c.*979T>-	X.37:g.70520905delT			B7Z4C2|D3DVV4|F5GYZ3|O00201|P30807|Q12786|Q9BQC5	RNA	DEL	-	NULL	ENST00000276079.8	37	NULL	CCDS14410.1	X																																																																																			NONO	-	-	ENSG00000147140		0.368	NONO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NONO	HGNC	protein_coding	OTTHUMT00000057138.1		0.00	45	0	T	NM_007363		70520905	+1	tier1		no_errors	ENST00000490044	ensembl	human	known	74_37	rna	10.00	45	5	DEL	0.995	-
NT5C1B	93034	genome.wustl.edu	37	2	18765458	18765458	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:18765458C>T	ENST00000359846.2	-	6	1044	c.967G>A	c.(967-969)Ggc>Agc	p.G323S	NT5C1B_ENST00000460052.1_5'Flank|RNU6-1215P_ENST00000384441.1_RNA|NT5C1B_ENST00000600945.1_Missense_Mutation_p.G323S|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.G323S|NT5C1B_ENST00000304081.4_Missense_Mutation_p.G263S	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	323					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)	p.G323S(1)		endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				ATTTTCCTGCCGTCCACCATG	0.552																																																	1	Substitution - Missense(1)	large_intestine(1)											165.0	157.0	160.0					2																	18765458		2203	4300	6503	SO:0001583	missense	0			AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.967G>A	2.37:g.18765458C>T	ENSP00000352904:p.Gly323Ser		B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	pfam_5-nucleotidase	p.G323S	ENST00000359846.2	37	c.967	CCDS33150.1	2	.	.	.	.	.	.	.	.	.	.	C	13.24	2.177290	0.38413	.	.	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846	D	0.88586	-2.4	5.58	4.71	0.59529	.	0.366985	0.32852	N	0.005561	T	0.69663	0.3136	N	0.02674	-0.535	0.31997	N	0.603868	B;B;B;B;B;B;B;B;B	0.30326	0.091;0.091;0.091;0.091;0.07;0.085;0.147;0.091;0.276	B;B;B;B;B;B;B;B;B	0.20767	0.014;0.014;0.014;0.014;0.003;0.014;0.031;0.014;0.024	T	0.68213	-0.5468	10	0.05525	T	0.97	-13.8612	14.8118	0.70000	0.0:0.9306:0.0:0.0694	.	306;340;263;306;265;115;263;323;323	E7EXB7;B4DZ86;B4DXQ9;B4DXZ9;C9J2C7;Q96P26-3;Q96P26-2;Q96P26;Q96P26-4	.;.;.;.;.;.;.;5NT1B_HUMAN;.	S	323;265;263;323	ENSP00000412639:G265S	ENSP00000305979:G263S	G	-	1	0	NT5C1B-RDH14;NT5C1B	18628939	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	5.734000	0.68580	1.495000	0.48549	0.650000	0.86243	GGC	NT5C1B	-	NULL	ENSG00000185013		0.552	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NT5C1B	HGNC	protein_coding	OTTHUMT00000323822.1	-	0.00	34	0	C			18765458	-1	tier1	-	no_errors	ENST00000359846	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	T
NUP210L	91181	genome.wustl.edu	37	1	154091197	154091197	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:154091197G>C	ENST00000368559.3	-	11	1485	c.1414C>G	c.(1414-1416)Ctg>Gtg	p.L472V	NUP210L_ENST00000271854.3_Missense_Mutation_p.L472V	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	472					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			GGAAATGCCAGAAATTTGGGT	0.353																																																	0													170.0	172.0	171.0					1																	154091197		1828	4086	5914	SO:0001583	missense	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.1414C>G	1.37:g.154091197G>C	ENSP00000357547:p.Leu472Val		E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.L472V	ENST00000368559.3	37	c.1414	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	16.38	3.106387	0.56291	.	.	ENSG00000143552	ENST00000368559;ENST00000271854	T;T	0.43294	0.95;0.95	5.0	0.358	0.16084	Invasin/intimin cell-adhesion (1);	0.000000	0.43579	D	0.000545	T	0.40886	0.1135	M	0.67397	2.05	0.30155	N	0.802696	D;D	0.69078	0.997;0.997	D;D	0.78314	0.991;0.991	T	0.31223	-0.9951	10	0.28530	T	0.3	-0.125	10.01	0.41981	0.3355:0.0:0.6645:0.0	.	472;472	E7EP56;Q5VU65	.;P210L_HUMAN	V	472	ENSP00000357547:L472V;ENSP00000271854:L472V	ENSP00000271854:L472V	L	-	1	2	NUP210L	152357821	0.999000	0.42202	0.998000	0.56505	0.878000	0.50629	0.551000	0.23361	0.170000	0.19704	0.460000	0.39030	CTG	NUP210L	-	superfamily_Invasin/intimin_cell_adhesion	ENSG00000143552		0.353	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	-	0.00	38	0	G	NM_207308		154091197	-1	tier1	-	no_errors	ENST00000368559	ensembl	human	known	74_37	missense	26.92	38	14	SNP	0.997	C
NUPR1L	389493	genome.wustl.edu	37	7	56183800	56183800	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:56183800G>A	ENST00000329309.3	-	1	293	c.208C>T	c.(208-210)Cgc>Tgc	p.R70C		NM_001145712.1	NP_001139184.1	A6NF83	NUR1L_HUMAN	nuclear protein, transcriptional regulator, 1-like	70																	GCGACCTTGCGCTCGTGCCCG	0.721																																																	0													12.0	11.0	11.0					7																	56183800		692	1589	2281	SO:0001583	missense	0				CCDS59058.1	7p11.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000185290	ENSG00000185290			44164	protein-coding gene	gene with protein product							Standard	NM_001145712		Approved		uc003tsb.3	A6NF83	OTTHUMG00000156224	ENST00000329309.3:c.208C>T	7.37:g.56183800G>A	ENSP00000455442:p.Arg70Cys			Missense_Mutation	SNP	pfam_Nuclear_phosphoprot_p8_DNA-bd	p.R70C	ENST00000329309.3	37	c.208	CCDS59058.1	7																																																																																			NUPR1L	-	pfam_Nuclear_phosphoprot_p8_DNA-bd	ENSG00000185290		0.721	NUPR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUPR1L	HGNC	protein_coding	OTTHUMT00000343551.2	-	0.00	30	0	G	NM_001145712		56183800	-1	tier1	-	no_errors	ENST00000329309	ensembl	human	known	74_37	missense	11.63	38	5	SNP	1.000	A
OBSL1	23363	genome.wustl.edu	37	2	220430012	220430012	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:220430012C>G	ENST00000404537.1	-	6	2415	c.2359G>C	c.(2359-2361)Gag>Cag	p.E787Q	OBSL1_ENST00000265318.4_Missense_Mutation_p.E787Q|OBSL1_ENST00000289656.3_Missense_Mutation_p.E374Q|OBSL1_ENST00000603926.1_Missense_Mutation_p.E787Q|OBSL1_ENST00000373873.4_Missense_Mutation_p.E787Q|OBSL1_ENST00000373876.1_Missense_Mutation_p.E787Q	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	787	Ig-like 5.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GTCCTGCACTCAAACTCGCCA	0.607											OREG0003987	type=REGULATORY REGION|Gene=BC061909|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													72.0	74.0	73.0					2																	220430012		2129	4251	6380	SO:0001583	missense	0			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.2359G>C	2.37:g.220430012C>G	ENSP00000385636:p.Glu787Gln	2266	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like_dom	p.E787Q	ENST00000404537.1	37	c.2359	CCDS46520.1	2	.	.	.	.	.	.	.	.	.	.	C	16.91	3.253348	0.59212	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873;ENST00000289656	T;T;T;T;T	0.40476	1.03;1.03;1.03;1.03;1.03	5.95	5.95	0.96441	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.35219	0.0924	N	0.04043	-0.29	0.31798	N	0.628722	B;B;D;B	0.59357	0.433;0.433;0.985;0.162	B;B;P;B	0.51055	0.328;0.328;0.657;0.242	T	0.34650	-0.9820	9	0.29301	T	0.29	.	19.9804	0.97323	0.0:1.0:0.0:0.0	.	788;787;374;787	A4KVA4;O75147;A8MSZ8;O75147-2	.;OBSL1_HUMAN;.;.	Q	787;787;787;787;374	ENSP00000265318:E787Q;ENSP00000385636:E787Q;ENSP00000362983:E787Q;ENSP00000362980:E787Q;ENSP00000289656:E374Q	ENSP00000265318:E787Q	E	-	1	0	OBSL1	220138256	0.435000	0.25577	1.000000	0.80357	0.941000	0.58515	2.379000	0.44318	2.825000	0.97269	0.655000	0.94253	GAG	OBSL1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000124006		0.607	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	HGNC	protein_coding	OTTHUMT00000322012.1	-	0.00	43	0	C			220430012	-1	tier1	-	no_errors	ENST00000404537	ensembl	human	known	74_37	missense	12.50	42	6	SNP	1.000	G
OLFML3	56944	genome.wustl.edu	37	1	114524823	114524823	+	3'UTR	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:114524823C>G	ENST00000320334.4	+	0	1727				OLFML3_ENST00000369551.1_3'UTR|OLFML3_ENST00000393300.2_3'UTR|OLFML3_ENST00000491700.1_3'UTR	NM_020190.2	NP_064575.1	Q9NRN5	OLFL3_HUMAN	olfactomedin-like 3						multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)|vesicle (GO:0031982)				breast(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)|urinary_tract(1)	14	Lung SC(450;0.184)	all_cancers(81;4.5e-08)|all_epithelial(167;1.09e-07)|all_lung(203;1.53e-05)|Lung NSC(69;2.76e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACAGGACTTTCTCCACATTGT	0.493																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AF201945	CCDS870.1, CCDS65618.1, CCDS72839.1	1p13.1	2008-02-05			ENSG00000116774	ENSG00000116774			24956	protein-coding gene	gene with protein product		610088					Standard	NM_001286353		Approved	HNOEL-iso, OLF44	uc001eer.1	Q9NRN5	OTTHUMG00000011980	ENST00000320334.4:c.*432C>G	1.37:g.114524823C>G			Q53FR1|Q53HV9|Q5SQL6|Q69AX9|Q8NBJ2	RNA	SNP	-	NULL	ENST00000320334.4	37	NULL	CCDS870.1	1																																																																																			OLFML3	-	-	ENSG00000116774		0.493	OLFML3-011	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFML3	HGNC	protein_coding	OTTHUMT00000033119.1	-	0.00	54	0	C	NM_020190		114524823	+1	tier1	-	no_errors	ENST00000491700	ensembl	human	known	74_37	rna	18.06	59	13	SNP	0.000	G
OPA1	4976	genome.wustl.edu	37	3	193384092	193384092	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:193384092G>A	ENST00000392438.3	+	26	2855	c.2621G>A	c.(2620-2622)tGc>tAc	p.C874Y	OPA1_ENST00000361150.2_Missense_Mutation_p.C875Y|OPA1_ENST00000361908.3_Missense_Mutation_p.C911Y|OPA1_ENST00000361715.2_Missense_Mutation_p.C893Y|OPA1_ENST00000361510.2_Missense_Mutation_p.C929Y|OPA1_ENST00000361828.2_Missense_Mutation_p.C892Y	NM_015560.2	NP_056375.2	O60313	OPA1_HUMAN	optic atrophy 1 (autosomal dominant)	874					apoptotic process (GO:0006915)|axon transport of mitochondrion (GO:0019896)|cellular senescence (GO:0090398)|GTP catabolic process (GO:0006184)|inner mitochondrial membrane organization (GO:0007007)|mitochondrial fission (GO:0000266)|mitochondrial fusion (GO:0008053)|mitochondrion organization (GO:0007005)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neural tube closure (GO:0001843)|visual perception (GO:0007601)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial crista (GO:0030061)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)			breast(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(4)|lung(15)|upper_aerodigestive_tract(1)|urinary_tract(2)	31	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		CAGTTGGAATGCAATGATGTG	0.358																																																	0													138.0	124.0	129.0					3																	193384092		2203	4300	6503	SO:0001583	missense	0			AB011139	CCDS33917.1, CCDS43186.1	3q29	2014-09-17			ENSG00000198836	ENSG00000198836			8140	protein-coding gene	gene with protein product	"""mitochondrial dynamin-like GTPase"", ""dynamin-like guanosine triphosphatase"", ""Dynamin-like 120 kDa protein, mitochondrial"""	605290				9490303	Standard	NM_015560		Approved	NTG, KIAA0567, FLJ12460, NPG, MGM1	uc003ftg.3	O60313	OTTHUMG00000149897	ENST00000392438.3:c.2621G>A	3.37:g.193384092G>A	ENSP00000376233:p.Cys874Tyr		D3DNW4	Missense_Mutation	SNP	pfam_Dynamin_GTPase,superfamily_P-loop_NTPase,smart_Dynamin_GTPase,prints_Dynamin_SF	p.C929Y	ENST00000392438.3	37	c.2786	CCDS43186.1	3	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716975	0.89205	.	.	ENSG00000198836	ENST00000361908;ENST00000392438;ENST00000361510;ENST00000361715;ENST00000361828;ENST00000361150;ENST00000445863	D;D;D;D;D;D;D	0.92099	-2.97;-2.97;-2.97;-2.97;-2.97;-2.97;-2.97	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.95692	0.8599	M	0.68593	2.085	0.80722	D	1	D;D;D;D;D;D;D;D	0.76494	0.988;0.999;0.988;0.988;0.999;0.988;0.999;0.994	P;D;P;P;D;P;D;P	0.85130	0.803;0.996;0.803;0.803;0.997;0.803;0.996;0.882	D	0.95326	0.8425	10	0.56958	D	0.05	-9.7092	19.0191	0.92906	0.0:0.0:1.0:0.0	.	838;874;856;875;892;911;893;929	E5KLK2;O60313;E5KLK0;E5KLK1;E5KLJ6;E5KLJ7;E5KLJ9;E5KLJ5	.;OPA1_HUMAN;.;.;.;.;.;.	Y	911;874;929;893;892;875;66	ENSP00000354681:C911Y;ENSP00000376233:C874Y;ENSP00000355324:C929Y;ENSP00000355311:C893Y;ENSP00000354429:C892Y;ENSP00000354781:C875Y;ENSP00000398358:C66Y	ENSP00000354781:C875Y	C	+	2	0	OPA1	194866786	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.869000	0.99810	2.734000	0.93682	0.555000	0.69702	TGC	OPA1	-	NULL	ENSG00000198836		0.358	OPA1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OPA1	HGNC	protein_coding	OTTHUMT00000313812.2		0.00	49	0	G	NM_130837		193384092	+1			no_errors	ENST00000361510	ensembl	human	known	74_37	missense	5.17	54	3	SNP	1.000	A
OR2J2	26707	genome.wustl.edu	37	6	29141566	29141566	+	Missense_Mutation	SNP	G	G	A	rs141015719	byFrequency	TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:29141566G>A	ENST00000377167.2	+	1	256	c.154G>A	c.(154-156)Gtg>Atg	p.V52M		NM_030905.2	NP_112167.2	O76002	OR2J2_HUMAN	olfactory receptor, family 2, subfamily J, member 2	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V52L(1)		endometrium(1)|kidney(2)|large_intestine(1)|liver(2)|lung(17)|ovary(1)|upper_aerodigestive_tract(1)	25						CCTGTCATACGTGGACTCCCA	0.453													G|||	5	0.000998403	0.0	0.0	5008	,	,		19016	0.005		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	lung(1)						G	MET/VAL	0,4090		0,0,2045	171.0	163.0	166.0		154	-3.9	0.7	6	dbSNP_134	166	2,8462		0,2,4230	no	missense	OR2J2	NM_030905.2	21	0,2,6275	AA,AG,GG		0.0236,0.0,0.0159	benign	52/313	29141566	2,12552	2045	4232	6277	SO:0001583	missense	0				CCDS43434.1	6p22.2-p21.31	2012-08-09			ENSG00000204700	ENSG00000204700		"""GPCR / Class A : Olfactory receptors"""	8260	protein-coding gene	gene with protein product							Standard	NM_030905		Approved	OR6-8, hs6M1-6, dJ80I19.4	uc011dlm.2	O76002	OTTHUMG00000031091	ENST00000377167.2:c.154G>A	6.37:g.29141566G>A	ENSP00000366372:p.Val52Met		A6NCU9|A6NLD0|B0UY53|Q32N09|Q5ST39|Q5SUJ6|Q6IF24|Q9GZK2|Q9GZL3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V52M	ENST00000377167.2	37	c.154	CCDS43434.1	6	5	0.0022893772893772895	0	0.0	0	0.0	5	0.008741258741258742	0	0.0	G	2.473	-0.321483	0.05386	0.0	2.36E-4	ENSG00000204700	ENST00000377167	T	0.03094	4.05	2.48	-3.91	0.04168	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01320	0.0043	M	0.76574	2.34	0.09310	N	1	B	0.16603	0.018	B	0.08055	0.003	T	0.46162	-0.9211	9	0.49607	T	0.09	.	0.8342	0.01137	0.1605:0.2025:0.3256:0.3114	.	52	O76002	OR2J2_HUMAN	M	52	ENSP00000366372:V52M	ENSP00000366372:V52M	V	+	1	0	OR2J2	29249545	0.000000	0.05858	0.715000	0.30552	0.395000	0.30598	-5.759000	0.00100	-0.577000	0.05967	-1.087000	0.02190	GTG	OR2J2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000204700		0.453	OR2J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2J2	HGNC	protein_coding	OTTHUMT00000076131.2		0.00	46	0	G			29141566	+1			no_errors	ENST00000377167	ensembl	human	known	74_37	missense	5.66	50	3	SNP	0.002	A
OR4D9	390199	genome.wustl.edu	37	11	59282609	59282609	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:59282609C>T	ENST00000329328.3	+	1	224	c.224C>T	c.(223-225)tCc>tTc	p.S75F		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	75						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						TGCTTTTCCTCCATCACAGCT	0.458																																																	0													173.0	164.0	167.0					11																	59282609		2201	4295	6496	SO:0001583	missense	0			AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.224C>T	11.37:g.59282609C>T	ENSP00000328563:p.Ser75Phe		Q6IFF3	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S75F	ENST00000329328.3	37	c.224	CCDS31564.1	11	.	.	.	.	.	.	.	.	.	.	C	12.93	2.086299	0.36855	.	.	ENSG00000172742	ENST00000329328	T	0.00408	7.54	4.02	3.01	0.34805	GPCR, rhodopsin-like superfamily (1);	0.200907	0.24700	U	0.036312	T	0.00524	0.0017	M	0.73962	2.25	0.25942	N	0.982867	B	0.25169	0.119	B	0.30316	0.114	T	0.26292	-1.0107	10	0.87932	D	0	.	12.0265	0.53373	0.0:0.8242:0.1758:0.0	.	75	Q8NGE8	OR4D9_HUMAN	F	75	ENSP00000328563:S75F	ENSP00000328563:S75F	S	+	2	0	OR4D9	59039185	0.000000	0.05858	0.993000	0.49108	0.881000	0.50899	1.263000	0.33004	1.931000	0.55961	0.462000	0.41574	TCC	OR4D9	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000172742		0.458	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D9	HGNC	protein_coding	OTTHUMT00000394237.1	-	0.00	59	0	C	NM_001004711		59282609	+1	tier1	-	no_errors	ENST00000329328	ensembl	human	known	74_37	missense	28.24	61	24	SNP	0.992	T
OR4K14	122740	genome.wustl.edu	37	14	20483328	20483328	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:20483328C>T	ENST00000305045.2	-	1	24	c.25G>A	c.(25-27)Gtg>Atg	p.V9M		NM_001004712.1	NP_001004712.1	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K, member 14	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(20)|skin(6)	37	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		AATTCTGACACCAAGGAATAG	0.383																																																	0													44.0	45.0	45.0					14																	20483328		2177	4286	6463	SO:0001583	missense	0				CCDS32027.1	14q11.2	2013-09-23			ENSG00000169484	ENSG00000169484		"""GPCR / Class A : Olfactory receptors"""	15352	protein-coding gene	gene with protein product							Standard	NM_001004712		Approved		uc010tky.2	Q8NGD5	OTTHUMG00000170780	ENST00000305045.2:c.25G>A	14.37:g.20483328C>T	ENSP00000305011:p.Val9Met		Q6IEU1|Q96R71	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V9M	ENST00000305045.2	37	c.25	CCDS32027.1	14	.	.	.	.	.	.	.	.	.	.	.	9.801	1.180501	0.21787	.	.	ENSG00000169484	ENST00000305045	T	0.00892	5.57	4.15	3.25	0.37280	.	0.000000	0.34676	N	0.003763	T	0.02230	0.0069	M	0.86740	2.835	0.23309	N	0.997932	P	0.50819	0.939	B	0.42555	0.391	T	0.35871	-0.9771	10	0.72032	D	0.01	.	9.1035	0.36683	0.2182:0.7818:0.0:0.0	.	9	Q8NGD5	OR4KE_HUMAN	M	9	ENSP00000305011:V9M	ENSP00000305011:V9M	V	-	1	0	OR4K14	19553168	0.138000	0.22547	0.683000	0.30040	0.034000	0.12701	1.246000	0.32803	0.928000	0.37168	0.603000	0.83216	GTG	OR4K14	-	NULL	ENSG00000169484		0.383	OR4K14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K14	HGNC	protein_coding	OTTHUMT00000410343.1	-	0.00	27	0	C			20483328	-1	tier1	-	no_errors	ENST00000305045	ensembl	human	known	74_37	missense	39.53	26	17	SNP	0.878	T
OR51A7	119687	genome.wustl.edu	37	11	4928760	4928760	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:4928760C>T	ENST00000359350.4	+	1	161	c.161C>T	c.(160-162)tCg>tTg	p.S54L	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004749.1	NP_001004749.1	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A, member 7	54						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(7)|lung(13)|ovary(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACAGAGCCCTCGCTTCATGAG	0.493																																																	0													173.0	153.0	160.0					11																	4928760		2201	4298	6499	SO:0001583	missense	0			AB065525	CCDS31364.1	11p15.4	2012-08-09			ENSG00000176895	ENSG00000176895		"""GPCR / Class A : Olfactory receptors"""	15188	protein-coding gene	gene with protein product							Standard	NM_001004749		Approved		uc010qyq.2	Q8NH64	OTTHUMG00000066502	ENST00000359350.4:c.161C>T	11.37:g.4928760C>T	ENSP00000352305:p.Ser54Leu		Q6IFH8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_Olfact_rcpt,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.S54L	ENST00000359350.4	37	c.161	CCDS31364.1	11	.	.	.	.	.	.	.	.	.	.	c	5.501	0.277452	0.10403	.	.	ENSG00000176895	ENST00000359350;ENST00000545959;ENST00000544684	T	0.00441	7.41	5.02	1.99	0.26369	GPCR, rhodopsin-like superfamily (1);	0.364747	0.20148	N	0.098228	T	0.00637	0.0021	M	0.91354	3.2	0.09310	N	1	P	0.42203	0.773	B	0.44085	0.44	T	0.39272	-0.9622	10	0.87932	D	0	.	4.3909	0.11339	0.1089:0.5469:0.1988:0.1454	.	54	Q8NH64	O51A7_HUMAN	L	54;54;43	ENSP00000352305:S54L	ENSP00000352305:S54L	S	+	2	0	OR51A7	4885336	0.000000	0.05858	0.200000	0.23457	0.031000	0.12232	0.205000	0.17356	0.318000	0.23185	-1.733000	0.00692	TCG	OR51A7	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM	ENSG00000176895		0.493	OR51A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A7	HGNC	protein_coding	OTTHUMT00000142175.1	-	0.00	59	0	C	NM_001004749		4928760	+1	tier1	-	no_errors	ENST00000359350	ensembl	human	known	74_37	missense	33.33	30	15	SNP	0.000	T
OR5AU1	390445	genome.wustl.edu	37	14	21623201	21623201	+	Silent	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:21623201G>T	ENST00000304418.3	-	1	1021	c.984C>A	c.(982-984)atC>atA	p.I328I		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	328						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		CCACTGTGTAGATGACAGCAA	0.488																																																	0													111.0	105.0	107.0					14																	21623201		2203	4300	6503	SO:0001819	synonymous_variant	0			AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.984C>A	14.37:g.21623201G>T			B2RP78|Q6IEU2|Q96R10	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I328	ENST00000304418.3	37	c.984	CCDS32042.1	14																																																																																			OR5AU1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	ENSG00000169327		0.488	OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AU1	HGNC	protein_coding	OTTHUMT00000410213.1	-	0.00	49	0	G			21623201	-1	tier1	-	no_errors	ENST00000304418	ensembl	human	known	74_37	silent	28.30	38	15	SNP	0.989	T
OTUD7B	56957	genome.wustl.edu	37	1	149922096	149922096	+	Nonsense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:149922096C>A	ENST00000369135.4	-	8	1168	c.874G>T	c.(874-876)Gag>Tag	p.E292*		NM_020205.2	NP_064590.2	Q6GQQ9	OTU7B_HUMAN	OTU deubiquitinase 7B	292	Catalytic.|OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.|TRAF-binding.				mucosal immune response (GO:0002385)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|DNA binding (GO:0003677)|Lys48-specific deubiquitinase activity (GO:1990380)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.E292*(1)		breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(18)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)			TCAAGGCTCTCATATACAGGC	0.527																																																	1	Substitution - Nonsense(1)	upper_aerodigestive_tract(1)											66.0	66.0	66.0					1																	149922096		1969	4164	6133	SO:0001587	stop_gained	0			AJ293573	CCDS72903.1	1q21.2	2014-02-24	2014-02-24	2006-07-07	ENSG00000163113	ENSG00000264522		"""OTU domain containing"""	16683	protein-coding gene	gene with protein product		611748	"""zinc finger, A20 domain containing 1"", ""OTU domain containing 7B"""	ZA20D1		11463333, 23827681	Standard	NM_020205		Approved	CEZANNE	uc001etn.3	Q6GQQ9	OTTHUMG00000012291	ENST00000369135.4:c.874G>T	1.37:g.149922096C>A	ENSP00000358131:p.Glu292*		B7Z643|D3DUZ8|Q5SZ60|Q8WWA7|Q9NQ53|Q9UFF4	Nonsense_Mutation	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.E292*	ENST00000369135.4	37	c.874	CCDS41389.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.842964	0.97016	.	.	ENSG00000163113	ENST00000369135;ENST00000543330;ENST00000417191	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-12.8015	17.52	0.87784	0.0:1.0:0.0:0.0	.	.	.	.	X	292	.	.	E	-	1	0	OTUD7B	148188720	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.254000	0.78329	2.612000	0.88384	0.655000	0.94253	GAG	OTUD7B	-	pfam_OTU,pfscan_OTU	ENSG00000163113		0.527	OTUD7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7B	HGNC	protein_coding	OTTHUMT00000034146.3		0.00	34	0	C	NM_020205		149922096	-1			no_errors	ENST00000369135	ensembl	human	known	74_37	nonsense	7.14	26	2	SNP	1.000	A
PAH	5053	genome.wustl.edu	37	12	103238176	103238176	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:103238176T>C	ENST00000553106.1	-	10	1475	c.1003A>G	c.(1003-1005)Aaa>Gaa	p.K335E	PAH_ENST00000307000.2_Missense_Mutation_p.K330E	NM_000277.1	NP_000268.1	P00439	PH4H_HUMAN	phenylalanine hydroxylase	335					catecholamine biosynthetic process (GO:0042423)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|neurotransmitter biosynthetic process (GO:0042136)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|phenylalanine 4-monooxygenase activity (GO:0004505)			endometrium(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(5)|skin(2)|urinary_tract(1)	27					Droxidopa(DB06262)|Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	TCTCCTTGTTTGCAGAGCCCA	0.423																																																	0													98.0	89.0	92.0					12																	103238176		2203	4300	6503	SO:0001583	missense	0			U49897	CCDS9092.1	12q22-q24.2	2010-04-27				ENSG00000171759	1.14.16.1		8582	protein-coding gene	gene with protein product	"""phenylalanine 4-monooxygenase"""	612349				2063869	Standard	NM_000277		Approved	PH	uc001tjq.1	P00439		ENST00000553106.1:c.1003A>G	12.37:g.103238176T>C	ENSP00000448059:p.Lys335Glu		Q16717|Q8TC14	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,prints_Aromatic-AA_hydroxylase_C,tigrfam_Phe-4-hydroxylase_tetra	p.K335E	ENST00000553106.1	37	c.1003	CCDS9092.1	12	.	.	.	.	.	.	.	.	.	.	T	21.6	4.166179	0.78339	.	.	ENSG00000171759	ENST00000553106;ENST00000307000	D;D	0.99683	-6.39;-6.39	5.81	5.81	0.92471	Aromatic amino acid hydroxylase, C-terminal (3);	0.042652	0.85682	D	0.000000	D	0.99013	0.9663	L	0.58428	1.81	0.80722	D	1	B	0.19583	0.037	B	0.23018	0.043	D	0.98241	1.0488	10	0.62326	D	0.03	-27.7423	16.1623	0.81730	0.0:0.0:0.0:1.0	.	335	P00439	PH4H_HUMAN	E	335;330	ENSP00000448059:K335E;ENSP00000303500:K330E	ENSP00000303500:K330E	K	-	1	0	PAH	101762306	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.883000	0.87264	2.223000	0.72356	0.533000	0.62120	AAA	PAH	-	pfam_Aromatic-AA_hydroxylase_C,superfamily_Aromatic-AA_hydroxylase_C,pirsf_Tyrosine_3-monooxygenase-like,tigrfam_Phe-4-hydroxylase_tetra	ENSG00000171759		0.423	PAH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAH	HGNC	protein_coding	OTTHUMT00000406692.1	-	0.00	79	0	T			103238176	-1	tier1	-	no_errors	ENST00000553106	ensembl	human	known	74_37	missense	24.32	56	18	SNP	1.000	C
PARD3	56288	genome.wustl.edu	37	10	34400148	34400148	+	Silent	SNP	C	C	T	rs533880946		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:34400148C>T	ENST00000374789.3	-	25	4345	c.4020G>A	c.(4018-4020)gcG>gcA	p.A1340A	PARD3_ENST00000350537.4_Silent_p.A1294A|PARD3_ENST00000545260.1_Silent_p.A1250A|PARD3_ENST00000545693.1_Silent_p.A1324A|PARD3_ENST00000374794.3_Silent_p.A1228A|PARD3_ENST00000374790.3_Silent_p.A1280A|PARD3_ENST00000374788.3_Silent_p.A1337A|PARD3_ENST00000346874.4_Silent_p.A1303A	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	1340					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				TGTTCAGCCTCGCAACCTGAG	0.537																																																	0													47.0	52.0	50.0					10																	34400148		2203	4300	6503	SO:0001819	synonymous_variant	0			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.4020G>A	10.37:g.34400148C>T			F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Silent	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A1340	ENST00000374789.3	37	c.4020	CCDS7178.1	10																																																																																			PARD3	-	NULL	ENSG00000148498		0.537	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD3	HGNC	protein_coding	OTTHUMT00000047527.1	-	0.00	47	0	C	NM_019619		34400148	-1	tier1	-	no_errors	ENST00000374789	ensembl	human	known	74_37	silent	13.43	58	9	SNP	0.576	T
PARD3	56288	genome.wustl.edu	37	10	34649188	34649188	+	Splice_Site	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:34649188C>G	ENST00000374789.3	-	13	2033		c.e13-1		PARD3_ENST00000340077.5_Splice_Site|PARD3_ENST00000350537.4_Splice_Site|PARD3_ENST00000545260.1_Splice_Site|PARD3_ENST00000545693.1_Splice_Site|PARD3_ENST00000374776.1_Splice_Site|PARD3_ENST00000544292.1_Splice_Site|PARD3_ENST00000374794.3_Splice_Site|PARD3_ENST00000374768.1_Splice_Site|PARD3_ENST00000374790.3_Splice_Site|PARD3_ENST00000374773.1_Splice_Site|PARD3_ENST00000374788.3_Splice_Site|PARD3_ENST00000346874.4_Splice_Site	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator						apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				CTTCTGCTTTCTAATAGGGAA	0.388																																																	0													87.0	78.0	81.0					10																	34649188		2203	4300	6503	SO:0001630	splice_region_variant	0			AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.1708-1G>C	10.37:g.34649188C>G			F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Splice_Site	SNP	-	e13-1	ENST00000374789.3	37	c.1708-1	CCDS7178.1	10	.	.	.	.	.	.	.	.	.	.	C	22.7	4.327469	0.81690	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790;ENST00000374776;ENST00000340077;ENST00000374773;ENST00000544292;ENST00000374768	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0951	0.97834	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PARD3	34689194	1.000000	0.71417	0.998000	0.56505	0.929000	0.56500	7.487000	0.81328	2.753000	0.94483	0.467000	0.42956	.	PARD3	-	-	ENSG00000148498		0.388	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PARD3	HGNC	protein_coding	OTTHUMT00000047527.1	-	0.00	22	0	C	NM_019619	Intron	34649188	-1	tier1	-	no_errors	ENST00000374789	ensembl	human	known	74_37	splice_site	14.71	29	5	SNP	1.000	G
PAX1	5075	genome.wustl.edu	37	20	21686544	21686544	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr20:21686544G>A	ENST00000398485.2	+	1	248	c.194G>A	c.(193-195)gGc>gAc	p.G65D	PAX1_ENST00000444366.2_5'Flank|PAX1_ENST00000460221.1_Intron	NM_001257096.1|NM_006192.4	NP_001244025.1|NP_006183.2	P15863	PAX1_HUMAN	paired box 1	65					bone morphogenesis (GO:0060349)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell proliferation (GO:0008283)|parathyroid gland development (GO:0060017)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sclerotome development (GO:0061056)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|thymus development (GO:0048538)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(21)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	38						CGCGGCGGCGGCGGCGCCCAA	0.806																																																	0													1.0	1.0	1.0					20																	21686544		52	160	212	SO:0001583	missense	0				CCDS13146.2, CCDS74709.1	20p11.22	2007-07-12	2007-07-12		ENSG00000125813	ENSG00000125813		"""Paired boxes"""	8615	protein-coding gene	gene with protein product		167411	"""paired box gene 1"""			1358810	Standard	NM_006192		Approved		uc002wsj.3	P15863	OTTHUMG00000032034	ENST00000398485.2:c.194G>A	20.37:g.21686544G>A	ENSP00000381499:p.Gly65Asp		B4E0D6|Q642X9|Q6NTC0|Q9Y558	Missense_Mutation	SNP	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	p.G65D	ENST00000398485.2	37	c.194	CCDS13146.2	20	.	.	.	.	.	.	.	.	.	.	G	9.336	1.061757	0.19987	.	.	ENSG00000125813	ENST00000398485	D	0.97352	-4.35	4.1	2.02	0.26589	.	.	.	.	.	D	0.89884	0.6844	N	0.08118	0	0.58432	D	0.999999	B	0.06786	0.001	B	0.04013	0.001	D	0.83738	0.0202	9	0.87932	D	0	.	4.1006	0.10012	0.252:0.2657:0.4823:0.0	.	65	P15863	PAX1_HUMAN	D	65	ENSP00000381499:G65D	ENSP00000381499:G65D	G	+	2	0	PAX1	21634544	0.000000	0.05858	1.000000	0.80357	0.368000	0.29767	0.005000	0.13129	0.710000	0.31997	-0.707000	0.03653	GGC	PAX1	-	NULL	ENSG00000125813		0.806	PAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAX1	HGNC	protein_coding	OTTHUMT00000078282.3	-	0.00	24	0	G			21686544	+1	tier1	-	no_errors	ENST00000398485	ensembl	human	known	74_37	missense	27.78	13	5	SNP	0.931	A
PAX4	5078	genome.wustl.edu	37	7	127255145	127255145	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:127255145G>T	ENST00000341640.2	-	2	330	c.125C>A	c.(124-126)tCt>tAt	p.S42Y	PAX4_ENST00000338516.3_Missense_Mutation_p.S50Y|PAX4_ENST00000463946.1_Missense_Mutation_p.S40Y|PAX4_ENST00000378740.2_Missense_Mutation_p.S42Y	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	50	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						ACAGCCATTAGATACCTGAGT	0.562																																					Ovarian(113;737 1605 7858 27720 34092)												0													62.0	58.0	60.0					7																	127255145		2203	4300	6503	SO:0001583	missense	0				CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.125C>A	7.37:g.127255145G>T	ENSP00000339906:p.Ser42Tyr		O95161|Q6B0H0	Missense_Mutation	SNP	pfam_Paired_dom,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeobox_dom,pfscan_Homeobox_dom,pfscan_Paired_dom,prints_Paired_dom	p.S42Y	ENST00000341640.2	37	c.125	CCDS5797.1	7	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881010	0.91740	.	.	ENSG00000106331	ENST00000341640;ENST00000338516;ENST00000378740;ENST00000463946	D;D;D	0.99701	-6.45;-6.45;-6.28	5.73	5.73	0.89815	Paired box protein, N-terminal (5);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99782	0.9909	M	0.92077	3.27	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.97317	0.9941	10	0.87932	D	0	.	17.4002	0.87458	0.0:0.0:1.0:0.0	.	42;40;50;40	O43316-4;Q1W386;O43316;G3V4Q1	.;.;PAX4_HUMAN;.	Y	42;50;50;40	ENSP00000339906:S42Y;ENSP00000344297:S50Y;ENSP00000451923:S40Y	ENSP00000344297:S50Y	S	-	2	0	PAX4	127042381	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.689000	0.98673	2.693000	0.91896	0.655000	0.94253	TCT	PAX4	-	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom	ENSG00000106331		0.562	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	HGNC	protein_coding	OTTHUMT00000349165.1		0.00	24	0	G			127255145	-1			no_errors	ENST00000341640	ensembl	human	known	74_37	missense	8.57	32	3	SNP	1.000	T
PBX1	5087	genome.wustl.edu	37	1	164789343	164789343	+	Silent	SNP	A	A	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:164789343A>T	ENST00000420696.2	+	7	1220	c.1032A>T	c.(1030-1032)ggA>ggT	p.G344G	PBX1_ENST00000560641.1_Silent_p.G239G|PBX1_ENST00000540246.1_Silent_p.G239G|PBX1_ENST00000401534.1_Intron|PBX1_ENST00000559240.1_Intron|PBX1_ENST00000367897.1_Intron|PBX1_ENST00000540236.1_Silent_p.G344G	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	344					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						CAAACTCTGGAGATTTGTTCA	0.488			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																			Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	0													86.0	85.0	85.0					1																	164789343		2203	4300	6503	SO:0001819	synonymous_variant	0			M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.1032A>T	1.37:g.164789343A>T			B4DSC1|F5H4U9|Q5T488	Silent	SNP	pfam_PBX,pfam_Homeobox_dom,superfamily_Homeodomain-like,smart_Homeobox_dom,pfscan_Homeobox_dom	p.G344	ENST00000420696.2	37	c.1032	CCDS1246.1	1																																																																																			PBX1	-	NULL	ENSG00000185630		0.488	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PBX1	HGNC	protein_coding	OTTHUMT00000082864.4	-	0.00	72	0	A	NM_002585		164789343	+1	tier1	-	no_errors	ENST00000420696	ensembl	human	known	74_37	silent	15.09	45	8	SNP	1.000	T
PCDH10	57575	genome.wustl.edu	37	4	134072089	134072089	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:134072089C>A	ENST00000264360.5	+	1	1620	c.794C>A	c.(793-795)cCa>cAa	p.P265Q	RP11-9G1.3_ENST00000505289.1_lincRNA	NM_032961.1	NP_116586.1	Q9P2E7	PCD10_HUMAN	protocadherin 10	265	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(30)|liver(1)|lung(72)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(2)	136				LUSC - Lung squamous cell carcinoma(193;0.227)		AACTCTCCCCCAGGCACTCTC	0.627																																																	0													89.0	88.0	88.0					4																	134072089		2203	4300	6503	SO:0001583	missense	0			AB037821	CCDS34063.1, CCDS75192.1	4q28.3	2010-01-26				ENSG00000138650		"""Cadherins / Protocadherins : Non-clustered"""	13404	protein-coding gene	gene with protein product		608286				10835267	Standard	NM_020815		Approved	OL-PCDH, KIAA1400	uc003iha.3	Q9P2E7		ENST00000264360.5:c.794C>A	4.37:g.134072089C>A	ENSP00000264360:p.Pro265Gln		Q4W5F6|Q96SF0	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P265Q	ENST00000264360.5	37	c.794	CCDS34063.1	4	.	.	.	.	.	.	.	.	.	.	C	0.718	-0.784617	0.02907	.	.	ENSG00000138650	ENST00000264360;ENST00000394248	T	0.41400	1.0	4.29	4.29	0.51040	Cadherin (4);Cadherin-like (1);	0.000000	0.43579	D	0.000548	T	0.53753	0.1816	M	0.69185	2.1	0.41594	D	0.988811	D;B	0.61080	0.989;0.033	P;B	0.55055	0.767;0.102	T	0.52351	-0.8587	10	0.19147	T	0.46	.	16.5992	0.84807	0.0:1.0:0.0:0.0	.	265;265	Q9P2E7;Q96SF0	PCD10_HUMAN;.	Q	265	ENSP00000264360:P265Q	ENSP00000264360:P265Q	P	+	2	0	PCDH10	134291539	0.986000	0.35501	0.871000	0.34182	0.220000	0.24768	3.685000	0.54678	2.202000	0.70862	0.505000	0.49811	CCA	PCDH10	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000138650		0.627	PCDH10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PCDH10	HGNC	protein_coding	OTTHUMT00000364457.2	-	0.00	35	0	C	NM_032961		134072089	+1	tier1	-	no_errors	ENST00000264360	ensembl	human	known	74_37	missense	31.03	20	9	SNP	0.982	A
PCDHA7	56141	genome.wustl.edu	37	5	140214165	140214165	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:140214165C>T	ENST00000525929.1	+	1	197	c.197C>T	c.(196-198)gCg>gTg	p.A66V	PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.A66V|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	66	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGTTCCGGGCGGTGTGCAAA	0.617																																					NSCLC(160;258 2013 5070 22440 28951)												0													84.0	102.0	96.0					5																	140214165		2203	4300	6503	SO:0001583	missense	0			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.197C>T	5.37:g.140214165C>T	ENSP00000436426:p.Ala66Val		O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A66V	ENST00000525929.1	37	c.197	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.605859	0.00842	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.19938	2.11;2.11	4.17	0.291	0.15732	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.03871	0.0109	N	0.00226	-1.805	0.22511	N	0.999038	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.40776	-0.9545	9	0.02654	T	1	.	10.1587	0.42838	0.0:0.1593:0.0:0.8407	.	66;66	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	V	66	ENSP00000436426:A66V;ENSP00000367365:A66V	ENSP00000367365:A66V	A	+	2	0	PCDHA7	140194349	0.300000	0.24435	0.998000	0.56505	0.148000	0.21650	3.486000	0.53215	0.121000	0.18284	-1.817000	0.00601	GCG	PCDHA7	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin	ENSG00000204963		0.617	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	-	0.00	129	0	C	NM_018910		140214165	+1	tier1	-	no_errors	ENST00000525929	ensembl	human	known	74_37	missense	17.04	112	23	SNP	0.996	T
PCDHAC2	56134	genome.wustl.edu	37	5	140347393	140347393	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:140347393C>G	ENST00000289269.5	+	1	1574	c.1042C>G	c.(1042-1044)Cac>Gac	p.H348D	PCDHA11_ENST00000398640.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA13_ENST00000289272.2_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	348	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CATGGCAGGTCACTGCAAGGT	0.582																																					Melanoma(190;638 2083 3390 11909 52360)												0													61.0	54.0	57.0					5																	140347393		2203	4300	6503	SO:0001583	missense	0			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1042C>G	5.37:g.140347393C>G	ENSP00000289269:p.His348Asp		Q2M3V1|Q9Y5F4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.H348D	ENST00000289269.5	37	c.1042	CCDS4242.1	5	.	.	.	.	.	.	.	.	.	.	C	16.11	3.029882	0.54790	.	.	ENSG00000243232	ENST00000289269	T	0.50548	0.74	5.87	5.0	0.66597	Cadherin (5);Cadherin-like (1);	0.000000	0.44285	D	0.000466	T	0.63510	0.2517	M	0.68728	2.09	0.54753	D	0.999984	P;D	0.63880	0.915;0.993	P;P	0.60236	0.614;0.871	T	0.67887	-0.5554	10	0.72032	D	0.01	.	14.7371	0.69424	0.0:0.9309:0.0:0.0691	.	348;348	Q9Y5I4-2;Q9Y5I4	.;PCDC2_HUMAN	D	348	ENSP00000289269:H348D	ENSP00000289269:H348D	H	+	1	0	PCDHAC2	140327577	0.978000	0.34361	0.999000	0.59377	0.998000	0.95712	2.407000	0.44565	1.486000	0.48398	0.655000	0.94253	CAC	PCDHAC2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000243232		0.582	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	HGNC	protein_coding	OTTHUMT00000251802.2	-	0.00	38	0	C	NM_018899		140347393	+1	tier1	-	no_errors	ENST00000289269	ensembl	human	known	74_37	missense	10.53	34	4	SNP	1.000	G
PDE5A	8654	genome.wustl.edu	37	4	120528239	120528239	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:120528239C>T	ENST00000354960.3	-	2	685	c.366G>A	c.(364-366)gtG>gtA	p.V122V	PDE5A_ENST00000264805.5_Silent_p.V80V|PDE5A_ENST00000394439.1_Silent_p.V70V	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	122					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	AGAGGAAGCTCACAGTTCCCT	0.483																																																	0													96.0	92.0	94.0					4																	120528239		2203	4300	6503	SO:0001819	synonymous_variant	0			D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.366G>A	4.37:g.120528239C>T			A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.V122	ENST00000354960.3	37	c.366	CCDS3713.1	4																																																																																			PDE5A	-	NULL	ENSG00000138735		0.483	PDE5A-001	KNOWN	basic|CCDS	protein_coding	PDE5A	HGNC	protein_coding	OTTHUMT00000256529.1	-	0.00	54	0	C	NM_001083		120528239	-1	tier1	-	no_errors	ENST00000354960	ensembl	human	known	74_37	silent	29.69	45	19	SNP	1.000	T
PER1	5187	genome.wustl.edu	37	17	8046067	8046067	+	Silent	SNP	G	G	A	rs148594937	byFrequency	TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:8046067G>A	ENST00000317276.4	-	20	3396	c.3159C>T	c.(3157-3159)tcC>tcT	p.S1053S	PER1_ENST00000578089.1_5'Flank|PER1_ENST00000581082.1_Silent_p.S1030S	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	1053	Ser-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						AGCCTGTGCCGGAGCGCGAGT	0.647			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																																Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	0								G		0,4406		0,0,2203	46.0	52.0	50.0		3159	-9.3	0.5	17	dbSNP_134	50	5,8595	4.3+/-15.6	0,5,4295	no	coding-synonymous	PER1	NM_002616.2		0,5,6498	AA,AG,GG		0.0581,0.0,0.0384		1053/1291	8046067	5,13001	2203	4300	6503	SO:0001819	synonymous_variant	0			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.3159C>T	17.37:g.8046067G>A			B2RPA8|B4DI49|D3DTR3	Silent	SNP	pfam_Period_circadian-like_C,pfam_PAS_fold_3,superfamily_PAS,smart_PAS,pfscan_PAS	p.S1053	ENST00000317276.4	37	c.3159	CCDS11131.1	17																																																																																			PER1	-	pfam_Period_circadian-like_C	ENSG00000179094		0.647	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER1	HGNC	protein_coding	OTTHUMT00000441481.2	-	0.00	62	0	G			8046067	-1	tier1	rs148594937	no_errors	ENST00000317276	ensembl	human	known	74_37	silent	26.09	51	18	SNP	0.147	A
PGLYRP4	57115	genome.wustl.edu	37	1	153314237	153314237	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:153314237G>A	ENST00000359650.5	-	6	555	c.491C>T	c.(490-492)gCt>gTt	p.A164V	PGLYRP4_ENST00000368739.3_Missense_Mutation_p.A160V	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	164					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			CGACAGGGCAGCAGGGCTGGG	0.542																																																	0													90.0	89.0	89.0					1																	153314237		2203	4300	6503	SO:0001583	missense	0			AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.491C>T	1.37:g.153314237G>A	ENSP00000352672:p.Ala164Val		A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Missense_Mutation	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.A164V	ENST00000359650.5	37	c.491	CCDS30871.1	1	.	.	.	.	.	.	.	.	.	.	G	11.91	1.779154	0.31502	.	.	ENSG00000163218	ENST00000368739;ENST00000359650	T;T	0.20200	2.09;2.09	4.2	1.14	0.20703	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (4);	0.691156	0.12513	N	0.462315	T	0.07234	0.0183	L	0.55990	1.75	0.21719	N	0.999576	B;B	0.26400	0.122;0.148	B;B	0.34590	0.117;0.186	T	0.43327	-0.9398	10	0.29301	T	0.29	-45.5771	3.0718	0.06233	0.2394:0.0:0.549:0.2116	.	160;164	Q96LB8-2;Q96LB8	.;PGRP4_HUMAN	V	160;164	ENSP00000357728:A160V;ENSP00000352672:A164V	ENSP00000352672:A164V	A	-	2	0	PGLYRP4	151580861	0.000000	0.05858	0.820000	0.32676	0.801000	0.45260	0.277000	0.18734	0.044000	0.15775	-0.293000	0.09583	GCT	PGLYRP4	-	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	ENSG00000163218		0.542	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGLYRP4	HGNC	protein_coding	OTTHUMT00000089978.1	-	0.00	51	0	G	NM_020393		153314237	-1	tier1	-	no_errors	ENST00000359650	ensembl	human	known	74_37	missense	8.89	41	4	SNP	0.902	A
PGLYRP4	57115	genome.wustl.edu	37	1	153317794	153317794	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:153317794G>C	ENST00000359650.5	-	4	268	c.204C>G	c.(202-204)tgC>tgG	p.C68W	PGLYRP4_ENST00000368739.3_Missense_Mutation_p.C64W|PGLYRP4_ENST00000490266.1_5'UTR	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	68					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.C68C(1)|p.C68S(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCTGAATACTGCAGCCAACAG	0.587																																																	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)											149.0	116.0	127.0					1																	153317794		2203	4300	6503	SO:0001583	missense	0			AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.204C>G	1.37:g.153317794G>C	ENSP00000352672:p.Cys68Trp		A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Missense_Mutation	SNP	pfam_Amidase_domain,superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	p.C68W	ENST00000359650.5	37	c.204	CCDS30871.1	1	.	.	.	.	.	.	.	.	.	.	G	11.71	1.720286	0.30503	.	.	ENSG00000163218	ENST00000368739;ENST00000359650	T;T	0.22539	1.95;1.95	3.2	1.25	0.21368	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (3);	.	.	.	.	T	0.23965	0.0580	M	0.64630	1.985	0.35500	D	0.799737	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.07121	-1.0789	9	0.72032	D	0.01	0.0485	5.514	0.16896	0.275:0.0:0.725:0.0	.	64;68	Q96LB8-2;Q96LB8	.;PGRP4_HUMAN	W	64;68	ENSP00000357728:C64W;ENSP00000352672:C68W	ENSP00000352672:C68W	C	-	3	2	PGLYRP4	151584418	0.672000	0.27530	0.099000	0.21106	0.806000	0.45545	1.035000	0.30216	0.205000	0.20568	0.313000	0.20887	TGC	PGLYRP4	-	superfamily_Amidase_domain,smart_PGRP_domain_met/bac,smart_Amidase_domain	ENSG00000163218		0.587	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PGLYRP4	HGNC	protein_coding	OTTHUMT00000089978.1	-	0.00	37	0	G	NM_020393		153317794	-1	tier1	-	no_errors	ENST00000359650	ensembl	human	known	74_37	missense	7.84	47	4	SNP	0.481	C
PGS1	9489	genome.wustl.edu	37	17	76415780	76415780	+	Intron	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:76415780C>A	ENST00000262764.6	+	9	1707				PGS1_ENST00000588281.1_3'UTR|PGS1_ENST00000329897.7_3'UTR	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			CATCACCTCTCAGCACGATTT	0.527																																					Esophageal Squamous(45;182 1126 10685 43198)												0													56.0	61.0	60.0					17																	76415780		2173	4251	6424	SO:0001627	intron_variant	0				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.1668+24C>A	17.37:g.76415780C>A			B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	RNA	SNP	-	NULL	ENST00000262764.6	37	NULL	CCDS42391.1	17																																																																																			PGS1	-	-	ENSG00000087157		0.527	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGS1	HGNC	protein_coding	OTTHUMT00000437301.1	-	0.00	38	0	C	NM_024419		76415780	+1	tier1	-	no_errors	ENST00000588281	ensembl	human	known	74_37	rna	17.95	32	7	SNP	0.000	A
PHKA2	5256	genome.wustl.edu	37	X	18936848	18936848	+	Silent	SNP	C	C	T	rs151240321		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chrX:18936848C>T	ENST00000379942.4	-	19	2753	c.2088G>A	c.(2086-2088)acG>acA	p.T696T		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	696					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GTATGTCCCGCGTGGAGTGGA	0.423																																																	0								C		0,3835		0,0,0,1632,571	118.0	103.0	108.0		2088	-1.1	1.0	X	dbSNP_134	108	2,6726		0,1,1,2427,1871	no	coding-synonymous	PHKA2	NM_000292.2		0,1,1,4059,2442	TT,TC,T,CC,C		0.0297,0.0,0.0189		696/1236	18936848	2,10561	2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2088G>A	X.37:g.18936848C>T			A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Silent	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.T696	ENST00000379942.4	37	c.2088	CCDS14190.1	X																																																																																			PHKA2	-	pfam_Glyco_hydro_15	ENSG00000044446		0.423	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	-	0.00	39	0	C	NM_000292		18936848	-1	tier1	rs151240321	no_errors	ENST00000379942	ensembl	human	known	74_37	silent	14.63	35	6	SNP	0.949	T
PI4KA	5297	genome.wustl.edu	37	22	21067673	21067673	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr22:21067673G>A	ENST00000572273.1	-	48	5523	c.5293C>T	c.(5293-5295)Cgg>Tgg	p.R1765W	PI4KA_ENST00000414196.3_Missense_Mutation_p.R575W|PI4KA_ENST00000255882.6_Missense_Mutation_p.R1823W			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1765	Pleckstrin homology (PH) domain conferring phosphoinositide binding specificity. {ECO:0000250}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GAGCGGCACCGCAGACCTGCC	0.637																																					GBM(136;1332 1831 3115 23601 50806)												0													19.0	15.0	16.0					22																	21067673		2191	4284	6475	SO:0001583	missense	0			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.5293C>T	22.37:g.21067673G>A	ENSP00000458238:p.Arg1765Trp		Q7Z625|Q9UPG2	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.R1823W	ENST00000572273.1	37	c.5467		22	.	.	.	.	.	.	.	.	.	.	G	14.12	2.440753	0.43326	.	.	ENSG00000241973	ENST00000255882;ENST00000414196;ENST00000399213	T;D	0.81499	-1.08;-1.5	4.43	4.43	0.53597	Protein kinase-like domain (1);	0.467738	0.24134	N	0.041232	T	0.75236	0.3822	L	0.40543	1.245	0.41088	D	0.985573	P;D	0.56746	0.862;0.977	B;P	0.44860	0.339;0.462	T	0.79347	-0.1841	10	0.72032	D	0.01	-20.3997	12.6865	0.56949	0.0:0.0:0.835:0.1649	.	158;1765	A8MTF1;P42356	.;PI4KA_HUMAN	W	1765;575;158	ENSP00000402981:R575W;ENSP00000382162:R158W	ENSP00000255882:R1765W	R	-	1	2	PI4KA	19397673	1.000000	0.71417	1.000000	0.80357	0.568000	0.35870	4.247000	0.58750	2.460000	0.83146	0.544000	0.68410	CGG	PI4KA	-	superfamily_Kinase-like_dom	ENSG00000241973		0.637	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	PI4KA	HGNC	protein_coding			0.00	82	0	G	NM_058004		21067673	-1			no_errors	ENST00000255882	ensembl	human	known	74_37	missense	5.36	53	3	SNP	1.000	A
PIDD1	55367	genome.wustl.edu	37	11	804101	804101	+	Silent	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:804101G>T	ENST00000347755.5	-	2	429	c.288C>A	c.(286-288)gtC>gtA	p.V96V	PIDD_ENST00000411829.2_Silent_p.V96V|PIDD_ENST00000534649.1_5'UTR	NM_145886.3|NM_145887.3	NP_665893.2|NP_665894.2																					CACCTTTGAGGACCAGGGAGC	0.622																																																	0													55.0	39.0	45.0					11																	804101		2201	4298	6499	SO:0001819	synonymous_variant	0																														ENST00000347755.5:c.288C>A	11.37:g.804101G>T				Silent	SNP	pfam_Peptidase_S68_pidd,pfam_Death_domain,pfam_Leu-rich_rpt,pfam_ZU5,superfamily_DEATH-like_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Death_domain,pfscan_Death_domain,pfscan_ZU5	p.V96	ENST00000347755.5	37	c.288	CCDS7716.1	11																																																																																			PIDD	-	NULL	ENSG00000177595		0.622	PIDD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIDD	HGNC	protein_coding	OTTHUMT00000257103.1	-	0.00	57	0	G			804101	-1	tier1	-	no_errors	ENST00000347755	ensembl	human	known	74_37	silent	9.76	37	4	SNP	0.992	T
PIGO	84720	genome.wustl.edu	37	9	35094020	35094020	+	Splice_Site	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr9:35094020C>T	ENST00000378617.3	-	4	1051	c.657G>A	c.(655-657)atG>atA	p.M219I	PIGO_ENST00000341666.3_Splice_Site_p.M219I|RP11-182N22.8_ENST00000431804.1_RNA|PIGO_ENST00000361778.2_Splice_Site_p.M219I|PIGO_ENST00000492770.1_5'Flank|PIGO_ENST00000298004.5_Splice_Site_p.M219I	NM_032634.3	NP_116023.2	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class O	219					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(3)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)	38			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CACCACTGTCCACTGTGAAGG	0.552																																																	0													91.0	73.0	79.0					9																	35094020		2203	4300	6503	SO:0001630	splice_region_variant	0			AB083625	CCDS6575.1, CCDS6576.1	9p13.2	2013-02-26	2006-06-28		ENSG00000165282	ENSG00000165282		"""Phosphatidylinositol glycan anchor biosynthesis"""	23215	protein-coding gene	gene with protein product		614730	"""phosphatidylinositol glycan, class O"""			10781593	Standard	NM_032634		Approved	DKFZp434M222, FLJ00135	uc003zwd.3	Q8TEQ8	OTTHUMG00000019854	ENST00000378617.3:c.656-1G>A	9.37:g.35094020C>T			B1AML3|Q6P154|Q6UX80|Q8TDS8|Q96CS9|Q9BVN9|Q9Y4B0	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Metalloenzyme,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.M219I	ENST00000378617.3	37	c.657	CCDS6575.1	9	.	.	.	.	.	.	.	.	.	.	C	18.93	3.727350	0.69074	.	.	ENSG00000165282	ENST00000298004;ENST00000378617;ENST00000341666;ENST00000361778	T;T;T;T	0.26957	1.7;1.7;1.7;1.7	5.84	5.84	0.93424	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.281286	0.43260	D	0.000593	T	0.26882	0.0658	L	0.38733	1.17	0.80722	D	1	B;B	0.15141	0.012;0.003	B;B	0.20955	0.032;0.007	T	0.02263	-1.1186	10	0.48119	T	0.1	.	20.1379	0.98040	0.0:1.0:0.0:0.0	.	219;219	Q8TEQ8-2;Q8TEQ8	.;PIGO_HUMAN	I	219	ENSP00000298004:M219I;ENSP00000367880:M219I;ENSP00000339382:M219I;ENSP00000354678:M219I	ENSP00000298004:M219I	M	-	3	0	PIGO	35084020	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.960000	0.70348	2.779000	0.95612	0.655000	0.94253	ATG	PIGO	-	pfam_Phosphodiest/P_Trfase,pfam_Metalloenzyme,superfamily_Alkaline_phosphatase_core	ENSG00000165282		0.552	PIGO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGO	HGNC	protein_coding	OTTHUMT00000052284.1	-	0.00	40	0	C	NM_032634	Missense_Mutation	35094020	-1	tier1	-	no_errors	ENST00000341666	ensembl	human	known	74_37	missense	39.66	35	23	SNP	1.000	T
PIKFYVE	200576	genome.wustl.edu	37	2	209200537	209200537	+	Frame_Shift_Del	DEL	C	C	-			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:209200537delC	ENST00000264380.4	+	26	4435	c.4277delC	c.(4276-4278)gccfs	p.A1426fs	PIKFYVE_ENST00000474721.1_3'UTR	NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1426					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GTATATGTTGCCATTGATGAA	0.303																																																	0													75.0	79.0	78.0					2																	209200537		2203	4292	6495	SO:0001589	frameshift_variant	0			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.4277delC	2.37:g.209200537delC	ENSP00000264380:p.Ala1426fs		Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Frame_Shift_Del	DEL	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_GroEL-like_apical_dom,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.I1427fs	ENST00000264380.4	37	c.4277	CCDS2382.1	2																																																																																			PIKFYVE	-	NULL	ENSG00000115020		0.303	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2		0.00	50	0	C	NM_015040		209200537	+1	tier1		no_errors	ENST00000264380	ensembl	human	known	74_37	frame_shift_del	34.78	30	16	DEL	1.000	-
PLEKHA5	54477	genome.wustl.edu	37	12	19460013	19460013	+	Intron	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:19460013G>C	ENST00000299275.6	+	13	1851				PLEKHA5_ENST00000510738.2_3'UTR|PLEKHA5_ENST00000424268.1_Intron|PLEKHA5_ENST00000355397.3_Intron|PLEKHA5_ENST00000538714.1_Intron|PLEKHA5_ENST00000539256.1_Intron|PLEKHA5_ENST00000359180.3_Intron|PLEKHA5_ENST00000429027.2_Intron|PLEKHA5_ENST00000317589.4_Intron|PLEKHA5_ENST00000543806.1_Intron	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5						reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					TGTTGCCACAGATAGTTGCTG	0.507																																					Pancreas(196;329 2193 11246 14234 19524)												0																																										SO:0001627	intron_variant	0			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.1846-13483G>C	12.37:g.19460013G>C			A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	RNA	SNP	-	NULL	ENST00000299275.6	37	NULL	CCDS8682.1	12																																																																																			PLEKHA5	-	-	ENSG00000052126		0.507	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA5	HGNC	protein_coding	OTTHUMT00000397013.1	-	0.00	13	0	G	NM_019012		19460013	+1	tier1	-	no_errors	ENST00000510738	ensembl	human	known	74_37	rna	16.00	21	4	SNP	0.704	C
PLEKHA8P1	51054	genome.wustl.edu	37	12	45567215	45567215	+	RNA	SNP	C	C	A	rs147039982		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:45567215C>A	ENST00000256692.5	-	0	1470					NR_037144.1		O95397	PKHA9_HUMAN	pleckstrin homology domain containing, family A member 8 pseudogene 1							cytoplasm (GO:0005737)	glycolipid binding (GO:0051861)|glycolipid transporter activity (GO:0017089)			breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GTCTGGATATCCTTTTCCCCA	0.468																																																	0													101.0	99.0	99.0					12																	45567215		2203	4300	6503			0			AF103731		12q12	2010-11-24	2010-11-24	2010-11-24	ENSG00000134297	ENSG00000134297			30222	pseudogene	pseudogene	"""putative glycolipid transfer protein"""		"""pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 9"""	PLEKHA9		12477932	Standard	NR_037144		Approved	FLJ14156	uc001rom.2	O95397			12.37:g.45567215C>A				RNA	SNP	-	NULL	ENST00000256692.5	37	NULL		12																																																																																			PLEKHA8P1	-	-	ENSG00000134297		0.468	PLEKHA8P1-002	KNOWN	basic	processed_transcript	PLEKHA8P1	HGNC	pseudogene	OTTHUMT00000404814.1	-	0.00	60	0	C	NR_037144		45567215	-1	tier1	-	no_errors	ENST00000256692	ensembl	human	known	74_37	rna	8.82	62	6	SNP	0.997	A
POLE	5426	genome.wustl.edu	37	12	133219481	133219481	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:133219481G>A	ENST00000320574.5	-	36	4696	c.4653C>T	c.(4651-4653)caC>caT	p.H1551H	POLE_ENST00000535270.1_Silent_p.H1524H|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1551					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	CTTCGAAGGTGTGTTTGGGGG	0.607								DNA polymerases (catalytic subunits)																																									0													92.0	89.0	90.0					12																	133219481		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4653C>T	12.37:g.133219481G>A			Q13533|Q86VH9	Silent	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.H1551	ENST00000320574.5	37	c.4653	CCDS9278.1	12																																																																																			POLE	-	pfam_DNA_pol_e_suA_C	ENSG00000177084		0.607	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	-	0.00	25	0	G	NM_006231		133219481	-1	tier1	-	no_errors	ENST00000320574	ensembl	human	known	74_37	silent	44.44	15	12	SNP	0.980	A
POLG	5428	genome.wustl.edu	37	15	89862174	89862174	+	Silent	SNP	A	A	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr15:89862174A>T	ENST00000268124.5	-	20	3594	c.3261T>A	c.(3259-3261)gcT>gcA	p.A1087A	POLG_ENST00000442287.2_Silent_p.A1087A	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	1087					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			CTTCCTGGACAGCCGAGGGCT	0.572								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)												0													58.0	55.0	56.0					15																	89862174		2200	4299	6499	SO:0001819	synonymous_variant	0			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.3261T>A	15.37:g.89862174A>T			Q8NFM2|Q92515	Silent	SNP	pirsf_DNA-dir_DNA_pol_A_mt_sub,pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA-dir_DNA_pol_A_mt	p.A1087	ENST00000268124.5	37	c.3261	CCDS10350.1	15																																																																																			POLG	-	pirsf_DNA-dir_DNA_pol_A_mt_sub,pfam_DNA-dir_DNA_pol_A_palm_dom,smart_DNA-dir_DNA_pol_A_palm_dom	ENSG00000140521		0.572	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLG	HGNC	protein_coding	OTTHUMT00000312854.2	-	0.00	23	0	A	NM_002693		89862174	-1	tier1	-	no_errors	ENST00000268124	ensembl	human	known	74_37	silent	44.44	10	8	SNP	0.002	T
POLR3A	11128	genome.wustl.edu	37	10	79778932	79778932	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:79778932G>A	ENST00000372371.3	-	9	1414	c.1277C>T	c.(1276-1278)aCg>aTg	p.T426M	POLR3A_ENST00000484760.1_5'UTR	NM_007055.3	NP_008986.2	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide A, 155kDa	426					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|ribonucleoside binding (GO:0032549)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(3)|large_intestine(13)|lung(25)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)			TTTCATCTGCGTATGTCTCTG	0.428																																																	0													179.0	158.0	165.0					10																	79778932		2203	4300	6503	SO:0001583	missense	0			AF021351	CCDS7354.1	10q22-q23	2013-01-21			ENSG00000148606	ENSG00000148606		"""RNA polymerase subunits"""	30074	protein-coding gene	gene with protein product		614258				9331371, 12391170	Standard	NM_007055		Approved	RPC1, RPC155, hRPC155	uc001jzn.3	O14802	OTTHUMG00000018550	ENST00000372371.3:c.1277C>T	10.37:g.79778932G>A	ENSP00000361446:p.Thr426Met		Q8IW34|Q8TCW5	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,smart_RNA_pol_N	p.T426M	ENST00000372371.3	37	c.1277	CCDS7354.1	10	.	.	.	.	.	.	.	.	.	.	G	10.39	1.336080	0.24253	.	.	ENSG00000148606	ENST00000372371;ENST00000540842	T	0.68181	-0.31	5.64	-0.401	0.12407	RNA polymerase, alpha subunit (1);RNA polymerase, N-terminal (1);	0.365631	0.33515	N	0.004825	T	0.64349	0.2590	M	0.81341	2.54	0.21527	N	0.999651	B	0.27853	0.191	B	0.30572	0.117	T	0.57820	-0.7745	9	.	.	.	-5.7362	10.7207	0.46038	0.4491:0.0:0.5509:0.0	.	426	O14802	RPC1_HUMAN	M	426	ENSP00000361446:T426M	.	T	-	2	0	POLR3A	79448938	0.791000	0.28800	0.003000	0.11579	0.777000	0.43975	1.116000	0.31221	0.027000	0.15297	0.650000	0.86243	ACG	POLR3A	-	pfam_RNA_pol_asu,smart_RNA_pol_N	ENSG00000148606		0.428	POLR3A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3A	HGNC	protein_coding	OTTHUMT00000048923.1		0.00	40	0	G	NM_007055		79778932	-1			no_errors	ENST00000372371	ensembl	human	known	74_37	missense	6.45	29	2	SNP	0.004	A
PPM1D	8493	genome.wustl.edu	37	17	58740434	58740434	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:58740434G>T	ENST00000305921.3	+	6	1571	c.1339G>T	c.(1339-1341)Gag>Tag	p.E447*	RNU6-623P_ENST00000363143.1_RNA	NM_003620.3	NP_003611.1	O15297	PPM1D_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1D	447					G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of cell proliferation (GO:0008285)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)|response to bacterium (GO:0009617)|response to radiation (GO:0009314)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)	p.E447K(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	15	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;6.75e-12)|all cancers(12;1.96e-10)			TGCCTTCTCAGAGAATTTTTT	0.433											OREG0031485	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																																					1	Substitution - Missense(1)	skin(1)											100.0	100.0	100.0					17																	58740434		2203	4300	6503	SO:0001587	stop_gained	0			U78305	CCDS11625.1	17q23.3	2014-09-17	2010-03-05		ENSG00000170836	ENSG00000170836		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9277	protein-coding gene	gene with protein product	"""wild-type p53-induced phosphatase 1"", ""protein phosphatase 2C, delta isoform"""	605100	"""protein phosphatase 1D magnesium-dependent, delta isoform"""			9177166	Standard	NM_003620		Approved	Wip1, PP2C-DELTA	uc002iyt.2	O15297		ENST00000305921.3:c.1339G>T	17.37:g.58740434G>T	ENSP00000306682:p.Glu447*	1033	Q53XP4|Q6P991|Q8IVR6	Nonsense_Mutation	SNP	pfam_PP2C-like_dom,superfamily_PP2C-like_dom,smart_PP2C-like_dom	p.E447*	ENST00000305921.3	37	c.1339	CCDS11625.1	17	.	.	.	.	.	.	.	.	.	.	G	39	7.352756	0.98231	.	.	ENSG00000170836	ENST00000305921	.	.	.	6.08	6.08	0.98989	.	0.219106	0.48286	D	0.000199	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-23.029	9.6637	0.39972	0.0698:0.0:0.7885:0.1417	.	.	.	.	X	447	.	ENSP00000306682:E447X	E	+	1	0	PPM1D	56095216	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	4.741000	0.62095	2.894000	0.99253	0.591000	0.81541	GAG	PPM1D	-	NULL	ENSG00000170836		0.433	PPM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1D	HGNC	protein_coding	OTTHUMT00000449474.1		0.00	59	0	G	NM_003620		58740434	+1			no_errors	ENST00000305921	ensembl	human	known	74_37	nonsense	5.00	57	3	SNP	1.000	T
PPP1R13B	23368	genome.wustl.edu	37	14	104206306	104206306	+	Missense_Mutation	SNP	G	G	A	rs200606453		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:104206306G>A	ENST00000202556.9	-	12	2729	c.2447C>T	c.(2446-2448)cCg>cTg	p.P816L	PPP1R13B_ENST00000555391.1_5'UTR|PPP1R13B_ENST00000423488.2_Missense_Mutation_p.P235L	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B	816	Pro-rich.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				GTCCTCTGCCGGCTCGGCAGT	0.602																																																	0								G	LEU/PRO	1,4095		0,1,2047	39.0	46.0	44.0		2447	5.3	0.9	14		44	1,8387		0,1,4193	yes	missense	PPP1R13B	NM_015316.2	98	0,2,6240	AA,AG,GG		0.0119,0.0244,0.016	benign	816/1091	104206306	2,12482	2048	4194	6242	SO:0001583	missense	0			AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.2447C>T	14.37:g.104206306G>A	ENSP00000202556:p.Pro816Leu		B2RMX5|O94870	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SH3_domain,prints_SH3_domain	p.P816L	ENST00000202556.9	37	c.2447	CCDS41997.1	14	.	.	.	.	.	.	.	.	.	.	G	14.59	2.581333	0.46006	2.44E-4	1.19E-4	ENSG00000088808	ENST00000202556;ENST00000423488	T;T	0.55413	0.71;0.52	5.27	5.27	0.74061	.	0.227351	0.45606	D	0.000351	T	0.43144	0.1234	L	0.47716	1.5	0.58432	D	0.999999	P	0.42161	0.772	B	0.30943	0.122	T	0.40590	-0.9555	10	0.27082	T	0.32	.	18.2339	0.89944	0.0:0.0:1.0:0.0	.	816	Q96KQ4	ASPP1_HUMAN	L	816;235	ENSP00000202556:P816L;ENSP00000395213:P235L	ENSP00000202556:P816L	P	-	2	0	PPP1R13B	103276059	1.000000	0.71417	0.889000	0.34880	0.193000	0.23685	5.493000	0.66899	2.610000	0.88304	0.561000	0.74099	CCG	PPP1R13B	-	NULL	ENSG00000088808		0.602	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R13B	HGNC	protein_coding	OTTHUMT00000414591.1	-	0.00	31	0	G	NM_015316		104206306	-1	tier1	rs200606453	no_errors	ENST00000202556	ensembl	human	known	74_37	missense	10.81	33	4	SNP	0.989	A
PPP4C	5531	genome.wustl.edu	37	16	30092589	30092589	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:30092589G>T	ENST00000279387.7	+	3	276	c.108G>T	c.(106-108)ttG>ttT	p.L36F	PPP4C_ENST00000561610.1_Missense_Mutation_p.L36F	NM_002720.1	NP_002711.1	P60510	PP4C_HUMAN	protein phosphatase 4, catalytic subunit	36					dephosphorylation (GO:0016311)|NIK/NF-kappaB signaling (GO:0038061)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase 4 complex (GO:0030289)	metal ion binding (GO:0046872)|NF-kappaB-inducing kinase activity (GO:0004704)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|liver(2)|lung(2)|pancreas(1)|skin(1)|urinary_tract(1)	9						GAGAGATCTTGGTAGAGGAGA	0.582																																																	0													131.0	122.0	125.0					16																	30092589		2197	4300	6497	SO:0001583	missense	0				CCDS10669.1	16p11.2	2010-03-17	2010-03-05		ENSG00000149923	ENSG00000149923	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9319	protein-coding gene	gene with protein product	"""protein phosphatase X, catalytic subunit"""	602035	"""protein phosphatase 4 (formerly X), catalytic subunit"""			9177794	Standard	NM_002720		Approved	PP4, PPX	uc002dwf.3	P60510	OTTHUMG00000132113	ENST00000279387.7:c.108G>T	16.37:g.30092589G>T	ENSP00000279387:p.Leu36Phe		P33172	Missense_Mutation	SNP	pfam_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.L36F	ENST00000279387.7	37	c.108	CCDS10669.1	16	.	.	.	.	.	.	.	.	.	.	G	23.6	4.440303	0.83993	.	.	ENSG00000149923	ENST00000279387	T	0.68025	-0.3	5.82	4.77	0.60923	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	0.000000	0.64402	D	0.000001	T	0.80939	0.4720	M	0.77616	2.38	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	T	0.83221	-0.0068	10	0.72032	D	0.01	.	13.4772	0.61316	0.0823:0.0:0.9177:0.0	.	36	P60510	PP4C_HUMAN	F	36	ENSP00000279387:L36F	ENSP00000279387:L36F	L	+	3	2	PPP4C	30000090	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.608000	0.61141	1.305000	0.44909	0.655000	0.94253	TTG	PPP4C	-	smart_Ser/Thr-sp_prot-phosphatase	ENSG00000149923		0.582	PPP4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4C	HGNC	protein_coding	OTTHUMT00000255155.2		0.00	33	0	G	NM_002720		30092589	+1			no_errors	ENST00000279387	ensembl	human	known	74_37	missense	6.78	55	4	SNP	1.000	T
PRB2	653247	genome.wustl.edu	37	12	11546807	11546807	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:11546807G>C	ENST00000389362.4	-	3	240	c.205C>G	c.(205-207)Caa>Gaa	p.Q69E	PRB1_ENST00000546254.1_Intron|PRB2_ENST00000545829.1_5'Flank	NM_006248.3	NP_006239.3	P02812	PRB2_HUMAN	proline-rich protein BstNI subfamily 2	69	15 X 20 AA approximate tandem repeats of P-P-G-K-P-Q-G-P-P-P-Q-G-[GD]-[NKS]-[KSQ]- [PRS]-[QRS] [GPS]-[PSAR]-[PSR].					extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(5)|skin(4)|stomach(2)|urinary_tract(1)	37		all_cancers(2;0.00558)|Acute lymphoblastic leukemia(2;3.94e-11)|all_hematologic(2;3.6e-09)	OV - Ovarian serous cystadenocarcinoma(49;0.185)			GGGGGACCTTGAGGCTGGTTG	0.607																																																	0													125.0	141.0	136.0					12																	11546807		2164	4250	6414	SO:0001583	missense	0			K03208	CCDS41757.2	12p13.2	2012-10-02			ENSG00000121335	ENSG00000121335			9338	protein-coding gene	gene with protein product		168810				8554050	Standard	NM_006248		Approved	PRPPRB1, Ps, cP7	uc010shk.1	P02812	OTTHUMG00000156975	ENST00000389362.4:c.205C>G	12.37:g.11546807G>C	ENSP00000374013:p.Gln69Glu		O00599|P02811|P04281	Missense_Mutation	SNP	NULL	p.Q69E	ENST00000389362.4	37	c.205	CCDS41757.2	12	.	.	.	.	.	.	.	.	.	.	.	7.613	0.675282	0.14841	.	.	ENSG00000121335	ENST00000389362	T	0.04502	3.61	2.0	0.0115	0.14087	.	27.867600	0.00718	U	0.000874	T	0.04770	0.0129	L	0.53249	1.67	0.09310	N	1	P	0.41041	0.736	B	0.22152	0.038	T	0.46775	-0.9167	10	0.27082	T	0.32	.	6.5572	0.22466	0.0:0.0:0.3488:0.6512	.	69	P02812	PRB2_HUMAN	E	69	ENSP00000374013:Q69E	ENSP00000374013:Q69E	Q	-	1	0	PRB2	11438074	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.413000	0.07123	0.121000	0.18284	0.418000	0.28097	CAA	PRB2	-	NULL	ENSG00000121335		0.607	PRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRB2	HGNC	protein_coding	OTTHUMT00000346925.2	-	0.00	103	0	G	NM_006248		11546807	-1	tier1	-	no_errors	ENST00000389362	ensembl	human	known	74_37	missense	15.44	115	21	SNP	0.001	C
PRDM14	63978	genome.wustl.edu	37	8	70981446	70981446	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr8:70981446G>A	ENST00000276594.2	-	2	851	c.650C>T	c.(649-651)gCc>gTc	p.A217V		NM_024504.3	NP_078780.1	Q9GZV8	PRD14_HUMAN	PR domain containing 14	217					cell fate specification (GO:0001708)|cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|germ cell development (GO:0007281)|germ-line stem cell maintenance (GO:0030718)|histone H3-R26 methylation (GO:0034972)|homeostasis of number of cells within a tissue (GO:0048873)|inner cell mass cell fate commitment (GO:0001827)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|regulation of DNA methylation (GO:0044030)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(13)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Breast(64;0.193)		Epithelial(68;0.00508)|all cancers(69;0.0259)|OV - Ovarian serous cystadenocarcinoma(28;0.0405)			GTGCAGGCTGGCTGGGTGCTC	0.602																																					NSCLC(129;99 1813 5906 40656 46114)												0													77.0	81.0	79.0					8																	70981446		2203	4300	6503	SO:0001583	missense	0			AF319458	CCDS6206.1	8q13.3	2013-01-08			ENSG00000147596	ENSG00000147596		"""Zinc fingers, C2H2-type"""	14001	protein-coding gene	gene with protein product		611781					Standard	NM_024504		Approved		uc003xym.3	Q9GZV8	OTTHUMG00000150495	ENST00000276594.2:c.650C>T	8.37:g.70981446G>A	ENSP00000276594:p.Ala217Val		Q86UX9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2	p.A217V	ENST00000276594.2	37	c.650	CCDS6206.1	8	.	.	.	.	.	.	.	.	.	.	G	18.34	3.602157	0.66445	.	.	ENSG00000147596	ENST00000276594	T	0.11604	2.76	5.2	2.15	0.27550	.	0.719839	0.13245	N	0.402558	T	0.12475	0.0303	M	0.65975	2.015	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.19976	-1.0289	10	0.66056	D	0.02	-2.1385	6.4049	0.21658	0.1829:0.1477:0.6694:0.0	.	217	Q9GZV8	PRD14_HUMAN	V	217	ENSP00000276594:A217V	ENSP00000276594:A217V	A	-	2	0	PRDM14	71144000	0.012000	0.17670	0.002000	0.10522	0.608000	0.37181	1.264000	0.33015	0.690000	0.31570	0.655000	0.94253	GCC	PRDM14	-	NULL	ENSG00000147596		0.602	PRDM14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM14	HGNC	protein_coding	OTTHUMT00000318505.1		0.00	50	0	G			70981446	-1			no_errors	ENST00000276594	ensembl	human	known	74_37	missense	5.13	74	4	SNP	0.002	A
PRKRIP1	79706	genome.wustl.edu	37	7	102065491	102065491	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:102065491G>C	ENST00000496391.1	+	10	1798	c.488G>C	c.(487-489)aGc>aCc	p.S163T	RP11-514P8.2_ENST00000468165.1_RNA|PRKRIP1_ENST00000482465.1_3'UTR|PRKRIP1_ENST00000397912.3_Missense_Mutation_p.S163T|PRKRIP1_ENST00000354783.4_Missense_Mutation_p.Q103H|PRKRIP1_ENST00000462601.1_Missense_Mutation_p.S106T			Q9H875	PKRI1_HUMAN	PRKR interacting protein 1 (IL11 inducible)	163	Poly-Ser.				negative regulation of phosphorylation (GO:0042326)|negative regulation of protein kinase activity (GO:0006469)|renal system process (GO:0003014)	extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)			endometrium(1)|lung(4)|ovary(1)	6						CAGGGGTCCAGCAGCTCTGCG	0.552																																																	0													60.0	54.0	56.0					7																	102065491		2203	4300	6503	SO:0001583	missense	0			AK023964	CCDS34714.1	7q22.1	2013-01-09			ENSG00000128563	ENSG00000128563		"""Zinc fingers, C2H2-type"", ""-"""	21894	protein-coding gene	gene with protein product	"""likely ortholog of mouse C114 dsRNA-binding protein"", ""KRAB box domain containing 3"""					12679338	Standard	NM_024653		Approved	C114, FLJ13902, KRBOX3	uc003uzh.2	Q9H875	OTTHUMG00000157717	ENST00000496391.1:c.488G>C	7.37:g.102065491G>C	ENSP00000419270:p.Ser163Thr		B4DGM2|Q8NDM6|Q96CF8	Missense_Mutation	SNP	pfam_DUF1168	p.S163T	ENST00000496391.1	37	c.488	CCDS34714.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.917|9.917	1.211175|1.211175	0.22289|0.22289	.|.	.|.	ENSG00000128563|ENSG00000128563	ENST00000354783|ENST00000496391;ENST00000462601;ENST00000397912	T|T;T;T	0.47177|0.44482	0.85|0.92;0.92;0.92	3.3|3.3	3.3|3.3	0.37823|0.37823	.|.	.|0.977359	.|0.08451	.|N	.|0.943860	T|T	0.50377|0.50377	0.1612|0.1612	L|L	0.58101|0.58101	1.795|1.795	0.22424|0.22424	N|N	0.999118|0.999118	P|B;D	0.42123|0.53312	0.771|0.284;0.959	P|B;P	0.48114|0.51742	0.567|0.115;0.678	T|T	0.37009|0.37009	-0.9724|-0.9724	9|10	0.56958|0.26408	D|T	0.05|0.33	-37.453|-37.453	12.4081|12.4081	0.55451|0.55451	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	103|106;163	B4DGM2|E9PC43;Q9H875	.|.;PKRI1_HUMAN	H|T	103|163;106;163	ENSP00000346837:Q103H|ENSP00000419270:S163T;ENSP00000420136:S106T;ENSP00000381010:S163T	ENSP00000346837:Q103H|ENSP00000381010:S163T	Q|S	+|+	3|2	2|0	PRKRIP1|PRKRIP1	101852496|101852496	0.490000|0.490000	0.26012|0.26012	0.782000|0.782000	0.31804|0.31804	0.015000|0.015000	0.08874|0.08874	1.449000|1.449000	0.35123|0.35123	2.146000|2.146000	0.66826|0.66826	0.561000|0.561000	0.74099|0.74099	CAG|AGC	PRKRIP1	-	pfam_DUF1168	ENSG00000128563		0.552	PRKRIP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRKRIP1	HGNC	protein_coding	OTTHUMT00000349489.1	-	0.00	25	0	G	NM_024653		102065491	+1	tier1	-	no_errors	ENST00000397912	ensembl	human	known	74_37	missense	40.48	25	17	SNP	0.932	C
PRKRIP1	79706	genome.wustl.edu	37	7	102065493	102065493	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:102065493A>C	ENST00000496391.1	+	10	1800	c.490A>C	c.(490-492)Agc>Cgc	p.S164R	RP11-514P8.2_ENST00000468165.1_RNA|PRKRIP1_ENST00000482465.1_3'UTR|PRKRIP1_ENST00000397912.3_Missense_Mutation_p.S164R|PRKRIP1_ENST00000354783.4_Missense_Mutation_p.Q104P|PRKRIP1_ENST00000462601.1_Missense_Mutation_p.S107R			Q9H875	PKRI1_HUMAN	PRKR interacting protein 1 (IL11 inducible)	164	Poly-Ser.				negative regulation of phosphorylation (GO:0042326)|negative regulation of protein kinase activity (GO:0006469)|renal system process (GO:0003014)	extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)	double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)			endometrium(1)|lung(4)|ovary(1)	6						GGGGTCCAGCAGCTCTGCGGA	0.552																																																	0													59.0	53.0	55.0					7																	102065493		2203	4300	6503	SO:0001583	missense	0			AK023964	CCDS34714.1	7q22.1	2013-01-09			ENSG00000128563	ENSG00000128563		"""Zinc fingers, C2H2-type"", ""-"""	21894	protein-coding gene	gene with protein product	"""likely ortholog of mouse C114 dsRNA-binding protein"", ""KRAB box domain containing 3"""					12679338	Standard	NM_024653		Approved	C114, FLJ13902, KRBOX3	uc003uzh.2	Q9H875	OTTHUMG00000157717	ENST00000496391.1:c.490A>C	7.37:g.102065493A>C	ENSP00000419270:p.Ser164Arg		B4DGM2|Q8NDM6|Q96CF8	Missense_Mutation	SNP	pfam_DUF1168	p.S164R	ENST00000496391.1	37	c.490	CCDS34714.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	7.739|7.739	0.700811|0.700811	0.15172|0.15172	.|.	.|.	ENSG00000128563|ENSG00000128563	ENST00000354783|ENST00000496391;ENST00000462601;ENST00000397912	T|T;T;T	0.46451|0.43688	0.87|0.94;0.94;0.94	3.3|3.3	2.05|2.05	0.26809|0.26809	.|.	.|0.789213	.|0.12211	.|N	.|0.489320	T|T	0.35278|0.35278	0.0926|0.0926	L|L	0.50333|0.50333	1.59|1.59	0.21841|0.21841	N|N	0.999519|0.999519	P|P;P	0.45569|0.41748	0.861|0.761;0.57	B|B;B	0.29716|0.42386	0.106|0.378;0.386	T|T	0.13150|0.13150	-1.0520|-1.0520	9|10	0.39692|0.29301	T|T	0.17|0.29	-28.8083|-28.8083	4.9738|4.9738	0.14129|0.14129	0.7214:0.0:0.2786:0.0|0.7214:0.0:0.2786:0.0	.|.	104|107;164	B4DGM2|E9PC43;Q9H875	.|.;PKRI1_HUMAN	P|R	104|164;107;164	ENSP00000346837:Q104P|ENSP00000419270:S164R;ENSP00000420136:S107R;ENSP00000381010:S164R	ENSP00000346837:Q104P|ENSP00000381010:S164R	Q|S	+|+	2|1	0|0	PRKRIP1|PRKRIP1	101852498|101852498	0.967000|0.967000	0.33354|0.33354	0.920000|0.920000	0.36463|0.36463	0.027000|0.027000	0.11550|0.11550	1.988000|1.988000	0.40697|0.40697	0.577000|0.577000	0.29470|0.29470	0.459000|0.459000	0.35465|0.35465	CAG|AGC	PRKRIP1	-	pfam_DUF1168	ENSG00000128563		0.552	PRKRIP1-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRKRIP1	HGNC	protein_coding	OTTHUMT00000349489.1	-	0.00	25	0	A	NM_024653		102065493	+1	tier1	-	no_errors	ENST00000397912	ensembl	human	known	74_37	missense	41.86	25	18	SNP	0.963	C
PRRG3	79057	genome.wustl.edu	37	X	150869317	150869317	+	Missense_Mutation	SNP	C	C	T	rs143276868	byFrequency	TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chrX:150869317C>T	ENST00000370353.3	+	4	898	c.508C>T	c.(508-510)Cgg>Tgg	p.R170W	PRRG3_ENST00000538575.1_Missense_Mutation_p.R170W			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	170						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					GACCACAGTCCGGCTAGAGAG	0.667																																																	0								C	TRP/ARG	1,3833		0,1,0,1631,570	40.0	33.0	35.0		508	2.8	0.1	X	dbSNP_134	35	2,6725		0,1,1,2427,1870	no	missense	PRRG3	NM_024082.3	101	0,2,1,4058,2440	TT,TC,T,CC,C		0.0297,0.0261,0.0284	possibly-damaging	170/232	150869317	3,10558	2202	4299	6501	SO:0001583	missense	0			AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.508C>T	X.37:g.150869317C>T	ENSP00000359378:p.Arg170Trp		A1A523|A1A575|Q8N2N6	Missense_Mutation	SNP	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain,prints_GLA_domain	p.R170W	ENST00000370353.3	37	c.508	CCDS14699.1	X	.	.	.	.	.	.	.	.	.	.	C	6.429	0.447371	0.12223	2.61E-4	2.97E-4	ENSG00000130032	ENST00000538575;ENST00000370353	D;D	0.98280	-4.84;-4.84	3.75	2.85	0.33270	.	0.855021	0.10316	N	0.689375	D	0.94255	0.8155	N	0.22421	0.69	0.09310	N	1	D	0.69078	0.997	B	0.43575	0.424	D	0.89565	0.3809	9	.	.	.	-15.8375	3.737	0.08514	0.2554:0.6144:0.0:0.1302	.	170	Q9BZD7	TMG3_HUMAN	W	170	ENSP00000440217:R170W;ENSP00000359378:R170W	.	R	+	1	2	PRRG3	150619973	0.000000	0.05858	0.095000	0.20976	0.090000	0.18270	0.247000	0.18179	0.905000	0.36596	0.523000	0.50628	CGG	PRRG3	-	NULL	ENSG00000130032		0.667	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG3	HGNC	protein_coding	OTTHUMT00000060880.1	-	0.00	47	0	C	NM_024082		150869317	+1	tier1	rs143276868	no_errors	ENST00000370353	ensembl	human	known	74_37	missense	14.06	55	9	SNP	0.005	T
PTENP1	11191	genome.wustl.edu	37	9	33674344	33674344	+	RNA	DEL	T	T	-	rs76928302|rs200594180		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr9:33674344delT	ENST00000532280.1	-	0	3153					NR_023917.1				phosphatase and tensin homolog pseudogene 1 (functional)																		TTCTATGTTCTTTTTTTTTTT	0.269																																																	0																																												0			AF023139, BC038293, BY797336		9p13.3	2014-09-11	2014-01-16		ENSG00000237984	ENSG00000237984		"""-"""	9589	pseudogene	pseudogene		613531	"""phosphatase and tensin homolog pseudogene 1"""			9393738, 9620558	Standard	NR_023917		Approved	PTEN2, psiPTEN, PTH2, PTEN-rs, PTENpg1	uc003zth.4		OTTHUMG00000000410		9.37:g.33674344delT				RNA	DEL	-	NULL	ENST00000532280.1	37	NULL		9																																																																																			PTENP1	-	-	ENSG00000237984		0.269	PTENP1-002	KNOWN	basic	processed_transcript	PTENP1	HGNC	pseudogene	OTTHUMT00000395145.1		0.00	15	0	T	NR_023917		33674344	-1	tier1		no_errors	ENST00000532280	ensembl	human	known	74_37	rna	17.65	14	3	DEL	0.837	-
PTGIR	5739	genome.wustl.edu	37	19	47127434	47127434	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:47127434G>T	ENST00000291294.2	-	2	182	c.49C>A	c.(49-51)Ccg>Acg	p.P17T	PTGIR_ENST00000597185.1_Intron|PTGIR_ENST00000598865.1_Intron|PTGIR_ENST00000594275.1_Intron|PTGIR_ENST00000596260.1_Missense_Mutation_p.P17T	NM_000960.3	NP_000951.1	P43119	PI2R_HUMAN	prostaglandin I2 (prostacyclin) receptor (IP)	17					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of GTPase activity (GO:0043547)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	13		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000327)|all cancers(93;0.000641)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0331)	Dinoprost Tromethamine(DB01160)|Epoprostenol(DB01240)|Iloprost(DB01088)|Treprostinil(DB00374)	CTGGTGGCCGGCCCCACCGAG	0.721																																																	0													5.0	3.0	4.0					19																	47127434		1679	3462	5141	SO:0001583	missense	0				CCDS12686.1	19q13.3	2012-08-08				ENSG00000160013		"""GPCR / Class A : Prostanoid receptors"""	9602	protein-coding gene	gene with protein product		600022				7759114	Standard	NM_000960		Approved	IP	uc002pex.3	P43119		ENST00000291294.2:c.49C>A	19.37:g.47127434G>T	ENSP00000291294:p.Pro17Thr			Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Prostglndn_IP_rcpt,prints_Prostanoid_rcpt,prints_Thbox_rcpt	p.P17T	ENST00000291294.2	37	c.49	CCDS12686.1	19	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170423	0.78452	.	.	ENSG00000160013	ENST00000291294	T	0.11063	2.81	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	T	0.33235	0.0856	M	0.78456	2.415	0.54753	D	0.999983	D	0.89917	1.0	D	0.91635	0.999	T	0.03673	-1.1014	10	0.41790	T	0.15	-9.3516	14.872	0.70465	0.0:0.0:1.0:0.0	.	17	P43119	PI2R_HUMAN	T	17	ENSP00000291294:P17T	ENSP00000291294:P17T	P	-	1	0	PTGIR	51819274	0.999000	0.42202	0.998000	0.56505	0.994000	0.84299	4.103000	0.57783	2.367000	0.80283	0.491000	0.48974	CCG	PTGIR	-	prints_Prostglndn_IP_rcpt	ENSG00000160013		0.721	PTGIR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGIR	HGNC	protein_coding	OTTHUMT00000466581.1		0.00	22	0	G			47127434	-1			no_errors	ENST00000291294	ensembl	human	known	74_37	missense	12.50	28	4	SNP	0.996	T
PTK7	5754	genome.wustl.edu	37	6	43098368	43098368	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:43098368G>A	ENST00000230419.4	+	5	1002	c.781G>A	c.(781-783)Gag>Aag	p.E261K	PTK7_ENST00000352931.2_Missense_Mutation_p.E261K|PTK7_ENST00000349241.2_Missense_Mutation_p.E261K|PTK7_ENST00000471863.1_Missense_Mutation_p.E261K|PTK7_ENST00000481273.1_Missense_Mutation_p.E269K|PTK7_ENST00000345201.2_Missense_Mutation_p.E261K	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7	261	Ig-like C2-type 3.				actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E261K(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GTGGCTCTTTGAGGATGAGAC	0.582																																																	1	Substitution - Missense(1)	NS(1)											93.0	78.0	83.0					6																	43098368		2203	4300	6503	SO:0001583	missense	0			AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.781G>A	6.37:g.43098368G>A	ENSP00000230419:p.Glu261Lys		A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Immunoglobulin,pfam_Prot_kinase_dom,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E261K	ENST00000230419.4	37	c.781	CCDS4884.1	6	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436657	0.62955	.	.	ENSG00000112655	ENST00000230419;ENST00000471863;ENST00000349241;ENST00000352931;ENST00000345201;ENST00000481273;ENST00000419972;ENST00000481946	T;T;T;T;T;T;T	0.66638	4.81;4.81;4.81;-0.22;-0.22;4.81;4.81	5.68	5.68	0.88126	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.69949	0.3168	L	0.45051	1.395	0.80722	D	1	B;D;D;D;D;D	0.63046	0.392;0.984;0.986;0.968;0.974;0.992	B;P;D;P;P;D	0.70227	0.262;0.888;0.917;0.79;0.81;0.968	T	0.62623	-0.6815	10	0.21014	T	0.42	.	19.798	0.96494	0.0:0.0:1.0:0.0	.	269;261;261;261;261;261	E9PFZ5;Q13308-3;Q13308-2;Q13308-4;Q13308;Q86X91	.;.;.;.;PTK7_HUMAN;.	K	261;261;261;261;261;269;269;14	ENSP00000230419:E261K;ENSP00000419037:E261K;ENSP00000325462:E261K;ENSP00000326029:E261K;ENSP00000325992:E261K;ENSP00000418754:E269K;ENSP00000420165:E14K	ENSP00000230418:E261K	E	+	1	0	PTK7	43206346	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.106000	0.89555	2.677000	0.91161	0.563000	0.77884	GAG	PTK7	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	ENSG00000112655		0.582	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK7	HGNC	protein_coding	OTTHUMT00000040580.2	-	0.00	33	0	G			43098368	+1	tier1	-	no_errors	ENST00000230419	ensembl	human	known	74_37	missense	17.86	23	5	SNP	1.000	A
PTPRN	5798	genome.wustl.edu	37	2	220161025	220161025	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:220161025G>T	ENST00000295718.2	-	18	2671	c.2431C>A	c.(2431-2433)Ccg>Acg	p.P811T	PTPRN_ENST00000409251.3_Missense_Mutation_p.P782T|PTPRN_ENST00000497977.1_5'UTR|AC114803.3_ENST00000417355.1_RNA|MIR153-1_ENST00000384914.1_RNA|PTPRN_ENST00000423636.2_Missense_Mutation_p.P721T	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	811	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		TCCACCAGCGGGGTCAGCATG	0.612																																																	0													143.0	123.0	130.0					2																	220161025		2203	4300	6503	SO:0001583	missense	0				CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.2431C>A	2.37:g.220161025G>T	ENSP00000295718:p.Pro811Thr		B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.P811T	ENST00000295718.2	37	c.2431	CCDS2440.1	2	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015727	0.54468	.	.	ENSG00000054356	ENST00000409251;ENST00000295718;ENST00000539342;ENST00000537666	T;T;T	0.13196	2.61;2.61;2.61	4.66	4.66	0.58398	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.065461	0.64402	D	0.000007	T	0.22322	0.0538	N	0.13198	0.31	0.58432	D	0.999995	D;P	0.65815	0.995;0.544	D;B	0.69824	0.966;0.408	T	0.12837	-1.0532	10	0.62326	D	0.03	.	17.7136	0.88328	0.0:0.0:1.0:0.0	.	782;811	Q6NSL1;Q16849	.;PTPRN_HUMAN	T	782;811;782;721	ENSP00000386638:P782T;ENSP00000295718:P811T;ENSP00000444244:P721T	ENSP00000295718:P811T	P	-	1	0	PTPRN	219869269	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.490000	0.66881	2.575000	0.86900	0.655000	0.94253	CCG	PTPRN	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000054356		0.612	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRN	HGNC	protein_coding	OTTHUMT00000256819.2		0.00	23	0	G			220161025	-1			no_errors	ENST00000295718	ensembl	human	known	74_37	missense	6.45	29	2	SNP	1.000	T
PTPRN	5798	genome.wustl.edu	37	2	220164085	220164085	+	Silent	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:220164085G>C	ENST00000295718.2	-	11	1785	c.1545C>G	c.(1543-1545)acC>acG	p.T515T	PTPRN_ENST00000409251.3_Silent_p.T486T|PTPRN_ENST00000497977.1_5'Flank|AC114803.3_ENST00000417355.1_RNA|PTPRN_ENST00000423636.2_Silent_p.T425T	NM_002846.3	NP_002837.1	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	515					cytokine-mediated signaling pathway (GO:0019221)|peptidyl-tyrosine dephosphorylation (GO:0035335)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to insulin (GO:0032868)|response to reactive oxygen species (GO:0000302)	integral component of plasma membrane (GO:0005887)	spectrin binding (GO:0030507)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(28)|ovary(3)|prostate(4)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		GGATGCGGAAGGTGAGGGCTG	0.567											OREG0015221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													149.0	142.0	144.0					2																	220164085		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS2440.1, CCDS56167.1, CCDS56168.1	2q35-q36.1	2011-06-09			ENSG00000054356	ENSG00000054356		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9676	protein-coding gene	gene with protein product		601773				8024693	Standard	NM_001199763		Approved	IA-2	uc002vkz.3	Q16849	OTTHUMG00000133129	ENST00000295718.2:c.1545C>G	2.37:g.220164085G>C		2264	B4DK12|F5GZS3|Q08319|Q53QD6|Q6NSL1	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.T515	ENST00000295718.2	37	c.1545	CCDS2440.1	2																																																																																			PTPRN	-	pfam_Receptor_IA-2	ENSG00000054356		0.567	PTPRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRN	HGNC	protein_coding	OTTHUMT00000256819.2	-	0.00	33	0	G			220164085	-1	tier1	-	no_errors	ENST00000295718	ensembl	human	known	74_37	silent	12.50	35	5	SNP	1.000	C
PTPRT	11122	genome.wustl.edu	37	20	41514563	41514563	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr20:41514563G>A	ENST00000373187.1	-	2	97	c.98C>T	c.(97-99)tCc>tTc	p.S33F	PTPRT_ENST00000373184.1_Missense_Mutation_p.S33F|PTPRT_ENST00000356100.2_Missense_Mutation_p.S33F|PTPRT_ENST00000485499.1_5'UTR|PTPRT_ENST00000373190.1_Missense_Mutation_p.S33F|PTPRT_ENST00000373193.3_Missense_Mutation_p.S33F|PTPRT_ENST00000373198.4_Missense_Mutation_p.S33F|PTPRT_ENST00000373201.1_Missense_Mutation_p.S33F			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	33	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				CTCATCAAAGGAACAGCCACC	0.478																																																	0													94.0	89.0	91.0					20																	41514563		1946	4128	6074	SO:0001583	missense	0			AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.98C>T	20.37:g.41514563G>A	ENSP00000362283:p.Ser33Phe		A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-sp_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like_dom,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.S33F	ENST00000373187.1	37	c.98	CCDS42874.1	20	.	.	.	.	.	.	.	.	.	.	G	19.51	3.840916	0.71488	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.02301	4.35;4.35;4.35;4.35;4.35;4.35;4.35	5.73	5.73	0.89815	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.069166	0.56097	D	0.000035	T	0.05868	0.0153	L	0.46157	1.445	0.47994	D	0.999565	P;P	0.44690	0.809;0.841	B;P	0.46940	0.397;0.532	T	0.15407	-1.0438	10	0.87932	D	0	.	19.5572	0.95357	0.0:0.0:1.0:0.0	.	33;33	O14522-1;O14522	.;PTPRT_HUMAN	F	33	ENSP00000362286:S33F;ENSP00000362283:S33F;ENSP00000362289:S33F;ENSP00000348408:S33F;ENSP00000362294:S33F;ENSP00000362280:S33F;ENSP00000362297:S33F	ENSP00000348408:S33F	S	-	2	0	PTPRT	40947977	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.268000	0.95675	2.713000	0.92767	0.456000	0.33151	TCC	PTPRT	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl_sf,smart_MAM_dom,pfscan_MAM_dom	ENSG00000196090		0.478	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRT	HGNC	protein_coding	OTTHUMT00000080315.1	-	0.00	45	0	G			41514563	-1	tier1	-	no_errors	ENST00000373198	ensembl	human	known	74_37	missense	21.79	61	17	SNP	1.000	A
PURA	5813	genome.wustl.edu	37	5	139494603	139494603	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:139494603G>A	ENST00000331327.3	+	1	896	c.837G>A	c.(835-837)aaG>aaA	p.K279K		NM_005859.4	NP_005850.1	Q00577	PURA_HUMAN	purine-rich element binding protein A	279					DNA replication initiation (GO:0006270)|DNA unwinding involved in DNA replication (GO:0006268)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|DNA replication factor A complex (GO:0005662)|neuronal cell body (GO:0043025)|nuclear chromosome, telomeric region (GO:0000784)|nucleus (GO:0005634)	double-stranded telomeric DNA binding (GO:0003691)|poly(A) RNA binding (GO:0044822)|purine-rich negative regulatory element binding (GO:0032422)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|single-stranded DNA binding (GO:0003697)|transcription factor binding (GO:0008134)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(1)|lung(2)|ovary(1)|prostate(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGAGATGAAGAAGATTCAAG	0.587																																																	0													56.0	55.0	55.0					5																	139494603		2203	4300	6503	SO:0001819	synonymous_variant	0			BC036087	CCDS4220.1	5q31	2008-02-05			ENSG00000185129	ENSG00000185129			9701	protein-coding gene	gene with protein product		600473				1448097	Standard	NM_005859		Approved	PURALPHA, PUR1, PUR-ALPHA	uc003lfa.3	Q00577	OTTHUMG00000129242	ENST00000331327.3:c.837G>A	5.37:g.139494603G>A				Silent	SNP	pfam_PUR_DNA_RNA-bd,smart_PUR_DNA_RNA-bd	p.K279	ENST00000331327.3	37	c.837	CCDS4220.1	5																																																																																			PURA	-	smart_PUR_DNA_RNA-bd	ENSG00000185129		0.587	PURA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PURA	HGNC	protein_coding	OTTHUMT00000251341.3	-	0.00	31	0	G	NM_005859		139494603	+1	tier1	-	no_errors	ENST00000331327	ensembl	human	known	74_37	silent	14.29	24	4	SNP	1.000	A
RANBP3	8498	genome.wustl.edu	37	19	5921258	5921258	+	Silent	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:5921258G>C	ENST00000340578.6	-	14	1341	c.1284C>G	c.(1282-1284)ctC>ctG	p.L428L	RANBP3_ENST00000034275.8_Silent_p.L360L|RANBP3_ENST00000439268.2_Silent_p.L423L|RANBP3_ENST00000591092.1_Silent_p.L355L|RANBP3_ENST00000541471.1_Silent_p.L300L	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	428	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CCATGTCATTGAGTCTGAGCA	0.637																																																	0													55.0	62.0	60.0					19																	5921258		1994	4167	6161	SO:0001819	synonymous_variant	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1284C>G	19.37:g.5921258G>C			B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.L428	ENST00000340578.6	37	c.1284	CCDS42478.1	19																																																																																			RANBP3	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000031823		0.637	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1	-	0.00	47	0	G	NM_007322		5921258	-1	tier1	-	no_errors	ENST00000340578	ensembl	human	known	74_37	silent	12.00	43	6	SNP	1.000	C
FDX1L	112812	genome.wustl.edu	37	19	10428177	10428177	+	5'Flank	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:10428177C>T	ENST00000393708.3	-	0	0				CTD-2369P2.10_ENST00000452032.2_5'Flank|CTD-2369P2.12_ENST00000586529.1_Missense_Mutation_p.G143S|FDX1L_ENST00000541276.1_5'Flank|RAVER1_ENST00000293677.6_Missense_Mutation_p.G742S|FDX1L_ENST00000492239.1_5'Flank|FDX1L_ENST00000494368.1_5'Flank	NM_001031734.2	NP_001026904.1	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like						oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)			NS(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)			TAGTGGCCGCCGAGGCCCTGG	0.622																																																	0													46.0	51.0	49.0					19																	10428177		2058	4196	6254	SO:0001631	upstream_gene_variant	0			AK097022	CCDS32905.1	19p13.2	2012-10-09			ENSG00000267673	ENSG00000267673			30546	protein-coding gene	gene with protein product		614585				12477932	Standard	NM_001031734		Approved	MGC19604	uc002mny.1	Q6P4F2	OTTHUMG00000141299		19.37:g.10428177C>T	Exception_encountered		Q8N8B8	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G742S	ENST00000393708.3	37	c.2224	CCDS32905.1	19	.	.	.	.	.	.	.	.	.	.	C	34	5.333862	0.95758	.	.	ENSG00000161847	ENST00000293677	T	0.44083	0.93	5.01	5.01	0.66863	.	0.683100	0.13253	N	0.401909	T	0.63745	0.2537	M	0.63843	1.955	0.54753	D	0.999985	D	0.89917	1.0	D	0.87578	0.998	T	0.63659	-0.6587	10	0.72032	D	0.01	-8.5941	15.7941	0.78394	0.0:1.0:0.0:0.0	.	742	E9PAU2	.	S	742	ENSP00000293677:G742S	ENSP00000293677:G742S	G	-	1	0	RAVER1	10289177	1.000000	0.71417	0.594000	0.28785	0.990000	0.78478	6.402000	0.73260	2.323000	0.78572	0.561000	0.74099	GGC	RAVER1	-	NULL	ENSG00000161847		0.622	FDX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAVER1	HGNC	protein_coding	OTTHUMT00000280567.2		0.00	95	0	C			10428177	-1			no_errors	ENST00000293677	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.994	T
RBKS	64080	genome.wustl.edu	37	2	28065945	28065945	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:28065945C>G	ENST00000302188.3	-	5	1255	c.503G>C	c.(502-504)cGc>cCc	p.R168P	RBKS_ENST00000444339.2_Missense_Mutation_p.R168P	NM_022128.1	NP_071411.1	Q9H477	RBSK_HUMAN	ribokinase	168					D-ribose catabolic process (GO:0019303)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ribokinase activity (GO:0004747)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	7	Acute lymphoblastic leukemia(172;0.155)					TCCACTCCTGCGGGCCATTGT	0.403																																																	0													71.0	72.0	72.0					2																	28065945		2203	4300	6503	SO:0001583	missense	0			BC017425	CCDS1762.1	2p23.3	2008-02-05			ENSG00000171174	ENSG00000171174	2.7.1.15		30325	protein-coding gene	gene with protein product		611132				8382990	Standard	NM_022128		Approved	DKFZp686G13268, RBSK	uc002rlo.1	Q9H477	OTTHUMG00000097833	ENST00000302188.3:c.503G>C	2.37:g.28065945C>G	ENSP00000306817:p.Arg168Pro		A9UK04|B4DV96	Missense_Mutation	SNP	pfam_PfkB_dom,pfam_HMP-P_kinase-1,prints_Ribokinase,tigrfam_D_ribokin_bac	p.R168P	ENST00000302188.3	37	c.503	CCDS1762.1	2	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434155	0.62955	.	.	ENSG00000171174	ENST00000302188;ENST00000444339	T;T	0.78003	-1.14;-1.14	5.87	-0.375	0.12509	Carbohydrate/purine kinase (1);	0.185954	0.64402	D	0.000020	D	0.85084	0.5616	M	0.83384	2.64	0.80722	D	1	D;D	0.69078	0.997;0.974	D;P	0.63793	0.918;0.846	D	0.83923	0.0302	10	0.66056	D	0.02	-1.8892	10.8855	0.46964	0.0:0.5305:0.0:0.4695	.	168;168	B4DV96;Q9H477	.;RBSK_HUMAN	P	168	ENSP00000306817:R168P;ENSP00000413232:R168P	ENSP00000306817:R168P	R	-	2	0	RBKS	27919449	0.016000	0.18221	0.677000	0.29947	0.946000	0.59487	-1.122000	0.03267	-0.287000	0.09064	-0.782000	0.03352	CGC	RBKS	-	pfam_PfkB_dom,tigrfam_D_ribokin_bac	ENSG00000171174		0.403	RBKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBKS	HGNC	protein_coding	OTTHUMT00000215118.1	-	0.00	76	0	C	NM_022128		28065945	-1	tier1	-	no_errors	ENST00000302188	ensembl	human	known	74_37	missense	21.52	62	17	SNP	0.963	G
RBM19	9904	genome.wustl.edu	37	12	114397134	114397134	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:114397134C>T	ENST00000545145.2	-	5	532	c.454G>A	c.(454-456)Gat>Aat	p.D152N	RBM19_ENST00000261741.5_Missense_Mutation_p.D152N|RBM19_ENST00000392561.3_Missense_Mutation_p.D152N	NM_001146699.1	NP_001140171.1	Q9Y4C8	RBM19_HUMAN	RNA binding motif protein 19	152					multicellular organismal development (GO:0007275)|positive regulation of embryonic development (GO:0040019)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(4)	55	Medulloblastoma(191;0.163)|all_neural(191;0.178)					TCCAGGCCATCATTCGCCCAA	0.607																																																	0													95.0	87.0	89.0					12																	114397134		2203	4300	6503	SO:0001583	missense	0			AL117547	CCDS9172.1	12q24.21	2013-02-12				ENSG00000122965		"""RNA binding motif (RRM) containing"""	29098	protein-coding gene	gene with protein product						9734811, 11230166	Standard	NM_016196		Approved	DKFZp586F1023, KIAA0682	uc009zwi.2	Q9Y4C8	OTTHUMG00000169646	ENST00000545145.2:c.454G>A	12.37:g.114397134C>T	ENSP00000442053:p.Asp152Asn		A8K5X9|Q9BPY6|Q9UFN5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom	p.D152N	ENST00000545145.2	37	c.454	CCDS9172.1	12	.	.	.	.	.	.	.	.	.	.	C	20.4	3.987406	0.74589	.	.	ENSG00000122965	ENST00000545145;ENST00000392561;ENST00000261741	T;T;T	0.08634	3.07;3.07;3.07	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.35595	0.0937	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.24368	-1.0162	10	0.66056	D	0.02	-32.6209	18.8999	0.92439	0.0:1.0:0.0:0.0	.	152	Q9Y4C8	RBM19_HUMAN	N	152	ENSP00000442053:D152N;ENSP00000376344:D152N;ENSP00000261741:D152N	ENSP00000261741:D152N	D	-	1	0	RBM19	112881517	1.000000	0.71417	0.103000	0.21229	0.113000	0.19764	7.181000	0.77682	2.466000	0.83321	0.650000	0.86243	GAT	RBM19	-	NULL	ENSG00000122965		0.607	RBM19-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	RBM19	HGNC	protein_coding	OTTHUMT00000405251.1	-	0.00	49	0	C	NM_016196		114397134	-1	tier1	-	no_errors	ENST00000261741	ensembl	human	known	74_37	missense	10.00	45	5	SNP	1.000	T
RGS4	5999	genome.wustl.edu	37	1	163042230	163042230	+	Silent	SNP	T	T	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:163042230T>A	ENST00000367909.6	+	2	430	c.90T>A	c.(88-90)tcT>tcA	p.S30S	RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000367908.4_Silent_p.S30S|RGS4_ENST00000421743.2_Silent_p.S127S|RGS4_ENST00000367906.3_Silent_p.S12S|RGS4_ENST00000531057.1_Silent_p.S30S|RGS4_ENST00000527809.1_Silent_p.S12S	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	30					inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						TGCAAAAATCTGATTCCTGTG	0.363																																					Ovarian(76;1257 1738 3039 6086)												0													79.0	77.0	78.0					1																	163042230		2203	4300	6503	SO:0001819	synonymous_variant	0			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.90T>A	1.37:g.163042230T>A			A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Silent	SNP	pfam_RGS_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal_superfam,pfscan_Regulat_G_prot_signal_superfam,prints_RGS_dom	p.S127	ENST00000367909.6	37	c.381	CCDS1243.1	1																																																																																			RGS4	-	NULL	ENSG00000117152		0.363	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS4	HGNC	protein_coding	OTTHUMT00000083197.2	-	0.00	52	0	T	NM_005613		163042230	+1	tier1	-	no_errors	ENST00000421743	ensembl	human	known	74_37	silent	9.43	48	5	SNP	0.910	A
RGL1	23179	genome.wustl.edu	37	1	183895404	183895404	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:183895404G>T	ENST00000360851.3	+	18	2463	c.2285G>T	c.(2284-2286)aGa>aTa	p.R762I	RGL1_ENST00000539189.1_Missense_Mutation_p.R733I|RGL1_ENST00000304685.4_Missense_Mutation_p.R797I|RGL1_ENST00000536277.1_Missense_Mutation_p.R760I			Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation stimulator-like 1	762					cellular lipid metabolic process (GO:0044255)|positive regulation of Ral GTPase activity (GO:0032852)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	Ral guanyl-nucleotide exchange factor activity (GO:0008321)			breast(5)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(17)|ovary(4)|prostate(3)|stomach(1)	51						TGGAGTAACAGACACAGCAAA	0.527																																																	0													58.0	55.0	56.0					1																	183895404		2203	4300	6503	SO:0001583	missense	0			AF186780	CCDS1359.1, CCDS72992.1	1q25.2	2008-02-05			ENSG00000143344	ENSG00000143344			30281	protein-coding gene	gene with protein product		605667				10760592, 10231032	Standard	XM_005245010		Approved	RGL	uc001gqm.3	Q9NZL6	OTTHUMG00000035328	ENST00000360851.3:c.2285G>T	1.37:g.183895404G>T	ENSP00000354097:p.Arg762Ile		Q5SXQ2|Q5SXQ6|Q9HBY3|Q9HBY4|Q9NZL5|Q9UG43|Q9Y2G6	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Ras-assoc,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R797I	ENST00000360851.3	37	c.2390		1	.	.	.	.	.	.	.	.	.	.	G	25.2	4.609926	0.87258	.	.	ENSG00000143344	ENST00000304685;ENST00000367531;ENST00000536277;ENST00000360851;ENST00000539189	T;T;T;T;T	0.55413	0.53;0.53;0.61;0.61;0.52	5.37	5.37	0.77165	.	0.046667	0.85682	D	0.000000	T	0.58250	0.2109	L	0.27053	0.805	0.80722	D	1	D;D;D;D	0.71674	0.998;0.997;0.997;0.997	D;D;D;D	0.69142	0.962;0.916;0.916;0.916	T	0.61282	-0.7094	10	0.87932	D	0	.	12.4607	0.55731	0.0779:0.0:0.9221:0.0	.	733;760;762;797	F5H6U6;B7Z2W5;Q9NZL6;Q5SXQ6	.;.;RGL1_HUMAN;.	I	797;797;760;762;733	ENSP00000303192:R797I;ENSP00000356501:R797I;ENSP00000438662:R760I;ENSP00000354097:R762I;ENSP00000437355:R733I	ENSP00000303192:R797I	R	+	2	0	RGL1	182162027	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	8.675000	0.91195	2.666000	0.90696	0.650000	0.86243	AGA	RGL1	-	NULL	ENSG00000143344		0.527	RGL1-002	KNOWN	basic|appris_candidate	protein_coding	RGL1	HGNC	protein_coding	OTTHUMT00000085742.1	-	0.00	30	0	G	NM_015149		183895404	+1	tier1	-	no_errors	ENST00000304685	ensembl	human	known	74_37	missense	8.89	41	4	SNP	1.000	T
REN	5972	genome.wustl.edu	37	1	204125333	204125333	+	Silent	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:204125333G>T	ENST00000272190.8	-	8	961	c.933C>A	c.(931-933)gcC>gcA	p.A311A	REN_ENST00000367195.2_Silent_p.A308A	NM_000537.3	NP_000528.1	P00797	RENI_HUMAN	renin	311					angiotensin maturation (GO:0002003)|beta-amyloid metabolic process (GO:0050435)|cell maturation (GO:0048469)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|drinking behavior (GO:0042756)|hormone-mediated signaling pathway (GO:0009755)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mesonephros development (GO:0001823)|proteolysis (GO:0006508)|regulation of blood pressure (GO:0008217)|regulation of MAPK cascade (GO:0043408)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cAMP (GO:0051591)|response to cGMP (GO:0070305)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|peptidase activity (GO:0008233)|receptor binding (GO:0005102)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|skin(4)|urinary_tract(1)	19	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	TGGCTCCCAAGGCCTCCATGA	0.567																																																	0													202.0	198.0	199.0					1																	204125333		2203	4300	6503	SO:0001819	synonymous_variant	0			BC047752	CCDS30981.1	1q32	2008-02-05			ENSG00000143839	ENSG00000143839	3.4.23.15		9958	protein-coding gene	gene with protein product		179820					Standard	NM_000537		Approved		uc001haq.2	P00797	OTTHUMG00000036059	ENST00000272190.8:c.933C>A	1.37:g.204125333G>T			Q6FI38|Q6T5C2	Silent	SNP	pfam_Aspartic_peptidase,pfam_Aspartic_peptidase_N,superfamily_Peptidase_aspartic_dom,prints_Aspartic_peptidase	p.A311	ENST00000272190.8	37	c.933	CCDS30981.1	1																																																																																			REN	-	pfam_Aspartic_peptidase,superfamily_Peptidase_aspartic_dom	ENSG00000143839		0.567	REN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REN	HGNC	protein_coding	OTTHUMT00000087891.1		0.00	42	0	G	NM_000537		204125333	-1			no_errors	ENST00000272190	ensembl	human	known	74_37	silent	8.16	45	4	SNP	0.306	T
RIPK2	8767	genome.wustl.edu	37	8	90801591	90801591	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr8:90801591C>G	ENST00000220751.4	+	10	1480	c.1166C>G	c.(1165-1167)cCt>cGt	p.P389R	RIPK2_ENST00000540020.1_Missense_Mutation_p.P252R	NM_003821.5	NP_003812.1	O43353	RIPK2_HUMAN	receptor-interacting serine-threonine kinase 2	389					activation of MAPK activity (GO:0000187)|adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of apoptotic process (GO:0043065)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immature T cell proliferation (GO:0033091)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T-helper 1 cell differentiation (GO:0045627)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|response to exogenous dsRNA (GO:0043330)|response to interleukin-1 (GO:0070555)|response to interleukin-12 (GO:0070671)|response to interleukin-18 (GO:0070673)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|T cell proliferation (GO:0042098)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|LIM domain binding (GO:0030274)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	10			BRCA - Breast invasive adenocarcinoma(11;0.0474)			CATCACTGTCCTGGAAATCAC	0.393																																																	0													145.0	135.0	138.0					8																	90801591		2203	4300	6503	SO:0001583	missense	0			AC004003	CCDS6247.1	8q21	2008-05-02			ENSG00000104312	ENSG00000104312			10020	protein-coding gene	gene with protein product		603455				9575181, 9705938	Standard	XM_005251092		Approved	RICK, RIP2, CARDIAK, CARD3	uc003yee.3	O43353	OTTHUMG00000163809	ENST00000220751.4:c.1166C>G	8.37:g.90801591C>G	ENSP00000220751:p.Pro389Arg		B7Z748|Q6UWF0	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_CARD,superfamily_Kinase-like_dom,superfamily_DEATH-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Rcpt-int_Ser/Thr_kinase-2,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_CARD,pfscan_Prot_kinase_dom	p.P389R	ENST00000220751.4	37	c.1166	CCDS6247.1	8	.	.	.	.	.	.	.	.	.	.	C	11.67	1.707092	0.30232	.	.	ENSG00000104312	ENST00000220751;ENST00000540020	T;T	0.80824	-1.19;-1.42	5.89	3.13	0.36017	.	0.561140	0.14981	N	0.287255	T	0.63046	0.2478	N	0.19112	0.55	0.09310	N	1	B	0.25521	0.128	B	0.18263	0.021	T	0.53795	-0.8388	10	0.51188	T	0.08	-0.1049	3.9433	0.09338	0.1755:0.5944:0.0:0.2301	.	389	O43353	RIPK2_HUMAN	R	389;252	ENSP00000220751:P389R;ENSP00000441623:P252R	ENSP00000220751:P389R	P	+	2	0	RIPK2	90870732	0.000000	0.05858	0.001000	0.08648	0.126000	0.20510	0.324000	0.19610	0.825000	0.34637	0.655000	0.94253	CCT	RIPK2	-	pirsf_Rcpt-int_Ser/Thr_kinase-2	ENSG00000104312		0.393	RIPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK2	HGNC	protein_coding	OTTHUMT00000375686.1	-	0.00	44	0	C			90801591	+1	tier1	-	no_errors	ENST00000220751	ensembl	human	known	74_37	missense	26.67	33	12	SNP	0.000	G
RIMS2	9699	genome.wustl.edu	37	8	105257203	105257203	+	Missense_Mutation	SNP	G	G	T	rs377163259		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr8:105257203G>T	ENST00000436393.2	+	24	3689	c.3448G>T	c.(3448-3450)Gtg>Ttg	p.V1150L	RIMS2_ENST00000406091.3_Missense_Mutation_p.V1132L|RIMS2_ENST00000507740.1_Missense_Mutation_p.V946L|RIMS2_ENST00000339750.2_Missense_Mutation_p.V68L|RIMS2_ENST00000262231.10_Missense_Mutation_p.V971L			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1194					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGGCCTGGCCGTGGAAATGAG	0.463										HNSCC(12;0.0054)																																							0													129.0	136.0	133.0					8																	105257203		2019	4182	6201	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3448G>T	8.37:g.105257203G>T	ENSP00000390665:p.Val1150Leu		B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_dom,pfam_PDZ,superfamily_C2_dom,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_dom,pfscan_C2_dom,pfscan_PDZ,pfscan_Znf_FYVE-typ,pfscan_Znf_FYVE-rel	p.V1132L	ENST00000436393.2	37	c.3394		8	.	.	.	.	.	.	.	.	.	.	G	17.51	3.407092	0.62399	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T;T	0.20200	2.68;2.38;2.38;2.11;2.56;2.11;2.09	5.05	5.05	0.67936	.	.	.	.	.	T	0.18676	0.0448	L	0.43152	1.355	0.58432	D	0.999995	B;P;B;B;B	0.34955	0.3;0.477;0.247;0.08;0.029	B;B;B;B;B	0.25506	0.058;0.054;0.058;0.061;0.061	T	0.03576	-1.1023	9	0.27785	T	0.31	.	18.5918	0.91215	0.0:0.0:1.0:0.0	.	1194;1150;971;946;1132	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	L	1169;1132;1194;971;946;1139;1150;68;68	ENSP00000384892:V1132L;ENSP00000262231:V971L;ENSP00000423559:V946L;ENSP00000386228:V1139L;ENSP00000390665:V1150L;ENSP00000428478:V68L;ENSP00000342051:V68L	ENSP00000262231:V971L	V	+	1	0	RIMS2	105326379	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.807000	0.86032	2.623000	0.88846	0.650000	0.86243	GTG	RIMS2	-	NULL	ENSG00000176406		0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1		0.00	19	0	G	NM_001100117		105257203	+1			no_errors	ENST00000406091	ensembl	human	known	74_37	missense	9.09	30	3	SNP	1.000	T
RNF168	165918	genome.wustl.edu	37	3	196199528	196199528	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:196199528G>A	ENST00000318037.3	-	6	1472	c.878C>T	c.(877-879)tCa>tTa	p.S293L	CTD-2002J20.1_ENST00000610042.1_RNA	NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	293					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		GGACTCTATTGAAGAATCTGC	0.453																																																	0													122.0	117.0	119.0					3																	196199528		2203	4300	6503	SO:0001583	missense	0			AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.878C>T	3.37:g.196199528G>A	ENSP00000320898:p.Ser293Leu		Q8NA67|Q96NS4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S293L	ENST00000318037.3	37	c.878	CCDS3317.1	3	.	.	.	.	.	.	.	.	.	.	G	8.796	0.931707	0.18131	.	.	ENSG00000163961	ENST00000318037	T	0.08008	3.14	5.98	4.13	0.48395	.	0.739812	0.12193	N	0.491011	T	0.08626	0.0214	L	0.47716	1.5	0.09310	N	1	B	0.15141	0.012	B	0.12156	0.007	T	0.41070	-0.9529	10	0.15066	T	0.55	0.6437	9.8464	0.41030	0.1675:0.0:0.8325:0.0	.	293	Q8IYW5	RN168_HUMAN	L	293	ENSP00000320898:S293L	ENSP00000320898:S293L	S	-	2	0	RNF168	197683925	0.001000	0.12720	0.018000	0.16275	0.036000	0.12997	-0.249000	0.08842	0.790000	0.33803	0.591000	0.81541	TCA	RNF168	-	NULL	ENSG00000163961		0.453	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF168	HGNC	protein_coding	OTTHUMT00000340778.1	-	0.00	16	0	G	NM_152617		196199528	-1	tier1	-	no_errors	ENST00000318037	ensembl	human	known	74_37	missense	50.00	15	15	SNP	0.005	A
RNF213	57674	genome.wustl.edu	37	17	78262164	78262164	+	Splice_Site	SNP	T	T	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:78262164T>A	ENST00000582970.1	+	4	953		c.e4+2		RNF213_ENST00000319921.4_Splice_Site|RNF213_ENST00000456466.1_Splice_Site|RNF213_ENST00000508628.2_Splice_Site	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213						ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCCTCTATGGTGAGTCATCCG	0.662																																																	0													25.0	29.0	27.0					17																	78262164		2178	4240	6418	SO:0001630	splice_region_variant	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.810+2T>A	17.37:g.78262164T>A			C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Splice_Site	SNP	-	e3+2	ENST00000582970.1	37	c.810+2	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	T	9.684	1.150093	0.21371	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	.	.	.	4.19	1.67	0.24075	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.99998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.8425	0.29406	0.0:0.0:0.4234:0.5766	.	.	.	.	.	-1	.	.	.	+	.	.	RNF213	75876759	0.404000	0.25328	0.883000	0.34634	0.006000	0.05464	0.782000	0.26788	0.702000	0.31825	-0.316000	0.08728	.	RNF213	-	-	ENSG00000173821		0.662	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	-	0.00	27	0	T	NM_020914	Intron	78262164	+1	tier1	-	no_errors	ENST00000582970	ensembl	human	known	74_37	splice_site	11.11	32	4	SNP	0.854	A
RNF40	9810	genome.wustl.edu	37	16	30775652	30775652	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:30775652T>C	ENST00000324685.6	+	5	1030	c.595T>C	c.(595-597)Tca>Cca	p.S199P	C16orf93_ENST00000545825.1_5'Flank|RNF40_ENST00000402121.3_Intron|C16orf93_ENST00000543610.1_5'Flank|RNF40_ENST00000357890.5_Missense_Mutation_p.S199P|C16orf93_ENST00000541260.1_5'Flank|RNF40_ENST00000563683.1_Missense_Mutation_p.S199P	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	199					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GGTAGAGGCCTCAGACCGCCT	0.617																																																	0													81.0	67.0	72.0					16																	30775652		2197	4300	6497	SO:0001583	missense	0			AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.595T>C	16.37:g.30775652T>C	ENSP00000325677:p.Ser199Pro		Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.S199P	ENST00000324685.6	37	c.595	CCDS10691.1	16	.	.	.	.	.	.	.	.	.	.	T	29.7	5.024413	0.93518	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000452273	T;T	0.31247	1.5;1.5	5.54	5.54	0.83059	.	0.129068	0.53938	D	0.000055	T	0.39306	0.1073	L	0.44542	1.39	0.80722	D	1	D;B;B	0.60160	0.987;0.047;0.047	P;B;B	0.52343	0.696;0.017;0.017	T	0.21449	-1.0245	10	0.72032	D	0.01	-8.5405	14.7997	0.69906	0.0:0.0:0.0:1.0	.	199;199;199	O75150-4;A8K6K1;O75150	.;.;BRE1B_HUMAN	P	199;199;48	ENSP00000325677:S199P;ENSP00000350563:S199P	ENSP00000325677:S199P	S	+	1	0	RNF40	30683153	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.093000	0.64517	2.326000	0.78906	0.533000	0.62120	TCA	RNF40	-	NULL	ENSG00000103549		0.617	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF40	HGNC	protein_coding	OTTHUMT00000255524.2	-	0.00	54	0	T	NM_014771		30775652	+1	tier1	-	no_errors	ENST00000324685	ensembl	human	known	74_37	missense	8.33	44	4	SNP	1.000	C
ROCK2	9475	genome.wustl.edu	37	2	11355639	11355639	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:11355639C>A	ENST00000315872.6	-	14	2042	c.1594G>T	c.(1594-1596)Gat>Tat	p.D532Y	ROCK2_ENST00000401753.1_Missense_Mutation_p.D289Y	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	532	Interaction with PPP1R12A.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		CACAAACCATCATTTTCCAAA	0.338																																																	0													115.0	112.0	113.0					2																	11355639		1820	4085	5905	SO:0001583	missense	0			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.1594G>T	2.37:g.11355639C>A	ENSP00000317985:p.Asp532Tyr		Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Rho-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_tRNA-bd_arm,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kin,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_dom	p.D532Y	ENST00000315872.6	37	c.1594	CCDS42654.1	2	.	.	.	.	.	.	.	.	.	.	C	14.35	2.507996	0.44558	.	.	ENSG00000134318	ENST00000315872;ENST00000401753	D;D	0.85629	-2.01;-2.01	4.9	4.9	0.64082	.	0.051585	0.85682	D	0.000000	T	0.77226	0.4099	N	0.14661	0.345	0.50632	D	0.999889	B	0.10296	0.003	B	0.19946	0.027	T	0.73056	-0.4103	10	0.56958	D	0.05	.	18.4356	0.90645	0.0:1.0:0.0:0.0	.	532	O75116	ROCK2_HUMAN	Y	532;289	ENSP00000317985:D532Y;ENSP00000385509:D289Y	ENSP00000317985:D532Y	D	-	1	0	ROCK2	11273090	1.000000	0.71417	0.998000	0.56505	0.975000	0.68041	6.025000	0.70864	2.434000	0.82447	0.655000	0.94253	GAT	ROCK2	-	pirsf_Rho-assoc_coiled-coil_kin	ENSG00000134318		0.338	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	HGNC	protein_coding	OTTHUMT00000313886.3	-	0.00	60	0	C			11355639	-1	tier1	-	no_errors	ENST00000315872	ensembl	human	known	74_37	missense	25.32	59	20	SNP	1.000	A
RP2	6102	genome.wustl.edu	37	X	46713020	46713020	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chrX:46713020A>G	ENST00000218340.3	+	2	373	c.212A>G	c.(211-213)aAc>aGc	p.N71S		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	71	C-CAP/cofactor C-like. {ECO:0000255|PROSITE-ProRule:PRU00659}.				cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)			NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						GAGAACTGTAACATCTATATT	0.423																																																	0													112.0	102.0	105.0					X																	46713020		2203	4300	6503	SO:0001583	missense	0			AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.212A>G	X.37:g.46713020A>G	ENSP00000218340:p.Asn71Ser		Q86XJ7|Q9NU67	Missense_Mutation	SNP	pfam_Tubulin-bd_cofactor_C_dom,superfamily_Nucleoside_diP_kinase,superfamily_Adenylate_cyclase-assoc_CAP_C,smart_CARP_motif,pirsf_Protein_XRP2	p.N71S	ENST00000218340.3	37	c.212	CCDS14270.1	X	.	.	.	.	.	.	.	.	.	.	A	11.48	1.650520	0.29336	.	.	ENSG00000102218	ENST00000218340	D	0.86230	-2.09	5.62	4.47	0.54385	CARP motif (1);Tubulin binding cofactor C (1);Cyclase-associated protein CAP/septum formation inhibitor MinC, C-terminal (1);C-CAP/cofactor C-like domain (1);	0.174459	0.64402	D	0.000010	T	0.76378	0.3979	N	0.25890	0.77	0.43719	D	0.996195	B	0.06786	0.001	B	0.04013	0.001	T	0.68659	-0.5350	10	0.16420	T	0.52	-17.8842	9.1468	0.36937	0.852:0.0:0.148:0.0	.	71	O75695	XRP2_HUMAN	S	71	ENSP00000218340:N71S	ENSP00000218340:N71S	N	+	2	0	RP2	46597964	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.951000	0.56684	1.879000	0.54435	0.417000	0.27973	AAC	RP2	-	pfam_Tubulin-bd_cofactor_C_dom,superfamily_Adenylate_cyclase-assoc_CAP_C,smart_CARP_motif,pirsf_Protein_XRP2	ENSG00000102218		0.423	RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP2	HGNC	protein_coding	OTTHUMT00000056375.1	-	0.00	63	0	A	NM_006915		46713020	+1	tier1	-	no_errors	ENST00000218340	ensembl	human	known	74_37	missense	12.82	34	5	SNP	1.000	G
RPTN	126638	genome.wustl.edu	37	1	152128077	152128077	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:152128077C>T	ENST00000316073.3	-	3	1562	c.1498G>A	c.(1498-1500)Ggt>Agt	p.G500S		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	500	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TCTGGCTGACCATAATGATAA	0.502																																																	0													829.0	716.0	750.0					1																	152128077		1568	3582	5150	SO:0001583	missense	0			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.1498G>A	1.37:g.152128077C>T	ENSP00000317895:p.Gly500Ser		B7ZBZ3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_hand_dom	p.G500S	ENST00000316073.3	37	c.1498	CCDS41397.1	1	.	.	.	.	.	.	.	.	.	.	C	14.17	2.456772	0.43634	.	.	ENSG00000215853	ENST00000316073;ENST00000541545	T	0.17213	2.29	4.59	1.67	0.24075	.	0.820317	0.09951	N	0.734628	T	0.06096	0.0158	M	0.71296	2.17	0.09310	N	1	P	0.39748	0.686	B	0.32022	0.139	T	0.31888	-0.9927	10	0.34782	T	0.22	-2.4395	6.751	0.23487	0.0:0.6905:0.0:0.3095	.	500	Q6XPR3	RPTN_HUMAN	S	500;155	ENSP00000317895:G500S	ENSP00000317895:G500S	G	-	1	0	RPTN	150394701	0.000000	0.05858	0.002000	0.10522	0.030000	0.12068	-0.158000	0.10070	0.059000	0.16252	0.176000	0.17051	GGT	RPTN	-	NULL	ENSG00000215853		0.502	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	HGNC	protein_coding	OTTHUMT00000333867.1	-	0.00	213	0	C	XM_371312		152128077	-1	tier1	-	no_errors	ENST00000316073	ensembl	human	known	74_37	missense	21.01	187	50	SNP	0.010	T
RTN3	10313	genome.wustl.edu	37	11	63487016	63487016	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:63487016G>A	ENST00000377819.5	+	3	1196	c.1042G>A	c.(1042-1044)Gtg>Atg	p.V348M	RTN3_ENST00000356000.3_Intron|RTN3_ENST00000540798.1_Missense_Mutation_p.V236M|RTN3_ENST00000339997.4_Missense_Mutation_p.V329M|RTN3_ENST00000341307.2_Intron|RTN3_ENST00000354497.4_Intron|RTN3_ENST00000537981.1_Intron	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	348					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						GGTTCCCCAAGTGAAACAACA	0.383																																																	0													62.0	62.0	62.0					11																	63487016		2201	4298	6499	SO:0001583	missense	0			AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.1042G>A	11.37:g.63487016G>A	ENSP00000367050:p.Val348Met		B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.V348M	ENST00000377819.5	37	c.1042	CCDS58141.1	11	.	.	.	.	.	.	.	.	.	.	G	17.01	3.279168	0.59758	.	.	ENSG00000133318	ENST00000377819;ENST00000339997;ENST00000540798	T;T;T	0.18502	2.21;2.21;2.21	6.07	3.02	0.34903	.	0.534882	0.17222	N	0.182305	T	0.19967	0.0480	N	0.19112	0.55	0.58432	D	0.999999	D;P;D	0.53462	0.96;0.933;0.96	P;P;P	0.54312	0.748;0.564;0.748	T	0.02498	-1.1150	10	0.37606	T	0.19	-1.1142	14.2801	0.66205	0.0:0.4288:0.5712:0.0	.	236;348;329	F5H774;O95197;O95197-2	.;RTN3_HUMAN;.	M	348;329;236	ENSP00000367050:V348M;ENSP00000344106:V329M;ENSP00000442733:V236M	ENSP00000344106:V329M	V	+	1	0	RTN3	63243592	0.993000	0.37304	0.731000	0.30826	0.965000	0.64279	2.956000	0.49129	0.851000	0.35264	0.655000	0.94253	GTG	RTN3	-	NULL	ENSG00000133318		0.383	RTN3-002	KNOWN	basic|CCDS	protein_coding	RTN3	HGNC	protein_coding	OTTHUMT00000397846.1		0.00	21	0	G	NM_006054		63487016	+1			no_errors	ENST00000377819	ensembl	human	known	74_37	missense	10.71	25	3	SNP	0.900	A
RUNX1T1	862	genome.wustl.edu	37	8	92998435	92998435	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr8:92998435G>T	ENST00000523629.1	-	9	1650	c.1196C>A	c.(1195-1197)gCc>gAc	p.A399D	RUNX1T1_ENST00000396218.1_Missense_Mutation_p.A372D|RUNX1T1_ENST00000436581.2_Missense_Mutation_p.A410D|RUNX1T1_ENST00000265814.3_Missense_Mutation_p.A399D|RUNX1T1_ENST00000360348.2_Missense_Mutation_p.A362D|RUNX1T1_ENST00000520724.1_Missense_Mutation_p.A362D|RUNX1T1_ENST00000422361.2_Missense_Mutation_p.A362D|RUNX1T1_ENST00000518844.1_Missense_Mutation_p.A372D	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	399					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.A410V(1)|p.A399V(1)|p.A362V(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TAAGTCCTCGGCGTCACTGTA	0.512																																																	3	Substitution - Missense(3)	skin(3)											105.0	109.0	108.0					8																	92998435		2203	4300	6503	SO:0001583	missense	0			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.1196C>A	8.37:g.92998435G>T	ENSP00000428543:p.Ala399Asp		B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.A410D	ENST00000523629.1	37	c.1229	CCDS6256.1	8	.	.	.	.	.	.	.	.	.	.	G	28.5	4.924521	0.92319	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	T;T;T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93;0.93;0.93	5.67	5.67	0.87782	NHR2-like (1);	0.000000	0.85682	D	0.000000	T	0.54838	0.1883	L	0.44542	1.39	0.80722	D	1	B;B;P	0.52577	0.399;0.372;0.954	B;B;P	0.58331	0.206;0.216;0.837	T	0.45145	-0.9281	10	0.37606	T	0.19	-15.8922	19.773	0.96379	0.0:0.0:1.0:0.0	.	410;399;372	E7EPN4;Q06455;Q06455-2	.;MTG8_HUMAN;.	D	399;372;399;362;362;362;410;372	ENSP00000428543:A399D;ENSP00000379520:A372D;ENSP00000265814:A399D;ENSP00000353504:A362D;ENSP00000390137:A362D;ENSP00000428742:A362D;ENSP00000402257:A410D;ENSP00000430728:A372D	ENSP00000265814:A399D	A	-	2	0	RUNX1T1	93067611	1.000000	0.71417	0.844000	0.33320	0.969000	0.65631	7.636000	0.83301	2.677000	0.91161	0.655000	0.94253	GCC	RUNX1T1	-	pfam_NHR2	ENSG00000079102		0.512	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3		0.00	40	0	G	NM_004349, NM_175635		92998435	-1			no_errors	ENST00000436581	ensembl	human	known	74_37	missense	5.13	37	2	SNP	1.000	T
SCN4A	6329	genome.wustl.edu	37	17	62034633	62034633	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:62034633G>A	ENST00000435607.1	-	13	2341	c.2265C>T	c.(2263-2265)ttC>ttT	p.F755F	SCN4A_ENST00000578147.1_Silent_p.F755F	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	755					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	ACAGGATGCGGAAGACGATGA	0.577																																																	0													83.0	86.0	85.0					17																	62034633		2203	4300	6503	SO:0001819	synonymous_variant	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.2265C>T	17.37:g.62034633G>A			Q15478|Q16447|Q7Z6B1	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfscan_IQ_motif_EF-hand-BS,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2	p.F755	ENST00000435607.1	37	c.2265	CCDS45761.1	17																																																																																			SCN4A	-	pfam_Ion_trans_dom	ENSG00000007314		0.577	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		-	0.00	60	0	G	NM_000334		62034633	-1	tier1	-	no_errors	ENST00000435607	ensembl	human	known	74_37	silent	18.64	48	11	SNP	1.000	A
SERINC3	10955	genome.wustl.edu	37	20	43150680	43150680	+	5'UTR	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr20:43150680G>A	ENST00000342374.4	-	0	70				SERINC3_ENST00000255175.1_5'UTR|SERINC3_ENST00000541235.1_5'Flank|SERINC3_ENST00000468234.1_5'UTR	NM_006811.2	NP_006802.1	Q13530	SERC3_HUMAN	serine incorporator 3						phosphatidylserine metabolic process (GO:0006658)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(4)|large_intestine(2)|lung(8)|skin(3)|urinary_tract(1)	18		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)			CCAGAAACATGACGGTTTCTC	0.667																																																	0																																										SO:0001623	5_prime_UTR_variant	0			U49188	CCDS13333.1	20q13.12	2008-05-14	2005-11-15	2005-11-15	ENSG00000132824	ENSG00000132824			11699	protein-coding gene	gene with protein product		607165	"""tumor differentially expressed 1"""	TDE1		10559794	Standard	NM_006811		Approved	DIFF33, TDE, SBBI99, TMS-1, AIGP1	uc002xme.3	Q13530	OTTHUMG00000033087	ENST00000342374.4:c.-88C>T	20.37:g.43150680G>A			B4DUE9|O43717|Q9BR33	RNA	SNP	-	NULL	ENST00000342374.4	37	NULL	CCDS13333.1	20																																																																																			SERINC3	-	-	ENSG00000132824		0.667	SERINC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERINC3	HGNC	protein_coding	OTTHUMT00000080544.3	-	0.00	52	0	G	NM_006811		43150680	-1	tier1	-	no_errors	ENST00000468234	ensembl	human	known	74_37	rna	24.24	50	16	SNP	0.000	A
SESTD1	91404	genome.wustl.edu	37	2	180016092	180016092	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:180016092C>T	ENST00000428443.3	-	6	712	c.396G>A	c.(394-396)ttG>ttA	p.L132L		NM_178123.4	NP_835224.3	Q86VW0	SESD1_HUMAN	SEC14 and spectrin domains 1	132	CRAL-TRIO. {ECO:0000255|PROSITE- ProRule:PRU00056}.						phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			breast(2)|endometrium(4)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(3)	30			OV - Ovarian serous cystadenocarcinoma(117;0.0344)|Epithelial(96;0.0531)|all cancers(119;0.147)			TATAACGAGTCAATTTGTTGG	0.353																																																	0													70.0	69.0	69.0					2																	180016092		2203	4300	6503	SO:0001819	synonymous_variant	0			AK096232	CCDS33338.1	2q31.3	2014-01-28			ENSG00000187231	ENSG00000187231			18379	protein-coding gene	gene with protein product						12837271	Standard	NM_178123		Approved	DKFZp434O0515, Solo	uc002uni.4	Q86VW0	OTTHUMG00000154554	ENST00000428443.3:c.396G>A	2.37:g.180016092C>T			Q53R38|Q53SP3|Q5GM69|Q8N6M1|Q96LQ2	Silent	SNP	superfamily_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.L132	ENST00000428443.3	37	c.396	CCDS33338.1	2																																																																																			SESTD1	-	superfamily_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	ENSG00000187231		0.353	SESTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SESTD1	HGNC	protein_coding	OTTHUMT00000335916.2	-	0.00	66	0	C	NM_178123		180016092	-1	tier1	-	no_errors	ENST00000428443	ensembl	human	known	74_37	silent	17.24	48	10	SNP	1.000	T
SETD1A	9739	genome.wustl.edu	37	16	30982809	30982811	+	In_Frame_Del	DEL	TCC	TCC	-	rs531337171|rs569719496	byFrequency	TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	TCC	TCC					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:30982809_30982811delTCC	ENST00000262519.8	+	13	3813_3815	c.3127_3129delTCC	c.(3127-3129)tccdel	p.S1058del		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1058	Ser-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CAGctcctcatcctcctcctcct	0.547																																																	0																																										SO:0001651	inframe_deletion	0			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3127_3129delTCC	16.37:g.30982818_30982820delTCC	ENSP00000262519:p.Ser1058del		A6NP62|Q6PIF3|Q8TAJ6	In_Frame_Del	DEL	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.S1046in_frame_del	ENST00000262519.8	37	c.3127_3129	CCDS32435.1	16																																																																																			SETD1A	-	NULL	ENSG00000099381		0.547	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	HGNC	protein_coding	OTTHUMT00000318244.2		0.00	42	0	TCC	NM_014712		30982811	+1			no_errors	ENST00000262519	ensembl	human	known	74_37	in_frame_del	7.55	49	4	DEL	0.734:0.781:0.676	0
SGK223	157285	genome.wustl.edu	37	8	8185481	8185481	+	Missense_Mutation	SNP	G	G	T	rs142121457	byFrequency	TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr8:8185481G>T	ENST00000520004.1	-	5	3075	c.2811C>A	c.(2809-2811)caC>caA	p.H937Q	SGK223_ENST00000330777.4_Missense_Mutation_p.H937Q			Q86YV5	SG223_HUMAN		939							ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										TCAGGAGACCGTGCAGCTGAA	0.647																																					GBM(34;731 755 10259 33573 33867)												0													40.0	44.0	43.0					8																	8185481		2015	4182	6197	SO:0001583	missense	0																														ENST00000520004.1:c.2811C>A	8.37:g.8185481G>T	ENSP00000428054:p.His937Gln		Q8N3N5	Missense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_dom	p.H937Q	ENST00000520004.1	37	c.2811	CCDS43706.1	8	.	.	.	.	.	.	.	.	.	.	G	8.141	0.785181	0.16189	.	.	ENSG00000182319	ENST00000330777;ENST00000520004	T;T	0.28069	1.63;1.63	4.73	3.85	0.44370	.	0.261806	0.38381	N	0.001715	T	0.19046	0.0457	N	0.25144	0.715	0.35999	D	0.837275	B	0.23735	0.09	B	0.21917	0.037	T	0.13710	-1.0499	10	0.12103	T	0.63	.	12.3871	0.55338	0.0822:0.0:0.9178:0.0	.	937	Q86YV5	SG223_HUMAN	Q	937	ENSP00000330930:H937Q;ENSP00000428054:H937Q	ENSP00000330930:H937Q	H	-	3	2	AC068353.1	8222891	1.000000	0.71417	1.000000	0.80357	0.595000	0.36748	3.169000	0.50809	1.359000	0.45940	0.563000	0.77884	CAC	SGK223	-	NULL	ENSG00000182319		0.647	SGK223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK223	Uniprot_gn	protein_coding	OTTHUMT00000374864.1		0.00	27	0	G			8185481	-1			no_errors	ENST00000330777	ensembl	human	known	74_37	missense	6.67	42	3	SNP	1.000	T
SH3TC1	54436	genome.wustl.edu	37	4	8207065	8207065	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:8207065C>T	ENST00000245105.3	+	2	211	c.144C>T	c.(142-144)ccC>ccT	p.P48P	SH3TC1_ENST00000539824.1_5'UTR|SH3TC1_ENST00000382521.3_Silent_p.P48P	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	48										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						AAGCGGGGCCCGAGGAGGCCA	0.687																																					NSCLC(145;2298 2623 35616 37297)												0													28.0	30.0	30.0					4																	8207065		1989	3919	5908	SO:0001819	synonymous_variant	0			AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.144C>T	4.37:g.8207065C>T			Q4W5G5	Silent	SNP	superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.P48	ENST00000245105.3	37	c.144	CCDS3399.1	4																																																																																			SH3TC1	-	NULL	ENSG00000125089		0.687	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH3TC1	HGNC	protein_coding	OTTHUMT00000206991.2		0.00	54	0	C	NM_018986		8207065	+1			no_errors	ENST00000245105	ensembl	human	known	74_37	silent	16.95	49	10	SNP	0.000	T
SIRT1	23411	genome.wustl.edu	37	10	69666547	69666547	+	Splice_Site	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:69666547G>A	ENST00000212015.6	+	5	996	c.943G>A	c.(943-945)Gaa>Aaa	p.E315K	SIRT1_ENST00000403579.1_Splice_Site_p.E12K|SIRT1_ENST00000406900.1_Splice_Site_p.E12K|SIRT1_ENST00000432464.1_Splice_Site_p.E20K	NM_012238.4	NP_036370.2	Q96EB6	SIR1_HUMAN	sirtuin 1	315	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.|Interaction with CCAR2.				angiogenesis (GO:0001525)|cell aging (GO:0007569)|cellular glucose homeostasis (GO:0001678)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to starvation (GO:0009267)|cellular response to tumor necrosis factor (GO:0071356)|cellular triglyceride homeostasis (GO:0035356)|cholesterol homeostasis (GO:0042632)|chromatin organization (GO:0006325)|chromatin silencing (GO:0006342)|chromatin silencing at rDNA (GO:0000183)|circadian regulation of gene expression (GO:0032922)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|establishment of chromatin silencing (GO:0006343)|fatty acid homeostasis (GO:0055089)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of chromatin silencing (GO:0006344)|methylation-dependent chromatin silencing (GO:0006346)|muscle organ development (GO:0007517)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|negative regulation of cell growth (GO:0030308)|negative regulation of cellular response to testosterone stimulus (GO:2000655)|negative regulation of cellular senescence (GO:2000773)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of helicase activity (GO:0051097)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of neuron death (GO:1901215)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of peptidyl-lysine acetylation (GO:2000757)|negative regulation of phosphorylation (GO:0042326)|negative regulation of prostaglandin biosynthetic process (GO:0031393)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|ovulation from ovarian follicle (GO:0001542)|peptidyl-lysine acetylation (GO:0018394)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular senescence (GO:2000774)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of chromatin silencing (GO:0031937)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of DNA repair (GO:0045739)|positive regulation of histone H3-K9 methylation (GO:0051574)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of macroautophagy (GO:0016239)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deacetylation (GO:0006476)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|regulation of bile acid biosynthetic process (GO:0070857)|regulation of cell proliferation (GO:0042127)|regulation of endodeoxyribonuclease activity (GO:0032071)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle (GO:0007346)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of smooth muscle cell apoptotic process (GO:0034391)|response to hydrogen peroxide (GO:0042542)|response to insulin (GO:0032868)|response to oxidative stress (GO:0006979)|rRNA processing (GO:0006364)|single strand break repair (GO:0000012)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)|triglyceride mobilization (GO:0006642)|viral process (GO:0016032)|white fat cell differentiation (GO:0050872)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear envelope (GO:0005635)|nuclear euchromatin (GO:0005719)|nuclear heterochromatin (GO:0005720)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|rDNA heterochromatin (GO:0033553)	bHLH transcription factor binding (GO:0043425)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone binding (GO:0042393)|histone deacetylase activity (GO:0004407)|HLH domain binding (GO:0043398)|identical protein binding (GO:0042802)|keratin filament binding (GO:1990254)|metal ion binding (GO:0046872)|mitogen-activated protein kinase binding (GO:0051019)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent protein deacetylase activity (GO:0034979)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|protein deacetylase activity (GO:0033558)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)	p.E315*(1)		central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	14						CTTGATACAGGAAATATATCC	0.328																																																	1	Substitution - Nonsense(1)	large_intestine(1)											61.0	63.0	62.0					10																	69666547		2203	4300	6503	SO:0001630	splice_region_variant	0			AF083106	CCDS7273.1, CCDS44412.1	10q21	2010-06-25	2010-06-25		ENSG00000096717	ENSG00000096717			14929	protein-coding gene	gene with protein product		604479	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 1"", ""sirtuin (silent mating type information regulation 2 homolog) 1 (S. cerevisiae)"""			10381378	Standard	NM_012238		Approved	SIR2L1	uc001jnd.3	Q96EB6	OTTHUMG00000018340	ENST00000212015.6:c.943-1G>A	10.37:g.69666547G>A			Q2XNF6|Q5JVQ0|Q9GZR9|Q9Y6F0	Missense_Mutation	SNP	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	p.E315K	ENST00000212015.6	37	c.943	CCDS7273.1	10	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828688	0.90955	.	.	ENSG00000096717	ENST00000212015;ENST00000432464;ENST00000406900;ENST00000403579	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.43122	0.1233	M	0.73319	2.225	0.80722	D	1	P;D	0.89917	0.944;1.0	D;D	0.79108	0.928;0.992	T	0.19910	-1.0291	9	.	.	.	-17.377	18.5847	0.91185	0.0:0.0:1.0:0.0	.	12;315	B0QZ35;Q96EB6	.;SIRT1_HUMAN	K	315;20;12;12	ENSP00000212015:E315K;ENSP00000409208:E20K;ENSP00000384508:E12K;ENSP00000384063:E12K	.	E	+	1	0	SIRT1	69336553	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	9.402000	0.97298	2.480000	0.83734	0.585000	0.79938	GAA	SIRT1	-	pfam_Sirtuin,pfscan_Ssirtuin_cat_dom	ENSG00000096717		0.328	SIRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT1	HGNC	protein_coding	OTTHUMT00000048296.1		0.00	27	0	G		Missense_Mutation	69666547	+1			no_errors	ENST00000212015	ensembl	human	known	74_37	missense	6.00	47	3	SNP	1.000	A
SLC11A1	6556	genome.wustl.edu	37	2	219249019	219249019	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:219249019G>T	ENST00000233202.6	+	3	544	c.204G>T	c.(202-204)atG>atT	p.M68I	SLC11A1_ENST00000473367.1_Intron|SLC11A1_ENST00000539932.1_5'UTR	NM_000578.3	NP_000569.3	P49279	NRAM1_HUMAN	solute carrier family 11 (proton-coupled divalent metal ion transporter), member 1	68	Pro/Ser-rich.				activation of protein kinase activity (GO:0032147)|antigen processing and presentation of peptide antigen (GO:0048002)|cadmium ion transmembrane transport (GO:0070574)|cellular cadmium ion homeostasis (GO:0006876)|cellular iron ion homeostasis (GO:0006879)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|defense response to protozoan (GO:0042832)|divalent metal ion export (GO:0070839)|inflammatory response (GO:0006954)|interaction with host (GO:0051701)|interleukin-2 production (GO:0032623)|interleukin-3 production (GO:0032632)|iron ion homeostasis (GO:0055072)|iron ion transport (GO:0006826)|L-arginine import (GO:0043091)|macrophage activation (GO:0042116)|manganese ion transport (GO:0006828)|MHC class II biosynthetic process (GO:0045342)|mRNA stabilization (GO:0048255)|multicellular organismal iron ion homeostasis (GO:0060586)|negative regulation of cytokine production (GO:0001818)|nitrite transport (GO:0015707)|phagocytosis (GO:0006909)|phagosome maturation (GO:0090382)|positive regulation of cytokine production (GO:0001819)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of gene expression (GO:0010628)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus, translocation (GO:0000060)|respiratory burst (GO:0045730)|response to bacterium (GO:0009617)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)|T cell cytokine production (GO:0002369)|T cell proliferation involved in immune response (GO:0002309)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)|wound healing (GO:0042060)	cell outer membrane (GO:0009279)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosome (GO:0005764)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|tertiary granule membrane (GO:0070821)	manganese ion transmembrane transporter activity (GO:0005384)|metal ion:proton antiporter activity (GO:0051139)|protein homodimerization activity (GO:0042803)|transition metal ion transmembrane transporter activity (GO:0046915)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	19		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCTTCCTCATGAGCATTGCTT	0.597																																																	0													111.0	106.0	108.0					2																	219249019		2203	4300	6503	SO:0001583	missense	0			D38171	CCDS2415.1	2q35	2013-07-18	2013-07-18		ENSG00000018280	ENSG00000018280		"""Solute carriers"""	10907	protein-coding gene	gene with protein product	"""natural resistance-associated macrophage protein 1"""	600266		LSH, NRAMP, NRAMP1		7964458, 7980580	Standard	NM_000578		Approved		uc002vhv.3	P49279	OTTHUMG00000086747	ENST00000233202.6:c.204G>T	2.37:g.219249019G>T	ENSP00000233202:p.Met68Ile		C0H5Y3	Missense_Mutation	SNP	pfam_NRAMP-like,prints_NRAMP-like,tigrfam_NRAMP-like	p.M68I	ENST00000233202.6	37	c.204	CCDS2415.1	2	.	.	.	.	.	.	.	.	.	.	G	29.8	5.037289	0.93630	.	.	ENSG00000018280	ENST00000233202	T	0.16597	2.33	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.34774	0.0909	L	0.41824	1.3	0.80722	D	1	B;B;D	0.76494	0.119;0.371;0.999	B;B;D	0.70016	0.119;0.223;0.967	T	0.05616	-1.0874	10	0.87932	D	0	-46.717	18.6237	0.91330	0.0:0.0:1.0:0.0	.	68;68;68	Q9HBK0;B4DQ73;P49279	.;.;NRAM1_HUMAN	I	68	ENSP00000233202:M68I	ENSP00000233202:M68I	M	+	3	0	SLC11A1	218957263	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.340000	0.97038	2.620000	0.88729	0.561000	0.74099	ATG	SLC11A1	-	tigrfam_NRAMP-like	ENSG00000018280		0.597	SLC11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC11A1	HGNC	protein_coding	OTTHUMT00000195076.2	-	0.00	49	0	G	NM_000578		219249019	+1	tier1	-	no_errors	ENST00000233202	ensembl	human	known	74_37	missense	7.84	47	4	SNP	1.000	T
SLC30A2	7780	genome.wustl.edu	37	1	26365766	26365766	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:26365766T>A	ENST00000374278.3	-	7	1073	c.857A>T	c.(856-858)aAg>aTg	p.K286M	SLC30A2_ENST00000374276.3_Missense_Mutation_p.K335M	NM_032513.3	NP_115902.1	Q9BRI3	ZNT2_HUMAN	solute carrier family 30 (zinc transporter), member 2	286					positive regulation of sequestering of zinc ion (GO:0061090)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)	cation transmembrane transporter activity (GO:0008324)			cervix(1)|endometrium(2)|kidney(1)|lung(8)|stomach(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.09e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00614)|READ - Rectum adenocarcinoma(331;0.0649)		GCTGGCTGTCTTCAGCACAGC	0.587																																																	0													62.0	57.0	59.0					1																	26365766		2203	4300	6503	SO:0001583	missense	0			AK023491	CCDS272.1, CCDS30644.1	1p35.3	2013-05-22			ENSG00000158014	ENSG00000158014		"""Solute carriers"""	11013	protein-coding gene	gene with protein product		609617		ZNT2			Standard	NM_001004434		Approved		uc001blg.1	Q9BRI3	OTTHUMG00000007508	ENST00000374278.3:c.857A>T	1.37:g.26365766T>A	ENSP00000363396:p.Lys286Met		Q71RC8	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.K335M	ENST00000374278.3	37	c.1004	CCDS272.1	1	.	.	.	.	.	.	.	.	.	.	T	14.49	2.551424	0.45487	.	.	ENSG00000158014	ENST00000374278;ENST00000374276	T;T	0.66280	-0.2;-0.2	5.52	4.38	0.52667	.	0.069288	0.64402	N	0.000018	T	0.67505	0.2900	M	0.88570	2.965	0.45056	D	0.998077	B;B	0.27679	0.034;0.185	B;B	0.29267	0.1;0.094	T	0.67647	-0.5617	10	0.59425	D	0.04	-10.3146	11.0015	0.47609	0.14:0.0:0.0:0.8599	.	286;335	Q9BRI3;Q9BRI3-2	ZNT2_HUMAN;.	M	286;335	ENSP00000363396:K286M;ENSP00000363394:K335M	ENSP00000363394:K335M	K	-	2	0	SLC30A2	26238353	1.000000	0.71417	0.965000	0.40720	0.644000	0.38419	2.805000	0.47939	0.912000	0.36772	0.379000	0.24179	AAG	SLC30A2	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000158014		0.587	SLC30A2-001	KNOWN	basic|CCDS	protein_coding	SLC30A2	HGNC	protein_coding	OTTHUMT00000019742.1	-	0.00	26	0	T	NM_032513		26365766	-1	tier1	-	no_errors	ENST00000374276	ensembl	human	known	74_37	missense	11.11	40	5	SNP	1.000	A
SLC7A9	11136	genome.wustl.edu	37	19	33333110	33333110	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:33333110C>T	ENST00000023064.4	-	11	1379	c.1188G>A	c.(1186-1188)atG>atA	p.M396I	SLC7A9_ENST00000590341.1_Missense_Mutation_p.M396I|SLC7A9_ENST00000587772.1_Missense_Mutation_p.M396I	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	396					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	TTGTAAATCTCATCACGATGA	0.418																																					GBM(181;1335 2108 9644 44178 46689)												0													91.0	90.0	90.0					19																	33333110		2203	4300	6503	SO:0001583	missense	0			AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.1188G>A	19.37:g.33333110C>T	ENSP00000023064:p.Met396Ile		B2R9A6	Missense_Mutation	SNP	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	p.M396I	ENST00000023064.4	37	c.1188	CCDS12425.1	19	.	.	.	.	.	.	.	.	.	.	C	19.22	3.786482	0.70337	.	.	ENSG00000021488	ENST00000023064	D	0.88509	-2.39	5.71	5.71	0.89125	Amino acid permease domain (1);	0.034723	0.85682	D	0.000000	D	0.90369	0.6986	L	0.55213	1.73	0.80722	D	1	P;P	0.43352	0.804;0.804	P;P	0.47251	0.542;0.542	D	0.90878	0.4751	10	0.72032	D	0.01	.	19.4554	0.94886	0.0:1.0:0.0:0.0	.	396;396	Q53FY4;P82251	.;BAT1_HUMAN	I	396	ENSP00000023064:M396I	ENSP00000023064:M396I	M	-	3	0	SLC7A9	38024950	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	7.137000	0.77295	2.681000	0.91329	0.655000	0.94253	ATG	SLC7A9	-	pfam_AA-permease/SLC12A_dom,pirsf_AA/rel_permease1	ENSG00000021488		0.418	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A9	HGNC	protein_coding	OTTHUMT00000450585.1	-	0.00	27	0	C			33333110	-1	tier1	-	no_errors	ENST00000023064	ensembl	human	known	74_37	missense	9.52	38	4	SNP	1.000	T
SLCO1C1	53919	genome.wustl.edu	37	12	20903690	20903690	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:20903690G>C	ENST00000266509.2	+	14	2248	c.1880G>C	c.(1879-1881)aGa>aCa	p.R627T	SLCO1C1_ENST00000545604.1_Missense_Mutation_p.R627T|SLCO1C1_ENST00000545102.1_Missense_Mutation_p.R509T|SLCO1C1_ENST00000381552.1_Missense_Mutation_p.R627T|SLCO1C1_ENST00000540354.1_Missense_Mutation_p.R578T	NM_017435.4	NP_059131.1	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family, member 1C1	627					sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	60	Esophageal squamous(101;0.149)				Conjugated Estrogens(DB00286)|Dextrothyroxine(DB00509)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprostone(DB00917)|Estradiol(DB00783)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Meclofenamic acid(DB00939)|Methotrexate(DB00563)|Ouabain(DB01092)|Phenytoin(DB00252)|Probenecid(DB01032)	TGTGGAAGTAGAGGATCATGC	0.388																																																	0													133.0	122.0	126.0					12																	20903690		2203	4300	6503	SO:0001583	missense	0			AF260704	CCDS8683.1, CCDS53757.1, CCDS53758.1, CCDS53759.1	12p12.2	2013-05-22	2003-11-25	2003-11-26	ENSG00000139155	ENSG00000139155		"""Solute carriers"""	13819	protein-coding gene	gene with protein product		613389	"""solute carrier family 21 (organic anion transporter), member 14"""	SLC21A14			Standard	NM_017435		Approved	OATP-F, OATP1C1, OATP1	uc010sii.2	Q9NYB5	OTTHUMG00000168966	ENST00000266509.2:c.1880G>C	12.37:g.20903690G>C	ENSP00000266509:p.Arg627Thr		B7Z251|B7Z3Q3|B7Z8P1|F5GZD6|Q5JPA4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.R627T	ENST00000266509.2	37	c.1880	CCDS8683.1	12	.	.	.	.	.	.	.	.	.	.	G	15.54	2.864845	0.51482	.	.	ENSG00000139155	ENST00000545604;ENST00000540354;ENST00000266509;ENST00000381552;ENST00000545102	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.32	0.412	0.16397	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.322024	0.36665	N	0.002468	T	0.56731	0.2005	M	0.84433	2.695	0.32988	D	0.524605	P;P;B;B	0.37824	0.609;0.562;0.293;0.07	B;P;P;B	0.51742	0.326;0.678;0.456;0.217	T	0.65274	-0.6208	10	0.46703	T	0.11	.	9.2133	0.37331	0.4527:0.0:0.5473:0.0	.	509;578;627;627	F5GZD6;B7Z3Q3;Q5JPA4;Q9NYB5	.;.;.;SO1C1_HUMAN	T	627;578;627;627;509	ENSP00000444149:R627T;ENSP00000438665:R578T;ENSP00000266509:R627T;ENSP00000370964:R627T;ENSP00000444527:R509T	ENSP00000266509:R627T	R	+	2	0	SLCO1C1	20794957	0.063000	0.20901	0.850000	0.33497	0.989000	0.77384	0.276000	0.18716	0.122000	0.18314	-0.136000	0.14681	AGA	SLCO1C1	-	pfam_OA_transporter,tigrfam_OA_transporter	ENSG00000139155		0.388	SLCO1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1C1	HGNC	protein_coding	OTTHUMT00000401765.1	-	0.00	59	0	G	NM_017435		20903690	+1	tier1	-	no_errors	ENST00000381552	ensembl	human	known	74_37	missense	25.40	47	16	SNP	0.099	C
SMARCAD1	56916	genome.wustl.edu	37	4	95199585	95199585	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:95199585G>C	ENST00000354268.4	+	17	2168	c.2095G>C	c.(2095-2097)Gag>Cag	p.E699Q	SMARCAD1_ENST00000457823.2_Missense_Mutation_p.E699Q|SMARCAD1_ENST00000509418.1_Missense_Mutation_p.E269Q			Q9H4L7	SMRCD_HUMAN	SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1	699					ATP-dependent chromatin remodeling (GO:0043044)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|chromosome separation (GO:0051304)|DNA double-strand break processing (GO:0000729)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|nucleotide metabolic process (GO:0009117)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|regulation of DNA recombination (GO:0000018)	heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|liver(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	44				OV - Ovarian serous cystadenocarcinoma(123;4.33e-08)		ATCAGCAGATGAGCAAAGCAT	0.289																																																	0													39.0	47.0	44.0					4																	95199585		2187	4282	6469	SO:0001583	missense	0			AB032948	CCDS3639.1, CCDS47101.1, CCDS58914.1	4q22-q23	2008-02-05			ENSG00000163104	ENSG00000163104			18398	protein-coding gene	gene with protein product		612761				11031099	Standard	NM_001128430		Approved	ETL1, DKFZP762K2015, KIAA1122, DKFZp762K2015	uc003htb.4	Q9H4L7	OTTHUMG00000130971	ENST00000354268.4:c.2095G>C	4.37:g.95199585G>C	ENSP00000346217:p.Glu699Gln		B7Z799|Q05D56|Q96SX1|Q9H017|Q9H860|Q9NPU9|Q9ULU7	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_P-loop_NTPase,superfamily_UBA-like,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_CUE,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E699Q	ENST00000354268.4	37	c.2095	CCDS3639.1	4	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057045	0.76074	.	.	ENSG00000163104	ENST00000359052;ENST00000457823;ENST00000354268;ENST00000509418	D;D;D;D	0.94046	-3.34;-3.34;-3.34;-3.24	5.55	5.55	0.83447	SNF2-related (1);	0.000000	0.49916	D	0.000123	D	0.93979	0.8072	L	0.45422	1.42	0.80722	D	1	P;P	0.43352	0.804;0.767	P;P	0.52031	0.688;0.561	D	0.93153	0.6551	10	0.41790	T	0.15	-17.6041	19.4964	0.95075	0.0:0.0:1.0:0.0	.	699;699	Q9H4L7;Q9H4L7-2	SMRCD_HUMAN;.	Q	699;699;699;269	ENSP00000351947:E699Q;ENSP00000415576:E699Q;ENSP00000346217:E699Q;ENSP00000423286:E269Q	ENSP00000346217:E699Q	E	+	1	0	SMARCAD1	95418608	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	9.344000	0.97050	2.616000	0.88540	0.650000	0.86243	GAG	SMARCAD1	-	pfam_SNF2_N,superfamily_P-loop_NTPase	ENSG00000163104		0.289	SMARCAD1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMARCAD1	HGNC	protein_coding	OTTHUMT00000253583.1	-	0.00	46	0	G	NM_020159		95199585	+1	tier1	-	no_errors	ENST00000359052	ensembl	human	known	74_37	missense	19.23	42	10	SNP	1.000	C
SMG6	23293	genome.wustl.edu	37	17	2203562	2203562	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:2203562C>T	ENST00000263073.6	-	2	535	c.485G>A	c.(484-486)cGg>cAg	p.R162Q	SMG6_ENST00000544865.1_Missense_Mutation_p.R131Q	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	162	Interaction with telomeric DNA.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)	p.R162L(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CTCCTCCACCCGACTGGCGGA	0.463																																					Melanoma(59;28 1088 11621 25887 46638 50814)												1	Substitution - Missense(1)	lung(1)											160.0	173.0	169.0					17																	2203562		2203	4300	6503	SO:0001583	missense	0			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.485G>A	17.37:g.2203562C>T	ENSP00000263073:p.Arg162Gln		B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	pfam_EST1,smart_PIN_dom	p.R162Q	ENST00000263073.6	37	c.485	CCDS11016.1	17	.	.	.	.	.	.	.	.	.	.	C	10.09	1.256028	0.22965	.	.	ENSG00000070366	ENST00000263073;ENST00000544865	T;T	0.08984	3.03;3.03	5.48	2.14	0.27477	.	1.158280	0.06033	N	0.653493	T	0.08088	0.0202	L	0.29908	0.895	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.40251	-0.9573	10	0.54805	T	0.06	-0.2178	7.9834	0.30196	0.0:0.6528:0.0:0.3472	.	162	Q86US8	EST1A_HUMAN	Q	162;131	ENSP00000263073:R162Q;ENSP00000443920:R131Q	ENSP00000263073:R162Q	R	-	2	0	SMG6	2150312	0.000000	0.05858	0.000000	0.03702	0.608000	0.37181	0.338000	0.19858	0.194000	0.20326	0.655000	0.94253	CGG	SMG6	-	NULL	ENSG00000070366		0.463	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	-	0.00	59	0	C			2203562	-1	tier1	-	no_errors	ENST00000263073	ensembl	human	known	74_37	missense	24.19	47	15	SNP	0.002	T
SNRNP200	23020	genome.wustl.edu	37	2	96956138	96956138	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:96956138C>T	ENST00000323853.5	-	20	2745	c.2668G>A	c.(2668-2670)Gaa>Aaa	p.E890K	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	890	Helicase C-terminal 1. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						ATCTGGCTTTCAATAGGAAGT	0.483																																																	0													174.0	163.0	167.0					2																	96956138		2203	4300	6503	SO:0001583	missense	0			AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.2668G>A	2.37:g.96956138C>T	ENSP00000317123:p.Glu890Lys		O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	pfam_Sec63-dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_P-loop_NTPase,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Sec63-dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E890K	ENST00000323853.5	37	c.2668	CCDS2020.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.540125	0.96474	.	.	ENSG00000144028	ENST00000323853;ENST00000540328	T	0.45276	0.9	5.74	5.74	0.90152	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.75184	0.3815	H	0.94886	3.595	0.80722	D	1	D	0.76494	0.999	D	0.72338	0.977	T	0.82157	-0.0596	10	0.87932	D	0	-26.0753	18.7061	0.91639	0.0:1.0:0.0:0.0	.	890	O75643	U520_HUMAN	K	890;565	ENSP00000317123:E890K	ENSP00000317123:E890K	E	-	1	0	SNRNP200	96319865	1.000000	0.71417	0.999000	0.59377	0.948000	0.59901	7.794000	0.85869	2.712000	0.92718	0.563000	0.77884	GAA	SNRNP200	-	superfamily_P-loop_NTPase,pfscan_Helicase_C	ENSG00000144028		0.483	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP200	HGNC	protein_coding	OTTHUMT00000252846.2	-	0.00	49	0	C	NM_014014		96956138	-1	tier1	-	no_errors	ENST00000323853	ensembl	human	known	74_37	missense	26.67	22	8	SNP	1.000	T
SNX11	29916	genome.wustl.edu	37	17	46198856	46198856	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:46198856G>T	ENST00000393405.2	+	8	1153	c.799G>T	c.(799-801)Gtt>Ttt	p.V267F	SNX11_ENST00000580219.1_Missense_Mutation_p.V259F|SNX11_ENST00000452859.2_Missense_Mutation_p.V123F|SNX11_ENST00000359238.2_Missense_Mutation_p.V267F|SNX11_ENST00000439357.2_Missense_Mutation_p.V206F|SNX11_ENST00000582104.1_Missense_Mutation_p.V259F	NM_152244.1	NP_689450.1	Q9Y5W9	SNX11_HUMAN	sorting nexin 11	267					intracellular protein transport (GO:0006886)|vesicle organization (GO:0016050)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol phosphate binding (GO:1901981)			breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|prostate(1)|skin(1)	14						GTTAGAAACAGTTTTGGAAAA	0.537																																																	0													109.0	103.0	105.0					17																	46198856		2203	4300	6503	SO:0001583	missense	0			AF121861	CCDS11526.1	17q21.32	2011-05-03			ENSG00000002919	ENSG00000002919		"""Sorting nexins"""	14975	protein-coding gene	gene with protein product		614906					Standard	NM_013323		Approved		uc002ing.1	Q9Y5W9		ENST00000393405.2:c.799G>T	17.37:g.46198856G>T	ENSP00000377059:p.Val267Phe		B3KRL6|B4DPY5|D3DTV0|Q53YC0|Q9H885	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.V267F	ENST00000393405.2	37	c.799	CCDS11526.1	17	.	.	.	.	.	.	.	.	.	.	G	13.71	2.318437	0.40996	.	.	ENSG00000002919	ENST00000452859;ENST00000393405;ENST00000439357;ENST00000359238	T;T	0.69306	-0.39;-0.39	5.64	2.51	0.30379	.	0.945841	0.08834	N	0.886807	T	0.52964	0.1767	L	0.40543	1.245	0.09310	N	1	P;B;B	0.37015	0.578;0.278;0.278	B;B;B	0.28305	0.088;0.088;0.088	T	0.42932	-0.9422	10	0.72032	D	0.01	-13.7362	7.7085	0.28663	0.0861:0.3475:0.5664:0.0	.	206;259;267	B4DKH7;B4DPY5;Q9Y5W9	.;.;SNX11_HUMAN	F	123;267;206;267	ENSP00000377059:V267F;ENSP00000352175:V267F	ENSP00000352175:V267F	V	+	1	0	SNX11	43553855	0.012000	0.17670	0.003000	0.11579	0.788000	0.44548	1.876000	0.39588	0.444000	0.26612	0.650000	0.86243	GTT	SNX11	-	NULL	ENSG00000002919		0.537	SNX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX11	HGNC	protein_coding	OTTHUMT00000443423.1	-	0.00	58	0	G			46198856	+1	tier1	-	no_errors	ENST00000359238	ensembl	human	known	74_37	missense	5.26	72	4	SNP	0.006	T
SORBS1	10580	genome.wustl.edu	37	10	97194456	97194456	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:97194456C>A	ENST00000361941.3	-	3	121	c.95G>T	c.(94-96)cGc>cTc	p.R32L	SORBS1_ENST00000371239.1_Intron|SORBS1_ENST00000474353.2_Intron|SORBS1_ENST00000353505.5_Missense_Mutation_p.R32L|SORBS1_ENST00000347291.4_Missense_Mutation_p.R32L|SORBS1_ENST00000371247.2_Missense_Mutation_p.R32L|SORBS1_ENST00000393949.1_Missense_Mutation_p.R32L|SORBS1_ENST00000306402.6_Missense_Mutation_p.R32L|SORBS1_ENST00000371246.2_Missense_Mutation_p.R32L|SORBS1_ENST00000371227.4_Missense_Mutation_p.R32L|SORBS1_ENST00000354106.3_Missense_Mutation_p.R32L|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000277982.5_Missense_Mutation_p.R32L|SORBS1_ENST00000371245.3_Missense_Mutation_p.R32L|SORBS1_ENST00000607232.1_Intron	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1									p.R32H(2)		NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AGAGCGTGCGCGTAAAGGGTC	0.483																																																	2	Substitution - Missense(2)	endometrium(2)											90.0	88.0	89.0					10																	97194456		2203	4300	6503	SO:0001583	missense	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.95G>T	10.37:g.97194456C>A	ENSP00000355136:p.Arg32Leu			Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain	p.R32L	ENST00000361941.3	37	c.95	CCDS31255.1	10	.	.	.	.	.	.	.	.	.	.	C	14.77	2.636077	0.47049	.	.	ENSG00000095637	ENST00000371245;ENST00000306402;ENST00000371247;ENST00000371227;ENST00000371246;ENST00000393949;ENST00000353505;ENST00000347291;ENST00000361941;ENST00000277982;ENST00000354106	T;T;T;T;T;T;T;T;T;T;T	0.10960	3.4;2.83;3.14;3.04;3.44;2.93;3.4;2.82;3.14;3.44;2.93	5.82	4.91	0.64330	.	0.000000	0.42964	D	0.000638	T	0.12433	0.0302	N	0.19112	0.55	0.18873	N	0.999989	P;D;P;B;P;D	0.61697	0.628;0.99;0.811;0.304;0.811;0.982	B;P;B;B;B;P	0.52856	0.203;0.711;0.309;0.062;0.229;0.686	T	0.08330	-1.0727	10	0.52906	T	0.07	-8.2186	11.7537	0.51863	0.0:0.8645:0.0:0.1355	.	32;32;32;32;32;32	Q9BX66-11;Q9BX66-9;Q9BX66-3;Q9BX66;Q9BX66-2;Q9BX66-6	.;.;.;SRBS1_HUMAN;.;.	L	32	ENSP00000360291:R32L;ENSP00000302556:R32L;ENSP00000360293:R32L;ENSP00000360271:R32L;ENSP00000360292:R32L;ENSP00000377521:R32L;ENSP00000343998:R32L;ENSP00000277985:R32L;ENSP00000355136:R32L;ENSP00000277982:R32L;ENSP00000277984:R32L	ENSP00000277982:R32L	R	-	2	0	SORBS1	97184446	1.000000	0.71417	0.959000	0.39883	0.515000	0.34225	2.143000	0.42187	2.767000	0.95098	0.655000	0.94253	CGC	SORBS1	-	NULL	ENSG00000095637		0.483	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1		0.00	31	0	C			97194456	-1			no_errors	ENST00000361941	ensembl	human	known	74_37	missense	11.11	16	2	SNP	0.985	A
SPAG9	9043	genome.wustl.edu	37	17	49077040	49077041	+	Frame_Shift_Ins	INS	-	-	T	rs371303534		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	-	-					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:49077040_49077041insT	ENST00000262013.7	-	14	1853_1854	c.1645_1646insA	c.(1645-1647)aggfs	p.R549fs	SPAG9_ENST00000357122.4_Frame_Shift_Ins_p.R535fs|SPAG9_ENST00000510283.1_Frame_Shift_Ins_p.R392fs|SPAG9_ENST00000505279.1_Frame_Shift_Ins_p.R535fs	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	549					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)		p.R535fs*28(1)		NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			AATGCTTGACCTTTTTTTTTCC	0.322																																																	1	Deletion - Frameshift(1)	large_intestine(1)																																								SO:0001589	frameshift_variant	0			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.1646dupA	17.37:g.49077049_49077049dupT	ENSP00000262013:p.Arg549fs		A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Frame_Shift_Ins	INS	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.R549fs	ENST00000262013.7	37	c.1646_1645	CCDS45740.1	17																																																																																			SPAG9	-	NULL	ENSG00000008294		0.322	SPAG9-001	KNOWN	basic|CCDS	protein_coding	SPAG9	HGNC	protein_coding	OTTHUMT00000368543.2		0.00	63	0	0	NM_003971		49077041	-1			no_errors	ENST00000262013	ensembl	human	known	74_37	frame_shift_ins	7.41	75	6	INS	1.000:1.000	T
SPATA13	221178	genome.wustl.edu	37	13	24798292	24798292	+	Intron	SNP	G	G	A	rs565957473		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr13:24798292G>A	ENST00000382095.4	+	2	185				SPATA13_ENST00000424834.2_Missense_Mutation_p.V409I|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.V409I|SPATA13_ENST00000382108.3_Missense_Mutation_p.V409I	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13						cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		TGACACTGCCGTATTTCCTCT	0.597																																																	0													40.0	42.0	41.0					13																	24798292		692	1591	2283	SO:0001627	intron_variant	0			AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.-222-25323G>A	13.37:g.24798292G>A			A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.V409I	ENST00000382095.4	37	c.1225	CCDS9305.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.12|13.12	2.142912|2.142912	0.37825|0.37825	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000424834|ENST00000382108	.|T	.|0.76578	.|-1.03	4.45|4.45	1.41|1.41	0.22369|0.22369	.|.	.|0.867657	.|0.08990	.|U	.|0.864523	T|T	0.68256|0.68256	0.2981|0.2981	L|L	0.29908|0.29908	0.895|0.895	0.26088|0.26088	N|N	0.980991|0.980991	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.58160|0.58160	-0.7685|-0.7685	5|8	.|0.32370	.|T	.|0.25	.|.	8.1753|8.1753	0.31278|0.31278	0.0862:0.3009:0.6129:0.0|0.0862:0.3009:0.6129:0.0	.|.	.|.	.|.	.|.	H|I	446|409	.|ENSP00000371542:V409I	.|ENSP00000371542:V409I	R|V	+|+	2|1	0|0	SPATA13|SPATA13	23696292|23696292	0.038000|0.038000	0.19896|0.19896	0.005000|0.005000	0.12908|0.12908	0.073000|0.073000	0.16967|0.16967	1.204000|1.204000	0.32296|0.32296	0.810000|0.810000	0.34279|0.34279	0.478000|0.478000	0.44815|0.44815	CGT|GTA	SPATA13	-	NULL	ENSG00000182957		0.597	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPATA13	HGNC	protein_coding	OTTHUMT00000044180.2	-	0.00	67	0	G	NM_153023		24798292	+1	tier1	-	no_errors	ENST00000382108	ensembl	human	known	74_37	missense	47.54	32	29	SNP	0.013	A
SRRM2	23524	genome.wustl.edu	37	16	2812373	2812373	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:2812373C>T	ENST00000301740.8	+	11	2393	c.1844C>T	c.(1843-1845)tCt>tTt	p.S615F		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	615	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGGGGCAGGTCTCGGTCTAGA	0.612																																																	0													62.0	63.0	63.0					16																	2812373		2198	4300	6498	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.1844C>T	16.37:g.2812373C>T	ENSP00000301740:p.Ser615Phe		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.S615F	ENST00000301740.8	37	c.1844	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	C	14.68	2.606861	0.46527	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	T	0.32988	1.43	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000011	T	0.45034	0.1322	L	0.27053	0.805	0.45015	D	0.99803	D	0.71674	0.998	D	0.80764	0.994	T	0.37709	-0.9694	10	0.72032	D	0.01	-12.2892	17.7728	0.88497	0.0:1.0:0.0:0.0	.	615	Q9UQ35	SRRM2_HUMAN	F	615;615;580	ENSP00000301740:S615F	ENSP00000301740:S615F	S	+	2	0	SRRM2	2752374	1.000000	0.71417	0.999000	0.59377	0.912000	0.54170	3.626000	0.54245	2.801000	0.96364	0.655000	0.94253	TCT	SRRM2	-	NULL	ENSG00000167978		0.612	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	-	0.00	55	0	C			2812373	+1	tier1	-	no_errors	ENST00000301740	ensembl	human	known	74_37	missense	17.39	38	8	SNP	1.000	T
SRRM2	23524	genome.wustl.edu	37	16	2812379	2812379	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:2812379C>G	ENST00000301740.8	+	11	2399	c.1850C>G	c.(1849-1851)tCt>tGt	p.S617C		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	617	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGGTCTCGGTCTAGAACACCT	0.597																																																	0													67.0	68.0	68.0					16																	2812379		2198	4300	6498	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.1850C>G	16.37:g.2812379C>G	ENSP00000301740:p.Ser617Cys		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.S617C	ENST00000301740.8	37	c.1850	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	C	14.92	2.680152	0.47886	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	T	0.28069	1.63	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000014	T	0.43077	0.1231	N	0.19112	0.55	0.41174	D	0.986186	D	0.76494	0.999	D	0.80764	0.994	T	0.41770	-0.9490	10	0.87932	D	0	-12.4907	17.7728	0.88497	0.0:1.0:0.0:0.0	.	617	Q9UQ35	SRRM2_HUMAN	C	617;617;582	ENSP00000301740:S617C	ENSP00000301740:S617C	S	+	2	0	SRRM2	2752380	0.998000	0.40836	0.998000	0.56505	0.966000	0.64601	4.907000	0.63300	2.801000	0.96364	0.655000	0.94253	TCT	SRRM2	-	NULL	ENSG00000167978		0.597	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	-	0.00	54	0	C			2812379	+1	tier1	-	no_errors	ENST00000301740	ensembl	human	known	74_37	missense	17.78	37	8	SNP	1.000	G
SRRM2	23524	genome.wustl.edu	37	16	2812817	2812817	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:2812817C>G	ENST00000301740.8	+	11	2837	c.2288C>G	c.(2287-2289)tCt>tGt	p.S763C		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	763	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AGGTCTCTCTCTTCACCACGG	0.493																																																	0													128.0	132.0	131.0					16																	2812817		2198	4300	6498	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.2288C>G	16.37:g.2812817C>G	ENSP00000301740:p.Ser763Cys		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.S763C	ENST00000301740.8	37	c.2288	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	C	5.519	0.280700	0.10458	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933;ENST00000426305	T	0.38401	1.14	5.62	5.62	0.85841	.	0.000000	0.64402	D	0.000011	T	0.43765	0.1262	L	0.27053	0.805	0.40077	D	0.976085	D	0.76494	0.999	D	0.69142	0.962	T	0.40289	-0.9571	10	0.59425	D	0.04	-11.9833	10.5656	0.45171	0.0:0.9125:0.0:0.0875	.	763	Q9UQ35	SRRM2_HUMAN	C	763;763;15;728	ENSP00000301740:S763C	ENSP00000301740:S763C	S	+	2	0	SRRM2	2752818	1.000000	0.71417	0.994000	0.49952	0.529000	0.34654	3.010000	0.49559	2.638000	0.89438	0.655000	0.94253	TCT	SRRM2	-	NULL	ENSG00000167978		0.493	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1		0.00	32	0	C			2812817	+1			no_errors	ENST00000301740	ensembl	human	known	74_37	missense	11.76	30	4	SNP	1.000	G
SRRM2	23524	genome.wustl.edu	37	16	2812877	2812877	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:2812877C>T	ENST00000301740.8	+	11	2897	c.2348C>T	c.(2347-2349)tCc>tTc	p.S783F		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	783	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TCAGGGTCTTCCCCATGCCCT	0.532																																																	0													187.0	188.0	188.0					16																	2812877		2198	4300	6498	SO:0001583	missense	0			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.2348C>T	16.37:g.2812877C>T	ENSP00000301740:p.Ser783Phe		A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.S783F	ENST00000301740.8	37	c.2348	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	C	9.810	1.182895	0.21870	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000544933;ENST00000426305	T	0.34072	1.38	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000011	T	0.47116	0.1428	L	0.27053	0.805	0.39765	D	0.972087	D	0.65815	0.995	D	0.63597	0.916	T	0.49153	-0.8969	10	0.72032	D	0.01	-12.2259	17.3941	0.87440	0.0:1.0:0.0:0.0	.	783	Q9UQ35	SRRM2_HUMAN	F	783;783;35;748	ENSP00000301740:S783F	ENSP00000301740:S783F	S	+	2	0	SRRM2	2752878	1.000000	0.71417	0.989000	0.46669	0.916000	0.54674	4.492000	0.60334	2.709000	0.92574	0.655000	0.94253	TCC	SRRM2	-	NULL	ENSG00000167978		0.532	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	-	0.00	33	0	C			2812877	+1	tier1	-	no_errors	ENST00000301740	ensembl	human	known	74_37	missense	10.64	42	5	SNP	1.000	T
STAM	8027	genome.wustl.edu	37	10	17737170	17737170	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:17737170G>T	ENST00000377524.3	+	7	873	c.658G>T	c.(658-660)Gac>Tac	p.D220Y	RP11-390B4.3_ENST00000445235.1_RNA|STAM_ENST00000540523.1_Missense_Mutation_p.D109Y	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	220	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						TGCTATATATGACTTTGAAGC	0.363																																																	0													110.0	101.0	104.0					10																	17737170		2203	4300	6503	SO:0001583	missense	0			U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.658G>T	10.37:g.17737170G>T	ENSP00000366746:p.Asp220Tyr		B0YJ99|D3DRU5|Q8N6D9	Missense_Mutation	SNP	pfam_VHS,pfam_SH3_domain,pfam_SH3_2,pfam_Ubiquitin-int_motif,superfamily_ENTH_VHS,superfamily_SH3_domain,smart_VHS_subgr,smart_SH3_domain,pfscan_SH3_domain,pfscan_Ubiquitin-int_motif,pfscan_VHS,prints_SH3_domain,prints_p67phox	p.D220Y	ENST00000377524.3	37	c.658	CCDS7122.1	10	.	.	.	.	.	.	.	.	.	.	G	30	5.051861	0.93793	.	.	ENSG00000136738	ENST00000377524;ENST00000377500;ENST00000540523	T;T	0.67698	-0.28;-0.28	5.88	5.88	0.94601	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	D	0.89608	0.6764	H	0.97874	4.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92705	0.6178	10	0.87932	D	0	-24.0441	20.2187	0.98312	0.0:0.0:1.0:0.0	.	220	Q92783	STAM1_HUMAN	Y	220;123;109	ENSP00000366746:D220Y;ENSP00000438073:D109Y	ENSP00000366721:D123Y	D	+	1	0	STAM	17777176	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.780000	0.95670	0.655000	0.94253	GAC	STAM	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_p67phox	ENSG00000136738		0.363	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAM	HGNC	protein_coding	OTTHUMT00000047039.1	-	0.00	71	0	G	NM_003473		17737170	+1	tier1	-	no_errors	ENST00000377524	ensembl	human	known	74_37	missense	15.15	56	10	SNP	1.000	T
STAT5B	6777	genome.wustl.edu	37	17	40359718	40359718	+	Silent	SNP	A	A	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:40359718A>G	ENST00000293328.3	-	16	2103	c.1935T>C	c.(1933-1935)ccT>ccC	p.P645P		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	645	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)	p.P645P(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	TGGTGGTAAAAGGCATCAGAT	0.393																																																	1	Substitution - coding silent(1)	kidney(1)											103.0	102.0	103.0					17																	40359718		2203	4300	6503	SO:0001819	synonymous_variant	0			BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.1935T>C	17.37:g.40359718A>G			Q8WWS8	Silent	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.P645	ENST00000293328.3	37	c.1935	CCDS11423.1	17																																																																																			STAT5B	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000173757		0.393	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5B	HGNC	protein_coding	OTTHUMT00000319797.1	-	0.00	30	0	A	NM_012448		40359718	-1	tier1	-	no_errors	ENST00000293328	ensembl	human	known	74_37	silent	6.56	57	4	SNP	0.944	G
SYAP1	94056	genome.wustl.edu	37	X	16761850	16761850	+	Silent	SNP	T	T	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chrX:16761850T>A	ENST00000380155.3	+	5	555	c.462T>A	c.(460-462)ccT>ccA	p.P154P		NM_032796.3	NP_116185.2	Q96A49	SYAP1_HUMAN	synapse associated protein 1	154						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				endometrium(3)|lung(4)|pancreas(1)|prostate(1)|skin(1)	10	Hepatocellular(33;0.0997)					TTCGTGACCCTCCGGCTGGCG	0.408																																																	0													152.0	146.0	148.0					X																	16761850		2203	4300	6503	SO:0001819	synonymous_variant	0			AF338728	CCDS14177.1	Xp22.31	2010-06-25	2010-06-25		ENSG00000169895	ENSG00000169895			16273	protein-coding gene	gene with protein product	"""SAP47 homolog (Drosophila)"""					11483580	Standard	NM_032796		Approved	FLJ14495, PRO3113	uc004cxp.3	Q96A49	OTTHUMG00000021192	ENST00000380155.3:c.462T>A	X.37:g.16761850T>A			Q68CP1|Q96C60|Q96JQ6|Q96T20	Silent	SNP	pfam_BSD,smart_BSD,pfscan_BSD	p.P154	ENST00000380155.3	37	c.462	CCDS14177.1	X																																																																																			SYAP1	-	NULL	ENSG00000169895		0.408	SYAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYAP1	HGNC	protein_coding	OTTHUMT00000055904.1	-	0.00	53	0	T	NM_032796		16761850	+1	tier1	-	no_errors	ENST00000380155	ensembl	human	known	74_37	silent	10.42	43	5	SNP	0.994	A
TAPBP	6892	genome.wustl.edu	37	6	33272235	33272235	+	Missense_Mutation	SNP	G	G	A	rs374308480		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:33272235G>A	ENST00000489157.1	-	4	1000	c.788C>T	c.(787-789)tCg>tTg	p.S263L	TAPBP_ENST00000426633.2_Missense_Mutation_p.S350L|TAPBP_ENST00000434618.2_Missense_Mutation_p.S350L|TAPBP_ENST00000456592.2_Missense_Mutation_p.S350L|TAPBP_ENST00000475304.1_Missense_Mutation_p.S368L			O15533	TPSN_HUMAN	TAP binding protein (tapasin)	350					amide transport (GO:0042886)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|peptide antigen stabilization (GO:0050823)|peptide transport (GO:0015833)|protein complex assembly (GO:0006461)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|integral component of membrane (GO:0016021)|MHC class I peptide loading complex (GO:0042824)	MHC class I protein binding (GO:0042288)|peptide antigen binding (GO:0042605)|peptide antigen-transporting ATPase activity (GO:0015433)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)|unfolded protein binding (GO:0051082)			endometrium(2)|large_intestine(5)|lung(8)|ovary(3)	18						GCGCAGGGCCGAGAGCCACCT	0.677																																																	0								G	LEU/SER,LEU/SER,LEU/SER	0,4402		0,0,2201	24.0	27.0	26.0		1049,1049,788	5.5	1.0	6		26	1,8587		0,1,4293	no	missense,missense,missense	TAPBP	NM_003190.4,NM_172208.2,NM_172209.2	145,145,145	0,1,6494	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging,probably-damaging,probably-damaging	350/449,350/505,263/362	33272235	1,12989	2201	4294	6495	SO:0001583	missense	0			Y13582	CCDS34426.1, CCDS34427.1, CCDS34428.1, CCDS34427.2, CCDS34428.2	6p21.3	2014-09-17			ENSG00000231925	ENSG00000231925		"""Immunoglobulin superfamily / C1-set domain containing"""	11566	protein-coding gene	gene with protein product		601962				9238042	Standard	NM_003190		Approved	TAPA	uc003odz.3	O15533	OTTHUMG00000031090	ENST00000489157.1:c.788C>T	6.37:g.33272235G>A	ENSP00000419659:p.Ser263Leu		A2AB91|A2ABC0|B0V003|B0V0A6|B2ZUA4|E9PGM2|O15210|O15272|Q5STJ8|Q5STK6|Q5STQ5|Q5STQ6|Q66K65|Q96KK7|Q9HAN8|Q9UEE0|Q9UEE4|Q9UIZ6|Q9Y6K2	Missense_Mutation	SNP	pfam_Ig_C1-set,pfscan_Ig-like_dom,prints_Tapasin	p.S350L	ENST00000489157.1	37	c.1049	CCDS34427.2	6	.	.	.	.	.	.	.	.	.	.	G	23.7	4.450426	0.84101	0.0	1.16E-4	ENSG00000231925	ENST00000434618;ENST00000475304;ENST00000489157;ENST00000426633;ENST00000456592;ENST00000449540	T;T;T;T;T	0.16897	2.31;2.31;2.31;2.31;2.31	5.51	5.51	0.81932	Immunoglobulin-like (1);Immunoglobulin C1-set (1);Immunoglobulin-like fold (1);	0.185406	0.47455	D	0.000222	T	0.31167	0.0788	M	0.63428	1.95	0.42321	D	0.992257	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.998;0.998;0.999;0.999	T	0.02371	-1.1169	10	0.87932	D	0	-25.3199	14.905	0.70711	0.0:0.0:1.0:0.0	.	350;263;368;350;350	G5E9H8;E9PGM2;A2AB90;O15533-3;O15533	.;.;.;.;TPSN_HUMAN	L	350;368;263;350;350;350	ENSP00000395701:S350L;ENSP00000417949:S368L;ENSP00000419659:S263L;ENSP00000404833:S350L;ENSP00000387803:S350L	ENSP00000404833:S350L	S	-	2	0	TAPBP	33380213	0.999000	0.42202	0.953000	0.39169	0.777000	0.43975	4.921000	0.63397	2.598000	0.87819	0.498000	0.49722	TCG	TAPBP	-	pfam_Ig_C1-set,pfscan_Ig-like_dom,prints_Tapasin	ENSG00000231925		0.677	TAPBP-006	NOVEL	basic|exp_conf|CCDS	protein_coding	TAPBP	HGNC	protein_coding	OTTHUMT00000276425.2	-	0.00	47	0	G			33272235	-1	tier1	-	no_errors	ENST00000426633	ensembl	human	known	74_37	missense	18.60	70	16	SNP	0.980	A
TBC1D22A	25771	genome.wustl.edu	37	22	47507497	47507497	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr22:47507497C>G	ENST00000337137.4	+	12	1589	c.1423C>G	c.(1423-1425)Caa>Gaa	p.Q475E	TBC1D22A_ENST00000355704.3_Missense_Mutation_p.Q397E|TBC1D22A_ENST00000406733.1_Missense_Mutation_p.Q428E|TBC1D22A_ENST00000407381.3_Missense_Mutation_p.Q416E	NM_001284304.1|NM_001284305.1|NM_014346.2	NP_001271233.1|NP_001271234.1|NP_055161.1	Q8WUA7	TB22A_HUMAN	TBC1 domain family, member 22A	475							protein homodimerization activity (GO:0042803)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(3)|large_intestine(10)|lung(5)|ovary(2)|prostate(1)	22		all_cancers(38;4.44e-05)|all_epithelial(38;0.000507)|Breast(42;0.0488)|all_lung(38;0.0682)|Ovarian(80;0.0731)|all_neural(38;0.0966)|Glioma(61;0.222)|Lung SC(80;0.236)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0347)|BRCA - Breast invasive adenocarcinoma(115;0.231)		AAAAGATTTTCAAGTAAGTAA	0.368																																																	0													64.0	64.0	64.0					22																	47507497		2203	4300	6503	SO:0001583	missense	0			AK125705	CCDS14078.1, CCDS63511.1, CCDS63512.1, CCDS74877.1	22q13	2008-01-22	2005-01-05	2005-01-05	ENSG00000054611	ENSG00000054611			1309	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 4"""	C22orf4			Standard	XM_005261496		Approved		uc003bib.3	Q8WUA7	OTTHUMG00000150332	ENST00000337137.4:c.1423C>G	22.37:g.47507497C>G	ENSP00000336724:p.Gln475Glu		B0QYI2|B0QYI3|B9A6M3|Q5TE47|Q6ZUH2|Q92680|Q9BVD6|Q9UGG0|Q9UGT2|Q9UGU6|Q9UH25|Q9Y4W5	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.Q475E	ENST00000337137.4	37	c.1423	CCDS14078.1	22	.	.	.	.	.	.	.	.	.	.	C	23.0	4.361891	0.82353	.	.	ENSG00000054611	ENST00000337137;ENST00000407381;ENST00000355704;ENST00000406733	T;T;T;T	0.19806	2.12;2.12;2.12;2.12	5.3	5.3	0.74995	Rab-GAP/TBC domain (1);	0.057629	0.64402	D	0.000001	T	0.35219	0.0924	M	0.75777	2.31	0.80722	D	1	B;P;P;B	0.49961	0.21;0.919;0.93;0.21	B;P;P;B	0.47827	0.03;0.475;0.558;0.03	T	0.19289	-1.0310	10	0.56958	D	0.05	.	16.4417	0.83903	0.0:1.0:0.0:0.0	.	475;397;416;475	B9A6M3;Q8WUA7-2;B0QYI1;Q8WUA7	.;.;.;TB22A_HUMAN	E	475;416;397;428	ENSP00000336724:Q475E;ENSP00000384036:Q416E;ENSP00000347932:Q397E;ENSP00000385634:Q428E	ENSP00000336724:Q475E	Q	+	1	0	TBC1D22A	45886161	1.000000	0.71417	0.998000	0.56505	0.955000	0.61496	6.632000	0.74281	2.462000	0.83206	0.655000	0.94253	CAA	TBC1D22A	-	superfamily_Rab-GTPase-TBC_dom	ENSG00000054611		0.368	TBC1D22A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D22A	HGNC	protein_coding	OTTHUMT00000317600.3	-	0.00	56	0	C	NM_014346		47507497	+1	tier1	-	no_errors	ENST00000337137	ensembl	human	known	74_37	missense	32.08	36	17	SNP	1.000	G
TCEB3B	51224	genome.wustl.edu	37	18	44561247	44561247	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr18:44561247C>T	ENST00000332567.4	-	1	741	c.389G>A	c.(388-390)cGg>cAg	p.R130Q	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	130					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GCGTGCTGTCCGTCTGTGCTC	0.637																																																	0													56.0	65.0	62.0					18																	44561247		2202	4292	6494	SO:0001583	missense	0			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.389G>A	18.37:g.44561247C>T	ENSP00000331302:p.Arg130Gln		Q9P2V9	Missense_Mutation	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.R130Q	ENST00000332567.4	37	c.389	CCDS11932.1	18	.	.	.	.	.	.	.	.	.	.	c	0.039	-1.291034	0.01375	.	.	ENSG00000206181	ENST00000332567	T	0.06528	3.29	2.87	-5.74	0.02391	.	2.653420	0.01849	N	0.035797	T	0.07863	0.0197	N	0.20766	0.605	0.09310	N	1	D	0.89917	1.0	P	0.62382	0.901	T	0.49322	-0.8952	10	0.07644	T	0.81	-1.4217	3.7797	0.08676	0.0904:0.3524:0.3526:0.2046	.	130	Q8IYF1	ELOA2_HUMAN	Q	130	ENSP00000331302:R130Q	ENSP00000331302:R130Q	R	-	2	0	TCEB3B	42815245	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.355000	0.00247	-5.058000	0.00023	-1.656000	0.00753	CGG	TCEB3B	-	NULL	ENSG00000206181		0.637	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	HGNC	protein_coding	OTTHUMT00000255900.1	-	0.00	98	0	C	NM_016427		44561247	-1	tier1	-	no_errors	ENST00000332567	ensembl	human	known	74_37	missense	34.78	59	32	SNP	0.000	T
TCOF1	6949	genome.wustl.edu	37	5	149755735	149755735	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:149755735G>T	ENST00000504761.2	+	13	1984	c.1984G>T	c.(1984-1986)Ggc>Tgc	p.G662C	TCOF1_ENST00000394269.3_Missense_Mutation_p.G662C|TCOF1_ENST00000513346.1_Missense_Mutation_p.G662C|TCOF1_ENST00000439160.2_Missense_Mutation_p.G662C|TCOF1_ENST00000445265.2_Missense_Mutation_p.G585C|TCOF1_ENST00000451292.1_Missense_Mutation_p.G662C|TCOF1_ENST00000323668.7_Missense_Mutation_p.G585C|TCOF1_ENST00000377797.3_Missense_Mutation_p.G662C			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	662					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGTGCGAGTGGGCACCCAAGC	0.592																																																	0													114.0	129.0	124.0					5																	149755735		2203	4300	6503	SO:0001583	missense	0				CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.1984G>T	5.37:g.149755735G>T	ENSP00000421655:p.Gly662Cys		A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	pfam_TCS_treacle,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_Treacle-like_TCS	p.G662C	ENST00000504761.2	37	c.1984	CCDS54936.1	5	.	.	.	.	.	.	.	.	.	.	G	14.75	2.628028	0.46944	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000394269;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45;-0.45	4.79	-0.976	0.10286	Treacher Collins syndrome, treacle (1);	0.168005	0.28821	N	0.014039	T	0.75125	0.3807	M	0.80422	2.495	0.09310	N	1	D;D;D;D;D;D;D	0.89917	0.999;0.997;0.997;0.997;1.0;0.997;0.997	D;D;D;D;D;D;D	0.85130	0.969;0.912;0.912;0.912;0.997;0.912;0.912	T	0.62946	-0.6746	10	0.62326	D	0.03	-6.5249	3.2147	0.06695	0.4063:0.0:0.3679:0.2258	.	171;662;585;662;662;585;662	B4DRA2;Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8;Q13428-5	.;.;.;.;TCOF_HUMAN;.;.	C	662;662;585;585;662;662;662;662;662	ENSP00000400939:G662C;ENSP00000367028:G662C;ENSP00000409944:G585C;ENSP00000325223:G585C;ENSP00000406888:G662C;ENSP00000377811:G662C;ENSP00000390717:G662C;ENSP00000421655:G662C;ENSP00000427484:G662C	ENSP00000325223:G585C	G	+	1	0	TCOF1	149735928	0.975000	0.34042	0.001000	0.08648	0.008000	0.06430	1.287000	0.33284	0.022000	0.15160	0.561000	0.74099	GGC	TCOF1	-	pfam_TCS_treacle	ENSG00000070814		0.592	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCOF1	HGNC	protein_coding	OTTHUMT00000380552.1	-	0.00	18	0	G	NM_001008656		149755735	+1	tier1	-	no_errors	ENST00000451292	ensembl	human	known	74_37	missense	22.58	24	7	SNP	0.002	T
TENM4	26011	genome.wustl.edu	37	11	78443405	78443405	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:78443405C>T	ENST00000278550.7	-	21	3556	c.3094G>A	c.(3094-3096)Gcc>Acc	p.A1032T		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1032					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CAGGAGCTGGCGAAGGACGTC	0.517																																																	0													63.0	67.0	66.0					11																	78443405		1924	4127	6051	SO:0001583	missense	0			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.3094G>A	11.37:g.78443405C>T	ENSP00000278550:p.Ala1032Thr		A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.A1032T	ENST00000278550.7	37	c.3094	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129635	0.77549	.	.	ENSG00000149256	ENST00000278550	D	0.89552	-2.53	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	D	0.90497	0.7023	L	0.27053	0.805	0.58432	D	0.999999	D	0.89917	1.0	D	0.77557	0.99	D	0.89491	0.3757	9	.	.	.	.	18.0785	0.89435	0.0:1.0:0.0:0.0	.	1032	Q6N022	TEN4_HUMAN	T	1032	ENSP00000278550:A1032T	.	A	-	1	0	ODZ4	78121053	0.998000	0.40836	1.000000	0.80357	0.956000	0.61745	3.692000	0.54727	2.495000	0.84180	0.561000	0.74099	GCC	TENM4	-	NULL	ENSG00000149256		0.517	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2		0.00	50	0	C			78443405	-1			no_errors	ENST00000278550	ensembl	human	known	74_37	missense	7.14	52	4	SNP	1.000	T
TLN1	7094	genome.wustl.edu	37	9	35700035	35700035	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr9:35700035C>T	ENST00000314888.9	-	50	7057	c.6704G>A	c.(6703-6705)cGa>cAa	p.R2235Q	TLN1_ENST00000540444.1_Missense_Mutation_p.R2123Q	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	2235					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GTGCAGGGCTCGAAGCCGCAC	0.567																																																	0													78.0	77.0	78.0					9																	35700035		2203	4300	6503	SO:0001583	missense	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.6704G>A	9.37:g.35700035C>T	ENSP00000316029:p.Arg2235Gln		A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ_dom,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ_dom,pfscan_FERM_domain,pfscan_ILWEQ_dom	p.R2235Q	ENST00000314888.9	37	c.6704	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	C	35	5.594747	0.96602	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.69040	-0.37;-0.36	5.37	5.37	0.77165	.	0.062767	0.64402	D	0.000006	T	0.68366	0.2993	M	0.81341	2.54	0.80722	D	1	D	0.63046	0.992	B	0.37989	0.262	T	0.77487	-0.2569	10	0.66056	D	0.02	-5.0699	18.7269	0.91717	0.0:1.0:0.0:0.0	.	2235	Q9Y490	TLN1_HUMAN	Q	2235;2123	ENSP00000316029:R2235Q;ENSP00000442981:R2123Q	ENSP00000316029:R2235Q	R	-	2	0	TLN1	35690035	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.774000	0.85478	2.516000	0.84829	0.655000	0.94253	CGA	TLN1	-	NULL	ENSG00000137076		0.567	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	-	0.00	29	0	C	NM_006289		35700035	-1	tier1	-	no_errors	ENST00000314888	ensembl	human	known	74_37	missense	52.78	17	19	SNP	1.000	T
TMCO4	255104	genome.wustl.edu	37	1	20097816	20097816	+	Silent	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:20097816C>T	ENST00000294543.6	-	5	580	c.339G>A	c.(337-339)ccG>ccA	p.P113P	TMCO4_ENST00000375127.1_Silent_p.P113P|TMCO4_ENST00000375122.2_Silent_p.P113P	NM_181719.4	NP_859070.3	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	113						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		TGATCACCGTCGGGTCGTCCT	0.478																																																	0													125.0	129.0	128.0					1																	20097816		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS198.1	1p36.13	2008-02-05			ENSG00000162542	ENSG00000162542			27393	protein-coding gene	gene with protein product							Standard	NM_181719		Approved	DKFZp686C23231	uc001bcn.3	Q5TGY1	OTTHUMG00000002697	ENST00000294543.6:c.339G>A	1.37:g.20097816C>T			Q5TGY2|Q6MZN5|Q7Z6K6|Q9UQP4|Q9Y3K1	Silent	SNP	pfam_DUF726,pfam_DUF900_hydrolase	p.P113	ENST00000294543.6	37	c.339	CCDS198.1	1																																																																																			TMCO4	-	NULL	ENSG00000162542		0.478	TMCO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO4	HGNC	protein_coding	OTTHUMT00000007658.1	-	0.00	36	0	C	NM_181719		20097816	-1	tier1	-	no_errors	ENST00000294543	ensembl	human	known	74_37	silent	22.73	34	10	SNP	0.000	T
TMED10	10972	genome.wustl.edu	37	14	75601670	75601670	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr14:75601670G>A	ENST00000303575.4	-	5	629	c.578C>T	c.(577-579)tCa>tTa	p.S193L	RP11-950C14.7_ENST00000556236.1_RNA|TMED10_ENST00000557670.1_5'UTR	NM_006827.5	NP_006818.3	P49755	TMEDA_HUMAN	transmembrane emp24-like trafficking protein 10 (yeast)	193	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				beta-amyloid formation (GO:0034205)|cargo loading into vesicle (GO:0035459)|COPI coating of Golgi vesicle (GO:0048205)|COPI-coated vesicle budding (GO:0035964)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|intracellular protein transport (GO:0006886)|kidney development (GO:0001822)|protein oligomerization (GO:0051259)|regulated secretory pathway (GO:0045055)|response to acid chemical (GO:0001101)|response to alkaloid (GO:0043279)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle targeting, to, from or within Golgi (GO:0048199)	cis-Golgi network (GO:0005801)|COPI-coated vesicle (GO:0030137)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network transport vesicle (GO:0030140)|zymogen granule membrane (GO:0042589)	syntaxin binding (GO:0019905)			endometrium(1)|large_intestine(5)|lung(3)	9				BRCA - Breast invasive adenocarcinoma(234;0.0126)		ACAGAACATTGAAAAGATGCT	0.408																																																	0													95.0	96.0	95.0					14																	75601670		2203	4300	6503	SO:0001583	missense	0			AL832012, X97442	CCDS9840.1	14q24.3	2008-08-11			ENSG00000170348	ENSG00000170348			16998	protein-coding gene	gene with protein product		605406				7596406, 8663407	Standard	NM_006827		Approved	TMP21, P24(DELTA)	uc001xrm.1	P49755		ENST00000303575.4:c.578C>T	14.37:g.75601670G>A	ENSP00000303145:p.Ser193Leu		B2R605|Q15602|Q16536|Q86TC2|Q86TS5	Missense_Mutation	SNP	pfam_GOLD,pfscan_GOLD	p.S193L	ENST00000303575.4	37	c.578	CCDS9840.1	14	.	.	.	.	.	.	.	.	.	.	G	34	5.297029	0.95574	.	.	ENSG00000170348	ENST00000303575	T	0.18657	2.2	6.04	6.04	0.98038	GOLD (2);	0.000000	0.85682	D	0.000000	T	0.55242	0.1908	M	0.86651	2.83	0.80722	D	1	D	0.76494	0.999	D	0.70016	0.967	T	0.59268	-0.7486	10	0.87932	D	0	-26.9595	20.5948	0.99439	0.0:0.0:1.0:0.0	.	193	P49755	TMEDA_HUMAN	L	193	ENSP00000303145:S193L	ENSP00000303145:S193L	S	-	2	0	TMED10	74671423	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.810000	0.99221	2.873000	0.98535	0.563000	0.77884	TCA	TMED10	-	pfam_GOLD,pfscan_GOLD	ENSG00000170348		0.408	TMED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED10	HGNC	protein_coding	OTTHUMT00000415034.1	-	0.00	33	0	G	NM_006827		75601670	-1	tier1	-	no_errors	ENST00000303575	ensembl	human	known	74_37	missense	20.00	36	9	SNP	1.000	A
TMEM117	84216	genome.wustl.edu	37	12	44781966	44781966	+	Missense_Mutation	SNP	G	G	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:44781966G>C	ENST00000266534.3	+	8	1183	c.1056G>C	c.(1054-1056)ttG>ttC	p.L352F	TMEM117_ENST00000546978.1_3'UTR|TMEM117_ENST00000551577.1_3'UTR|TMEM117_ENST00000536799.1_Missense_Mutation_p.L248F	NM_032256.1	NP_115632.1	Q9H0C3	TM117_HUMAN	transmembrane protein 117	352						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|urinary_tract(1)	23	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		TAAAAGATTTGAACAGAACCA	0.398																																																	0													80.0	77.0	78.0					12																	44781966		2203	4299	6502	SO:0001583	missense	0			BC060798	CCDS8745.1, CCDS73462.1	12q12	2006-02-03				ENSG00000139173			25308	protein-coding gene	gene with protein product						11230166	Standard	NM_001286211		Approved	DKFZp434K2435	uc001rod.3	Q9H0C3	OTTHUMG00000169427	ENST00000266534.3:c.1056G>C	12.37:g.44781966G>C	ENSP00000266534:p.Leu352Phe			Missense_Mutation	SNP	NULL	p.L352F	ENST00000266534.3	37	c.1056	CCDS8745.1	12	.	.	.	.	.	.	.	.	.	.	G	7.802	0.713779	0.15306	.	.	ENSG00000139173	ENST00000266534;ENST00000536799;ENST00000417623	T;T	0.42513	0.97;0.97	5.73	3.48	0.39840	.	0.057784	0.64402	D	0.000002	T	0.24353	0.0590	L	0.31207	0.915	0.40782	D	0.983188	B;B	0.24186	0.099;0.004	B;B	0.22753	0.041;0.006	T	0.12116	-1.0560	10	0.33141	T	0.24	-25.3523	1.8004	0.03070	0.1943:0.1143:0.4681:0.2232	.	248;352	F5H3Q2;Q9H0C3	.;TM117_HUMAN	F	352;248;100	ENSP00000266534:L352F;ENSP00000445243:L248F	ENSP00000266534:L352F	L	+	3	2	TMEM117	43068233	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.676000	0.25247	1.062000	0.40625	0.650000	0.86243	TTG	TMEM117	-	NULL	ENSG00000139173		0.398	TMEM117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM117	HGNC	protein_coding	OTTHUMT00000403969.1	-	0.00	45	0	G	NM_032256		44781966	+1	tier1	-	no_errors	ENST00000266534	ensembl	human	known	74_37	missense	20.00	44	11	SNP	0.999	C
TMEM211	255349	genome.wustl.edu	37	22	25334229	25334229	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr22:25334229C>T	ENST00000423535.1	-	2	226	c.227G>A	c.(226-228)gGc>gAc	p.G76D	TMEM211_ENST00000382744.1_Missense_Mutation_p.G5D|TMEM211_ENST00000407886.1_Missense_Mutation_p.G5D			Q6ICI0	TM211_HUMAN	transmembrane protein 211	76						integral component of membrane (GO:0016021)		p.G5A(1)		endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						CAGGAGCCAGCCTCCGAGGAG	0.577																																																	1	Substitution - Missense(1)	ovary(1)											63.0	59.0	60.0					22																	25334229		2203	4300	6503	SO:0001583	missense	0				CCDS33624.1	22q11.23	2009-01-12			ENSG00000206069	ENSG00000206069			33725	protein-coding gene	gene with protein product							Standard	NM_001001663		Approved	bA9F11.1	uc003abk.1	Q6ICI0	OTTHUMG00000150790	ENST00000423535.1:c.227G>A	22.37:g.25334229C>T	ENSP00000387813:p.Gly76Asp			Missense_Mutation	SNP	pfam_Lipome_HGMIC_fus_partner-like	p.G76D	ENST00000423535.1	37	c.227		22	.	.	.	.	.	.	.	.	.	.	C	19.68	3.872316	0.72180	.	.	ENSG00000206069	ENST00000407886;ENST00000423535;ENST00000382744	T;T;T	0.80566	-1.39;-1.02;-1.39	4.06	4.06	0.47325	.	0.000000	0.49305	D	0.000158	D	0.88235	0.6382	M	0.71581	2.175	0.44871	D	0.997882	D	0.89917	1.0	D	0.85130	0.997	D	0.89623	0.3850	10	0.87932	D	0	-37.4368	14.3359	0.66589	0.0:1.0:0.0:0.0	.	76	Q6ICI0	TM211_HUMAN	D	5;76;5	ENSP00000385494:G5D;ENSP00000387813:G76D;ENSP00000372192:G5D	ENSP00000372192:G5D	G	-	2	0	TMEM211	23664229	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	2.293000	0.43558	2.308000	0.77769	0.538000	0.68166	GGC	TMEM211	-	pfam_Lipome_HGMIC_fus_partner-like	ENSG00000206069		0.577	TMEM211-202	KNOWN	basic|appris_principal	protein_coding	TMEM211	HGNC	protein_coding			0.00	36	0	C	NM_001001663		25334229	-1			no_errors	ENST00000423535	ensembl	human	known	74_37	missense	5.00	38	2	SNP	1.000	T
TNFRSF4	7293	genome.wustl.edu	37	1	1147001	1147001	+	Silent	SNP	T	T	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:1147001T>C	ENST00000379236.3	-	7	772	c.768A>G	c.(766-768)ggA>ggG	p.G256G	TNFRSF4_ENST00000453580.1_5'Flank	NM_003327.3	NP_003318.1	P43489	TNR4_HUMAN	tumor necrosis factor receptor superfamily, member 4	256					cellular defense response (GO:0006968)|immune response (GO:0006955)|inflammatory response (GO:0006954)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of immunoglobulin secretion (GO:0051024)|regulation of apoptotic process (GO:0042981)|regulation of protein kinase activity (GO:0045859)|T cell proliferation (GO:0042098)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	tumor necrosis factor-activated receptor activity (GO:0005031)			large_intestine(1)|lung(2)|urinary_tract(1)	4	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.73e-36)|OV - Ovarian serous cystadenocarcinoma(86;1.01e-21)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GGAAACTGCCTCCCCCTGGGG	0.677																																																	0													28.0	34.0	32.0					1																	1147001		2201	4300	6501	SO:0001819	synonymous_variant	0			X75962	CCDS11.1	1p36	2008-02-05			ENSG00000186827	ENSG00000186827		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11918	protein-coding gene	gene with protein product		600315		TXGP1L		7510240, 2828930	Standard	NM_003327		Approved	ACT35, OX40, CD134	uc001ade.3	P43489	OTTHUMG00000001415	ENST00000379236.3:c.768A>G	1.37:g.1147001T>C			Q13663|Q2M312|Q5T7M0	Silent	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_4	p.G256	ENST00000379236.3	37	c.768	CCDS11.1	1																																																																																			TNFRSF4	-	prints_TNFR_4	ENSG00000186827		0.677	TNFRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF4	HGNC	protein_coding	OTTHUMT00000004086.1		0.00	35	0	T			1147001	-1			no_errors	ENST00000379236	ensembl	human	known	74_37	silent	5.17	55	3	SNP	0.985	C
TNFRSF8	943	genome.wustl.edu	37	1	12164492	12164492	+	Nonsense_Mutation	SNP	C	C	T	rs148756853		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:12164492C>T	ENST00000263932.2	+	4	547	c.325C>T	c.(325-327)Cga>Tga	p.R109*	TNFRSF8_ENST00000417814.2_5'UTR	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	109					cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	CTGCGAATGTCGACCCGGCAT	0.577																																																	0								C	stop/ARG	1,4405		0,1,2202	174.0	130.0	145.0		325	2.9	0.1	1	dbSNP_134	145	0,8600		0,0,4300	no	stop-gained	TNFRSF8	NM_001243.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		109/596	12164492	1,13005	2203	4300	6503	SO:0001587	stop_gained	0			M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.325C>T	1.37:g.12164492C>T	ENSP00000263932:p.Arg109*		B1AN79|B9EGD9|D3YTD8|Q6P4D9	Nonsense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_8	p.R109*	ENST00000263932.2	37	c.325	CCDS144.1	1	.	.	.	.	.	.	.	.	.	.	.	20.8	4.045823	0.75846	2.27E-4	0.0	ENSG00000120949	ENST00000263932	.	.	.	4.92	2.87	0.33458	.	0.281964	0.25735	N	0.028656	.	.	.	.	.	.	0.20873	N	0.999832	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.0445	9.6551	0.39921	0.379:0.6209:0.0:0.0	.	.	.	.	X	109	.	ENSP00000263932:R109X	R	+	1	2	TNFRSF8	12087079	0.467000	0.25831	0.110000	0.21437	0.037000	0.13140	1.550000	0.36223	1.379000	0.46325	-0.175000	0.13238	CGA	TNFRSF8	-	smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg	ENSG00000120949		0.577	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF8	HGNC	protein_coding	OTTHUMT00000005130.1	-	0.00	61	0	C			12164492	+1	tier1	rs148756853	no_errors	ENST00000263932	ensembl	human	known	74_37	nonsense	21.82	43	12	SNP	0.146	T
TNKS	8658	genome.wustl.edu	37	8	9437894	9437894	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr8:9437894G>T	ENST00000310430.6	+	2	924		c.e2+1		TNKS_ENST00000520408.1_Splice_Site|TNKS_ENST00000518281.1_Splice_Site	NM_003747.2	NP_003738.2	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase						mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|mRNA transport (GO:0051028)|negative regulation of DNA binding (GO:0043392)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein poly-ADP-ribosylation (GO:0070212)|protein polyubiquitination (GO:0000209)|protein transport (GO:0015031)|regulation of telomere maintenance via telomerase (GO:0032210)|spindle assembly (GO:0051225)|Wnt signaling pathway (GO:0016055)	chromosome, centromeric region (GO:0000775)|chromosome, telomeric region (GO:0000781)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nuclear chromosome, telomeric region (GO:0000784)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	NAD+ ADP-ribosyltransferase activity (GO:0003950)|zinc ion binding (GO:0008270)			NS(1)|endometrium(10)|kidney(6)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	49				COAD - Colon adenocarcinoma(149;0.0467)		GTGTGCATTGGTAAGTATCAT	0.358																																																	0													99.0	90.0	93.0					8																	9437894		2203	4300	6503	SO:0001630	splice_region_variant	0			AF082556	CCDS5974.1	8p23.1	2013-01-10			ENSG00000173273	ENSG00000173273		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	11941	protein-coding gene	gene with protein product		603303				9822378, 10198177	Standard	XM_006716263		Approved	TIN1, TINF1, TNKS1, PARP-5a, PARP5A, pART5	uc003wss.3	O95271	OTTHUMG00000090481	ENST00000310430.6:c.898+1G>T	8.37:g.9437894G>T			O95272|Q4G0F2	Splice_Site	SNP	-	e2+1	ENST00000310430.6	37	c.898+1	CCDS5974.1	8	.	.	.	.	.	.	.	.	.	.	G	23.6	4.435960	0.83885	.	.	ENSG00000173273	ENST00000520408;ENST00000310430;ENST00000518281	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0114	0.97452	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TNKS	9475304	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	9.835000	0.99442	2.732000	0.93576	0.591000	0.81541	.	TNKS	-	-	ENSG00000173273		0.358	TNKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS	HGNC	protein_coding	OTTHUMT00000206935.1		0.00	18	0	G	NM_003747	Intron	9437894	+1			no_errors	ENST00000310430	ensembl	human	known	74_37	splice_site	7.69	36	3	SNP	1.000	T
TNS1	7145	genome.wustl.edu	37	2	218762544	218762544	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:218762544A>G	ENST00000171887.4	-	6	597	c.145T>C	c.(145-147)Tcc>Ccc	p.S49P	TNS1_ENST00000419504.1_Missense_Mutation_p.S49P|TNS1_ENST00000310858.6_Missense_Mutation_p.S80P|TNS1_ENST00000430930.1_Missense_Mutation_p.S49P	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	49	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		CCATGTTTGGACTTGAGCATC	0.557																																																	0													191.0	170.0	177.0					2																	218762544		2203	4300	6503	SO:0001583	missense	0			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.145T>C	2.37:g.218762544A>G	ENSP00000171887:p.Ser49Pro		Q4ZG71|Q6IPI5	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_dom,smart_Tyr_Pase_cat,smart_SH2,smart_PTB/PI_dom,pfscan_SH2,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.S49P	ENST00000171887.4	37	c.145	CCDS2407.1	2	.	.	.	.	.	.	.	.	.	.	A	20.6	4.019200	0.75275	.	.	ENSG00000079308	ENST00000171887;ENST00000419504;ENST00000430930;ENST00000446903;ENST00000413554;ENST00000310858;ENST00000413280;ENST00000439083;ENST00000423413	D;D;D;D;D;D;D;D;D	0.98567	-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-5.0;-4.72	5.54	5.54	0.83059	Phosphatase tensin type (1);	0.053979	0.85682	D	0.000000	D	0.98874	0.9619	M	0.81239	2.535	0.80722	D	1	D;B;B;D;D;D	0.89917	0.998;0.431;0.203;1.0;0.999;0.999	P;B;B;D;D;D	0.85130	0.889;0.244;0.199;0.997;0.933;0.933	D	0.99850	1.1070	10	0.87932	D	0	.	15.8465	0.78895	1.0:0.0:0.0:0.0	.	49;103;80;49;49;49	B2RU35;A1L0S7;Q6IPI5;Q9HBL0;E9PGF5;E9PF55	.;.;.;TENS1_HUMAN;.;.	P	49;49;49;174;117;80;49;49;114	ENSP00000171887:S49P;ENSP00000408724:S49P;ENSP00000406016:S49P;ENSP00000405460:S174P;ENSP00000400383:S117P;ENSP00000308321:S80P;ENSP00000395615:S49P;ENSP00000404477:S49P;ENSP00000411349:S114P	ENSP00000171887:S49P	S	-	1	0	TNS1	218470789	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.139000	0.94554	2.326000	0.78906	0.533000	0.62120	TCC	TNS1	-	pfscan_Phosphatase_tensin-typ	ENSG00000079308		0.557	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2	-	0.00	42	0	A	NM_022648		218762544	-1	tier1	-	no_errors	ENST00000171887	ensembl	human	known	74_37	missense	8.00	46	4	SNP	1.000	G
TOPAZ1	375337	genome.wustl.edu	37	3	44323479	44323479	+	Missense_Mutation	SNP	A	A	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:44323479A>T	ENST00000309765.4	+	9	3560	c.3392A>T	c.(3391-3393)aAg>aTg	p.K1131M		NM_001145030.1	NP_001138502.1	Q8N9V7	TOPZ1_HUMAN	testis and ovary specific PAZ domain containing 1	1131						cytoplasm (GO:0005737)	metal ion binding (GO:0046872)										GATGTGTTTAAGAAATATATA	0.279																																																	0													104.0	94.0	97.0					3																	44323479		692	1585	2277	SO:0001583	missense	0			AK093476	CCDS46809.1	3p21.33	2012-10-08	2012-10-08	2012-10-08	ENSG00000173769	ENSG00000173769			24746	protein-coding gene	gene with protein product		614412	"""chromosome 3 open reading frame 77"""	C3orf77		22069478	Standard	NM_001145030		Approved	FLJ36157	uc003cna.4	Q8N9V7	OTTHUMG00000156172	ENST00000309765.4:c.3392A>T	3.37:g.44323479A>T	ENSP00000310303:p.Lys1131Met			Missense_Mutation	SNP	NULL	p.K1131M	ENST00000309765.4	37	c.3392	CCDS46809.1	3	.	.	.	.	.	.	.	.	.	.	A	17.09	3.299419	0.60195	.	.	ENSG00000173769	ENST00000309765	T	0.15487	2.42	5.68	4.49	0.54785	.	.	.	.	.	T	0.24699	0.0599	N	0.19112	0.55	0.27917	N	0.938397	D	0.89917	1.0	D	0.70935	0.971	T	0.06935	-1.0799	9	0.72032	D	0.01	-4.5211	9.3957	0.38401	0.8537:0.0:0.1463:0.0	.	1131	Q8N9V7	CC077_HUMAN	M	1131	ENSP00000310303:K1131M	ENSP00000310303:K1131M	K	+	2	0	C3orf77	44298483	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	1.764000	0.38471	0.934000	0.37316	0.460000	0.39030	AAG	TOPAZ1	-	NULL	ENSG00000173769		0.279	TOPAZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPAZ1	HGNC	protein_coding	OTTHUMT00000343247.1		0.00	81	0	A	NM_001145030		44323479	+1			no_errors	ENST00000309765	ensembl	human	known	74_37	missense	5.19	73	4	SNP	1.000	T
TP53	7157	genome.wustl.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000359597.4_Missense_Mutation_p.R273C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000445888.2_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343						65.0	56.0	59.0					17																	7577121		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273C	ENST00000269305.4	37	c.817	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	31	0	G	NM_000546		7577121	-1	tier1	rs121913343	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	18.52	22	5	SNP	0.830	A
TP53	7157	genome.wustl.edu	37	17	7578260	7578260	+	Missense_Mutation	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr17:7578260C>A	ENST00000269305.4	-	6	778	c.589G>T	c.(589-591)Gtg>Ttg	p.V197L	TP53_ENST00000413465.2_Missense_Mutation_p.V197L|TP53_ENST00000455263.2_Missense_Mutation_p.V197L|TP53_ENST00000359597.4_Missense_Mutation_p.V197L|TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.V197L|TP53_ENST00000445888.2_Missense_Mutation_p.V197L	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	197	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> E (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> M (in LFS; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V197M(10)|p.0?(8)|p.V197L(6)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.V104L(1)|p.V65L(1)|p.P191fs*6(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.P59_E66>Q(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTTCCTTCCACTCGGATAAGA	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)		yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	42	Substitution - Missense(18)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)|Complex - deletion inframe(5)|Complex - frameshift(1)	breast(6)|biliary_tract(5)|large_intestine(5)|liver(5)|skin(4)|bone(4)|central_nervous_system(3)|lung(3)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|stomach(1)|oesophagus(1)|ovary(1)	GRCh37	CM070297	TP53	M							108.0	96.0	100.0					17																	7578260		2203	4300	6503	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.589G>T	17.37:g.7578260C>A	ENSP00000269305:p.Val197Leu		Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.V197L	ENST00000269305.4	37	c.589	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	15.66	2.900571	0.52227	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99824	-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96;-6.96	5.41	4.44	0.53790	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.059878	0.64402	D	0.000004	D	0.99739	0.9897	M	0.77820	2.39	0.51767	D	0.999939	D;P;P;D;B;D;D	0.89917	0.997;0.484;0.927;0.999;0.367;0.995;1.0	D;P;P;D;P;D;D	0.87578	0.972;0.735;0.856;0.975;0.72;0.985;0.998	D	0.97374	0.9978	10	0.54805	T	0.06	-16.054	12.3714	0.55256	0.0:0.9175:0.0:0.0824	.	158;197;197;104;197;197;197	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	L	197;197;197;197;197;197;186;104;65;104;65	ENSP00000410739:V197L;ENSP00000352610:V197L;ENSP00000269305:V197L;ENSP00000398846:V197L;ENSP00000391127:V197L;ENSP00000391478:V197L;ENSP00000425104:V65L;ENSP00000423862:V104L	ENSP00000269305:V197L	V	-	1	0	TP53	7518985	0.994000	0.37717	0.999000	0.59377	0.021000	0.10359	3.252000	0.51461	1.420000	0.47138	0.655000	0.94253	GTG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	-	0.00	59	0	C	NM_000546		7578260	-1	tier1	-	no_errors	ENST00000269305	ensembl	human	known	74_37	missense	33.33	38	19	SNP	1.000	A
TRAPPC11	60684	genome.wustl.edu	37	4	184587394	184587394	+	Intron	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:184587394C>A	ENST00000334690.6	+	3	406				TRAPPC11_ENST00000357207.4_Intron	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11						vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)											TTTTCAATTTCTGCCAATGTT	0.423																																																	0													102.0	101.0	101.0					4																	184587394		2203	4300	6503	SO:0001627	intron_variant	0				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.205-16C>A	4.37:g.184587394C>A			A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	RNA	SNP	-	NULL	ENST00000334690.6	37	NULL	CCDS34112.1	4																																																																																			TRAPPC11	-	-	ENSG00000168538		0.423	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC11	HGNC	protein_coding	OTTHUMT00000361654.2	-	0.00	42	0	C	NM_021942		184587394	+1	tier1	-	no_errors	ENST00000504526	ensembl	human	putative	74_37	rna	20.31	51	13	SNP	0.000	A
TRIM24	8805	genome.wustl.edu	37	7	138189074	138189074	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:138189074C>T	ENST00000343526.4	+	2	619	c.404C>T	c.(403-405)gCa>gTa	p.A135V	TRIM24_ENST00000415680.2_Missense_Mutation_p.A135V|TRIM24_ENST00000497516.1_3'UTR			O15164	TIF1A_HUMAN	tripartite motif containing 24	135					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						CAAGAATGTGCAGAGAGACAC	0.353																																					Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)												0													121.0	118.0	119.0					7																	138189074		2203	4300	6503	SO:0001583	missense	0			AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.404C>T	7.37:g.138189074C>T	ENSP00000340507:p.Ala135Val		A4D1R7|A4D1R8|O95854	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Bromodomain,prints_Bromodomain	p.A135V	ENST00000343526.4	37	c.404	CCDS5847.1	7	.	.	.	.	.	.	.	.	.	.	C	20.9	4.063193	0.76187	.	.	ENSG00000122779	ENST00000343526;ENST00000452999;ENST00000536822;ENST00000415680;ENST00000378381	T;T	0.76839	-1.05;-1.04	5.17	5.17	0.71159	Zinc finger, RING/FYVE/PHD-type (1);	0.119930	0.56097	D	0.000023	T	0.79516	0.4459	N	0.25332	0.735	0.41527	D	0.988438	P;D	0.65815	0.457;0.995	B;D	0.66196	0.379;0.942	T	0.73458	-0.3976	10	0.12430	T	0.62	-16.4335	18.4584	0.90729	0.0:1.0:0.0:0.0	.	135;135	O15164;O15164-2	TIF1A_HUMAN;.	V	135;135;46;135;93	ENSP00000340507:A135V;ENSP00000390829:A135V	ENSP00000340507:A135V	A	+	2	0	TRIM24	137839614	0.987000	0.35691	0.998000	0.56505	0.996000	0.88848	1.155000	0.31700	2.684000	0.91462	0.650000	0.86243	GCA	TRIM24	-	NULL	ENSG00000122779		0.353	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM24	HGNC	protein_coding	OTTHUMT00000341814.1		0.00	29	0	C	NM_015905		138189074	+1			no_errors	ENST00000343526	ensembl	human	known	74_37	missense	7.69	24	2	SNP	1.000	T
TRIM49	57093	genome.wustl.edu	37	11	89531759	89531759	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:89531759T>C	ENST00000329758.1	-	8	1226	c.898A>G	c.(898-900)Atc>Gtc	p.I300V	TRIM49_ENST00000532501.2_Missense_Mutation_p.I223V	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	300	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TACAGAAAGATATCATTGTTG	0.328																																																	0													33.0	45.0	41.0					11																	89531759		2125	4287	6412	SO:0001583	missense	0			AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.898A>G	11.37:g.89531759T>C	ENSP00000327604:p.Ile300Val		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.I300V	ENST00000329758.1	37	c.898	CCDS8287.1	11	.	.	.	.	.	.	.	.	.	.	T	0.820	-0.749086	0.03065	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	T	0.06449	3.3	0.821	-0.995	0.10222	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.05731	0.0150	L	0.52011	1.625	0.09310	N	1	B	0.15930	0.015	B	0.20384	0.029	T	0.42899	-0.9424	8	.	.	.	.	3.2474	0.06802	0.0:0.4304:0.0:0.5696	.	300	P0CI25	TRI49_HUMAN	V	300;223	ENSP00000327604:I300V	.	I	-	1	0	TRIM49	89171407	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.353000	0.07691	-0.340000	0.08388	0.163000	0.16589	ATC	TRIM49	-	superfamily_ConA-like_lec_gl_sf,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000168930		0.328	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49	HGNC	protein_coding	OTTHUMT00000395435.1	-	0.00	97	0	T	NM_020358		89531759	-1	tier1	-	no_errors	ENST00000329758	ensembl	human	known	74_37	missense	19.61	82	20	SNP	0.000	C
TRIM49C	642612	genome.wustl.edu	37	11	89774257	89774257	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:89774257A>G	ENST00000448984.1	+	8	1227	c.898A>G	c.(898-900)Atc>Gtc	p.I300V	TRIM49C_ENST00000432771.1_Intron	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	300	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|lung(4)	8						CAACAGTGATATCTTTCTGTA	0.328																																																	0																																										SO:0001583	missense	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.898A>G	11.37:g.89774257A>G	ENSP00000388299:p.Ile300Val		A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.I300V	ENST00000448984.1	37	c.898	CCDS53694.1	11	.	.	.	.	.	.	.	.	.	.	A	0.158	-1.084394	0.01888	.	.	ENSG00000204449	ENST00000448984	T	0.06449	3.3	0.823	-1.65	0.08291	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.05502	0.0145	L	0.52011	1.625	0.09310	N	1	B	0.15930	0.015	B	0.20384	0.029	T	0.43669	-0.9377	8	.	.	.	.	2.3501	0.04281	0.2779:0.3257:0.3964:0.0	.	300	P0CI26	T49L2_HUMAN	V	300	ENSP00000388299:I300V	.	I	+	1	0	TRIM49L2	89413905	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.630000	0.02028	-0.760000	0.04677	-0.973000	0.02599	ATC	TRIM49C	-	superfamily_ConA-like_lec_gl_sf,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000204449		0.328	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1		0.00	70	0	A	NM_001195234		89774257	+1			no_errors	ENST00000448984	ensembl	human	known	74_37	missense	5.06	75	4	SNP	0.000	G
TRMT11	60487	genome.wustl.edu	37	6	126329537	126329537	+	Splice_Site	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr6:126329537G>T	ENST00000334379.5	+	8	800		c.e8-1		TRMT11_ENST00000368332.3_Splice_Site|TRMT11_ENST00000450358.1_Splice_Site	NM_001031712.2	NP_001026882.2	Q7Z4G4	TRM11_HUMAN	tRNA methyltransferase 11 homolog (S. cerevisiae)						tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)|tRNA binding (GO:0000049)	p.?(1)		NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				GBM - Glioblastoma multiforme(226;0.0356)		TGATTTTTCAGGTGGCCTGCT	0.423																																																	1	Unknown(1)	lung(1)											262.0	230.0	240.0					6																	126329537		2203	4300	6503	SO:0001630	splice_region_variant	0			AF182423	CCDS35496.1	6q11.1-q22.33	2009-06-15	2006-11-28	2006-11-28	ENSG00000066651	ENSG00000066651			21080	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 75"""	C6orf75			Standard	XM_006715546		Approved	MDS024, dJ187J11.2, TRM11, TRMT11-1	uc003qam.3	Q7Z4G4	OTTHUMG00000015515	ENST00000334379.5:c.680-1G>T	6.37:g.126329537G>T			E1P570|Q5JY11|Q6PGQ5|Q9HC13	Splice_Site	SNP	-	e8-1	ENST00000334379.5	37	c.680-1	CCDS35496.1	6	.	.	.	.	.	.	.	.	.	.	G	23.8	4.457730	0.84317	.	.	ENSG00000066651	ENST00000334379;ENST00000450358;ENST00000368332;ENST00000453993	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1511	0.98086	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TRMT11	126371230	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	9.869000	0.99810	2.865000	0.98341	0.655000	0.94253	.	TRMT11	-	-	ENSG00000066651		0.423	TRMT11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRMT11	HGNC	protein_coding			0.00	32	0	G	NM_021820	Intron	126329537	+1			no_errors	ENST00000334379	ensembl	human	known	74_37	splice_site	6.45	29	2	SNP	1.000	T
TRPC2	7221	genome.wustl.edu	37	11	3656575	3656575	+	RNA	SNP	C	C	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:3656575C>A	ENST00000526541.1	+	0	652					NR_002720.2				transient receptor potential cation channel, subfamily C, member 2, pseudogene																		TCCCCCGATCCCTACTTTTGT	0.507																																																	0																																												0			X89067		11p15.4	2014-03-20	2010-03-12		ENSG00000182048	ENSG00000182048		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12334	pseudogene	pseudogene			"""transient receptor potential cation channel, subfamily C, member 2"""			7568191, 16382100, 17217050	Standard	NR_002720		Approved		uc001lya.2		OTTHUMG00000011712		11.37:g.3656575C>A				RNA	SNP	-	NULL	ENST00000526541.1	37	NULL		11																																																																																			TRPC2	-	-	ENSG00000182048		0.507	TRPC2-002	KNOWN	basic	processed_transcript	TRPC2	HGNC	pseudogene	OTTHUMT00000392439.1	-	0.00	76	0	C	NR_002720		3656575	+1	tier1	-	no_errors	ENST00000526541	ensembl	human	known	74_37	rna	28.05	59	23	SNP	0.364	A
TRPV6	55503	genome.wustl.edu	37	7	142571887	142571887	+	Frame_Shift_Del	DEL	A	A	-			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr7:142571887delA	ENST00000359396.3	-	12	1706	c.1461delT	c.(1459-1461)tttfs	p.F487fs	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	487					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					TCAGGTCGCCAAAAATCATCT	0.542																																																	0													67.0	50.0	56.0					7																	142571887		2203	4300	6503	SO:0001589	frameshift_variant	0			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1461delT	7.37:g.142571887delA	ENSP00000352358:p.Phe487fs		A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6,prints_TRPV6_channel,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.F487fs	ENST00000359396.3	37	c.1461	CCDS5874.1	7																																																																																			TRPV6	-	pfam_Ion_trans_dom,tigrfam_TRP_channel	ENSG00000165125		0.542	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV6	HGNC	protein_coding	OTTHUMT00000347662.1		0.00	32	0	A	NM_014274		142571887	-1	tier1		no_errors	ENST00000359396	ensembl	human	known	74_37	frame_shift_del	5.88	32	2	DEL	1.000	-
TSGA10	80705	genome.wustl.edu	37	2	99697803	99697803	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:99697803C>G	ENST00000393483.3	-	11	1513	c.669G>C	c.(667-669)aaG>aaC	p.K223N	TSGA10_ENST00000542655.1_Missense_Mutation_p.K223N|TSGA10_ENST00000539964.1_Missense_Mutation_p.K223N|TSGA10_ENST00000410001.1_Missense_Mutation_p.K223N|TSGA10_ENST00000478090.1_5'UTR|TSGA10_ENST00000355053.4_Missense_Mutation_p.K223N	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	223					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						CATATTTTTTCTTAGCAAGGT	0.274																																																	0													66.0	69.0	68.0					2																	99697803		2201	4288	6489	SO:0001583	missense	0			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.669G>C	2.37:g.99697803C>G	ENSP00000377123:p.Lys223Asn		B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	NULL	p.K223N	ENST00000393483.3	37	c.669	CCDS2037.1	2	.	.	.	.	.	.	.	.	.	.	C	14.23	2.472493	0.43942	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482;ENST00000542655	T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99	4.96	4.08	0.47627	.	0.000000	0.56097	D	0.000023	T	0.26195	0.0639	N	0.25647	0.755	0.39507	D	0.968296	B;B	0.23650	0.089;0.089	B;B	0.23574	0.047;0.028	T	0.07654	-1.0761	10	0.18276	T	0.48	-22.3431	8.5511	0.33451	0.0:0.8984:0.0:0.1016	.	223;223	B7Z925;Q9BZW7	.;TSG10_HUMAN	N	223	ENSP00000377123:K223N;ENSP00000386956:K223N;ENSP00000347161:K223N;ENSP00000444419:K223N;ENSP00000386508:K223N;ENSP00000377122:K223N;ENSP00000445623:K223N	ENSP00000347161:K223N	K	-	3	2	TSGA10	99064235	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.010000	0.40913	2.732000	0.93576	0.585000	0.79938	AAG	TSGA10	-	NULL	ENSG00000135951		0.274	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	-	0.00	99	0	C	NM_182911		99697803	-1	tier1	-	no_errors	ENST00000355053	ensembl	human	known	74_37	missense	21.37	92	25	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179424251	179424251	+	Missense_Mutation	SNP	C	C	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:179424251C>G	ENST00000591111.1	-	276	81909	c.81685G>C	c.(81685-81687)Gaa>Caa	p.E27229Q	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E26302Q|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E19997Q|TTN_ENST00000359218.5_Missense_Mutation_p.E19930Q|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E28870Q|TTN_ENST00000460472.2_Missense_Mutation_p.E19805Q|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	27229	Fibronectin type-III 98. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCATCGTTTTCAGGAACATCC	0.463																																																	0													148.0	142.0	144.0					2																	179424251		1934	4151	6085	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.81685G>C	2.37:g.179424251C>G	ENSP00000465570:p.Glu27229Gln		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.E26302Q	ENST00000591111.1	37	c.78904		2	.	.	.	.	.	.	.	.	.	.	C	16.18	3.050537	0.55218	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58358	0.34;0.34;0.34;0.34	5.77	5.77	0.91146	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67813	0.2933	L	0.52266	1.64	0.80722	D	1	D;D;D;D	0.62365	0.991;0.991;0.991;0.991	P;P;P;P	0.62089	0.864;0.864;0.864;0.898	T	0.67964	-0.5534	9	0.87932	D	0	.	20.3473	0.98799	0.0:1.0:0.0:0.0	.	19805;19930;19997;27229	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	26302;19805;19997;19930;19802	ENSP00000343764:E26302Q;ENSP00000434586:E19805Q;ENSP00000340554:E19997Q;ENSP00000352154:E19930Q	ENSP00000340554:E19997Q	E	-	1	0	TTN	179132497	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.082000	0.71318	2.884000	0.98904	0.655000	0.94253	GAA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.463	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	46	0	C	NM_133378		179424251	-1	tier1	-	no_errors	ENST00000342992	ensembl	human	known	74_37	missense	16.28	36	7	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179408016	179408016	+	Silent	SNP	G	G	A	rs368423941		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:179408016G>A	ENST00000591111.1	-	297	91985	c.91761C>T	c.(91759-91761)taC>taT	p.Y30587Y	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Silent_p.Y29660Y|TTN-AS1_ENST00000591332.1_RNA|RP11-65L3.4_ENST00000604692.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342175.6_Silent_p.Y23355Y|TTN_ENST00000359218.5_Silent_p.Y23288Y|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Silent_p.Y32228Y|TTN_ENST00000460472.2_Silent_p.Y23163Y|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592600.1_RNA			Q8WZ42	TITIN_HUMAN	titin	30587	Fibronectin type-III 123. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TACCACCATCGTAGAGTGGTT	0.507																																																	0								G	,,,	0,3844		0,0,1922	146.0	135.0	139.0		69489,88980,69864,70065	-11.2	0.0	2		139	5,8261		0,5,4128	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	TTN	NM_003319.4,NM_133378.4,NM_133432.3,NM_133437.3	,,,	0,5,6050	AA,AG,GG		0.0605,0.0,0.0413	,,,	23163/26927,29660/33424,23288/27052,23355/27119	179408016	5,12105	1922	4133	6055	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.91761C>T	2.37:g.179408016G>A			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.Y29660	ENST00000591111.1	37	c.88980		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.507	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	31	0	G	NM_133378		179408016	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	silent	5.26	36	2	SNP	0.030	A
TTN	7273	genome.wustl.edu	37	2	179610671	179610671	+	Intron	SNP	T	T	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:179610671T>C	ENST00000591111.1	-	46	10585				TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342992.6_Intron|TTN_ENST00000360870.5_Missense_Mutation_p.T5486A|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000460472.2_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGCTTAAAGTCACTTTGCTT	0.423																																																	0													106.0	102.0	103.0					2																	179610671		2203	4300	6503	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4023A>G	2.37:g.179610671T>C			A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like_dom	p.T5486A	ENST00000591111.1	37	c.16456		2	.	.	.	.	.	.	.	.	.	.	T	13.80	2.345522	0.41498	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.58358	0.34	6.07	6.07	0.98685	.	.	.	.	.	T	0.41442	0.1159	L	0.27053	0.805	0.80722	D	1	B	0.30914	0.3	B	0.33454	0.164	T	0.28299	-1.0048	9	0.18276	T	0.48	.	14.8705	0.70453	0.0:0.0:0.0:1.0	.	5486	Q8WZ42-6	.	A	5486;767	ENSP00000354117:T5486A	ENSP00000304714:T767A	T	-	1	0	TTN	179318916	1.000000	0.71417	0.997000	0.53966	0.409000	0.31022	4.832000	0.62759	2.326000	0.78906	0.533000	0.62120	ACT	TTN	-	NULL	ENSG00000155657		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	-	0.00	33	0	T	NM_133378		179610671	-1	tier1	-	no_errors	ENST00000360870	ensembl	human	known	74_37	missense	20.00	20	5	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179647638	179647638	+	Missense_Mutation	SNP	G	G	A	rs142000511	byFrequency	TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:179647638G>A	ENST00000591111.1	-	18	3219	c.2995C>T	c.(2995-2997)Cgt>Tgt	p.R999C	RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R999C|TTN_ENST00000360870.5_Missense_Mutation_p.R999C|TTN_ENST00000342175.6_Missense_Mutation_p.R953C|TTN_ENST00000359218.5_Missense_Mutation_p.R953C|TTN_ENST00000589042.1_Missense_Mutation_p.R999C|TTN_ENST00000460472.2_Missense_Mutation_p.R953C			Q8WZ42	TITIN_HUMAN	titin	32552	Ig-like 3.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATCATAAGACGAGCAATTCCA	0.493																																																	0								G	CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG,CYS/ARG	1,4405	2.1+/-5.4	0,1,2202	103.0	100.0	101.0		2857,2995,2995,2857,2857	5.3	1.0	2	dbSNP_134	101	0,8600		0,0,4300	no	missense,missense,missense,missense,missense	TTN	NM_003319.4,NM_133378.4,NM_133379.3,NM_133432.3,NM_133437.3	180,180,180,180,180	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	953/26927,999/33424,999/5605,953/27052,953/27119	179647638	1,13005	2203	4300	6503	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2995C>T	2.37:g.179647638G>A	ENSP00000465570:p.Arg999Cys		A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_dom,pfscan_Ig-like_dom	p.R999C	ENST00000591111.1	37	c.2995		2	.	.	.	.	.	.	.	.	.	.	G	12.13	1.845197	0.32606	2.27E-4	0.0	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32	6.17	5.29	0.74685	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70815	0.3267	N	0.17312	0.475	0.42923	D	0.994295	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.74023	0.963;0.963;0.963;0.98;0.982	T	0.77059	-0.2728	9	0.87932	D	0	.	16.9456	0.86229	0.0:0.0:0.8711:0.1289	.	953;953;953;999;999	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	C	999;953;953;953;953;999	ENSP00000343764:R999C;ENSP00000434586:R953C;ENSP00000340554:R953C;ENSP00000352154:R953C;ENSP00000354117:R999C	ENSP00000340554:R953C	R	-	1	0	TTN	179355883	1.000000	0.71417	0.992000	0.48379	0.426000	0.31534	6.535000	0.73838	1.602000	0.50124	0.655000	0.94253	CGT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like_dom	ENSG00000155657		0.493	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1		0.00	18	0	G	NM_133378		179647638	-1			no_errors	ENST00000342992	ensembl	human	known	74_37	missense	12.90	27	4	SNP	1.000	A
TUBGCP2	10844	genome.wustl.edu	37	10	135098607	135098607	+	Missense_Mutation	SNP	G	G	A	rs561848773		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:135098607G>A	ENST00000252936.3	-	12	2045	c.2006C>T	c.(2005-2007)tCg>tTg	p.S669L	TUBGCP2_ENST00000368562.1_Missense_Mutation_p.S262L|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.S539L|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.S697L|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.S669L			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	669					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GGAGTGCAGCGAGTGCTGCTT	0.627													G|||	1	0.000199681	0.0	0.0	5008	,	,		17581	0.0		0.001	False		,,,				2504	0.0																0													114.0	84.0	95.0					10																	135098607		2203	4300	6503	SO:0001583	missense	0			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.2006C>T	10.37:g.135098607G>A	ENSP00000252936:p.Ser669Leu		B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	pfam_TUBGCP,superfamily_Ocr	p.S697L	ENST00000252936.3	37	c.2090	CCDS7676.1	10	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384973	0.42308	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000368562;ENST00000543663	T;T;T;T;T	0.08370	3.1;3.1;3.1;3.1;3.1	5.43	5.43	0.79202	.	0.353030	0.30329	N	0.009879	T	0.09905	0.0243	L	0.55103	1.725	0.34865	D	0.743032	P;P;B	0.40250	0.661;0.709;0.339	B;B;B	0.36666	0.147;0.23;0.23	T	0.20240	-1.0281	10	0.09084	T	0.74	-6.9939	18.2118	0.89872	0.0:0.0:1.0:0.0	.	697;697;669	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	L	669;539;669;262;697	ENSP00000252936:S669L;ENSP00000395666:S539L;ENSP00000357551:S669L;ENSP00000357550:S262L;ENSP00000446093:S697L	ENSP00000252936:S669L	S	-	2	0	TUBGCP2	134948597	1.000000	0.71417	0.006000	0.13384	0.193000	0.23685	9.249000	0.95470	2.729000	0.93468	0.655000	0.94253	TCG	TUBGCP2	-	pfam_TUBGCP	ENSG00000130640		0.627	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP2	HGNC	protein_coding	OTTHUMT00000051148.1	-	0.00	87	0	G			135098607	-1	tier1	-	no_errors	ENST00000543663	ensembl	human	known	74_37	missense	22.50	62	18	SNP	0.440	A
UBR3	130507	genome.wustl.edu	37	2	170865359	170865359	+	Missense_Mutation	SNP	A	A	G			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr2:170865359A>G	ENST00000272793.5	+	29	4326	c.4276A>G	c.(4276-4278)Ata>Gta	p.I1426V	UBR3_ENST00000392631.1_Missense_Mutation_p.I247V|UBR3_ENST00000418381.1_Missense_Mutation_p.I1426V			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1426					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						AATGAAAGATATAAAAAATAC	0.294																																																	0													35.0	38.0	37.0					2																	170865359		2203	4294	6497	SO:0001583	missense	0			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.4276A>G	2.37:g.170865359A>G	ENSP00000272793:p.Ile1426Val		B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.I1426V	ENST00000272793.5	37	c.4276		2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.53|13.53	2.264157|2.264157	0.39995|0.39995	.|.	.|.	ENSG00000144357|ENSG00000144357	ENST00000392632|ENST00000272793;ENST00000442603;ENST00000418381;ENST00000392631;ENST00000439681	.|T;T;T;T	.|0.48522	.|0.81;0.81;0.81;0.81	5.1|5.1	5.1|5.1	0.69264|0.69264	.|.	0.049462|0.049462	0.85682|0.85682	D|D	0.000000|0.000000	T|T	0.45054|0.45054	0.1323|0.1323	L|L	0.59436|0.59436	1.845|1.845	0.34684|0.34684	D|D	0.725031|0.725031	.|B;B;B	.|0.22080	.|0.009;0.041;0.064	.|B;B;B	.|0.21151	.|0.008;0.033;0.032	T|T	0.53739|0.53739	-0.8396|-0.8396	6|10	.|0.25751	.|T	.|0.34	.|.	14.8814|14.8814	0.70537|0.70537	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1426;247;1426	.|Q6ZT12;Q6ZT12-2;E7EVK3	.|UBR3_HUMAN;.;.	M|V	487|1426;1426;1426;247;97	.|ENSP00000272793:I1426V;ENSP00000396068:I1426V;ENSP00000376408:I247V;ENSP00000389097:I97V	.|ENSP00000272793:I1426V	I|I	+|+	3|1	3|0	UBR3|UBR3	170573605|170573605	1.000000|1.000000	0.71417|0.71417	0.991000|0.991000	0.47740|0.47740	0.988000|0.988000	0.76386|0.76386	7.152000|7.152000	0.77419|0.77419	1.919000|1.919000	0.55581|0.55581	0.377000|0.377000	0.23210|0.23210	ATA|ATA	UBR3	-	NULL	ENSG00000144357		0.294	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	-	0.00	59	0	A	NM_172070		170865359	+1	tier1	-	no_errors	ENST00000272793	ensembl	human	known	74_37	missense	17.28	67	14	SNP	1.000	G
USP16	10600	genome.wustl.edu	37	21	30411852	30411852	+	Missense_Mutation	SNP	G	G	A	rs537793903		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr21:30411852G>A	ENST00000334352.4	+	10	1145	c.914G>A	c.(913-915)cGc>cAc	p.R305H	USP16_ENST00000535828.1_Intron|USP16_ENST00000399976.2_Missense_Mutation_p.R305H|USP16_ENST00000399975.3_Missense_Mutation_p.R304H	NM_001032410.1	NP_001027582.1			ubiquitin specific peptidase 16											breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(2)	34						GAGCTGCTTCGCTACTTATTG	0.398													G|||	1	0.000199681	0.0	0.0	5008	,	,		16622	0.001		0.0	False		,,,				2504	0.0				Melanoma(92;625 1444 27493 34101 44971)												0													110.0	98.0	102.0					21																	30411852		2203	4300	6503	SO:0001583	missense	0			AF126736	CCDS13583.1, CCDS42912.1	21q21	2008-04-11	2005-08-08		ENSG00000156256	ENSG00000156256		"""Ubiquitin-specific peptidases"""	12614	protein-coding gene	gene with protein product		604735	"""ubiquitin specific protease 16"""			12838346	Standard	NM_006447		Approved	Ubp-M	uc002ymy.3	Q9Y5T5	OTTHUMG00000078802	ENST00000334352.4:c.914G>A	21.37:g.30411852G>A	ENSP00000334808:p.Arg305His			Missense_Mutation	SNP	pfam_Peptidase_C19/C67,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19/C67	p.R305H	ENST00000334352.4	37	c.914	CCDS13583.1	21	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666056	0.47677	.	.	ENSG00000156256	ENST00000399975;ENST00000399976;ENST00000334352	T;T;T	0.32023	1.47;1.47;1.47	5.25	5.25	0.73442	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.47284	0.1437	L	0.42744	1.35	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.75020	0.939;0.975;0.985	T	0.11155	-1.0599	10	0.19147	T	0.46	.	19.0466	0.93022	0.0:0.0:1.0:0.0	.	290;304;305	Q9Y5T5-3;Q9Y5T5-2;Q9Y5T5	.;.;UBP16_HUMAN	H	304;305;305	ENSP00000382857:R304H;ENSP00000382858:R305H;ENSP00000334808:R305H	ENSP00000334808:R305H	R	+	2	0	USP16	29333723	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.282000	0.78630	2.742000	0.94016	0.650000	0.86243	CGC	USP16	-	pfam_Peptidase_C19/C67,pfscan_Peptidase_C19/C67	ENSG00000156256		0.398	USP16-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	USP16	HGNC	protein_coding	OTTHUMT00000171847.1		0.00	47	0	G			30411852	+1			no_errors	ENST00000334352	ensembl	human	known	74_37	missense	5.08	56	3	SNP	0.997	A
USP6NL	9712	genome.wustl.edu	37	10	11505072	11505072	+	Missense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:11505072G>T	ENST00000609104.1	-	15	2249	c.1855C>A	c.(1855-1857)Cta>Ata	p.L619I	USP6NL_ENST00000379237.2_Missense_Mutation_p.L642I|USP6NL_ENST00000277575.5_Missense_Mutation_p.L636I	NM_014688.2	NP_055503.1	Q92738	US6NL_HUMAN	USP6 N-terminal like	619					Golgi organization (GO:0007030)|plasma membrane to endosome transport (GO:0048227)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of Golgi organization (GO:1903358)|retrograde transport, plasma membrane to Golgi (GO:0035526)|virion assembly (GO:0019068)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			endometrium(3)|kidney(2)|large_intestine(6)|lung(18)|prostate(1)|skin(1)|urinary_tract(1)	32						TCCCCATCTAGCTGGGACGGA	0.522																																																	0													60.0	59.0	59.0					10																	11505072		1936	4140	6076	SO:0001583	missense	0			BC010351	CCDS44357.1, CCDS53492.1	10p13	2013-07-09			ENSG00000148429	ENSG00000148429			16858	protein-coding gene	gene with protein product	"""related to the N terminus of tre"""	605405	"""USP6NL intronic transcript 1 (non-protein coding)"""	USP6NL-IT1		8700515, 8700527, 12399475	Standard	XR_247492		Approved	RNTRE, KIAA0019, TRE2NL, RN-tre	uc001iks.1	Q92738	OTTHUMG00000017672	ENST00000609104.1:c.1855C>A	10.37:g.11505072G>T	ENSP00000476462:p.Leu619Ile		A8KA79|Q15400|Q5VV10|Q7L0K9	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.L642I	ENST00000609104.1	37	c.1924	CCDS53492.1	10	.	.	.	.	.	.	.	.	.	.	G	9.343	1.063591	0.20067	.	.	ENSG00000148429	ENST00000535316;ENST00000277575;ENST00000379237	T;T	0.04015	3.73;3.74	5.92	-11.8	0.00035	.	0.938895	0.08883	N	0.879740	T	0.02807	0.0084	L	0.36672	1.1	0.09310	N	1	B;B	0.18610	0.017;0.029	B;B	0.13407	0.004;0.009	T	0.32587	-0.9901	10	0.20519	T	0.43	.	7.6134	0.28144	0.6225:0.1223:0.187:0.0682	.	619;636	Q92738;Q92738-2	US6NL_HUMAN;.	I	619;636;619	ENSP00000277575:L636I;ENSP00000368539:L619I	ENSP00000277575:L636I	L	-	1	2	USP6NL	11545078	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-0.976000	0.03786	-2.228000	0.00721	0.467000	0.42956	CTA	USP6NL	-	NULL	ENSG00000148429		0.522	USP6NL-001	KNOWN	basic|CCDS	protein_coding	USP6NL	HGNC	protein_coding	OTTHUMT00000046764.3	-	0.00	42	0	G	NM_014688		11505072	-1	tier1	-	no_errors	ENST00000379237	ensembl	human	known	74_37	missense	6.15	61	4	SNP	0.000	T
VKORC1	79001	genome.wustl.edu	37	16	31104658	31104658	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr16:31104658G>A	ENST00000394975.2	-	2	485	c.258C>T	c.(256-258)atC>atT	p.I86I	VKORC1_ENST00000354895.4_Intron|VKORC1_ENST00000319788.7_Silent_p.I86I|VKORC1_ENST00000498155.1_Missense_Mutation_p.L119F|VKORC1_ENST00000394971.3_Missense_Mutation_p.L118F|RP11-196G11.1_ENST00000529564.1_Silent_p.I86I|VKORC1_ENST00000300851.6_Missense_Mutation_p.L107F	NM_024006.4	NP_076869.1	Q9BQB6	VKOR1_HUMAN	vitamin K epoxide reductase complex, subunit 1	86					blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular protein metabolic process (GO:0044267)|drug metabolic process (GO:0017144)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)|vitamin K metabolic process (GO:0042373)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	quinone binding (GO:0048038)|vitamin-K-epoxide reductase (warfarin-sensitive) activity (GO:0047057)			lung(3)|urinary_tract(1)	4					Acenocoumarol(DB01418)|Dicoumarol(DB00266)|Menadione(DB00170)|Phenindione(DB00498)|Phenprocoumon(DB00946)|Warfarin(DB00682)	GTGTGTAGAAGATGCAACCGA	0.622																																																	0													159.0	119.0	132.0					16																	31104658		2197	4300	6497	SO:0001819	synonymous_variant	0				CCDS10703.1, CCDS10704.1	16p11.2	2008-02-05	2004-07-23		ENSG00000167397	ENSG00000167397			23663	protein-coding gene	gene with protein product		608547	"""vitamin K dependent clotting factors deficiency 2"""	VKCFD2			Standard	NM_024006		Approved		uc002eas.3	Q9BQB6	OTTHUMG00000047408	ENST00000394975.2:c.258C>T	16.37:g.31104658G>A			A6NIQ6|B2R4Z6|Q6UX90|Q7Z2R4	Missense_Mutation	SNP	NULL	p.L119F	ENST00000394975.2	37	c.355	CCDS10703.1	16	.	.	.	.	.	.	.	.	.	.	G	13.93	2.384604	0.42308	.	.	ENSG00000167397	ENST00000300851;ENST00000394971;ENST00000498155	D	0.97994	-4.65	6.17	4.11	0.48088	.	.	.	.	.	D	0.95752	0.8618	.	.	.	0.24460	N	0.994441	.	.	.	.	.	.	D	0.90997	0.4839	6	0.45353	T	0.12	-36.8594	5.3335	0.15945	0.2101:0.1768:0.6131:0.0	.	.	.	.	F	107;118;119	ENSP00000300851:L107F	ENSP00000300851:L107F	L	-	1	0	VKORC1	31012159	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.961000	0.40432	0.760000	0.33108	0.655000	0.94253	CTT	VKORC1	-	NULL	ENSG00000167397		0.622	VKORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VKORC1	HGNC	protein_coding	OTTHUMT00000108582.1	-	0.00	71	0	G	NM_024006		31104658	-1	tier1	-	no_errors	ENST00000498155	ensembl	human	putative	74_37	missense	10.10	89	10	SNP	1.000	A
VPS13B	157680	genome.wustl.edu	37	8	100147953	100147953	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr8:100147953C>T	ENST00000358544.2	+	11	1666	c.1555C>T	c.(1555-1557)Cat>Tat	p.H519Y	VPS13B_ENST00000355155.1_Missense_Mutation_p.H519Y|VPS13B_ENST00000395996.1_Missense_Mutation_p.H519Y|VPS13B_ENST00000357162.2_Missense_Mutation_p.H519Y	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	519					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GGATTCAACTCATCATAAGGT	0.338																																					Colon(161;2205 2542 7338 31318)												0													74.0	68.0	70.0					8																	100147953		2203	4299	6502	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1555C>T	8.37:g.100147953C>T	ENSP00000351346:p.His519Tyr		C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.H519Y	ENST00000358544.2	37	c.1555	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	C	0.512	-0.866127	0.02590	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996	T;T;T;T	0.75821	-0.97;-0.28;-0.27;0.02	5.36	3.53	0.40419	.	0.359596	0.26800	N	0.022432	T	0.52645	0.1747	N	0.19112	0.55	0.32425	N	0.548858	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.001	T	0.48714	-0.9011	10	0.11794	T	0.64	.	6.4094	0.21682	0.1435:0.6601:0.1245:0.0719	.	519;519;519;519	Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4	.;VP13B_HUMAN;.;.	Y	519	ENSP00000347281:H519Y;ENSP00000349685:H519Y;ENSP00000351346:H519Y;ENSP00000379318:H519Y	ENSP00000347281:H519Y	H	+	1	0	VPS13B	100217129	1.000000	0.71417	1.000000	0.80357	0.912000	0.54170	2.866000	0.48420	0.723000	0.32274	0.655000	0.94253	CAT	VPS13B	-	NULL	ENSG00000132549		0.338	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	-	0.00	43	0	C	NM_184042		100147953	+1	tier1	-	no_errors	ENST00000358544	ensembl	human	known	74_37	missense	36.76	43	25	SNP	0.998	T
VPS8	23355	genome.wustl.edu	37	3	184711826	184711826	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr3:184711826T>A	ENST00000437079.3	+	43	3812	c.3641T>A	c.(3640-3642)aTg>aAg	p.M1214K	VPS8_ENST00000436792.2_Missense_Mutation_p.M1212K|VPS8_ENST00000287546.4_Missense_Mutation_p.M1214K|VPS8_ENST00000446204.2_Missense_Mutation_p.M1122K	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	1214							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			ATCTTGGGAATGTTAGATACC	0.299																																																	0													55.0	52.0	53.0					3																	184711826		1804	4057	5861	SO:0001583	missense	0			AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.3641T>A	3.37:g.184711826T>A	ENSP00000397879:p.Met1214Lys		A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like_supfam,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M1214K	ENST00000437079.3	37	c.3641	CCDS46971.1	3	.	.	.	.	.	.	.	.	.	.	T	25.1	4.599318	0.87055	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.30448	1.57;1.57;1.57;1.53	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.57446	0.2054	M	0.75085	2.285	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.961;0.994;0.997	T	0.61584	-0.7033	10	0.87932	D	0	-4.8177	16.1894	0.81975	0.0:0.0:0.0:1.0	.	1214;1122;1212	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	K	1214;1214;1212;1122	ENSP00000287546:M1214K;ENSP00000397879:M1214K;ENSP00000404704:M1212K;ENSP00000405483:M1122K	ENSP00000287546:M1214K	M	+	2	0	VPS8	186194520	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.216000	0.77974	2.222000	0.72286	0.477000	0.44152	ATG	VPS8	-	NULL	ENSG00000156931		0.299	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS8	HGNC	protein_coding		-	0.00	107	0	T	NM_015303		184711826	+1	tier1	-	no_errors	ENST00000287546	ensembl	human	known	74_37	missense	16.67	90	18	SNP	1.000	A
VWA2	340706	genome.wustl.edu	37	10	116045741	116045741	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr10:116045741G>A	ENST00000392982.3	+	11	1291	c.1041G>A	c.(1039-1041)ctG>ctA	p.L347L	VWA2_ENST00000603594.1_Silent_p.L347L			Q5GFL6	VWA2_HUMAN	von Willebrand factor A domain containing 2	347	VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				calcium-independent cell-matrix adhesion (GO:0007161)|protein homooligomerization (GO:0051260)|regulation of insulin receptor signaling pathway (GO:0046626)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)			central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Epithelial(162;0.036)|all cancers(201;0.0793)		TCCTCTTCCTGCTGGACAGCT	0.642																																																	0													69.0	65.0	66.0					10																	116045741		2203	4300	6503	SO:0001819	synonymous_variant	0			AK127756	CCDS7589.1, CCDS7589.2	10q25.3	2009-11-06			ENSG00000165816	ENSG00000165816			24709	protein-coding gene	gene with protein product						15580307, 14506275	Standard	NM_001272046		Approved	FLJ45857, FLJ16213, CCSP-2, AMACO, NET42	uc001lbl.2	Q5GFL6	OTTHUMG00000019082	ENST00000392982.3:c.1041G>A	10.37:g.116045741G>A			A1A5D4|B5MDJ8|Q6ZS39|Q6ZWJ7|Q708C5|Q70UZ8	Silent	SNP	pfam_VWF_A,pfam_EG-like_dom,pfam_EGF_extracell,smart_VWF_A,smart_EG-like_dom,smart_EGF-like_Ca-bd_dom,pfscan_EG-like_dom,pfscan_VWF_A	p.L347	ENST00000392982.3	37	c.1041		10																																																																																			VWA2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000165816		0.642	VWA2-001	KNOWN	basic|appris_principal	protein_coding	VWA2	HGNC	protein_coding	OTTHUMT00000050456.3	-	0.00	44	0	G	NM_198496		116045741	+1	tier1	-	no_errors	ENST00000392982	ensembl	human	known	74_37	silent	9.52	38	4	SNP	1.000	A
WEE1	7465	genome.wustl.edu	37	11	9603162	9603162	+	Nonsense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:9603162C>T	ENST00000450114.2	+	6	1478	c.1225C>T	c.(1225-1227)Caa>Taa	p.Q409*	RN7SL56P_ENST00000470034.2_RNA|WEE1_ENST00000299613.6_Nonsense_Mutation_p.Q195*	NM_003390.3	NP_003381.1	P30291	WEE1_HUMAN	WEE1 G2 checkpoint kinase	409	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|establishment of cell polarity (GO:0030010)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuron projection morphogenesis (GO:0048812)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	23				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		TCTCCTTTTGCAAGTTGGCCG	0.373																																																	0													103.0	104.0	104.0					11																	9603162		2201	4294	6495	SO:0001587	stop_gained	0			X62048	CCDS7800.1, CCDS44536.1	11p15.4	2013-10-21	2013-10-21		ENSG00000166483	ENSG00000166483			12761	protein-coding gene	gene with protein product		193525	"""wee1+ (S. pombe) homolog"", ""WEE1 homolog (S. pombe)"""			1840647	Standard	NM_003390		Approved		uc001mhs.3	P30291	OTTHUMG00000165863	ENST00000450114.2:c.1225C>T	11.37:g.9603162C>T	ENSP00000402084:p.Gln409*		B3KVE1|D3DQV0	Nonsense_Mutation	SNP	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Wee1-like_protein_kinase,pfscan_Prot_kinase_dom	p.Q409*	ENST00000450114.2	37	c.1225	CCDS7800.1	11	.	.	.	.	.	.	.	.	.	.	C	36	5.645460	0.96704	.	.	ENSG00000166483	ENST00000450114;ENST00000299613;ENST00000524612;ENST00000530712	.	.	.	5.32	5.32	0.75619	.	0.059366	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-16.1521	19.3563	0.94416	0.0:1.0:0.0:0.0	.	.	.	.	X	409;195;37;15	.	ENSP00000299613:Q195X	Q	+	1	0	WEE1	9559738	1.000000	0.71417	1.000000	0.80357	0.929000	0.56500	7.456000	0.80751	2.634000	0.89283	0.591000	0.81541	CAA	WEE1	-	pfam_Prot_kinase_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Wee1-like_protein_kinase,pfscan_Prot_kinase_dom	ENSG00000166483		0.373	WEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WEE1	HGNC	protein_coding	OTTHUMT00000386757.1	-	0.00	47	0	C	NM_003390		9603162	+1	tier1	-	no_errors	ENST00000450114	ensembl	human	known	74_37	nonsense	8.51	43	4	SNP	1.000	T
WFS1	7466	genome.wustl.edu	37	4	6293094	6293094	+	Splice_Site	SNP	G	G	A	rs138682654		TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr4:6293094G>A	ENST00000226760.1	+	5	801	c.631G>A	c.(631-633)Gat>Aat	p.D211N	WFS1_ENST00000503569.1_Splice_Site_p.D211N	NM_001145853.1|NM_006005.3	NP_001139325.1|NP_005996.2	O76024	WFS1_HUMAN	Wolfram syndrome 1 (wolframin)	211					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|calcium ion homeostasis (GO:0055074)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glucose homeostasis (GO:0042593)|kidney development (GO:0001822)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of programmed cell death (GO:0043069)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)|neurological system process (GO:0050877)|olfactory behavior (GO:0042048)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of growth (GO:0045927)|positive regulation of protein metabolic process (GO:0051247)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of proteolysis (GO:0045862)|protein maturation by protein folding (GO:0022417)|protein stabilization (GO:0050821)|renal water homeostasis (GO:0003091)|response to endoplasmic reticulum stress (GO:0034976)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	activating transcription factor binding (GO:0033613)|ATPase binding (GO:0051117)|transporter activity (GO:0005215)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	21				Colorectal(103;0.0512)		CAACGAGCACGGTGCGAGGAT	0.642																																																	0			GRCh37	CM033824	WFS1	M	rs138682654	G	ASN/ASP,ASN/ASP	0,4402		0,0,2201	66.0	63.0	64.0		631,631	4.7	0.2	4	dbSNP_134	64	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice,missense-near-splice	WFS1	NM_001145853.1,NM_006005.3	23,23	0,1,6500	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	211/891,211/891	6293094	1,13001	2201	4300	6501	SO:0001630	splice_region_variant	0			AF084481	CCDS3386.1	4p16.1	2014-06-18			ENSG00000109501	ENSG00000109501			12762	protein-coding gene	gene with protein product		606201		DFNA6, DFNA14, DFNA38		7987399, 9771706	Standard	NM_006005		Approved	DIDMOAD, WFS	uc003gix.3	O76024	OTTHUMG00000090431	ENST00000226760.1:c.631+1G>A	4.37:g.6293094G>A			B2R797|D3DVT1|Q8N6I3|Q9UNW6	Missense_Mutation	SNP	NULL	p.D211N	ENST00000226760.1	37	c.631	CCDS3386.1	4	.	.	.	.	.	.	.	.	.	.	G	15.08	2.725876	0.48833	0.0	1.16E-4	ENSG00000109501	ENST00000503569;ENST00000226760	D;D	0.93906	-3.31;-3.31	4.72	4.72	0.59763	.	0.180905	0.48767	D	0.000171	D	0.88081	0.6341	L	0.36672	1.1	0.51482	D	0.999926	P	0.43633	0.813	B	0.31101	0.124	D	0.89928	0.4064	10	0.62326	D	0.03	-10.0158	16.6615	0.85242	0.0:0.0:1.0:0.0	.	211	O76024	WFS1_HUMAN	N	211	ENSP00000423337:D211N;ENSP00000226760:D211N	ENSP00000226760:D211N	D	+	1	0	WFS1	6343995	1.000000	0.71417	0.222000	0.23844	0.090000	0.18270	4.710000	0.61873	2.175000	0.68902	0.561000	0.74099	GAT	WFS1	-	NULL	ENSG00000109501		0.642	WFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WFS1	HGNC	protein_coding	OTTHUMT00000206863.1	-	0.00	11	0	G		Missense_Mutation	6293094	+1	tier1	rs138682654	no_errors	ENST00000226760	ensembl	human	known	74_37	missense	42.86	8	6	SNP	0.983	A
WNK1	65125	genome.wustl.edu	37	12	960821	960821	+	Intron	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:960821C>T	ENST00000315939.6	+	5	1954				WNK1_ENST00000535572.1_Intron|WNK1_ENST00000540360.1_Intron|WNK1_ENST00000530271.2_Intron|WNK1_ENST00000340908.4_5'Flank|WNK1_ENST00000537687.1_Intron	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1						intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TTTTTTCCTTCATTTTCCTCC	0.363																																					Colon(19;451 567 6672 12618 28860)												0													9.0	9.0	9.0					12																	960821		875	1984	2859	SO:0001627	intron_variant	0			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.1312-5506C>T	12.37:g.960821C>T			A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	RNA	SNP	-	NULL	ENST00000315939.6	37	NULL	CCDS8506.1	12																																																																																			WNK1	-	-	ENSG00000060237		0.363	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1	-	0.00	20	0	C	NM_018979		960821	+1	tier1	-	no_errors	ENST00000538787	ensembl	human	known	74_37	rna	37.14	22	13	SNP	0.000	T
WIF1	11197	genome.wustl.edu	37	12	65514254	65514254	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr12:65514254C>T	ENST00000286574.4	-	2	605	c.231G>A	c.(229-231)atG>atA	p.M77I		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	77	WIF. {ECO:0000255|PROSITE- ProRule:PRU00222}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		GAATAGCTGGCATTCTCTGTT	0.373			T	HMGA2	pleomorphic salivary gland adenoma																																Esophageal Squamous(148;1595 1816 48559 49439 49664)			Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	0													137.0	141.0	139.0					12																	65514254		2203	4300	6503	SO:0001583	missense	0			AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.231G>A	12.37:g.65514254C>T	ENSP00000286574:p.Met77Ile		Q6UXI1|Q8WVG4	Missense_Mutation	SNP	pfam_WIF,pfam_EGF_extracell,smart_WIF,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_WIF,prints_Wnt-inh	p.M77I	ENST00000286574.4	37	c.231	CCDS8971.1	12	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551140	0.86127	.	.	ENSG00000156076	ENST00000286574;ENST00000546001	T;T	0.40225	1.04;1.04	5.5	5.5	0.81552	WIF domain (4);	0.086825	0.85682	D	0.000000	T	0.55226	0.1907	L	0.36672	1.1	0.80722	D	1	P	0.48294	0.908	D	0.63488	0.915	T	0.42531	-0.9446	9	.	.	.	.	19.7678	0.96349	0.0:1.0:0.0:0.0	.	77	Q9Y5W5	WIF1_HUMAN	I	77;15	ENSP00000286574:M77I;ENSP00000442063:M15I	.	M	-	3	0	WIF1	63800521	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	6.673000	0.74482	2.760000	0.94817	0.655000	0.94253	ATG	WIF1	-	pfam_WIF,smart_WIF,pfscan_WIF,prints_Wnt-inh	ENSG00000156076		0.373	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WIF1	HGNC	protein_coding	OTTHUMT00000401258.2		0.00	38	0	C			65514254	-1			no_errors	ENST00000286574	ensembl	human	known	74_37	missense	6.06	62	4	SNP	1.000	T
XRRA1	143570	genome.wustl.edu	37	11	74638464	74638464	+	Missense_Mutation	SNP	A	A	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	A	A					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr11:74638464A>C	ENST00000340360.6	-	7	801	c.470T>G	c.(469-471)gTg>gGg	p.V157G	XRRA1_ENST00000527087.1_Missense_Mutation_p.V157G|XRRA1_ENST00000321448.8_5'UTR|XRRA1_ENST00000533598.1_5'UTR	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						TCCATATTTCACGTAGATAGT	0.428																																																	0													108.0	101.0	103.0					11																	74638464		1862	4079	5941	SO:0001583	missense	0			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.470T>G	11.37:g.74638464A>C	ENSP00000339918:p.Val157Gly			Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.V157G	ENST00000340360.6	37	c.470	CCDS44680.1	11	.	.	.	.	.	.	.	.	.	.	A	17.09	3.301557	0.60195	.	.	ENSG00000166435	ENST00000340360;ENST00000344880;ENST00000398418;ENST00000527087;ENST00000525407	T;T;T	0.49720	1.86;0.77;0.82	6.06	6.06	0.98353	.	0.240834	0.32068	N	0.006636	T	0.60248	0.2254	L	0.55103	1.725	0.58432	D	0.999998	D;D	0.89917	0.998;1.0	P;D	0.74674	0.852;0.984	T	0.55244	-0.8171	10	0.16420	T	0.52	-20.4951	13.0011	0.58676	1.0:0.0:0.0:0.0	.	157;157	Q6P2D8;Q6P2D8-2	XRRA1_HUMAN;.	G	157;157;157;157;165	ENSP00000339918:V157G;ENSP00000435838:V157G;ENSP00000437334:V165G	ENSP00000339918:V157G	V	-	2	0	XRRA1	74316112	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.791000	0.62460	2.324000	0.78689	0.533000	0.62120	GTG	XRRA1	-	NULL	ENSG00000166435		0.428	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384715.1	-	0.00	50	0	A	NM_182969		74638464	-1	tier1	-	no_errors	ENST00000340360	ensembl	human	known	74_37	missense	12.50	42	6	SNP	1.000	C
ZBTB17	7709	genome.wustl.edu	37	1	16269652	16269652	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:16269652G>A	ENST00000375743.4	-	13	1967	c.1735C>T	c.(1735-1737)Cac>Tac	p.H579Y	ZBTB17_ENST00000537142.1_Missense_Mutation_p.H497Y|ZBTB17_ENST00000479282.1_5'Flank|ZBTB17_ENST00000375733.2_Missense_Mutation_p.H579Y	NM_003443.2	NP_003434.2	Q13105	ZBT17_HUMAN	zinc finger and BTB domain containing 17	579					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|ectoderm development (GO:0007398)|endoplasmic reticulum unfolded protein response (GO:0030968)|gastrulation with mouth forming second (GO:0001702)|negative regulation of cell cycle (GO:0045786)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(4)|large_intestine(1)|lung(4)|ovary(2)|prostate(2)	15		Colorectal(325;0.000257)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|Colorectal(212;4.12e-07)|COAD - Colon adenocarcinoma(227;2.43e-05)|BRCA - Breast invasive adenocarcinoma(304;9.97e-05)|Kidney(64;0.000182)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		TTGTCGTGGTGGCGAATATGA	0.592																																																	0													292.0	257.0	269.0					1																	16269652		2203	4300	6503	SO:0001583	missense	0			U20647	CCDS165.1, CCDS55576.1, CCDS72712.1	1p36.13	2013-01-08	2004-07-16	2004-07-16	ENSG00000116809	ENSG00000116809		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	12936	protein-coding gene	gene with protein product		604084	"""zinc finger protein 151 (pHZ-67)"", ""zinc finger protein 60"""	ZNF151, ZNF60			Standard	NM_003443		Approved	MIZ1, pHZ-67	uc001axl.4	Q13105	OTTHUMG00000009377	ENST00000375743.4:c.1735C>T	1.37:g.16269652G>A	ENSP00000364895:p.His579Tyr		A0AV07|B4DXB4|B7ZLQ9|F5H411|Q15932|Q5JYB2|Q9NUC9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.H579Y	ENST00000375743.4	37	c.1735	CCDS165.1	1	.	.	.	.	.	.	.	.	.	.	G	24.4	4.531451	0.85706	.	.	ENSG00000116809	ENST00000375743;ENST00000375733;ENST00000444654;ENST00000537142;ENST00000375729	T;T;T	0.07444	3.19;3.19;3.19	5.2	5.2	0.72013	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.14313	0.0346	N	0.04705	-0.18	0.80722	D	1	D;D;D	0.69078	0.996;0.997;0.997	D;D;D	0.75484	0.986;0.93;0.962	T	0.43442	-0.9391	10	0.87932	D	0	.	19.112	0.93319	0.0:0.0:1.0:0.0	.	579;497;579	Q13105-2;F5H411;Q13105	.;.;ZBT17_HUMAN	Y	579;579;498;497;135	ENSP00000364895:H579Y;ENSP00000364885:H579Y;ENSP00000438529:H497Y	ENSP00000364881:H135Y	H	-	1	0	ZBTB17	16142239	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	7.378000	0.79679	2.580000	0.87095	0.563000	0.77884	CAC	ZBTB17	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000116809		0.592	ZBTB17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB17	HGNC	protein_coding	OTTHUMT00000025998.1	-	0.00	56	0	G	NM_003443		16269652	-1	tier1	-	no_errors	ENST00000375733	ensembl	human	known	74_37	missense	15.28	61	11	SNP	1.000	A
ZFAT	57623	genome.wustl.edu	37	8	135614789	135614789	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr8:135614789G>A	ENST00000377838.3	-	6	1347	c.1173C>T	c.(1171-1173)ctC>ctT	p.L391L	ZFAT_ENST00000520727.1_Silent_p.L379L|ZFAT_ENST00000429442.2_Silent_p.L379L|ZFAT-AS1_ENST00000505776.1_RNA|ZFAT_ENST00000520214.1_Silent_p.L379L|ZFAT_ENST00000520356.1_Silent_p.L379L|ZFAT_ENST00000523399.1_Silent_p.L329L	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing	391					hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			TCATCAGGCAGAGCTCGTCCA	0.557																																																	0													62.0	64.0	63.0					8																	135614789		2087	4219	6306	SO:0001819	synonymous_variant	0			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.1173C>T	8.37:g.135614789G>A			B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L391	ENST00000377838.3	37	c.1173	CCDS47924.1	8																																																																																			ZFAT	-	NULL	ENSG00000066827		0.557	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAT	HGNC	protein_coding	OTTHUMT00000378272.1	-	0.00	21	0	G	NM_001029939		135614789	-1	tier1	-	no_errors	ENST00000377838	ensembl	human	known	74_37	silent	32.35	23	11	SNP	0.581	A
ZNF185	7739	genome.wustl.edu	37	X	152087570	152087572	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	GAG	GAG					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chrX:152087570_152087572delGAG	ENST00000370268.4	+	7	512_514	c.475_477delGAG	c.(475-477)gagdel	p.E165del	ZNF185_ENST00000535861.1_In_Frame_Del_p.E165del|ZNF185_ENST00000324823.6_In_Frame_Del_p.E30del|ZNF185_ENST00000370270.2_In_Frame_Del_p.E165del|ZNF185_ENST00000449285.2_In_Frame_Del_p.E165del|ZNF185_ENST00000318529.8_In_Frame_Del_p.E30del|ZNF185_ENST00000318504.7_In_Frame_Del_p.E165del|ZNF185_ENST00000539731.1_In_Frame_Del_p.E165del			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	165	Poly-Glu.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGGACACCgaggaggaggagg	0.596																																																	0									,,,,,,	160,3115		6,91,57,1273,478					,,,,,,	-7.0	0.0			54	367,5848		0,178,189,2088,1494	no	coding,coding,coding,coding,coding,coding,coding	ZNF185	NM_007150.3,NM_001178113.1,NM_001178110.1,NM_001178109.1,NM_001178108.1,NM_001178107.1,NM_001178106.1	,,,,,,	6,269,246,3361,1972	A1A1,A1R,A1,RR,R		5.9051,4.8855,5.5532	,,,,,,	,,,,,,		527,8963				SO:0001651	inframe_deletion	0			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.475_477delGAG	X.37:g.152087579_152087581delGAG	ENSP00000359291:p.Glu165del		A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	In_Frame_Del	DEL	smart_Znf_LIM,pfscan_Znf_LIM	p.E162in_frame_del	ENST00000370268.4	37	c.475_477	CCDS48184.1	X																																																																																			ZNF185	-	NULL	ENSG00000147394		0.596	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	HGNC	protein_coding	OTTHUMT00000377480.1		0.00	38	0	GAG	NM_007150		152087572	+1	tier1		no_errors	ENST00000370270	ensembl	human	known	74_37	in_frame_del	15.22	39	7	DEL	0.026:0.052:0.078	-
ZNF333	84449	genome.wustl.edu	37	19	14829423	14829423	+	Silent	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:14829423G>T	ENST00000292530.6	+	12	1375	c.1284G>T	c.(1282-1284)ggG>ggT	p.G428G	ZNF333_ENST00000540689.2_Intron|ZNF333_ENST00000536363.1_Silent_p.G319G	NM_032433.2	NP_115809.1	Q96JL9	ZN333_HUMAN	zinc finger protein 333	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(2)|pancreas(1)|prostate(1)	21						GTCAGTGTGGGAAAACCTTCA	0.468																																					NSCLC(60;75 1281 16985 25154 29885)												0													59.0	61.0	60.0					19																	14829423		2203	4300	6503	SO:0001819	synonymous_variant	0				CCDS12316.1, CCDS74298.1	19p13	2013-01-08				ENSG00000160961		"""Zinc fingers, C2H2-type"", ""-"""	15624	protein-coding gene	gene with protein product		611811				12151103	Standard	XM_005260098		Approved	KIAA1806	uc002mzn.3	Q96JL9		ENST00000292530.6:c.1284G>T	19.37:g.14829423G>T			Q6P2E6|Q86WS6|Q8TDL0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G428	ENST00000292530.6	37	c.1284	CCDS12316.1	19																																																																																			ZNF333	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160961		0.468	ZNF333-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF333	HGNC	protein_coding	OTTHUMT00000466496.1	-	0.00	26	0	G	NM_032433		14829423	+1	tier1	-	no_errors	ENST00000292530	ensembl	human	known	74_37	silent	12.50	28	4	SNP	1.000	T
ZNF354C	30832	genome.wustl.edu	37	5	178506461	178506461	+	Missense_Mutation	SNP	T	T	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr5:178506461T>A	ENST00000315475.6	+	5	1334	c.1028T>A	c.(1027-1029)cTt>cAt	p.L343H		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	343					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		AGAGCAAAACTTCACAGGCAT	0.438																																																	0													157.0	169.0	165.0					5																	178506461		2203	4300	6503	SO:0001583	missense	0				CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.1028T>A	5.37:g.178506461T>A	ENSP00000324064:p.Leu343His		Q6P4P9|Q8NFX1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L343H	ENST00000315475.6	37	c.1028	CCDS4443.1	5	.	.	.	.	.	.	.	.	.	.	T	16.41	3.116879	0.56505	.	.	ENSG00000177932	ENST00000315475	T	0.16196	2.36	4.04	4.04	0.47022	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.53690	0.1812	H	0.96239	3.79	0.09310	N	0.999994	D	0.89917	1.0	D	0.85130	0.997	T	0.54009	-0.8357	9	0.87932	D	0	-14.1537	11.2691	0.49127	0.0:0.0:0.0:1.0	.	343	Q86Y25	Z354C_HUMAN	H	343	ENSP00000324064:L343H	ENSP00000324064:L343H	L	+	2	0	ZNF354C	178439067	0.998000	0.40836	0.907000	0.35723	0.977000	0.68977	7.311000	0.78958	1.808000	0.52836	0.482000	0.46254	CTT	ZNF354C	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000177932		0.438	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354C	HGNC	protein_coding	OTTHUMT00000253473.2	-	0.00	34	0	T			178506461	+1	tier1	-	no_errors	ENST00000315475	ensembl	human	known	74_37	missense	11.43	31	4	SNP	0.152	A
ZNF358	140467	genome.wustl.edu	37	19	7585086	7585086	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:7585086C>T	ENST00000597229.1	+	2	1128	c.958C>T	c.(958-960)Cgc>Tgc	p.R320C	CTD-2207O23.11_ENST00000602083.1_RNA|ZNF358_ENST00000394341.2_Missense_Mutation_p.R320C|MCOLN1_ENST00000264079.6_5'Flank	NM_018083.4	NP_060553.4	Q9NW07	ZN358_HUMAN	zinc finger protein 358	320					embryonic forelimb morphogenesis (GO:0035115)|neural tube development (GO:0021915)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|lung(1)|skin(2)	8						GCGCCCCTACCGCTGCCCCCA	0.716																																																	0													32.0	35.0	34.0					19																	7585086		2202	4298	6500	SO:0001583	missense	0			AK001252	CCDS32890.2	19p13.2	2013-01-08			ENSG00000198816	ENSG00000198816		"""Zinc fingers, C2H2-type"""	16838	protein-coding gene	gene with protein product							Standard	NM_018083		Approved	FLJ10390, ZFEND	uc002mgn.2	Q9NW07		ENST00000597229.1:c.958C>T	19.37:g.7585086C>T	ENSP00000472305:p.Arg320Cys		Q9BTM7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R320C	ENST00000597229.1	37	c.958	CCDS32890.2	19	.	.	.	.	.	.	.	.	.	.	C	13.96	2.391655	0.42410	.	.	ENSG00000198816	ENST00000361576;ENST00000394341	T	0.15139	2.45	4.57	4.57	0.56435	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17066	0.0410	L	0.46819	1.47	0.41219	D	0.986499	P	0.36483	0.555	B	0.37015	0.239	T	0.02758	-1.1114	9	0.72032	D	0.01	-31.7135	10.4934	0.44764	0.1941:0.8059:0.0:0.0	.	320	Q9NW07	ZN358_HUMAN	C	320	ENSP00000377873:R320C	ENSP00000354703:R320C	R	+	1	0	ZNF358	7491086	0.000000	0.05858	1.000000	0.80357	0.625000	0.37756	-1.339000	0.02652	2.265000	0.75225	0.462000	0.41574	CGC	ZNF358	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198816		0.716	ZNF358-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF358	HGNC	protein_coding	OTTHUMT00000316747.1	-	0.00	26	0	C			7585086	+1	tier1	-	no_errors	ENST00000394341	ensembl	human	known	74_37	missense	26.92	19	7	SNP	0.995	T
ZNF57	126295	genome.wustl.edu	37	19	2916945	2916945	+	Missense_Mutation	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:2916945G>A	ENST00000306908.5	+	4	474	c.326G>A	c.(325-327)tGt>tAt	p.C109Y	ZNF57_ENST00000523428.1_Missense_Mutation_p.C77Y|AC006277.2_ENST00000520090.2_RNA	NM_173480.2	NP_775751.1	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	109					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C109fs*106(1)		endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	18				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		GACAGATTCTGTACACATAAT	0.338																																					NSCLC(150;910 1964 4303 10464 26498)												1	Deletion - Frameshift(1)	large_intestine(1)											80.0	74.0	76.0					19																	2916945		2203	4300	6503	SO:0001583	missense	0			M88368	CCDS12098.1	19p13.3	2013-01-08			ENSG00000171970	ENSG00000171970		"""Zinc fingers, C2H2-type"", ""-"""	13125	protein-coding gene	gene with protein product			"""zinc finger protein 424"""	ZNF424		1505991	Standard	NM_173480		Approved		uc002lwr.3	Q68EA5	OTTHUMG00000164485	ENST00000306908.5:c.326G>A	19.37:g.2916945G>A	ENSP00000303696:p.Cys109Tyr		Q8N6R9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C109Y	ENST00000306908.5	37	c.326	CCDS12098.1	19	.	.	.	.	.	.	.	.	.	.	G	1.447	-0.566150	0.03910	.	.	ENSG00000171970	ENST00000306908;ENST00000395204;ENST00000522294;ENST00000523428	T;T;T	0.06142	3.47;5.89;3.34	2.07	-2.3	0.06785	.	.	.	.	.	T	0.02193	0.0068	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.46261	-0.9204	9	0.07813	T	0.8	.	2.2768	0.04104	0.3219:0.0:0.4383:0.2398	.	109	Q68EA5	ZNF57_HUMAN	Y	109;111;77;77	ENSP00000303696:C109Y;ENSP00000430905:C77Y;ENSP00000430223:C77Y	ENSP00000303696:C109Y	C	+	2	0	ZNF57	2867945	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.393000	0.07305	-0.626000	0.05596	-0.467000	0.05162	TGT	ZNF57	-	NULL	ENSG00000171970		0.338	ZNF57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF57	HGNC	protein_coding	OTTHUMT00000378969.1		0.00	32	0	G	NM_173480		2916945	+1			no_errors	ENST00000306908	ensembl	human	known	74_37	missense	6.90	27	2	SNP	0.001	A
ZNF627	199692	genome.wustl.edu	37	19	11728069	11728069	+	Missense_Mutation	SNP	T	T	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:11728069T>C	ENST00000361113.5	+	4	959	c.751T>C	c.(751-753)Tat>Cat	p.Y251H	ZNF627_ENST00000588174.1_3'UTR	NM_145295.3	NP_660338.1	Q7L945	ZN627_HUMAN	zinc finger protein 627	251					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14						AGATAAACCCTATGAATGCAA	0.423																																					Melanoma(112;173 1614 10731 17751 23322)												0													55.0	58.0	57.0					19																	11728069		2203	4299	6502	SO:0001583	missense	0			AK074846	CCDS42502.1	19p13.2	2013-01-08				ENSG00000198551		"""Zinc fingers, C2H2-type"", ""-"""	30570	protein-coding gene	gene with protein product		612248				12477932	Standard	NM_145295		Approved	FLJ90365	uc002msk.2	Q7L945		ENST00000361113.5:c.751T>C	19.37:g.11728069T>C	ENSP00000354414:p.Tyr251His		O14846|Q4KMP9|Q6NT81|Q9BRG4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y251H	ENST00000361113.5	37	c.751	CCDS42502.1	19	.	.	.	.	.	.	.	.	.	.	t	17.16	3.317868	0.60524	.	.	ENSG00000198551	ENST00000361113	T	0.21734	1.99	1.36	1.36	0.22044	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.23054	0.0557	L	0.46741	1.465	0.80722	D	1	B	0.27351	0.176	B	0.40410	0.328	T	0.12477	-1.0546	9	0.56958	D	0.05	.	6.8018	0.23756	0.0:0.0:0.0:1.0	.	251	Q7L945	ZN627_HUMAN	H	251	ENSP00000354414:Y251H	ENSP00000354414:Y251H	Y	+	1	0	ZNF627	11589069	0.005000	0.15991	0.895000	0.35142	0.751000	0.42716	1.476000	0.35420	0.901000	0.36495	0.260000	0.18958	TAT	ZNF627	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198551		0.423	ZNF627-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF627	HGNC	protein_coding	OTTHUMT00000458875.1	-	0.00	34	0	T	NM_145295		11728069	+1	tier1	-	no_errors	ENST00000361113	ensembl	human	known	74_37	missense	6.90	54	4	SNP	0.968	C
ZNF540	163255	genome.wustl.edu	37	19	38102736	38102736	+	Silent	SNP	G	G	A			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:38102736G>A	ENST00000592533.1	+	5	887	c.555G>A	c.(553-555)gtG>gtA	p.V185V	ZNF540_ENST00000316433.4_Silent_p.V185V|ZNF540_ENST00000586792.1_3'UTR|ZNF540_ENST00000589117.1_Silent_p.V153V|ZNF540_ENST00000343599.5_Silent_p.V185V	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	185					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATTCTGATGTGAAACATGATT	0.348																																																	0													57.0	57.0	57.0					19																	38102736		2203	4298	6501	SO:0001819	synonymous_variant	0			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.555G>A	19.37:g.38102736G>A			A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V185	ENST00000592533.1	37	c.555	CCDS12506.1	19																																																																																			ZNF540	-	NULL	ENSG00000171817		0.348	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF540	HGNC	protein_coding	OTTHUMT00000459481.1	-	0.00	34	0	G	NM_152606		38102736	+1	tier1	-	no_errors	ENST00000316433	ensembl	human	known	74_37	silent	22.03	46	13	SNP	0.424	A
ZNF99	7652	genome.wustl.edu	37	19	22939092	22939092	+	IGR	SNP	T	T	C			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	T	T					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:22939092T>C	ENST00000596209.1	-	0	2686				CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Missense_Mutation_p.Y1010C	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TTCACATTTGTAGGTTTTCCC	0.383																																																	0													52.0	71.0	65.0					19																	22939092		2008	4278	6286	SO:0001628	intergenic_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4			19.37:g.22939092T>C			M0R335	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Y1010C	ENST00000596209.1	37	c.3029	CCDS59369.1	19	.	.	.	.	.	.	.	.	.	.	-	2.707	-0.269704	0.05716	.	.	ENSG00000213973	ENST00000397104	T	0.61392	0.11	1.2	-0.417	0.12347	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.56247	0.1972	.	.	.	0.09310	N	1	P	0.49307	0.922	P	0.50934	0.654	T	0.49652	-0.8917	8	0.72032	D	0.01	.	5.3767	0.16170	0.2488:0.0:0.0:0.7512	.	1009	A8MXY4	ZNF99_HUMAN	C	1010	ENSP00000380293:Y1010C	ENSP00000380293:Y1010C	Y	-	2	0	ZNF99	22730932	0.001000	0.12720	0.011000	0.14972	0.076000	0.17211	-0.202000	0.09451	0.550000	0.28991	0.303000	0.19852	TAC	ZNF99	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.383	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1		0.00	42	0	T	XM_065124		22939092	-1			no_errors	ENST00000397104	ensembl	human	known	74_37	missense	6.82	41	3	SNP	0.041	C
ZNF776	284309	genome.wustl.edu	37	19	58264886	58264886	+	Missense_Mutation	SNP	C	C	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	C	C					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr19:58264886C>T	ENST00000317178.5	+	3	651	c.388C>T	c.(388-390)Cat>Tat	p.H130Y	AC003006.7_ENST00000594684.1_Missense_Mutation_p.H130Y	NM_173632.3	NP_775903.3	Q68DI1	ZN776_HUMAN	zinc finger protein 776	130					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|kidney(13)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		TGCAAACCATCATCAAGACCA	0.418																																																	0													100.0	91.0	94.0					19																	58264886		2203	4300	6503	SO:0001583	missense	0			AK095607	CCDS12962.2	19q13.43	2013-01-08			ENSG00000152443	ENSG00000152443		"""Zinc fingers, C2H2-type"", ""-"""	26765	protein-coding gene	gene with protein product							Standard	NM_173632		Approved	FLJ38288		Q68DI1	OTTHUMG00000156943	ENST00000317178.5:c.388C>T	19.37:g.58264886C>T	ENSP00000321812:p.His130Tyr		Q6ZS36|Q8N968	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H130Y	ENST00000317178.5	37	c.388	CCDS12962.2	19	.	.	.	.	.	.	.	.	.	.	C	4.465	0.086119	0.08583	.	.	ENSG00000152443	ENST00000317178	T	0.08193	3.12	2.07	-0.217	0.13149	.	.	.	.	.	T	0.07052	0.0179	L	0.61218	1.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.48885	-0.8995	9	0.02654	T	1	.	5.861	0.18747	0.0:0.5741:0.0:0.4259	.	130;130	Q68DI1;B4DSC6	ZN776_HUMAN;.	Y	130	ENSP00000321812:H130Y	ENSP00000321812:H130Y	H	+	1	0	ZNF776	62956698	0.531000	0.26338	0.038000	0.18304	0.031000	0.12232	-0.336000	0.07863	0.196000	0.20367	-0.680000	0.03767	CAT	ZNF776	-	NULL	ENSG00000152443		0.418	ZNF776-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF776	HGNC	protein_coding	OTTHUMT00000346722.2	-	0.00	47	0	C	NM_173632		58264886	+1	tier1	-	no_errors	ENST00000317178	ensembl	human	known	74_37	missense	15.38	44	8	SNP	0.015	T
ZYG11A	440590	genome.wustl.edu	37	1	53358486	53358486	+	Nonsense_Mutation	SNP	G	G	T			TCGA-L5-A8NK-01A-21D-A37C-09	TCGA-L5-A8NK-11A-11D-A37F-09	G	G					Unknown	Untested	Somatic	Phase_IV	WXS	none			Illumina HiSeq	3440197d-00e0-4cbf-8332-763812ca2d0b	a7ce1ff9-9b8c-4425-b183-9d822a39913d	g.chr1:53358486G>T	ENST00000371528.1	+	14	2285	c.2137G>T	c.(2137-2139)Gaa>Taa	p.E713*	ZYG11A_ENST00000371532.1_Nonsense_Mutation_p.E371*	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	713										breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						AGTTGAAGAAGAAGGATTGCA	0.438																																																	0													195.0	161.0	171.0					1																	53358486		692	1591	2283	SO:0001587	stop_gained	0				CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.2137G>T	1.37:g.53358486G>T	ENSP00000360583:p.Glu713*		A6NCK5	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.E713*	ENST00000371528.1	37	c.2137	CCDS44148.1	1	.	.	.	.	.	.	.	.	.	.	G	39	7.364587	0.98238	.	.	ENSG00000203995	ENST00000371532;ENST00000371528	.	.	.	5.07	5.07	0.68467	.	0.679004	0.14323	N	0.326894	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	0.0	16.7608	0.85511	0.0:0.0:1.0:0.0	.	.	.	.	X	371;713	.	ENSP00000360583:E713X	E	+	1	0	ZYG11A	53131074	1.000000	0.71417	0.972000	0.41901	0.956000	0.61745	3.705000	0.54823	2.793000	0.96121	0.563000	0.77884	GAA	ZYG11A	-	superfamily_ARM-type_fold	ENSG00000203995		0.438	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11A	HGNC	protein_coding	OTTHUMT00000024856.3		0.00	59	0	G	NM_001004339		53358486	+1			no_errors	ENST00000371528	ensembl	human	known	74_37	nonsense	6.25	60	4	SNP	0.998	T
